Food Microbiology 27 (2010) 327e331

Contents lists available at ScienceDirect

Food Microbiology
journal homepage: www.elsevier.com/locate/fm

Detection and characterization of virulence genes and integrons

in Aeromonas veronii isolated from catsh
Mohamed Nawaz a, *, Saeed A. Khan a, Ashraf A. Khan a, Kidon Sung a, Quynhtien Tran a,
Khalil Kerdahi b, Roger Steele a
a
b

Division of Microbiology, National Center for Toxicological Research, US Food and Drug Administration, Jefferson, AR 72079, USA
Arkansas Regional Laboratory, US Food and Drug Administration, Jefferson, AR 72079, USA

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 8 May 2009
Received in revised form
29 October 2009
Accepted 2 November 2009
Available online 10 November 2009

The presence of virulence genes and integrons was determined in 81 strains of Aeromonas veronii isolated
from farm-raised catsh. Polymerase chain reaction (PCR) protocols were used to determine the presence of genes for cytotoxic enterotoxin (act), aerolysin (aerA), two cytotonic enterotoxins (ast, alt), lipase
(lip), glycerophospholipid:cholesterol acyltransferase (gcaT), serine protease (ser), DNases (exu), elastase
(ahyB) and the structural gene agellin (a) in the template DNA. Oligonucleotide primers amplied
a 231-bp region of the act gene from the template DNA of 97.0% of the isolates. Primers specic for the
amplication of the aerA gene amplied a 431-bp region of the aerA gene from the template DNA of
96.0% of the isolates. None of the isolates contained ast or alt genes. Oligonucleotide primers specic for
the amplication of lip, gcaT, ser and a genes, amplied their respective amplicons from 85.0, 78.0, 82.0
and 80.0% of the isolates. None of the isolates contained exu or the elastase genes. Several of the isolates
(48.0%) contained class I integrons that confer resistance to multiple antibiotics; various sizes between
0.6 and 3.1 kb were found. None of the isolates contained Class II integrons. Our results indicate that
farm-raised catsh may be a source of pathogenic A. veronii and that the potential health risks posed by
virulent strains of A. veronii should not be underestimated.
Published by Elsevier Ltd.

Keywords:
Virulence genes
Aeromonas
Catsh
PCR

1. Introduction
Aeromonas spp. are inhabitants of a wide range of aquatic
ecosystems such as freshwater, estuarine, and coastal waters, and
are even found in chlorinated potable water (Janda and Duffy,
1988). They are either mesophilic, motile or psychrophilic, nonmotile Gram negative bacteria. These opportunistic bacteria have
been associated with several categories of human infections, such
as gastroenteritis, peritonitis, endocarditis, meningitis, septicemia,
and urinary tract and wound infections (Gosling, 1996). Foods of
animal origin, including seafood, and vegetables have been
considered important sources of Aeromonas spp. infection (Ison and
Drake, 2002; Rabaan et al., 2001; Sen and Rodgers, 2004; Soler
et al., 2002). Virulent strains of Aeromonas spp. have also been
isolated from potable water (Alvandi and Anathan, 2003., Granum
et al., 1998; Huys et al., 1996; Sen and Rodgers, 2004). The United
States Environmental Protection Agency (USEPA) has placed

* Corresponding author. Tel.: 1 870 543 7586.

E-mail address: Mohamed.nawaz@fda.hhs.gov (M. Nawaz).
0740-0020/$ e see front matter Published by Elsevier Ltd.
doi:10.1016/j.fm.2009.11.007

