Leishmaniosis in the major endemic region of Plurinational State of

Bolivia: species identification, phylogeography and drug susceptibility

implications.
Pablo Bilbao-Ramosa, M Auxiliadora Dea-Ayuela a,b, Oscar Cardenas-Alegrac,
Efran Salamancac, Cesar Benitod, Ninoska Floresc and Francisco BolsFernndeza*.
a

Departamento

de

Parasitologa,

Facultad

of

Farmacia,

Universidad

Complutense de Madrid, Plaza Ramn y Cajal s/n, 28040-Madrid, Espaa

b

Departamento de Farmacia. Facultad de Ciencias de la Salud, Universidad

CEU-Cardenal Herrera, Avda. Seminario s/n, 46113-Moncada, Espaa

c

Instituto de Investigaciones Frmaco Bioqumicas, Facultad de Ciencias

Farmacuticas y Bioqumicas, Universidad Mayor de San Andrs, Avda.

Saavedra 2224, Miraflores, La Paz, Bolivia
d

Departamento de Gentica, Facultad de Ciencias Biolgicas, Universidad

Complutense de Madrid C/ Jos Antonio Novais, 12, 28040-Madrid, Espaa

Pablo Bilbao-Ramos: pablobil15@yahoo.com
M Auxiliadora Dea-Ayuela: mda_3000@yahoo.es
Oscar Cardenas-Alegra: scar_ale@hotmail.com
Efran Salamanca: efrain_salamanca@hotmail.com
Cesar Benito Jimnez: cebe8183@ucm.es
Ninoska Flores: ninofq@yahoo.es
*Corresponding author: Francisco Bols-Fernndez; Departamento de
Parasitologa, Facultad de Farmacia, Universidad Complutense de Madrid,
Plaza Ramn y Cajal s/n, 28040-Madrid, Espaa. Tel.: +34 913941818; fax: +34
913941815. E-mail address: francisb@ucm.es

Abstract
The Plurinational State of Bolivia is one of the Latin American countries with the
highest prevalence of leishmaniosis, highlighting the lowlands of the
Department of La Paz where about 50% of the total cases were reported. The.
control of the disease can be seriously compromised by the intrinsic variability
of the circulating species that may limit the efficacy of treatment while favoring
the emergence of resistance. Fifty-five isolates of Leishmania were collected
from cutaneous and mucocutaneous lesions from patients living in different
provinces of the Department of La Paz. Molecular characterization of isolates
was carried out by 3 classical markers: the rRNA internal transcribed spacer 1
(ITS-1), the heat shock protein 70 (HSP70) and the mitochondrial cytochrome b
(Cyt-b). These genes were amplified by PCR and their products digested by the
restriction endonuclease enzymes AseI and HaeIII followed by subsequent
sequencing of Cyt-b gene and ITS-1 region for subsequent phylogenetic
analysis. The combined use of these 3 markers allowed us to assign 36 isolates
(65.5%) to the complex Leishmania (Viannia) braziliensis, 15 isolates (23.7%) to
L. (Leishmania) mexicana-amazonensis and the remaining 4 isolates (7,27%) to
L. (Viannia) lainsoni. In addition sequences analysis of Cyt-b and ITS-1
evidenced the presence of intraspecific polymorphisms in L. (L.) braziliensis and
L. (L.) mexicana complexes that suggest the existence of the mixed subclade L.
(L.) mexicana-amazonensis. Concerning in vitro drug susceptibility the
amastigotes from all isolates where highly sensitive to Fungizone (mean IC50
between 0.23 and 0.5g/mL) whereas against Glucantime the sensitivity was
moderate (mean IC50 ranging from 50.84 g/mL for L. (V.) braziliensis to 18.23
g/mL for L. (L.) mexicana-amazonensis). L. (V.) lainsoni was not sensitive to
Glucantime. The susceptibility to miltefosine was highly variable among
species isolates, being L. (L.) mexicana-amazonensis the most sensitive,
followed by L. (V.) braziliensis and L. (V.) lainsoni (mean IC50 of 8.24 g/mL,
17.85 g/mL and 23.28 g/mL, respectively).
Key words: Leishmania, Bolivian isolates, molecular characterization, drug
susceptibility, ITS-1, HSP-70, Cytochrome b.

Highlights:
1. Leishmaniasis is highly endemic in the Department of La Paz (Bolivia)
2. L. (V.) braziliensis, L. (L) mexicana-amazonensis and L. (V.) lainsoni are the
major circulating species
3. L. (V.) braziliensis is the most prevalent monophyletic clade
4. Intracellular amastigotes show high variation in susceptibility to conventional
drugs
5. L. (L.) mexicana-amazonensis is more susceptibility to miltefosine than L.
(V.) braziliensis

1. Introduction
Human leishmaniosis is one of the most important neglected tropical diseases
of broad global distribution. In the Americas leishmaniosis is present under a
wide range of clinical manifestations, such as visceral leishmaniosis (VL) that is
the most severe form of the disease, muco-cutaneous leishmaniosis (MCL) a

mutilating disorder; diffuse cutaneous leishmaniosis (DCL), a long-lasting

complication and the more benign cutaneous leishmaniosis (CL) (Desjeux,
2004; David and Craft, 2009). A mosaic of phylogenetically distinct species of
Leishmania are the responsible for all these clinical manifestations with great
species-specific variation in the severity of the disease (Berzunza-Cruz et al.,
2009). For this reason, the characterization of Leishmania parasites is critical,
not only from an epidemiologic perspective, but also because the treatment
choice largely depends on the levels of virulence and response to the various
chemotherapeutic regimens of infecting species (Marfurt et al., 2003; Victoire et
al., 2003).
The Plurinational State of Bolivia is one of the countries with highest incidence
of leishmaniosis in Latin America, with 33 cases per 100.000 population
recorded in 2006 (Garca et al., 2009). Data from the national programme of
surveillance and control of leishmaniosis in Bolivia reflects high variation and
constant increase since 1983, raising from 278 cases to 1810 cases reported in
2010. Nearly 50% of citizens affected were located in subtropical lowlands of
the Department of La Paz (David et al., 1993; PNVCL-Bolivia, 2011). Besides,
most cases of severe mucocutaneous leishmaniosis are reported in Bolivia,
Brazil and Peru (WHO, 2010). The increases of transmission in migrants from
Andean to subtropical lands and uncontrolled logging are two of the main
reasons for the emergence of new highly active foci that are continually
increasing in scale and extension (Alcais et al., 1997). Despite efforts to
implement programs to control the leishmaniosis, the epidemiological
information still do not reflect the real status of severity due to the difficult
access to tropical rainforest areas where the transmission of the infection is
very high.
At present, the classical multilocus enzyme electrophoresis (MLEE) continues
being the gold standard for Leishmania species characterization in Europe and
in South America (Rioux et al., 1989; Cupolillo et al., 1994). Unfortunately this
method is highly time-consuming and it can only be performed in specialized
laboratories. The significant advances in molecular methods have led to the
development of reliable alternative tools for gene typing, all based on the
polymerase chain reaction (PCR) and multiple subsets were developed such as

randomly amplified polymorphic DNA (PCR-RAPD) (Tibayrenc et al., 1993;

Bauls et al., 2000; Martinez et al., 2003), multiplex PCR (Harris et al., 1998),
restriction fragment length polymorphism (PCR-RFLP) (Cupolillo et al., 1995;
Schonian et al., 2003; Garcia et al., 2004). In addition the new real-time PCR
assay for rapid diagnostic (Stevenson et al., 2010; Pita-Pereira et al., 2012;
Jara et al., 2013), the powerful and robust developed multilocus sequence
typing (MLST) (Mauricio et al., 2006; Zemanov et al., 2007; Tsukayama et al.,
2009; Boite et al., 2012) and multilocus microsatellite typing (MLMT) (Kuhls et
al., 2007; Kuhls et al., 2011) were also implemented. Each of them use specific
coding or non-coding gene targets such as heat shock proteins (HSP70, HSP20
and UTR-HSP70), cytochrome b (Cyt-b), internal transcribed spacers (ITS-1
and ITS-2), 7SL of the ribosomal RNA, DNA microsatellite (Luyo-Acero et al.,
2004; Zelazny et al., 2005; Fraga et al., 2010; De Almeida et al., 2011; Requena
et al., 2012; Van der Auwera et al., 2014) and others.
In line with the recommendations from Control strategies for visceral
leishmaniosis (VL) and mucocutaneous leishmaniosis (MCL) in South America,
applications of molecular epidemiology, the PCR-RFLP of ITS-1 and HSP70
genes are reliable for detection and identification of Leishmania species
(LeishEpiNetSA, 2009). The ITS-1 region lying between the genes coding for
the SSU and the 5.8S rRNA genes of the ribosomal RNA from Leishmania
species are one of the most evolved sequences for the characterization of interand intra-species variation by restriction enzyme analyses or sequencing
(Cupolillo et al., 1995; Dvila and Momen, 2000; Schonian et al., 2003). The
HSP70 gene can be applied for direct identification of Leishmania species in
clinical samples or cultures by a simple digestion of the PCR-product with
HaeIII enzyme (Garcia et al., 2004; Montalvo et al., 2010). In addition, Cyt-b is
one of the most useful genes for phylogenetic and taxonomic works (Escalante
et al., 1998; Zhang et al., 2005; Garcia et al., 2012).
Today there is still no effective vaccine for leishmaniosis and chemotherapy
remains the most effective control measure. In Bolivia, the drugs available for
the treatment are still primarily pentavalent antimony (Glucantime and
Pentostan), although intravenous amphotericin B (Fungizone ) is used as a
second line of treatment in severe or recurrence lesions and recently, oral

miltefosine (MIL) has been introduced for clinical trials (Soto et al., 2008).
However, none of these therapies is 100% effective and several authors
reported therapy failure and variable efficacy in many scenarios (Bermudez et
al., 2006; Soto et al., 2007; Soto et al., 2008, 2009; Garca et al., 2009). These
failures can lead to drug resistance, lack of efficacy for American Leishmania
species and these implications could be the most worrying problem in order to
control the disease.
This work has been designed for molecular characterization and drug
susceptibility assessment in autochthonous Leishmania isolates from patients
located in the major endemic region in Bolivia. Furthermore their geographical
distribution and the phylogenetic relationship among circulating species have
been reconstructed using a partial sequence of ITS-1 and Cyt-b gene markers.
2. Material and Methods
2.1. Drugs
Antimony-N-methyl-glutamine
deoxycholate

(Fungizone,

(Glucantime,
Bristol

Myers

Merial),

amphotericin

Squibb)

and

Hexadecyl-

phosphocholine (miltefosine, Sigma Aldrich) were used in this work.

