Biochem Genet (2011) 49:161176

DOI 10.1007/s10528-010-9396-2

Isolation and Expression of Two Distinct Sox8 Genes

in Mudloach (Misgurnus anguillicaudatus)
Xiaohua Xia Jie Zhao Qiyan Du Zhongjie Chang

Received: 18 March 2010 / Accepted: 5 August 2010 / Published online: 15 December 2010
Springer Science+Business Media, LLC 2010

Abstract To investigate the function and evolutionary origin of the SOXE subgroup, we amplified the genomic DNA of Misgurnus anguillicaudatus using a pair
of degenerate primers. Using RACE, we obtained two versions of Sox8 (MaSox8a
and MaSox8b) from M. anguillicaudatus. The overall sequence identity of the
deduced amino acids from the two genes was 54.38%, with only one amino acid
change in the high-mobility group domain. Southern blotting and evidence from the
phylogenetic tree provided further proof for the existence of two Sox8 genes at the
genomic level. This is the first evidence of two distinct Sox8 genes in Cypriniformes. Semi-quantitative and real-time quantitative PCR assays showed the expression trend of the genes was opposite in early embryonic development, and both were
expressed ubiquitously in several adult tissues. The similar expression patterns
indicated that MaSox8a and MaSox8b have possible overlapping functions.
Keywords Sox8a  Sox8b  RACE-PCR  Real-time quantitative PCR 
Misgurnus anguillicaudatus

X. Xia  J. Zhao  Q. Du  Z. Chang (&)

Molecular and Genetic Laboratory, College of Life Science, Henan Normal University,
46 East Construction Road, Xinxiang 453007, Henan, China
e-mail: changzhongjie@tom.com
X. Xia
e-mail: xxhlpf@163.com
J. Zhao
e-mail: uptime@126.com
Q. Du
e-mail: duqiyan09@tom.com

123

162

Biochem Genet (2011) 49:161176

Introduction
The sex-determining region of the Y chromosome (Sry) was discovered in 1990. It
is regarded as the mammalian Y-linked testis determining gene (Gubbay et al.
1990). The SRY protein contains a high-mobility group (HMG) box DNA-binding
domain that binds to the sequence (A/T) AACAAT (Harley et al. 1994). The
discovery of SRY led to the identification of the Sox family of genes, which encode
proteins with conserved SRY-type HMG boxes. The diverse functions of SOX
proteins range from roles in early embryogenesis to lineage specification and
terminal differentiation events (Kiefer 2007).
Subgroup E, including Sox8, Sox9, and Sox10, has received special attention
because of its possible functions. Sox9 is critical for chondrogenesis and is a critical
component of the male sex-determining pathway (Canning and Lovell-Badge 2002).
Sox10 is a key regulator of neural crest cell differentiation. Mutations in Sox10 can
cause the human disorders WaardenbergHirschsprung disease type IV (aganglionic
megacolon) (Pingault et al. 1998), Yemenite deaf-blind hypopigmentation (Bondurand et al. 1999), and chronic intestinal pseudo-obstruction (Pingault et al. 2000).
Recently, Sox8 was identified as a third member of SoxE in mice, humans, and
chickens (Bell et al. 2000; Pfeifer et al. 2000; Schepers et al. 2000). The exact
functions of the Sox8 gene are not yet clear.
Fish serve as a pivotal link during the systematic evolution of vertebrates. The
results obtained from teleost fish will provide clues to the molecular evolution
process of vertebrates. Mudloach (Misgurnus anguillicaudatus) is a freshwater
teleost widely distributed along the eastern coasts of the Asian continent, with no
heteromorphic sex chromosomes (Chang and Yu 1997). Since the 1990s, it has
become an emerging aquaculture species. To explore the role and degree of
evolutionary origin of the SoxE subgroup in fish development, we amplified
genomic DNA from M. anguillicaudatus with degenerate primers specific for the
HMG-box. Using RACE-PCR, we obtained two versions of Sox8 in M. anguillicaudatus: MaSox8a and MaSox8b. This is the first evidence that there are two
distinct orthologs of Sox8 in Cypriniformes. The expression patterns in embryogenesis and in various adult tissues indicated that MaSox8a and MaSox8b have
functional overlaps and are essential for neuronal development and differentiation
of the gonads.

