Sunteți pe pagina 1din 269

Filiala Bli a Academiei de tiine a Moldovei

Universitatea de Stat Alecu Russo din Bli

Institutul de Cercetri pentru Culturile de Cmp Selecia

CONFERINA NAIONAL CU PARTICIPARE INTERNAIONAL

TIINA N NORDUL REPUBLICII MOLDOVA: REALIZRI, PROBLEME,


PERSPECTIVE

Bli 25- 26 septembrie 2015

Colegiul redacional:
Capcelea Valeriu, doctor habilitat, confereniar universitar;
Gagim Ion, doctor habilitat, profesor universitar;
Gavdiuc Ion, cercettor tiinific;
Talp Sergiu, doctor, cercettor tiinific.
Coordonator (editor) doctor habilitat, confereniar universitar, Valeriu Capcelea
Descrierea CIP a Camerei Naionale a Crii din RM
"tiina n nordul Republicii Moldova: realizri, probleme, perspective", conferina naional (2015 ; Bli).
Conferina naional cu participare internaional "tiina n nordul Republicii Moldova. realizri,
probleme, perspective", 25-26 sept. 2015, Bli / col. red.: Capcelea Valeriu [et al.]. Bli : S. n., 2015
(Tipogr. "Indigou Color"). 286 p.
Antetit.: Filiala Bli a Acad. de tiine a Moldovei, Univ. de Stat "Alecu Russo" din Bli, Inst. de Cercetri
pentru Culturile de Cmp "Selecia". Texte : lb. rom., eng., fr., rus. Bibliogr. la sfritul art.
ISBN 978-9975-3054-5-7.

Autorii sunt n ntregime responsabili pentru coninutul lucrrilor publicate

CUPRINS
1. HF
.., .., ..
2.

.., .., ..
3. ANALIZELE XRD, SEM I AFM ALE STRATURILOR SUBIRI POLICRISTALINE DE
ZnSxSe1-x
Popa Mihail
4. CERCETAREA PROPRIETILOR ELECTRICE ALE STRATURILOR ELECTRICE ALE
STRATURILOR SUBIRI DE ZnSxSe1-x,
Popa Mihail
5. CONFERIREA UNEI MICRO-GEOMETRIEI PRESCRISE A SUPRAFEELOR METALICE N
SCOPUL SPORIRII INTENSITII CURENTULUI DE EMISIE TERMO-ELECTRIC,
Guzgan Dorin
6. REGIUNEA DE DEZVOLTARE NORD N CADRUL PIEEI ENERGETICE A PEPUBLICII
MOLDOVA
Timofte Natalia
7. PROMOVAREA TRANSFERULUI TEHNOLOGIC N DEZVOLTAREA DURABIL A
AGRICULTURII
Crmaru, Valentin
8. REFLECII ASUPRA MANAGEMENTULUI CERCETRII FORMAIUNILOR SILVICE DE
STEJAR PUFOS DIN REPUBLICA MOLDOVA
Agapi Ion, Gociu Dumitru
9. RESURSELE AGROCLIMATICE IN CONTEXTUL CULTIVARII NOILOR SOIURI DE VI
DE VIE N CONDIIILE MOLDOVEI
Alexandrov Eugeniu
10. NECESITI LA CREAREA SOIURILOR NOI DE VI DE VIE
Alexandrov Eugeniu, Gaina Boris
11. CERCETAREA GRADULUI DE INFLUEN A REGLATORULUI DE CRETERE
BLACKJAK ASUPRA PRODUCTIVITII POMILOR I CALITII FRUCTELOR DE MR
Bujoreanu Nicolae, Harea Ion, Gaviuc Ludmila, Bejan Nina
12. DREB
.., ., ..;
..; .., ..
13. THE POTENTIAL OF GOAT MILK FOR NEW PRODUCTS
Bogdan Nina
14. FOLOSIREA APEI DIN SOL SUB INFLUENA DIFERITOR SISTEME DE FERTILIZARE N
ASOLAMENT
Boincean Boris, Stadnic Stanislav
15. FIN EXTRUDAT DIN NUT
Carelina M., Caragia V., Linda Ludmila, Migalatiev Olga
16. STUDIU PRIVIND EFECTUL APLICRII FOLIARE A REGULATORULUI NATURAL DE
CRETERE REGLALG ASUPRA ACTIVITII CHITINAZELOR DIN FRUNZELE PLANTELOR
DE TOMATE
Cau Maria, Clugru-Sptaru Tatiana, Sromeatnicov Iurie, Dascaliuc Alexandru
17. ACIUNEA NGRMINTELOR MINERALE CU AZOT ASUPRA PRODUCTIVITII
GRULUI DE TOAMN PE DIFERITE NIVELURI DE FOSFOR PE CERNOZIOMUL
CARBONATIC
CiochinaVitalie
18. INFLUENA PROTECIEI APARATULUI FOLIAR ASUPRA NIVELULUI DE
PRODUCIE I A GRADULUI DE PUTREFACIE A RIZOCARPILOR SFECLEI
PENTRU ZAHR
rivceanschi Gheorghe
19. EFICACITATEA HRNIRII PURCEILOR SUGARI CU AMESTEC DE OBINUIRE
Danilov Anatolie, Donica Ion
20. FABRICATION DES PRODUITS NON-ALCOOLIQUES OBTEBUS DU RAISIN IMMATURE
Golubi Roman, Iorga Eugen, Gaina Boris

10

13

17

21

24

27

30

33

36
40

42

45
47

52
55

57

59

62
64

21. PROPRIETILE BIOMETRICE, FIZICO-CHIMICE I TEHNOLOGII DE PRELUCRARE A


LEGUMINOASELOR DE SELECIE AUTOHTON
Linda Ludmila, Caragia V., Sarandi T., Odobescu L., Karelina M.
22. PRODUCTIVITATEA CULTURILOR AGRICOLE LA APLICAREA NGRMINTELOR
MINERALE
Lungu Vasile
23.

.., .., .., ..
24.


25.

, ,
26. ASPECTE GENERALE PRIVIND MORFOLOGIA I STAREA CERNOZIOMULUI OBINUIT
SLAB ERODAT DIN CADRUL BAZINULUI DE RECEPIE NEGREA
Cojocaru Olesea, Cerbari Valerian, Corman Iurie
27. TENDINE NOI N CREAREA I PROMOVAREA SORTIMENTULUI DE CAIS
Pntea Maria
28. ACIUNEA DIFERITELOR TIPURI DE GUNOI DE GRAJD ASUPRA INDICILOR
AGROCHIMICI AI SOLULUI I RECOLTEI CULTURILOR DE CMP
Plmdeal Vasile, Rusu Alexandru, Bulat Ludmila
29. EFECTUL TRATAMENTELOR FOLIARE CU FOLIRUS ACTIV ASUPRA PRODUCTIVITII
SOII CULTIVAT PE CHERNOZIOM CARBONATIC
Rotaru Vladimir, Ivantova Irina, Budac A.
30. PRETABILITATEA SOLURILOR LA IRIGAIE N REPUBLICA MOLDOVA
Rozloga Iurie, Filipciuc Vladimir
31. ALTENERIA,


32.

.., ..
33. ASPECTE METODOLOGICE ALE DETERMINRII CONINUTULUI DE HUMUS N SOL I
PROBLEMA DEHUMIFICRII CERNOZIOMURILOR N REPUBLICA MOLDOVA
Taran Mihail
34. PRODUCTIVITATEA I CALITATEA DIFERITELOR SOIURI ALE SFECLEI DE ZAHR
chiopu Leonid
35.

/

36. ACIUNEA FERTILIZRII FOLIARE ASUPRA PRODUCTIVITII I CALITII
FRUCTELOR
Grican Sava, Dadu Zinaida, Polihovici Lidia, Crivaia Parascovia
37. EFICIENA LUCRRII SOLULUI I ERBICIDRII ASUPRA CRETERII I DEZVOLTRII
BURUIENILOR PERENE CU RIZOMI
Grican Sava
38. STAREA ELEMENTELOR NATURALE RARE DIN UNELE ARII PROTEJATE DE STAT
Begu Adam, Liogchii Nina, Brega Vladimir,
Braoveanu Valeriu, Donica Ala, Fasola Regina
39. ARII FAVORABILE PENTRU CONSERVAREA BIODIVERSITII
Begu Adam, Liogchii Nina, Donica Ala, Ajder Vitalie
40. ANALIZA SWOT A PARCURILOR MOIERETI REPREZENTATIVE DIN REGIUNEA DE
DEZVOLTARE CENTRU
Ciobanu Cristina
41. GESTIONAREA DEEURILOR O PROBLEM STRINGENT A REPUBLICII MOLDOVA
Bodrug Nicolae, Bulimaga Constantin, Budeanu V.
42. ARMONIZAREA SISTEMULUI NAIONAL DE EVALUARE DE MEDIU LA CERINELE
COMUNITARE: PROVOCRI I DIRECII DE DEZVOLTARE
Cojocaru Mircea, Capcelea Arcadie

68

72

74

78

81

86

88
91

95

98
101

104

106

109
111

113

116

120

125
128

132
134

43.


44. DIVERSITATEA FLORISTIC A ECOSISTEMULUI PETROFIT DEGRADAT PE EXEMPLUL
CARIEREI DE CALCAR LAFARGE CIMENT
Certan Corina, Bulimaga Constantin, Grabco Nadejda
45. STUDIEREA GRADULUI DE TOXICITATE A APELOR RURILOR MICI DIN PARTEA
INFERIOAR A BAZINULUI HIDROGRAFIC RUT
Drumea Dumitru, Debelaia-Buracinschi Svetlana, Portarescu Anastasia
46. VESTIGIILE ARHEOLOGICE - COMPONENTE ALE PEISAJELOR CULTURALE DIN
NORDUL REPUBLICII MOLDOVA
Mironov Ion
47.

, ,
48. STUDIUL RADIOLOGIC AL ARIILOR NATURAL PROTEJATE DE STAT DIN ZONA DE
NORD A REPUBLICII MOLDOVA
Stagrescu Vasile, Motelica Liliana, Vatamaniuc Galina
49. ,

.., ..
50. RELAIA NTRE COMPONENA APEI RURILOR I A MONUMENTELOR NATURALE
HIDROLOGICE PROTEJATE DE STAT DIN BAZINUL LOR
Sandu Maria, Tr Anatol, Lozan Raisa, Mosanu Elena, Goreacioc Tatiana
51. CAPACITATEA DE AUTOEPURARE I NITRIFICARE A APELOR DE SUPRAFA DIN
TERITORIUL ZONEI UMEDE UNGURI-HOLONIA
Tr Anatol, Sandu Maria, Lozan Raisa,
Zlotea Alexandru, Sidoren Iulia, Comarnichi A.
52. DIMENSIUNEA ETIC A SCHIMBRILOR CLIMATICE
Capcelea Valeriu
53. ASPECTE FILOSOFICE ALE COMUNICRII SEMIOTICE
Mohorea Efim
54. UNELE CONSIDERENTE PRIVIND REORGANIZAREA SISTEMULUI ADMINISTRATIVTERITORIAL NAIONAL
Varzari Pantelimon
55. PUTEREA I OPOZIIA POLITIC N CONTEXTUL MODERNIZRII REPUBLICII
MOLDOVA
Rusandu Ion
56.


57.
( )

58. SECURITATEA UMAN N CONTEXTUL PERICOLELOR I AMENINRILOR
CONTEMPORANE
Sprincean Serghei
59. RESURSE INOVAIONALE PENTRU O DEZVOLTARE INTELIGENT A LUMII
SPIRITUALE I MORALE LA ELEVI
Zolotariov Elena
60. UNELE PARTICULARITI DE PRACTICARE A SPORTULUI DE CTRE PERSOANELE
VRSTNICE
Morari Alexandru
61. EDUCAREA CALITILOR INDIVIDUALE DE PREGTIRE TEHNIC I TACTIC CU
STUDENII LA ANTRENAMENTUL DE FOTBAL
Ceban Ion
62. CARACTERISTICILE I OBIECTIVELE DE NVARE A JOCULUI DE VOLEI
Butnaru Roman
63. DEZVOLTAREA CALITILOR MOTRICE LA ORELE DE EDUCAIE FIZIC
Foca Ion

137

140

143

146

148

152

154

158

162

165
167
171

175

178

181

184

188

192

194

196
198

64. SOLUII METODICO-PRACTICE DE CRETERE A EFICIENEI LECIEI DE EDUCAIE


FIZIC
Prodan Vladislav
65. CILE DE IMPLEMENTARE A PRAXIOLOGIEI INOVATIV-ARTISTICE
Babii Vladimir
66. TENDINE N DEZVOLTAREA DOMENIULUI DE EDUCAIE MUZICAL DIN
PERSPECTIVA CERCETTORILOR UNIVERSITII DE STAT ALECU RUSSO DIN BLI
Morari Marina
67. ULTIVAREA SUCCESULUI ARTISTIC LA ELEVII DOTAI
Tatiana Bularga
68.

,
69. TEATRUL HAIDUCESC DE PE VALEA TROTUULUI CA VALOARE ARTISTIC I
DIDACTIC
Gavrili Laura
70. ESENA DREPTULUI N CONTEXTUL TEORIEI GENERALE A SISTEMELOR
Mohorea Efim
71 NVINUIREA I VARIETILE (CATEGORIILE) ACESTEIA N PROCESUL PENAL
Bnzari Grigore
72. CLASIFICAREA I CONDIIILE REALIZRII MSURILOR SPECIALE DE INVESTIGAII
Covalciuc Ion
73. REFLECII PRIVIND AUDIEREA INCULPATULUI N CADRUL CERCETRII
JUDECTORETI N PROCESUL PENAL AL REPUBLICII MOLDOVA
Gherasim Dumitru
74. EXPERTIZA CRIMINALISTIC A MICROOBIECTELOR, O FORM DISTINCT DE
CUNOATERE A FAPTELOR N PROCESUL PENAL
Pisarenco Constantin
75. ESENA I IMPORTANA PRINCIPIULUI CONTRADICTORIALITII N PROCESUL
PENAL AL REPUBLICII MOLDOVA
Rusu Lucia
76. ,
(- )

77.
ASISTENA
JURIDICO-PENAL
INTERNAIONAL:
NOIUNE,
FORME,
PARTICULARITI
arlung Victoria
78. TEORIA INEXISTENEI N CONTEXTUL CONCEPIILOR DESPRE NULITATEA ACTULUI
JURIDIC CIVIL
Boca Sergiu
79. PROFITUL N CONTEXTUL CRIZEI ECONOMICE
Corina Matei Gherman, Vasile Matei
80. PROBLEMELE OCUPRII FOREI DE MUNC A TINERILOR DIN MEDIUL RURAL CA
FACTOR A DEZVOLTRII DURABILE
Trusevici Ala
81. EVALUAREA ECONOMIC A CULTIVRII DIFERITOR SOIURI DE SFECL DE
ZAHR
chiopu Leonid
82. UNELE CONSIDERENTE TEORETICE PRIVIND EFECTUL PROCESULUI TEHNOLOGIC
ASUPRA CONTABILITII COSTURILOR N PROCESAREA LAPTELUI DE CONSUM
Cojocari Corneliu
83.

..
84. ASPECTE NOI N AUDITUL IMOBILIZRILOR CORPORALE
Amarfii-Rileanu Nelli

200

203
206

211
214

218

221
225
228
231

234

238

241

244

248

251
257

259

261

263

266

HF
.., . ., . ., USARB, .., , , ..,

The method of the section etching by HF solution is proposed for the analysis of the surface layers of
the flat glass. We managed to work out the method of flat glass surface layers dissolution, with the thickness from 10 nm to 10 m and more. The graphs of the dissolution rate of industrial glass depending on different
duration of one etching are analyzed. The experiments showed that the rate of dissolution of all the samples in
HF solution is not stable. The article discusses the possibility to reveal the stratified structure in the flat glass
with help of section etching by HF solution method.
Key words: flat glass, etching by HF solution method, surface layer, dissolution rate, duration, stratified
structure.

,
- .
.
-
1 1 [1-2]. (
) .

10 .
.

HF.


( , %): 72,55 SiO 2, 1,83 Al2O3,
0,10 Fe2O3, 7,65 CaO, 3,61 MgO, 13,57 Na2O, 0,46 K2O, 0,31 SO3.
HF- .
[3-4].
HF
(- )
[5-6].
HF-
. HF
.
.
, .
, 1 HF.
HF 0,1%.
, (300,1) 0.
.

, , .
HF
. :

m
104 ,
S

(1)

h , ;
m , ;
S , 2;
- , /3.
:
v m 100 ,
(2)
S
v - , /[2 ( )];
- , .

5%, 4%.


.
Na +,
+
2+
K Ca . .

, :
, , F,
, . F,
.
2,5 60 .
. 1
10 .
. 1. HF-
,

10 .

.
. 1 ,

0,1 .
. -,
. -,

.

0,25-0,30 /(2 ).

0,1 1,5-2

.

,
.
, , ,
, .
10 . ,

.

20 . 2.
. 2.
HF-

20 .

.
. 2 . 1.
0,2 .
10 20 . ,
2 ,

.

,
.
, . 2 . 1.
20
0,26-0,28 /(2 )
10 .
30
, ,
. 3.
. 3.
HF-

30 .


.
. 3 ,
0,3 .
30 0,30 /( 2 )

10 20.
HF-
60 . 4.
. 4.
HF-
,

60 .

.
. 3 . 4 ,
60 ,
,
.
0,6-0,7 . ,
.

60 0,30 /( 2 ) ,
30 .
. 1 - . 4 .
.
[7-9],
.
- 20 30 .
(. 2 . 3).
:

( 2,5 60 ).

, .

.

.
HF-
.
:
1. Rupertus, V.; Bange, K. Sophisticated techniques for studying glass surface. XIX-th International Congress on
Glass. Extended Abstracts. Edinburgh, 2001. Vol. 1, p. 2-11.
2. Mazzoldi, P. Discovery of glass surface through analytical techniques. Proc. of the XVI International
Congress on Glass. Madrid, 1992,Vol. 1, p. 197-217.
3. Csakvari, B.; Boksay, Z.; Bouquet, G. Investigation of surface layers on electrode Glasses for pH
measurement. Anal. Chim. Acta, 1971, vol. 56, p. 279-284.
4. , .; , .; .; , . -
. . V
. : . , 1971, . 310-313.
5. , .. -
, . B: . .
: . , 1987, c. 223-242.
6. , .. -
, . B: , 1985, 11, 3, . 257-277.
7. , ..; , .. ,
. B: , 1978, 4, c. 9-11.
8. , ..; , . .
. B: , 1974, 11, c. 6-7.
9. , ..; , ..; , ..; , ..
. B: , 1978, 4, c. 6-7.


.., . ., . ., .., , .., . ., USARB.
The article focuses on thermodynamic analysis of the possibility of chemical interaction of inorganic
glasses with hydrogen chloride. The list of the most probable chemical reactions between hydrogen chloride and
different oxides has been made. Graphics of Gibbs energy changes depending on the temperature of chemical
reactions between hydrogen chloride and different oxides have been obtained. From the thermodynamic position,
there have been determined metal oxides for the most effective dealkalization by hydrogen chloride from
industrial glasses.
Key words: inorganic glass, hydrogen chloride, oxide, chemical reaction, thermodynamic analysis,
Gibbs energy changes, temperature, dealkalization.

,
, , .
- ,
, .
,
[1-2].
- (
). ,
3-5 [2].
,
. .
,
.
HF,
(!). ,
, . . [2].

[2, 3], [4],
[2, 5].
-
.
,
.

10

, 20-30%, 510% [4].


( ,
, ) ,
, , [1, 3, 4, 7, 8].
, ,
[4, 8].
(, .) ,
[9]. 300 0
,
.

.


:
1) ,
;
2) ,
;
3)
;
4)
;
5)
= 400; 500; 600; 700; 800, 900 1000 .
6)
.
, , : Na2O,
K2O, MgO, CaO, BaO, FeO, B2O3, Al2O3 SiO2.

.
298 1000 .

298 1000

rG (1000 K),
rG0 (298 K), /

/
Na2O + 2HCl = 2NaCl + H2O
-428
-4917
K2O + 2HCl = 2KCl + H2O
-602
-12413
MgO + 2HCl = MgCl2 + H2O
206
-4843
CaO + 2HCl = CaCl2 + H2O
-190
-3122
BaO + 2HCl = BaCl2 + H2O
-318
-2928
FeO + 2HCl = FeCl2 + H2O
-196
-9710
B2O3 () + 6HCl = 2BCl3 + 3H2O
291
-7815
B2O3 () + 6HCl = 2BCl3 + 3H2O
290
-9408
Al2O3 + 6HCl = 2AlCl3 + 3H2O
211
-26312
SiO2 + 4HCl = SiCl4 + 2H2O
151
2089

.
[10].
,
, , , .

: K2O Na2O BaO FeO CaO.
1000 ,
.
, 298 1000
.

1000 : Al 2O3
K2O FeO B2O3 () B2O3 () Na2O MgO CaO BaO.
: - .

11


.
. 1
.
. 1.



1. Na2O + 2HCl = 2NaCl + H2O; 2. K2O +
2HCl = 2KCl + H2O
.1



.

. 2.
. 2.



1. BaO + 2HCl = BaCl2 + H2O; 2. CaO +
2HCl = CaCl2 + H2O;
3. MgO + 2HCl = MgCl2 + H2O;



(. 3).
. 3.



1. Al2O3 + 6HCl = 2AlCl3 + 3H2O; 2. B2O3 (c)
+ 6HCl = 2BCl3 + 3H2O;
3. B2O3 () + 6HCl = 2BCl3 + 3H2O

.
3

,

298 1000 .


298 1000

(.4).

1.

. 4.



SiO2 + 4HCl = SiCl4 + 2H2O; 2. SiO2 + 4HF = SiF4 + 2H2O

12


.
,
298-350 .

800 1000 [4]. ,
: Na 2O, K2O, MgO, CaO,
BaO, FeO, B2O3 Al2O3.
, , , .
,
, ,
.
:

,
: Na2O, K2O, MgO, CaO, BaO, FeO, B2O3, Al2O3 SiO2.

, , , .
: K2O Na2O BaO FeO CaO.

1000 : Al2O3 K2O FeO
B2O3() B2O3() Na2O MgO CaO BaO.
.

.
:
1. , .. . : , 1997. 253 .
2. C, .. . . : ,
1987. 70 .
3. Shelby, J.E. Introduction to Glass Science and Technology. 2-nd ed. Royal Society of Chemistry, 2005. 276 p.
4. , .. . : , 1988.
130 .
5. Karlsson, Stefan. Modification of Float Glass Surfaces by Ion Exchange. Linnaeus University Dissertations,
No 89/2012. 176 p.
6. Hense, C.R.; Mecha, J.; Schaeffer, H.A. Treatment of soda-lime-silica glass surfaces with fluorine-containing
gases. In: Glasstech. Ber., 1990, vol. 63, N. 5, p. 127-134.
7. Guloyan,Yu.A. Surface phenomena in glass technology (A review). In: Glass and Ceramics, 2006, vol. 63, N.
5-6, p. 146-153
8. Sharagov, V.; Duca, G. Increasing physical and chemical properties of annealed hollow glassware as well as
of those stored and used. In: Romanian Journal of Materials, 2013, vol. 43, nr. 2, p. 218-222.
9. , .. . . . : , 1970. 182 .
10. , ..; , ..; -, .. . :
, 1980. 349 .
ANALIZELE XRD, SEM i AFM ALE STRATURILOR SUBIRI POLICRISTALINE DE ZnSxSe1-x
Popa Mihail, dr. n tiine fizico-matematice, conf. univ., USARB
ZnSxSe1-x thin films were prepared from the vacuum evaporated technique on the glass substrates using
powders of ZnS and ZnSe.
The analysis of the structure was carried out through the XRD method. The diffractograms established
that ZnSxSe1-x thin films have a cubic structure, of type sphalerite zinc with a strong orientation of crystallites as
the crystalline plane (111). The values found for cubic network parameter calculated from diffractograms are
between a = 5.658-5.406 nm, the interplanar distance d111 = 3.270 - 3.120 nm, and the crystallite sizes D = 37.50
- 24.35 nm.
The surface morphology of polycrystalline thin films ZnS xSe1-x was studied by SEM and AFM technics.
The average crystallite size determined from the images varies between 40 and 20 nm.
INTRODUCERE
Compuii semiconductori de tip AIIBIV, cu band interzis larg, sunt atractivi, deoarece ei au multe
aplicaii n dispozitive electronice i optoelectronice nanostructurate. Materiale de perspectiva, care i-au gsit

13

multe aplicaii n pregtirea elementelor optice, care lucreaz n domeniul lungimilor de und vizibil i infrarou,
i care ndeplinesc cele mai multe dintre cerinele descrise mai sus, sunt semiconductori policristalini de ZnS i
ZnSe. Mult mai puin studiate sunt soluiile solide de ZnSxSe1-x (0 < x < 1). Interesul pentru prepararea i
cercetarea proprietilor fizice ale sulfuroselenidelor de zinc este determinat de posibilitatea de variaie a
proprietilor fizice ale acestora, odat cu schimbarea compoziiei lor. Materialul semiconductor de tip ZnS xSe1-x
trebuie s combine caracteristicile optice ridicate ale ZnSe i rezisten mecanic a ZnS. Este interesant
utilizarea sulfuroselenidelor de zinc ca materiale pentru optica gradiental.
n literatura de specialitate exist unele informaii cu privire la utilizarea straturilor subiri policristaline
de ZnSxSe1-x n diverse aplicaii optoelectronice, cum ar fi laserii sau diodele laser n domeniul albastru de
funcionare [1, 2], n calitate de heterojonctiuni ale celulelor solare [3, 4]. n ceea ce privete protecia mediului,
materiale compozite nanostructurate de tip ZnSxSe1-x sunt materiale alternative pentru producerea de straturifereastr i straturi tampon pentru aplicaiile fotovoltaice, nlocuind astfel CdS, care este un material toxic [5].
Scopul lucrrii este de a prezenta rezultatele cercetrii cu privire la structura, morfologia suprafeei i
compoziia straturilor subiri de ZnSxSe1-x obinute prin evaporarea termic n vid n volum cuasinchis.
DETALII EXPERIMENTALE
Prin metoda evaporrii termice n volum cuasinchis au fost preparate straturi subiri de ZnS xSe1-x cu
grosimi cuprinse ntre 0,2 i 1,0 m. Ca materie prim s-au folosit pulberi de ZnSe (cu puritatea de 99,99%) i
ZnS (cu puritatea de 99,99%) n diferite proporii. Soluiile obinute s-au amestecat minuios pentru a se obine o
pulbere uniform ca culoare.
n instalaia UVH-70A-1 s-au folosit evaporatoare din wolfram, confecionate n form de tvi.
Cristalele de ZnSxSe1-x fiind nclzite prin efect Joule trec direct din stare solid n stare de vapori, adic
sublimeaz, dup parcurgerea distanei evaporator-suport, condenseaz pe suport. S-au obinut compui de
ZnSxSe1-x cu valorile x = 0, 0.2, 0.4, 0.5, 0.6, 0.8 i 1.0. Distana evaporator-suport a fost modificat ntre 70 i
120 mm. Temperatura suportului n timpul depunerii a fost cuprins ntre 300 i 500K, iar temperatura
evaporatorului a variat ntre 1000 i 1500K. Au fost obinute straturi cu grosimi cuprinse ntre 0,2 i 1,0 m.
n calitate de substraturi sau folosit sticle cu diferite dimensiuni: 15x15x2mm sau 20x20x2mm. Anterior
depunerii, substraturile din sticl au fost curate n detergent diluat n ap. Apoi substraturile au fost curate cu
Ultrasonic Cleaner type Bandelin Sonotex n aceton (5 min.) i metanol sau etanol (10 min). Ulterior
substraturile au fost cltite cu ap deionizat i uscate cu flux de azot cu degestorium.
Structura cristalin a straturilor a fost investigat cu ajutorul unui difractometru de tip Philips PW
1120/00, no Dy.813, care folosete radiaia CuK ( = 1,5418). Parametrii de lucru au fost: i = 20mA i U =
40kV.
Morfologia suprafeei straturilor subiri policristaline de ZnSxSe1-x a fost studiat prin microscopie
electronic de baleaj (SEM) i microscopie de for atomic (AFM).
REZULTATE I ANALIZ
A fost studiat structura cristalin a straturilor subiri de ZnSxSe1-x prin difracie de radiaii X, folosind
radiaia CuK ( = 1.5418). S-a gsit c straturile sunt policristaline i au o structur cubic, de tip blend de
zinc, cu o puternic orientare a cristalitelor cu planele (111) paralele la suprafaa suportului (Fig. 1). Poziia
acestui pic deviaz de la 2 = 27,2970 (pentru x = 0) pn la 2 = 28,6120 (pentru x = 1) (Tabel 1).

Fig. 1. Evoluia difractogramelor


straturilor subiri de ZnSxSe1-x

Parametrul reelei cubice pentru straturile subiri de ZnSxSe1-x a fost determinat prin relaia [6]:

14

a=

( h 2 + k 2 + l 2 ) , (1)
2 sin

unde este lungimea de und a radiaiilor CuK ( = 1.5418 ), iar h, k, l sunt indicii Miller ai planului (111).
Valorile obinute sunt cuprinse ntre a =5.658 (pentru x = 0) i a = 5.406 (pentru x = 1) (Tabel 1). Venkata
Subbaiah i col. [2, 3] indic valori similare ale parametrului reelei cristaline pentru straturile respective.
Formula de calcul a distanei dintre planele paralele i echidistante care au indicii Miller (hkl) este [6]

d hkl =

n
.,
2 sin

(2)

Folosind relaia respectiv a fost determinat valoarea distanei interplanare pentru straturilor subiri de
ZnSxSe1-x. Valorile obinute sunt cuprinse ntre dhkl = d111 = 3.267 (pentru x = 0) i d111 = 3.121 (pentru x =
1) (Tabel 1).
Distana interplanar poate fi calculat i direct, folosind formula pentru aceast distan n cazul
sistemului cubic [6]:

d hkl =

a
h2 + k 2 + l 2

. (3)

Pentru planul (111), obinem d111 = a / (12 +12 +12)1/2 = a / 31/2 . Folosind valorile parametrului reelei cubice,
calculate conform relaiei (1), am obinut valorile distanei interplanare cuprinse ntre d111 = 3.270 (pentru x =
0) i d111 = 3.120 (pentru x = 1). Venkata Subbaiah i col. [2, 3], Ambrico i col. [4] au obinut valori similare
ale distanei interplanare pentru straturile respective.
Datorit faptului c difractogramele straturilor subiri de ZnS xSe1-x, studiate de noi, prezint un singur
maxim intens corespunztor planului (111), dimensiunea cristaliilor a fost determinat folosind numai datele
pentru acest maxim, conform formulei Scherer [1]
unde este lungimea de und a radiaiilor CuK ( = 1,5418), este lime integral a jumtii maximului
(111) (FWHM), iar 2 este unghiul de difracie. Dimensiunile cristalitelor au fost cuprinse ntre D = 37,50 nm
(pentru x = 0) i D = 24,35 nm (pentru x = 1) (Tabel 1). Aceste valori ale dimensiunilor cristaliilor sunt n bun
concordan cu cele indicate i de ali autori pentru straturi subiri de ZnS xSe1-x [2, 4-8].

2, grad

0
0,2
0,4
0,5
0,6
0,8
1,0

27, 297
27,423
27,658
27,801
27,952
28,273
28,612

Tabel 1. Valori experimentale pentru structura cubic a straturilor subiri de ZnS xSe1-x
FWHM
a, nm
d111, nm
d111, nm
D, nm
(form. 2)
(form. 3)
0, 4092
5,658
3,267
3,27
37,50
0,4336
5,634
3,253
3,25
34,40
0,4654
5,586
3,226
3,23
32,07
0,4977
5,559
3,209
3,21
30,00
0,5290
5,529
3,192
3,19
28,23
0,5663
5,473
3,160
3, 16
26,39
0,6143
5,406
3,121
3,12
24,35

n scopul de a obine informaii suplimentare referitoare la structura straturilor am apelat la microscopia


electronic de baleaj (SEM). Imaginile SEM sunt obinute prin mriri succesive ale unor poriuni din ce n ce
mai mici de pe suprafa probei respective pentru a putea distinge structura policristalin a stratului.
Imaginile SEM ale suprafeelor a dou straturi subiri de ZnSxSe1-x sunt prezentate n Fig. 2. a i b. Se
observ c eantioanele prezint cristalite de dimensiuni mici, iar forma i dimensiunile acestora sunt
asemntoare. Aceste imagini ale suprafeelor straturilor constituie un indiciu al unei creteri de tip columnar a
straturilor (cristalitele au forma unor coloane crescute perpendicular pe suport). Se observ c odat cu creterea
concentraiei de S i micorarea concentraiei de Se, dimensiunile cristalitelor se micoreaz, fapt confirmat i
prin calculele din datele XRD (Tabel 1.). Micorarea dimensiunilor cristalitelor, ca rezultat al tratamentului
termic influeneaz proprietile electrice i optice ale straturilor subiri de ZnS xSe1-x.

15

a)
b)
Fig. 2. Imagini SEM ( 12000) ale suprafeei straturilor subiri de ZnS0,2Se0,8 (a) i ZnS0,8Se0,2 (b)
n Fig. 3 este reprezentat imaginea n tietur a unui strat subire de ZnS xSe1-x. Se observ c structura
stratului este uniform i compact. Din aceste imagini a fost determinat grosimea straturilor subiri, care a fost
cuprins ntre 0,2 i 1,0 m.

Fig. 3. Imagine SEM a stratului fracionat de ZnS0,2Se0,8

ntruct forma i dimensiunea cristalitelor (pentru probele cu cristalite mici) sunt dificil de studiat prin
microscopie electronic, am efectuat investigaii ale suprafeei straturilor subiri de ZnS xSe1-x i prin microscopie
de for atomic (AFM). Aceast metod mai are avantajul c poate oferi informaii despre rugozitatea probelor.
Imaginile AFM sunt obinute prin scanarea unor suprafee din ce n ce mai mici din aceeai regiune a probei,
suprafaa de dimensiune mai mic fiind aleas de pe suprafaa mai mare.
n Fig. 4 a, b i c sunt prezentate imaginile de microscopie de for atomic pentru trei straturi subiri de
ZnSxSe1-x. Se constat, c probele prezint cristalite cu forme i dimensiuni asemntoare i c rugozitatea
probelor este mic, variind ntre 20 i 60 nm.
Forma cristalitelor pus n eviden prin aceast metod conduce la ipoteza unei creteri columnare a
straturilor. Aceast ipotez este susinut i de rezultatele obinute prin microscopie electronic de baleaj (Fig. 2.
a) i b).
Se observ c odat cu creterea concentraiei de S i micorarea concentraiei de Se are loc o micorare a
dimensiunilor orizontale a cristalitelor. Aceast comportare a dimensiunilor cristalitelor a fost evideniat i prin
calculele acestor dimensiuni din difractogramele de radiaii X i din studiul morfologiei straturilor subiri de
ZnSe prin microscopie electronic de baleaj (SEM).