2.2. Leishmania isolates
Fifty-five Leishmania isolates from patients with cutaneous and mucocutaneous
lesions were kindly provided by Dr. Jos Santalla from the Laboratory of
Parasitology of the National Institute Laboratory of Health (INLASA). Code of
Leishmania isolates and dataset with clinical manifestations, sex, age and
geographical origins of patients are listed in Table 1. Moreover, characterized
Leishmania species isolates were used: an autochthonous isolate of L. (L.)
infantum (MCAN/ES/92/BCN83) was gently provided by Prof. Montserrat Ports
(Universidad de Barcelona, Spain), L. (V.) braziliensis (MHOM/BR/75/M2903),
L. (L.) amazonensis (MHOM/Br/79/Maria) and L. (L.) guyanensis (141/93) were
kindly donated by Drs. Alfredo Torao and Mercedes Domnguez (Instituto de
Salud Carlos III, Madrid, Spain) and L. donovani (MHOM/IN/80/DD8) purchased
from ATCC. Two additional isolates, L. (V.) braziliensis (MHOM/BR/75/M2904)

and L. (L.) mexicana (MNYC/BZ/62/M379) were given as gift by Dr. Cesar

Ramrez (Universidad Javeriana, Colombia) and Dr. Liliana Yepez-Mulia
(Instituto Mexicano del Seguro Social, Ciudad de Mexico, Mexico), respectively.
2.3. In vitro culture and DNA extraction
Promastigote stages were cultured in Schneiders insect medium (Sigma ) at
26C supplemented with 10% heat-inactivated foetal bovine serum (HIFBS) and
100 U/mL of penicillin plus 100 g/mL of streptomycin in 20 mL culture flask.
One millilitre of cultured suspension on log growth phase per sample were
centrifuged at 1,500 g and washed two times in phosphate buffer saline. The
genomic DNA of the promastigotes was isolated using the DNeasy Blood &
Tissue isolation kit (Qiagen). DNA was recovery in mili-Q water and stored at
-20C until use.
2.4. PCR amplification assay
A set of three standard markers previously described by other authors for
Leishmania

species

identification

were

used.

Primer

LITSR

(5-

CTGGATCATTTTCCGATG-3) and L5.8S (5-TGATACCACTTATCGCACTT-3)

(El

Tai

et

al.,

2000;

Schonian

GACGGTGCCTGCCTACTTCAA-3)
CCGCCCATGCTCTGGTACATC-3)
(5GGTGTAGGTTTTAGTTTAGG3)

et

al.,

2003),

and
(Garcia

HSP70sen

HSP70ant
et
and

al.,

2004),

(5(5-

LCBF1
LCBR2

(5CTACAATAAACAAATCATAATATACAATT3) (Luyo-Acero et al., 2004) were

purchased (Sigma-Aldrich). Amplitaq Gold PCR Master Mix was purchased
from Applied Biosystems.
PCR assays were performed according to the conditions previously published
by other authors with minor modifications. Briefly, PCR mix reaction was carried
out in a 25L solution containing 12.5 L of Amplitaq Gold PCR master mix,
0,04 M of each primer, 2L of DNA for ITS-1 and Cyt-b and 5L for HSP70 at
10 ng/L, and mili-Q water up to final volume. PCR runs were activated at 96C
for 10 min followed by 33 cycles for ITS-1: 96C for 30 s, 53C for30 s, 72C for
60 s; 35 cycles for HSP70: 96C for 60 s, 61C for 90 s, 72C for 180 s, and 35
cycles for Cyt-b: 96C for 60 s; 50C for 90 s, 72C for 90 s, and then the final

elongation step at 72C for 10 min in a Master cycler Gradient 5331

thermocycler

(Eppendorf).

The

PCR

products

were

subjected

to

electrophoresis in 2 % agarose gel at 100 V in TAE buffer (40 mM Tris acetate,

1 mM EDTA and pH 8.2) for 30 min and then they were embedded in a pool
containing ethidium bromide solution during 15 min, finally they were visualized
under ultraviolet light (Uvitec transilluminator).
2.5. RFLP electrophoresis analysis
RFLP were performed according to the instructions provided by the supplier
(Sigma-Aldrich and Fermentas). Ten microliters of PCR products were directly
digested with 10 L of a solution of HaeIII for ITS-1 and HSP-70 and AseI for
Cyt-b for one hour at 37C and 20 min to 80C to inactivate the enzyme. Then
they were subjected to electrophoresis in 3% high-resolution agarose (Sigma )
at 100V in TAE buffer for 90 min. Finally the gels were embedded in a pool
containing ethidium bromide solution during 15 min and visualized under
ultraviolet light (Uvitec transilluminator).
2.6. DNA sequencing and phylogenetic analysis
PCR products were purified directly with QIAquick PCR purification kit
(Qiagen). The fragments were sequenced with the PCR primers LITSR- L5.8S
for ITS-1 and LCBF1-LCBR2 for Cyt-b to obtain forward and reverse sequences
for partial genes. Purified PCR products were direct sequencing in ABI PRISM
3730 DNA Sequencer (Applied Biosystem ). Partial sequences were analysed
and visualized in Chromas 2.31 (McCarthy, 1998), edited and local alignment
forward-reverse in BioEdit Sequence Alignment Editor (Hall, 2007). Sequences
were compared with BLASTn (nucleotide Basic Local Alignement Search Tool)
from NCBI-NIH online accession.
In addition, a set of sequences was retrieved from GenBank NCBI-NIH, twelve
of them are from ITS-1 region and nineteen from Cyt-b region from different
Leishmania species. Besides out-group sequences of T. cruzi were included.
They are listed in Table 2.

DNA sequences were aligned with the program CLUSTAL W 1.6 (Thompson et
al., 1994), incorporated into MEGA6 (Tamura et al., 2013) software, with default
parameters, gap opening penalty (GOP) 15, gap extension penalty (GEP) 6.66,
DNA weight matrix ClustalW 1.6, transition weight 0.5 and delay divergence cut
off 30%. The aligned matrix including GAP was uniform sequence length at 579
and 342 nucleotides for Cyt-b and ITS-1respectively. In the sequence alignment
of Leishmania species single nucleotide polymorphisms (SNPs) and insertiondelections (INDELS) were searched. Phylogenetic relationship distances were
estimated with Kimura-2-parameter model (Kimura, 1980) and the phylogeny
trees were constructed using Neighbour Joining (NJ) (Saitou and Nei, 1987),
Maximum Likelihood (ML) (Tamura et al., 2013), Minimum Evolution (ME) (Nei
and Kumar, 2000; Rzhetsky and Nei, 1992) and Unweighted Pair-Group
Method with Arithmetic (UPGMA) (Sneath and Sokal, 1973) methods.
Monophyletic groups has been supported by 2000 bootstrap method
(Felsenstein, 1985).
2.7. Promastigote drug assay
Promastigote drug susceptibility was determined by using the sensitive
fluorometric resazurin model (Sigma-Aldrich ) as previously described (DeaAyuela et al., 2009). Briefly, cultured log phase promastigotes (2,5x10 5
parasites/well) were plated in 96-well flat-bottomed microtiter plates in 200
L/well final volume, in the presence of different concentrations of the studied
drugs (eight-fold serial dilutions 1:2 of Glucantime , Fungizone and miltefosine
were seeded from 200 to 1.6g/m, 5 to 0.02g/m and 100 to 0.8 g/mL
respectively). Finally, the relative fluorescence units (535 exitation 590emission nm
wavelength) was measured with a fluorimeter Infinite 200 (Tecani-Control) to
determine the growth inhibition rate and then the fifty percentage of growth
inhibition (IC50) were calculated by Probit analysis using SPSS 20.0 Statistics
Software. For each strain three independent experiments were performed in
triplicate to determine the IC 50 for each drug. For each drug, L. (V.) braziliensis,
L. (V.) guyanensis, L. (L.) mexicana, L. (L.) amazonensis and L. (L.) infantum
reference strains were tested in parallel.
2.8. Intracellular amastigote drug assay