Materials and Methods

Fish Stocks
Adult M. anguillicaudatus were collected from wetlands in the old course of the
Yellow River, Yanjin County (Henan, China). Female and male loaches were
induced to mate by intramuscular injection of human chorionic gonadotropin
hormone, and fertilized eggs were allowed to develop until use.

123

Biochem Genet (2011) 49:161176

163

Preparation of Genomic DNA

Genomic DNA was isolated from blood samples using the protease K digestion and
phenolchloroform extraction method (Sambrook et al. 1989). Purified DNA was
quantified and stored at -20C.
Degenerate PCR of Genomic DNA
Nucleotide sequences of Sox8 genes were retrieved from GenBank (www.ncbi.
nlm.nih.gov) and multiple-aligned using DNAman. Degenerate primers were
designed from the conserved regions of the HMG domain (Table 1).
The PCR was performed in 20 ll containing 0.2 mM dNTPs, 2.0 mM MgCl2,
20 lM each primer, 1 U Taq DNA polymerase, and 1 lg genomic DNA.
Amplification conditions were 95C for 5 min; followed by 35 cycles of 94C
(40 s), 56C (60 s), and 72C (60 s); ending with extension at 72C for 10 min.

Table 1 Nucleotide sequences of primers used for analysis of two Sox8 genes
Primer

Oligonucleotide sequence (50 ? 30 )