Aeromonas spp. on the contaminant candidate list and has actively

monitored water supplies for aeromonads since 2002 (USEPA,
2006).
A wide range of putative virulence factors have been detected
and studied in several Aeromonas spp.(Albert et al., 2000; Gonzalez-Serrano et al., 2002; Kingombe et al., 1999; Sechi et al., 2003);
they play a pivotal role in the establishment of infection. Indeed,
several studies have reported the detection and characterization of
virulence factors in Aeromonas spp. isolated from freshwater sh,
Tilapia (Oreochromis niloticus), humans, meat-producing animals
and potable water (Albert et al., 2000; Escarpulli et al., 2003;
Granum et al., 1998; Gonzalez-Serrano et al., 2002). However, little
is known about the virulent traits of Aeromonas veronii isolated
from catsh (Nawaz et al., 2006). Pond-raised catsh (Ictalurus
punctatus) is a popular food sh and the annual production in the
US is estimated at $600 million (Aquaculture Outlook, 2001).
Earlier, we isolated and identied by molecular techniques
81-strains of A. veronii from catsh (Nawaz et al., 2006). Since little
is known about the virulence mechanisms involved in A. veronii, we
decided to investigate whether these isolates contained virulence
factors associated with various human diseases.

328

M. Nawaz et al. / Food Microbiology 27 (2010) 327e331

2. Materials and methods

2.1. Growth of bacterial strains and extraction of DNA
Bacteria were isolated from the intestinal contents of farmraised catsh and identied as per details described earlier (Nawaz
et al., 2006). All isolates were stored in Luria-Bertani (LB) broth
containing 20% glycerol at 70  C. Cultures were grown overnight
at 37  C in LB broth or on trypticase soy agar (TSA) plates supplemented with 5% sheep's blood. Genomic DNA was extracted with
the QIAamp DNA mini kit (Qiagen, Valencia, CA).

2.2. Detection of virulence and related genes by polymerase

chain reaction (PCR)

2.3. Conrmation of the PCR amplicon by restriction digestion

PCR assays for the amplication of the aerolysin (aerA), cytotoxic enterotoxin (act), cytotonic enterotoxins (ast, alt), lipase (lip),
glycerophospholipid:cholesterol acyltransferase (gcat), serine
protease (ser), DNase (exu), elastase (ahyB) and the structural gene,
agellin (a) were performed with the template DNA of the
isolates. Primers for the amplication of the virulence and related
genes (Table 1) from the template DNA of A. veronii were designed
by using a primer selection module of the Lasergene program
(DNASTAR, Inc., Madison, WI) and synthesized by MWG, Inc. (High
Point, NC). The Tm of the primers was calculated by the 2(A T) 4
(G C) formula. PCR amplication of virulence genes was carried
out in a reaction volume of 25 ml by using a PCR Kit (Applied Biosystems, Foster City, CA). Each reaction tube contained 1 ml of
bacterial DNA (0.01e0.05 mg), 5 ml of a 10 mM mixture of the primer
mix, and 19 ml of PCR mix (200 ml of PCR mix contains: 33.3 ml of
10  XL buffer II, 27 ml of 25 mM magnesium acetate, 66 ml of 10 mM
dNTP mix, 7 ml of Taq DNA polymerase and 66.7 ml of water). The
thermal cycling conditions consisted of an initial denaturation of

Table 1
Sequence of oligonucleotide primers used in the studya.
Name of Primer sequence
gene

Product size Length Tm( C)

(bp)
(bp)

act

F:AGAAGGTGACCACCACCAAGAACA
R:AACTGACATCGGCCTTGAACTC

232

24
24

65

ast

F:TCTCCATGCTTCCCTTCCACT
R:GTGTAGGGATTGAAGAAGCCG

331

21
21

63

aer

F:CCTATGGCCTGAGCGAGAAG
R:CCAGTTCCAGTCCCACCACT

431

20
20

63

alt

F: TGACCCAGTCCTGGCACGGC
R: GGTGATCGATCACCACCAGC

442

20
20

64

F:TCCAACCGTYTGACCTC
R:GMYTGGTTGCGRATGGT

608

17
17

55

gcaT

F:CTCCTGGAATCCCAAGTATCAG
R:GGCAGGTTGAACAGCAGTATCT

237

22
22

65

ser

F:CACCGAAGTATTGGGTCAGG
R:GGCTCATGCGTAACTCTGGT

350

20
20

57

ahyB

F:ACACGGTCAAGGAGATCAAC
R:CGCTGGTGTTGGCCAGCAGG

513

20
20

59

exu

F:(A/G)GACATGCACAACCTCTTCC
323
R:GATTGGTATTGCC(C/T)TGCAA(C/G)