Amastigote assays were performed using the fluorimetric resazurin model

reported by us (Bilbao-Ramos et al., 2012). First, macrophages were plated
(5x104 cells/well cultured in RPMI medium) in a microtiter plates with flat
bottom; then they were infected with 5x10 5 promastigotes of each isolate. The
plates were incubated at 33 C/24 h and then increased to 37 C for another 24
h. After incubation, the culture medium was removed and washed with buffered
RPMI-HEPES pH 7.2 in order to eliminate the non-internalized parasites.
Immediately afterwards, 100 L of tempered medium RPMI was added to each
well and then100 L of medium containing different concentrations of drugs
(eight serial 1:2 dilutions of Glucantime , Fungizone and miltefosine ranging
from 100 to 0.8 g/mL, 5 to 0.02 g/mL and from 50 to 0.4 g/mL respectively)
were added. Sixteen wells as positive untreated control and eight well as
negative uninfected control were adjusted to final volume 200 L with fresh
RPMI medium and incubated at 37 C/48 h. The culture medium at different
drug concentrations was removed by centrifugation at 3,500 rpm for 5 min
(Centrifuge 5403 Eppendorf) and then replaced by lysis solution (0.02 %
sodium dodecyl sulphate in RPMI-HEPES). After 20 min, lysis solution was
removed after centrifugation at 3,500 rpm for 5 min at 4 C. The supernatants
were replaced by 200 L of Fresh Schneiders culture medium. The plates were
then incubated at 26 C for another 3 days to allow the transformation of viable
amastigotes into promastigotes and proliferation. Afterwards, 20 L/well of 2.5
mM resazurin salt were added followed by 3 h of incubation at room
temperature and relative fluorescence units were measured as described
above.
All in vitro experiments were carried out for three times and by triplicate. The
IC50 was calculated by Probit analysis and the statistic parameters were
computed using SPSS Statistics v17.0 Software. In order to determine the
significance of variation in response of Leishmania species isolates and
reference strains to each tested drug, the mean of individual IC 50 were
calculated by ANOVA and multivariant T3-Dunnett post-hoc test for nonhomogeneous variances according to Levene test (Stoline, 1981).
3. Results

3.1. Molecular characterization

3.1.1. PCR-RFLP analysis
PCR-product of 55 isolates and reference isolates were rightly amplified by the
three molecular markers. Then they were cut by restriction enzyme HaeIII for
the ITS-1 and HSP70 region and 40 of the ITS-1 products showed identical
banding profile to L. (V.) braziliensis (MHOM/BR/75/M2904) and L. (V.)
guyanensis (141/93) reference strain whereas the remaining 15 products were
identical to L. (L.) amazonensis (MHOM/BR/79/Maria) (figure 1). However, for
the HSP70 region, 36 isolates were identical to L. (V.) braziliensis
(MHOM/BR/75/M2904),

15

isolates

to

L.

(L.)

amazonensis

(MHOM/BR/79/Maria) and the remaining 4 isolates showed a different profile

from those of the reference strains used in this study (figure 2). Moreover, the
banding pattern of these 4 isolates was compatible to that previously described
by Garca et al., (2004) for L. (V.) lainsoni. Furthermore, the AseI restriction
fragments of Cyt-b showed 40 isolates with similar banding pattern to L. (V.)
braziliensis (MHOM/BR/75/M2904) whereas for the remaining 15 isolates the
patterns were different from those of the reference strains used in this study
(figure 3). The contrasting results for the three molecular markers used here led
us to sequence partial regions of the highly divergent ITS-1 and the conserved
Cyt-b genes.
3.1.2.

Sequencing

analysis,

phylogenetic

tree

construction

and

geographical distribution
The sequences length of ITS-1 region (previously revised, edited and aligned)
finally was 342 nucleotides GAPs included. These sequences reveal 245
conserved and 92 variable sites with 87 parsimony-informative sites. However,
the sequences length of the Cyt-b gene was 579 nucleotides GAPs excluded,
revealing 473 conserved and 106 variable sites with 93 parsimony-informative
sites.
BLASTn function have evidenced similitudes for ITS-1 region: 36 isolates were
homologous to L. (V.) braziliensis, of which 33 were up to 100% identical to L.
(V.) braziliensis MHOM/BR/75/M2904 reference strains and 3 up to 99%

identical to L. (V.) braziliensis MHOM/BR/2006/EFSF (JQ061322.1) sequence

reference strain. These polymorphisms are characterized by delection A, G, T
and G on 71, 72, 95 and 96 position respectively (see supplementary data A).
Four isolates were homologous to L. (V.) lainsoni with 100% of identity to
reference sequence L. (V.) lainsoni MHOM/BR/1981/M6426 (FN398154.1). The
remaining 15 isolates were homologous to L. (L.) amazonensis with 99%
identity to the reference strains L. (L.) amazonensis MHOM/BR/79/Maria, L. (L.)
amazonensis MHOM/BR/81/LTB16 (AJ000314.1) and L. (L.) amazonensis
MHOM/BR/81/LTB16 (DQ182536.1) reference sequences. The sequences of
these 15 isolate were characterized by addition of 2 nucleotides at 37 and 38
positions.
On the other hand, we identified a varied performance with Cyt-b gene. Thirty
six isolates were homologous to L. (V.) braziliensis, of which 19 were up to
100% identical to the reference strain L. (V.) braziliensis MHOM/BR/75/M2904
and L. (V.) braziliensis MHOM/EC/88/INH-03 (AB095967.1) reference sequence
and of the remaining 17 isolates, 16 were 100% and 1 was 99, 8% identical to
reference

sequence

from

L.

(V.)

braziliensis

MHOM/BR/75/M2903

(AB434682.1). The polymorphism of SNPs was characterized by one

transversion of GT at 50 position and one transition of GA at 27 position. Four
isolates were homologous to L. (V.) lainsoni with 99.1% of identity to reference
sequence

L.

(V.)

braziliensis

MHOM/BR/81/M6426

(AB433280.1). The

remaining 15 isolates were homologous to L. (L.) mexicana, of which 14 were

up to 99, 8% and 1 was up to 99,7% identical to L. (L.) mexicana
MHOM/BZ/82/BEL21 (EF579906.1) reference sequence. Moreover, these
isolates were also respectively up to 100% and 99,8% identical to L. (L.)
mexicana Clone:-V3 (AB558229.1) reference sequence previously submitted by
Kato et al. (2011) from patients of the Lara state, Venezuela. This polymorphism
is depicted by one transition of GA at 6 position (See supplementary data A).
Global alignment and phylogenetic tree construction for ITS-1 region and Cyt-b
gene, group the subgenus L. (Viannia) and L. (Leishmania) in 2 major
monophyletic clades. In the L (Viannia) subgenus, the isolates are grouped in 2
minor subclades join to L. (V.) braziliensis and L. (V.) lainsoni. In the major clade
of subgenus L. (Leishmania), we confirm the grouping differences according to

ITS-1 region or Cyt-b gene since the 15 isolates are grouped join to L. (L.)
amazonensis and L. (L.) mexicana respectively (figure 4).
We focused the geographical distribution of the Leishmania species based on
the place of residence of the patients from who the parasites were isolated.
Most of patients (92.7%) had residence in 8 Provinces in the Sub-Andean and
Amazonian region of the Department of La Paz and, among them, more than
70% were from Inquisivi, Nor-Yungas and Sud-Yungas provinces. The rest
came from Vaca Dez and Chapare Provinces of the Beni and Cochabamba
Departments respectively; in addition we analysed one from Peru (Figure 5). L.
(V.) braziliensis is the most predominant specie in the Sub-Andean and
Amazonian region of the Department of La Paz as it is distributed in 7 of the 8
provinces with leishmaniasis patients. However, the majority of the L. (L.)
mexicana-amazonensis isolates (84%) came from Cajuata in Inquisive
Province. The rest of isolates characterized as L. (V.) lainsoni, were distributed
in 3 Provinces Nor-Yungas, Sud-Yungas and Muecas.
3.2. Assessment of susceptibility to antileishmanial drugs
3.2.1. Promastigote stage
Data obtained on the in-vitro drug susceptibility are expressed as mean IC 50
SD values for promastigotes of each Leishmania isolate to Glucantime,
Fungizone and miltefosine. The summarised data from three different
experiments and three replicates are shown in Table 3 and supplementary data
B.
Glucantime had no in vitro activity against promastigotes from all isolates (test
and reference strains) even at the highest concentration tested (200 g/mL).
However, Fungizone showed its best activity at low concentrations ranging
between 0.20 and 0.93 g/mL for all test and reference isolates; the IC 50 SD
values for reference isolates being 0.51 0.001 and 0.21 0.001 g/mL for L
(V.)

braziliensis

MHOM/BR/75/M2904

and

(V.)

braziliensis

MHOM/BR/75/M2903 respectively, 0.22 0.03 and 0.81 0.05 g/mL for L. (L.)
mexicana MNYC/BZ/62/M379 and L. (L.) amazonensis MHOM/79/BR/Maria
respectively, 0.23 0.03 g/mL for L. (V.) guyanensis 141/93 and 0.29 0.008

g/mL for L. (L.) infantum MCAN/ES/92/BCN83. Although no variation was

observed between isolates within each species however significant differences
were observed between isolates from L. (L.) mexicana-amazonensis and L. (L.)
mexicana MNYC/BZ/62/M379, and L. (L.) amazonensis MHOM/79/BR/Maria
reference strains (p-value 0.000 and 0.001 respectively), or between isolates
from L. (V.) braziliensis and L (V.) braziliensis MHOM/BR/75/M2904; L (V.)
braziliensis MHOM/BR/75/M2903 and L. (V.) guyanensis 141/93 (p-value 0.000,
0.000 and 0.000 respectively). By contrast, the susceptibility of the isolates of
different species to miltefosine was highly variable with mean IC 50 SD and
range values for L. (V.) braziliensis, L. (L.) mexicana-amazonensis and L. (V.)
lainsoni isolates of 18.0 4.55 [9.60 30.56] g/mL, 2.81 1.85 [0.86 6.25]
g/mL and 5.01 2.18 [3.13 7.71] g/mL respectively. The IC50 values for L.
(V.) braziliensis were significantly different from those of L. (L.) mexicanaamazonensis and L. (V.) lainsoni (p-value 0.000 and 0.001, respectively). L. (V.)
braziliensis isolates were significantly different from all references strains used
in this study (p-value 0.000), and L. (L.) mexicana-amazonensis differed from L.
(L.)

mexicana

MNYC/BZ/62/M379,

and

L.