Degenerate PCR
HMG-F

T(C/G)AA(G/A)(A/C)G(G/A)CC(C/T)ATGAA(C/T)GC

HMG-R

G(G/A)TG(G/A)TC(C/T) TT(C/T)TTGTGCTG

50 RACE-PCR
GSP1 Sox8a

AAGAGACCGTTTGTGGAAGAAGC

GSP2 Sox8a

GCAAAACCCTCGGCAAACTCTGGA

GSP1 Sox8b

CATCAGAAAATGTGAGGCAGAACA

GSP2 Sox8b

GAGGGTCCAGCACAAGAAAGACT

30 RACE-PCR
GSP1 Sox8a

GCAAACTCTGGAGACTGTTGAC

GSP2 Sox8a

AAGAAGCCGAGAGACTGAGAG

GSP1 Sox8b

TCTGAGAATGAGAAGAGACCGTT

GSP2 Sox8b

TAGAAGAGGCAGAAAGACTGAG

Semi-quantitative RT-PCR
Sox8a SQ-F

CGAGAGAAGACGCCTGCT

Sox8a SQ-R

CGTGTTGGAGAATGAGGG

Sox8b SQ-F

TCAGCATCAAGGAGCGAAAC

Sox8b SQ-R

GTAGGTCAGAACAGTCAGTC

Fluorescent quantitative PCR

Sox8a FQ-F

ATTCCTCACGGAGACCCATACT

Sox8a FQ-R

CCTGGATAATGTGGTGTAAACCG

Sox8b FQ-F

CAAATGAGTCAAGCCAACAAAG

Sox8b FQ-R

GTGTAGGTCAGAACAGTCAGTCAG

GAPDH-F

ACCAACTGCTTGGCTCCCC

GAPDH-R

GGAATGACTTTGCCCACG

123

164

Biochem Genet (2011) 49:161176

PCR products were separated by electrophoresis on 1.5% agarose gels and

visualized by scanning with a UV imaging system. PCR products were gel-purified,
cloned into pGEM-T vector (Promega, USA), and sequenced by dideoxy-chain
termination using Sp6 and T7 promoter sequences as primers.
Isolation of Total RNA and RT-PCR
For total RNA extraction, approximately 25 mg of mature adult tissues (heart, liver,
kidney, brain, testis, and ovary) and different stages of developing embryos
(gastrulae, neurula, tail-bud-formed, hatched larva, and yolk-sac absorption phases)
was homogenized using a glass tissue homogenizer and a total RNA extraction kit
from RNAiso Reagent (Takara, Japan). Concentration and purity were determined
by a Bio-Photometer (Eppendorf), and RNA was extracted according to the
manufacturers protocols. RNA was stored at -80C.
Cloning the Full-Length Sox8a and Sox8b cDNA
Based on the HMG-box sequence of the Sox8 genes, gene-specific primers (Table 1)
were designed for RACE. Reverse transcription reactions were performed with
35 lg of total brain RNA to produce 50 and 30 cDNA. Reverse transcription and
RACE-PCR reaction conditions were according to the manufacturers instructions
for the RACE Core Set (TaKaRa, Japan). Subsequent cloning of RACE products
was performed as described above.
Southern Blot Analysis
About 10 lg genomic DNA from each fish was digested with the restriction enzyme
BamHI (6 U/lg DNA), separated on 0.8% agarose gel at 5 V/cm, and blotted onto
nylon membranes. Membranes were hybridized with random primer-labeled Sox8a
or Sox8b probes at 40C. Blots were exposed to X-ray film for 37 days at -20C
with an intensifying screen.
Data Analysis
Full-length cDNA sequences were confirmed by the BlastX program on the NCBI
Blast Server (http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi). A phylogenetic tree
of vertebrate SOXE proteins was constructed using the neighbor-joining method of
Mega3 and ClustalW (http://www.ebi.ac.uk/Tools/clustalw2/index.html).
Semi-Quantitative Reverse Transcription (RT) PCR
For expression profile studies, first-strand cDNA synthesis was carried out with
Prime Script reverse transcriptase (Takara, Japan), using 1 lg of total RNA isolated
as described above. Two pairs of specific primers were designed based on the 30
nonconserved regions of the MaSox8a and MaSox8b genes (Table 1). Semiquantitative RT-PCR reactions were performed to analyze expression profiles using

123

Biochem Genet (2011) 49:161176

165

the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as the reference.

The relative optical densities of bands were determined by Band Leader software.
Fluorescent Real-Time Quantitative RT-PCR
RT-PCR was used for expression profiles of specific Sox8 genes. First-strand cDNA
synthesis was carried out as described above. RT-PCR was performed on an ABI
7500 real-time PCR detection system (Applied Biosystems, USA) with SYBR green
fluorescent label. GAPDH was used to normalize data for differences between
samples. Primers are listed in Table 1. Amplification was performed in 50 ll
containing 12.5 ll 2 9 SYBR Premix Ex Taq (Takara, Japan), 3.5 pM each primer,
2 ll diluted cDNA, and 0.5 ll 50 9 ROX Reference Dye II (Takara, Japan). Data
were analyzed with the 7500 System SDS software, version 1.4 (Applied
Biosystems, USA). The 2-DDCt method was used to analyze the expression levels
of Sox8a and Sox8b (Livak and Schmittgen 2001).

Results
Cloning and Structural Analysis of the HMG-Box of SoxE
Using a set of degenerate primers (Table 1) specifically for the HMG-box motif of
Sox8 genes, three specific bands of 371, 463, and 553 bp were amplified from
M. anguillicaudatus genomic DNA (Fig. 1). No fragment differences were observed
between male and female individuals. The amplified fragments were purified and
sequenced. Homology searches with the tBlastX program on the NCBI Blast Server
(http://www.ncbi.nlm.nih.gov/BLAST/Blast.cgi) confirmed that all exhibited a high
percentage of identity with other SoxE subgroup genes from other animals.
We noticed that the fragments of 463 and 553 bp encoded 64 amino acids, but
there was only one amino acid change in the HMG domain, and the splicing sites of
the introns were consistent with the GTAG rule (Fig. 2). It is possible that they
encode the same gene with different introns, one of 241 bp and the other of 343 bp.