20
20

61

F:CA(C/T)CTGGT(T/G)CCGCTCAAG
R:GT(A/G)CCGAACCAGTCGGAGAA

18
20

63

lip

247

Amplied PCR products were puried by the QIAquick PCR

purication kit (Qiagen). Unless otherwise stated, the digestion
mixture contained 6 ml of the amplicon, 2 ml of sterile distilled
water, 1 ml of enzyme and 1 ml of the corresponding buffer. The PCR
amplicons were digested for 4 h at 37  C with appropriate
restriction enzymes (Promega Corporation, Madison, WI), respectively. The digested fragments were separated on a 2.0% agarose gel.
A 100-bp DNA ladder (Invitrogen, San Jose, CA) was used as the size
standard.
2.4. PCR amplication of integrons
Primers used for the amplication of integrons are listed in
Table 2. Thermal cycling conditions consisted of an initial denaturation cycle (94  C for 2 min) followed by 30 cycles of denaturation (95  C for 45 s), annealing (56  C for 1 min), and extension
(72  C for 90 s). The nal cycle of amplication was carried out at
72  C for 10 min. The amplied DNA fragments were separated by
electrophoresis using 1.2% agarose gels, stained with ethidium
bromide (1 mg/mL), visualized with UV, and photographed using
the Eagle Eye II gel documentation system (Stratagene, La Jolla, CA).
3. Results and discussion
3.1. PCR amplication of toxin genes (act, aerA, alt, ast)

The thermal cycling conditions consists of an initial denaturation of 94  C for

2 min followed by a total of 35 cycles of amplication. Each cycle consisted of 94  C
denaturation for 30 s, annealing for 50 s at 1  C below the lowest Tm of a given
primer pair, and 72  C extension for 10 min. PCR was started with an initial denaturation at 94  C for 2 min.
a

94  C for 2 min followed by a total of 35 cycles of amplication. Each

cycle consisted of 94  C denaturation for 30 s, annealing for 50 s at
1  C below the lowest Tm of a given primer pair, and 72  C extension
for 10 min. PCR was started with a initial denaturation at 94  C for
2 min. The amplied PCR products were maintained at 4  C. A
reagent blank contained all the components of the reaction mixture
except template DNA, for which sterile distilled water was
substituted. The PCR products were subjected to electrophoresis on
1.2% agarose gels in 1 Tris-borate-EDTA (TBE) buffer, stained with
ethidium bromide (1 mg/mL), visualized with UV, and photographed using the Eagle Eye II gel documentation system (Stratagene, La Jolla, CA). A 100-bp DNA ladder (Invitrogen, San Jose, CA)
was used as the size standard.

PCR amplication of the toxin genes from the template DNA of

all 81 A. veronii isolates from catsh was attempted. The oligonucleotide primers specic for the amplication of act amplied the
231-bp region of the gene from 79/81 (97.0%) of the isolates
(Fig. 1A, Lane 2). The identity of the 231-bp PCR amplicon was
conrmed by restriction digesting with AluI, which produced the
predicted 177- and 54-bp DNA fragments (Fig. 1A, lane 3). PCR
amplication was also attempted with aer-specic primers,
amplied a 431-bp portion of the aerA gene (Fig. 2, lane 2) from 78/
81 (96.0%) of the isolates. The identity of the 431-bp PCR amplicon

Table 2
Oligonucleotide Primers Used for the Amplication of Class I and II Integrons.
Name of the gene

Primer sequence

Size

Class I
Integrons
Class II
Integrons

F:GGC ATC CAA GCA GCA AG

R:GGC ATC CAA GCA GCA AG
F:CGG GAT CCC CGG CAT GCA CGA TTT GTA
R:GAT GCC ATC GCA AGT ACG AG

Variable
Variable

Thermal cycling conditions consisted of an initial denaturation cycle (94  C for

2 min) followed by 30 cycles of denaturation (95  C for 45 s), annealing (56  C for
1 min), and extension (72  C for 90 s). The nal cycle of amplication was carried out
at 72  C for 10 min.