(L.)

amazonensis

MHOM/79/BR/Maria (p-value 0.028 and 0.000 respectively). Great variation

was also recorded for L (V.) braziliensis MHOM/BR/75/M2904 and L. (L.)
mexicana MNYC/BZ/62/M379 reference strains with mean IC 50 SD values
varying from 15.47 0.99 to 0.83 0.027 (see table 3).
3.2.2. Intracellular amastigote stage
The activity of Glucantime, Fungizone and miltefosine was evaluated in-vitro
against the intracellular amastigote stage of Leishmania test and references
isolates on the J774 macrophages infection model as described in Mat & Meth
section. Previously, the 90% tolerance to cytotoxic activity was determined for
each tested drug (data not shown). Five L. (V.) braziliensis isolates were
excluded because the infection levels reached were not suitable for drug
susceptibility test. The mean IC 50 SD values for each isolate and reference
strains were summarized in Table 3 and supplementary data B.
In contrast to promastigote stage, Glucantime showed moderate-low activity on
the intracellular amastigote stage of both test isolates and reference strains.

The mean of IC50 SD and range values for L. (V.) braziliensis isolates were
50.84 27.09 g/mL [2.15 85.55], excepting nine of them that went over 100
g/mL,

compared

to

47.58

5.3

g/mL

for

L.

(V.)

braziliensis

MHOM/BR/75/M2904 and 39.18 2.27 g/mL for L. (V.) braziliensis

MHOM/BR/75/M2903 reference strains. Another group composed by L. (L.)
mexicana-amazonensis test isolates showed mean IC50 SD values of 33.68
32.99 g/mL compared to 18.23 3.84 g/mL for L. (L.) mexicana
MNYC/BZ/62/M379 and 31.08 2.63 g/mL for L. (L.) amazonensis
MHOM/79/BR/Maria reference strain. None of L. (V.) lainsoni isolates was
susceptible to Glucantime at 100 g/mL. The IC50 SD for L. (V.) guyanensis
141/93 and L. (L.) infantum MCAN/ES/92/BCN83 reference strain were 4.25
0.56 and 45.51 3.52 g/mL, respectively. Statistical analysis did not show
significant difference between L. (V.) braziliensis and L. (L.) mexicanaamazonensis isolates (p-value 0.946) but it did between L. (V.) braziliensis and
L. (V.) guyanensis as well as L. (L.) mexicana reference strains (p-value 0.000
and 0.001 respectively).
Against Fungizone the IC50 values on intracellular amastigote stages were
more variable among species than the promastigote stage. The mean IC 50 SD
and range values for L. (V.) braziliensis were 0.32 0.28 g/mL [0.04 1.03]
and 0.05 0.01 g/mL and 0.04 0.006 g/mL for L. (V.) braziliensis
MHOM/BR/75/M2904 and L. (V.) braziliensis MHOM/BR/75/M2903 reference
strain, respectively. For L. (L.) mexicana-amazonensis IC50 SD and range
value were 1.18 1.10 g/mL [0.04 3.42] compared to 0.04 0.01 g/mL for
L. (L.) mexicana and 2.33 0.09 g/mL for L. (L.) amazonensis reference
strains. Mean and range values for L. (V.) lainsoni isolates were 0.5 0.16
g/mL [0.36 0.67]. For L. (V.) guyanensis and L. (L.) infantum reference
strains the IC50 SD were 1.66 0.19 g/mL and 0.007 0.002 g/mL,
respectively. The susceptibility of L. (V.) braziliensis isolates to Fungizone was
significantly different from that of all reference strains (p-value ranging from
0.000 0.016), as it was that of L. (L.) mexicana-amazonensis isolates in
comparison to L. (L.) mexicana and L. (L.) amazonensis reference strains (pvalue 0.032 and 0.031 respectively). Also the isolates of L. (V.) lainsoni were

significantly less susceptible to Fungizone than those of L. (L.) amazonensis

and L. (L.) infantum (p-value 0.000 and 0.015 respectively).
For L. (V.) braziliensis the effectivity of miltefosine against intracellular
amastigotes was similar to that recorded on promastigotes, with IC 50 SD of
17.85 8.94 g/mL for test isolates as compared to 39.95 1.36 g/mL and
8.15 1.02 g/mL, L. (V.) braziliensis MHOM/BR/75/M2904 and L. (V.)
braziliensis

MHOM/BR/75/M2903

reference

strains,

respectively.

The

susceptibility of amastigotes of L. (L.) mexicana-amazonensis was lower than

that of promastigotes with mean values of 8.24 5.88 g/mL, compared to 0.96
0.14 g/mL for L. (L.) mexicana and 6.74 0.27 g/mL for L. (L.)
amazonensis reference strains. Mean IC50 SD values for L. (V.) lainsoni
isolates were 23.28 6.08 g/mL whereas for L. (V.) guyanensis and L. (L.)
infantum reference strain they fell down to 3.32 1.67 g/mL and 8.31 0.57
g/mL, respectively. Significant differences were observed between L. (V.)
braziliensis and L. (L.) mexicana-amazonensis isolates (p-value 0.003).
Likewise L. (V.) braziliensis isolates significantly differed from all reference
strains (p-values ranging from 0.000 to 0.042). By contrast L. (L.) mexicanaamazonensis isolates only significantly differed from L. (L.) mexicana reference
strain (p-value 0.009).

Discussion
Currently a large branch of molecular strategies devoted towards the
characterization of the Leishmania genus is available with enough highly
sensitivity to determine intraspecific polymorphisms. MLEE continues being the
golden standard despite it has several drawbacks such as the need to cultivate
the parasite, lack of discriminatory power and difficulties in comparing data
between laboratories (Botilde et al., 2006; Zhang et al., 2013). Furthermore, by
applying molecular methods it has been demonstrated that the different

isoenzymatic profiles obtained by MLEE can be due to the presence of multiple

heterozygotes or variation in a particular nucleotide position (Jamjoom et al.,
2004) and not simply to nucleotide diversity of a gene (Mauricio et al., 2006;
Zemanov et al., 2007). On the other hand, different genotypes could render
indistinguishable isoenzyme profiles which at the same time can exhibit distinct
zymodemes (Mauricio et al., 2006). These disadvantages have restated their
use and replacement by new molecular methods for the reorganization of the
taxonomy of Leishmania (Fraga et al., 2010; Schnian et al., 2010). In this
work, we obtained partial sequences of Cyt-b, ITS-1 and HSP70 genes and its
reaction profiles by PCR-RFLP. The combination of these three approaches has
allowed us to characterize 3 taxonomic entities in the species of Leishmania: L.
(V.) braziliensis, L. (V.) lainsoni and L. (L.) mexicana-amazonensis, circulating in
the highest endemic area of Bolivia.
In Bolivia, the first epidemiological study on leishmaniosis was performed in the
decade of the 1970's by using serological methods (Desjeux et al., 1973). Later
on the circulating species were identified, being L. (V.) braziliensis the causative
agent in the Sub-Andean region of the Department of La Paz (Walton et al.,
1973; Le Pont and Desjeux, 1985, 1986; Desjeux et al., 1987). In the 80s only
isolated cases of visceral leishmaniosis have been documented (Desjeux et al.,
1983; Le Pont and Desjeux, 1985) and the species involved were typified as L.
(L.) chagasi/infantum (Dimier-David et al., 1991; Martinez et al., 2002): By the
end of the 90s L. (L.) amazonensis was reported as the most prevalent species
in the community of Cajuata, in Inquisivi province (Martinez et al., 1998) and at
the beginning of the 2000s the presence of L. (V.) lainsoni has been reported
(Martinez et al., 2001).
The PCR-RFLP analysis of part region of the HSP70 gene following digestion
with the enzyme HaeIII carried out on Bolivians isolates of Leishmania served 3
clearly differentiated patterns which, in comparison with the bands of reference
strains, correspond to the L. (L.) mexicana, L. (V.) braziliensis and L. (V.)
lainsoni complexes. These profiles are consistent with those obtained by other
authors, who, by means of capillary electrophoresis of the products digested
with the PCR-RFLP of the HSP70 HaeIII enzyme identified L. (V.) braziliensis
and L. (V.) lainsoni in clinical samples of Bolivians patients from the Isiboro