Fig. 1 Degenerate PCR of the

Misgurnus anguillicaudatus
genome. Lane L, 100 bp DNA
ladder. Lane 1, male; lane 2,
female; lane 3, negative control

123

166

Biochem Genet (2011) 49:161176

Fig. 2 DNA sequence and predicted amino acid sequence of fragments amplified from degenerate
primers. Top: 463 bp fragment. Bottom: 553 bp fragment. Sequences of primers used for degenerate PCR
reactions are underlined. Introns are indicated by lowercase letters

To obtain complete information on these two fragments, we carried out 50 and 30

RACE.
Cloning Full-Length cDNA and Sequence Alignments
Employing the RACE strategy (Table 1), we cloned the 50 and 30 cDNAs of the 463
and 553 bp fragments (Fig. 3). RACE products were sequenced and spliced to

123

Biochem Genet (2011) 49:161176

167

Fig. 3 RACE-PCR of two fragments amplified from M. anguillicaudatus genomic DNA: 50 RACE
(a) and 30 RACE (b) of the 463 bp fragment; 50 RACE (c) and 30 RACE (d) of the 553 bp fragment. Lane
M, 2000 bp DNA marker

obtain full-length cDNA. The full-length cDNA of the 463 bp fragment (MaSox8a)
was 2555 bp (GenBank accession no. GU166139), encoding a putative protein of
429 amino acids with a characteristic HMG-box DNA-binding domain of 79 amino
acids (aa 86164; Fig. 4). The full-length cDNA of the 553 bp fragment (MaSox8b)
was 1725 bp (GenBank acc. no. GU166140), encoding a putative protein of 414
amino acids with a characteristic HMG-box DNA-binding domain of 79 amino
acids (aa: 89167; Fig. 5). Primary structure analysis indicated that both of them
belonged to the SoxE subgroup, and they exhibited a high percentage of identity
with other Sox8 genes in the GenBank database. Consequently, these two fragments
were provisionally named MaSox8a and MaSox8b. The overall sequence similarity
of the deduced amino acid sequences was 54.38%, and the two proteins were highly
conserved in the HMG-box, with only one amino acid change (Fig. 6).
Southern Blot
Two distinct transcripts were detected in the Southern blot experiment. Since two
Sox8 genes exist in M. anguillicaudatus, the two bands may be the hybrid signals of
two kinds of transcript. The 11.4 kb band represents the Sox8a sequence, and the
9.4 kb band could be another Sox8b gene transcript (Fig. 7).
Homology and Phylogenetic Analysis of MaSox8a and MaSox8b Genes
The evolutionary relationship of the MaSox8a and MaSox8b genes to other
vertebrate SoxE members from GenBank was investigated with a phylogenetic tree

123

168

123

Biochem Genet (2011) 49:161176

Biochem Genet (2011) 49:161176

169

b Fig. 4 Nucleotide and deduced amino acid sequences of Sox8a cDNA from M. anguillicaudatus. The
deduced amino acid sequence is shown below the nucleotide sequence. Nucleotide and amino acid
sequences are numbered at left. The HMG-box conserved region is indicated by white letters in black
boxes. ATG shows the initiation codon. An asterisk indicates the stop codon. The putative polyadenylation
signal AATAAA is underlined. This sequence has been submitted to GenBank (acc. no. GU166139)

(Fig. 8). The tree revealed that MaSox8a and MaSox8b fit strongly into the SOX8
clade, with each in a separate clade from the SOX9 or SOX10 genes. Moreover,
MaSox8a and TrSox8a clustered in one branch, and MaSox8b and TrSox8b clustered
in another.
Spatio-Temporal Expression Patterns of MaSox8a and MaSox8b
Semi-quantitative RT-PCR and fluorescent real-time RT-PCR were conducted to
determine the expression of MaSox8a and MaSox8b in various tissues and in
different embryonic development periods. During early embryonic development,
the expression of MaSox8a showed a downward trend from the gastrulae to the
yolk-sac absorption phase. MaSox8b showed a notable up-regulation during those
periods. In adult tissues, the expression level of MaSox8a varied among tissues, with
stronger expression detected in brain and testis and lower expression in other
tissues. MaSox8b was expressed ubiquitously, at similar levels in all tissues (Figs. 9,
10).