16

Fig. 4. Imagini AFM ale straturilor subiri de ZnS0,2Se0,8 (a),


ZnS0,5Se0,5 (b) i ZnS0,8Se0,2 (c)

CONCLUZII:
n aceast lucrare am descris rezultate noi referitoare la studiul structurii i morfologiei suprafeei
straturilor subiri de ZnSxSe1-x. Straturile obinute de noi prezint un grad bun de cristalinitate, n ciuda
caracterului amorf al substratului. Acestea sunt policristaline, cu cristalite de dimensiuni mici i au o structur
cubic de tip blend de zinc. Straturile sunt compacte i prezint o rugozitate mic.
Rezultatele obinute demonstreaz marele avantaj al metodei evaporrii termice n vid pentru prepararea
straturilor subiri de nalt cristalinitate care au multiple aplicaii n dispozitivele optoelectronice.
BIBLIOGRAFIE:
1. Patil, D.S.; Gautam, D.K., Analysis of effect of temperature on ZnSSe based blue laser diode characteristics at
507 nm wavelength, Physica B 344 (2004), p. 140-146;
2. Venkata, Subbaiah Y.P.; Prathap, P.; Reddy, K.T.R.; Mangalaraj, D., Kim, K. and Junsin, Yi, Growth and
characterization of ZnSxSe1x films deposited by close-spaced evaporation. In: Journal of Physics D: Applied
Physics, 40 (2007), 3683-3688;
3. Venkata, Subbaiah Y.P.; Prathap, P.; Ramakrishna, Reddy K.T.; Miles, R.W.; Yi, J. Studies on
ZnS0.5Se0.5 buffer based thin film solar cells, Thin Solid Films 516 (2008), 7060.
4. Ambrico, M.; Perna, G.; Smaldone, D.; Spezzacatena, C.; Stagno, V. and Capozzi,V. Structural and optical
parameters of ZnSxSe1x films deposited on quartz substrates by laser ablation, Semicond. Sci. Technol. 13
(1998), p. 14461455.
5. Ganguly, A.; Chaudhury, S. and A.K. Pal, Synthesis of ZnSxSe1x (0 < x < 1) nanocrystalline thin films by
high-pressure sputtering, Journal of Physics D: Applied Physics, 34 (2001), p. 506-513.
6. Sirotin, Y. and Shaskolskaya, M. Fundamental of Crystal Physics, Moscow, Mir Publishers, 1982.
7. Standart X-ray Diffraction Powder Patterns, National Bureau of Standarts, Circular 539, Volume III, Issued
June 10, 1954.
8. Standart X-ray Diffraction Powder Patterns, National Bureau of Standarts, Circular 539, Volume II, Issued
June 15, 1953.
CERCETAREA PROPRIETILOR ELECTRICE ALE STRATURILOR ELECTRICE ALE
STRATURILOR SUBIRI DE ZnSxSe1-x
Popa Mihail, dr. n tiine fizico-matematice, conf. univ., USARB
ZnSxSe1-x thin films (x = 0, 0.2, 0.4, 0.5, 0.6, 0.8, 1.0) were prepared from thermal evaporation method in
quasi closed volume with a thickness between 0.2 and 1.0 m.
Thermal activation energy determined from the dependencies ln = f (103/T) type were between 0.43 eV 1.89 eV (for T > 300 K) and 0,132-0,403 eV ( for T < 300K). Explaining the mechanism of electron transport in
polycrystalline ZnSxSe1-x thin films is based on the Efros-Shklovskii and Mott models.
We have studied the current-voltage characteristics of In - ZnSxSe1-x - In type systems and the obtained
results were represented in the Schottky coordinates which have been shown to be linear. By extrapolating the
linear portion of curve lnJ = f(U1/2) for U 0, was determined the height of the barrier potential at the metalsemiconductor interface. The values found for the 0 accord well with those found for the ZnSe and ZnS
crystals.
INTRODUCERE
Cercetrile ntreprinse de diferii autori asupra proprietilor electrice ale straturilor subiri de ZnSe i ZnS
au evideniat deosebiri importante ale acestora fa de cele ale materialului masiv [1, 2], pe de o parte, i o
dependen nsemnat a acestor proprieti de condiiile de obinere ale straturilor, pe de alt parte [3, 4].
Obiectul cercetrilor ntreprinse de noi const n studierea proprietilor electrice ale straturilor subiri de
ZnSxSe1-x. Scopul principal urmrit a fost acela de a gsi unele corelaii ale rezultatelor experimentale obinute
funcie de structura i condiiile de preparare ale acestor straturi. Dintre proprietile care caracterizeaz din

17

punct de vedere electric straturile subiri de ZnSxSe1-x am studiat conductivitatea electric i caracteristicele
curent tensiune ale heterostructurilor de tipul metal / semiconductor / metal.
DETALII EXPERIMENTALE
Prin metoda evaporrii termice n volum cuasinchis au fost preparate straturi subiri de ZnSxSe1-x (x = 0;
0,2; 0,4; 0,5; 0,6; 0,8; 1,0) cu grosimi cuprinse ntre 0,2 i 1,0 m.
Pentru studiul dependenei de temperatur a conductivitii electrice s-au folosit celule de msur de tip
suprafa cu electrozi sub form de straturi subiri cu grosimi de 1 2 m, depui pe suport prin evaporare
termic n vid nainte sau dup depunerea stratului. Distana dintre electrozi a variat ntre 2 5 mm.
Pentru studiul caracteristicelor curent-tensiune s-a folosit un dispozitiv cu dou sonde care contacteaz
celulele de tip sandwich. Pentru confecionarea acestor celule la nceput se depune primul electrod de In pe
suportul de sticl, dup care urmeaz depunerea stratului subire de ZnS xSe1-x i n final al II-lea electrod de In
pe direcie perpendicular la primul electrod. Ridicarea caracteristicelor curent tensiune s-a fcut cu ajutorul
unui electrometru tip KEYTHLEY 6517A.
REZULTATE I ANALIZ
Studiul influenei temperaturii asupra conductivitii electrice a straturilor subiri semiconductoare ofer
informaii nu numai asupra mecanismelor de conducie care acioneaz n straturile respective, dar poate pune n
eviden i eventualele modificri de structur care pot avea loc n strat n procesul nclzirii acestora.
Pentru straturile subiri de tip ZnSxSe1-x dependena de temperatur a conductivitii electrice a fost
studiat n timpul unor tratamente termice, constnd dintr-o o serie de nclziri i rciri succesive (cu rata de
temperatur 6K/min) efectuate n domeniul de temperaturi 300 500K.
n Fig. 1-2 sunt reprezentate dependenele ln = f(103/T) pentru unele straturi subiri policristaline de
ZnSxSe1-x (d = 0.15 0.99m), preparate prin metoda evaporrii n vid, pe suporturi nenclzite de sticl (Tsup =
300K), cu rata de depunere rd = 1.3 1.6nm. n timpul primei nclziri are loc o cretere accentuat a
conductivitii electrice, iar spre sfrit creterea lui se mai diminueaz, ca la final s rmn o valoare
constant. n timpul primei rciri, ct i n urmtorul ciclu de nclzire-rcire curbele devin reversibile i prezint
dou poriuni distincte:
- prima poriune, situat n domeniul temperaturilor mici, n care se presupune c straturile prezint o
conducie extrinsec;
- a doua poriune, n care se consider conducia intrinsec, situat n domeniul temperaturilor ridicate.
n Fig. 3 sunt reprezentate dependenele de tip ln = f(103/T) (II nclzire) pentru toate straturile cu
valorile x = 0; 0,2; 0,4; 0,5; 0,6; 0,8; 1,0. Se observ c odat cu creterea lui x conductivitatea se deplaseaz n
domeniul valorilor mai mici, iar panta acestor dependene crete. Din pantele curbelor ln = f(103/T) n
domeniul conduciei intrinseci i extrinseci, folosind relaia
(1)
[ln - ln] , eV ,
E = 0,1725

10 3 10 3
T1 T2

se poate determinat energia de activare termic.


n domeniul conduciei intrinseci (Fig. 3) au fost determinate valorile E1, care n domeniul de
temperaturi T > 300K, n funcie de x variaz de la 0.43 eV (pentru x = 0) pn la 1.89 eV (pentru x = 1) (Tabel
1). Aceste valori sunt n bun concordan cu cele gsite i de ali autori [5-8].

Fig. 1. Dependena de temperatur a conductivitii


electrice pentru proba de ZnS0,2Se0,8 .

Fig. 2. Dependena de temperatur a conductivitii


electrice pentru proba de ZnS0,5Se0,5.

18

Fig. 3. Dependenele de tip ln = 103/T (II nclzire)


pentru straturile de ZnSxSe1-x

Tabel 1. Valorile energiei de activare termic pentru straturile subiri de ZnS xSe1-x
0
0,2
0,4
0,5
0,6
0,8
1,0
x
0,43
0,57
0,74
1,05
1,34
1,62
1,89
E1, eV
0,13
0,18
0,24
0,30
0,34
0,39
0,43
E2, eV
Prezena poriunii determinate de conducia extrinsec n dependenele de tip ln = f(103/T) ne conduce la
ideea c n straturile studiate sunt prezente nivele energetice adiionale, localizate adnc n interiorul benzii
interzise. n cristalele de ZnSe, defectele native sunt atomii interstiiali de zinc (Zni) i vacanele de seleniu (VSe).
Nivelele donore, Zni, sunt situate mai jos de minimul benzii de conducie ( Ed = 0,90eV) [1], iar nivelele
acceptoare, VSe, sunt localizate mai sus de marginea superioar a benzii de valen ( Ea = 0,01eV) [9, 10]. n
domeniul de temperaturi (kBT = 0.026 0.043eV) impuritile puin adnci (donorii i acceptorii) sunt ionizate
termic [9, 10] i nivelul Fermi este situat aproape de mijlocul benzii interzise.
Din pantele curbelor ln = f(103/T), n domeniul conduciei extrinseci (Fig. 3) au fost determinate valorile
energiei de activare termic, E2, care variaz ntre 0.132 eV i 0.403 eV, n domeniul de temperaturi T < 300K
(Tabel 1). Probabil, aceste valori pot fi atribuite unor complexe defect impuritate de tip Zni VSe [7].
Valorile foarte mici ale energiei de activare termic E2, obinute la temperaturi mici, indic c saltul
purttorilor de sarcin din strile localizate n interiorul i exteriorul gropii Coulomb poate fi mecanismul de
transport dominant din aceste straturi, iar conducia poate fi explicat pe baza modelelor Efros-Shklovskii i
Mott pentru transportul in salt n straturile subiri cu rezisten mare la temperatura mici [11].
Pentru a obine noi informaii referitoare la natura mecanismului conduciei electrice n straturile subiri
de ZnSxSe1-x, pentru un numr mare de eantioane preparate n condiii experimentale diferite, au fost studiate
caracteristicele curent-tensiune ale unor sisteme de tip sandwich metal semiconductor metal (Fig. 4).
Fig. 4. Caracteristica curent-tensiune pentru structura de
tip In-ZnS0,5Se0,5-In
n Fig. 4 este prezentat caracteristica curenttensiune pentru sistemul de tip In ZnS0,5Se0,5 In.
Analiznd aspectul acesteia putem distinge dou poriuni
distincte:
- prima poriune, care este caracterizat printr-o
dependen liniar a intensitii curentului n funcie de
tensiunea aplicat i care respect legea lui Ohm;
a doua poriune, care prezint o cretere aproape
exponenial a intensitii curentului cu tensiunea aplicat.
Fig. 5. Dependena lnJ=f(U1/2) pentru sistemul de
tip sandwich In-ZnS0,5Se0,5-In
n cazul n care mecanismul de conducie este de tip
Richardson-Schottky, densitatea de curent se exprim prin
relaia [10, 11]:

19

unde A este constanta efectiv Richardson-Dushman


iar 0 este nlimea barierei de potenial de la interfaa metal-semiconductor i me masa efectiv a purttorilor
de sarcin.
Logaritmm expresia (2) i obinem

Pentru eantioanele cercetate de noi caracteristicele curent-tensiune au fost reprezentate n coordonate


Schottky (lnJ, U1/2) i ele s-au dovedit a fi liniare. Prin extrapolarea poriunii liniare a unei curbe lnJ = f(U1/2)
(Fig. 5) pentru

U 0 se poate determina nlimea barierei de potenial de la interfaa metal-semiconductor

n tabelul 2 sunt indicate unele valori ale lui 0, calculate pentru mai multe eantioane de tip tip In
ZnS0,5Se0,5 In.
Tabel 2. Valorile nlimii barierei de potenial pentru sistemul In-ZnSxSe1-x-In
x
d (m)
lnJRS (A/cm2)
0 (eV)
0
0.55
6.20
0.677
0,2
0.67
7.50
0.677
0,4
0.77
8.75
0.678
0,5
0,55
8.50
0,678
0,6
0.50
9.10
0.678
0,8
0.60
8.90
0,679
1,0
0,80
9.30
0.679
Valorile gsite pentru 0 concord bine cu cele gsite pentru cristalele de ZnSe i ZnS [10-11]. Aceasta
se poate explica prin faptul c n cadrul sistemelor sandwich contactul dintre cristalite poate influena mai puin
mecanismul conduciei electrice.
CONCLUZII:
Au fost studiate dependenele de temperatur ale conductivitii electrice ale straturilor subiri de
ZnSxSe1-x. Energia de activare termic, determinat din dependenele de tip ln = f (103/T), au fost cuprinse ntre
0.43 eV - 1.89 eV (for T > 300 K) and 0,132-0,403 eV ( for T < 300K). Explicarea mecanismului transportului
electronic n straturile subiri policristaline de ZnSxSe1-x se face pe baza modelelor Efros-Shklovskii i Mott.
Au fost studiate caracteristicele curent-tensiune ale unor sisteme de tip In ZnSxSe1-x In, iar rezultatele
obinute au fost reprezentate n coordonate Schottky (lnJ, U1/2), care s-au dovedit a fi liniare. Prin extrapolarea
poriunii liniare a unei curbe de tip lnJ = f(U1/2), pentru U 0, s-a determinat nlimea barierii de potenial
de la interfaa metal-semiconductor. Valorile gsite pentru 0 concord bine cu cele gsite pentru cristalele de
ZnSe i ZnS.
BIBLIOGRAFIE:
1. AIIBVI, . .. . : - , 1980.
2. , ..; , .. .
: - , 1984.
3. Harbeke, G. (Ed.). Polycrytalline Semiconductors: Physical Properties and Applications. Springer, Berlin,
1985.
4. Greenaway, D.L.; Harbeke, G. Optical Propertiess and Band Structure of Semiconductors. Pergamon Press,
Oxford, 1988.
5. Venkata, Subbaiah Y.P.; Ramakrishna, Reddy K.T. Structural behaviour of ZnSxSe1x films deposited by
close-spaced evaporation. In: Materials Chemistry and Physics, 92 (2005), p. 448452.
6. Ambrico, M.; Perna, G.; Smaldone, D.; Spezzacatena, C.; Stagno, V. and Capozzi, V. Structural and optical
parameters of ZnSxSe1x films deposited on quartz substrates by laser ablation, Semicond. Sci. Technol. 13
(1998), p. 14461455;
7. Venkata, Subbaiah Y.P.; Prathap, P.; Reddy, K.T.R.; Mangalaraj, D.; Kim, K. and Junsin, Yi, Growth and
characterization of ZnSxSe1x films deposited by close-spaced evaporation. In: Journal of Physics D: Applied
Physics, 40 (2007), p. 3683-3688;
8. Ganguly, A.; Chaudhury, S. and A.K., Pal. Synthesis of ZnSxSe1x (0 < x < 1) nanocrystalline thin films by
high-pressure sputtering. In: Journal of Physics D: Applied Physics, 34 (2001), p. 506-513.
9. Bhargava, R. (Ed.), Properties of Wide Bandgap II VI Semiconductors. London, Inspection, 1997.
10. Jain, M. (Ed.), II VI, Semiconductor Compounds, World Scientific, Singapore, 1993.
11. Shklovsky, B.I.; Efros, A.L. Electronic Properties of Doped Semiconductors. Moscow: Nauka, 1979.

20

CONFERIREA UNEI MICRO-GEOMETRIEI PRESCRISE A SUPRAFEELOR METALICE N


SCOPUL SPORIRII INTENSITII CURENTULUI DE EMISIE TERMO-ELECTRIC
Guzgan Dorin, asistent universitar, USARB
The paper presents results of experimental investigations aimed at the construction of cathodes for
thermo-electronic emission. The method of pulsed electrical discharge machining was applied to confer a
prescribed micro-geometry of the cathode active surface. Modification of the cathode surface micro-geometry
involves the extraction and freezing of the Taylor cone meniscuses that are electric field and heat concentrators
applied in order to increase the intensity of the thermo-electronic emission current.
Key words: electrical discharges, micro-geometry, meniscus, emission, thermo-electrons.
INTRODUCERE
Fenomenul de emisie termo-electronic a fost descoperit n anul 1881 de ctre cunoscutul inventator
american Thomas Alva Edison (1847-1931) [1, 2]. Acest fenomen i-a gsit o utilitate vast n construcia de
aparate, se aplic pe larg n tuburile electronice, instalaii mari de prelucrare cu fascicol de electroni s. a. [9].
Emisia termo-electronic constituie o surs de sarcini libere, care apar la nclzirea unui metal. Cantitatea de
cldur primit de metal se transform n energie de micare a particulelor elementare din care este alctuit.
Electronii liberi din interiorul unui material metalic acumulnd o energie cinetic mai mare, pot prsi metalul n
urma nclzirii acestuia. Materialul din care este confecionat electrodul (catod) trebuie s posede proprieti
fizice care vin n asigurarea unei emisii eficiente i anume ca lucrul de ieire al electronilor s fie minim.
Numrul de termo-electroni emii depinde puternic de gradul de nclzire a metalului de execuie a catodului
[3]. Experimental i teoretic s-a stabilit, c intensitatea curentului de emisie termo-electronic este exprimat cu
relaia Richardson-Dushman:
(1)
n care: A* este o constanta, W este energia de extracie iar k prezint constanta lui Boltzmann. Din relaia (1) se
observ deci, c intensitatea curentului de emisie termo-electronic este funcie exponenial de temperatur.
Pentru a spori intensitatea curentului de emisie termo-electronic se aplic metoda sporirii temperaturii de
nclzire a catodului, ns aceast cale este limitat, deoarece la o anumit temperatur catodul se topete i ca
rezultat are loc distrugerea lui. De asemenea, este posibil de a spori intensitatea curentului de emisie prin mrirea
diferenei de potenial dintre electrozi (catodul n calitate de emitor i anodul n calitate de receptor) pentru a
zmulge din catod electronii liberi i a le conferi particulelor emise vector al micrii spre anod, precum i de a
spori gradul de vidare din camera de lucru n scopul evitrii ciocnirii acestor particule n drumul su spre anod cu
molecule i atomii existeni n interstiiu.
Din relaia lui Boltzman rezult, c puterea de emisie este direct proporional cu aria suprafeei active
de emisie (adic PE~S) i poate fi exprimat cu relaia:
(2)
n care: PE-puterea de emisie; T temperatura catodului; k - constanta lui Boltzman; A aria suprafeei active;
constatnta lui Stefan-Boltzmann;
Din aceste considerente, se impune modificarea micro-geometriei suprafeei catodului n vederea
sporirii ariei suprafeei active a termo-catodului destinat emisie termo-electronice.
Aplicnd metoda descrcrilor electrice n impuls, n condiii optimale, pentru fiecare material, pe
suprafaa catozilor destinai emisiei termo-electronice se creeaz o micro-geometrie prescris, modificat care
conduce la sporirea ariei suprafeei active prin extragerea i congelarea unor asperiti conice, numite i
meniscuri Taylor [4, 6-8].
METODICA CERCETRILOR EXPERIMENTALE
Cercetrile experimentale s-au efectuat n mediu aer (condiii normale) la descrcri solitare. n calitate
de material pentru executarea catozilor destinai emisiei se aplicau fire executate din aliaj de W(90%)+Re(10%),
cu diametrul (d) de 0,9 mm.
Pentru efectuarea cercetrilor privind modificarea micro-geometriei suprafeelor pieselor prin
dezvoltarea undelor capilare pe suprafaa metalului lichid n condiiile descrcrii electrice n impuls [5] a fost
utilizat o instalaie compus din: un generator de impulsuri de curent, blocul de dirijare, blocul de amorsare,
mecanisme de poziionare i dirijare a interstiiului [8].
Conform metodicii descrise n [7-8] au fost extrase de pe suprafeele metalice asperiti sub form de
con Taylor (fig. 1) de pe suprafeele lateral a firelor din W(90%)+Re(10%). Piesa era conectat n circuitul de
descrcare n calitate de anod. Parametrii energetici ai descrcrii electrice n impuls: U=80V (tensiunea de
ncrcare a bateriilor de condensatoare), Cc=600F (capacitatea bateriei de condensatoare), S=0,3 mm (mrimea
interstiiului), d=0,9 mm, n=1 (numrul de descrcri electrice n impuls pentru o unitate de suprafa).

21

Fig. 1. Vedere general a formaiunilor


extrase prin metoda descrcrilor electrice
n impuls
n scopul construirii caracteristicilor
volt-amperice de emisie se pregteau cteva
perechi de catozi: unii neprelucrai, alii
avnd la suprafa formaiuni conice extrase
conform metodicii [7-8]. Ulterior firele erau
introduse pe rnd n camera de lucru (tubul
M, fig. 2).
Cu ajutorul schemei poteniometrice, constituit din
bateria B i poteniometrul R (fig. 2), ntre electrozi se aplic
tensiunea U care se msoar cu ajutorul voltmetrului V.
Catodul (K) este parcurs de curent electric (intensitatea cruia
se msura cu miliamperimetrul mA), care n rezultat se
nclzete (Efectul Joule-Lentz). Catodul incandescent emite
electroni care sub aciunea cmpului electric (creat de
diferena de potenial U) capt o micare ordonat.
Intensitatea curentului termo-electronic I se msoar cu
ajutorul microampermetrului A. Pentru a evita oxidarea
catodului i ciocnirile electronilor emii de el cu moleculele de
aer n camera de lucru (tubul M, fig. 2) preventiv se crea vid la
presiunea 10-5 mmHg. Pentru obinerea unor rezultate veridice se
recomand crearea n camera de lucru unui grad mai nalt de
vidare.
Fig. 2. Schema principial a instalaiei
pentru emisie termo-electronic
REZULTATE EXPERIMENTALE A EMISIEI TERMO-ELECTONICE
Pentru valori mici ale diferenei de potenial aplicate U, intensitatea curentului I crete la nceput
lent. Aceasta se explic prin faptul, c la valori mici ale diferenei de potenial ntre electrozi nu toi
electronii emii de catod ajung la anod, fiind respini de norul de electroni (sarcina spaial negativ), situat
n spaiul dintre anod i catod. Cu creterea n continuare a diferenei de potenial U are loc dispersarea
norului de electroni i intensitatea curentului de emisie I crete. Pentru U=Us (tensiune de saturaie)
intensitatea curentului de emisie nu mai crete, deoarece toi electronii emii de ctre catod ajung la anod.
Intensitatea curentul termo-electronic I va crete odat cu mrirea diferenei de potenial U numai pn
la valoarea intensitii curentului de saturaie I s care se calculeaz cu formula (3):

I s ensec

(3)

Experienele demonstreaz c nsec i Is cresc foarte repede odat cu sporirea temperaturii catodului
conform relaiei (2) P E~S. Raportul dintre intensitatea curentului de saturaie i aria specific a suprafeei
A ne vorbete despre densitatea curentului de saturaie js:

Is
js
A

(4)

Densitatea curentului de saturaie a catodului satisface formula lui Richardson-Dechmen:

js B /T 2 e
/

L
kT

(5)

n care: B = 120(1-R)A/(cm K ) i R coeficientul de reflexie a electronilor de conducie de la bariera de


potenial de lng suprafaa emitorului.
La temperatura camerei, emisia termo-electronic este neglijabil i, pentru eliberarea unui electron din
metal numai sub aciunea unui cmp electric exterior, ar fi necesar ca intensitatea acestuia s fie de ordinul 1010 1011 V/m. Experimental s-a constatat, c emisia electronic la temperatura mediului ambiant, numit i emisie la
rece, poate avea loc i pentru intensiti ale unui cmp exterior de ordinul 107- 109 V/m. Acest fapt poate fi
explicat numai prin modificarea formei barierei de potenial n prezena cmpului electric exterior i, n
consecin, a existenei posibilitii ca unii electroni s o strpung prin efect tunel [1-3].
n continuare, sunt prezentate caracteristicile volt-amperice (fig. 3-5) a catozilor cercetai pentru a
nregistra valorilor intensitii curentului de termo-emisie electronic. Diametrul catozilor, valorile mrimii
interstiiului S i gradul de vidare se pstrau constante, temperatura de nclzire constituia 1000oC (cazul I), 1200
o
C (cazul II) i 1600 oC (cazul III).

22

Cazul I: Diferena de potenial Uk=const. (tensiunea de alimentare a catodului); U (diferena de potenial


dintre electrozi) se modifica conform graficului din fig. 3 n limitele 0-1050 V.

Fig. 3. Caracteristica volt-amperic de emisie:


S=10 mm; Tk=1000 oC;

Fig. 4. Caracteristica volt-amperic de emisie


S=10 mm; Tk=1200 oC;

Cazul II: Diferena de potenial Uk=const.; U se modific n aceleai limite: 0-1050V (fig. 4).
Cazul III: Diferena de potenial Uk=const.; U se modific conform datelor graficului prezentat n fig. 5.
Fig. 5. Caracteristica volt-amperic de emisie. S=10
mm; Tk=1600 oC;
Comparnd rezultatele experimentale pentru
cazurile I-III (caracteristicile volt-amperice, fig. 3-5)
putem conclude, c catozii care au fost prelucrai
prin metoda descrcrilor electrice n impuls au
prezentat o intensitate a curentului de saturaie
pentru emisia termo-electronic mai mare de circa 46 ori fa de catozii neprelucrai prin aceast metod.
Rezultatele prezentate pot varia n dependen de
regimurile i condiiile stabilite (mrimea
interstiiului, temperatura de nclzire a catodului, dimensiunile i numrul de asperiti raportate la o unitate de
suprafa, condiiile de extragere a meniscurilor Taylor, gradul de oxidare a suprafeei prelucrate, diametrul i
materialul firului pentru executarea catodului, gradul de vidare a camerei de lucru, s.a.) pentru efectuarea
experimentului.
CONCLUZII:
Din rezultatele cercetrilor executate concludem c:
- emisia termo-electronic este funcie de proprietile materialului de execuie a catodului, aria suprafeei de
emisie i temperatura de nclzire a lui;
- sporirea intensitii curentului de emisie termo-electronic se poate realiza prin sporirea ariei suprafeei
active a catozilor prin extragerea meniscurilor inclusiv cu aplicarea descrcrilor electrice n impuls;
- metoda aplicat permite sporirea intensitii curentului de emisie termo-electronic de circa 4-6 ori n raport
cu catozii a cror suprafee active nu au fost prelucrate prin aceast metod;
- pentru a obine rezultate veridice despre mrimea intensitaii curentului de emisie termo-electronic este
necesar crearea n camera de lucru a unui grad mai nalt de vidare.
BIBLIOGRAFIE:
1. Detlav, A.A.; Iavorski, B.M. Curs de fizic. Chiinu: Ed. Lumina, 1991, p. 193-195.
2. Traian, I. Creu. Fizica curs universitar. Bucureti: Ed. Tehnic, 1996, p. 210- 213.
3. http://www.phys.ubbcluj.ro/~anghels/teaching/Plasma/Capitole_curs/CAP2.pdf;
4. , ..; , ..; , ..; , ..
. B: , 2004, 4.
5. Topal, P.; Stoicev, P. Tehnologii de prelucrare a materialelor conductibile cu aplicarea descrcrilor electrice
n impuls. Chiinu: TEHNICA INFO, 2008, p. 265;
6. Wilson Perry. Formation of Taylor Cones on a Molten Metal Surface Followed by Ion Injection Into the
Vacuum, SLAC, 2007.
7. Topal, P.; Guzgan, D. The Technology of Surface Micro Geometry Modifications Via Application of Electric
Discharges in Impulse. Advanced Manufacturing Tehnologies. Ed. 14. Ceepus III. Sozopol. Bulgaria 2630.06.2013.
8. Topal, P.; Guzgan, D.; Rusnac, V. Tehnologii de formare a suprafeelor pentru emisie electronic. n: Lucrri
tiinifice Volumul 38, Inginerie agrar i transport auto. Chiinu 2013, p. 196-201.
9. http://www.dumitruneagu.ro/pdf/(6.3.2)APLICATIIale%20FE.pdf.

23

REGIUNEA DE DEZVOLTARE NORD N CADRUL PIEEI ENERGETICE


A PEPUBLICII MOLDOVA
Timofte Natalia, magistru n tiine energetice, cercet. t., Institutul de Energetic al AM
Some aspects of energy development for the North region in Moldova in the national energy market and
the achievement of commitments undertaken by Moldova's accession to the Energy Community on training
internal energy market.
Key words: regional development, energy, fuel, market rates, Moldova, Energy Community.
Regiunea de dezvoltare Nord (n continuare RDN) pe teritoriul Republicii Moldova (n continuare RM),
conform Legii RM nr. 438 din 28.12.2006 cu modificrile ulterioare, include municipiul Bli i raioanele
Briceni, Dondueni, Drochia, Edine, Fleti, Floreti, Glodeni, Ocnia, Rcani, Sngerei i Soroca cu populaia
de circa un milion de locuitori, 29% din totalul populaiei RM. Aceast regiune de dezvoltare este una din cele
ase pe teritoriul RM menite s sprijine nemijlocit dezvoltarea social-economic n corespundere cu politica de
dezvoltare regional, orientat spre planificarea i realizarea unei dezvoltri social-economice teritoriale
echilibrate.
n cele ce urmeaz, sunt reflectate unele aspecte ale situaiei privind dezvoltarea energetic a RDN n
cadrul pieii energetice a RM n contextul implementrii angajamentelor asumate n cadrul Tratatului de
Constituire a Comunitii Energetice ce prevd realizarea a acquis-ului comunitar, dezvoltarea interconexiunilor
de transportare a resurselor energetice, sporirea eficienei energetice i utilizarea resurselor regenerabile de
energie.
Astfel, n procesul de dezvoltare i perfecionare a cadrului legislativ i normativ n domeniu au fost
deja transpuse o serie de Directive europene i elaborate n baza lor un ir de acte legislative printre care Lega cu
privire la energia termic i promovarea cogenerrii, Legea nr. 92 din 29. 05. 2014, legea privind modificare i
completarea Legii cu privire la gazele naturale, Legea nr. 125 din 11.07 2014 i a Legii cu privire la energia
electric, nr. 27 din 13.03.2014, menite s asigure funcionarea i dezvoltarea sistemului energetic naional n
conformitate cu cerinele economiei de pia. Pe parcursul ultimilor ani n RM au avut loc schimbri majore i n
funcionarea i dezvoltarea pieei energetice, n particular, pot fi menionate urmtoarele:
- Ucraina care a sistat exportul de energie electric n PM la 28.11.2014 care asigura cu energie electric
preponderent consumatorii RDN;
- ncepnd cu luna decembrie 2014 consumatorii din RM sunt asigurai cu energie electric, procurat de la
Centrala Electric de la Cuciurgan, n volum de circa 75%, iar 25% provin de la sursele locale, inclusiv CETNord, mun. Bli, 6,1%;
- la 21.05.2015 la Chiinu a fost semnat Memorandumul privind realizarea proiectelor necesare
interconectrii reelelor de gaze naturale i de energie electric din RM i Romnia, n particular LEA-400kV
Bli-Suceava;
- n stadiu de elaborare se afl proiectele construciei staiei back-to-back care s permit importul de
energie electric din Romnia, proiectul de extindere a conductei de gaz Iai-Ungheni pn la Chiinu i
modernizarea CET-Nord din mun. Bli.
La nceputul anului 2015 pe piaa energetic a RM activau 268 de titulari de licen care asigur
activitatea de import, transport, producere, distribuie i consum de energie i combustibil.
Ca exemplu, n anul 2013, n ar, conform datelor statistice disponibile la moment, au fost consumate
2160 mii t.e.p., din care:
- surse interne 125 mii t.e.p.: petrolul i gazele naturale extrase n raionul Cahul, deeurile lemnoase
obinute n rezultatul curirii sanitare a livezilor, viilor, pdurilor, energia hidro produs la nodul hidroenergetic
Costeti de pe rul Prut. Aceste resurse constituie 5,8% din total resurse energetice consumate n ar;
- surse de import total 94,2% din care crbune 8,7%, motorin 21,2%, pcur - 1,4%, benzin auto
- 8,1%, gaze naturale - 35,4%, gaze lichefiate - 4,4%, lemne de foc - 3,0%, energie electric - 12,1%, alte - 5,0%.
Din total resursele energetice pe ar 30,0% au fost transformate din alte tipuri de energie, 60,3% pentru necesiti tehnologice de producie i 9,7 % - alte. Pe parcursul perioadei, att ct i dup aderarea la
Comunitatea Energetic, consumul de energie i combustibil anual per/capita a fost practic stabil - n mrime de
circa 600 kg.e.p. de combustibil, de gaze naturale - 300 m3, de energie electric - 1200 kWh. (tab. 1).
Producerea energiei electrice n RM a fost practic stabil - n mrime de circa 1 mlrd. kWh/an. Indicii
consumului de combustibil i energie n perspectiv nu se vor modifica esenial ntruct pe parcursul a ultimilor
25 ani numrul populaiei RM (partea dreapt a rului Nistru) a fost mereu n descretere, s-a redus cu circa 3%.
Conform prognozei demografice pentru RM pn n anul 2050 efectuat de Organizaia Naiunilor Unite,
Departamentul de Afaceri Economice i Sociale, se prevede scderea n continuare a numrului populaiei, ctre
anul 2025 - pn la 3291 mii locuitori (7,4% ), iar pn n anul 2050 - pn la 2734 locuitori ( 31,1%), fa de
anul 2014.
PIAA ENERGIEI ELECTRICE
Cadrul legal al pieii de energie electric n RM este asigurat de Legea Cu privire la energia electric
din 2009 cu modificrile ulterioare. Aceast Lege creeaz cadrul necesar aplicrii Directivei 2003/54/CE a

24

Parlamentului European i a Consiliului din 26 iunie 2003, privind normele comune pentru piaa intern a
energiei electrice. n piaa energiei electrice a RM sunt supuse licenierii 5 genuri de activitate.
Conform datelor Ageniei Naionale Pentru Reglementare n Energetic (n continuare ANRE) la
nceputul anului 2015 n piaa energiei electrice a RM activau 23 de titulari de licen, 9% din total pe piaa
energetic. Producerea energiei electrice la centralele autohtone pe parcursul a ultimilor 20 ani a fost n scdere.
De exemplu, n anul 2014 au fost produse doar 788 mil. kWh., preponderent - la CET-2 n mun. Chiinu, 76,3%
( fig. 1).
Consumul de energie electric in perioada analizat a fost mereu n mic cretere. n anul 2013
consumul a fost de 4236 mil. kWh, din care au fost vndute populaiei - 43,3%, consumat n: industrie - 27,8%,
comer i servicii comunale - 23%, agricultur - 1,3%, transporturi - 1,4%, construcii - 0,4%, alte lucrri i
necesiti - 2,6%.
Tarifele ns au avut o dinamic mereu n cretere att la producere, transport, distribuie, ct i la
consum final. De exemplu, tarifele de livrare a energiei electrice n perioada examinat au variat de la 6,22
ceni/kWh pn la 13,26 ceni kWh. (fig. 2).
PIAA GAZE NATURALE
Cadrul legal al pieei de gaze naturale n RM a este asigurat de Legea Cu privire la gaze naturale din
2009 cu modificrile ulterioare. Aceast lege asigur aplicarea Directivei 2003/55/CE a Parlamentului European
i a Consiliului din 26 iunie 2003 privind normele comune pentru piaa intern a gazelor naturale. n piaa
gazelor naturale sunt supuse licenierii 5 genuri de activitate. Valabilitatea licenelor este de 25 ani.
Conform datelor ANRE la nceputul anului 2015 n piaa de gaze naturale a RM activau 60 titulari de
licen, 22% din totalul pe piaa energetic.
Tab. 1. Dinamica consumului de combustibil i energie per/capita
Populaia la 1 ianuarie,
mii locuitori
Producerea
energiei
electrice, mil. kwh
Importul
energiei
electrice, mil. kwh
Consumul
energiei
electrice, mil. kwh
Resurse energetice total,
mii tone e.p., inclusiv:
- proprii
- consumat, total
inclusiv:

2000

2005

2009

2010

2011

2012

2013

2014

3635,1

3589,9

3563,7

3560,4

3559,5

3559,5

3557,6

3555,2

720

1000

866

888

854

843

748

788

2426

2465

2934

3033

3144

3278

3331

3342

3145

3465

3800

3921

3999

4121

4979

4130

1985,9

2464

2312

2401

2442

2358

2391

58,8
1852,9

59,5
2279,9

124
2071

104
2209

116
2237

123
2145

125
2160

1315

1029,9

1089,8

1036,3

989,6

945,4

0,635

0,581

0,620

0,628

0,602

0,607

0,366

0,289

0,306

0,291

0,278

0,266

1,170

1,115

1,152

1,170

1,184

1,191

904,4
gaz natural, mil m3
Consumul mediu anual per/capita de:
- resurse energetice, tone
0,509
e.p., inclusiv:
0,248
- gaz natural, mii m3
- energie electric, mii
0,931
kwh
5000

4630
4335

4500
4000

3539

3471

3500
3000

3660

2426
1757
1714

1000

1159

1915

1467

887 720

500

875

690

2934

2424 2465

2316
1615

1525

1043 953 842 899


685

701

696

831

1999

2000

2001

2002

2003

2004

2611
1876

1367

1456

1099

905

904

866

888 854

1000 958

15
1998

3278

2005

3342

2433
2479

2688

1997

3144 3331

1826

1778 1736

1447

974

2152

2955 3008 3033

2703

2522

2653
2500

1500

2923

2951

3362

2000

3827 3860 3800

3465
3269 3364 3255
3145 3195

4055 4079 4130


3921 3999

2006

2007

Total procurri

Importul+ CTE Moldoveneasca

Imortul de energie

Producia energiei electrice

4
2008

788

666

776

748

731

2011

2012

2013

2014

25

0
2009

846

2010

CTE Moldoveneasc, Transnistria

25

959

0,269

Fig. 1. Evoluia producerii,


importului i procurrilor de energie
electric n RM n perioada anilor
1997-2014, mil. kwh., Sursa ANRE
n anul 2014 au fost livrate
consumatorilor 959 mil. m. 3 gaze
(fig.3), din care: populaiei - 28,9%;
sectorului energetic - 41,4%; altor
ageni economici - 25,3%; instituii
publice - 4,4%.
Consumul de gaze naturale
n RM este n scdere (fig. 3).
Tarifele de procurare a gazelor
naturale au fost mereu n cretere - de
la 98,6 $ US/ 1000 m.3 n anul 1997

pn la 397,6 $US/1000 m.3 n anul 2014 sau majorat de 4,3 ori fa de anul 1997 (fig. 4). Pn n anul 2015,
concernul S.A.D. Gazprom din Federaia Rus a fost unicul furnizor de gaze naturale pe piaa din RM.
Procurrile totale de gaze naturale n ultimii ani au fost relativ stabile - circa 1 mlrd. m.3/an. Pe data de
4.09.2014 au fost ncepute livrrile de gaze naturale din Romnia prin conducta Ungheni Iai n volum anual
de circa 0,1%.
Fig. 2. Tarifele de livrare a
energiei electrice consumatorilor
14,17
RM n anii 1997-2014, /kWh,
13,34
13,26
12,82
11,97
12,36
Sursa ANRE
11,63
16

14

12

12,4

9,59

10

12,07

11,33 10,81

10,83

8,35
8,71

7,93
6

5,22 5,16

4,67

4,17

5,66 5,53

5,5

5,15 5,27

6,26

5,93

5,04 4,81 4,95 4,96

4,52

6,08
5,33

5,61 5,46

RED Union Fenosa

31.12.2014

31.12.2013

15.05.2012

20.04.2011

19.01.2010

01.08.2008

19.01.2008

03.08.2007

31.12.2006

31.12.2005

31.12.2004

15.07.2003

01.07.2003

01.08.2002

11.09.2001

21.03.2000

25.06.1999

15.12.1998

09.09.1998

05.06.1997

RED Nord i Nord-Vest

Tariful mediu de livrare a


gazelor naturale consumatorilor
RM a fost mereu n cretere.
De exemplu, n anul
2014 s-a majorat cu 11,5% fa de
anul 2013 (fig.4). Pe data de
4.09.2014 au fost ncepute
livrrile de gaze naturale din
Romnia prin conducta Ungheni
Iai n volum anual de circa 0,1%.