M. Nawaz et al. / Food Microbiology 27 (2010) 327e331

329

Fig. 1. AeB: PCR amplication, conrmation and screening of A. veronii isolates for the cytotoxic enterotoxin (act) gene. A. Lane 1, 100-bp molecular weight marker; lanes 2e3, 231bp act gene amplied from genomic DNA and the AluI restriction digestion (150 and 81-bp) fragments. (B) screening of the isolates for the act gene. Lanes 1&8, 100-bp molecular
weight marker, lanes 2e7, the 231-bp act gene amplied from the template DNA of various isolates.

was conrmed by restriction digesting the PCR amplicon with

Sau3AI, which produced the predicted DNA fragment 351 and 80bp (Fig. 2, lane 3). PCR amplication was also attempted for a 331bp region of alt and a 442-bp region of ast, but it failed to amplify
the genes from the template DNA of any isolates.
Aeromonads secrete a variety of toxins that enhance the severity
of many infections (Cahill, 1990; Chopra and Houston, 1999; Sen
and Rodgers, 2004; Vadivelu et al., 1995). However, not all species
of aeromonads produce all the toxins (Chopra and Houston, 1999).
Aeromonads are considered potential foodborne pathogens when
harboring aerolysin/hemolysin genes (Cumberbatch et al., 1993;
Gosling, 1996). However, the pathogenic nature of A. veronii is
ambiguous. Pollard et al. (1990) failed to detect the aerA gene in any
of the isolates of A. veronii. Similarly, A. veronii biovar sobria isolated
from freshwater sh was also reported to lack the aerA gene
(Gonzalez-Serrano et al., 2002). In contrast, our results indicate that
96.0% of the A. veronii isolates from catsh harbored the aerA gene
and the cytotoxic enterotoxin act gene. Cytotoxic enterotoxin,
cytotonic enterotoxin and aerolysin play crucial roles in the
establishment of infections (Chopra et al., 1996; Soler et al., 2002;
Sha et al., 2002). These toxins trigger uid accumulation in animal
intestinal loops, elongation of CHO cells, rounding of Y1 adrenal
tumor cells and increases in intracellular cAMP levels (Chopra and
Houston, 1999; Gosling, 1996; Janda and Duffy, 1988). They exhibit
hemolytic, cytotoxic and enterotoxic activities. Our results indicate

that most A. veronii strains from farm-raised catsh are virulent

strains because they contain both aerA and act genes.
3.2. PCR amplication of serine protease (ser), glycerophospholipid:
cholesterol acyltransferase (gcaT), agellin (a), lipase (lip), DNase
(exu) and elastase (ahyB) genes
Oligonucleotide primers specic for the amplication of the
350-bp region of the serine protease gene amplied the PCR
product from the template DNA of 68/83 (82.0%) of the isolates
(Fig. 3A). Primers specic for the amplication of the 237-bp region
of the gcaT gene amplied the PCR amplicon from 65/83 strains
(78.0%) (Fig. 3B). Oligonucleotide primers specic for the amplication of a 608-bp region of the a gene and 247-bp region of the lip
gene amplied the PCR amplicon from 80.0% to 85.0% of isolates
(Fig. 3C,D).
The three genes involved in the regulation and secretion of
extracellular
glycerophospholipid-cholesterol
acyltransferase
(gcaT), serine protease and lipases play a coherent, integrated role
in the establishment of pathogenicity of Aeromonas spp (Lee and
Ellis, 1990; Pemberton et al., 1997). These extracellular enzymes are
secreted into the environment via the well characterized type II or
general secretory pathway (Pemberton et al., 1997). The gcaT and
ser genes play crucial roles in furunculosis caused by Aeromonas
salmonicida (Gosling, 1996). In addition serine protease has been

Fig. 2. AeB: PCR amplication, conrmation and screening of A.veronii isolates for the 431-bp aerA gene. (A) Lane 1, 100-bp molecular weight marker; lane 2, 431-bp aerA amplied
from the genomic DNA. Lane 3, sau3AI restriction digested fragment (350-bp) of the aer gene. (B) screening of the isolates for the act gene. Lanes 1&18, 100-bp molecular weight
marker. Lanes 4e17, 431-bp aerA gene amplied from the genomic DNA.