Discussion
HMG-box introns have been reported for vertebrate members of groups D, E, and F
(Bowlles et al. 2000). In subgroup E, intron positions are conserved between
Drosophila and vertebrates, providing evidence that these represent ancient introns
present before the divergence of the vertebrate lineage (Foster et al. 1994; Wagner
et al. 1994; Schepers et al. 2000). In M. anguillicaudatus, three DNA fragments
were amplified using degenerate primers. They all exhibited a high percentage of
identity with SoxE subgroups of other vertebrates and had an intron of different
length in the conserved HMG-box region.
A comparison of the deduced amino acid sequences of these three fragments
revealed different introns in the 463 and 553 bp fragments, with only one amino
acid difference in the HMG-box domain. It may be that these two fragments are
homologs and are actually transcribed by two different genes. To investigate this
possibility, we obtained their full-length cDNA from M. anguillicaudatus. We
found that it had a high similarity with other vertebrate Sox8 genes. Whether the
comparison uses the full-length nucleotide sequence or the deduced amino acid
sequence, their differences are significant. We inferred that these two fragments are
transcribed from two different genes, which we provisionally named MaSox8a and
MaSox8b.
Two Sox9 genes have been found in teleosts, such as zebrafish, medaka,
stickleback, and rice field eel (Chiang et al. 2001; Yokoi et al. 2002; Cresko et al.
2003; Zhou et al. 2003; Nakamoto et al. 2005). Duplicates of Sox11 are also

123

170

123

Biochem Genet (2011) 49:161176

Biochem Genet (2011) 49:161176

171

b Fig. 5 Nucleotide and deduced amino acid sequences of Sox8b cDNA from M. anguillicaudatus. The
deduced amino acid sequence is shown below the nucleotide sequence. Nucleotide and amino acid
sequences are numbered at left. The HMG-box conserved region is indicated by white letters in black
boxes. ATG shows the initiation codon. An asterisk indicates the stop codon. The putative polyadenylation
signal AATAAA is underlined. This sequence has been submitted to GenBank (acc. no. GU166140)

reported in zebrafish (Martino et al. 2000). So far only one case reported that two
duplicates of Sox8 (TrSox8a and TrSox8b) were identified in Takifugu rubripes
(Tetraodontiformes) by genomewide analysis. The identity of the overall deduced
amino acid sequence encoded by TrSox8a and TrSox8b was 42.55% (Koopman
et al. 2004). In this study, two distinct Sox8 genes (MaSox8a and MaSox8b) were
identified in M. anguillicaudatus (acc. nos. GU166139 and GU166140). The
predicted protein sequence shared 54.38% identity. This is the first evidence of
distinct duplications of Sox8 genes in Cypriniformes. Southern blotting and
evidence from the phylogenetic tree provided further proof for the existence of two
Sox8 genes at the genomic level. Only one Sox8 gene, however, has been found in
the genome of mammals and birds, indicating that the Sox8 gene was duplicated
during the evolution of some ancestral fish lineages. We concluded that these two
Sox8 genes (MaSox8a and MaSox8b) were both orthologs of mammalian SOX8.
MaSox8b was presumed to be a duplicate of MaSox8a, and they arose by
duplication events that involved large chromosome sections (Chiang et al. 2001).
These results lend strong support to a theory of fish-specific whole-genome
duplication (Woods et al. 2000; Taylor et al. 2003) and were significant to reveal the
evolution and origin of Sox genes. Determining if this is a common phenomenon in
lower vertebrates requires additional research.

Fig. 6 Comparison of amino acid sequences of the MaSox8a protein and the MaSox8b protein. Amino
acid sequences are numbered at right. The HMG-box motif is indicated by white letters on a black
background. Asterisks indicate identical amino acids. Dashes indicate gaps introduced in the sequence to
optimize the alignment

123

172

Biochem Genet (2011) 49:161176

Fig. 7 Southern blot of M. anguillicaudatus genomic DNA with specific DNA fragments of MaSox8a
and MaSox8b as probes. Hybridization products of MaSox8a (left) and MaSox8b (right). Each lane
contains 50 lg genomic DNA digested by BamHI