1400

1315
1200

1322

1129,9 1141,4

1108,5

1208,8
1089,8

1130,8

1050,6

1036,3
989,6

1000

959

945,3

1029,9

Fig. 3. Procurrile de gaze


naturale n RM n perioada anilor
2001-2014. (Sursa ANRE).

800

600

542,1
485,9

526,3
471,9

513,7

402,5
400

323,7

305,5

227,1

239,7

15,6

19,5

407,3

344,7

326,1
301,2

200

490,1

454,1

311,9
30,7

30,6

351,4

34,8

360,2

40,9

470,4

376,5

302,7

312,3

304,5

39,4

43,6

2007

2008

457,8

452,3

313,9

240,6

209,9

428,9

430,8

340,5

319,6

393,5

298,9

238,9

396,9
277,1

278,1

211,5

242,3

231,4
50,9

48,1

52,7

50,3

42,4

42,7

2001

2002
Total

2003

2004

2005

Sectorul energetic

2006

Ageni economici

2009

2010

2011

Gospodrii casnice

500

2012

2013

2014

Instituii publice

475,5
450,6

450
400

397,6

363,0

350

282,7

300

324,0

250

Fig. 4. Evoluia tarifelor la gaze


naturale n RM n 1997-2014,
$/1000 m. (Sursa ANRE).

199,4
200

175,8

150

98,6
100

76,3

81,6

75

85,1

50
0
01.06.1997 24.12.1998 01.07.1999 15.07.2003 01.03.2004 21.07.2006 16.02.2007 01.08.2008 11.09.2009 18.05.2010 01.10.2011 31.12.2013 31.12.2014

CONCLUZII:
1. n perioada analizat necesitile economiei i populaiei RM, inclusiv a RDN, n energie i combustibil sunt
asigurate n volum de circa 96% din import, preul crora mereu crete. De exemplu, costul gazului natural, cota
cruia n balana energetic a rii este de circa 40%, s-a majorat de 4,7 ori, la energia electric-de 2,5 ori,
consumul per/capita de gaze naturale sa redus de la 0,360 mii m3 pn la 0,310 mii m3. Consumul de energie
electric este n aceast perioad n mediu 1,15 mii kWh/per/capita ce denot stagnarea procesului de
modernizare i retehnologizare a economiei rii, consumul intern anual de resurse energetice n ar pe parcursul
ultimilor ani este practic stabil i constituie circa 2 milioane tone echivalent petrol (t e.p.), sau 0,6 t
e.p./per/capita.
2. Aderarea RM la Tratatul de Constituire a Comunitii Energetice este menit s schimbe practica tradiional
de dezvoltare a pieei energetice n RM prin trecerea la crearea unor piee comune de energie electric i gaze
naturale n Europa de Sud-Est i de integrare a acestora n piaa energetic intern a Uniunii Europene.
3. n noile condiii de dezvoltare a sectorului energetic al RM este necesar revizuirea proiectelor investiionale
anterioare privind construcia noilor centrale electrice, interconexiuni sistemice, modernizarea i extinderea

26

infrastructurii energetice prin atragerea investiiilor strine, autohtone, private i de stat. Proiectele investiionale
anterioare necesit s fie perfectate n baza noilor acte legislative n corespundere cu condiiile de pia.
Activitatea de business n sectorul energetic trebuie s reduc la minimum posibilele consecine negative n
dezvoltarea sectorului energetic al rii, s diminueze riscul i incertitudinea n obinerea rezultatelor planificate
n termenii stabilii.
4. n sectorul energetic al RM, n particular n RDN, este evident un necesar de investiii. n RM au fost iniiate
dar nu s-au implementat proiecte investiionale de generare a energiei electrice. Strategia Energetic a RM pn
n anul 2030 contureaz alte proiecte noi, cu un necesar impresionant de investiii, o estimare generalizat indic
un necesar investiional de rangul a 1 miliard USD ( Euro). Investiiile pot fi atrase de la Uniunea European (n
continuare UE) E direct, (UE, intermediar Romnia), fonduri internaionale diverse.
5. n noua conjunctur social este necesara de elaborarea de noi politici privind dezvoltarea surselor de energie
n spaiul aflrii RM, permind organelor abilitate ale statului s ia decizii corecte. n acest scop realizarea
Memorandumului de nelegere dintre RM i Romnia, privind realizarea proiectelor necesare interconectrii
reelelor de gaze naturale i energie electric din RM este menit s contribuie la implementarea proiectelor
strategice de interconectare cu UE, att n domeniul energiei electrice, ct i al gazelor naturale. Memorandumul
prevede realizarea proiectelor de importan naional: Gazoductul UngheniChiinu, interconectarea electrica
Isaccea-Vulcneti-Chiinu; Iai-Ungheni-Streni i Suceava-Bli. Proiectele de interconexiune energetic
ntre RM i Romnia vor fi implementate n perioada anilor 2015-2018. Important n situaia nou este
determinarea locului i rolului Centralei de pe teritoriul Transnistriei cu o capacitate de generare ce acoper nu
doar volumul necesar pentru consumatorii din RM, ci i pentru a exporta att n Est, ct i n Vest.
BIBLIOGRAFIE:
1. Anuarul Statistic al Republicii Moldova, Chiinu,2014.
2. Raportul de activitate al Ministerului Economiei pe anul 2014.
3. Raportul de activitate al Ageniei Naionale pentru Reglementare n Energetic a Republicii Moldova n anul
2014.
4. Strategia energetica a Republicii Moldova pn n anul 2030. n: Monitorul Oficial al RM, nr. 27-30 din
08.02.2013.
5. Balana energetic a Republicii Moldova. Biroul Naional de statistic al RM, 2014
6. Surse internet: www.statistica.md;
www.mec.gov.md; www.anre.md; www.ince.md; www.aee.md;
www.ie.asm.md www.moldelectrica.md; www.ufmoldova.com.
PROMOVAREA TRANSFERULUI TEHNOLOGIC N DEZVOLTAREA DURABIL
A AGRICULTURII
Crmaru, Valentin, dr. n tiine agricole, conf. cercet., Institutul de Ecologie i Geografie al A..M.
Key words: agriculture, innovation, technology transfer, sustainable development technologies.
Integrarea european n cadrul eficientizrii sferei de cercetare-inovare din sectorul agroalimentar
constituie un obiectiv de baz, realizarea cruia poate asigura dezvoltarea unei societi a cunoaterii, unde
informaia, managementul performant i inovaiile tehnologico-tiinifice devin tot mai importante. Necesitatea
dezvoltrii sistemului de cercetare-inovare din sectorul agroindustrial al Republicii Moldova (n continuare RM)
este un imperativ pentru asigurarea realizrii prevederilor: Strategiei naionale de dezvoltare agricol i rural
pentru anii 20014-2020; Strategiei inovaionale a RM pentru perioada 2013-2020 Inovaii pentru
Competitivitate: Programelor perspective sectoriale de dezvoltare a sectorului agroalimentar i substituirea
treptat a importului i promovarea exportului a mrfurilor i serviciilor agroindustriale moldoveneti. Realizarea
celor trasate n continuare tinde s asigure materializarea obiectivelor din cadrul prioritilor naionale pe termen
mediu.
Este cert faptul, c tiina i tehnologia reprezint sursa principal a progresului n toate sferele de
activitate uman, factorul care asigur supravieuirea i dezvoltarea durabil i care contribuie cu 80-95% la
creterea produsului intern brut (n continuare PIB). n condiiile actuale, singura cale vital ce poate asigura
dezvoltarea economic a RM i crea premise pentru creterea competitivitii economiei naionale este
implementarea modelului de dezvoltare bazat pe inovare i transfer tehnologic. Anume utilizarea eficient a
elaborrilor tiinifice este unul din factorii de care depinde dezvoltarea durabil a umanitii n mileniul trei.
Geneza procesului de transfer tehnologic i finalizarea cu succes, confirmat de difuzarea n economie a
inovaiilor, fac din procesul respectiv o problem economic complex, care se afl n strns legtur cu
obiectivele creterii economice. Transferul tehnologic este o activitate prin care resursele oferite de cercetarea
tiinific sunt folosite ca ingrediente de baz n producia bunurilor materiale de utilitate social. Agenii
economici preiau resursele de cunotine tiinifice i tehnice din cercetarea tiinific i le dezvolt n sensul
incorporrii lor n produse fizice, finite, comerciale, de pia. Organizarea transferului tehnologic i a inovrii, ca
activiti cu caracter special, bine definite i conturate n plan economic i social, reprezint o problem de
interes naional n actuala etap de modernizare i restructurare a sistemului de cercetare-dezvoltare n RM [3].

27

Atingerea acestor obiective strategice ale economiei naionale impune crearea i dezvoltarea unor entiti
organizatorice care s poat asigura un mediu optim, att pentru dezvoltarea sistemului naional de inovare, ct i
pentru transferul rezultatelor cercetrii ctre industrie i economie i n particular, ctre agricultura Moldovei.
n prezent, agricultura ocup un loc semnificativ n economia RM, iar contribuia ei n crearea PIB-ului
este la nivel de circa 13% (27,2% n 2006). Sectorul agrar contribuie la crearea PIB-ului cu aproape 50% n
volumul total al exporturilor, iar n agricultur sunt antrenai peste 40 la sut din populaia ocupat a rii.
Dac n anii 6090 ai secolului trecut obiectivele urmrite de agricultur ineau de creterea produciei n
vederea satisfacerii cerinelor alimentare, astzi se caut noi soluii, care au ca obiective protecia mediului,
realizarea unui sistem de producie viabil din punct de vedere economic, ntreinerea i valorificarea eficient a
resurselor naturale. Acest nou tip de agricultura este numit agricultur durabil, care presupune un ansamblu de
tehnici i practici ce trebuie s asigure necesarul de alimente, inndu-se cont de protecia mediului nconjurtor.
Agricultura durabil reprezint o aciune orientat pe termen lung prin care se urmrete depirea problemelor
i restriciilor cu care se confrunt agricultura convenional, societatea n general, pentru a se asigura:
viabilitatea economic; starea bun a mediului nconjurtor i acceptarea sistemului de agricultur alternativ.
Pentru implementarea agriculturii durabile trebuie s se identifice: experiena i tehnologiile avansate din
ar i de peste hotare, capabile s asigure obinerea unor produse agricole ecologice, fiind protejat mediul,
viabilitatea i securitatea economic; posibilitile tehnice, potenialul care poate asigura o dezvoltare durabil a
agriculturii; instrumentele economice, instituionale i culturale capabile n dezvoltarea i adoptarea tehnologiilor
i practicilor moderne ale agriculturii durabile.
Formarea unei agriculturi durabile presupune implementarea unui sistem de tehnologii i practici menite
s asigure necesarul de produse agricole, s creeze un sector agricol competitiv i eficient din punct de vedere
economic, care sa rspund preferinelor fluctuante ale consumatorilor, care s faciliteze dezvoltarea comerului
cu produsele agricole, protejnd mediul ambiant i resursele naturale existente. Tranziia ctre o agricultur
durabil constituie un proces ndelungat i destul de complicat, unde trebuie s se aib n vedere necesitatea de a
menine un sector agricol competitiv i eficient din punct de vedere economic.
Prosperitatea naional i standardul individual de via, care trebuie realizate n societatea cunoaterii
sunt direct legate de aplicarea eficient a tehnologiilor moderne. Potenialul de inovare al economiei este
determinat de capacitatea sistemului de a utiliza eficient realizrile tiinifice pentru dezvoltarea sa i se compune
din potenialul nvmntului i tiinei, la fel i din cel al ramurilor de producere i comercializare a mrfurilor,
tehnologiilor performante.
O barier n implementarea politicii de inovare i transfer tehnologic l reprezint lipsa unor legturi
funcionale ntre principalii actori ai procesului de inovare: institutele de cercetare, universitile i
antreprenoriatul privat. n scopul mediatizrii acestor activiti, n cadrul Academiei de tiine a Moldovei deja
de zece ani funcioneaz Agenia pentru Inovare i Transfer Tehnologic (n continuare AITT) - susintorul
logistic i financiar al procesului de inovare i transfer tehnologic.
n perioada anilor 2005-2014 AITT a contribuit la implementarea a peste 260 (5) de proiecte de transfer
tehnologic. Este necesar de menionat c din arsenalul de proiecte realizate ponderea cea mai mare o alctuiesc
cele din domeniul agriculturii, constituind cca 56%.
Actualmente cele mai rspndite forme de transfer tehnologic n agricultur sunt: procurarea
echipamentului i liniilor tehnologice pentru complexul agroindustrial, industria de procesare a produselor
agricole; investiiile directe n cazul implementrii noilor soiuri i hibrizi de plante agricole, tehnologiile noi,
modernizarea ntreprinderilor etc.; instituirea ntreprinderilor mixte, activitatea crora nu este axat preponderent
pe importul mrfurilor i leasing; comercializarea know-how-ului, a secretelor comerciale, experienei
tehnologice, documentaiei tehnice; executarea comun a lucrrilor tiinifice etc. [4].
Un exemplu elocvent de transfer tehnologic eficient poate servi proiectele implementate n cadrul
Direciei Strategice Biotehnologii agricole, fertilitatea solului i securitatea alimentar. Spre exemplu,
actualmente de ctre Institutul de Fitotehnie Porumbeni se implementeaz proiectul cu genericul:
Implementarea hibrizilor timpurii de porumb n producerea seminelor pentru export. Necesitatea proiectului
propus n scopul accelerrii perioadei de implementare n practic a noilor hibrizi a fost impus de cerinele
pieei de comercializare, de a nlocui operativ produsele anterioare cu creaii noi competitive. n cadrul testrilor
de Stat hibrizii, care au fost implementai au nregistrat un surplus a produciei de boabe, respectiv: 6,8% i
9,3%, fiind mai timpurii cu 4 i 2 zile comparativ cu martorii oficiali. n baza rezultatelor obinute n urma
realizrii proiectului dat, s-a diminuat esenial decalajul ntre anul omologrii hibrizilor i lansarea n producerea
de semine pentru comercializare. La hibrizii simpli de porumb omologai n Moldova acest decalaj a constituit 5
ani pentru Porumbeni 461MRf (2008-2012), 8 ani pentru Porumbeni 459MRf (2003-2010) i 11 ani pentru
Porumbeni 458MRf (2001-2010). Astfel hibrizii noi dup perioada de lansare n producerea de semine
comerciale vor fi mai aproape de practica firmelor internaionale, care constituie 2-3 ani pentru hibrizii simpli
multiplicai cu nlturarea manual a paniculelor la forma matern.
Dac n trecut durata utilizrii n producere a unor hibrizi a constituit pn la 20 ani, actualmente viaa
hibridului constituie n medie 6-8 ani din momentul primelor comercializri de semine. Aceast evoluie, n
principiu, este benefic, n primul rnd, pentru cultivatorii de porumb deoarece fiecare hibrid nou are
performane comparativ cu predecesorii [5].

28

Un alt proiect din cadrul aceleai direcii strategice este proiectul: Reproducerea seminelor elit i
implementarea n cultur a soiului nou de linte verzuie. Culturile leguminoase pentru boabe din care face parte i
lintea au un rol important n structura culturilor anuale. Lintea este o cultur autohton, cu rezisten sporit la
secet i temperaturi nalte, uitat n ultimele decenii, a crei particulariti agrobiologice corespund specificului
pedoclimatic dur al rii noastre. Prioritile i avantajul lintei const n aceea, c ea este o surs de proteine
valoroase i ieftine, contribuie la diversificarea alimentaiei sntoase i echilibrate, sporete valorificarea
fertilitii solului, realizeaz o economie substanial a resurselor energetice, este un excelent premergtor n
asolamente, are o producie stabil de boabe cu un coninut bogat n proteine (23-35%), amidon (48-53%),
grsimi (0,6-2%), substane minerale (2,3-4,4%), vitamine, datorit crora ea are un efect socio-economic major.
De ctre savanii Institutului de Genetic, Fiziologie i Protecie a Plantelor al AM a fost creat i omologat
soiul nou performant de linte Verzuie, caracterizat prin productivitate sporit (23,0-25,0 q/ha), calitate superioar
(proteine - 26,7%, grsimi -1,5%), timpuriu (98 zile), rezistent la secet i temperaturi nalte, tolerant la boli i
duntori, la care necesit reproducerea seminelor elit pentru implementare n producere n RM. Lintea se
prezint ca o cultur nou, cu un grad nalt de adaptare la condiiile ecologice de risc ale Moldovei. Prin urmare,
lintea ca surs de inovare i transfer tehnologic poate contribui la soluionarea problemei agriculturii durabile,
ceea ce este o prioritate pentru prosperarea rii [5].
rile cu o pomicultur avansat din Comunitatea European i de pe alte continente utilizeaz deja timp
de peste 40 ani material sditor devirozat pentru nfiinarea livezilor. Pentru a dezvolta aceast ramur ndeosebi
n partea de nord a RM, unde suprafeele de culturi pomicole se mresc substanial, este necesar de a avea o baz
de producere a materialului sditor. Un exemplu elocvent poate servi proiectul Implementarea tehnologiei de
producere a materialului sditor pomicol conform standardelor europene. Implementarea n producere a
materialului sditor devirozat poate asigura: sporirea cu 20-30% a ponderii de prindere a altoirilor n pepinier;
adaptivitate sporit a pomilor n condiiile RM; facilitarea crerii plantaiilor intensive i super intensive;
intrarea mai timpurie n rod a pomilor; obinerea recoltelor sporite cu 20-25% fa de prototipul existent;
micorarea cheltuielilor de producie; optimizarea mai lejer a strii fitosanitare n plantaii; longevitate a
pomilor i plantaiilor de producie; obinerea produciilor de fructe de nalt calitate i competitive pe pia.
Implementarea materialului sditor devirozat n plantaiile pomicole pentru producia de fructe sporete
eficacitatea economic a livezilor numai de la obinerea sporului n recolt i reducerea numrului de tratamente
chimice la o unitate de suprafa [5].
n ultimii ani, cercettorii sunt preocupai de gsirea noilor soluii nutriionale pentru alimentaia
animalelor i psrilor, soluii care s permit obinerea de performante productive majorate cu eforturi
financiare ct mai reduse. Pentru soluionarea acestei probleme de ctre Institutul de Cercetri pentru Culturile
de Cmp Selecia din mun. Bli a fost implementat proiectul de transfer tehnologic cu genericul: Colectarea
deeurilor piscicole i cerealiere, prepararea adausului proteico-furajer.
Proiectul dat a fost elaborat reieind din principiile minimizrii riscului asupra mediului din partea
deeurilor, includerea lor maximal n circuitul economic, i anume elaborarea tehnologiilor inovative de
prelucrare i utilizare raional a deeurilor. Conform datelor statistice ale Inspectoratului Ecologic de Stat,
actualmente gradul de reciclare a deeurilor este foarte redus, constituind aproximativ 18%, totodat, n categoria
de deeuri de producere sunt incluse i deeurile de la prelucrarea materiei prime piscicole. Prin intermediul
acestui proiect s-a propus prepararea adausului proteic din deeuri de pete i tre, ultimele fiind preparate sub
form de fin furajer cu coninut proteic piscicol vegetal. Procesul de producere, presupune examinarea
materiei prime, nlturarea impuritilor grosiere strine, apoi se direcioneaz n instalaia de mrunire.
Argumentarea restructurrii procesului de producere const n economisirea suprafeelor de producere, de
resurse energetice, reducerea echipei de administrare i deservire, este stabilit raionalitatea i eficiena
tehnologic majorat de prelucrare a deeurilor de pete i prepararea finii furajere de pete de calitate major,
micorarea volumului specific de material utilizat la fabricarea miniliniilor tehnologice de 5-7 ori n raport cu
instalaiile existente n RM [6].
Totodat, n scopul promovrii activitilor inovaionale i a transferului tehnologic n regiunea de nord a
Moldovei, n perioada anului 2013 a fost creat un cluster inovaional pe lng Universitatea de Stat Alecu
Russo din Bli i Institutul de Cercetri pentru Culturile de Cmp Selecia. Totodat, n cadrul Institutului
de Cercetri pentru Culturile de Cmp Selecia n scopul dezvoltrii infrastructurii inovaionale a fost creat
Incubatorul de Inovare Antreprenorul inovativ. Pe parcursul perioadei menionate de ctre incubator au fost
realizate urmtoarele: nrolate 6 companii rezidente; atrase investiii n valoare de 2636,8 mii lei, dintre care
1123,6 mii lei din bugetul de stat; create 44 locuri de munc; comercializat producie n volum de 2646,0 mii lei
[7].
Astfel valorificarea realizrilor tiinifice prin promovarea transferului de cunotine i tehnologie n
activitatea economic a agenilor economici din sectorul agroalimentar, n particular implementarea tehnologiilor
performante, practicarea unor tehnici de producie, care protejeaz mediul ambiant, constituie indiscutabil un
suport n dezvoltarea durabil a agriculturii.
BIBLIOGRAFIE:
1. Strategia inovaional a Republicii Moldova pentru perioada 2013-2020 Inovaii pentru Competitivitate
(Hotrrea Guvernului nr. 952 din 27.11.2013).

29

2. Strategia naional de dezvoltare agricol i rural pentru anii 2014-2020 (HG nr.409 din 04.06.2014).
3. Afanasiev, V.; Moldovanu, Gh.; Crmaru, V. Probleme i perspective privind inovarea i transferul
tehnologic n Republica Moldova: Probleme teoretice i practice ale economiei proprietii intelectuale.
Chiinu, 2007.
4. Sosnovschi, V. Transferul de tehnologii - premis a dezvoltrii durabile a economiei rilor n tranziie.
http://patent-2007.by.ru/transferul.html.
5. http://aitt.md/ro/rapoarte-de-activitate.html.
6. http://aitt.md/uploads/files/Catalogul proiectelor de transfer Tehnologic din anul 2013.pd.
7. www.mec.gov.md/sites/default/files/.../raport_in_a._2013_1.doc.
REFLECII ASUPRA MANAGEMENTULUI CERCETRII
FORMAIUNILOR SILVICE DE STEJAR PUFOS DIN REPUBLICA MOLDOVA
Agapi Ion, doctorand, Gociu Dumitru dr. n biologie, Institutul de Ecologie i Geografie al AM
Rflexions sur la gestion et la recherche des formations forestires des chnes pubescents en
Moldavie. Entre les formations forestires et le rseau de lacs et de rivires, combin avec une grande varit de
formes du relief, il existe une harmonie. Dans le contexte cologique, les massifs forestiers compactes,
caractristiques pour le Plateau Central de Moldavie, passent lentement sous linfluence de la steppe de Balti par
le rseau de peuplement de la zone du nord et sous linfluence de la steppe de Bugeac par le rseau des Codrii
Tigheciului de la zone cologique du sud.
Dans les deux cas, la structure phytocenotique des forts a t influence par l'environnement de steppe,
implicitement par le chne pubescent. Dans la zone cologique du nord, les formations forestires qui
contiennent des chnes pubescents sont sporadiques, mais dans les Codrii Tigheciului les chnes pubescents
forment des zones forestires compactes. Ces circonstances ont dtermin les spcificits des activits socioconomiques et les traditions culturelles de cette zone et ont approfondi ainsi lintrt de la socit et des
chercheurs en ce qui concerne les ralits prsentes. Au nord, ainsi que dans tout le pays, les expriences
ralises au sein de cette activit ont t transmises de pre en fils.
Une solution pour la rgnration des forts, la restauration cologique des forts dgrades et lextension
des zones forestires est la cration et l'utilisation de matriels forestiers par rapport son origine, aux conditions
stationnaires. Dans ce contexte, il faut tenir compte du fait que la nature a ses propres lois et lHomme ne peut
pas aller l'encontre de la nature.
Mots-cls: formations forestires, les peuplements de chnes genofond, l'cologie.
n timpurile istorice se presupune c meleagul basarabean a fost acoperit cu pduri n proporie de 30%.
n natur persista o armonie perfect ntre masivele formaiunilor forestiere, reeaua de lacuri i ruri, conjugate
cu o vast varietate a formelor de relief. Pe fonul ecologic masivele forestiere compacte, specifice Podiului
Central al Codrilor, i-au stabilit o trecere lent ctre mediul de influen a stepei de Bli i cel petrofit prin
reeaua arboretelor zonei ecologice de nord, iar ctre mediul de influen a stepei Bugeacului, prin cele a
Codrilor Tigheciului a zonei ecologice de sud. n ambele cazuri n structura fitocenotic a pdurilor i-a lsat
amprenta influena mediului de step i petrofit, n care ca edificator se prezint stejarul pufos. i dac n zona
ecologic de nord formaiunile forestiere cu participarea stejarului pufos pot fi ntlnite sporadic, n trupuri
insulare, n cazul Codrilor Tigheciului stejarul pufos formeaz trupuri de pdure compacte. Anume n aceste
condiii, n toate formele lor austere, n raport cu elementele specifice de relief i clim, pe dimensiunile
factorului uman, s-au stabilit ndeletniciri socio-economice, tradiii culturale i de alt natur specifice acestei
zone.
Aceste ndeletniciri, stabilite nc din timpurile istorice n raport cu formaiunile forestiere, cu
modificrile provenite n funcie de cerinele vectorului vremii, se precedau de la o generaie la alta sub forma
utilizrii masei lemnoase, a produselor auxiliare, activnd pe msura funciilor pe care le ndeplinesc aceste
masive forestiere, dar i a serviciilor pe care le ofer societii cu o deosebit amabilitate. Terenurile cultivate
erau concentrate doar n apropierea aezmintelor umane. Impresia pe care un astfel de peisaj o producea asupra
oamenilor nzestrai cu sentimente morale fireti era remarcabil. Pe fonul acestei splendide panorame, cei ce neau vizitat meleagurile n timpurile ndeprtate au apreciat spaiul dintre Prut i Nistru ca pe un col de rai, numit
de localnici, mioritic.
Aadar, n relaiile cu factorii naturali de mediu formaiunile forestiere, printre care i cele cu participarea
stejarului pufos, i-au fortificat pe fonul adaptiv potenialul mecanismelor bioecologice reproductive i cele
ecoprotectoare de o manier echilibrat. n matricea genetico-molecular i-au depozitat pe deplin baza
informaional, fiind, n aa mod, pregtite de a da riposta adecvat tuturor provocrilor posibile. n depozitele
acestei vaste baze informaionale la momentul oportun nu s-au regsit doar formele de ripost la provocrile
brutale, imprevizibile i, n fond, fr precedent, exercitate de factorul uman.
O privire imaginar asupra trecutului fondului forestier naional trebuie s ne trezeasc uimire,
comparndu-l cu starea celui contemporan nou, la care oferind unele explicaii suplimentare ar reaminti
condiiile de ordin politic i social, derulate pe parcurs n care fondul forestier a fost adus. Ddac s-ar putea de

30

tras o linie imaginar de unire dintre mreia legendar a trecutului acestor formaiuni forestiere i nfiarea
jalnic a acestora astzi, i poi crea o imagine despre tragedia prin care au trecut pe parcursul timpului pe fonul
aplicrii tehnologiilor dubioase. Aceast realitate rmne i n continuare a fi prezent la ordinea zilei deoarece
anume la capitolul relaia om-pdure n-am prea progresat. Noi am rmas restanieri incurabili, n fond, prin
mentalitatea de mult depit de timp i devenit pe parcurs de o manier conservatoare. Fiind ncredinai c
doar nelepciunea ntmplrii crmuiete i reguleaz rostul ntreg al tuturor lucrurilor, ne-am mpotmolit la
capitolul regenerare i am luat o pauz nedefinit n sfera de cercetare. Tradiional, ne permitem utilizarea pe
larg a pdurilor cu participarea stejarului pufos n calitate de ima i fnea, modaliti prin care continu
restrngerea suprafeelor mpdurite i reducerea drastic a potenialului bioproductiv i ecoprotector a acestor
formaiuni. Doar n unele cazuri greu accesibile sau mai pstrat i pn n zilele noastre arborete cu structura
funcional raportat la condiiile specifice de mediu. Asemenea monumente ale naturii n prezent se consider
adevrate depozite ale genofondului naional.
Cu trecerea timpului, sub presiunea factorului uman, pe fonul unui concurs de mprejurri defavorabile,
pe aceste meleaguri, peisajul a suferit unele schimbri, n consecin - de la natural-rustic, la cel agrar urbanoindustrializat ca pn i eterna succesiune a anotimpurilor s suporte modificri eseniale. Din cele patru
anotimpuri - primvar, var, toamn, iarn, care se precedau cu o precizie aproape fantastic, dou - primvara
i toamna, practic cedeaz n favoarea celorlalte dou - vara i iarna. Astzi nu se mai simte succesiunea
proverbial de alt dat. Prin complexul factorilor de mediu se produce o trecere direct de la iarn la var i de
la var la iarn. n aceste circumstane de ordinul calamitilor naturale, care nc urmeaz a cpta o deplin
explicaie, pdurea i tot ce nseamn prin definiie mediu silvic, prin potenialul ecoprotector capt noi valene.
n problemele ce in de silvicultura modern trecutul ei trebuie s fie considerat ca o treapt de trecere
prin prezent pentru furirea unui viitor cu temelii statornice. Atracia generaiilor precedente de a exercita
tehnologiile n domeniu de o manier neprieteneasc devenit tradiie, n-ar trebui n nici un fel s umbreasc
optimismul generaiilor contemporane n aplicarea tehnologiilor moderne de o manier durabil, orientate pe
fundament ecosistemic. Aceast orientare necesit a fi considerat drept sprijinul cel mai adecvat n condiiile
specifice fondului forestier naional, n msur s duc la promovarea virtuilor naionale n domeniu. Ea trebuie
s capete forma preuirii tradiiilor sntoase n domeniu i a ncrederii nestrmutate n vitalitatea acesteia. De
altfel, n acest context, pe parcurs acumuleaz tot mai mult teren explicaia referitor la realizrile cercetrilor
tiinifice n domeniul taxonomic care i-au dobndit un aer att de venerabil pe dimensiunile problemelor ce in
de noiunea de regenerare a pdurilor n cel mai larg sens al cuvntului - natural, artificial, mixt. Cnd
ncercm s ne imaginm nceputurile istoriei acestei activiti, care de fapt i trage rdcinile din antichitate, ni
se pare destul de nceoat. Pe parcurs au fost obinute realizri, au fost i eecuri, dar care n fond pe aceste
dimensiuni au consolidat interesul dintre societate i specialitii n domeniu, activitatea de cercetare cu cea de
experimentare. n zona de nord, ca de altfel i n ntreaga ar, generaii ntregi au transmis din tat n fiu pe post
de experiment tot ceea ce s-a obinut n limitele acestei activiti. n acest context, ceea ce ni se pare a fi pus doar
pe seama trecutului devine cunoscut i apropiat de ndat ce privim lucrurile n perspectiv.
O explicaie triumftoare pe dimensiunile problemelor ce in de regenerarea pdurilor, de reconstrucia
ecologic a arboretelor degradate, de extindere a suprafeelor mpdurite, obine orientarea acestor activiti pe
seama concepiei populaionale de creare a fondului seminologic silvic i de utilizare a materialului reproductiv
n raport cu originea lui, cu condiiile staionale. Concepia a fost elaborat innd cont de faptul c natura i are
legile ei i nu-i poi merge mpotriv. Pentru mintea omului au rmas nc nenelese i inacceptabile legitile
naturii care dirijeaz specificul comportamental al arboretelor respective. Aa c pe lng cunotine teoretice,
tehnice, pe lng experiena acumulat pe parcursul timpului, pentru a obine nite realizri pe msura
ateptrilor ar mai trebui de pus n micare i puin spirit de observaie. Dintre cele ce s-au ntreprins pn n
prezent, judecnd dup starea arboretelor, se vede cu ochiul liber ce primejdioas este orice ncercare de a te
crede superior naturii, de a o nela n relaiile de colaborare. n acest sens, vom insista asupra faptului, c exist
o lege a naturii, care domin ntregul univers i cine neal legea aceasta nu are sori de izbnd, nu obine
realizrile dorite.
Aceasta ine de noiunea de origine. Orientarea n cauz dac ar fi putut s-i pstreze drepturile sale
legitime prin a fi cunoscute i respectate cu strictee de silvicultori, demult am fi obinut arborete productive cu
structura lor funcional n raport cu potenialul habitual al mediului de referin. Acum ns pdurile nu
reprezint dect un adevr crunt, ignorarea acestor legiti le-a adus ntr-o stare jalnic, degradat fr precedent.
Concepia nominalizat, elaborat nc prin anii 90 ai secolului trecut, dar care i pn n prezent nu este
pe deplin contientizat n toate amnuntele, reprezint o sfer de activitate, care este fondat pe o trstur
fireasc a materialului reproductiv i ar fi pcat dac aceast trstur din arogan, necunoatere, sau alte
obstacole nu i-ar gsi continuitate prin activitatea silvicultorilor. n plan managerial anume de aceast nelegere
cu natura avem mare nevoie. Din aceste motive, suntem ncurajai s credem c silvicultorii vor rmne ntr-o
continu cercetare a tainelor pdurii privite printr-un unghi de vedere mai larg al lucrrilor ce-l preocup de
mult vreme, fundamentate pe farmecul luntric, de sentimentul care-l insufl natura mediului silvic prin mreia
i linitea ei.
n contextul celor relevate mai sus suntem de prerea c atenia acordat stejarului pufos, care populeaz
niele ecologice respective ne orienteaz la unele consideraiuni specifice doar acestui subiect. Pentru a fixa ntr-