330

M. Nawaz et al. / Food Microbiology 27 (2010) 327e331

Fig. 3. AeD: (A) Amplication of the 350-bp region of the serine protease (ser) gene from the template DNA of different strains of A. veronii. Lanes 1&20, 100-bp molecular weight
marker. Lanes 3e16, 350-bp region of the ser gene PCR amplicon. B. Amplication of the 237-bp region of the gcaT gene from the template DNA. Lanes 1&18, 100-bp molecular
weight marker. Lanes 3e16, 237-bp gcaT gene product. C. Amplication of the 608-bp region of the a gene. Lanes 1&18, 100-bp molecular weight marker. Lanes 2, 4e9, 11e16, the
608-bp region of the a gene. D. Amplication of the 247-bp region of the lip gene from the template DNA of different strains. Lane 1&18, 100-bp molecular weight marker. Lanes
2e16, 247-bp lip gene amplied from the strains.

associated with the activation of aerolysin (aerA) and other extracellular enzymes, thus affecting the overall virulence of aeromonads (Cahill, 1990). Aeromonads secrete four different kinds of
extracellular lipases (lip, lipH3, pla and plc) which actively participate in the alteration of the host plasma membrane and thus
increase the severity of infection (Chaung et al., 1997; Lee and Ellis,
1990; Pemberton et al., 1997).
Swarming motility, a agellum-dependent behavior, is crucial
for biolm formation and bacterial virulence (Harshey, 1994; Kirov
et al., 2002; Rabaan et al., 2001). Polar, monotrichous agella of
Aeromonas spp. help in motility and colonization of surfaces after
initial attachment and aeromonads with lateral agella are
frequently associated with severe dysenteric infections (Kirov et al.,
2002; Rabaan et al., 2001).
Primers designed to specically amplify the 323-bp region of
the exu region and the 513-bp region of the ahyB gene failed to
amplify the respective PCR amplicon from the template DNA of any
of the 81 isolates.

contained integrons measuring ca. 0.8 and 2.0 Kb (lane 3), 11/39
integrom positive isolates contained a single integron measuring
0.8 Kb (lanes 4 and 7), seven isolates contained integrons
measuring 0.8 and 1.8 Kb (lane 5), four isolates contained integrons

3.3. Amplication of class I integrons

One pair of synthetic class I integron-specic oligonucleotide
primers (Jacobs and Chenia, 2007) was used to screen for integrons
in genomic DNA (Table 2). The primers were able to amplify the
integrons from 39/81 (48.0%) isolates; these integrons varied in
their sizes. Nine of the thirty nine integron- positive isolates contained integrons measuring 0.8 and 1.7 Kb (Fig. 4, lane 2), ve

Fig. 4. PCR amplication of class I integrons from the template DNA of A. veronii. Lanes
1 & 7, 1.0 kb molecular weight marker. Lanes 26, integrons measuring various sizes
(0.8e3.1 kb) amplied from the template DNA.