Secure Park of the Department of Cochabamba (Garcia et al., 2004). Previous

studies on this highly conserved region of the genome of Leishmania, have
confirmed its usefulness for the species differentiation (Arora et al., 1998;
Quijada et al., 1997).
Restriction fragment profiles of the ITS-1 region of the Bolivian isolates of
Leishmania showed 2 clear patterns: some are identical to the reference strains
of L. (L.) amazonensis whereas others match with the species of the subgenus
L. (Viannia). These results agree with those already published by Schnian and
coworkers (2003). In addition the sequencing of the ITS-1 region has allowed us
to group the isolates next to the monophyletic clades of L. (V.) braziliensis, L.
(V.) lainsoni and L. (L.) amazonensis-mexicana. In phylogenetic studies of
Leishmania, the sequencing of the ITS-1 and ITS-2 regions have proved to be
very useful for the identification and reconstruction of the relationships between
species (Schnian et al., 2011). Therefore, some studies have been conducted
to construct phylogenetic relationships among the species of the subgenus L.
(Leishmania) (Dvila and Momen, 2000; Kuhls et al., 2005). Likewise, another
study indicated that the sequencing of the ITS-1 region, confirms its ability to
discriminate among species of the subgenus L. (Leishmania), resulting that L.
(l.) amazonensis and L (L.) mexicana may form a single and quite robust clade
(Yang et al., 2010), similar to the findings reported in this study.
On the other hand, the sequences of the Cyt-b gene are highly conserved and
this is the reason why they are widely used in phylogenetic studies since they
are not subject to a selective pressure on the accumulation of polymorphisms
(Meyer, 1994; Conway et al., 2000; Serizawa et al., 2000). Previous studies
have shown that the sequences of Cyt-b of Leishmania are sufficient to
characterize species in this genus (Luyo-Acero et al., 2004; Asato et al., 2009).
The single nucleotide polymorphisms identified in the isolates characterized as
L. (V.) braziliensis were identical to those previously described in the sequences
of reference strains L. (V.) braziliensis MHOM/EC/88/INH-03 (AB095967.1)
(Luyo-Acero et al., 2004) and L. (V.) braziliensis MHOM/BR/75/M2903
(AB344682.1) (Asato et al., 2009). Other works based on MLEE, carried out on
isolated from the Sub-Andean region of the Department of La Paz, identified L.
(V.) braziliensis as the predominant species (Desjeux et al., 1987). Similarly,

another study in the Department of Pando also confirmed L. (V.) braziliensis as

major circulating species in this region (Torres Espejo et al., 1989). Besides, 4
isolates carrying single mutations in 4 polymorphic sites were 99.3% identical to
the L. (V.) lainsoni monophyletic clade represented by the reference strain
MHOM/BR/81/M6426, previously isolated and characterized by MLEE (Silveira
et al., 1987; Kato et al., 2011).
Surprisingly, 15 isolates that, using the PCR-RFLP of the ITS-1 outlined
patterns identical to L. (L.) amazonensis MHOM/79/BR/Maria, grouped in a third
monophyletic clade next to the reference isolate L. (L.) amazonensis
MHOM/79/BR/Maria and L. (L.) mexicana MNYC/BZ62/M379. In contrast, the
profile banding of Cyt-b from these 15 isolates after digestion with the enzyme
AseI

quite

diverged

from

that

generated

for

L.

(L.)

amazonensis

MHOM/79/BR/Maria and the identity of these 15 sequences with those of the

reference strains L. (L.) amazonensis MHOM/BR/73/M2269 (AB095964 and
EF579902) previously described (Luyo-Acero et al., 2004; Foulet et al., 2007)
only reached 97.4% and 97.2% respectively. Despite the low level of divergence
between L. (L.) mexicana and L. (L.) amazonensis, sequencing and PCR-RFLP
of Cyt-b gene show notorious differences between these two species. However,
we must consider that these 15 Bolivian isolates named L. (L.) mexicanaamazonensis in this study could constitute a local variant of the region. It must
be noticed that previous studies by MLEE analysis, already identified
divergences of Bolivians isolated with L. (L.) amazonensis and L. (L.) mexicana.
Thus, in the community of Cajuata of Inquisivi province (Department of La Paz),
L. (L.) amazonensis was identified as the causal agent of leishmaniosis in that
area. However, their identity was only 69% with L. (L.) amazonensis
IFLA/BR/67/PH8 and 30% with L. (L.) mexicana/pifanoi MNYC/BZ/62/M379 and
MHOM/VE/57/LV135 reference strains (Martinez et al., 1998). Furthermore,
divergence in at least one locus was depicted (Buitrago et al., 2011).
From the genetic study carried out on a collection on isolates of Leishmania
circulating in highly endemic areas of leishmaniosis in Bolivia based on the
assessment of polymorphisms of ITS-1, cyt-b and HSP-70 molecular markers it
can be concluded that a marked degree of variation is present within and
among the canonical species of the monophyletic clades L. (L.) mexicana

versus L.(L.) amazonensis and L. (V.) braziliensis versus L.(V.) lainsoni.

Therefore and from an applied point of view it is worthy to check in vitro how
this genetic variability could affect the speciess sensitivity to the drugs
commonly used to treat leishmaniosis in these highly endemic regions.
In Bolivia, the pentavalent antimonials (commercial and generic) are first choice
in the treatment of cutaneous, mucocutaneous and visceral leishmaniosis.
While there is no reference data of resistance or susceptibility to these drugs, in
1987, a clinical study reported that Glucantime treatment was effective only in
88% of patients suffering from any of the different forms of de disease in the
Department of La Paz (Desjeux et al., 1987). Another controlled trial in patients
with leishmaniosis from the National Park "Isiboro Scure" of the Department of
Cochabamba, determined that the cure rate reached 94% in the localized
cutaneous and 73% in mucocutaneous leishmaniosis after treatment with
generic sodium stibogluconate (Bermudez et al., 2006). On the other hand, the
results of a broad operation campaign in the Department of Cochabamba,
determined that the effectiveness of the treatment with pentavalent antimonials
achieved a cure rate between 75% and 94% of patients with localized
cutaneous leishmaniosis (Garca et al., 2009). In our study promastigotes
appeared totally refractory to Glucantime and this can be attributed to low or
lack of activity of the SbV versus SbIII after bioconversion by host macrophages
(Goodwin, 1995) or to the presence of some kind of resistance by some
American cutaneous species to antimonial drugs as assessed by Rojas et al.
(2006). For the Leishmania (Viannia) subgenus. Intracellular amastigotes did
show in vitro sensitivity to Glucantime although at quite different level among
species, thus, L(V) guyanensis was the most susceptible whereas L.(V.)
lainsoni, the least. Among the subgenus Leishmania, L. (L.) mexicana was more
susceptible than L. (L.) amazonensis and L.( L.) mexicana-amazonensis.
Various reasons may account for this marked difference among species and
among others, the supposedly environmental pressure caused by a sustained
under-dose treatment with the drug that may trigger over-expression of certain
genes related to thiol metabolism leading to the out-come of resistance against
antimonials as already observed in dogs for L. (L.) infantum (Gmez-Prez et
al., 2016).

In Bolivia, Fungizone is the second choice in the therapy of chronic

leishmaniosis in patients with therapeutic failure against pentavalent antimonials
and, although cases of resistance are unknown, therapeutic failures to
Fungizone are reported. Thus in a random assay on 10 hospitalized patients
with mucocutaneus leishmaniosis, the cure rate was 90% with only one case
relapse (Valda Rodriguez et al., 1995). However in another clinical trial also
carried on mucocutaneous patients the cure rate reached only 50% (Soto et al.,
2007). In our study intracellular amastigotes of L. (V.) braziliensis were more
susceptible than promastigote, except the INL-414-10 isolated strains whose
IC50 was 3 times higher. As for L. (L.) amazonensis, in the majority of L. (L,)
mexicana-amazonensis isolates promastigotes were more susceptible than
intracellular amastigotes, whereas the contrary occurred in L. (L.) mexicana
reference strain. There are few studies on the mechanism of resistance to
Amphotericin B. In resistant L. (L.) donovani isolates, alterations of membrane
sterols by dysfunctional expression of SCMT (S-adenosyl-L-methionine: C-24-sterol methyltransferase) genes have been described. However, a small
amount of amphotericin B can be captured by the parasite and another can be
excreted through the overexpression of MDR1 membrane proteins whereas the
intracellular AmB remnant would activate the ROS, but this effect could be
controlled by the cascade of the triparedoxin of the thiol metabolism (Purkait et
al., 2012).
Concerning miltefosine despite its approval for therapeutic use in Bolivia only
few clinical trials with patients suffering cutaneous and mucutaneous
leishmaniosis have been reported with cure rates varying between 58% and
91% (Soto et al., 2007, 2008, 2009). In our study promastigotes from L. (L.)
mexicana-amazonensis and L. (V.) lainsoni were more susceptible to
miltefosine than the intracellular amastigotes. Likewise, promastigotes of L. (L.)
mexicana-amazonensis and L. (V.) lainsoni were more susceptible than
promastigotes and amastigotes of L. (V.) braziliensis where both were equally
sensitive. In the search for a reason for the low sensitivity of L. (V.)braziliensis
to

miltefonsine

some

studies

point

towards

the

over-expression

of

LbMT/LbROS3 or ABCA3 membrane transporting proteins carrying the drug

outside the parasite (Snchez-Caete et al., 2009; Obonaga et al., 2013). The

susceptibility of L. (L.) mexicana-amazonensis isolates to miltefosine was

similar to that of L. (L.) mexicana and different from that of L. (L.) amazonensis
reference strains. Other authors reported similar variability results between
species and isolated. Thus Ganguly et al. (2006) concluded that the IC 50 for
promastigotes of L. (L.) amazonensis (MORY/BR/72/M184) and L. (L.)
mexicana (LV4) reference strains was 4.99 and 11.21 g/mL, respectively.
Moreover, Escobar et al. (2002) estimated the IC 50 of the reference strain L. (L.)
mexicana (MHOM/BZ/82/BEL21) ranging between 0.97 to 5.18 g/mL on
promastigote and 2.78 to 4.12 g/mL on the amastigote stage. Instead, a study
on Leishmania isolates from Peru, found that susceptibility to miltefosine of
intracellular amastigotes of the L. (L.) mexicana 068 isolate was above 30
g/mL (Yardley et al., 2005). The in vitro high sensitivity to miltefosine of
Bolivian isolates of L. (L.) mexicana could be an indicator of effectiveness in the
treatment of leishmaniosis with miltefosine due to infection by parasites of this
complex. Thus, in vivo studies in the mouse model, found that miltefosine is
able to eradicate the infection in BALB/c mice infected with L. amazonensis
(WHOM/BR/75/Josefa) isolate, when treated at doses of 20, 30, 40 and 50
mg/kg for 21 days (Godinho et al., 2012). By contrast, in another study also
carried out in BALB/c mice infected with L. (L.) mexicana, the parasitological
cure was only achieved in 60% of mice treated with 20 mg/kg for 21 days
(Serrano-Martn et al., 2009). On the other hand, the great variability in
susceptibility to miltefosinee of isolates characterized as L. (V.) braziliensis,
could be an indicator of resistance.
In summary, the results from this study confirm the intrinsic variations in
susceptibility to conventional treatments between circulating species in the
region. Although some authors consider that the in vitro susceptibility is not
decisive in determining resistance (Yardley et al., 2005), other studies identified
the correlation between low in vitro susceptibility and therapeutic failure or
resistance to treatment (Bhandari et al., 2012; Fernandez et al., 2012).
Regardless the intrinsic mechanisms that support sensitivity of Bolivian
Leishmania species to different drugs the results from our work unveil a
complex mosaic of species composition whit the presence of intraspecific