31

o formul definitorie specificul, esenialul bioecologic al acestuia vom aminti c stejarul pufos a fost definit ca
xerofil i termofil. Din aceste considerente, starea pdurilor de stejar pufos ar trebui privit aa cum este, dar nu
aa cum am dori s o vedem, pentru a acion n raport cu realitatea din teren i vectorul vremii. Privit prin
prisma acestor realiti se explic intrarea trzie a stejarului pufos n sfera intereselor ce in de cercetarea lui
tiinific i celor raportate la valorile lui ecologo-economice care, s sperm, c nc nu depesc limitele unui
subiect izolat. Mai degrab el a fost pus pe post de o curiozitate forestier i lsat s-i vin rndul. Cunoaterea
particularitilor lui bioecologice mai ndeaproape ne va oferi explicaia multora din problemele n noianul
crora a fost nvluit pn n prezent.
Formaiunile forestiere cu participarea stejarului pufos n perioada cumpenei dintre mileniile 2 i 3 se
definete prin lupta de curente contradictorii dintre elementul vechi cunoscut ca tradiie preluat de la generaia
precedent de silvicultori i cel nou, cunoscut ca realizare obinut de progresul tehnico-tiinific. Pentru nceput,
mentalitatea n aceast sfer de activitate demult depit de timp pe fonul ei specific conservator ine s abat
atenia silvicultorilor de orientare contemporan de la eecurile comise n trecut, n timp ce realizrile tiinifice
obinute n domeniu i puse pe picior de implementare prin aplicarea corect a tehnologiilor moderne vor
exercita ulterior o influen crescnd asupra silviculturii orientat pe fundament ecosistemic.
Erorile grave executate n limitele arboretelor din stejar pufos servesc cu prisosin drept subiect de
discuii pentru toi cei, care dei nu erau att de bine pregtii ca s-i vad i aprecia greelile, dar, totui aveau
destule cunotine culese n teren, ca s fie n stare s descopere neajunsurile altora. Oricine care-i d osteneala
s confrunte informaia referitor la arboretele Codrilor Tigheciului antic cu cele actuale, s-ar convinge pe dat c
au destule temeiuri de a aprecia critic acest domeniu de activitate.
Adepii mentalitii conservatiste in de acea categorie de ,,teoreticieni care consider c opinia lor este
mai sus de oricare alta, cu toate c au preri destul de vagi la subiect i nchipuiri destul de aproximative i c
contiina le este nvluit de frdelegile pe care le nfptuiesc fa de formaiunile silvice ncredinate. Pentru a
se ndrepti i a se mpca cu realitatea ei nscocesc formule destul de uoare, cum ar fi n mod tradiional, lipsa
de finane, tierile ilicite etc. Aceast categorie de specialiti, fr a putea aduce vreun argument serios, au
ntotdeauna preri preconcepute referitor la activitatea pe care o desfoar. Ei nu se vd nici predispui de a-i
pleca urechea la argumentele raiunii. Dimpotriv, ei sunt nclinai s recurg la iretlicuri verbale ca s-i apere
punctul su de vedere sau o prejudecat predominant. De multe ori i specialitii destul de experimentai cad n
ncurctur n faa unor obiecii i nu e de mirare c muli reprezentani ai generaiei actuale cu toat sinceritatea
se pierd n formularea rspunsurilor corecte la subiect i, cu att mai mult, la aplicarea corect a tehnologiilor
respective, conform realizrilor obinute de progresul tehnico-tiinific n domeniu.
n plan tiinific, din literatura de specialitate, posedm informaia potrivit creia pe parcursul lor milenar
plantele n mersul lor evolutiv i-au creat unele din cele mai sofisticate mecanisme pe dimensiunile actului
reproductiv i celui adaptiv, raportat la condiiile de mediu, de multe ori extremale, din limitele vastei
variabiliti a nielor ecologice n care s-au instalat. n acest context, la grele ncercri a fost pus de rnd cu o
gam larg a populaiilor altor specii i cele ale stejarului pufos. Atribuindu-i stejarului pufos ca subiect de
studiu un nou prestigiu, ne pomenim n situaia n care n-a fost depit posibilitatea de a da o explicaie uneia
dintre cele mai misterioase mprejurri cum ar fi cea de mediu de creare a mugurilor florali de ambele sexe pe
unele i aceleai crengue ale sistemului aerian al plantei i lugerilor cu cretere orizontal i vertical al aceluiai
sistem radicular.
n condiiile extremale de mediu, pe dimensiunile potenialului regenerrii naturale stejarul pufos i-a
adaptat specificul bioecologic al ghindei combinndu-l cu cel al lugerilor sistemului aerian i celui radicular.
Ghinda stejarului pufos a evoluat spre nsuirea particularitilor recalcitrante prin care-i pierde viabilitatea la
uscare. Pe aceste dimensiuni, pentru a iei din situaia creat, au fost efectuate o serie de cercetri tiinifice n
cadrul proiectului Evaluarea diversitii genetice i multiplicarea biotehnologic a Q. pubescens n vederea
restabilirii structurii funcionale a pdurilor din Republica Moldova care a demarat n anul 2003, la propunerea
comun a savaniilor Institutului de Cercetri i Amenajri Silvice, a Ageniei Moldsilva i a Institutului de
Fiziologie a Plantelor al Academiei de tiine a Moldovei, finanat de Consiliul Suprem pentru tiin i
Dezvoltare Tehnologic. n cadrul proiectului au fost soluionate o serie de probleme, cum ar fi, inventarierea
genotipurilor valoroase de stejar pufos, determinarea capacitii germinative a ghindei, stabilirea gradului de
atacare a acesteia de ctre trombar etc. Au fost efectuate multiple cercetri n vederea elaborrii strategiilor de
multiplicare rapid i de meninere a viabilitii ghindei i puieilor n condiii naturale. Acestea din urm s-au
dovedit a fi destul de costisitoare, din care motive, cercetrile urmeaz a fi aprofundate.
Pentru a recupera natura reducerii potenialului reproductiv pe calea ghindei n cazul stejarului pufos a
evoluat i potenialul reproductiv prin lugerii sistemului radicular. Acetia obin posibiliti de a produce
plantule-clone fie prin drajonarea sistemului radicular, fie prin orientarea creterii lor de la poziia orizontal la
cea vertical. Prin acest act de producere a plantulelor-clone simplificate toate fazele de obinere a materialului
reproductiv - de la faza depunerii mugurilor florali, la cea de germinare a ghindei, se trece direct la producerea
plantulelor-clone, nzestrate de la natur cu toate nsuirile caracteristice acestui subiect. Iat c anume pe acest
segment dispunem de o informaie tiinific insuficient. Aceste mistere ateapt nc a fi descifrate. n prezent
cunoatem doar urmrile actului creativ - depunerea mugurilor florali de ambele sexe i crearea plantulelor-clone
prin intermediul lugerilor sistemului radicular. Aceste fenomene, ntrunite n limitele unuia i aceluiai subiect

32

(unitate individual), nu se exclud unele pe altele, ci dimpotriv, se completeaz. Cu att mai mult, n limitele
sistemului aerian pe aceiai crengu se depun mugurii florali de ambele sexe, continu dezvoltarea lugerilor
coronamentului i cele ale axei centrale a fusului, n limitele sistemului radicular se dezvolt cu succes att
lugerii cu cretere orizontal, specific sistemului radicular majoritii reprezentanilor regnului vegetal, ct i
lugerii cu cretere vertical, specifice doar dezvoltrii plantulelor-clone.
Confruntndu-ne cu problemele de ordin regenerativ, n cazul stejarului pufos, constatm faptul c pe
aceste dimensiuni pe plan tiinific nc nu a fost obinut o explicaie clar referitor la punctul de pornire a
ntrunirii elementelor de structur, de combinaie a factorilor de mediu, a potenialului de influen asupra masei
critice genetico-moleculare prin impulsul actului creativ de orientare sexual a mugurilor florali i de orientare a
creterii verticale a lugerilor sistemului radicular, a orientrii actului creativ cnd se stabilete o bun armonie
ntr-un complex de antiteze materializate iniial n structura genetico-molecular.
BIBLIOGRAFIE:
1. Vlad, I.; Doni, N.; Chiri, C.; Petrescu, L. Silvicultur pe baze ecosistemice. Bucureti: Ed. Academiei
Romne, 1997. 485 p.
2. Negulescu, E.G.; Ciumac, Gh. 1959: Silvicultura. Bucureti: Ed. Agro-Silvic de Stat, 1959. 885 p.
3. Lorne, R. Etude quantitative sur les claircies dans les peuplements de chne de qualit. n: Revue Forestire
Franaise, no. 11, 1959, pp. 746-768.
4. Allegrini, Ch. Choisir les arbres davenir. In: Forts de France, 2010, no. 531, Mars, pp. 33-34.
RESURSELE AGROCLIMATICE IN CONTEXTUL CULTIVARII
NOILOR SOIURI DE VIA DE VIE N CONDIIILE MOLDOVEI
Alexandrov Eugeniu, dr. conf. cercet., Grdina Botanic (Institut), AM
Improving grapevine consists not only in the creation production of vines varieties and quality traits, but
also resistant to biotic and abiotic factors of the environment, including to the low temperatures in the cold
season. As to the of wintering conditions, Moldova serves as the northern border of territorial location for some
thermophilic multiannual crops, including vines. The flowering plants are adapting to environmental conditions
through various methods, anatomical and morphological the changes play a decisive role under conditions of
high ambient temperatures. Ecological adaptation of plants to environmental conditions of the hydric variability
is done based on quantitative indicators leaf morphology and anatomy. Distance hybrids of vines of the drought
resistant: DRX-M4-660; - 677; - 560; - 508; - 583. Distance hybrids of vines with enhanced resistance to winter:
DRX-M4-502, -504; -536; -537; -545; -578; -579; -609.
Key words: hybrids, vines, resistance, winter, drought.
INTRODUCERE
La cultivarea plantelor multianuale este necesar de a se ine cont de caracteristicile resurselor
agroclimatice ale regiunii. Cu att mai mult c condiiile climatice sunt ntr-o continu schimbare [3].
Teritoriul Republicii Moldova (n continuare RM) este amplasat la limita de nord pentru unele culturi
multianuale termofile, inclusiv pentru via-de-vie. innd cont c unele soiuri sunt foarte receptive i vulnerabile
la condiiile climatice, cunoaterea acestora ar putea contribui n mod esenial la sporirea productivitii agricole,
ndeosebi n condiiile omologrii soiurilor noi de plante multianuale.
Analiza condiiilor climatice din lunile de iarn, adic din perioada de iernare, denot c acestea au un
coraport de manifestare i de prevalare a anomaliilor pozitive dup anii 60 ai sec. XX. De menionat faptul c n
perioada 1960-2009 anomaliile pozitive au depit esenial norma climatic a iernii. Astfel, n 14 din 49 de ani
nregistrai dup anii 60, anomaliile pozitive au depit cu 2 0C media multianual. Asemenea anomalii au o
frecven de manifestare de aproximativ o dat la 3 ani, iar valorile temperaturii medii sezoniere sunt peste zero
grade. Valorile pozitive record au fost nregistrate n anii 1961 i 2007, cnd acestea au depit pragul de 4 0C.
n luna decembrie, anomaliile pozitive de peste 2 0C ale mediei lunare se echivaleaz cu valori termice
medii lunare de peste 1 0C i mai mult. Asemenea valori termice au fost nregistrate n 18 cazuri pentru perioada
menionat, avnd o frecven de manifestare de aproape o dat la 4 ani. Aadar, o dat n 4 ani, n RM apare
riscul intrrii incorecte n iernare a culturilor multianuale. Cele mai semnificative anomalii pozitive lunare sunt
nregistrate, ca i n cazul anomaliilor pozitive sezoniere, n anii 1961 i 2007.
Anomaliile pozitive de peste 2 0C din cea mai rece lun a anului (ianuarie) au o frecven de manifestare
o dat la 3 ani. Relevm faptul c n ianuarie crete intensitatea manifestrii acestora. Astfel, n 9 din 49 de ani
anomaliile pozitive au depit valoarea de 4 0C, iar n 3 cazuri chiar i valoarea de 6 0C. Anomaliile termice
maxime pozitive de 6,8 0C au fost nregistrate n 2007, cnd temperatura medie a lunii ianuarie a constituit +3,9
0
C.
n luna februarie, anomaliile termice de peste 2 0C au aceeai frecven de manifestare, adic o dat la 3
ani, ca i n cazul anomaliilor pozitive din ianuarie. Crete numrul de cazuri cu anomaliile pozitive ce depesc
valoarea de 4 0C (7 cazuri pe parcursul a 49 de ani), iar n 2 cazuri valoarea de 6 0C. Anomaliile termice
maxime pozitive de 6,7 0C au fost nregistrate n 2002, cnd temperatura medie a lunii februarie a constituit +4,9
0
C. Sporirea intensitii anomaliilor pozitive din luna februarie poate contribui la scoaterea prea devreme din

33

iernare a culturilor multianuale, condiionnd compromiterea acestora n timpul manifestrii ngheurilor de


primvar.
Aadar, soiurile de vi-de-vie sensibile la ger au temperatura critic de vtmare de < -17 0C. Dup
cum dovedete analiza probabilitii de manifestare n spaiu, culturile sensibile la ger pot fi compromise o dat
n doi ani n partea de sud a republicii i aproape n fiecare an n partea de nord i, parial, n partea central.
Pentru soiurile de vi-de-vie relativ rezistente la ger, temperatura critic de vtmare la ger este de < -22 0C.
Modelarea spaial a probabilitii de manifestare a acestui fond termic permite s constatm c n sudul
republicii o dat n 10 ani apare riscul vtmrii soiurilor respective. Pe msura deplasrii spre nord, riscul
devine mai frecvent i, n partea central, acest prag termic se manifest o dat n 5 ani, iar n partea nordic o
dat n 2-3 ani. n cazul soiurilor de vi-de-vie rezistente la ger, temperatura critic de vtmare este de -25 0C.
Regimul precipitaiilor atmosferice pentru perioada anilor 2007-2010 se caracterizeaz printr-o mare
instabilitate n timp. Anomaliile pluviometrice raportate ctre media multianual pentru o perioad de un secol
(1891-2010), n partea central a republicii, denot c acestea au constituit de la -105.-118 mm n anii 2007,
2009 pn la +210 mm n anul 2010.
Deosebit de secetoas a fost vara anului 2007, cnd practic pretutindeni s-a nregistrat un deficit de
precipitaii semnificativ, cantitatea acestora fiind de 62-170 mm (35-80% din media multianual). Numrul total
al zilelor fr precipitaii n perioada cald (aprilie-octombrie) a constituit 40-110 zile n nord i 92-133 zile n
sud. Cea mai mare durat nentrerupt a zilelor fr precipitaii a fost de 20-40 zile, valori ce se nregistreaz n
medie o dat n 20 ani. Cea mai ndelungat perioad nentrerupt lipsit de precipitaii a fost nregistrat la
postul Vulcneti (52 zile), unde n lunile mai-iulie au czut doar 17 mm de precipitaii, adic 10% din norma
climatic. [5, 6, 7].
MATERIAL I METODE
Determinarea rezistenei viei de vie la nghe poate fi efectuat cu ajutorul metodei de conducere
electrolitic sau n condiii naturale cu temperaturile respective [4].
Conform principiilor tiinifice contemporane, rezistena complex a viei de vie fa de condiiile
nefavorabile ale perioadei reci a anului (iarna), condiional determinat ca rezistena viei de vie la nghe,
depinde de capacitile genetice ale soiului, starea fiziologic a plantei n momentul nceperii/sosirii ngheurilor,
condiiilor i capacitilor de dezvoltare, agrotehnica aplicat etc.
Determinarea rezistenei la secet a viei de vie, s-a aplicat metoda de fixare a laminei frunzei n etanol
de 95%. n luna iulie cnd frunzele la via de vie sunt mature, de pe nodurile al 7-lea - al 12-lea ale unui lstar de
vi de vie, normal dezvoltat se colecteaz 6 frunze. Apoi din partea de mijloc a acestor frunze se taie cu
tanatorul cte un segment din fiecare frunz. Segmentele de frunz obinute se introduc n soluie de etanol cu
concentraia de 95% pentru fixare. Fragmentele de frunz peste o perioad scurt de timp sunt scoase din fixator
i soluia rmas este nlturat cu hrtia de filtru. Pentru a reduce fragilitatea frunzelor, acestea se amplaseaz
pe lama de sticl i se acoper cu 2-3 picturi de soluie de glicerin + ap distilat (1:1) pentru 2-4 ore.
Fragmentele de frunz sunt secionate i plasate pe lama de sticl n soluie de glicerin + ap distilat (1:1),
acoperindu-le cu o lamel de sticl pot fi examinate la microscop [4].
ntru determinarea rezistenei viei de vie la secet s-au utilizat criteriile morfo-anatomice ale laminei
frunzei, care constau n: lamina frunzei cu grosimea medie mai mare; - suprafaa medie a laminei frunzei este
mai mic; volumul mediu al laminei frunzei mai mare; raportul mai mic al suprafeei medii a laminei frunzei la
volumul mediu al laminei frunzei [4].
REZULTATE I DISCUII
nclzirea intens a suprafeei terestre n limitele teritoriului RM ncepe n luna martie i continu n
luna aprilie. Datorit adveciei diferitor mase de aer, n lunile de primvar, maxima absolut a temperaturii
aerului poate atinge + 25-28 0C n luna martie i + 29-32 0C n luna aprilie.
n prima jumtate a lunii mai temperatura diurn depete + 15 0C, ceea ce indic nceputul sezonului
de var. Cea mai cald lun a anului este luna iulie cu temperatura medie de 19,1 0C la nord i 22 0C la sud.
Maximele de temperatur n aceast lun constituie 36-39 0C, iar minimele 6-8 0C. pentru sezonul de var al RM
este caracteristic meninerea temperaturilor nalte (25 0C) pe o perioad destul de ndelungat de timp: de la 30
pn la 70 de zile, pn la 80-115 de zile sumar i 21-27 de nentrerupt, care, n lipsa precipitaiilor sau a
sumelor lor nensemnate, duc la instalarea timpului secetos.
Plantele cu flori se adapteaz la condiiile mediului prin diferite metode, iar modificrile morfoanatomice dein un rol decisiv n cazul condiiilor temperaturilor ridicate ale mediului nconjurtor.
Schimbrile adaptive ale plantelor pot fi studiate n baza caracterelor morfo-anatomice ale frunzei,
deoarece acest organ al plantei este cel mai plastic i receptiv la schimbrile mediului nconjurtor.
Adaptarea ecologic a plantelor la condiiile hidrice ale mediului se realizeaz n baza variabilitii
indicilor cantitativi ai morfologiei i anatomiei frunzei.
Ca rezultat al studierii anatomiei cantitative a laminei frunzei la via de vie (Vitis L.) s-au evideniat
patru caractere morfo-anatomice, care determin rezistena relativ mai mare la secet, i anume: - suprafaa
medie mai mic a laminei frunzei; - grosimea medie mai mare a laminei frunzei; - volumul mediu mai mare a
laminei frunzei; - raportul mai mic al suprafeei medii a laminei frunzei la volumul mediu a laminei frunzei
(S:V).

34

Tabelul 1. Caractere biometrice ale laminei frunzei hibrizilor distani de vi de vie


Suprafaa medie a Volumul mediu al
Raportul suprafaa
Grosimea medie
laminei frunzei (n laminei frunzei (n medie: volumul mediu
a laminei
cm2)
cm3)
al laminei frunzei
frunzei (n m)
(S:V)
1.
DRX-M4-508
102,05
3,1841
32,05
312,01
2.
DRX-M4-583
72,36
2,1438
33,75
299,54
3.
DRX-M4-677
107,83
2,7087
39,80
251,20
4.
DRX-M4-547
70,36
1,7329
40,60
246,29
5.
DRX-55
62,80
1,5464
40,61
246,24
6.
DRX-M4-542
88,81
2,1785
40,76
230,03
7.
DRX-M4-660
101,76
2,3982
42,43
236,90
8.
DRX-M4-545
95,56
2,2180
43,08
232,11
9.
DRX-M4-560
84,03
1,8926
44,39
225,23
Grosimea laminei frunzei la hibrizii distani de vi de vie BC3 este de 312,01 m la hibridul DRX-M4508 i 299,54 m la hibridul DRX-M4-583.
Suprafaa medie mai mic a laminei frunzei la hibrizii distani de vi de vie BC 3 este n limita de 70,36
cm2 la hibridul distant DRX-M4-547 i 72,36 cm2, la hibridul distant DRX-M4-583.
Volumul mediu mai mare al laminei frunzei la hibrizii distani de vi de vie BC 3 este n limitele de
3,18741 cm3 la hibridul distant DRX-M4-508 i 2,70873 la hibridul distant DRX-M4-677.
Raportul mai mic al suprafeei medii al laminei frunzei la volumul mediu al laminei frunzei la hibrizii
distani de vi de vie BC3 s-a constatat a fi n limita de 32,05, la hibridul distant DRX-M4-508, i 33,75, la
hibridul DRX-M4-583.
Reieind din particularitile morfo-anatomice ale laminei frunzei hibrizilor distani de vi de vie BC3,
s-a constatat c hibrizii DRX-M4-508 i DRX-M4-583 au o rezisten sporit fa de secet.
Cu ct raportul S:V este mai mic, cu att rezistena relativ la secet este mai mare, deci hibridul distant
DRX-55 (F2) deine cea mai nalt rezisten la secet. Ceilali hibrizii distani analizai s-a constatat c i ei
dein o rezisten destul de sporit fa de secet: DRX-M4-660 (45,06); - 677 (46,48); - 560 (47,58); - 508
(49,29); - 583 (49,90) (Tab. 1).
La momentul actual, n condiiile schimbrilor globale ale climei, evaluarea resurselor agroclimatice la
nivel regional reprezint un factor decisiv n utilizarea durabil a resurselor vegetale. Din punct de vedere al
condiiilor de iernare, teritoriul Republicii Moldova servete drept hotarul de nord al amplasrii teritoriale pentru
unele culturi multianuale termofile, inclusiv i via de vie.
Ameliorarea viei de vie const nu numai n crearea soiurilor de vi de vie productive i cu nsuiri
calitative, dar i rezistente la factorii biotici i abiotici ai mediului, inclusiv i fa de temperaturile joase n
perioada rece a anului.
nveliul instabil de zpad deseori provoac situaii cnd temperaturile de nivelul - 20, - 25 0C devin
factor climatic de risc. Frecvena temperaturii de - 20 0C variaz destul de mult n spaiu. n nordul Republicii
Moldova acest nivel de temperatur poate fi nregistrat n ase ani din 10, iar n sud o dat n 5 ani.
Conform studiilor ntreprinse privind gradul de vtmare a lstarilor de un an i capacitatea de
restabilire s-a constatat c cel mai sporit nivel de rezisten fa de nghe l dein speciile slbatice din fam.
Vitaceae L. Speciile genului Parthenocissus Planch, dein 100% rezisten fa de nghe. De asemenea, nivel
sporit de rezisten fa de nghe dein i unele specii din genul Vitis L.: Vitis amurensis Rupr.; speciile de vi
de vie din Amrica de Nord: Vitis cinerea Arnoldi, Vitis longii Br., Vitis riparia Michx., Vitis solonis Planch.
Capacitatea de rezisten a mugurilor fa de nghei este de 95-98 %, iar capacitatea de restabilire este de 98100%.
Studiind structura anatomic a rdcinii viei de vie din punctul de vedere al rezistenei la ger s-a
constatat c soiurile i speciile de vi de vie, dein rezisten sporit fa de ger n cazul cnd, dein: celulele
liberului (floemului) i ale razelor rdcinii au dimensiuni mai mici i sunt mai compacte; diametrul vaselor din
lemnul rdcinii este mai mic i densitatea vaselor la o unitate de suprafa este mai mic; procentul lemnului
(xilemului) rdcinii este mai mare, dar procentul liberului (floemului) este mai mic [28].
Rezistena la iernare a acestor hibrizi se ncadreaz n 4 grupe n dependen de procentul mugurilor vii
al fiecrui hibrid distant. Hibrizii din grupa I de rezisten la iernare au cel mai mare procentaj de muguri vii. La
aceast grup aparin hibrizii DRX-M4-502 (96,78% de muguri vii), DRX-M4-537 (95,24%), DRX-M4-545
(95,13%), DRX-M4-578 (92,31%).
Cel mai mare procentaj de muguri necrotizai, dup iarna 2012-2013, este determinat la hibrizii DRXM3-(3-1) (28,57%), DRX-M4-508 (29,41%), DRX-M4-602 (35,71%), DRX-M4-511 (43,33%).
Hibrizii cu cel mai mic procent de ap, n fragmentele de tulpin de un an, situate ntre nodurile 5-10, i
cel mai mare procentaj de substan uscat, n acest fragment al tulpinii caractere biomorfologice care, de
asemenea, caracterizeaz hibrizii mai rezisteni la iernare, - sunt urmtorii: DRX-M4-504, DRX-M4-536, DRXM4-537, DRX-M4-545, DRX-M4-579, DRX-M4-609; toi aceti hibrizi aparin la grupa I de rezisten a tulpinii
de un an cu procentajul (39,18%-42,10%) ap din masa proaspt a tulpinii de un an (Tab. 2).
Nr.
d/o

Hibridul

35

Tabelul 2. Rezistena la iernare a hibrizilor distani (Vitis vinifera L. x Muscadinia rotundifolia Michx.)
determinat n baza mugurilor axilari ai tulpinii de un an
Nr.
Hibridul
Muguri
Muguri
Procentul
Muguri
Procentul
Gradul de
d/o
examinai,
vii,
mugurilor
mori,
mugurilor mori,
rezisten
(unit.)
(unit.)
vii, (%)
(unit.)
(unit.)
1
2
3
4
5
6
7
8
1. DRX-M4-502
31
30
96,78
1
3,22
1
2. DRX-M4-537
21
20
95,24
1
4,76
1
3. DRX-M4-538
65
59
90,77
6
9,23
1
4. DRX-M4-545
41
39
95,13
2
4,87
1
5. DRX-M4-578
39
36
92,31
3
7,69
1
6. DRX-55
42
33
78,58
9
21,42
2
7. DRX-M4-504
8
7
87,50
1
12,50
2
8. DRX-M4-510
49
39
79,60
10
20,41
2
9. DRX-M4-535
82
71
86,59
11
13,41
2
10. DRX-M4-541
64
55
85,94
9
14,06
2
11. DRX-M4-579
35
31
88,57
4
11,43
2
12. DRX-M4-580
104
88
84,62
16
15,38
2
13. DRX-M3-3-1
14
10
71,43
4
28,57
3
14. DRX-M4-508
34
24
70,59
10
29,41
3
15. DRX-M4-512
14
10
71,43
4
28,57
3
16. DRX-M4-602
28
18
64,29
10
35,71
3
17. DRX-M4-660
11
7
63,64
4
36,36
3
18. DRX-M4-511
30
17
56,67
13
43,33
4
CONCLUZII:
1. Cu ct raportul S:V este mai mic, cu att rezistena relativ la secet este mai mare, deci hibridul distant DRX55 (F2) deine cea mai nalt rezisten la secet. Ceilali hibrizii distani analizai s-a constatat c i ei dein o
rezisten destul de sporit fa de secet: DRX-M4-660; - 677; - 560; - 508; - 583.
2. Hibrizii distani de vi cu rezisten sporit la iernare: determinat n baza mugurilor axilari ai tulpinii de un
an: DRX-M4-502, DRX-M4-537, DRX-M4-545, DRX-M4-578; cu cel mai mic procent de ap, n fragmentele de
tulpin de un an, situate ntre nodurile 5-10, i cel mai mare procentaj de substan uscat, n acest fragment al
tulpinii caractere morfologice care, de asemenea, caracterizeaz hibrizii mai rezisteni la iernare: DRX-M4504, DRX-M4-536, DRX-M4-537, DRX-M4-545, DRX-M4-579, DRX-M4-609.
BIBLIOGRAFIE:
1. Alexandrov, E. Hibridarea distant la via de vie (Vitis vinifera L. x VitisrotundifoliaMichx.). Chiinu:
Print-Cargo SRL, 2010. 192 p.
2. Alexandrov, E. Hibrizii distani ai viei de vie (Vitis vinifera L. x Muscadinia rotundifolia Michx.). Aspecte
biomorfologice i uvologice. Chiinu: Tipogr. AM, 2012. 140 p.
3. Chisil, M.; Chisil, S.; Dadu, V. Trei etape n dezvoltarea viticulturii i vinificaiei n Republica Moldova. n:
Pomicultura, Viticultura i Vinificaia, 2014, nr. 1(49), p. 38-39.
4. Codreanu, V. Anatomia comparat a viei de vie (Vitis L.). Chiinu: Comb. Poligraf, 2006. 252 p.
5. Constantinov, T.; Nedealcov, M. Evaluarea resurselor agroclimatice n contextul posibilitilor de cultivare a
noilor soiuri de vi de vie. n: Akademos, 2010, nr. 3(18), p. 92-95.
6. Gaina, B.; Alexandrov, E. Pagini din istoria i actualitatea viticulturii. Chiinu: Lexon-Plus, (Tipografia
Reclama), 2015. 260 p.
7. . 3- . :
, 1986-1987.
NECESITI LA CREAREA SOIURILOR NOI DE VI DE VIE
Alexandrov Eugen, dr. conf. cercet., Grdina Botanic (Institut) a AM, Gaina Boris, academician,
AM
The process of obtaining distant hybrids, as well as any crossing of cultivars of V.vinifera L. with
representatives of species possessing the necessary qualities (resistance to diseases and pests, low temperature,
etc.) may change the spectrum of chemical and biochemical compounds responsible for flavour, colour and taste
of grapes, obtained juice and wine. For the determination of diglucoside-3,5-malvidin, the fluorimetric method,
for determining the methyl anthranilate, the gas chromatographic method was applied. Based on the analyzes of
biochemical constituents of grapes of the distant hybrids: DRX-M4-578; -502; -571; -660; -609; -580; etc.,
compared to the traditional cultivars Feteasca alb and Rar neagr, it has been found that these varieties are
similar. The distant hybrids studied according to the classical uvologic and technological principles can be
classified as follows: distant hybrids are attributed to the table vine species (DRX-M4-502; DRX-M4-512 etc.)

36

and distant hybrids have mixed properties (DRX-M3-3-1; DRXM4-580; -640 etc). According to the physical and
biochemical indices of the grapes of the studied distant hybrids, their characteristics are similar to European vine
species.
Key words: berry, diglucoside-3,5-malvidin, methyl anthranilate, variety.

INTRODUCERE
Dezvoltarea culturii viei de vie pe parcursul evoluiei sale a cunoscut multiple metode de ameliorare,
cum ar fi selecia natural sau dirijat (intraspecific, interspecific, clonal, ingineria genetic etc.). Un
deziderat al tiinei i practicii mondiale vitivinicole rmne a fi obinerea varietilor de vi de vie de calitate,
absolut rezistente la atacul filoxerei (radicular i foliar).
Procesul de obinere a hibrizilor distani, la fel ca orice ncruciare a varietilor de Vitis vinifera L. cu
reprezentani din speciile donatoare de caliti necesare (rezisten la boli i vtmtori la temperaturi joase de
iarn etc.), poate duce la schimbarea spectrului de compui chimici i biochimici responsabili de aroma, culoarea
i gustul bacelor, al sucului i al vinului obinut.
Conform cerinelor Uniunii Europene la producerea produselor vitivinicole, compoziia chimic a
materiei prime trebuie s ntruneasc unele cerine stricte, de exemplu diglucozid-3,5-malvidol nu trebuie s
depeasc limita de 15 mg/dm3. Recent Organizaia Mondial a Viei i Vinului a pus n discuie problema
acestui indice n vinurile importate pe piaa Uniunii Europene. Se cere o monitorizare n selecia hibridrii
distante pentru a selecta i omologa doar varietile cu un coninut sczut de acest compus antocianic
diglucozid -3,5 -malvidol, cu att mai mult c numeroi enologi proemineni, printre care acad. Pascal RibreauGayon (Institut dOenologie din Bordeaux), afirm inofensivitatea absolut a antocianelor i, din contra,
enumer proprietile lor igienice i curative nalte.
Un alt component important din sucul bacelor hibrizilor de orice ordin, inclusiv al celor distani, este
antranilatul de metil (3,4-benzoxazol), cruia i se atribuie rolul principal n crearea gustului i mirosului
(aromelor) de foxat (de naftalin i/sau de fenol). Antranilatul de metil reprezint un compus azotic din grupa
benzoxazolilor, se formeaz n struguri (ndeosebi la hibrizii productori direci) n cantiti de 0,2-3,5 mg/dm3
de must (suc). Acesta se regsete n vin n aceleai concentraii alturi de un alt component chimic aromat
volatil acetatul de izoamil. De aceea, acest constituent chimic important din sucul bacelor hibrizilor noi din
selecia intraspecific se cere determinat, studiat i luat drept criteriu de preselecie.
Organizaia Internaional a Viei i Vinului a stabilit n anul 2004 concentraia limit de metanol de
250 ml/l pentru vinurile albe i de 400 ml/l pentru vinurile roii.
Metanolul reprezint un alcool care se sintetizeaz prin substituirea n molecula de metan a unui atom
de hidrogen cu o grupare OH (hidroxilic). n procesele de fermentare a fructelor se poate forma metanol prin
descompunerea pectinelor. Consumul de metanol poate produce intoxicaii grave, acesta poate lua natere prin
distilarea fracionat n mod particular a alcoolului.
n literatura de specialitate (biologic, uvologic i enologic) sunt descrise i o alt serie de substane
ce comunic arome vegetale sau erbacee: 2-metoxi-3-izobutil-pirazina i 2-metoxi-3-metiletil-pirazina, ambele
din grupa pirazinelor care se formeaz n struguri. Ele se gsesc n forme volatile libere n sucul bacelor de
hibrizi i n vinul obinut. Pragul lor senzorial de percepie este de 10 mg/dm3 i, la un coninut de peste 24
mg/dm3 total, ei se depisteaz uor olfactiv.
A mai fost depistat, n sucul i vinul obinut din hibrizi, furanolul cu gust i arom de cpun. Pragul
de percepie gustativ este nalt, la nivelul de 700 mg/dm3. Alturi de el, un alt compus chimic natural, i anume
aminoacetofenona, a fost depistat, cu miros i gust de fenol.
ns coninutul ultimilor constitueni din mustul i vinul hibrizilor productori direci i ale speciilor de
vi-de-vie nord-americane (Vitis labrusca: Concord, Delaware, Isabella etc.) este destul de redus i este dificil
de a aprecia mai exact influena lor asupra spectrului aromatic al produselor din struguri (must, suc i vinuri).

MATERIAL I METODE
n calitate de obiect de studiu au servit hibrizii distani de vi de vie (Vitis vinifera L. x Muscadinia
rotundifolia Michx.) de F4 (DRX-M4-578; -502; -571; -660; -609;-580;-512 etc.) i soiurile de vi de vie
Feteasca alb, Rar neagr i Negru de Ialoveni. Soiurile de vi de vie din Italia, dintre care: soiuri cu struguri
cu bace albe (Fleurtai, Soreli, Early Sauvignon; Petit Sauvignon, Sauvignon dore i soiuri cu sucul bacelor de
culoare roie (Petit Cabernet, Royal Cabernet, Royal Merlot, Petit Merlot, Julius 1, 2, 3.
Diglucozid-3,5-malvidol a fost determinat prin metoda fluorimetric cantitativ i calitativ.
Antranilatul de metil s-a determinat prin metoda cromotografic cu faz gazoas. La efectuarea analizelor
biochimice i uvologice s-au utilizat metodele expuse n Reglementrile tehnice Metode de analiz n domeniul
fabricrii vinurilor 9, 10, 11.