Sox8 is an important transcription factor, but few studies have reported its
expression and function. Deficiencies in Sox8 are implicated in human alpha
thalassemia/mental retardation syndrome (Pfeifer et al. 2000). Mice with a mutated
Sox8 gene are characterized only by weight reduction and premature osteoblast
differentiation, which results in poor tarsal development and low bone density (Sock
et al. 2001; Schmidt et al. 2005). Different Sox8 expression profiles have been
reported in humans, mice, chickens, and trout (Schepers et al. 2003). In mice, Sox8
is expressed in the central nervous system, limbs, kidneys, gonads, and craniofacial
structures during embryonic development. In rainbow trout, a 3.3 kb transcript is
detectable in brain, ovary, and testis by Northern blot, with little or no detectable
expression in other tissues (Ito et al. 1995). The expression patterns of the MaSox8a
and MaSox8b genes overlapped in embryogenesis and adult tissues. Both MaSox8a
and MaSox8b are expressed from the gastrulae to the yolk-sac absorption phase
during early embryonic development. In adult tissues, the two genes were expressed
ubiquitously in various tissues. This indicated that MaSox8a and MaSox8b have a
wide range of functions and a possible functional redundancy in some domains.
Abundant expression of MaSox8a and MaSox8b in the brain confirms that they are
essential for the differentiation of neuronal development.
Two classical theories are proposed for gene duplication. The subfunctionalization model predicts that the Sox8 gene was parental to Sox8a and Sox8b, and the
functions of the single Sox8 gene in the preduplication ancestor were a combination
of the functions of the current Sox8a and Sox8b genes. The original Sox8 would
have had at least two essential functions (or essential expression domains) that are
now split between the two derivative genes (Force et al. 1999). The neofunctionalization model predicts that at least one of the Sox8 genes must have acquired a
novel function from a beneficial mutation, so one or both of the Sox8 genes has

123

Biochem Genet (2011) 49:161176

173

Fig. 8 Phylogenetic relationships of SOXE proteins from various species. The tree was obtained by
bootstrap analysis with the neighbor-joining method. Solid diamond indicates Sox8 from Misgurnus
anguillicaudatus. Open diamond indicates Sox8 from Takifugu rubripes. Accession numbers for the
sequences are: MaSox8a (this study), M. anguillicaudatus (GU166139); MaSox8b (this study),
M. anguillicaudatus (GU166140); DrSox8, Danio rerio (AAX73357); TrSox8a, T. rubripes
(AAQ18505); TrSox8b, T. rubripes (AAQ18506); SsSox8, Salmo salar (ABC24688); XlSox8, Xenopus
laevis (AAI69525); GgSox8, Gallus gallus (AAF73917); MmSox8, Mus musculus (AAH85619); HsSox8,
Homo sapiens (AAH31797); DrSox9a, D. rerio (NP571718); DrSox9b, D. rerio (NP 571719); OmSox9,
Oncorhynchus mykis (NP001117651); XlSox9, X. laevis (NP001084276); GgSox9, G. gallus (NP989612);
MmSox9, Mus musculus (NP035578); HsSox9, H. sapiens (NP000337); DrSox10, D. rerio (AAI63883);
XlSox10, X. laevis (NP001082358); GgSox10, G. gallus (NP990123); MmSox10, Mus musculus
(NP035567); HsSox10, H. sapiens (NP 008872)

acquired a new function not present in the Sox8 gene of the preduplication ancestor
(Ohno et al. 1968). During embryogenesis, the expression level of MaSox8a and
MaSox8b are distinct. MaSox8a showed a downward trend from the gastrulae to the
yolk-sac absorption phase, while MaSox8b showed a notable up-regulation during
those periods. The lower level of MaSox8a may imply a gradual loss of function for
Sox8a in the early embryo developmental process. The differing expression patterns
of MaSox8a and MaSox8b in gonads suggest that Sox8a is essential for testicular
differentiation but that Sox8b possibly acquired a new function in the ovary during
evolution. They may have reciprocally lost separate roles of an ancestral Sox8 gene.
The partitioning of ancestral subfunctions among duplicated genes may contribute