polimorphisms for canonical genes such as Cyt-b in the most prevalent L. (V.)
brasiliensis and L. (L.) mexicana species of high taxonomical value.
Unraveling these variations and its extension is of special values for the control
of leishmaniosis in this and neighboring countries not only from an epidemiology
point of view but also towards the right design and application of protocols for
an effective and safe treatment of the suffering patients.
Acknowledgments
We are grateful to the National Institute Laboratory of Health (INLASA) of La
Paz (Bolivia) for the donation of 55 Leishmania Bolivian isolates and to Drs. M.
Ports Vinyeta (Universidad de Barcelona), Dr. A. Torrao and Dr. M.
Domnguez (Instituto Carlos III, Madrid), Dr. Cesar Ramrez (Universidad
Javeriana, Colombia) and Dr. Lilian Ypez-Mulia (Centro Mdico Nacional Siglo
XXI, Instituto Mexicano del Seguro Social, Ciudad de Mxico, Mexico) for
providing reference strains. This study was supported by the Spanish Agency of
International Cooperation for Development (AECID) through projects Ns
A/024457/09, A/024457/09 and AP/039767/11.P.E.B.R. was a recipient of a PreDoctoral fellowship from AECID.

Uncategorized References
Alcais, A., Abel, L., David, C., Torrez, M.E., Flandre, P., Dedet, J.P., 1997. Risk factors
for onset of cutaneous and mucocutaneous leishmaniasis in Bolivia. Am J Trop Med
Hyg. 57, 79-84.
Arora, S., Kapoor, G., Sehgal, S., 1998. Heterogeneity in heat shock protein genes in
Leishmania isolates. Immunol cell biol. 76, 186-189.
Asato, Y., Oshiro, M., Myint, C.K., Yamamoto, Y., Kato, H., Marco, J.D., Mimori, T.,
Gomez, E.A., Hashiguchi, Y., Uezato, H., 2009. Phylogenic analysis of the genus
Leishmania by cytochrome b gene sequencing. Exp parasitol. 121, 352-361.
Bauls, A.L., Dujardin, J.C., Guerrini, F., Doncker, S., Jacquet, D., Arevalo, J., Nol, S.,
Ray, D., Tibayrenc, M., 2000. Is Leishmania (Viannia) peruviana a distinct species? A
MLEE/RAPD evolutionary genetics answer. J Eukaryot Microbiol. 47, 197-207.
Bermudez, H., Rojas, E., Garcia, L., Desjeux, P., Dujardin, J.-C., Boelaert, M.,
Chappuis, F., 2006. Generic sodium stibogluconate is as safe and effective as branded
meglumine antimoniate, for the treatment of tegumentary leishmaniasis in Isiboro
Secure Park, Bolivia. Ann Trop Med Parasitol. 100, 591-600.

Berzunza-Cruz, M., Bricaire, G., Salaiza Suazo, N., Perez-Montfort, R., Becker, I.,
2009. PCR for identification of species causing American cutaneous leishmaniasis.
Parasitol Res. 104, 691-699.
Bhandari, V., Kulshrestha, A., Deep, D.K., Stark, O., Prajapati, V.K., Ramesh, V.,
Sundar, S., Schonian, G., Dujardin, J.C., Salotra, P., 2012. Drug susceptibility in
Leishmania isolates following miltefosine treatment in cases of visceral leishmaniasis
and post kala-azar dermal leishmaniasis. PLoS Negl Trop Dis. 6, e1657.
Bilbao-Ramos, P., Sifontes-Rodrguez, S., Dea-Ayuela, M.A., Bols-Fernndez, F.,
2012. A fluorometric method for evaluation of pharmacological activity against
intracellular Leishmania amastigotes. J Microbiol Methods. 89, 8-11.
Boite, M.C., Mauricio, I.L., Miles, M.A., Cupolillo, E., 2012. New insights on
taxonomy, phylogeny and population genetics of Leishmania (Viannia) parasites based
on multilocus sequence analysis. PLoS Negl Trop Dis. 6, e1888.
Botilde, Y., Laurent, T., Quispe Tintaya, W., Chicharro, C., Canavate, C., Cruz, I.,
Kuhls, K., Schonian, G., Dujardin, J.C., 2006. Comparison of molecular markers for
strain typing of Leishmania infantum. Infect Genet Evol. 6, 440-446.
Buitrago, R., Cupolillo, E., Bastrenta, B., Le Pont, F., Martinez, E., Barnab, C.,
Brenire, S.F., 2011. PCR-RFLP of ribosomal internal transcribed spacers highlights
inter and intra-species variation among Leishmania strains native to La Paz, Bolivia.
Infect Genet Evol.11, 557-563.
Conway, D.J., Fanello, C., Lloyd, J.M., Al-Joubori, B.M.A.S., Baloch, A.H., Somanath,
S.D., Roper, C., Oduola, A.M.J., Mulder, B., Povoa, M.M., Singh, B., Thomas, A.W.,
2000. Origin of Plasmodium falciparum malaria is traced by mitochondrial DNA. Mol
Biochem Parasitol. 111, 163-171.
Cupolillo, E., Grimaldi Jr, G., Momen, H., 1994. A general classification of New World
Leishmania using numerical zymotaxonomy. Am J Trop Med Hyg. 50, 296-311.
Cupolillo, E., Grimaldi Junior, G., Momen, H., Beverley, S.M., 1995. Intergenic region
typing (IRT): a rapid molecular approach to the characterization and evolution of
Leishmania. Mol Biochem Parasitol.73, 145-155.
David, C., Dimier-David, L., Vargas, F., Torrez, M., Dedet, J.P., 1993. Fifteen years of
cutaneous and mucocutaneous leishmaniasis in Bolivia: a retrospective study. Trans R
Soc Trop Med Hyg. 87, 7-9.
David, C.V., Craft, N., 2009. Cutaneous and mucocutaneous leishmaniasis. Dermatol
Ther. 22, 491-502.
Dvila, A., Momen, H., 2000. Internal-transcribed-spacer (ITS) sequences used to
explore phylogenetic relationships within Leishmania. Ann Trop Med Parasitol. 94,
651-654.
de Almeida, M.E., Steurer, F.J., Koru, O., Herwaldt, B.L., Pieniazek, N.J., da Silva, A.J.,
2011. Identification of Leishmania spp. by molecular amplification and DNA

sequencing analysis of a fragment of rRNA internal transcribed spacer 2. J Clin

Microbiol. 49, 3143-3149.
Dea-Ayuela, M.A., Castillo, E., Gonzalez-Alvarez, M., Vega, C., Rolon, M., BolasFernandez, F., Borras, J., Gonzalez-Rosende, M.E., 2009. In vivo and in vitro antileishmanial activities of 4-nitro-N-pyrimidin- and N-pyrazin-2-ylbenzenesulfonamides,
and N2-(4-nitrophenyl)-N1-propylglycinamide. Bioorg Med Chem. 17, 7449-7456.
Desjeux, P., 2004. Leishmaniasis: current situation and new perspectives. Comp
Immunol Microbiol Infect Dis. 27, 305-318.
Desjeux, P., Aranda, E., Aliaga, O., Mollinedo, S., 1983. Human visceral leishmaniasis
in Bolivia: first proven autochthonous case from 'Los Yungas'. Trans R Soc Trop Med
Hyg. 77, 851-852.
Desjeux, P., Mollinedo, S., Le Pont, F., Paredes, A., Ugarte, G., 1987. Cutaneous
leishmaniasis in Bolivia. A study of 185 human cases from Alto Beni (La Paz
Department). Isolation and isoenzyme characterization of 26 strains of Leishmania
brasiliensis brasiliensis. Trans R Soc Trop Med Hyg. 81, 742-746.
Desjeux, P., Quilici, M., Lapierre, J., 1973. [On 113 cases of cutaneous leishmaniasis
and mucocutaneous leishmaniasis observed in Bolivia. Sero-immunologic study of 71
cases]. Bull Soc Pathol Exot Filiales 67, 387-395.
Dimier-David, L., Inofuentes, A., Carrasco, M., David, C., Vargas, F., Revollo, S.,
Dedet, J., 1991. [A new case of autochthonous visceral leishmaniasis in Bolivia], Ann
Soc Belg Med Trop. 275-278.
El Tai, N., Osman, O., El Fari, M., Presber, W., Schnian, G., 2000. Genetic
heterogeneity of ribosomal internal transcribed spacer in clinical samples of Leishmania
donovani spotted on filter paper as revealed by single-strand conformation
polymorphisms and sequencing. Trans R Soc Trop Med Hyg. 94, 575-579.
Escalante, A.A., Freeland, D.E., Collins, W.E., Lal, A.A., 1998. The evolution of
primate malaria parasites based on the gene encoding cytochrome b from the linear
mitochondrial genome. Proc Natl Acad Sci U S A. 95, 8124-8129.
Escobar, P., Matu, S., Marques, C., Croft, S.L., 2002. Sensitivities of Leishmania
species to hexadecylphosphocholine (miltefosine), ET-18-OCH3 (edelfosine) and
amphotericin B. Acta Trop. 81, 151-157.
Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the
bootstrap. Evolution. 783-791.
Fernandez, O., Diaz-Toro, Y., Valderrama, L., Ovalle, C., Valderrama, M., Castillo, H.,
Perez, M., Saravia, N.G., 2012. Novel approach to in vitro drug susceptibility
assessment of clinical strains of Leishmania spp. J Clin Microbiol. 50, 2207-2211.
Foulet, F., Botterel, F., Buffet, P., Morizot, G., Rivollet, D., Deniau, M., Pratlong, F.,
Costa, J.-M., Bretagne, S., 2007. Detection and identification of Leishmania species
from clinical specimens by using a real-time PCR assay and sequencing of the
cytochrome B gene. J Clin Microbiol. 45, 2110-2115.