REZULTATE I DISCUII
n tiina agro-biologic contemporan sunt cunoscute realizrile din domeniul seleciei intraspecifice
efectuate, ncepnd cu a dou jumtate a veacului XX soldate cu obinerea de noi varieti cu rezistene sporite la
factorii biotici i abiotici, i caliti acceptabile cum ar fi cele din Germania (Soliaris, Hibernal-GM); Ungaria
(Bianca); Moldova (Viorica, Legenda, Reton, Luminia, Alb de Ialoveni, Negru de Ialoveni i altele, destinate
sucurilor i vinurilor; Apiren alb, Apiren roz, Negru de Grozeti, Ki-mi moldovenesc, Ki-mi Lucisti,

37

destinate consumului proaspt i procesrii industriale, precum i varietile pentru mas: Moldova, Guzun,
Suruceni alb, Leana, Ialoveni rezistent, Codreanca, Tudor i altele); Ucraina, Odessa: soiuri i forme de mas
(Arkadia, Vostok, Gherkules, Dnestrovchii rozovi, Zolotisti ustoicivi, Ki-mi tairovschii, Muscat jemciujni,
Muscat tairovschii i altele); soiuri i forme tehnice (Aromatni, Golubok, Iliciovschii rannii, Muscat odesschii,
Odesschii Ciorni, Ovidiopolschii, Rubin tairovschii, Suholimanschii beli i altele); Italia create soiuri noi de
vi de vie, dintre care: soiuri cu struguri cu bace albe (Fleurtai, Soreli, Early Sauvignon; Petit Sauvignon,
Sauvignon dore i soiuri cu sucul bacelor de culoare roie (Petit Cabernet, Royal Cabernet, Royal Merlot, Petit
Merlot, Julius 1, 2, 3.
Apreciind la justa valoare aceste realizri cu caractere agro-biologice concrete a soiurilor obinute,
trebuie de menionat c cultivarea acestor varieti impune n mod obligatoriu altoirea lor pe protaltoi nordamericani (rezisteni la filoxer), lucru care ridic considerabil costul de producere a materialului sditor i cel al
nfiinrii unei uniti - plantaie de vi de vie. n plus, majoritatea varietilor sus menionate sunt relativ
rezistente la contaminanii principal n perioada de vegetaie (mildium, oidium, mucegaiul cenuiu), iar n
ultimul timp se atest i sensibilitate la Agrobacterium tumefacium (cancerul bacterian al viei de vie) i
Flovecence dore (uscarea aurie a braelor).
Pentru a nu amesteca strugurii roii de vi de vie din specia Vitis vinifera L. cu hibrizii productori
direci, n practica european sa purces la stabilirea unei limite la componentul - test, care este un antocian de
culoare violet-albstrui cu denumirea chimic veche malvidin (malvin), iar cea nou - diglucozid-3,5malvidol. El este un component natural, inofensiv i curativ, i nu posed proprieti duntoare.
Din rezultatele prezente n Fig. 1 reiese c doar n soiul nou Petit Cabernet concentraia diglucozid-3,5malvidol nu depete limitele stabilite de 15 mg/l, nscriindu-se n aa fel n clusterul varietilor europene din
specia Vitis vinifera L.
Fig. 1. Concentraia de diglucozid-3,5malvidol i suma total a antocianelor
n sucul bacelor soiurilor de vi de vie
create n Italia
Ct privete varietile Julius,
Petit Cabernet, Petit Merlot, Royal
Merlot, Royal Cabernet se atest o
concentraie sporit a acestui antocian
inofensiv i curativ (12), dar care poate
crea impedimente actualmente doar la
omologarea lor n unele ri ale Uniunii
Europene. Specialitii nutriioniti i
dietologi afirm c organismul uman n
evoluia sa a creat suficiente sisteme
enzimatice
de
valorificare,
de
metabolizare a antocianelor i altor compui transformndu-i n derivate necesare i utile 13.
Fig. 2 Concentraia de
diglucozid-3,5-malvidol
n
sucul
bacelor unor soiuri de vi de vie (roii)
create n Germania
Rezultatele selecionerilor din
Germania, ne demonstreaz c prin
selecia intraspecific se pot obine
caractere agrobiologice importante
(rezisten, productivitate i calitate),
dar cu un coninut nalt n diglucozid 3,5-malvidol (580 mg/l n vinul de soiul
Regent i 1900 mg/l n vinul soiului
Cabernet Carbon). Sigur, c n
comparaie cu varietile din specia Vitis
vinifera L., Cabernet (Jura, Frana) i
Zweigelt (Rhein, Germania) indicele investigat nu depete limitele de 15 mg/l, stabilite de organismele
internaionale de specialitate.
Investigaiile efectuate au avut ca scop verificarea dac prin obinerea hibrizilor distani nu s-au
transmis caracteristici specifice varietilor de hibrizi productori direci, ai cror indici la concentraia
antranilatului de metil variaz de la 0,30 mg/dm3 pn la 3,6 mg/dm3. Datele obinute atest o similitudine ntre

38

hibrizii distani i varietile clasice: la varietile cu bacele de culoare verde-glbuie sau verde-pai ale hibrizilor
distani, acest indice atest 0,08-0,17 mg/dm3. Aceste rezultate atest o asemnare a hibrizilor distani DRX-M4571; -578; -609; DRX-M3-3-1 la coninutul n antranilat de metil cu varietatea clasic de struguri Feteasc Alb
din specia Vitis vinifera L.
Hibrizii distani DRX-M4-660 i DRX-M3-3-1 cu bacele de culoare roie-violet (rodie), concentraia
antranilatului de metil variaz n limita de 0,21-0,24 mg/dm3, deci, se atest o similitudine cu soiul clasic Rar
Neagr, care a acumulat n sucul proaspt 0,27 mg/dm3 de antranilat de metil.
Aprecierile organoleptice ale calitii bacelor celor opt hibrizi distani i ale varietilor clasice ne-au
permis s constatm absena aromei (mirosului) i gustului de foxat tipic hibrizilor productori direci, dar mai
ales varietilor nord-americane din specia Vitis labrusca (Concord, Isabella, Noah, Lidia, Delaware, Othello
.a.).
Doar la hibridul intraspecific Negru de Ialoveni din colecia de vi-de-vie de la Institutul tiinificoPractic de Horticultur i Tehnologii Alimentare s-a determinat, prin aceeai metod cromatografic cu faza
gazoas, o concentraie sporit de antranilat de metil de 0,49 mg/dm3, ce atinge valori apropiate unor hibrizi
productori direci [7].
Determinnd concentraia de diglucozid -3,5-malvidol s-a ajuns la concluzia c acest indice n sucul
proaspt al hibrizilor distani variaz n limitele 7,7 mg/dm 3 i 9,3 mg/dm3 de diglucozid -3,5-malvidol (DRXM4-660; DRX-M3-3-1), iar la varietatea clasic Rara Neagr (Cricova S.A., c. Luceti, r. Cahul) se constat
doar 4,9 mg/dm3 de diglucozid-3,5-malvidol. Aceste rezultate ne permit s afirmm c, dup valorile indicelui
concentraia de diglucozid -3,5-malvidol, la hibrizii distani F4 nu se deosebesc practic de soiul clasic Rara
Neagr.
Excepie, n investigaiile realizate, face hibridul intraspecific Negru de Ialoveni cu 74,0 mg/dm3 de
malvin n sucul bacelor acestei varieti din colecia de vi-de-vie a Institutului tiinifico-Practic de
Horticultur i Tehnologii Alimentare.
Dup coninutul compuilor fenolici, inclusiv al antocianelor, din sucul bacelor hibrizilor direci n
comparaie cu cel al varietilor Vitis vinifera L. clasice (Feteasca Alb i Rara Neagr), aceste varieti nu se
deosebesc radical, ci doar n limitele 184-260 mg/dm3 la compuii fenolici n bacele de culoare verde-galben
(pai) DRX-M4-571; DRX-M4-512 etc. i 1987-2316 mg/dm3 la hibrizii distani DRX-M3-3-1 i DRX-M4-660.
i la indicele concentraiei antocianelor n varietile colorate nu se atest o deosebire esenial ntre
hibrizii distani i varietile clasice Rara Neagr: de la 513 mg/dm3 pn la 640 mg/dm3 pentru hibrizii distani
de vi-de-vie i un coninut (obinuit) de 469 mg/dm3 la Rar Neagr din grupa Vitis vinifera L.
n sucul bacelor hibridului intraspecific Negru de Ialoveni a fost constatat concentraia nalt de
compui fenolici, circa 2790 mg/dm3 i de antociane 861 mg/dm3.
Aprecierile organoleptice ale sucului proaspt obinut din hibrizii distani de vi de vie n comparaie
cu sucul bacelor varietilor clasice Feteasca Alb i Rara Neagr de la Cricova S.A., realizate n campania de
recoltare a anului 2014 [aprecierea aromei (mirosului) i gustului etc.], ne-au permis s atestm o asemnare a
culorii bacelor, a aromei i a gustului sucului extras din ele, cu mici nuane la fiecare varietate investigat.
La punctajul general s-au evideniat gustativ-olfactiv hibrizii cu bacele de culoare verde-glbuie: DRXM4-609 cu 9,5 puncte i DRX-M4-502 cu 9,0 puncte. Dintre hibrizii cu bacele de culoare roie-violet (rodie) sa evideniat hibridul DRX-M3-3-1 cu 9,3 puncte.
Evident, reprezentanii speciei Vitis vinifera L. (Feteasca Alb, Rara Neagr) au fost apreciai cu 9,9
puncte i, respectiv, 9,8 puncte, ceea ce se nscrie n valorile lor tradiionale i tipice. Varietatea intraspecific
Negru de Ialoveni nu a depit punctajul de 8,9 puncte, fiind prea taninos n gust i practic neutru n arom.
Ct privete indicii biochimici i fizico-chimici, dup concentraia acizilor organici (acidul tartric i
acidul malic), toi hibrizii distani pot fi atestai la specia de vi-de-vie european Vitis vinifera L., acidul tartric
variind n limitele de la 3,2 g/dm3 pn la 4,7 g/dm3, iar acidul malic: de la 1,9 g/dm3 la 3,1 g/dm3. Concentraia
glucozei i fructozei constituie n medie 95,5-99,3% din concentraia total a zaharurilor (100%). Raportul
glucoz/fructoz este tipic soiurilor de vi-de-vie europene i variaz de la 1,04 pn la 1,17.
Selecia noilor varieti de struguri de mas pune sarcina ca raportul monoglucidelor fructoza-glucoza
s fie n favoarea fructozei cu valoare optimal de 1,1-1,3, iar raportul dintre acidul tartric i acidul malic n
limitele indicilor 1,0 - 1,4.
Concentraia substanelor fenolice denot apartenena hibrizilor distani obinui la soiurile de vi-devie de mas. Suma acestor substane la hibrizii distani de vi-de-vie cu bacele de culoare verde-glbuie variaz
n limitele 201-293 mg/dm3, iar pentru hibrizii cu bacele de nuan albastr-violet de la 777 mg/dm3 pn la
809 mg/dm3.
Este mbucurtor faptul c concentraia resveratrolului, n calitate de compus biologic pentru nutriia
uman, este relativ sporit, n comparaie cu soiurile clasice de vi-de-vie (4,1-5,3 mg/dm3), variaz la hibrizii
distani n limitele de la 5,7 mg/dm3 pn la 11,7 mg/dm3.
Conform indicilor fizici i biochimici ai bacelor hibrizilor distani studiai, caracteristicile acestora sunt
similare soiurilor de vi-de-vie europene: azotul total variaz n limitele de la 563 mg/dm3 pn la 740 mg/dm3,
fosfor 179-263 mg/dm3, calciu 107-156 mg/dm3, potasiu 1367-2013 mg/dm3, magneziu 103-144 mg/dm3.

39

CONCLUZII:
1. n baza principiilor clasice uvologice i tehnologice s-a constatat c hibrizii distani de vi-de-vie (Vitis
vinifera L. x Muscadinia rotundifolia Michx.): DRX-M4-502; DRX-M4-512; DRX-M4-560; DRX-M4-580 .a.
posed caliti ale soiurilor de mas, iar hibrizii DRX-M3-3-1; DRX-M4-580; DRX-M4-640 .a. posed
proprieti mixte (pentru consum curent i procesare industrial).
2. A fost iniiat procedura de creare a sectoarelor experimentale de cultivare a hibrizilor distani de vi-de-vie
n condiiile zonei de nord a Republicii Moldova (Bli i Soroca).
BIBLIOGRAFIE:
1. 10 Nuovi vitigni resistenti alle malattie. Vivai Cooperativi Rauscedo, Italia, 2015. 20 p.
2. Alexandrov, E. Hibridarea distant la via de vie (Vitis vinifera L. x VitisrotundifoliaMichx.). Chiinu.
Print-Cargo SRL, 2010. 192 p.
3. Alexandrov, E. Hibrizii distani ai viei de vie (Vitis vinifera L. x Muscadinia rotundifolia Michx.). Aspecte
biomorfologice i uvologice. Chiinu: . AM, 2012. 140 p.
4. Antoce, Oana Arina. Enologie. Chimie i analiza senzorial. Craiova: Ed. Universitii Craiova, 2007. 808 p.
5. Burgot, G.; Burgot, I. Metodes instrumentales danalyses chimique et applications.
Methodeschromotografiques, electrophorese et methodes spectrales. 2 -e edition. Paris: Ed. Lavoisier, 2006. 320
p.
6. Gaina, B.; Alexandrov, E. Pagini din istoria i actualitatea viticulturii. Chiinu: Lexon-Plus, (Tipografia
Reclama). 2015. 260 p.
7. Gaina, B.; Jean-Louis, Puech, Perstnev, N. et al. Uvologie i Oenologie. Chiinu: Tip. AM, 2006. 444 p.
8. Gaina B.; Roman, O.; Bourzex, M.; Gougeon, R. Date recente privind resveratrolii n must i vinuri. n: Rev.
Viticultura i Vinificaia n Moldova, 2007, Nr.3, p. 24-26.
9. Struza, R.; Gaina, B. Inofensivitatea produselor uvologice. Metode de analiz i de prevenire contaminrii.
Chiinu, 2012. 216 p.
10. rdea, C. Chimia i analiza vinului. Iai: Ed. Ion Ionescu de la Brad, 2007, 1398 p.
11. rdea, C.; Srbu, Gh.; rdea, A. Tratat de vinificaie. Iai: Ed. Ion Ionescu de la Brad, 2010, 764 p.
CERCETAREA GRADULUI DE INFLUEN A REGLATORULUI DE CRETERE BLACKJAK
ASUPRA PRODUCTIVITII POMILOR I CALITII FRUCTELOR DE MR
Bujoreanu Nicolae, dr. hab., conf. cercet., Harea Ion, cercet. t., Gaviuc Ludmila, cercet. t., Bejan
Nina, cercet. t., Institutul de Genetic, Fiziologie i Protecie a Plantelor al AM
The results presented in this paper demonstrates the positive effect of growth regulators Blackjak on
the biosynthesis chlorophyll pigments and intensity of growth processes in apical shoots of fruit trees Renet
Simirenco variety. Research has highlighted the beneficial influence of preparation on productivity and
biochemical composition of the fruit trees of apple, in relation to the standard and control variants.
Key words: growth regulator, fruit apple, fruit, apple, biochemical indices, the process of growth,
foliar treatment, the growing season and quality.
INTRODUCERE
Pomicultura reprezint una dintre ramurile de baz a economiei naionale. Pe parcursul ultimilor ani
volumul de producie a sczut considerabil n rezultatul reducerii suprafeelor de livad, lipsei materialului
sditor, nerespectrii tehnologiilor de cretere a fructelor i msurilor de combatere a bolilor i vtmtorilor n
perioada de vegetaie.
Dezvoltarea de lung durat a pomiculturi n republic impune pe prim plan asigurarea stabilitii
fructificrii pomilor, prelungirea termenului de exploatare a livezilor, sporirea calitii i capacitii de pstrare a
fructelor i rentabilitii acestei ramuri.
Se cunoate, c creterea i dezvoltarea culturilor agricole sunt reglate de substane formate n plant fitohormonii endogeni. Aceste substane sunt clasificate n auxine, gibereline, citochinine, inhibitori de cretere
i etilen [7, 8, 9]. Reglatorii de cretere exogeni care influeneaz nivelul hormonilor din plant, modific
coraportul lor i, drept urmare, regleaz mecanismul productivitii, calitii i rezistenei plantelor la condiiile
nefavorabile de cretere.
O influen deosebit asupra derulrii proceselor fiziologo-biochimice la pomii fructiferi exercit
substanele biologic active (SBA), aplicate foliar n anumite faze de cretere i dezvoltare a acestora: nfloritul,
legarea fructelor, dividerea i alungirea celulelor, depunerea mugurilor de rod pentru roada anului viitor i
morfogeneza lor. Rezultatele tiinifico-practice din ultimii ani [10, 11] n aplicarea SBA la plantele pomicole
confirm aciunea benefic a lor asupra intensificrii proceselor fiziologo-biochimice de acumulare i distribuire
a substanelor plastice i minerale, reglrii activitii fotosintetice a aparatului foliar, sporirii volumului de
producie, calitii fructelor i rezistenei pomilor fructiferi la factorii nocivi ai mediului nconjurtor.
Cercetrile din aceast lucrare, au fost orientate spre determinarea influenei reglatorului de cretere
Blackjak asupra intensitii proceselor de cretere, acumulrii pigmenilor clorofilieni, productivitii i valorii
unor indici biochimici la pomii i fructele de mr de soiul Renet Simirenco.

40

MATERIALE I METODE
Experienele, privind determinarea gradului de influen a reglatorului de cretere Blackjak asupra
intensitii proceselor de cretere i dezvoltare a pomilor i fructelor de mr de soiul Ranet Simirenco, au fost
efectuate n livada de meri a SRL Lefcons Agro, com. Floreni, r-nul Ungheni. Reglatorul de cretere
Blackjak a fost aplicat pe durata perioadei de vegetaie n trei reprize, aplicnd concentraiile de 0,15 kg/ha,
2,0/ha i 3,0/ha. n calitate de standard a fost aplicat Lignogumatul de K n cantitate de 0,15 kg/ha. Pomii i
fructele de mr din varianta martorului au fost stropii cu ap.
Variantele experienelor montate au inclus cte 3 repetri, iar n fiecare repetare s-au tratat 3-5 pomi
fructiferi. Calitatea fructelor de mr recoltate a fost verificat prin cntrire cu utilizarea marcatorului de calibru,
conform recomandrilor n vigoare.
Pentru verificarea gradului de influen a reglatorului de cretere Blackjak asupra productivitii
pomilor fructiferi i calitii produciei obinute, cercetrile tiinifice au inclus determinarea valorilor
urmtorilor indici fiziologici, biochimici i tehnologici: coninutul pigmenilor clorofilieni i lungimea lstarilor
apicali, care s-a determinat conform metodelor descrise n (3); calitatea fructelor, determinat conform(4);
indicii biochimici: masa uscat, utiliznd cuptorul de laborator cu temperatura de 1050C, coninutul glucidelor,
acizilor titrabili i vitaminei C, aplicnd metodele propuse de [2]. Prelucrarea statistic a rezultatelor obinute, a
fost efectuat conform metodelor propuse de [1].
REZULTATE I DISCUII
Pomii fructiferi de soiul tardiv Renet Simirenco au fost tratai extraradicular cu reglatorul de cretere
Blackjak n 3 reprize i cu diferite concentraii pe durata perioadei de vegetaie. n calitate de standard a fost
utilizat Lignogumatul de K cu o cantitate de consum de 0,15 kg/ha. Rezultatele obinute dup efectuarea a 3
tratamente foliare conform termenilor i dozelor stabilite sunt prezentate n tabelul 1.
Tabelul 1. Determinarea gradului de influen a reglatorului de cretere Blackjak asupra proceselor
de cretere vegetativ a lstarilor apicali i acumulrii pigmenilor clorofilieni la pomii de mr de soiul Renet
Simirenco
Soiul, varianta
Coninutul pigmenilor clorofilieni n
Creterea vegetativ a lstarilor apicali
experienei
frunzele pomilor de mr, mg/dm2
n perioada de vegetaie a pomilor
fructiferi, cm
a
b
a+b
timp de o zi
pe durata a 45 zile
St. Lignogumat de K,
2,68
0,89
3,57
0,73
33,0
0,15 kg/ha
Blackjak 2,0 l/ha
3,11
1,04
4,15
0,82
36,8
Blackjak 3,0 l/ha
3,57
1,19
4,76
0,89
40,0
Martorul
2,56
0,85
3,41
0,68
31,0
DL,5%
0,19
0,22
0,43
0,03
1,5
Din datele prezentate n tabelul 1 se constat c reglatorul de cretere Blackjak, aplicat la pomii de
mr de soiul Renet Simirenco a intensificat sintez a pigmenilor clorofilieni, sporind coninutul lor n frunzele
pomilor din variantele de experien cu 0,58-1,19 mg/dm2 fa de pomii din varianta standardului i cu 0,74-1,35
mg/dm2 fat de martor. Majorarea coninutului de pigmeni n frunze contribuie la intensificarea proceselor de
sintez a asimilatelor i transportului lor spre diferite organe ale pomului. Cercetri, privind activizarea
proceselor de biosintez i acumulare a pigmenilor clorofilieni prin aplicarea reglatorilor de cretere au fost
efectuate i de ali cercettori din republic [5, 6, 10]. Rezultate similare au fost obinute i la determinarea
intensitii de cretere a lstarilor apicali pe durata perioadei de vegetaie a pomilor fructiferi. n variantele
aplicrii reglatorului de cretere cercetat, intensitatea de cretere a lstarilor apicali pe durata unei zi a constituit
n dependen de varianta experienei de la 0,73 pn la 0,89 cm, fiind mai superioar cu 0,09-0,16 cm fa de
varianta standardului i cu 0,14-0,21 cm fa de martor. Aplicarea reglatorului de cretere Blackjak n
concentraiile i termenii stabilii, a influenat de asemeni productivitatea pomilor fructiferi i calitatea fructelor
de mr de soiul Ranet Simirenco (tab. 2).
Tabelul 2. Determinarea gradului de influen a reglatorului de cretere Blackjak asupra
productivitii pomilor fructiferi i calitii fructelor de mr de soiul Renet Simirenco
Varianta experienei
Dimensiunile fructelor n diametru, mm
Roada de pe 1
Roada de pe 1
pom, kg
ha, t
60-65
65-70
70-75
75-80
mm
mm
mm
mm
St.Lignogumat de K,
22
148
183
83
64,9
54,1
0,15kg/ha
Blackjak 2,0 l/ha
27
154
177
92
67,9
56,6
Blackjak 3,0 l/ha
25
168
174
83
68,7
57,2
Martorul
28
162
175
88
63,4
52,8
DL, 5%
2,3
3,4
2,5
1,7
0,7
0,6
Din rezultatele prezentate n tabelul 2 rezult, c reglatorul de cretere Blackjak de rnd cu
intensificarea proceselor de cretere vegetativ a lstarilor apicali i sintezei pigmenilor clorofilieni, a sporit n

41

mod semnificativ productivitatea pomilor fructiferi de soiul Renet Simirenco i calitatea fructelor. Avantajul n
road n variantele aplicrii reglatorului de cretere fa de varianta standard a constituit, n dependen de doza
aplicat a preparatului 2,5-3,1 t/ha, iar fa de martor 3,8-4,4 t/ha. De rnd cu sporirea productivitii pomilor
fructiferi de soiul Renet Simirenco i calitii produciei obinute important a fost de cercetat n ce msur
reglatorul de cretere a influenat procesele de sintez i acumulare a substanelor plastice n fructele de mr din
variantele de experien (tab. 3).
Tabelul 3. Coninutul unor substane biochimice n fructele de mr de soiul Renet Simirenco n
rezultatul aplicrii reglatorului de cretere Blackjak
Varianta
Coninutul minei C, Coninutul acizilor
Coninutul
Masa uscat,%
experienei
mg/%
titrabili, %
glucidelor totale,%
St. Lignogumat de
13,85
0,62
9,30
14,50
K, 0,15 kg/ha
Blackjak 2,0 l /ha
13,50
0,72
11,82
14,50
Blackjak 3,0 l /ha
12,79
0,70
10,9
15,20
Martorul
12,10
0,68
9,17
14,50
DL, 5%
0,30
0.03
0,20
0,20
Din rezultatele prezentate n tabelul 3 se observ, c abaterile n coninutul substanelor biochimice n
fructele recoltate din variantele de experien fa de martor se afl n diapazonul limitei de 5%, iar n varianta
aplicrii preparatului n concentraie de 3,0 l /ha, coninutul substanelor biochimice determinate a fost i mai
sporit.
CONCLUZII:
1. Fertilizantul Blackjak, aplicat n trei reprize pe durata perioadei de vegetaie, a sporit productivitatea
pomilor fructiferi i calitatea fructelor de mr de soiul Renet Simirenco.
2. Fertilizantul nominalizat, de rnd cu sporirea roadei i calitii acesteia, a intensificat acumularea substanelor
biochimice n fructele de mr al cror coninut, a fost la nivelul fructelor martor, iar n varianta aplicrii
substanei cercetate n cantitate de 3,0 l/ha, a fost i mai sporit.
BIBLIOGRAFIE:
1. , .. (
). : , 1979. 416 .
2. , ..; , .. . . M:
, 1987. 430 .
3. . , 1988. 36 c.
4. .
: , 1983. 62 c.
5. , ..; , .. ()
. B:
. : , 1985, . 37-50.
6. , ..; , ..
B: . :
, 1986, . 40-45.
7. , .. . . :
, 1987. 383 .
8. , . ( ). : , 1984. 198
.
9. , .. . : - , 1982. 248 .
10. Bujoreanu, N. Formarea condiionat a fructelor pentru pstrare ndelungat. Chiinu: Magna-Priceps
SRL, 2010. 256 p.
11. Bujoreanu, N.; Chirtoca, A. Pstrarea i comercializarea merelor n stare proaspt (Ghid practic). Chiinu,
2013. 127 p.
DREB
, .., . , . . ., , .; , . .; ,
..; , .. . ., ., , .., ,

For research on drought resistance to wheat there were used primers to the DREB 1 genes. In PCR reactions
for amplification of the AND are investigated three genes - specific primers for DREB 1 genes. At application of
marker P18F / PR at all genotypes of wheat were amplified on two bands: one band in the area 811-850 bp, other
band in the area 735-777 bp. In the process of application of marker P22F / PR at all wheal genotypes were
amplified fragments in the area 639-675 bp. At application of marker P25F / PR at all wheat genotypes were

42

amplified fragments in the area 609-658 bp. Skrining of various genotypes of wheat revealed gene DREB 1 on
the third chromosome of genomes A,B and D.
Key words: wheat (Triticum aestivum L.), functional markers, DREB genes, PCR analysis.

(Triticum aestivum L.)


. . 4
3- .
, , . [1]
. ,
17 94 96 .
,
,

.
, , .
. [., , 2]
(DREB dehydration responsive element binding).

DREB 1 .

13
, . 5 , 7 1
(. 1).
1.
(Triticum L.)

.
12
8/1
Centurk
14
114
16

17

18
19
07
,
, .
Fermentas, STAB [3].
-
- DREB 1 , [4]. , , 2.
2.
- Dreb 1

Ann.
temp.
(C)

3B

50

CTGGCACCTCCATTGCCGCT

3D

63

P25F

CTGGCACCTCCATTGCTGCC

3A

57

PRa

AGTACATGAACTCAACGCACAGGACAAC

3 5

18F

CCCAACCCAAGTGATAATAATCT

P18R

TTGTGCTCCTCATGGGTACTT

P22F

*PR P22F, P25F.


20 , 5-20 , 1x
, 1.5 , 0.2 , 2.0 MgCl 2 1.2
Taq- MultiGene II Personal Thermal Cycler
: 1 3 94; 40 1 94C, 1
, 1.5 72C;
72C 10 , 4.
2.0%- , 1 (Tris Boric acid, EDTA) ,

43

.
100 bp DNA Ladder Plus
( Fermentas).
GelAnalizer.


(2n=42 ABD) ,
. DREB 1 , D
. , 2.
P18F/P18R, DREB 1 B
735-777bp 811-850 bp . , ,
. DREB 1 .
. 1.
. 1. -

(Triticum L.)



P18F/PR.

1.
2.
3.
4.
5.
6.
7.

. 1


,

3.
3.
-
12.
8. 07.
14.
9. Safir .
16.
10. 8/1.
17.
11. .
18.
12. .
19.
13. 114.
Centurk.
14. 1 kb Leder.
. 2. -

(Triticum L.)


D
P22F/PR.
DREB 1
D

P22F/R

639-675 bp
.

44

. 2 .
D
DREB 1.
DREB 1 P25F/PR,
609-658 bp. .
.3.
DREB 1 .
. 3. -

(Triticum L.)


D P25F/PR.

:
, ,
, DREB 1.

. ,
.
:
1. Brenchley, R et al. Analysis of the bread wheat genome using whole-genome shotgun sequencing. Nature, 491
705-10 (2012).
2. Wei, B.; Jing, R. L.;Wang, C. S.; Chen, J. B.; Mao, X. G.; Chang, X. P. & Ji a J. Z. DREB 1 genes in wheat
(Triticum aestivumL.): development of functional markers and gene mapping based on SNPs. Molecular
Breeding, 23, 13-22 (2009).
3. . : . . . . , .
, . , . . : , 1991. 408 .
4. , ..
(Triticum L.). : ( ), 2001, 66, 1, . 53-62.
THE POTENTIAL OF GOAT MILK FOR NEW PRODUCTS
Bogdan Nina, researcher, Practical Scientific Institute of Horticulture and Food Technology,
Laboratory food biotechnology
Capr a fost un animal recunoscut din toate timpurile i laptele creia posed proprietii curative
valoroase. Laptele de capr i produsele lactate de capr prezint caliti nutritive excelente, valoare biologic
sporita cu grad nalt de asimilare i joac un rol important n alimentaia populaiei rilor n curs de dezvoltare.
Laptele de capr comparativ cu laptele de vac sau laptele de oaie are o compoziie fracionat a proteinelor mai
omogen, conine mai mult azot deproteinezat, proteinele sunt de calitate mai bun i practic nu produce reacii
alergice i tulburri digestive.
Cuvinte-cheie: lapte de capr, bacterii lactice.
A nutraceutical food may provide expanded utility beyond its nutritional benefit. These benefits can be
both physcial and mental and are commonly attributed to the active components of the food. Todays functional
foods are typically marketed to large groups of the total population. In addition to interest of industries and
consumers for functional foods has been exponentially increasing.
In the recent years the sociological, economic and nutritional value factors are been significiantly

45

impact on the food industry, as a result of these new foods is produced which has the required properties with
health-related and is marketed.
Goats has been part of agriculture since almost the first use of domestic animals and presently its
popularity is increasing throughout the world. The use of goat milk as an excellent food source is undeniable.
Some research suggests that one of the main benefits of goat milk is that it may be benefit in case of
inflammation. Another reason why it is better for people with bowel inflammation to drink goats milk instead of
cows milk [1]. Goat production constitutes an important part of the national economy in many countries. Such
activity has particular importance in France, Italy, Spain and Greece. So, goats dairy products possessed the
same importance and formed a part of meals in developed countries according to their healthy benefits and
functional properties. Goat milk is an excellent food source.
The worlds goat population increased by around 55% between 1991 and 2011, while, the number of
cattle grew by 9% and sheep numbers decreased by about 7%. The production of goat milk increased by around
70% between 1991 and 2011 (FAOSTAT, 2013). One of the most decisive factors in the growth in the
consumption of goat milk and derived products is their perceived beneficial effects on human health, which are
fully recognized by the scientific community. Goat milk has an acceptable, attractive taste, and can be consumed
as an alternative to cow milk because it is non allergic and higher digestibility [5].
Many traditional dairy products that are accepted by the consumers worldwide are made from sheep or
goat milk or from their mixtures.
Production of goats milk worldwide has increased in recent years. Today in Moldova the goats
population has increased by about 180.000 and is increasing every day. Milk production of goats is likely to
be much greater , because of the large amounts of unreported home consumption. For our country it is good
economic and ecological factor and possibility to make dairy production more profitable.
From the nutritional point of view goat milk is a valuable dairy product. Goats milk has some
particular properties that confer technological advantages in comparison to cows milk, such as a smaller size of
fat globules, which provides a smoother texture in derived products, lower amounts of casein, resulting in softer
gel products, a higher water holding capacity and a lower viscosity. Goat milk differs from cow or human milk
in having better digestibility, alkalinity, buffering capacity, and certain therapeutic values in medicine and
human nutrition. Mineral contents of goat milk showed higher level of Ca, P, K, Mg, and Cl. The composition of
basic nutrients in goat, sheep, cow, and human milk are given in Table 1, but vary with diet, breed, individuals,
parity, season, feeding, management, environmental conditions, locality, stage of lactation, and health status of
the udder.
Lipids in sheep and goat milk have higher physical characteristics than in cow milk, but there are
variations between different reports [4].
Average amino acid composition of goat and cow milk, shows higher levels of 6 of the 10 essential
amino acids: threonine, isoleucine, lysine, cystine, tyrosine, valine.
Table 1. Average composition of basic nutrients in goat, sheep, cow, and human milk [4]
Composition
Goat
Sheep
Cow
Human
Fat (%)
3.8
7.9
3.6
4.0
Lactose (%)
4.1
4.9
4.7
6.0
Protein (%)
3.4
6.2
3.2
1.2
Casein (%)
2.4
4.2
2.6
0.4
Solids-non-fat (%)
8.9
12.0
9.0
8.9
Calcium (mg/100 g)
72
105
69
68
Phosphorus (mg/100 g)
134
193
122
33
The functional value of goats milk may be further exploited through fermentation by selected
microorganisms possessing specific features. A mixed starter comprising Lactobacillus acidophilus,
Lactobacillus bulgaricus and Streptococcus thermophilus has been successfully used for fermentation of goats
milk and a high viability of probiotic strains in a fermented goats milk.
New sources of nutrients should be more exploited for varying the human diet and also to benefit from
new functional ingredients and natural food components. The beneficial microbiota of goat milk represented by
lactic acid bacteria is a potential source of biological materials to be used in dairy technology. The
transformation of goat milk by fermentation is not easy and more research for elucidating the process is needed
[3].
Nowadays in Moldova goats production exists on local level and normative documentation for goats
milk production doesnt exist also as scientific researches of the selection of lactic acid bacteria from goat raw
milk from different regions of Moldova with valuable characteristics for dairy industry. Thus, the study of
biochemical, physiological and phenotypic properties of lactic acid bacteria strains isolated from the raw goat
milk produced in different regions of Moldova took place in laboratory of Food Biotechnologies, ISPHTA,
Chisinau. Goats milk is suitable as cow's milk for culture growth while the biochemical activity of culture
starter is greater in goats milk than cows milk. The use of goat milk in combination with bacterial strains having
probiotic properties and producing physiologically active metabolites, represents one of the technology options
for manufacturing new dairy functional products. It has beneficial effects for health maintenance, physiological

46

functions, in the nutrition of children and elderly people, and can be consumed without negative effects.
Goat milk is produced for human health and nutrition of dairy products in terms of features, the less
valuable it is clear that the positive. The production of quality goat's milk products can be rewarding, profitable,
pleasant and successful. Although it has played an important role in human nutrition. So, recently has been
increasing demand to functional foods. Functional foods can be defined as foods that have positiv effects on the
health and important development in this regard has been in goat's milk products [2].
BIBLIOGRAPHY:
1. Anifantakis, E. Utilization of goat milk. In: Dairy News. National Greek Dairy Committee of IDF, 2001, p. 27.
2. Kondyli, E. Chemical composition and microbiological quality of ewe and goat milk of native Greek breeds/
E. Kondyli, C. Svarnas, J. Samelis, M. Katsiari. Small Ruminant Research, Volume 103, Issue 2, 2012, p. 194199.
3. Minervini, F. Fermented goats milk produced with selected multiple starters as a potentially functional food/
F. Minervini, M. Bilancia, S. Siragusa, M. Gobbetti, F. Caponio. Food Microbiology, 26, 2009, p. 559-564.
4. Park, Y. Goat milkchemistry and nutrition/ In: Handbook of Milk of Non-bovine Mammals. Blackwell
Publishing Professional, Oxford, 2006, pp. 34-58
5. Park, Y. Physico-chemical characteristics of goat and sheep milk/ Y. Park, M. Juarez, M. Ramos, G.
Haenlein, Res. 68, 2007, p. 88-113
FOLOSIREA APEI DIN SOL SUB INFLUENA DIFERITOR SISTEME
DE FERTILIZARE N ASOLAMENT
Boincean Boris, dr. hab., prof. cercet., Institutul de Cercetri pentru Culturile de Cmp Selecia,
Stadnic Stanislav, dr., conf. univ., USARB
The role of soil, especially of deeper soil layers in providing the requirement of crops in water is the
conditions of more often droughts with hotness. Fertilizers, especially organo-mineral and organic fertilizers are
increasing water use efficiency by winter wheat and sugar beet in crop rotation.
Key words: Crop rotation, systems of fertilization, water use efficiency, winter wheat, sugar beet.
INTRODUCERE
Agricultura Republicii Moldova se confrunt cu o serie de chemri la moment i care se vor acutiza pe
viitor: creterea neproporional a preurilor la sursele energetice neregenerabile limitate i derivatele lor
(ngrminte minerale, n deosebi de azot, pesticide . a.), pe de o parte, la producia agricol, pe de alt parte;
creterea pierderilor necompensate de substan organic a solului, pericolului degradrii i polurii solului i
apelor subterane n condiiile sistemului existent de agricultur; reducerea biodiversitii att n partea aerian,
ct i n partea subteran a solului; dezintegrarea stabilitii comunitilor rurale; manifestarea tot mai frecvent a
schimbrilor climatice prin consecinele nefaste a secetelor .a. [1, 2].
n condiii de step, apa este factorul limitativ n meninerea sau majorarea nivelului de producie.
Monitorizarea regimului hidric n condiiile experienelor de cmp de lung durat din stepa Blului sub
influena diferitor procedee agrotehnice (asolamente, sisteme de lucrare, fertilizare i irigare n asolament)
prezint un interes teoretic i practic deosebit, n deosebi innd cont de tendinele tot mai evidente de aridizare a
terenurilor agricole.
Lucrarea dat prezint o tentativ de evaluare a schimbrilor regimului hidric sub influena diferitor
sisteme de fertilizare a solului n experiena de cmp de lung durat cu diferite sisteme de fertilizare n
asolament pe cernoziom tipic din stepa Blului.
CONDIII I METODE DE CERCETARE
Experiena a fost executat n asolament de cmp avnd un caracter staionar de lung durat n cadrul
ICCC Selecia cu urmtoarea rotaie a culturilor: borceag de primvar gru de toamn sfecl de zahr
porumb pentru boabe orz de primvar floarea soarelui.
Solul lotului experimental reprezint cernoziom tipic, luto-argilos cu urmtoarea caracteristic
agrochimic: humus 4,7-4,1%; azot total 0,24-0,26%; fosfor 0,12-0,13%; potasiu 1,20-1,40%; pHH20 6,67,1. n experien recoltarea i evidena ei s-a efectuat manual prin metoda parcelelor de eviden.
ncepnd cu anul 1991 se cerceteaz patru sisteme de fertilizare n asolament cu 6 sole:
- natural (fr ngrminte), (varianta 1);
- mineral (NPK 75, 130, 175 kg s.a./ha suprafa de asolament, variantele 2, 3 i 4);
- organo-mineral (NPK 75, 130, 175 kg s.a./ha suprafa de asolament i gunoi de grajd 10 i 15 t/ha
suprafa de asolament, variantele 5, 6, 7, 8, 9 i 10);
- organic (15 t/ha suprafa de asolament gunoi de grajd, varianta 11).
Schema experienei include 12 variante cu diferite doze de fertilizare de ngrminte minerale i
organice sub diferite plante (tab. 1).