123

174

Biochem Genet (2011) 49:161176

Fig. 9 Expression analysis by semi-quantitative RT-PCR of MaSox8a and MaSox8b genes. Top:
Expression of MaSox8a in developing embryo (a) and six adult tissues (b). Bottom: Expression of
MaSox8b in developing embryo (c) and six adult tissues (d). Embryo development stages: G gastrulae,
N neurula T tail-bud formed, H hatched larva, Y yolk-sac absorption. Adult tissues: Heart, liver, kidney,
brain, testis, and ovary. GAPDH was the internal control. Products: MaSox8a 427 bp; MaSox8b 451 bp;
GAPDH 254 bp

Fig. 10 Expression analysis by real-time fluorescent quantitative RT-PCR of MaSox8a (top) and
MaSox8b (bottom) genes. Embryonic development stages: G gastrulae, N neurula T tail-bud formed,
H hatched larva, Y yolk-sac absorption. Adult tissues: Heart, liver, kidney, brain, testis, and ovary

to phenotypic evolution. The exact functions of the MaSox8a and MaSox8b proteins
are still unclear. A more extensive study should be carried out to explore their
expression patterns by in situ hybridization or immunohistological analysis.
Acknowledgments This research is supported by the National Natural Science Foundation of China
(30771666).

123

Biochem Genet (2011) 49:161176

175

References
Bell KM, Western PS, Sinclair AH (2000) Sox8 expression during chick embryogenesis. Mech Dev
94:257260
Bondurand N, Kuhlbrodt K, Pingault V, Enderich J, Sajus M, Tommerup N, Warburg M, Hennekam RC,
Read AP, Wegner M, Goossens M (1999) A molecular analysis of the yemenite deaf-blind
hypopigmentation syndrome: Sox10 dysfunction causes different neurocristopathies. Hum Mol
Genet 8:17851789
Bowlles J, Schepers G, Koopman P (2000) Phylogeny of the SOX family of developmental transcription
factors based on sequence and structural indicators. Dev Biol 227:239255
Canning CA, Lovell-Badge R (2002) Sry and sex determination: how lazy can it be? Trends Genet
18:111113
Chang ZJ, Yu QX (1997) The cytogenetic evidence of ZZ\ZW sex determination in Paramisgurnus
dabryanus. Heredity 19:1719
Chiang EF, Pai CI, Wyatt M, Yan YL, Postlethwait J, Chung B (2001) Two Sox9 genes on duplicated
zebrafish chromosomes: expression of similar transcription activators in distinct sites. Dev Biol
231:149163
Cresko WA, Yan YL, Baltrus DA, Amores A, Singer A, Rodriguez-Mari A, Postlethwait JH (2003)
Genome duplication, subfunction partitioning, and lineage divergence: Sox9 in stickleback and
zebrafish. Dev Dyn 228:480489
Force A, Lynch M, Pickett FB, Amores A, Yan YL, Postlethwait JH (1999) Preservation of duplicate
genes by complementary, degenerative mutations. Genetics 151:15311545
Foster JW, Dominguez-Steglich MA, Guioli S, Kwok C, Weller PA, Weissenbach J, Mansour S, Young
ID, Goodfellow PN, Brook JD, Schafer AJ (1994) Campomelic dysplasia and autosomal sex reversal
caused by mutations in an SRY-related gene. Nature 372:525530
Gubbay J, Collignon J, Koopman P, Capel B, Economou A, Munsterberg A, Vivian N, Goodfellow P,
Lovell-Badge R (1990) A gene mapping to the sex-determining region of the mouse Y chromosome
is a member of a novel family of embryonically expressed genes. Nature 346:245250
Harley VR, Lovell-Badge R, Goodfellow PN (1994) Definition of a consensus DNA binding site for SRY.
Nucleic Acids Res 22:15001501
Ito M, Ishikawa M, Suzuki S, Takamatsu N, Shiba T (1995) A rainbow trout SRY-type gene expressed in
pituitary glands. FEBS Lett 377:3740
Kiefer JC (2007) Back to basics: Sox genes. Dev Dyn 236:23562366
Koopman P, Schepers G, Brenner S, Venkatesh B (2004) Origin and diversity of the Sox transcription
factor gene family: genome-wide analysis in Fugu rubripes. Gene 328:77186
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative
PCR and the 2 (-Delta Delta C (T)) method. Methods 25:402408
Martino SD, Yan YL, Jowett T, Postlethwait JH, Varga ZM, Ashworth A, Austin CA (2000) Expression
of Sox11 gene duplicates in zebrafish suggests the reciprocal loss of ancestral gene expression
patterns in development. Dev Dyn 217:279292
Nakamoto M, Suzuki A, Matsuda M, Nagahama Y, Shibata N (2005) Testicular type Sox9 is not involved
in sex determination but might be in the development of testicular structures in the medaka, Oryzias
latipes. Biochem Biophys Res Commun 333:729736
Ohno S, Wolf U, Atkin NB (1968) Evolution from fish to mammals by gene duplication. Hereditas
59:169187
Pfeifer D, Poulat F, Holinski-Feder E, Kooy F, Scherer G (2000) The Sox8 gene is located within 700 kb
of the tip of chromosome 16p and is deleted in a patient with ATR-16 syndrome. Genomics
63:108116
Pingault V, Bondurand N, Kuhlbrodt K, Goerich DE, Prehu MO, Puliti A, Herbarth B, HermansBorgmeyer I, Legius E, Matthijs G, Amiel J, Lyonnet S, Ceccherini I, Romeo G, Smith JC, Read
AP, Wegner M, Goossens M (1998) Sox10 mutations in patients with WaardenburgHirschsprung
disease. Nat Genet 18:171173
Pingault V, Guiochon-Mantel A, Bondurand N, Faure C, Lacroix C, Lyonnet S, Goossens M, Landrieu P
(2000) Peripheral neuropathy with hypomyelination, chronic intestinal pseudo-obstruction and
deafness: a developmental neural crest syndrome related to a Sox10 mutation. Ann Neurol
48:671676