Fraga, J., Montalvo, A.M., De Doncker, S., Dujardin, J.-C., Van der Auwera, G., 2010.
Phylogeny of Leishmania species based on the heat-shock protein 70 gene. Infect Genet
Evol. 10, 238-245.
Ganguly, S., Bandyopadhyay, S., Sarkar, A., Chatterjee, M., 2006. Development of a
semi-automated colorimetric assay for screening anti-leishmanial agents. J Microbiol
Methods 66, 79-86.
Garca, A.L., Parrado, R., Rojas, E., Delgado, R., Dujardin, J.-C., Reithinger, R., 2009.
Leishmaniases in Bolivia: comprehensive review and current status. Am J Trop Med
Hyg. 80, 704-711.
Garcia, L., Kindt, A., Bermudez, H., Llanos-Cuentas, A., De Doncker, S., Arevalo, J.,
Tintaya, K.W.Q., Dujardin, J.-C., 2004. Culture-independent species typing of
neotropical Leishmania for clinical validation of a PCR-based assay targeting heat
shock protein 70 genes. J Clin Microbiol 42, 2294-2297.
Garcia, L., Ortiz, S., Osorio, G., Torrico, M.C., Torrico, F., Solari, A., 2012.
Phylogenetic analysis of Bolivian bat trypanosomes of the subgenus schizotrypanum
based on cytochrome B sequence and minicircle analyses. PloS one 7, e36578.
Godinho, J.L., Simas-Rodrigues, C., Silva, R., Urmenyi, T.P., de Souza, W., Rodrigues,
J.C., 2012. Efficacy of miltefosine treatment in Leishmania amazonensis-infected
BALB/c mice. Int J Antimicrob Agents. 39, 326-331.
Gmez-Prez, V., Hernandez-Garcia, R., Lpez Corpas, V., Toms, A.M., SanchezMartin, J., Castanys, S., Gamarro, F., 2016. Decreased antimony uptake and
overexpression of genes of thiol metabolism are associated with drug resistance in a
canine isolate of Leishmania infantum. Int J Parasitol Drugs Drug Resist. 2, 133-139.
Goodwin, L., 1995. Pentostam (sodium stibogluconate); a 50-year personal
reminiscence. Trans R Soc Trop Med Hyg. 89, 339-341.
Hall, T., 2007. BioEdit v7 http://www. mbio. ncsu. edu/BioEdit. BioEdit. html.
Harris, E., Kropp, G., Belli, A., Rodriguez, B., Agabian, N., 1998. Single-step multiplex
PCR assay for characterization of New World Leishmania complexes. J Clin Microbiol.
36, 1989-1995.
Jamjoom, M., Ashford, R., Bates, P., Chance, M., Kemp, S., Watts, P., Noyes, H., 2004.
Leishmania donovani is the only cause of visceral leishmaniasis in East Africa; previous
descriptions of L. infantum and L. archibaldi from this region are a consequence of
convergent evolution in the isoenzyme data. Parasitol. 129, 399-409.
Jara, M., Adaui, V., Valencia, B.M., Martinez, D., Alba, M., Castrillon, C., Cruz, M.,
Cruz, I., Van der Auwera, G., Llanos-Cuentas, A., 2013. Real-Time PCR Assay for
Detection and Quantification of Leishmania (Viannia) Organisms in Skin and Mucosal
Lesions: Exploratory Study of Parasite Load and Clinical Parameters. J Clin Microbiol.
51, 1826-1833.

Kato, H., Watanabe, J., Nieto, I.M., Korenaga, M., Hashiguchi, Y., 2011. Leishmania
species identification using FTA card sampling directly from patients' cutaneous lesions
in the state of Lara, Venezuela. Trans R Soc Trop Med Hyg 105, 561-567.
Kimura, M., 1980. A simple method for estimating evolutionary rates of base
substitutions through comparative studies of nucleotide sequences. J Mol Evol. 16, 111120.
Kuhls, K., Alam, M.Z., Cupolillo, E., Ferreira, G.E.M., Mauricio, I.L., Oddone, R.,
Feliciangeli, M.D., Wirth, T., Miles, M.A., Schnian, G., 2011. Comparative
microsatellite typing of New World Leishmania infantum reveals low heterogeneity
among populations and its recent Old World origin. PLoS Negl Trop Dis. 5, e1155.
Kuhls, K., Keilonat, L., Ochsenreither, S., Schaar, M., Schweynoch, C., Presber, W.,
Schnian, G., 2007. Multilocus microsatellite typing (MLMT) reveals genetically
isolated populations between and within the main endemic regions of visceral
leishmaniasis. Microbes Infec. 9, 334-343.
Kuhls, K., Mauricio, I.L., Pratlong, F., Presber, W., Schonian, G., 2005. Analysis of
ribosomal DNA internal transcribed spacer sequences of the Leishmania donovani
complex. Microbes Infec. 7, 1224-1234.
Le Pont, F., Desjeux, P., 1985. Leishmaniasis in Bolivia. I. Lutzomyia longipalpis (Lutz
& Neiva, 1912) as the vector of visceral leishmaniasis in Los Yungas. Trans R Soc Trop
Med Hyg. 79, 227-231.
Le Pont, F., Desjeux, P., 1986. Leishmaniasis in Bolivia. II. The involvement of
Psychodopygus yucumensis and Psychodopygus llanosmartinsi in the selvatic
transmission cycle of Leishmania braziliensis braziliensis in a lowland subandean
region. Mem Inst Oswaldo Cruz. 81, 311-318.
LeishEpiNetSA, 2009. Manual Molecular Procedures. Training course Molecular
Epidemiology Leishmaniasis. Instituto Oswaldo Cruz, Rio de Janeiro, Brazil.
PNVCL (Programa Nacional de Vigilancia y Control de la Leishmaniasis), 2011.
Situacin Epidemiolgica de la Leishmaniasis, in: investigacin, D.d. (Ed.), Memoria
2011. PNVCL. Ministerio de Salud y Deportes del Estado plurinacional de Boliva,
Bolivia, p. 6.
Luyo-Acero, G., Uezato, H., Oshiro, M., Takei, K., Kariya, K., Katakura, K., GomezLandires, E., Hashiguchi, Y., Nonaka, S., 2004. Sequence variation of the cytochrome b
gene of various human infecting members of the genus Leishmania and their phylogeny.
Parasitol. 128, 483-491.
Marfurt, J., Nasereddin, A., Niederwieser, I., Jaffe, C.L., Beck, H.-P., Felger, I., 2003.
Identification and differentiation of Leishmania species in clinical samples by PCR
amplification of the miniexon sequence and subsequent restriction fragment length
polymorphism analysis. J Clin Microbiol. 41, 3147-3153.
Martinez, E., Alonso, V., Quispe, A., Thomas, M.C., Alonso, R., Pinero, J.E., Gonzalez,
A.C., Ortega, A., Valladares, B., 2003. RAPD method useful for distinguishing

Leishmania species: design of specific primers for L. braziliensis. Parasitol. 127, 513517.
Martinez, E., Le Pont, F., Torrez, M., Tellera, J., Vargas, F., Muoz, M., De Doncker,
S., Dujardin, J., Dujardin, J., 1998. A new focus of cutaneous leishmaniasis due to
Leishmania amazonensis in a Sub Andean region of Bolivia. Acta Trop. 71, 97-106.
Martinez, E., Mollinedo, S., Torrez, M., Munoz, M., Banuls, A.L., Le Pont, F., 2002.
Co-infection by Leishmania amazonensis and L. infantum/L. chagasi in a case of diffuse
cutaneous leishmaniasis in Bolivia. Trans R Soc Trop Med Hyg. 96, 529-532.
Martinez, E., Pont, F.L., Mollinedo, S., Cupolillo, E., 2001. A first case of cutaneous
leishmaniasis due to Leishmania (Viannia) lainsoni in Bolivia. Trans R Soc Trop Med
Hyg. 95, 375-377.
Mauricio, I.L., Yeo, M., Baghaei, M., Doto, D., Pratlong, F., Zemanova, E., Dedet, J.P.,
Lukes, J., Miles, M.A., 2006. Towards multilocus sequence typing of the Leishmania
donovani complex: resolving genotypes and haplotypes for five polymorphic metabolic
enzymes (ASAT, GPI, NH1, NH2, PGD). Int J Parasitol. 36, 757-769.
McCarthy, C., 1998. Chromas 1.45. School of Health Science, Griffith University,
Southport, Queensland, Australia.
Meyer, A., 1994. Shortcomings of the cytochrome b gene as a molecular marker. Trends
Ecol Evol. 9, 278-280.
Montalvo, A.M., Fraga, J., Monzote, L., Montano, I., De Doncker, S., Dujardin, J.C.,
Van der Auwera, G., 2010. Heat-shock protein 70 PCR-RFLP: a universal simple tool
for Leishmania species discrimination in the New and Old World. Parasitol. 137, 11591168.
Nei, M., Kumar, S., 2000. Molecular evolution and phylogenetics. Oxford university
press.
Obonaga, R., Fernndez, O.L., Valderrama, L., Rubiano, L.C., del Mar Castro, M.,
Barrera, M.C., Gomez, M.A., Saravia, N.G., 2013. Treatment failure and miltefosine
susceptibility in dermal leishmaniasis caused by Leishmania Viannia species.
Antimicrob Agents Chemother. 01023-01013.
Pita-Pereira, D., Lins, R., Oliveira, M.P., Lima, R.B., Pereira, B., Moreira, O.C., Brazil,
R.P., Britto, C., 2012. SYBR Green-based Real-Time PCR targeting kinetoplast DNA
can be used to discriminate between the main etiologic agents of Brazilian cutaneous
and visceral leishmaniases. Parasit Vectors 5, 15.
Purkait, B., Kumar, A., Nandi, N., Sardar, A.H., Das, S., Kumar, S., Pandey, K.,
Ravidas, V., Kumar, M., De, T., Singh, D., Das, P., 2012. Mechanism of amphotericin B
resistance in clinical isolates of Leishmania donovani. Antimicrob Agents Chemother.
56, 1031-1041.
Quijada, L., Soto, M., Alonso, C., Requena, J.M., 1997. Analysis of post-transcriptional
regulation operating on transcription products of the tandemly linked Leishmania
infantum hsp70 genes. J Biol Chem. 272, 4493-4499.