47

ngrmintele minerale se introduc anual sub lucrarea de baz a solului n doze corespunztoare cu
excepia grului de toamn, unde doza de azot tehnic se administreaz n 2 etape: din toamn i primvara
devreme ca nutriie suplimentar.
Gunoiul de grajd se ncorporeaz n sol sub artura de toamn: variantele 5, 6, 7 - la sfecla de zahr (60
t/ha); variantele 8, 9, 10, 11 la sfecla de zahr (60 t/ha) i floarea-soarelui (30 t/ha). Amplasarea variantelor n
spaiu este sistematic n 4 repetiii i 2 niveluri. Suprafaa total a parcelelor este de 242 m 2 n form
dreptunghiular (5,6 x 43,2 m).
n experien a fost aplicat agrotehnica acceptat pentru culturile de cmp respective i zonei de nord a
Republicii Moldova.
Tabelul 1. Schema repartizrii ngrmintelor n experien pe culturile asolamentului, kg s.a./ha

N60P30K30

N30P30K30

N90P60K60

N60P60K60

N120P60K60

N90P120K90

N60P30K30

N90P60K60

N120P60K60

N60P30K30

N90P60K60

10

N120P60K60

11
12

remanen

5
-

6
-

7
-

30

N90P45K
45

N150P60
K60

N30P30K30 +
60 t/ha gunoi de grajd
N60P60 K60 +
60 t/ha gunoi de grajd
N90P120K90 +
60 t/ha gunoi de grajd
N30P30K30 +
60 t/ha gunoi de grajd
N60P60K60 +
60 t/ha gunoi de grajd
N90P120 K90 +
60 t/ha gunoi de grajd
60 t/ha gunoi de grajd

N60P30K30
N90P45K45
N150 P60K60

Gunoi de
grajd, t

4
N60P30K

K2O

3
-

Floarea soarelui

P2O5

2
-

Orz de
primvar

1
1

Porumb
pentru
boabe

Mzriche
+ovz

Sfecla de zahr

8
-

9
-

10
-

11
-

N30P30K30

180

150

120

N60P90K60

300

255

225

N60 P120K60

420

360

270

180

150

120

60

300

255

225

60

420

360

270

60

180

150

120

90

300

255

225

90

420

360

270

90

90

N30 P30K30
N60P90 K60
N60P120K60

Remanen

Gru de
toamn

Remanen

Nr. var.

Total pe rotaie, kg s.a.

N30P30K30 + 30 t/ha
gunoi de grajd
N60P90K60 + 30 t/ha
gunoi de grajd
N60P120K60 + 30 t/ha
gunoi de grajd
30 t/ha gunoi de grajd

N60P30K30
N90P45K45
N150P60K60
remanen
remanen

REZULTATE I DISCUII
Cercetrile anterioare au demonstrat tendina evident de reducere a nivelului de producie pentru
diferite culturi indiferent de sistemul de fertilizare aplicat n asolament, inclusiv pentru cultura grului de toamn
i sfeclei de zahr (fig. 1).
10
9
8

t/ha

a.

b.

Fr fertilizare
NPK
NPK+15 t/ha gunoi de grajd
15 t/ha gunoi de grajd

t/ha
70

Fr fertilizare
NPK
NPK+15 t/ha gunoi de grajd
15 t/ha gunoi de grajd

60

6
50

5
4

40

30

20

1
10
0

Anii

1971
1972
1973
1974
1975
1976
1977
1978
1979
1980
1981
1982
1983
1984
1985
1986
1987
1988
1989
1990
1991
1992
1993
1994
1995
1996
1997
1998
1999
2000
2001
2002
2003
2004
2005
2006
2007
2008
2009
2010
2011
2012
2013
2014

1971
1972
1973
1974
1975
1976
1977
1978
1979
1980
1981
1982
1983
1984
1985
1986
1987
1988
1989
1990
1991
1992
1993
1994
1995
1996
1997
1998
1999
2000
2001
2002
2003
2004
2005
2006
2007
2008
2009
2010
2011
2012
2013
2014

Anii

Fig. 1. Productivitatea grului de toamn (a) i a sfeclei de zahr (b) n asolament sub influena
diferitor sisteme de fertilizare n experiena de cmp de lung durat a ICCC Selecia, anii 1971-2014
Aceasta coreleaz cu tendina de reducere a precipitaiilor atmosferice pe parcursul anilor agricoli
pentru aceeai perioad de timp, 1971-2014 (fig. 2, a), dar, n deosebi pe parcursul perioadelor de vegetaie (fig.
2, b-c).

48

900
800
700
600
500
400
300
200
100
0

mm

600

a.

mm

b.

500
400
300
200

Anii

100

Anii

1971
1972
1973
1974
1975
1976
1977
1978
1979
1980
1981
1982
1983
1984
1985
1986
1987
1988
1989
1990
1991
1992
1993
1994
1995
1996
1997
1998
1999
2000
2001
2002
2003
2004
2005
2006
2007
2008
2009
2010
2011
2012
2013
2014

1971
1972
1973
1974
1975
1976
1977
1978
1979
1980
1981
1982
1983
1984
1985
1986
1987
1988
1989
1990
1991
1992
1993
1994
1995
1996
1997
1998
1999
2000
2001
2002
2003
2004
2005
2006
2007
2008
2009
2010
2011
2012
2013
2014

600

mm

c.

Fig. 2. Precipitaii pe ani agricoli (a) i pentru


perioada de vegetaie a grului de toamn (b) i a
sfeclei de zahr (c), anii 1971-2014

500
400
300
200
100

Anii
1971
1972
1973
1974
1975
1976
1977
1978
1979
1980
1981
1982
1983
1984
1985
1986
1987
1988
1989
1990
1991
1992
1993
1994
1995
1996
1997
1998
1999
2000
2001
2002
2003
2004
2005
2006
2007
2008
2009
2010
2011
2012
2013
2014

Consumul apei din sol (tone)


pentru formarea 1 tone substan
uscat producie de baz

Consumul total de ap (tone)


pentru formarea 1 tone substan
uscat producie de baz

Ponderea apei din precipitaii n


consumul total de ap, %

60,3
151,0
90,1
163,3
88,4
161,9
82,8
175,5
82,0
158,7

Recolta, t/ha

83,8
142,8
78,0
139,9
79,1
155,5
85,3
149,5
82,5
144,7

Consumul total de ap, mm

144,1
293,8
168,1
303,2
167,5
317,4
168,1
325,0
164,5
303,4

Precipitaii, mm

(6) NPK+10 t/ha


gunoi de grajd
(9) NPK+15 t/ha
gunoi de grajd
(11) 15t/ha
gunoi de grajd

0-100
0-200
0-100
0-200
0-100
0-200
0-100
0-200
0-100
0-200

Ponderea apei din 0-100 cm n


consum de ap din 0-200 cm, %

(3) NPK

toamna

(1) Fr
fertilizare

primvara

Variante de
fertilizare

Stratul de sol, cm

Rezerve de ap n
sol, mm

Consumul de ap n sol n
perioada de vegetaie, mm

Pentru a urmri ct de eficient se folosete apa din sol de ctre cultura grului de toamn i sfecla de
zahr n dependen de sistemul de fertilizare n asolament au fost analizate datele experimentale din ultimele
dou rotaii a asolamentului de lung durat cu diferite sisteme de fertilizare n asolament.
GRU DE TOAMN
Datele din tabelul 2 mrturisesc despre o rezerv de ap mai nalt primvara n stratul 0-200 cm pe
variantele fertilizate cu gunoi de grajd mpreun cu ngrmintele minerale, comparativ cu celelalte variante
studiate.
Tabelul 2. Folosirea apei din sol i precipitaii de cultura grului de toamn pe diferite sisteme de
fertilizare n experiena de cmp de lung durat a ICCC Selecia, anii 2009-2014

39,9

227,8

378,8

3,82

459,6

1153,1

60,1

55,2

227,8

391,1

4,44

427,7

1024,3

58,3

54,6

227,8

389,7

4,43

425,0

1022,9

58,5

47,2

227,8

403,3

3,91

521,9

1199,4

56,5

51,7

227,8

386,5

3,74

493,4

1201,7

58,9

Astfel, rezerva de ap accesibil primvara, n stratul de sol 0-200 cm, pentru variantele cu
ngrmintele organice n amestec cu ngrmintele minerale a constituit n mediu pe rotaie (2009-2014) 317,4
i 325,0 mm, comparativ cu 303,2-303,4 mm pe variantele cu fertilizare mineral i organic separat. Cea mai
mic rezerv de ap accesibil primvara, n stratul de sol 0-200 cm, a fost determinat pe martorul absolut
293,8 mm.
Totodat, toate variantele fertilizate cu ngrminte organice i minerale, att separat, ct i n amestec,
au condus la o acumulare a unei rezerve mai mari de ap accesibil n startul 0-100 cm (164,5-168,1 mm,
comparativ cu martorul absolut (144,1 mm).
Consumul de ap n perioada de vegetaie a grului de toamn din stratul 0-100 cm pe fondurile
fertilizate a depit consumul de ap pe varianta nefertilizat cu 21,7-29,8 mm. Variantele fertilizate se
deosebesc nu numai prin o acumulare mai mare a rezervelor de ap accesibil n stratul 0-200 cm i, n deosebi,
n 0-100 cm, dar i printr-un consum mai nalt de ap. Accesul la rezervele de umiditate din stratul 100-200 cm
determin un spor mai nalt de producie pe fondurile fertilizate comparativ cu fondul nefertilizat.
Ponderea startului 0-100 cm n consumul de ap din startul de sol 0-200 cm pe font nefertilizat
constituie 39,9%, iar pe variantele fertilizate 47,2-55,2%. Astfel, n lipsa fertilizrii plantele folosesc mai mult

49

Recolta, t/ha

Consumul apei din sol (tone)


pentru formarea 1 tone substan
uscat producie de baz

Consumul total de ap (tone)


pentru formarea 1 tone substan
uscat producie de baz

Ponderea apei din precipitaii n


consumul total de ap, %

71,0
129,5
81,8
136,1
91,1
160,8

Consumul total de ap, mm

74,5
195,3
58,6
171,8
50,6
143,1

Precipitaii, mm

(6) NPK+ 10 t/ha


gunoi de grajd

145,5
324,8
140,4
307,9
141,7
303,9

Ponderea apei din 0-100 cm n


consum de ap din 0-200 cm, %

(3) NPK

0-100
0-200
0-100
0-200
0-100
0-200

toamna

(1) Fr
fertilizare

primvara

Variante de
fertilizare

Stratul de sol, cm

Rezerve de ap
n sol, mm

Consumul de ap n sol n
perioada de vegetaie, mm

energie pentru a extrage apa necesar din straturile mai adnci ale solului, ceea ce i determin o rezisten mai
mic la secet.
Consumul total de ap (din sol i din precipitaii) este practic similar pe toate variantele studiate n
experien. Calculele consumului de ap au fost efectuate la o unitate de substan uscat producie de baz (86%
din masa boabelor cu un coninut de 14% umiditate). Consumul de ap din sol pentru formarea unei tone
substan uscat producie de baz la grul de toamn pe martor a constituit n medie pentru perioada 2009-2014
459,6 tone, iar pe variantele fertilizate 425,0-521,9 tone. Consumul total de ap (din sol + precipitaii)
constituie 1153,1 tone pe martor absolut i 1022,9-1201,7 tone pe fond fertilizat. Se observ o tendin de
prevalare a apei din precipitaii atmosferice n formarea produciei de boabe pe martorul absolut (60,1%) i
reducerea dependenei produciei de boabe de apa din precipitaii pe variantele fertilizate (56,5-58,9%).
n perioada 2003-2008 (tab. 3) rezervele de ap accesibil primvara n startul 0-200 cm au fost mai
mari pe martorul absolut comparativ cu variantele fertilizate 324,8 mm i 307,9-303,9 mm, corespunztor.
Tabelul 3. Folosirea apei din sol i din precipitaii de cultura grului de toamn pe diferite sisteme de
fertilizare n experiena de cmp de lung durat a ICCC Selecia, anii 2003-2008

54,8

189,3

318,8

3,23

466,2

1147,7

59,4

60,1

189,3

325,4

3,97

398,6

953,1

58,2

56,6

189,3

350,1

4,12

453,8

988,1

54,1

Consumul de ap accesibil din stratul de sol 0-200 cm n perioada de vegetaie a constituit 129,5 mm i
136,1-160,8 mm, corespunztor, pe martor nefertilizat i pe fond fertilizat cu ngrminte minerale i organominerale (10 t/ha gunoi de grajd + NPK). Ponderea apei consumate din stratul 0-100 cm n consumul apei din
stratul 0-200 cm a constituit: pe martor absolut 54,8%; iar pe fond fertilizat cu ngrminte minerale i
organo-minerale 60,1 i 56,6% corespunztor.
Consumul de ap din sol pentru formarea unei tone de boabe substan uscat pe martorul nefertilizat a
constituit 466,2 tone, iar pe fond fertilizat cu ngrminte minerale i organo-minerale 398,6 i 453,8 tone,
corespunztor. Aceeai tendin rmne pentru consumul total de ap pentru formarea unei tone de substan
uscat producie de baz din startul de sol 0-200 cm. Se observ aceeai tendin de reducere a dependenei
formrii produciei pe variantele fertilizate din apa precipitaiilor atmosferice. Ponderea apei din precipitaiile
atmosferice n consumul total de ap a constituit pe martorul absolut 59,4%, iar pe variantele fertilizate cu
ngrminte minerale i organo-minerale 58,2 i 54,1%, corespunztor.
SFECLA DE ZAHR
Rezervele de ap accesibil primvara, n perioada 2009-2014, att n stratul 0-200 cm, ct i 0-100 cm
pe fondurile fertilizate depesc rezervele de ap accesibil pe martorul absolut (tab. 4). Consumul de ap din
ambele straturi de sol la fel este mai mare pe variantele fertilizate comparativ cu varianta nefertilizat.
Ponderea apei folosite din stratul de sol 0-100 cm n consumul de ap din startul de sol 0-200 cm a
constituit 48,5% pe martorul nefertilizat i 53,5-66,4% pe variantele fertilizate cu excepia variantei cu folosirea
ngrmintelor organice (10 t/ha) i ngrmintele minerale (43,9%).
Calculele consumului de ap au fost efectuate la o unitate de substan uscat producie de baz (22%
din masa rdcinilor recoltate). Consumul apei din sol pentru formarea unei uniti de producie de baz la sfecla
de zahr este mai mic dect la grul de toamn, dar analogic grului de toamn este influenat de fondul de
fertilizare. Cel mai raional este folosit apa din sol pe fond fertilizat comparativ cu fondul nefertilizat. Astfel,
consumul de ap accesibil din sol pentru formarea unei tone de substan uscat producie de baz pe fond
nefertilizat constituie 252,9 tone, iar pe fond fertilizat cu ngrminte organice, organo-minerale i minerale
181,4-229,3 tone.
Ponderea apei din precipitaii n consumul total de ap a fost mai mare pe martorul absolut 59,5% i sa redus pe variantele fertilizate cu ngrminte minerale i organo-minerale 55,1-56,1%. Excepie prezint
varianta cu ngrminte organice, unde ponderea apei din precipitaii domin n consumul total de ap 58,3%.
Varianta cu fertilizare organic necesit o evaluare mai aprofundat pe viitor.

50

Recolta, t/ha

Consumul apei din sol (tone)


pentru formarea 1 tone substan
uscat producie de baz

Consumul total de ap (tone)


pentru formarea 1 tone substan
uscat producie de baz

Ponderea apei din precipitaii n


consumul total de ap, %

72,9
135,2
88,1
157,4
76,2
155,3
78,4
161,4
71,5
142,1

Consumul total de ap, mm

50,9
130,2
43,1
113,2
52,6
122,4
54,6
122,5
57,3
116,0

Precipitaii, mm

(6) NPK+10 t/ha


gunoi de grajd
(9) NPK+15 t/ha
gunoi de grajd
(11) 15 t/ha gunoi
de grajd

123,7
265,4
131,2
270,6
128,8
277,7
133,0
283,9
128,8
258,1

Ponderea apei din 0-100 cm n


consum de ap din 0-200 cm, %

(3) NPK

0-100
0-200
0-100
0-200
0-100
0-200
0-100
0-200
0-100
0-200

toamna

(1) Fr fertilizare

primvara

Variante de
fertilizare

Stratul de sol, cm

Rezerve de ap
n sol, mm

Consumul de ap n sol n
perioada de vegetaie, mm

Tabelul 4. Folosirea apei din sol i precipitaii de cultura sfeclei de zahr pe diferite sisteme de
fertilizare n experiena de cmp de lung durat a ICCC Selecia, anii 2009-2014

48,5

198,4

333,6

24,3

252,9

624,0

59,5

53,5

198,4

355,8

31,2

229,3

518,4

55,8

43,9

198,4

353,7

34,6

204,0

464,7

56,1

61,1

198,4

359,8

37,2

197,2

439,6

55,1

66,4

198,4

340,5

35,6

181,4

434,8

58,3

Recolta, t/ha

Consumul apei din sol (tone)


pentru formarea 1 tone substan
uscat producie de baz

Consumul total de ap (tone)


pentru formarea 1 tone substan
uscat producie de baz

Ponderea apei din precipitaii n


consumul total de ap, %

36,3
104,9
32,2
79,6
56,0
137,1

Consumul total de ap, mm

92,2
195,7
90,4
181,9
74,1
140,4

Precipitaii, mm

(6) NPK+10 t/ha


gunoi de grajd

128,5
300,6
122,6
261,5
130,1
277,5

Ponderea apei din 0-100 cm n


consum de ap din 0-200 cm, %

(3) NPK

0-100
0-200
0-100
0-200
0-100
0-200

toamna

(1) Fr fertilizare

primvara

Variante de
fertilizare

Stratul de sol, cm

Rezerve de
ap n sol, mm

Consumul de ap n sol n
perioada de vegetaie, mm

n perioada 2003-2008 rezervele de ap accesibil n primvar au fost la acelai nivel ca i n perioada


ulterioar, ns consumul de ap accesibil din ambele starturi de sol a fost mai mic (tab. 5). Corespunztor, a
sczut i ponderea stratului 0-100 cm n consumul de ap din startul de sol 0-200 cm, fiind mai mic pe martorul
absolut 34,6% i crescnd pe variantele fertilizate 40,5-40,9%.
Tabelul 5. Folosirea apei din sol i precipitaii de cultura sfeclei de zahr pe diferite sisteme de
fertilizare n experiena de cmp de lung durat a ICCC Selecia, anii 2003-2008

34,6

292,2

397,1

20,7

230,4

872,0

73,6

40,5

292,2

371,8

34,8

104,0

485,6

78,6

40,9

292,2

429,3

38,6

161,5

505,5

68,1

Analogic grului de toamn, plantele sunt nevoite s foloseasc o cantitate mai mare de ap din
straturile mai adnci ale solului cu reducerea ulterioar a nivelului de producie. Consumul de ap din sol pentru
formarea unei tone substan uscat de producie de baz a constituit pe martor absolut 230,4 tone, iar pe fond
fertilizat cu ngrminte minerale i organo-minerale 104,0 i 161,5 tone, corespunztor.
Consumul total de ap (din sol + precipitaii) a alctuit pe martor absolut 872,0 tone la o ton producie
de baz i 485,6-505,5 tone pe fond fertilizat cu ngrminte minerale i organo-minerale, corespunztor.
Ponderea apei din precipitaii n consumul total de ap este mai mare pe martorul nefertilizat i la folosirea
ngrmintelor minerale (73,6 i 78,6%, corespunztor), dar scade la aplicarea ngrmintelor organo-minerale.
Dac comparm perioada 2003-2008 cu perioada 2009-2014 la ambele culturi, apoi putem observa c n
ambele cazuri scade ponderea apei din precipitaii n consumul total de ap. Probabil, aceast situaie este
cauzat de majorarea temperaturilor n timpul perioadei de vegetaie, care conduc la sporirea pierderilor
evapotranspiraionale. Odat cu reducerea ponderii apei din precipitaii n consumul total de ap pentru formarea
nivelului de producie a culturilor de cmp crete importana solului n ndestularea plantelor cu rezervele
necesare de ap accesibil. La moment nu cunoatem care este ponderea diferitor straturi de sol n asigurarea
plantelor cu elemente nutritive.

51

Astfel, accentul n condiiile nclzirii globale trebuie plasat pe ameliorarea calitii solului n vederea
asigurrii plantelor cu cantitile necesare de ap accesibil n sol.
CONCLUZII:
1. Tendinele de micorare a nivelului de producie sub influena reducerii cantitii de precipitaii pe parcursul
ultimilor ani agricoli, inclusiv n perioada de vegetaie, impune necesitatea unui studiu mai aprofundat referitor
la folosirea mai raional a apei din sol i precipitaii sub influena diferitor procedee agrotehnice.
2. Fertilizanii contribuie la o folosire mai raional a apei din sol i precipitaii atmosferice pentru formarea unei
tone producie de baz, n deosebi, la cultivarea sfeclei de zahr. n lipsa fertilizrii plantele sunt nevoite s
dezvolte un sistem radicular capabil s foloseasc ap din straturile mai adnci ale solului.
3. n condiiile manifestrii tot mai frecvente a nclzirii globale ponderea apei din precipitaii n consumul total
de ap pentru formarea produciei rmne la acelai nivel n cazul amplasrii grului de toamn dup
premergtori timpurii, iar la cultura sfeclei de zahr scade de la 68,1-78,6% n 2003-2008 pn la 55,1-59,5% n
2009-2014, corespunztor. Astfel crete rolul calitii solului n asigurarea necesitilor culturilor n ap
accesibil pentru formarea nivelului scontat de producie.
4. Secetele frecvente, dar, n deosebi, aria contribuie la majorarea rolului straturilor mai adnci ale solului n
aprovizionarea plantelor cu ap.
BIBLIOGRAFIE:
1. Timo, Kautz; Wulf, Amelung; Frank, Ewort and others. Nutrient acquisition from arable sub soils in temperate
climates: A review. In: Soil Biology and Biochemistry, 57, 2013, pp. 1003-1022.
2. Stephen, R. Gliessman. Agroecology. Ecological Processes in Sustainable Agriculture. Editor: Eric Engles.
Lewis Publishers, CRC Press, Boca Ration, Florida, USA, 2000. 357 p.
FIN EXTRUDAT DIN NUT
Carelina M., Caragia V., Linda L., Migalatiev O., Institutul tiinifico-Practic de Horticultur i
Tehnologii Alimentare, Laboratorul Tehnologia Produselor Alimentare
Vegetable protein products manufacturing by thermoplastic extrusion method, in Moldova will generate
new opportunities for providing population with food protein based on local raw material. As a source of
perspective leguminous cultures can be used, for example chickpeas (Cicer arietinum L.). It contains a relatively
small amount of fat, and the amino acid composition of proteins is nutritionally balanced and easily digestible. It
was studied the physicochemical and functional-technological properties of chickpeas for use in the manufacture
of extruded combined food products.
Key words: chickpeas, method of extrusion thermoplastic extruded chickpea flour, functional and
technological properties.
INTRODUCERE
Una dintre cele mai promitoare culturi din Moldova este nutul, care conine o cantitate relativ mic
de grsime, iar proteinele au n compoziie aminoacizi uor de digerat, echilibrai din punct de vedere nutritiv.
Nutul se caracterizeaz printr-un coninut crescut de seleniu i zinc i aminoacizi cu sulf, n special metionina,
care previne dezvoltarea tumorilor maligne [1].
Cu toate acestea, n ciuda proprietilor sale benefice, utilizarea nutului n industria alimentar este
dificil din cauza pregtirii ndelungate (nmuiere, albire, frmiarea, fermentaie).
Una dintre cele mai moderne metode de prelucrare a cerealelor este extrudarea, care reduce n mod
semnificativ impactul termic asupra materiilor prime, schimb compoziia chimic i proprietile tehnologicofuncionale.
Lucrarea prevede obinerea produsului extrudat din nut i studierea caracteristicilor sale calitative.
MATERIAL I METODE DE CERCETARE
n cercetare a fost folosit cultura leguminoas - nut, selectat de ctre Institutul de Genetic i
Fiziologie a Plantelor al AM. Cercetrile au fost puse n aplicare cu ntrebuinarea extruderului cu nec singular
250 dotat cu mecanism special pentru bobul de soia i alte leguminoase. Determinarea indicilor fizicochimici i funcional-tehnologici s-a efectuat conform metodelor standardizate i accesibile n practica tiinific,
acestea fiind: umiditatea - 13586.5; coninutul de proteine - dup metoda micro-biuretic [2, 3], amidon hidroliza acid urmat de determinarea de monozaharide; inhibitori de tripsin - metoda se bazeaz pe micorarea
activitii tripsinei n prezena inhibitorului (n calitate de substrat s-a folosit Benzoil-DL-arginin-p-nitroanilid
hidrochlorid) [4], cantitatea de ap i grsime absorbite - determinate gravimetric [5, 6]; adsorbia - dup o macerat
timp de 30 minute n ap la 20 C [7]. Caracteristicile microstructurale s-au determinat la aparatul Qx5 Computer
Microscope cu gradul de mrire: 1x 10, 1x60 i 1x 200.
REZULTATE CERCETRILOR
Faina din nut a fost obinut prin metoda de extruziune termoplastic la extruderul cu nec singular i
urmtoarele caracteristici tehnice: lungimea camerei - 200 mm, diametrul - 95 mm, viteza de rotaie a spiralei - 700
r/min, presiunea 25 -50 bar. Boabele de nut au fost curate de impuritile mecanice, zdrobite ntr-un zdrobitor
cu ciocan i cernute prin site cu diametru de 1,5-2,0 mm. n aa mod, a fost distrus nveliul exterior, iar
straturile interioare au devenit accesibile pentru extrudare. nveliurile exterioare de nut nu s-au separat,

52

deoarece conin fibre alimentare, care ajut tranzitul intestinal, micoreaz colesterolul i previn maladiile
cardiovasculare [8].
Nutul zdrobit a fost umectat pn la umiditatea de 16% i din containerul de ncrcare materia prim a
fost introdus n camera extruderului. Regimul de extrudare a nutului: presiunea 40 MPa, temperatura 110C,
durata - 30 s. La ieire din camera de extrudare masa plastic este trecut prin matricea cu orificii. Din cauza
scderii brute a presiunii, produsul capt o structur fibroas, prezentnd un aglomerat dens puin poros.
Extrudatul obinut a fost rcit pn la temperatura de 20, apoi supus zdrobirii i trecut prin micromoar cu
ciocan de tipul 8MM.
Fina din nut extrudat are o arom plcut, gust i miros tipic de cereale, ce rezist la tratamente
termice, mirosul specific de leguminoase a disprut, ceea ce indic faptul c s-au ameliorat indicii organoleptici.
Pentru a justifica folosirea finii din nut la fabricarea produselor combinate au fost studiate caracteristicile
fizico-chimice i proprietile funcional-tehnologice. Proprietile fizico-chimice a finii din nut mcinat
mecanic i extrudat sunt prezentate n tabelul 1.
Tabelul 1. Proprietile fizico-chimice ale finii din nut mcinate mecanic i extrudate
Proteine,% Proteine
Inhibitor de
Glucide, %
Produsul
Umiditatea,%
solubile,% tripsin, mg/g
amidon
glucide solubile
Fain mcinat
14,5
24,2
12,2
2,6
47,5
3,0
mecanic
Fain extrudat
5,2
31,3
6,3
1,4
15,5
30,5
n timpul extrudrii apar schimbri substaniale n fraciile proteice ale nutului coninutul total de
proteine extrase ntr-un mediu alcalin crete de la 24,2 la 31,3%, iar cantitatea de proteine solubile n ap se
reduce de la 12,2 la 6,3%.
Denaturarea proteinelor majoreaz cantitatea de peptide i aminoacizi liberi, adic se mbuntete
digestibilitatea proteinelor [9] i are loc distrugerea parial a antinutrienilor, n special a inhibitorilor de tripsin
de la 2,5 pn la 1,4 m/g.
n acelai timp, exist schimbri semnificative n proprietile amidonului. Coninutul total de amidon
se reduce de la 47,5 la 15,5% datorit scindrii moleculelor de amiloz i amilopectin, totodat, crete cantitatea
de oligozaharide i dextrine, crete coninutul de carbohidrai solubili de la 3,0 pn la 30,5%. Acest lucru duce
la o cretere a coninutului de substane solubile n ap, adic crete digestibilitatea finii extrudate.
Modificrile structurii materiei prime n procesul de extruziune sunt prezentate n urmtoarele
fotografii:

a) fina din nut mcinat mecanic


b) faina din nut extrudat
Figura 1. Fotografii microstructurale a nutului mcinat mecanic (a) i nutului extrudat (b)
Analiznd fotografiile microscopice se poate de concis c procesul de extruziune modific esenial
structura esutului vegetal al materiei prime. Pn la extruziune (imaginea a) structura este format din particule
izolate (proteine, amidon, fibre) cu spaiu liber ntre ele. Dup extruziune (imaginea b) esutul vegetal devine
dens, spaiul ntre particule dispare.
A fost realizat o analiz comparativ a proprietilor funcional-tehnologice, cum ar fi capacitatea de
umflare, capacitatea de reinere a apei i uleiului a finii extrudate i mcinat mecanic.
Rezultatele studierii calitilor funcional-tehnologice a finii din nut sunt prezentate n tabelul 2.

2,15

53

Cantitatea de ulei absorbit de


produs, g/g
fain mcinat
fain
mecanic
extrudat
0,60

1,10

Coeficient
ul de
absorbie a
uleiului
(7:6)

Cantitatea de ap absorbit
de produs, g/g
fain
fain
mcinat
extrudat
mecanic
1,60
3,45

Coeficient
ul de
absorbie a
apei (4:3)

Tabelul 2. Proprietile funcional-tehnologice a finii din nut mcinate mecanic i finii extrudate
Capacitatea de gonflare,
%, T 20C
fain
fain
mcinat
extrudat
mecanic
260
650

1,83

Datele din tabelul 2 demonstreaz c procesul de extruziune modific esenial proprietile funcionaltehnologice ale materiei prime agricole. Cantitatea de ap absorbit de ctre nutul extrudat a crescut de 2,15.
Fin de nut extrudat are o capacitate de absorbie a uleiului mai mare - 110%, respectiv, suma maxim de ulei
absorbit per 1g de faina este 1,1g ulei.
Cele mai importante proprieti tehnologico-funcionale ale finii obinute din nut n producia de produse
combinate sunt durata i gradul de umflare (hidratare).
Fina extrudat de nut a fost hidratat la diferite temperaturi: 20, 30, 40, 50, 60, 70 C i diferite hidromoduli
(HM) 1:7; 18;1: 9 i 01:10 timp de 30 minute.
Analiza gradului de umflare la diferii indici ai hidromodulelor demonstreaz c absorbia maxim de ap are
loc la temperatura de 50 C. La temperaturi de peste 50 C fina extrudat devine de o consisten dens gelatinizat.
La tratarea la temperaturile de 20, 30, 40, 50 C fina de nut avea structura de terci, care s-a meninut timp de dou
ore.
A fost studiat
dinamica umflrii finii
de nut extrudate la
diferite temperaturi n
dependen de timp.
Rezultatele
cercetrii
sunt prezentate n figura
2.
Figura 2.
Procesul de gonflare a
finii din nut

Studiul dinamicii de umflare indic faptul c timpul de umflare la diferite temperaturi variaz. Umflarea
fin de nut extrudate este realizat timp de 20 minute la 20 C, timp de 15 minute la 30 C i timp de 10
minute la 40 i 50 C. Dup atingerea nivelului maximal de umflare nu au loc schimbri semnificative.
Astfel, timpul necesar pentru absorbia maxim a apei de hidratare constituie 15-20 minute la temperatura
de 20-30 C i 10 minute la temperatura de 40-50 C, hidromodulul optim fiind 1:7.
Fina extrudat are proprieti organoleptice i valoarea nutriional nalt din contul mbuntirii
digestibilitii i reducerii timpului de pregtire culinar.
Aadar, rezultatele comparative demonstreaz elocvent c produsele extrudate posed proprieti
funcional-tehnologice sporite i pot fi utilizate n industria alimentar.
CONCLUZII:
1. S-a stabilit posibilitatea efecturii procesului de extruziune a nutului. Sunt determinate regimurile de
extrudare, acestea fiind: presiunea 30-40 MPa, temperatura 105-115C, durata 20-30 s.
2. Au fost studiate caracteristicile fizico-chimice ale finii extrudate de nut. Fina obinut posed o valoare
nutritiv nalt i absorbia maxim de ap are loc la temperatura de 50 C timp de 10 min.
3. Rezultatele evalurii comparative au artat c fina extrudat are proprieti de reinere a apei i a uleiului
mai ridicate i poate fi utilizat n producerea alimentelor de calitate superioar.
BIBLIOGRAFIE:
1. , ..; , ..
. B:
, 2000, 11, . 26-28.
2. Schmandke, V.I. et al. Nahrung, 1977, 21, p. 205-208.
3. Langef , A. et al. Nahrung, 1979, 23, p. 549-559.
4. Kakade, M.L.; Rachis, J.J.; Meghee, J.E. and G.Pusk. Determination of tripsin inhibitor activity of soy
products. In: Cereal Chem, 1974, 1(3), p. 376.
5. Smith, A.K.; Circle, S.J. Soybeans. Chemistry and Technology AVI Publ. Co N.1972, p.455.
6. Lin, M.Y.U. et al. J. Food Si. 1974, 39, p. 368.
7. , .. ,
. B: i i i,
i i, 28, 2, . 73-75.
8. , ..; , ..; , ..
. B: , 9, 2006, . 32-36.
9. , .. . B: , 12, 2003, . 6-9.
Cercetrile au fost efectuate n cadrul Proiectului Instituional 11.817.04.32A Tehnologii inovaionale
de prelucrare a materiei prime agricole, origine vegetal i animalier, anii 2011-2014.