123

176

Biochem Genet (2011) 49:161176

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edn. Cold Spring
Harbor, New York
Schepers GE, Bullejos M, Hosking BM, Koopman P (2000) Cloning and characterisation of the sryrelated transcription factor gene Sox8. Nucleic Acids Res 28:14731480
Schepers G, Wilson M, Wilhelm D, Koopman P (2003) SOX8 is expressed during testis differentiation in
mice and synergizes with SF1 to activate the Amh promoter in vitro. J Biol Chem 278:2810128108
Schmidt K, Schinke T, Haberland M, Priemel M, Schilling AF, Mueldner C, Rueger JM, Sock E, Wegner
M, Amling M (2005) The high mobility group transcription factor Sox8 is a negative regulator of
osteoblast differentiation. J Cell Biol 168:899910
Sock E, Schmidt K, Hermanns-Borgmeyer I, Bosl MR, Wegner M (2001) Idiopathic weight reduction in
mice deficient in the high-mobility-group transcription factor Sox8. Mol Cell Biol 21:69516959
Taylor JS, Braasch I, Frickey T, Meyer A, Van de Peer Y (2003) Genome duplication, a trait shared by
22000 species of ray-finned fish. Genome Res 13:382390
Wagner T, Wirth J, Meyer J, Zabel B, Held M, Zimmer J, Pasantes J, Bricarelli FD, Keutel J, Hustert E,
Wolf U, Tommerup N, Schempp W, Scherer G (1994) Autosoma sex reversal and campomelic
dysplasia are caused by mutation in and around the SRY-related gene SOX9. Cell 79:11111120
Woods IG, Kelly PD, Chu F, Ngo-Hazelett P, Yan YL, Huang H, Postlethwait JH, Talbot WS (2000) A
comparative map of the zebrafish genome. Genome Res 10:19031914
Yokoi H, Kobayashi T, Tanaka M, Nagahama Y, Wakamatsu Y, Takeda H, Araki K, Morohashi K, Ozato
K (2002) Sox9 in a teleost fish, medaka (Oryzias latipes): evidence for diversified function of Sox9
in gonad differentiation. Mol Reprod Dev 63:516
Zhou R, Liu L, Guo Y, Yu H, Cheng H, Huang X, Tiersch TR, Berta P (2003) Similar gene structure of
two Sox9a genes and their expression patterns during gonadal differentiation in a teleost fish, rice
field eel (Monopterus albus). Mol Reprod Dev 66:211217

123