M. Nawaz et al. / Food Microbiology 27 (2010) 327e331

measuring 0.8 and 1.7 Kb (lane 6) and 3 contained integrons

measuring 0.8 and 3.1 Kb (lane 8). None of the strains contained
class II integrons.
Integrons are reservoirs of mobile gene cassettes that have sitespecic recombination, several multiple antibiotic resistance integrons are important contributors to the development of antibiotic
resistance in members of the Enterobacteriaceae and Aeromonadaceae (Jacobs and Chenia, 2007; White et al., 2001). More than
100 different antibiotic resistance gene cassettes have been found
within integrons and a majority encode antibiotic resistance
phenotypes (Jacobs and Chenia, 2007; White et al., 2001). The integrons in A. veronii may confer multiple antibiotic resistance markers.
The number of known outbreaks of foodborne infections due to the
consumption of catsh is low. However, catsh could serve as
a reservoir of A. veronii containing putative multiple virulence genes
and multiple antibiotic resistance integrons. Thus the potential health
risk due to the consumption of improperly cooked catsh harboring A.
veronii should not be underestimated. Although adequate cooking
should eliminate pathogenic bacteria, undercooking or crosscontamination during preparation could be of concern.
Acknowledgements
We thank Dr Carl E. Cerniglia, Dr. J.B. Sutherland and Dr. Huizhong Chen for critical review of the manuscript. This work was
supported by the National Center for Toxicological Research, US
Food and Drug Administration. Views presented here do not
necessarily reect those of the FDA.
References
Albert, M.J., Ansaruzzaman, M., Talukder, K.A., Chopra, A.K., Kuhn, I., Rahman, M.,
Faraque, A.S.G., Islam, M.S., Sack, R.B., Mollby, R., 2000. Prevalence of enterotoxin genes in Aeromonas spp. isolated from children with diarrhea, healthy
controls and the environment. J. Clin. Microbiol. 38, 3785e3790.
Alvandi, S.V., Anathan, S., 2003. Biochemical characteristics, serogroups, and virulence factors of Aeromonas species isolated from cases of diarrhea and domestic
water samples in Chennai. Ind. J. Med. Microbiol. 21, 233e238.
Aquaculture Outlook, 2001. Livestock, Dairy and Poultry Situation and Outlook
Supplement. US Department of Agriculture, Washington, D.C.
Cahill, M.M., 1990. Virulence factors in motile Aeromonas species: a review. J. Appl.
Bacteriol. 69, 1e16.
Chaung, Y.C., Chiou, S.F., Su, J.H., Wu, M.I., Chang, M.C., 1997. Molecular analysis and
expression of the extracellular lipase of Aeromonas hydrophila. MCC-2. Microbiology 143, 803e812.
Chopra, A.K., Houston, C.W., 1999. Enterotoxins in Aeromonas-associated gastroenteritis. Microbes Infect. 1, 1129e1137.
Chopra, A.K., Peterson, J.W., Xu, X.J., Coppenhaver, D.H., Houston, C.W., 1996.
Molecular and biochemical characterization of heat-stable cytotonic enterotoxin from Aeromonas hydrophila. Microb. Pathogenesis 21, 357e377.
Cumberbatch, N., Gurwith, M.J., Langston, C., Sack, R.B., Brunton, J.L., 1993. Cytotoxic
enterotoxin produced by Aeromonas hydrophila: relationship of toxigenic
isolates to diarrheal disease. Infect. Immun. 23, 267e277.
Escarpulli, G.C., Figueras, M.J., Arreola, G.A., Solar, L., Rendon, E.F., Aparicio, G.O.,
Guarro, J., Chacon, M.R., 2003. Characterization of Aeromonas spp. isolated from

331

frozen sh intended for human consumption in Mexico. Int. J. Food Microbiol.