54

STUDIU PRIVIND EFECTUL APLICRII FOLIARE A REGULATORULUI NATURAL DE


CRETERE REGLALG ASUPRA ACTIVITII CHITINAZELOR DIN FRUNZELE PLANTELOR DE
TOMATE
Cau Maria, dr. n biologie, cercet. t. coord., Clugru-Sptaru Tatiana, cercet. t., Sromeatnicov
Iurie, cercet. t., Dascaliuc Alexandru., dr. hab. n biologie, prof. univ., cercet. t. coord, Institutul de Genetic,
Fiziologie i Protecie a Plantelor al AM
The activity of chitinases in extracts obtained from the leaves of tomato, cultivars Julihirsutian (early
repining) and Anatolie (late repining) was analyzed. The plants were grown in field conditions and each 10th day
treated with the solutions of Reglalg, natural plant growth regulator. In extracts from the leaves of early repining
cultivar, in control and experimental (plants treated with Reglalg) variants, the successive increasing of
chitinases activity was observed. For the late repining cultivar a decline in enzyme activity was observed at the
middle period of vegetation (by the end of June), followed by increasing of its activity in the late of July. Also,
we note that in the extracts from the leaves of both cultivars, treated with Reglalg, the activity of chitinases was
lower compared to those of control plants. Taking into consideration the beneficial effects of Reglalg on plant
growth, we consider that the lower level of chitinases demonstrate the increasing of plants vigor, due to the
beneficial effects of natural plant growth regulator.
Key words tomato, early and late repining cultivars, plant growth regulator Reglalg, chitinases
INTRODUCERE
Pe parcursul evoluiei la plante s-au stabilit mai multe mecanisme de protecie mpotriva factorilor de
stres biotic i abiotic [1]. Printre ele, un rol important n asigurarea rezistenei plantelor la factorii de stres abiotic
i mai ales biotic l au chitinazele [7, 8, 4, 11, 18]. La plante, inducia biosintezei i activitii chitinazelor ca
rspuns atacurilor patogenilor este bine documentat [4]. Activitatea lor asigur hidroliza chilinelor, care
reprezint polimeri liniari al N-acetyl-D -glucosaminei (GlcNAc), ce se conin n pereii celulari ai fungilor [10].
A fost demonstrat c expresia genic a chitinazelor la plante este indus de infecia cu virui, bacterii i atacul
insectelor [13]; influena factorilor de stres abiotic [7, 11], precum i la etape diferite de dezvoltare [8].
Interesant de subliniat, c dei n plante nu exist substratul specific pentru activitatea chitinazei chitina, n
literatur se aduc date despre implicarea chitinazelor n procesele de cretere i dezvoltare a plantelor [12, 13, 21,
19]. Inducere remarcabil a activitii chitinazelor a fost relevat i la aciunea diferitor ageni abiotici [7, 15, 20,
21].
Actualmente, n condiiile sistemelor integrate de cultivare a plantelor, tot mai intens se efectueaz
cercetri, direcionate spre sporirea inducerii rezistenei plantelor fa de aciunea factorilor de stres prin
intermediul aplicrii tratamentelor plantelor cu preparate contra infeciilor i duntorilor n combinaie cu
regulatori de cretere naturali (RCN), extrai din materiale vegetale. RCN au capacitatea de a modifica procesele
fiziologice i biochimice ale creterii i dezvoltrii plantelor prin influena asupra biosintezei substanelor
regulatoare din plante i activitatea diferitor enzime [9, 5, 6, 3]. RCN Reglalg, obinut n laboratorul Biochimia
plantelor al Institutului de Genetic, Fiziologie i Protecie a Plantelor al Academiei de tiine a Moldovei a fost
utilizat n mai multe moduri la tratarea plantelor de cultur pentru sporirea eficacitii desfurrii unor reacii
fiziologice i biochimice, asigurnd vigoarea i sporirea rezistena plantelor fa de diferii factori de stres, att
n condiii in vivo, ct i in vitro [5, 6, 2, 3, 17].
Scopul acestui studiu a fost de a determinarea modificrilor activitii chitinazei din frunzele plantelor de
tomate cultivate n condiii de cmp i tratate pe parcursul sezonului de vegetaie cu RCN Reglalg
MATERIALE I METODE
Ca obiect de studiu au servit plantele de tomate Solanum lycopersicum L., soi mediu - timpuriu
Julihirsutian i soi tardiv .Anatolie, cultivate n condiii de cmp. Tratarea frunzelor prin pulverizarea cu soluii a
preparatului Reglalg, diluat cu ap n raport 1/200, s-a efectuat pe durata sezonului de vegetaie la fiecare a 10
zile. Frunzele, colectate pentru determinrile activitii enzimatice au fost fixate la temperatura de -33C.
Activitatea chitinazei din extractele fraciilor proteinelor solubile, separate din frunzele de tomate a fost
determinat cu utilizarea metodei spectrofotometrice, descris n literatura de specialitate [a se vedea: 16].
Analiza statistic a datelor s-a efectuat cu ajutorul setului de programe Statistica 7 pentru computer,
utiliznd Basic Statistics.
REZULTATE I DISCUII
Studierea influenei preparatului Reglalg, aplicat prin stropirea plantelor de tomate, cultivate n
condiii de cmp, pe parcursul perioadei de vegetaie. Cercetrile au fost direcionate pentru a determina
influena preparatului asupra creterii i dezvoltrii plantelor, precum i a analizei modificrilor posibile a
activitii chitinazelor din frunze sub influena preparatului. Fotografiile din fig. 1 A i B demonstreaz aciunea
benefic a Reglalgului asupra creterii ambelor soiuri de tomate, efect care se manifest chiar nainte de
nflorirea plantelor (n 10 iunie). De menionat c tratarea plantelor cu soluia preparatului Reglalg a contribuit la
legarea fructelor, accelerarea coacerii i a asigurat sporirea productivitii plantelor.

55

Figura 1. Plantele de tomate, soiul Julihirsutian (A) i Anatolie (B), martor i tratate cu preparatul
Reglalg la fiecare a 10-a zi pe parcursul perioadei de vegetaie.
Rezultatele privind activitate chitinazelor, extrase din frunze, sunt prezentate n figura 2. Analiznd datele
prezentate n figura 2 A i 2 B observm c pe parcursul ntregii perioadei de vegetaie la ambele soiuri
extractele din frunzele plantelor tratate cu preparatul Reglalg se caracterizau cu activitate mai joas a
chitinazelor. Totodat, observm, c extractele din frunzele soiului de tomate mediu-timpuriu Julihirsutian (fig.
2 A) se caracterizau cu o activitate mai nalt a chitinazelor n comparaie cu soiul tardiv Anatolie (Fig. 2 B).
mbtrnirea plantelor este asociat de sporirea activitii chitinazelor la ambele soiuri, dar la soiul tardiv ea se
manifest mai trziu, dup diminuarea iniial a activitii chitinazelor spre sfritul lunii iunie (fig. 2 B).
Figura 2. Influena
tratrii plantelor de tomate
pe parcursul perioadei de
vegetaie, la fiecare 10 zile,
cu preparatul Reglalg diluat
cu ap n raport de 1/200,
asupra activitii chitinazei
din
fracia
proteinelor
solubile,
separate
din
frunzele de tomate, soiul
mediu-timpuriu Julihirsutian
(A) i tardiv Anatolie (B).
Dup
cum
s-a
menionat mai sus [14, 10,
4] chitinazele joac un rol
important
n
rspunsul
defensiv al plantelor la
aciunea factorilor biotici. n
concordan
cu
reacia
plantelor
la
factorii
respectivi are loc inducia
expresiei
genelor,
responsabile de biosinteza i
activarea chzitinazelor. Pe
de alt parte, pe lng rolul aparent al chitinazelor n reacia defensiv a plantelor fat de agenii biotici, se
presupune, c aceste enzime, sunt implicate n procesele de dezvoltare a plantelor, inclusiv formarea aparatului
floral, senescena frunzelor i embriogenez [12, 15, 20]. Inducerea activitii chitinazelor din rdcinile unor
soiuri de soia la aplicarea exogen a etilenei este subordonat controlului evenimentelor perioadei de dezvoltare
a plantelor soia [20]. Datele obinute de noi confirm faptul c mbtrnirea plantelor este asociat cu creterea
activitii chitinazelor. Ele la fel suport viziunea despre efectul de ntinerire a preparatului Reglalg asupra
plantelor. Diminuarea activitii chitinazelor n plantele tratate cu preparatul Reglalg suport aceast viziune.
CONCLUZII:
1. Aplicarea preparatului Reglalg pe parcursul vegetaiei a avut efecte benefice asupra creterii, dezvoltrii i
productivitii plantelor.
2. Efectul benefic a preparatului s-a confirmat i prin diminuarea activitii chitinazelor, extrase din frunze, ceea
ce demonstreaz c sub influena Reglalgului sporete vigoarea plantelor.

56

BIBLIOGRAFIE:
1. Atkinson, N. J.; Urwin, P. E. The interaction of plant biotic and abiotic stresses: from genes to the field. In: J.
Exp. Bot., 2012, vol. 63, (10), p. 3523-3543.
2. Cau, M.; Clugru-Sptaru, T.; Dascaliuc, A. Influena preparatului Reglalg asupra acumulrii biomasei,
coninutului compuilor fenolici i spectrului izoenzimatic al polifenoloxidazei n celulele calusului de Rhodiola
rosea L. n: Materialele conferinei tiinifice internaionale (Ediia a V-a) Genetica, fiziologia i ameliorarea
plantelor, Chiinu, 23-24 octombrie 2014, p. 48- 52.
3. Cau, M.; Dascaliuc, A. Activitatea biologic i indicii antioxidativi ai extractelor din plantele de Cucumis
sativus L. tratate cu regulatorul natural de cretere Reglalg. n: Buletinul Academiei de tiine a Moldovei.
tiinele vieii, 2014, nr. 2 (323), p. 58-67.
4. Cosio. C.; Dunand, C. Specific functions of individual class III peroxidase genes. In: J. Exp. Botany, 2009,
vol. 60, p. 391- 408.
5. Dascaliuc, A.; Voineac, V.; Ralea, T. Native substances in plant protection. n: Buletinul Academiei de tiine
a Moldovei. tiinele vieii, 2006, nr 3, (300), p. 46-51.
6. Dascaliuc, A.; Voineac, V.; Ralea, T. Rolul reglatorilor naturali de cretere n agricultura organic. n:
Conferina tiinifico-practic internaional. Chiinu, 27-28 octombrie 2011. Chiinu, 2012, p. 297-303.
7. Gao, J. et al. Cloning and mRNA expression pattern analysis under low temperature stress of EAAP gene in
Dongmu-70 rye. In: Afr. J. Biotech., 2011, vol. 10, p. 67256731.
8. Gerhardt, L.B. et al. AtchitIV gene expression is stimulated under abiotic stresses and is spatially and
emporally regulated during embryo development. In: Gen. Molec. Biol., 2004, vol. 27, p. 118123.
9. Giannakoula, A.E. et al. The effects of plant growth regulators on growth, yield, and phenolic profile of lentil
plants. In: J. of Food Compos. Anal., 2012, vol. 28, p.4653.
10. Hietala, A.M., et al. Temporal and spatial proles of chitinase expression by Norway spruce in response to
bark colonization by Heterobasidion annosum. In: Applied and Environ. Microb., 2004, vol. 70, p. 39483953.
11. Kikuchi, T.; Masuda, K. Class II chitinase accumulated in the bark tissue involves with the cold hardiness of
shoot stems in highbush blueberry (Vaccinium corymbosum L.). In: Sci.Hort., 2009, vol. 120, p. 230236.
12. Neale, A.D. et al. Chitinase, beta -1,3-glucanase, osmotin, and extensin are expressed in tobacco explants
during flower formation. In: The Plant Cell, 1990, vol. 2, p. 673-684.
13. Patil1, V.R.; Widholm, J.M. Possible correlation between increased vigor and chitinase activity expression in
tobacco. In: J.Exp.Botany, 1997, vol. 48, (316), p. 1943-1950.
14. Reymond, P. et al. Dierential gene expression in response to mechanical wounding and insect feeding in
Arabidopsis. In: Plant Cell, 2000, vol. 12, p. 707720.
15. Roby, D. et al. Regulation of a chitinase gene promoter by ethylene and elicitors in bean protoplasts. In:
Plant Physiol, 1991, vol. 97, p. 433-439.
16. Sena, A.R. et al. Application of Doehlert experimental design in the optimization of experimental variables
for the Pseudozyma sp. (CCMB 306) and Pseudozyma sp. (CCMB 300) cell lysis. In: Cienc. Tecnol. Aliment.,
Campinas, 2012, vol. 32, (4), p. 762-767.
17. Sromeatnicov, Iu.; Dascaliuc, A. i al. Testarea i cultivarea tomatelor sub influena preparatului biologic
activ Reglalg. n: Materialele celui de al III-lea Simpozion Naional cu participare Internaional
Biotehnologii Avansate Realizri i Perspective, 24-25 octombrie 2013, Chiinu, p. 127.
18. Takenaka, Y., et al. Chitnase gene expression in response to environmental stresses in Arabidopsis thaliana:
chitinase inhibitor allosamidin enhances stress tolerance. In: Biosc. Biotechn. Bioch., 2009, vol. 73, p. 1066
1071.
19. Wiweger, M., et al. Expression of Chia 4-Pa chitinase genes during somatic and zygotic embryo
development in Norway spruce (Picea abies): similarities and differences between gymnosperm and angiosperm
class IV chitinases. In: J. Exp. Botany, 2003, vol. 54, p. 26912699.
20. Zhi-Ping, X., et al. Ethylene responsiveness of soybean cultivars characterized by leaf senescence, chitinase
induction and nodulation. In: J. Plant Physiol., 1996, vol. 149, p. 690-694.
21. Zhong, R. et al. Mutation of a chitinase-like gene causes ectopic deposition of lignin, aberrant cell shapes,
and overproduction of ethylene. In: The Plant Cell, 2002, vol. 14, p. 165179.
ACIUNEA NGRMINTELOR MINERALE CU AZOT ASUPRA PRODUCTIVITII GRULUI
DE TOAMN PE DIFERITE NIVELURI DE FOSFOR PE CERNOZIOMUL CARBONATIC
Ciochina Vitalie, doctorand, Institutul de Pedologie, Agrochimie i Protecie a Solului ,,Nicolae Dimo
In article are as presented the results of experience with mineral fertilizers under autumn wheat obtained
in 2015. The experience includes 16 variants in 4 replicates. Norms nitrogen: from 0 to 180 kg/ha on the optimal
level of phosphorus in the soil and different levels of phosphorus in the soil on a single standard of nitrogen. It
was established that nitrogen norms have significantly influenced the productivity of autumn wheat. The harvest
increased from 10.9 (control) up to 23.3 q/ha per norm of nitrogen - 120 kg/ha. The amount of gluten was from
17,2% to 30,4%. This demonstrates that even in drought conditions fertilizers influence on the productivity of
autumn wheat.

57

Key words: nitrogen, winter wheat, gluten, fertilizer, phosphate levels, harvest, sol.
INTRODUCERE
Pentru sporirea productivitii grului de toamn prin utilizarea raional a rezervelor de ap productiv
n sol, un rol esenial l joac ngrmintele minerale cu azot pe un nivel optim de fosfor.
Calculele demonstreaz c cantitatea medie multianual de precipitaii permite obinerea recoltei la
grul de toamn de circa 42 q/ha, prin administrarea n sol a 130 kg/ha azot, 50 kg fosfor i 100 kg de potasiu.
ns, deformarea asolamentelor, aplicarea iraional a ngrmintelor chimice cu azot i fosfor fr studii
agrochimice adecvate micoreaz producia grului de toamn la 24-26 q/ha, i a coninutului de gluten n boabe
pn la 14-17% [2, p.21].
MATERIAL I METOD
Studiile s-au efectuat pe experiena de lung durat fondat n anul 1961 pe cernoziomul carbonatic din
satul Grigorievca, raionul Cueni, situat n raionul agroclimatic III cu suma temperaturilor active de 320034000 C, coeficientul hidrotermic - 0,7, i frecvena secetelor de 3-4 ani din 10. Experiena este alctuit din 4
cmpuri. Fiecare cmp are 16 variante n 4 repetri. Schema experienei corespunde metodei lui Jorj-Vilea.
Nivelurile de azot sunt formate din doze de: 0, 30, 60, 90, 120, 180 kg/ha, pe nivel unic de fosfor mobil
3,5 mg/100 g sol. Nivelurile de fosfor n sol sunt: 1,0 - 1,5 2,0 2,5 - -3,0 - -3,5 4,0 4,5 mg/100 g sol dup
metoda Macighin pe o norm unic de azot - N120 [1, p.241].
REZULTATE I DISCUII
Din cauza secetei atmosferice severe, cu precipitaii czute n perioada de vegetaie activ de 51% sub
norma multianual i a stresului termic de peste 30 0 C mai mult de 21 zile consecutiv recolta la grul de toamn
sa micorat semnificativ, n schimb calitatea s-a majorat. La varianta nefertilizat recolta constituie 10,9 q/ha, iar
la varianta asigurat cu doza optim de 120 kg/ha de azot pe fond optim de fosfor ea a crescut pn la 23,3 q/ha,
ceea ce reprezint un spor de circa 113,8%. La aceeai doz de azot pe un fond foarte sczut de fosfor, specific
fondului natural de 1,0 mg de P 2O5 n sol recolta a fost doar de 14,2 q/ha, iar sporul n recolt este de 30,3 %
fa de martor, comparativ cu cel maxim s-a diminuat cu 83,5%.
Coninutul de gluten la martor este de 17,2% i de prima grup de calitate. La aplicarea dozei 120 kg/ha
de azot pe fond optim de fosfor coninutul de gluten este de 24,0%, iar calitatea de grupa a doua. La doza de 180
kg/ha de azot pe acelai fond coninutul de gluten umed este de 30,4%, de calitatea a doua. Pentru variantele cu
doza optim de azot i fond sczut de fosfor coninutul de gluten este de 27,6-25,2% i grupa de calitate a I-ea,
ceea ce se explic prin recolta joas obinut 15,9 18,4 q/ha conform tabelului 1.
Masa a 1000 boabe la martor este de 27,3 g, iar la varianta de N 30 kg/ha azot 34,4 g. La doza de N120
kg/ha masa are valori cuprinse ntre 28,8 32,6 g i este n dependen de gradul de asigurare cu fosfor.
Tabelul 1. Recolta i calitatea grului de toamn pe cernoziomul carbonatic din sat. Grigorievca, r-nul.
Cueni pe anul agricol 2014-2015
Varianta
Sporul
Masa a
Grupa
Recolta,
de
Glutenul,
P2O5,

1000
IDG
de
Azot,
K2O,
q/ha
recolt,
%
mg/100
boabe, g
calitate
kg/ha
kg/ha
%
g sol
1
2
3
4
5
6
7
8

Martor absolut
2,0
60
2,5
60
3,0
60
3,5
60
3,5
60
3,5
60
3,5
120

10,9
27,3
17,2
54
I
120
15,9
45,9
29,2
27,6
78
I
120
18,4
68,8
28,9
25,2
75
I
120
18,0
65,1
28,8
120
23,3
113,8
30,2
24,0
81
II
120
22,4
105,5
32,6
21,2
70
I
30
17,3
58,7
34,4
180
21,5
97,2
31,2
30,4
80
II
CONCLUZII:
1. Instalarea secetei puternice prin lipsa precipitaiilor atmosferice sub 51% fa de media multianual, i a
stresului termic cu temperaturi de peste 300 C mai mult de 21 de zile consecutiv au influenat negativ recolta
obinut. Recolta a fost de la 10,9 pn la 23,3 q/ha.
2. Rezultatele obinute au demonstrat c chiar i n condiii de secet nivelurile de nutriie mineral au influenat
pozitiv productivitatea grului de toamn. Aplicarea dozei de N 120 kg/ha de azot pe fond optim de fosfor a
majorat recolta cu 12,4 q/ha , iar sporul a constituit 113,8%. Calitatea grului de toamn s-a mbuntit
semnificativ. Coninutul de gluten umed la martor fiind de 17,2%. Variantele fertilizate cu doza de azot N 120
kg/ha au cantitatea de gluten 25,2-27,6%.
BIBLIOGRAFIE:
1. Lungu, V.; Andrie, S.; Leah, N.; Griuc, St. Productivitatea culturilor agricole n asolamentele de cmp n
funcie de tipul de sol i nivelul de nutriie n experienele de lung durat. n. Cernoziomurile Moldovei Evoluia, Protecia i Restabilirea fertilitii lor. 12-13 septembrie 2013, p. 241-244.
2. Recomandri privind aplicarea ngrmintelor pe diferite tipuri de sol la culturile de cmp. Chiinu: Ed.
Pontos, 2012, p. 66.

58

INFLUENA PROTECIEI APARATULUI FOLIAR ASUPRA NIVELULUI DE RODUCIE


I A GRADULUI DE PUTREFACIE A RIZOCARPILOR SFECLEI PENTRU ZAHR

Crivceanschi, Gheorghe, doctorand, IP Institutul de Cercetri pentru Culturile de Cmp Selecia


Influence of leaf fungicides over production level and root rotting by sugar beet. Experiments were
carried on during the 2012-2014 period on the North part of Moldova, under the conditions of natural infection.
The paper presents results regarding the behavior of seventeen sugar beet varieties with and without leaves
protection towards sugar yield and root rot level.
Key words: Leaves protection, Sugar beet varieties, Root crops, Sugar yield, Root Rot.

INTRODUCERE
Din cele mai severe boli, cauzate de microflora de ciuperci, ce paraziteaz organele aeriene ale sfeclei
pentru zahr se numr cercosporioza (ptarea frunzelor), finarea, fomoz, rugina frunzelor. Cercosporioza,
agentul patogen provocator al bolii fiind Cercospora beticola Sacc., este cea mai rspndit boal, n deosebi, n
rile cu vremea blnd precum i n Moldova [1]. Odat cu infectarea suprafeei fotosintetice se perturbeaz
decurgerea principalelor procese fiziologice n plant: prin frunze se intensific evaporarea de 5 ori, de 10 ori se
reduce asimilarea bioxidului de carbon[2]. Perforarea continu a limbului frunzelor de acest patogen duce la
micorarea semnificativ a esuturilor asimilatoare, ceea ce la rndul su diminueaz creterea rizocarpului i
acumularea glucidelor, deci n recolt de zahr [3, 4]. Pe lng acestor pierderi directe n recolt, pstrarea
rizocarpilor depozitai n silozuri se reduce vdit. Ca principalele metode de minimalizare a pierderilor cauzate
de agenii patogeni aerieni se refer: respectarea asolamentului, utilizarea fungicidelor, folosirea soiurilor
tolerante [5].
Prezenta lucrare a urmrit punerea n eviden a efectului fungicidrii i a genotipurilor de sfecl pentru
zahr cu toleran diferit la bolile aparatului foliar asupra nivelului de producie i a gradului de putrefacie.
MATERIAL I METOD
Rezultatele experimentale au fost obinute n urma cercetrii a17 varieti (KWS, Strube, SES/vdHave,
Syngenta), seminele crora au fost genetic monogerme, drajate, cu acelai tratament insecticid i fungicid, pe
parcursul anilor 2012-2014 n 14 locaii, n apropierea oraelor Drochia i Fleti. Experienele au fost fondate n
condiii naturale, fr irigare, pe cernoziomuri preponderent profunde. Alegerea cmpurilor experimentale s-a
efectuat minuios cu respectarea asolamentului, analiza de laborator la coninutul substanelor nutritive n sol
precum i controlul permanent al tuturor lucrrilor ndeplinite. Fiecare hibrid a fost amplasat n 4 repetiii cu
suprafaa minim de 13,5 m/repetiie, n blocuri randomizate. Semnatul a fost efectuat cu semntoarea
special RAU Exakta/ KUHN, cu nlturarea chimic a buruienilor, rritul s-a efectuat manual cu scopul de
obinere a populaiilor de plante repartizate uniform. Controlul maladiilor foliare a fost petrecut prin fungicidarea
parial, ceea ce a permis de a identifica comportamentul varietilor n condiii protejate i fr. La recoltarea
fiecrei parcele s-a determinat masa, numrul rizocarpilor, gradul i frecvena infectrii cu putregai.
Determinarea procentului de impuriti fizice i a coninutului de zahr s-a realizat n laboratorul fabricii de
zahr din Drochia, la linia Venema, iar coninutul substanelor melasigene - n laboratorul din
Ochsenfurt/SDZUCKER AG, RFG/. Datele obinute au fost prelucrate statistic prin intermediul programelor
Rbezahl, Statistica.
Tabelul 1. Suma depunerilor atmosferice n perioada cercetrilor 2012-2014, Drochia i Fleti
Date
Abateri lunare Abateri lunare
Depuneri atmosferice, mm
multianuale
2012-2014 de 2012-2014 de
(1995 - 2011)
la multianuale, la multianuale,
Luna
2012
2012
2013
2013
2014
2014
%
%
Balti
ianuarie
februarie
martie
aprilie
mai
iunie
iulie
august
septembrie
octombrie
noiembrie
decembrie
Suma anuala
Abateri,rel.(%)

30,6
26,2
24,3
38,4
37,8
66,2
79,1
57,7
63,0
36,5
35,6
34,0
529,2
100,0

Drochia Falesti Drochia Falesti Drochia Falesti


12,7
89,5
18,6
71,1
90,9
32,1
40,5
29,0
12,9
26,0
21,3
135,8
580,4
109,7

14,5
78,4
19,4
65,0
33,5
27,0
36,2
17,6
25,3
44,4
36,3
131,5
529,1
100,0

35,8
31,8
62,6
25,1
77,1
87,1
42,3
37,3
60,2
1,5
31,0
6,7
498,5
94,2

59

31,8
21,6
49,8
32,7
71,2
166,1
39,9
33,2
83,2
2,3
41,3
12,8
585,9
110,7

54,6
19,2
12,0
61,4
88,8
24,9
163,6
49,8
22,2
17,2
56,6
22,3
592,6
112,0

52,2
19,8
16,2
68,1
86,8
46,2
82,8
47,8
22,2
46,1
69,7
34,7
592,6
112,0

Drochia

Falesti

112,4
179,0
128,1
136,8
226,7
72,6
103,8
67,1
50,5
40,8
102,1
161,4

107,4
152,6
117,4
143,9
169,1
120,5
67,0
57,0
69,2
84,7
138,0
175,3

Conform sumei depunerilor precipitaiilor anuale pe parcursul de studii n sectorul Drochia, anii 2012 (580,4
mm/109,7%) i 2014 (592,6 mm/112,0%) au fost ploioi, iar 2013 a fost format deficitul de cca. 6% fa de
media a aptesprezece ani(tab.1). Dar, n cazul analizei climei n perioada creterii intense a rizocarpului (iunieaugust) deficitul n anii 2012 i 2013 constituie cca. 50% i 18% respectiv. Media 2012-2014 formeaz
557,2mm/105,3%.
Tabelul 2. Media temperaturii aerului n perioada studiului 2012-2014, Drochia i Fleti
Date
multianuale
(1995 - 2011)

Luna

Balti
-2,9
-0,5
3,7
10,5
16,5
20,1
22,2
21,2
15,6
10,2
4,7
-1,2
10,01

ianuarie
februarie
martie
aprilie
mai
iunie
iulie
august
septembrie
octombrie
noiembrie
decembrie
Media anuala, C
Abateri, absolut C

Temperatura aerului, C
2012
Drochia
-3,9
-10,0
3,0
12,4
18,2
21,9
24,8
22,2
18,4
11,5
5,3
-4,7
9,9
-0,1

2012

2013

2013

2014

Media Abateri lunare


lunara,
2012-2014
fata de
2014 2012-2014
multianuale, C

Falesti Drochia Falesti Drochia Falesti Drochia


-2,4
-4,4
-3,6
-2,5
-1,9
-3,6
-9,2
-0,4
0,8
-0,9
-0,9
-3,8
4,2
0,4
2,1
7,1
8,2
3,5
13,2
11,5
12,3
10,4
11,3
11,4
18,8
18,5
19,2
16,7
17,0
17,8
23,0
20,5
21,2
18,4
19,1
20,3
26,1
20,2
21,2
21,6
22,4
22,2
23,3
20,7
21,7
21,7
22,3
21,5
19,2
13,4
14,6
17,1
18,0
16,3
12,2
10,5
11,6
9,0
9,7
10,3
6,2
7,5
8,8
3,2
4,2
5,3
-4,2
-0,4
0,3
-0,7
-0,2
-1,9
10,9
9,8
10,9
10,1
10,8
10,0
0,9
-0,2
0,8
0,1
0,8
-0,1

Drochia
-0,7
-3,2
-0,2
0,9
1,3
0,1
0,0
0,4
0,7
0,2
0,6
-0,7

Media
lunara,
20122014

Abateri lunare
2012-2014
fata de
multianuale, C

Falesti
-2,6
-3,1
4,8
12,3
18,3
21,1
23,2
22,4
17,3
11,2
6,4
-1,4
10,8
0,8

Falesti
0,2
-2,6
1,1
1,8
1,8
1,0
1,0
1,3
1,7
1,0
1,7
-0,1

Suma depunerilor n sectoarele din r-nul. Fleti (tab.1) n perioada 2012-2014 constituie
569,2mm/107,6%, cu urmtoarea repartizare anual: 2012 529,1mm/100%; 2013 585,9mm/110,7%; 2014
592,6mm/112,0%. n perioada decisiv pentru formarea recoltei deficitul n anul 2012 a format 60,2%; n 2014cca.13%.
Temperatura medie anual (tab.2) n sectorul Drochia au fost la nivelul datelor multianuale (diferena
fiind -0,2(2013)..+0,1C(2014); n sectorul Fleti vremea a fost cu mult mai cald cu cca.+1C (2012 +0,9;
2013/2014 +0,8C). n perioada creterii intensive a plantelor, media temperaturii lunilor de var denot condiii
aride n deosebi n Fleti: 2012+3,0; 2013 +0,2; 2014+0,1C; Drochia: 2012+1,8; 2013-0,7; 2014-0,6C.
Media temperaturilor (2012-2014) a format 9,95C Drochia i 10,8C Fleti.
REZULTATE I DISCUII
Pe parcursul anilor de studiu (2012-2014) n varianta fr protecia aparatului foliar este de observat
diferene semnificative ntre varieti cercetate. Astfel, media pierderii din cauza putrefaciei (masa) a constituit
3,2% cu variaia 1,6% la varietatea Vedeta pn 4,9%(Taltos) (Tab. 3). Masa plantelor vetede (media standard
2,0%) a variat n limitele 1,1%-2,7%; masa plantelor propriu-zis putrede (media standard 1,2%) abaterile au
constituit 0,5%-2,1%. Important este faptul pierderile n densitatea plantelor ce a oscilat 2,3%-5,3%; media
standard fiind 3,5%.
Tabelul 3. Nivelul de producie i putrefacie a rizocarpilor (2012-2014) fr fungicidare, n=14
Varietate

Nastja
Impact
Merak
Cassidy
Media SD
Raissa
Baccara
Darja
Oxanna
Horizon
Cesaria
Corrida
Damian
Cantata
Armin
Vedeta
Wawilow
Taltos
Media variant.
Media exper.

Densitatea
total
plantelor,
mii/ha

Procentul
sumar pl
afectate
(densitate), %

107,3
108,6
107,1
105,4
107,1
111,1
111,0
108,5
107,6
107,6
105,5
112,3
103,9
107,9
108,0
106,8
105,9
106,9
107,9
107,7

3,6
2,8
4,8
2,9
3,5
3,0
3,0
3,9
4,0
2,5
3,7
3,6
3,4
2,4
4,0
2,3
3,5
5,3
3,4
3,5

Densitatea
plantelor
Recolta
sanatoase, totala, t/ha
mii/ha
101,6
104,3
99,9
100,1
101,5
105,5
105,5
102,9
99,5
101,4
97,3
106,1
95,9
103,1
100,9
102,7
100,1
99,1
101,5
101,5

68,3
65,2
62,3
63,4
64,8
68,7
68,7
69,6
66,3
65,4
62,5
62,6
62,8
60,3
62,4
60,7
63,1
62,0
64,2
64,4

Procentul
de
putrefacie
de la masa

Procentul
din masa
pantelor
vestede

3,3
2,6
4,3
2,6
3,2
3,2
2,7
3,5
4,3
2,3
3,3
3,2
3,0
2,1
3,5
1,6
3,4
4,9
3,2
3,2

2,2
1,3
2,6
1,7
2,0
1,6
2,0
2,3
2,3
1,4
1,9
1,4
1,4
1,1
2,0
1,1
2,0
2,7
1,8
1,8

60

Procentul
din masa
plantelor
putrede
1,1
1,3
1,7
0,9
1,2
1,6
0,7
1,3
2,0
0,9
1,4
1,7
1,6
1,0
1,5
0,5
1,4
2,1
1,4
1,3

Recolta
plante
Coninutul
sanatoase, zahrului,%
t/ha
65,6
63,2
59,5
61,6
62,5
65,6
66,7
66,9
63,2
63,5
60,1
60,2
60,7
58,7
60,0
59,4
60,6
59,1
61,9
62,0

18,3
18,5
18,7
18,3
18,4
18,6
18,1
18,0
18,3
18,2
18,7
18,7
18,7
19,0
18,5
18,5
18,2
18,2
18,4
18,4

Pierderi
de zahr
n
melas,%
1,57
1,60
1,61
1,70
1,62
1,59
1,65
1,65
1,75
1,66
1,44
1,57
1,58
1,64
1,60
1,58
1,65
1,63
1,61
1,62

Coninutul
zahrului
purificat,
%
16,1
16,3
16,5
16,0
16,2
16,4
15,8
15,8
16,0
15,9
16,7
16,6
16,5
16,8
16,3
16,3
16,0
15,9
16,2
16,2

Recolta
zaharului
purificat,
t/ha
10,49
10,22
9,79
9,67
10,04
10,64
10,34
10,32
10,01
9,95
9,92
9,87
9,84
9,72
9,59
9,58
9,52
9,33
9,90
9,93

Recolta
zaharului
purificat,
relativ
104,4
101,8
97,5
96,3
100,0
106,0
103,0
102,8
99,7
99,1
98,8
98,3
98,0
96,9
95,5
95,4
94,8
92,9
98,6
98,9

Dup recolta zaharului purificat (media standard 10,04t/ha 100%) diferena ntre hibrizi l constituie
92,9% (Taltos) la 106,0% (Raissa) (Tab. 3).
Nivelul de putrefacie (mas) n varianta cu fungicidare prezentate n tabelul 4, a constituit 2,6% cu
variaia n limitele 1,4-4,0% sau n mediu pe experien cu 0,4% mai sczut cu varianta fr fungicidare. i
recolta zahrului purificat, ce constituie rezultanta dintre recolta rizocarpilor i a indicilor de calitate, s-a mrit
semnificativ cu 0,79t/ha (sau 108% fa de media fr protecie).
Tabelul 4. Nivelul de producie i putrefacie a rizocarpilor (2012-2014) cu fungicidare, n=14
Procentul
Densitatea
sumar pl
total
Varietate
afectate
plantelor,
(densitate),
mii/ha
%
Impact
105,7
3,7
Nastja
105,2
3,2
Merak
107,3
3,4
Cassidy
104,4
2,2
Media SD
105,6
3,1
Horizon
108,6
3,0
Raissa
107,7
3,4
Darja
108,8
2,5
Baccara
105,9
3,5
Taltos
106,6
3,0
Wawilow
107,7
3,5
Oxanna
103,2
4,1
Damian
106,9
2,3
Corrida
106,1
3,7
Armin
108,2
4,1
Cesaria
105,5
3,8
Vedeta
108,5
1,8
Cantata
105,2
2,9
Media variant.
106,8
3,2
Media exper.
106,5
3,2

Densitatea
Procentul
Recolta
plantelor
de
totala,
sanatoase,
putrefacie
t/ha
mii/ha
de la masa
100,8
100,5
101,7
96,8
99,9
102,4
102,1
104,0
99,9
101,9
102,3
96,2
99,5
100,4
100,0
96,5
105,0
100,4
100,8
100,6

68,8
68,0
64,3
66,6
66,9
74,0
70,5
73,1
70,4
68,7
70,6
68,0
66,4
65,6
65,9
65,4
64,7
62,7
68,2
67,9

3,1
2,6
2,9
1,9
2,6
2,4
2,8
2,7
3,1
2,5
3,0
3,6
1,7
3,3
3,9
4,0
1,4
2,4
2,8
2,8

Procentul
din masa
pantelor
vestede

Procentul
din masa
plantelor
putrede

1,6
1,5
1,7
1,5
1,5
1,4
1,6
1,8
2,1
1,7
1,8
2,3
0,9
1,3
2,2
1,9
1,1
1,5
1,7
1,6

1,5
1,1
1,2
0,4
1,1
1,0
1,2
0,9
1,0
0,8
1,2
1,3
0,8
2,0
1,6
2,0
0,4
0,9
1,2
1,1

Recolta
Pierderi
Recolta
Coninutul
plante
Coninutul de zahr
zaharului
zahrului
sanatoase, zahrului,% n
purificat,
purificat,%
t/ha
melas,%
t/ha
66,1
65,7
62,1
65,0
64,7
71,9
68,1
70,7
68,0
66,8
68,0
65,5
64,9
63,0
62,9
62,7
63,3
60,8
65,9
65,6

18,9
18,1
18,9
18,4
18,6
18,5
18,9
18,3
18,7
18,8
18,5
18,7
18,8
19,2
18,8
18,7
18,6
19,1
18,8
18,7

1,54
1,59
1,55
1,62
1,6
1,56
1,51
1,58
1,54
1,49
1,64
1,62
1,54
1,50
1,56
1,39
1,62
1,56
1,55
1,55

16,8
15,9
16,8
16,2
16,4
16,4
16,8
16,2
16,6
16,8
16,3
16,5
16,7
17,1
16,7
16,7
16,4
16,9
16,61
16,56

10,98
10,35
10,34
10,28
10,49
11,49
11,37
11,26
11,10
11,03
10,95
10,70
10,63
10,63
10,37
10,37
10,24
10,12
10,79
10,72

Recolta
zaharului
purificat,
relativ
109,4
103,1
103,0
102,3
104,4
114,4
113,2
112,1
110,6
109,9
109,1
106,6
105,9
105,9
103,3
103,3
102,0
100,8
107,5
106,8

Tabelul 5. Ponderea fungicidrii asupra indicilor de productivitate i calitate precum i gradului de


putrefacie, 2012-2014, 17 varieti, 14 locaii
Recolta plante sanatoase, t/ha
Varietate
Impact
Nastja
Merak
Cassidy
Media SD
Horizon
Raissa
Darja
Baccara
Taltos
Wawilow
Oxanna
Damian
Corrida
Armin
Cesaria
Vedeta
Cantata
Media variant.
Media exper.