Requena, J.M., Chicharro, C., Garca, L., Parrado, R., Puerta, C.J., Caavate, C., 2012.
Sequence analysis of the 3'-untranslated region of HSP70 (type I) genes in the genus
Leishmania: its usefulness as a molecular marker for species identification. Parasit
Vectors. 5, 87.
Rioux, J., Lanotte, G., Serres, E., Pratlong, F., Bastien, P., Perieres, J., 1989. Taxonomy
of Leishmania. Use of isoenzymes. Suggestions for a new classification. Ann Parasitol
Hum Comp. 65, 111-125.
Rojas, R., Valderrama, L., Valderrama, M., Varona, M.X., Ouellette, M., Saravia, N.G.,
2006. Resistance to antimony and treatment failure in human Leishmania (Viannia)
infection. J Infect Dis.193, 1375-1383.
Rzhetsky, A., Nei, M., 1992. A simple method for estimating and testing minimumevolution trees. Mol. Biol. Evol 9, 945-967.
Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Mol Biol Evol. 4, 406-425.
Snchez-Caete, M.P., Carvalho, L., Prez-Victoria, F.J., Gamarro, F., Castanys, S.,
2009. Low plasma membrane expression of the miltefosine transport complex renders
Leishmania braziliensis refractory to the drug. Antimicrob Agents Chemother. 53, 13051313.
Schnian, G., Kuhls, K., Mauricio, I.L., 2011. Molecular approaches for a better
understanding of the epidemiology and population genetics of Leishmania. Parasitol.
138, 405-425.
Schnian, G., Mauricio, I., Cupolillo, E., 2010. Is it time to revise the nomenclature of
Leishmania?. Trends Parasitol. 26, 466-469.
Schonian, G., Nasereddin, A., Dinse, N., Schweynoch, C., Schallig, H.D., Presber, W.,
Jaffe, C.L., 2003. PCR diagnosis and characterization of Leishmania in local and
imported clinical samples. Diagn Microbiol Infect Dis. 47, 349-358.
Serizawa, K., Suzuki, H., Tsuchiya, K., 2000. A phylogenetic view on species radiation
in Apodemus inferred from variation of nuclear and mitochondrial genes. Biochem
Genet. 38, 27-40.
Serrano-Martn, X., Payares, G., De Lucca, M., Martinez, J.C., Mendoza-Len, A.,
Benaim, G., 2009. Amiodarone and miltefosine act synergistically against Leishmania
mexicana and can induce parasitological cure in a murine model of cutaneous
leishmaniasis. Antimicrob Agents Chemother. 53, 5108-5113.
Silveira, F.T., Shaw, J.J., Braga, R.R., Ishikawa, E., 1987. Dermal leishmaniasis in the
Amazon Region of Brazil: Leishmania (Viannaia) lainsoni sp. n., a new parasite from
the State of Par. Mem Inst Oswaldo Cruz. 82, 289-291.
Sneath, P.H., Sokal, R.R., 1973. Numerical taxonomy. The principles and practices of
numerical classification. San Fran cisco: WH Freeman.

Soto, J., Rea, J., Balderrama, M., Toledo, J., Soto, P., Valda, L., Berman, J.D., 2008.
Efficacy of miltefosine for Bolivian cutaneous leishmaniasis. Am J Trop Med Hyg. 78,
210-211.
Soto, J., Rea, J., Valderrama, M., Toledo, J., Valda, L., Ardiles, J., Berman, J., 2009.
Efficacy of extended (six weeks) treatment with miltefosine for mucosal leishmaniasis
in Bolivia. Am J Trop Med Hyg. 81, 387-389.
Soto, J., Toledo, J., Valda, L., Balderrama, M., Rea, I., Parra, R., Ardiles, J., Soto, P.,
Gomez, A., Molleda, F., 2007. Treatment of Bolivian mucosal leishmaniasis with
miltefosine. Clin Infect Dis. 44, 350-356.
Stevenson, L.G., Fedorko, D.P., Zelazny, A.M., 2010. An enhanced method for the
identification of Leishmania spp. using real-time polymerase chain reaction and
sequence analysis of the 7SL RNA gene region. Diagn Microbiol Infect Dis. 66, 432435.
Stoline, M.R., 1981. The status of multiple comparisons: simultaneous estimation of all
pairwise comparisons in one-way ANOVA designs. The American Statistician 35, 134141.
Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6:
Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol. 30, 2725-2729.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence weighting,
position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 46734680.
Tibayrenc, M., Neubauer, K., Barnabe, C., Guerrini, F., Skarecky, D., Ayala, F.J., 1993.
Genetic characterization of six parasitic protozoa: parity between random-primer DNA
typing and multilocus enzyme electrophoresis. Proc Natl Acad Sci USA. 90, 1335-1339.
Torres Espejo, J.M., Pratlong, F., Le Pont, F., Mouchet, J., Desjeux, P., Rioux, J.-A.,
1989. Leishmaniasis in Bolivia: V. Human strains of Leishmania (V.) braziliensis from
the department of Pando. Mem Inst Oswaldo Cruz. 84, 583-583.
Tsukayama, P., Lucas, C., Bacon, D.J., 2009. Typing of four genetic loci discriminates
among closely related species of New World Leishmania. Int J Parasitol. 39, 355-362.
Valda Rodriguez, L., Dedet, J.-P., Paredtes, V., Mendoza, C., Cardenas, F., 1995. A
randomized trial of amphotericin B alone or in combination with itraconazole in the
treatment of mucocutaneous leishmaniasis. Mem Inst Oswaldo Cruz. 90, 525-528.
Van der Auwera, G., Ravel, C., Verweij, J.J., Bart, A., Schonian, G., Felger, I., 2014.
Evaluation of four single-locus markers for Leishmania species discrimination by
sequencing. J Clin Microbiol. 52-4, 1098-1104.
Victoire, K., De Doncker, S., Cabrera, L., Alvarez, E., Arevalo, J., Llanos-Cuentas, A.,
Le Ray, D., Dujardin, J.-C., 2003. Direct identification of Leishmania species in
biopsies from patients with American tegumentary leishmaniasis. Trans R Soc Trop
Med Hyg. 97, 80-87.

Walton, B.C., Chinel, L.V., Eguia y Eguia, O., 1973. Onset of espundia after many years
of occult infection with Leishmania braziliensis. Am J Trop Med Hyg. 22, 696-698.
WHO, 2010. Control of the leishmaniases. World Health Organization technical report
series, xii-xiii, 1-186, back cover.
Yang, B.-B., Guo, X.-G., Hu, X.-S., Zhang, J.-G., Liao, L., Chen, D.-L., Chen, J.-P.,
2010. Species discrimination and phylogenetic inference of 17 Chinese Leishmania
isolates based on internal transcribed spacer 1 (ITS1) sequences. Parasitol Res. 107,
1049-1065.
Yardley, V., Croft, S.L., DE DONCKER, S., Dujardin, J.-C., Koirala, S., Rijal, S.,
Miranda, C., Llanos-Cuentas, A., Chappuis, F., 2005. The sensitivity of clinical isolates
of Leishmania from Peru and Nepal to miltefosine. Am J Trop Med Hyg. 73, 272-275.
Zelazny, A.M., Fedorko, D.P., Li, L., Neva, F.A., Fischer, S.H., 2005. Evaluation of 7SL
RNA gene sequences for the identification of Leishmania spp. Am J Trop Med Hyg. 72,
415-420.
Zemanov, E., Jirk, M., Mauricio, I.L., Hork, A., Miles, M.A., Luke, J., 2007. The
Leishmania donovani complex: Genotypes of five metabolic enzymes (ICD, ME, MPI,
G6PDH, and FH), new targets for multilocus sequence typing. Int J Parasitol. 37, 149160.

Zhang, C.Y., Zhou, J., Ding, B., Lu, X.J., Xiao, Y.L., Hu, X.S., Ma, Y., 2013.
Phylogenetic analysis of lack gene sequences for 22 Chinese Leishmania isolates.
Infection, genetics and evolution. Infect Genet Evol. 17, 79-86.
Zhang, H., Bhattacharya, D., Lin, S., 2005. Phylogeny of Dinoflagellates based on
mitochondrial cytochrome B and nuclear small subunit rDNA sequence somparisons. J
Phycol. 41, 411-420.