84, 41e49.
Granum, P.E., O'Sullivan, K., Tomas, J.M., Ormen, O., 1998. Possible virulence factors
of Aeromonas spp. from food and water. FEMS Immunol. Med. Microbiol. 21,
131e137.
Gonzalez-Serrano, C.J., Santos, J.A., Garcia-Lopez, M.L., Otero, A., 2002. Virulence
markers in Aeromonas hydrophila and Aeromonas veronii biovar sobria isolates
from freshwater sh and from a diarrhea case. J. Appl. Microbiol. 93, 414e419.
Gosling, P.J., 1996. Pathogenic mechanisms. In: Austin, B., Altwegg, M., Gosling, P.J.,
Joseph, S.W. (Eds.), The Genus Aeromonas. John Wiley & Sons Ltd., Chichester,
England, pp. 245e265.
Harshey, R.M., 1994. Bees aren't the only ones: swarming in Gram negative bacteria.
Mol. Microbiol. 13, 389e394.
Huys, G., Kesters, I., Coopman, R., Janssen, P., Kersters, K., 1996. Genotypic diversity
among Aeromonas isolates recovered from drinking water production plants as
revealed by AFLP analysis. Syst. Appl. Microbiol. 19, 428e435.
Ison, J.H., Drake, M., 2002. Aeromonas species in foods. J. Food Protect 65, 575e582.
Jacobs, L., Chenia, H.Y., 2007. Characterization of integrons and tetracycline resistance determinants in Aeromonas spp. isolated from South African aquaculture
systems. Int. J. Food Microbiol. 114, 295e306.
Janda, J.M., Duffy, P.S., 1988. Mesophilic aeromonads in human diseases: current
taxonomy, laboratory infection and infectious disease spectrum. Rev. Infect. Dis.
10, 980e997.
Kingombe, C.I.B., Huys, G., Tonolla, M., Albert, M.J., Swings, J., Peduzzi, R., Jemmi, T.,
1999. PCR detection, characterization, and distribution of virulence genes in
Aeromonas spp. Appl. Environ. Microbiol. 65, 5293e5302.
Kirov, S.M., Tassell, B.C., Annalese, B.T., Semmler, A.B.T., O'Donovan, L.A., Rabaan, A.
A., Shaw, J.W., 2002. Lateral agella and swarming motility in Aeromonas
species. J. Bacteriol. 184, 547e555.
Lee, K.K., Ellis, A.E., 1990. Glycerophospholipid:cholesterol acyltransferase complexed with lipopolysaccharide (LPS) is a major lethal exotoxin and cytolysin of
Aeromonas salmonicida: LPS stabilizes and enhances toxicity of the enzyme.
J. Bacteriol. 172, 5382e5393.
Nawaz, M.S., Sung, K., Khan, S.A., Khan, A.A., Steele, R.S., 2006. Biochemical and
molecular characterization of tetracycline-resistant Aeromonas veronii isolates
from catsh. Appl. Environ. Microbiol. 72, 6461e6466.
Pollard, D.R., Johnson, W.M., Lior, H., Tyler, S.D., Rozee, K.R., 1990. Detection of the
aerolysin gene in Aeromonas hydrophila by the polymerase chain reaction.
J. Clin. Microbiol. 28, 2477e2481.
Pemberton, J.M., Kidd, S.P., Schmidt, R., 1997. Secreted enzymes of Aeromonas. FEMS
Microbiol. Lett. 152, 1e10.
Rabaan, A.A., Gryllos, I., Tomas, J.M., Shaw, J.G., 2001. Motility and polar agellum
are required for Aeromonas caviae adherence to HEp-2 cells. Infect. Immun. 69,
4257e4267.
Sechi, L.A., Deriu, A., Falchi, M.P., Fadda, G., Zanetti, S., 2003. Distribution of virulence genes in Aeromonas spp. isolated from Sardinian waters and from patients
with diarrhea. J. Appl. Microbiol. 92, 221e227.
Sen, K., Rodgers, M., 2004. Distribution of six virulence factors in Aeromonas species
isolated from US drinking water utilities: a PCR identication. J. Appl. Microbiol.
97, 1077e1086.
Sha, J., Kozlova, E.V., Chopra, A.K., 2002. Role of various enterotoxins in Aeromonas
hydrophila-induced gastroenteritis: generation of enterotoxin gene-decient
mutants and evaluation of their enterotoxic activity. Infect. Immun. 70,
1924e1935.
Soler, L., Figueras, M.J., Chacon, M.R., Vila, J., Marco, F., Martinez-Murcia, A.J.,
Guarro, J., 2002. Potential virulence and antimicrobial susceptibility of Aeromonas popofi recovered from freshwater and seawater. FEMS Immun. Microbiol. 32, 243e247.
US Environmental Protection Agency. 2006. Aeromonas: Human health criteria
document. NTIS: #PB2006:11226.
Vadivelu, J., Puthucheary, S.D., Phillips, M., Chee, Y.W., 1995. Possible virulence
factors involved in bacteremia caused by Aeromonas hydrophila. J. Med.
Microbiol. 42, 171e174.
White, P.A., McIver, C.J., Rawlinson, W.D., 2001. Integrons and gene cassettes in the
enterobacteriaceae. Antimicrob. Agents Chemother. 45, 2658e2661.