Procentul de putrefacie, %
(masa)

Coninutul zahrului,%

Pierderi de zahr n melas,% Coninutul zahrului purificat,% Recolta zaharului purificat, t/ha

fungicida
fr
fungicidare diferenta fr
fungicidare diferenta fr
diferenta fr
re
63,2
66,1
3,0 2,60
3,07
0,47 18,49 18,89
0,40
65,6
65,7
0,2 3,32
2,57 -0,75 18,31 18,12 -0,19
59,5
62,1
2,6 4,26
2,87 -1,39 18,68 18,92
0,24
61,6
65,0
3,4 2,59
1,89 -0,70 18,29 18,41
0,12
62,5
64,7
2,3 3,19
2,60
-0,59 18,44 18,58
0,14
63,5
71,9
8,3 2,33
2,43
0,10 18,17 18,52
0,35
65,6
68,1
2,5 3,25
2,80 -0,45 18,62 18,87
0,25
66,9
70,7
3,8 3,51
2,68 -0,83 18,01 18,34
0,33
66,7
68,0
1,3 2,67
3,11
0,44 18,09 18,70
0,61
59,1
66,8
7,7 4,86
2,51 -2,36 18,16 18,85
0,68
60,6
68,0
7,4 3,42
3,02 -0,41 18,21 18,55
0,34
63,2
65,5
2,3 4,30
3,58 -0,72 18,32 18,72
0,40
60,7
64,9
4,2 3,03
1,72 -1,31 18,68 18,84
0,16
60,2
63,0
2,8 3,18
3,35
0,17 18,75 19,16
0,41
60,0
62,9
2,9 3,51
3,85
0,34 18,52 18,83
0,31
60,1
62,7
2,7 3,30
3,98
0,68 18,74 18,68 -0,05
59,4
63,3
3,9 1,62
1,44 -0,18 18,46 18,64
0,17
58,7
60,8
2,1 2,12
2,39
0,27 19,01 19,10
0,09
61,9
65,9
4,0 3,16
2,84
-0,33 18,44 18,75
0,31
62,0
65,6
3,6 3,17
2,78
-0,39 18,44 18,71
0,27

fungicidar
fungicidar
fungicidar
diferenta fr
diferenta fr
diferenta
e
e
e
1,60
1,54
-0,06
16,30
16,76
0,46
10,22
10,98
0,77
1,57
1,59
0,02
16,14
15,93
-0,21
10,49
10,35
-0,14
1,61
1,55
-0,06
16,47
16,77
0,30
9,79
10,34
0,55
1,70
1,62
-0,08
15,99
16,19
0,20
9,67
10,28
0,60
1,62
1,57
-0,04
16,22
16,41
0,19
10,04
10,49
0,45
1,66
1,56
-0,10
15,91
16,36
0,45
9,95
11,49
1,54
1,59
1,51
-0,08
16,42
16,76
0,33
10,64
11,37
0,72
1,65
1,58
-0,07
15,76
16,16
0,40
10,32
11,26
0,94
1,65
1,54
-0,12
15,84
16,56
0,72
10,34
11,10
0,76
1,63
1,49
-0,14
15,94
16,76
0,82
9,33
11,03
1,70
1,65
1,64
-0,01
15,96
16,31
0,35
9,52
10,95
1,43
1,75
1,62
-0,14
15,97
16,51
0,54
10,01
10,70
0,70
1,58
1,54
-0,04
16,50
16,70
0,19
9,84
10,63
0,79
1,57
1,50
-0,08
16,57
17,06
0,49
9,87
10,63
0,76
1,60
1,56
-0,04
16,32
16,67
0,35
9,59
10,37
0,79
1,44
1,39
-0,04
16,70
16,69
-0,01
9,92
10,37
0,45
1,58
1,62
0,03
16,28
16,42
0,14
9,58
10,24
0,66
1,64
1,56
-0,08
16,77
16,94
0,17
9,72
10,12
0,39
1,61
1,55
-0,07
16,23
16,61
0,38
9,90
10,79
0,89
1,62
1,55
-0,06
16,23
16,56
0,34
9,93
10,72
0,79

Ponderea fungicidrii asupra indicilor de productivitate i nivelului de putrefacie este semnificativ.


Astfel, asupra recoltei de rizocarpi constituie n mediu 3,6 t/ha (106%), ntre varieti 0,2t/ha, 3t/ha; procentul de
putrefacie (mas) a sczut n mediu cu 0,4%; coninutul zahrului s-a mrit n mediu 0,27% (pn la max.
+0,68%); pierderile de zahr n melas s-au mbuntit la cei ce au cultuvat aceast cultur de cmp, n mediu
cu 0,06% (pn la 0,14%); coninutul de zahr purificat s-a mrit n mediu cu 0,34% (max. 0,82%); iar recolta
zahrului purificat cu +0,79 t/ha (pn la 1,70 t/ha).
CONCLUZII:
n baza cercetrilor 2012-2014 a 17 hibrizi n 14 locaii pot fi fcute urmtoarele concluzii:
1. Influena semnificativ a fungicidrii asupra recoltei zahrului purificat se estimeaz la nivelul mediu de
108% (fa de varianta fr tratament).
Din toate variantele studiate pot fi formate trei grupe de hibrizi cu receptivitate la aplicarea fungicidelor
foliare (recolta zahrului purificat):
a) mrit : Darja (+0,94t/ha/109,1%), Wawilow(+1,43 t/ha/115,1%), Horizon (+1,54 t/ha/115,4%), Taltos (+1,70
t/ha/118,2%)

61

b) medie: cuprins n intervalul +0,45 t/ha/104,5% (Cesaria) +0,79t/ha/108,2% (Armin) i ali hibrizi
c) sczut:ponderea fiind pn la +0,39 t/ha/104% (Cantata).
2. Asupra coninutului substanelor melasigene fungicidarea a avut un efect pozitiv la toate variantele cercetate
n mediu constituind cu 3,9% (relativ) scdere n pierderi de zahr n melas. Dup receptivitate cultivrii pot fi
grupai:
a) Foarte receptivi: cuprins n diapazonul 4,7% Cassidy 8,4% Taltos; Baccara-7,0% Horizon-6,1% a.
b) Slab receptivi: intervalul 3,8% Impact 0,5% Wawilow.
c) Nereceptivi: Nastja -1,5% Vedeta -2,2%.
3. Hibrizii studiai au avut diferit receptivitate la aplicarea fungicidului (dup recolta rdcinilor):
a) foarte mrit: cuprinse +3,8t/ha/105,7%8,3t/ha/113,1% (Darja, Vedeta, Damian, Wawilow, Taltos,
Horizon)
b) mrit: cuprinse n limitele +1,3t/ha/102,0%, 4t/ha/105,5% (Impact, Merak, Cassidy, Raissa, Baccara,
Oxanna, Corrida, Armin, Cesaria, Cantata).
c) Hibridul Nastja (+0,2t/ha/ 100,2%) s-a dovedit a fi cel mai tolerant n formarea recoltei de rizocarpi la
infectarea aparatului foliar cu maladii.
3. Putrefacia rizocarpilor odat cu aplicarea fungicidelor s-a micorat n mediu cu 0,4%/ sau cu 12,3% fa de
martor. Din grupa hibrizilor cu reacie pronunat: Raissa cu micorarea putrefaciei cu 0,45% absolut/ sau
13,8%relativ Taltos 2,36%/48,5% respectiv. Tot din aceast grup fac parte: Nastja, Merak, Cassidy, Darja,
Wawilow, Oxanna, Damian.
BIBLIOGRAFIE:
1. Holtschulte, B. Cercospora beticola: World-wide distribution and incidence. In: Advances in Sugar Beet
Research, Vol. 2: Cercospora. International Institute for Beet Research, 2000.
2. , .; , .; , . .
B: , 2007, 7, .13-14.
3. Crivcianschi, Gh.; Kstner, B.; Lupascu, G. Particularitile genotipice ale sfeclei de zahr n legtur cu
protecia de cercosporioz. n: Materialele Congresul VIII al Societii tiinifice a Geneticienilor i
Amelioratorilor din Republica Moldova, Chiinu 2005, p. 580-584.
4. Crivcianschi, Gh.; Palii, A.; Kstner, B. Influena combaterii maladiilor aparatului foliar asupra indicilor de
producie la unele soiuri de sfecl pentru zahr: https://ro.scribd.com/doc/.../1-2007-1-pdf.
5. Wolf, P.; Weis, F.; Verreet, J.; Brcky, K.; Maier, J.; Tischner, H. Modell Zuckerrbe Entwicklungsschritte
und Einfhrung in die Praxis. Ges. Pflanzen, 1998, 50, p. 264-272.
EFICACITATEA HRNIRII PURCEILOR SUGARI CU AMESTEC DE OBINUIRE
Danilov Anatolie, Donica Ion, Institutul tiinifico- Practic de Biotehnologii n Zootehnie i Medicin
Veterinar
The paper presents results of establishing efficiency and possibilities for replacement in rations of
suckling piglets under the age of 21 days of mixed prestarter fodder with that of simple accustoming fodder.
It was established that additional feeding of suckling piglets in this period is required only to accustom
piglets to consume, while the amount of food consumed by a piglet is quite small, with an average of 557g and
585g in the control group and the experimental group respectively. In the experiment, the nutritional needs of
piglets were largely satisfied with sows mother milk, thus breastfeeding ability of sows was 51.5 kg in the
control group and 53.9 kg in the experimental group.
Weight gain of piglets in the conditions of relatively early weaning (28 days) was 6.19 kg and 6.59 kg
in corresponding lots.
Key words: lactating sows, piglets. fodder, fodder from ordinary premix capacity breastfeeding,
specific consumption, increase daily growth.
INTRODUCERE
Pentru dezvoltarea continu a zootehniei n ara noastr, un rol deosebit i revine ramurii de
cretere a porcinelor, deoarece din volumul total de carne produs n Republica Moldova, carnea de porc
ocup 50%, n afar de aceasta, acest produs este tradiional pentru populaia rii.
Cercetrile efectuate n domeniul nutriiei porcinelor au dovedit, c n mijlociu pn la 30% de energie
total a nutreului este folosit la formarea produciei, iar cealalt parte la ndeplinirea funciilor vitale. De o
importan deosebit o constituie ntreinerea purceilor n perioada de alptare n vederea realizrii unei greuti
mari la nrcare constituind un avantaj pentru gestionarea economic a ntreprinderii. Producia de lapte a
scroafelor pn la vrsta de trei sptmni este n cretere continu, fiind aproximativ egal cu cerinele
nutriionale ale purceilor [1, 5].
n primele luni de via purcelul are un ritm de cretere accelerat i valorific foarte bine hrana.
Deoarece el i dubleaz greutatea de la natere n aproximativ 6 zile, iar pn la 90 de zile de 20-30 de ori, acest
avantaj trebuie folosit din plin .

62

n perioada de lactaie a scroafelor purceii sugari sunt n primul rnd dependeni de mam, sub aspect
nutriional, iar dup vrsta de 21 de zile producia de lapte a scroafei i cerinele de substane nutritive ale
purcelului sunt diferite [3, 4]. Scroafa hrnit corect va avea o lactat abundent contribuind prin aceasta la
creterea accelerat a purceilor i la diminuarea pierderilor. n aceast perioad trebuie s se in seama de
capacitatea specific a purcelului de a valorifica hrana, fiindc sistemul enzimatic nu este adaptat la hrnirea
obinuit. Hrnirea suplimentar trebuie nceput mai devreme pentru ca purcelul s se obinuiasc s consume
nutreuri.
n acelai timp, nrcarea purceilor este de o deosebit importan iar fixarea vrstei de nrcare este
una n funcie de o multitudine de factori de ntreinere i nutriionali. Studiind literatura de specialitate am
constatat c sunt puine cercetrile n domeniu care arat, care reprezint vrsta fix pentru nceperea hrnirii
suplimentare a purceilor sugari. n practica de cretere a porcinelor administrarea prestarterului ncepe la vrste
diferite - 7,10,14 sau chiar 21 de zile.
Efectuarea acestui procedeu tehnologic prea devreme ridic probleme deosebite n privina hrnirii
purceilor, n acelai timp nu permite exploatarea suficient a capacitii de alptare a scroafei, iar o nrcare prea
trzie nu este avantajoas, ea determinnd o folosire iraional a scroafelor pentru reproducie.
SCOPUL CERCETRILOR
Cercetrile au avut ca scop determinarea eficienei i posibilitile de nlocuire din raiile purceilor
sugari pn la vrsta de 21 de zile a nutreului combinat prestarter cu nutre simplu de obinuire.
MATERIAL I METODE
Pentru realizarea obiectivelor propuse, n cadrul Filialei FCP Comfort SRL, au fost selectate loturile
de purcei obinui de la 16 scroafe cte 8 loturi pe variant, avnd acelai nivel de dezvoltare, constituie i stare
de sntate.
Pentru furajarea suinelor luate n studiu n cadrul seciei de preparare a nutreului combinat a
ntreprinderii, s-a pregtit nutre combinat, conform normelor de alimentaie. Reetele de nutre combinat
administrat scroafelor i purceilor sugari au fost calculate folosind sowtului HYBRIMIN formulate n aa fel
nct s satisfc cerinele zilnice n energie, protein, substane minerale i vitamine.
Receptura de nutre combinat a fost alctuit din orz, porumb, gru, trt de gru, drojdii furajere, rot
de soia, fin de pete, lapte degresat, cret, sare, premix.
Animalele selectate au fost hrnite cu nutreuri combinate uscate distribuite n trei tainuri, conform
tehnologiei primite la ntreprindere, fiind aplicat un singur regim de hrnire.
Zilnic s-a dus evidena cantitii de nutre combinat administrat i a resturilor de hran neconsumate
prin cntriri. Hrnirea purceilor cu nutre suplimentar a nceput la vrsta de 10 zile cu cantiti mici de mai
multe ori pe zi.
Pentru a stabili oportunitatea folosirii amestecului de obinuire loturile de purceii sugari pn la vrsta
de 21 de zile au fost furajai astfel:
Lotul martor - nutre combinat prestarter; lotul experimental de la vrsta de 10 pn la 21 de zile
porumb extrudat+complex vitamino - mineral.
Dup vrsta de 21 de zile pn la nrcare toi purceii au fost furajai cu nutre combinat prestarter.
nrcarea s-a fcut la vrsta medie de 28 de zile prin scoaterea scroafelor i ntreinerea purceilor n
continuare n maternitate.
Pe parcursul derulrii cercetrilor au fost urmrite performanele de cretere precum: viabilitatea,
mortalitatea purceilor, capacitatea de alptare a scroafelor, creterea n greutate de la natere pn la nrcare,
consumul de nutre combinat pe cap de scroaf, consumul de nutre pe cap de purcel i modul de valorificare a
hranei.
Animalele n grupe au fost selectate utiliznd metodele clasice [6]. Sporul mediu zilnic i consumul
specific pentru 1 kg spor a fost calculat dup tehnicile cunoscute [2].
Determinarea compoziiei chimice a nutreului conform metodelor clasice.
Datele experimentale obinute i aprecierea semnificaiei diferenelor s-a efectuat utiliznd metodele
clasice [7].
REZULTATELE OBINUTE
n componena reetelor de nutre combinat pentru scroafele lactante au fost incluse: porumb-35,6; orz25,9; gru-15,5; rot de soia-7,0; fin de pete-2,5; drojdii furajere-2,4; sare-0,5; cret-1,6; premix-1,0 procente.
Parametrii reetei de nutre combinat folosit n experien a avut un nivel de 12,6 Mj energie metabolizabil;
15,2% protein brut; 0,69% lizin; 0,52% metionina+cistina; calciu 0,88%, fosfor 0,65%. Aceti indici se
ncadreaz n limitele normelor de nutriie pentru scroafele lactante [5].
n perioada experimentrilor, consumul mediu de nutre combinat pe cap de scroaf cu purcei a fost de
169,4 kg n lotul martor i 174,3 kg n lotul experimental.
Valoarea nutritiv a unui kilogram de nutre combinat prestarter folosit pentru hrnirea purceilor sugari
a fost de: 13,7 Mj energie metabolizabil; 207g protein brut; 9,97g lizin; 6,34 g metionina+ cistina; 1,21g
triptofan, fibr brut 36 g. n componena reetei au fost incluse porumbul,cereale extrudate de orz, gru, mazre,
precum i rot de soia, fina de pete, laptele degresat primix vitamino- mineral.
Compoziia 1kg de complex vitamino-mineral folosit n experiment:

63

Calciu -260g; fosfor.-75g; lizin -3,0g; metionin -0,6g; cisteina -0,4g; treonina -0,4g; triptofan -0,5g;
leucina -3,4g; izoleucina -2,3g; tirozina -1,4g; valina -2,5g; arghinina -1,7g; histidina -1,2g; fenilalanina 1,9g;.natriu -2g; zinc -2500mg; magneziu -17g; mangan -1000mg; fer -800mg; cupru -200mg; iod -10g; cobalt 50mg; seleniu -30mg; vitamina A -0,64 UI; vitamina E -0,2mg; vitamina B6 -3,5mg; vitamina B1 -0,6mg;
vitamina B12 -0,4mg; vitamina B2 -5,0 mg; vitamina PP -47,2mg.
Din analiza datelor obinute n acest experiment reiese c, folosind pentru hrnirea purceilor pn la
vrsta de trei sptmni a unui nutre de obinuire format din porumb extrudat i un complex vitamino-mineral
(lotul experimental), comparativ cu nutreul prestarter (lotul martor), nu s-au obinut diferene semnificative n
privina consumului de nutret. n baza calculelor i observaiilor fcute s-a constatat c cantitatea de hran
consumat de un purcel pn la vrsta de trei sptmni este destul de mic. Consumul de hran n aceast
perioad a fost de 557g n lotul martor i 585g n lotul experimental.
Trebuie menionat faptul c, compoziia furajului i valoarea nutritiv a acestuia folosit n hrnirea
suplimentar a purceilor pn la vrsta de 21 de zile, n condiiile nrcrii semiprecoce (28 de zile) nu a avut o
influin asupra dezvoltrii lor ulterioare.
Creterea n greutate a purceilor pn la vrsta de 21 de zile a fost de 5,35 kg n lotul martor i 5,46 kg
n lotul experimental, iar la nrcare a fost de 6,19 kg i 6,59 kg corespunztor loturilor.
Analiznd datele capacitii de alptare a scroafelor am stabilit c, cerinele nutriionale ale purceilor
pn la vrsta de trei sptmni n mare msur au fost satisfcute din laptele scroafelor mame, astfel capacitatea
de alptare a scroafelor a fost de 51,5 kg n lotul martor i 53,9 kg n lotul experimental.
Datele obinute de noi sunt n concordan cu cele obinute n unele experimente efectuate n alte ri
care au demonstrat c hrnirea adugtoare a purceilor sugari n aceast perioad este necesar numai pentru a
obinui purceii s consume hrana fr a se conta prea mult pe aportul nutriional.
Cantitatea de hran folosit de purcei pn la vrsta de 21 de zile, raportat la un numr mare de purcei
crescui n sistem intensiv, permite de a economisi 5-6 t de nutre combinat prestarter pentru o ntreprindere care
produce 10000 capete purcei pe an. Acest nutre poate fi folosit mult mai util la o vrst mai naintat cnd
acesta este valorificat mult mai bine de ctre purcei.
CONCLUZII:
n urma experimentrii posibilitilor de nlocuire a nutreului combinat prestarter cu un nutre simplu
de obinuire folosit n raiile purceilor sugari pn la vrsta de 21 de zile i a rezultatelor obinute se pot trage
urmtoarele concluzii:
1. Cantitatea de hran consumat de un purcel pn la vrsta de trei sptmni este destul de mic 557g n lotul
martor i 585g n lotul experimental, iar compoziia nutreului folosit la hrnirea suplimentar a purceilor sugari,
n condiiile nrcrii semiprecoce (28 de zile) nu are o influen asupra creterii i dezvoltrii purceilor.
2. Cantitatea de nutre folosit de purcei a fost mic deoarece cerinele nutriionale ale purceilor n mare msur
au fost satisfcute din laptele scroafelor mame, iar capacitatea de alptare a scroafelor a fost de 51,5 kg n lotul
martor i 53,9 kg n lotul experimental.
3. Pentru o ntreprindere care produce 10000 capete purcei pe an folosirea n hrana purceilor pn la vrsta de 21
de zile a unui nutre de obinuire format din porumb extrudat i un premix vitamino-mineral permite de a
economisi 5-6 t nutre combinat prestarter.
4.innd cont c pentru producerea nutreului combinat prestarter se folosesc cantiti nsemnate de ingrediente
de origine animal, toate la preuri mari n aceast perioad purceii pot fi obinuii s consume nutre de
obinuire format din porumb extrudat i un complex vitamino-mineral i numai dup aceast vrst s se nceap
hrnirea cu nutre combinat prestarter.
BIBLIOGRAFIE:
1. Cuc, A.; Rou, I.; Potecea, V. Creterea porcinelor de la A la Z. Bucureti: Ed. Agro Tehnica, 2006.
2. Cucu, I.; Maciuc, V. i al. Cercetarea tiinific i elementele de tehnic experimental. Iai: Ed. Alfa, 2004.
388 p.
3. Pop I. i al. Nutriia i alimentaia animalelor, Iai, 2006.
4. Traian, Stan. Tehnologiia creterii suinelor. Iai, 1992. 363 p.
5. , .., , ..; , .., . . . - 3- . ,
2003. 456 .
6. , .. . . : , 2003.
1976. 304 .
7. , . . : , 1978. 256 .
FABRICATION DES PRODUITS NON-ALCOOLIQUES OBTEBUS DU RAISIN IMMATURE
Golubi Roman, researchers, del., PhD, Institut Scientifique-Pratique, dHorticulture et Technologies
Alimentaires, Iorga Eugen, chief laboratory to check the quality of food, Institut Scientifique-Pratique,
dHorticulture et Technologies Alimentaires, Gaina Boris, academician Acadmie des Sciences de Moldova

64

n articol sunt expuse procedeele de fabricare a unor produse non-alcoolice din struguri nematurizai
(preponderent soiuri Vitis Labrusca) recoltai la diferite etape de coacere, acestea fiind sucuri acide (acre) i
acidulani naturali. Pentru fiecare grup de produse sunt stabilii indicii tehnici eseniali: coninutul de substane
uscate solubile, aciditatea titrabil i coraportul coninut de glucide/aciditate. n baza acidulanilor produi
conform unei tehnologii specifice i a matricelor din fructe i legume sunt propuse reete de fabricare a unei
game de produse n care se prevede substituirea total a acidulanilor tradiionali (acizii acetic i citric) cu cei
obinui din struguri. Investigaiile respective au fost precedate de studiul metabolismului principalilor nutrieni
pe perioada de coacere a strugurilor.
INTRODUCTION
Sont connus des projets de recherche pour obtenir les acidifiants naturels.
LInstitut National de Recherche Agronomique en partenariat avec Foulon Sopagly (France) a tudi les
moyens de diversifier l'utilisation de raisins, leur rsultat est l'obtention du produit a une acidit leve, faible en
glucides et l'arme prononc de raisins verts [1].
LInstitut de recherche pour la conservation et la transformation de la production agricole Krasnodar
(Russie) a propos d'utiliser du jus ou de fruits de prunes blancs en conserve des legumes comme un substitut de
l'acide actique [2].
Des recherches d'exploiter les raisins de cpages Vitis Labrusca ont t faites par un groupe d'auteurs de
la ISPHTA [3, 4]. L'tude rcente fournit l'application des processus et procds technologiques pour atteindre
une plus grande efficacit du jus de raisin immature, ainsi que la production d'aliments de qualit (pas de dpts
cristallins tartrate).
Il propose la fabrication de produits non-alcoolises partir de raisin de cpages de Vitis labrusca - Noah
Isabelle, Lidia, etc. base sur une rcolte considrable non sollicite vinification. Les recherches menes ont
conduit des propositions pour faire des jus et acidifiants, le dernier tant appliqu en conserves des lgumes et
fruits.
MATRIELS ET MTHODES
En Aot-Septembre des annes 2011-2014 ont ts ramasss des raisins de cpages Vitis labrusca
Isabella et Noah diverses tapes de leur maturation, chz Collge National de la Viticulture et de Vinification
de Chisinau.
Pour chaque partie du raisin rcolts, on a dtermin le taux des solides solubles et l'acidit totale, sont
obtenu des chantillons de jus slon un processus technologique adapt dans le laboratoire.
La teneur en acides malique, tartrique et citrique a t dtermine par chromatographie en phase liquide
haute performance selon la Mthode Gnrale OIV. La phase mobile utilise - solution d'acide sulfurique de
0,0035 M, le dbit tait de 0,5 ml/min, temprature tablie de la colonne chromatographique 20C. Il a d'abord
t analyse les solutions talons des acides malique, tartrique et citrique, et des chantillons prpars partir du
jus de raisin. La rtention sur colonne chromatographie Zorbax Sax 250x4.6 mm a t spcifique pour chaque
substance. L'analyse quantitative a t effectue avec un dtecteur barrette de diodes (DAD) aux longueurs
d'onde 192, 208 et 210 nm.
Afin de rduire le jus tartrique sdiments a t utilis rsine changeuse d'ions Amberlite IRA-410,
Amberlite IRA-67, AV-17, AN-31, Purolite A-400.
RSULTATS ET DISCUSSIONS
Processus technologique de fabrication des chantillons exprimentaux de jus de raisin.
Les raisins aquisitionns ont t inspects et tris, lavs avec de l'eau potable, la pression d'eau est 1,2-1,3
atm.; puis blanchis 2-3 minutes dans l'eau chaude 80C: Les raisins blanchis ont ts rafls et crass, le mot
obtenu a t trait avec des enzymes pectolytiques une temprature de 40-42C pendant 10 min, puis press. Le
jus obtenu a suivi dbourbage et filtration. Le traitement thermique a t effectue 85C, la dure tant
dtermine par le type de matire: 20 min. jus de raisins 2,0-2,5% d'acidit titrable et 25 min. pour les raisins
lacidit en 1,2-2,0%. Les conditions de traitement thermique du jus sont plus lgres, car les valeurs de pH ont
t 2,5-3,0 conditionns effet conservateur des acides organiques.
La premire variante prevoit aprs traitement thermique lemballage du jus chaud dans des pots et leurs
hermetisage avec de couvercles twist-off.
Le deuxime mode de ralisation prevoit aprs traitement thermique un refroidissement du jus une
temprature de 4C et le maintien cette temprature pendant 48 heures pour sdimenter les tartrates. Pour la
sparation des cristaux forms, le jus a t dcant, puis dirig la concentration une temprature de 50C et
une pression de 72020 mm de Hg, on a obtenu jusqu' 30 32% de matires solides solubles. Le jus concentr
est vers dans des bocaux en verre twist-off volume de 380 et 560 ml.
Il a t dtermine la teneur totale en glucides et l'acidit titrable et on a calcul l'indice de sucre/ acidit
dans les chantillons de jus cpages Noah et Isabella (Fig. 1, 2)

65

Fig 1. Raport glucides/acides organiques dans


Fig. 2. Raport glucides/acides organiques dans le
le raisin cpage Noah pendant le mrissement
raisin cpage Isabella pendant le mrissement
De figures 1 et 2 est observe au cours des enqutes menes une augmentation de la teneur en sucres et
une diminution d' acides organiques similaire aux rsultats obtenus par Sabir et collgues chz les cpages
cultives en Turquie [5], le phnomne correspond en fait aux tudes sur le mtabolisme des principaux
nutriments dans les plantes de vigne, faites par Ribereau-Gayn et Peynod [6].
Bas sur ces deux paramtres, a t calcul l'indice sucre/acidit et appliqu sur les graphiques, ont t
conventionnellement dfinies le phases de ramassage des raisins pour la fabrication de divers produits. Cette
premire rcolte est optimale pour obtenir lacidifiant, la deuxime du jus avec une acidit modre, tandis que
les trois autres sont en phase de maturation complte et peuvent tre directionns un traitement pour obtenir du
jus selon la technologie classique.
Application exprimentale processus modernes de production.
Le pr-traitement thermique a t effectu de 2 faons: a) le chauffage de la cuve en acier inoxydable
pendant 10 minutes 80C sur rechaud lectrique, b) le chauffage par micro-ondes pendant 4 minutes dans le
four ( = 2450 MHz, P = 800W).
Il a galement t appliqu le traitement avec des enzymes pectolytiques Enovin (Espagne), aprs le
prtraitement thermique de quelques chantillons par rapport aux autres chantillons non-traits avec des
enzymes.
Tableau 1. Variation du rendement du jus en dpendence de la priode de rcolte
Matire
Rendement au pressage, % de la masse matire prmire
Date
premire
de
pre-traitement
pre-traitement
traitement
trait. micro-ondes
rcolte
80C/10 min.
80C/10 min.
micro-ondes
=2450 MHz
(schema clasique)
+ enzymes pect.
=2450 MHz
+ enzymes pect.
10 kg
34,1
45,2
35,3
45,4
09.08
raisin
54,5
58,5
54,7
58,8
21.08
cpage
54,2
58,3
54,4
58,3
28.08
Isabella
52,5
57,6
52,1
57,5
06.09
51,3
55,8
51,6
56,9
18.09
10 kg
33,2
42,3
34,8
43,6
09.08
raisin
54,4
58,2
54,1
58,4
21.08
cpage
53,2
57,5
53,4
58,2
28.08
Noah
50,5
56,7
51,3
57,9
06.09
48,1
54,4
50,7
57,7
18.09
Dans le cas du pr-traitement thermique classique des grains broys 80C pendant 10 minutes l'apport
calorique est considrablement, au cours de cette priode se produisent des ractions d'oxydation enzymatiques
des substances polyphnoliques. Le traitement par micro-ondes pendant 4 min. frquence de 2450 MHz,
favorise le chauffage rapide des liquides, dnature beaucoup des enzymes responsables de l'oxydation des
substances polyphnoliques, l'arme caractristique est mieux conserve.
Au pressage sobtiennent peu prs la mme quantit de jus, juste aprs le traitement aux micro-ondes
par rapport celui classique, la longueur est plus courte de 25-30% (5-7 min.)
Au but d'tude de la prcipitation des sels d'acide tartrique dans les jus, pures, compotes de raisin a t
labor un plan sur l'application de rsines changeuses d'ions
A partir des chantillons initials non traits de jus, ont t prpars des chantillons pour diffrents types
d'anionites (Amberlite IRA-410, IRA-67 Amberlite, AV-17, AN-31, Purolite A-400). Plus efficace est Purolite
A-400 qui permet de rduire la teneur en acides organiques tartrique, malique et citrique dans le jus de raisin par
18 20% (tableau 2).

66

Tableau 2. L effet du traitement du jus de raisin rsine echangeuse d ions sur le taux dacides organiques
Masse de rsine
Sparation des acides organiques contact rsine-jus
Purolite A 400,
Tartrique
Malique
Citrique
g 1dm3
%
g/dm3
%
g/dm3
%
g/dm3
20,0
20,0
1,60
6,0
0,70
18,5
0,12
15,0
14,3
1,10
4,3
0,50
14,5
0,09
10,0
7,8
0,60
0,8
0,10
10,8
0,07
5,0
1,3
0,10
0,4
0,05
4,8
0,03
2,5
0,6
0,05
0,2
0,02
1,5
0,01
Le tableau 3 prsente les rsultats de l'exprience avec la variation de la masse de rsine Purolite A-400
et la dure du traitement du jus de raisin cpage Isabella.
Sur la base des donnes prsentes dans le tableau 3, a t mis au point un modle mathmatique dont les
valeurs dtermines par les quations sont calculs sont semblables aux celles exprimentales.
Est remarqu que la diminuation des sdiments tartriques a une tendance exponentielle lorsque la masse
de rsine applique 1 dm3 jus de raisin a des valeurs jusqu' 8-10g, et a une tendance linaire vers l'axe 0
(pas cristaux de tartrate) lorsque la rsine est applique en quantit de 8-15g 1 dm3 jus.
Tableau 3. Leffet de la dure et masse de rsine contact au jus de raisin
Masse de
Dure du processus contact rsine-jus, t=30C
Contrle
rsine, g
(jus
non-trait)
10 min.
12 min.
15 min.
18 min.
20 min.
Quantit de cristaaux forms au traitement ultrieur par froid, g
20
0
0
0
0
0
4,650
15
0,265
0,160
0,055
0,035
0,012
4,655
10
0,650
0,425
0,175
0,155
0,105
4,655
5
1,450
1,150
0,725
0,520
0,300
4,660
2,5
2,550
2,115
1,815
1,545
1,255
4,650
A laide du logiciel Advanced Grapher ont ts dtermins les quations mathmatiques dont les valeurs
sont proches des donnes exprimentales, on a trouv les 3 secteurs de combinaisons de paramtres - le temps et
la quantit de rsine applique au traitement pour 1 dm3 du jus.
La diminution de la formation des cristaux tartrates est prsente sous la forme d'un modle
mathmatique qui comprend trois secteurs de valeurs. Microsoft Office Excel a calcul des valeurs de la fonction
pour tous les 3 secteurs de surface illustrant le modle mathmatique du processus de rduction des sdiments
cristallins tartriques dans le jus de raisin:
MC=(T*0,0056-0,003)*MR2-(T*0,08+0,1)*MR+4,65
pour les conditions MR=0-7g et T= 0-5 min
MC=(4,65*0,971exp((0,895*T-1,0465)*MR)+0,0002*MR3 pour les conditions MR=0-7g et T= 6-16 min
MC=(0,007*T-0,146)*MR+0,013*T2-0,5*T+5,23
pour les conditions MR=8-15g et T= 0-16 min
o MC-masse de cristaux tartriques, g; T-dure, min.; MR-masse de rsine, g.
Figure 3. Reprsentation
graphique du modle
mathmatique du processus de
diminuation des cristaux de
tartrates en jus de raisin par
traitement rsine echangeuse
dions Purolite A-400
Slon les valeurs des
quations
du
modle
mathmatique appliqu et la
reprsentation graphique obtenue,
on a rsolu qui sont les
paramtres optimaux pour le
dtartrage de jus de raisin: la
quantit de rsine Purolite A-400 a pour effet de rduire la formation de sdiments tartrique cristallins lorsque sa
valeur commence 16g/dm3 jus pendant 15 minutes, et manifeste l'effet sr aux valeurs de la quantit de rsine
dans la gamme 18-20g/dm3 et l'intervalle de 15-16 min (absence des cristaux).
Compars avec des acides organiques utiliss pour produire des boissons, de la pure, des conserves, les
acidifiants de raisin ont une valeur nutritive plus leve et sont naturels.

67

Ce qui importe est que la priode de rcolte du raisin pour la fabrication des acidifiants doit tre
dtermine en fonction de la composition physico-chimique et des indices organoleptiques optimales.
Ont ts obtenus des echantillons exprimentaux des conserves avec fruits et lgumes, o sont remplac
en recette les acides citrique et actique par les acidifiants du raisin des cpage Noah et Isabella avec 20% et
30% de solides solubles (produits concentrs), puis celles-ci ont ts soumises lanalyse organoleptique (voir
Tableau 4).
Tableau 4. Exemples de conserves avec acidifiants de raisin cpages Vitis Labrusca
Echantillons experimentaux de conserves avec
Analyse organoleptique, points
acidifiant naturel du raisin
Aspect exterieur
Couleur
Got
Arome
Confiture des noits vertes (acidifiant Noah)
4,3
4,2
4,1
4,0
Compote de crises (acidifiant Isabella)
4,6
4,5
4,2
4,2
Pure des pches (acidifiant Isabella)
4,6
4,6
4,3
4,2
Poivrons conservs (acidifiant Noah)
4,5
4,4
3,9
4,0
Tomates conservs (acidifiant Isabella)
4,6
4,5
4,3
4,4
Des chantillons plus russites ont prouv comme la pure des pches et les tomates conservs avec
lacidifiants de raisin de cpage Isabella, ils seront amliores en tablissant un quilibre harmonis de
composants et il reste de rationaliser davantage les processus.
CONCLUSIONS:
1. Bas sur la corrlation sucre/acidit des chantillons du jus de raisin, rcolt diffrents tapes de
maturation, ont ts dlimits les paramtres physico-chimiques de la matire premire ncessaire la
production des jus et des acidifiants naturels.
2. Afin d'augmenter le rendement en jus de raisins immature cpages Vitis labrusca ont ts appliqus le
pr-traitement thermique, le traitement avec prparation enzymatique et le traitement micro-ondes. Les
mthodes proposes ont tendu le rendement de 15-16%.
3. L'utilisation de rsines changeuses d'ions, en particulier Purolite A-400; contribue une
dminralisation partielle du jus, ce qui garantit la qualit du produit, en vitant la formation des sels cristallins
de l'acide tartrique.
RFERANCES BIBLIOGRAPHIQUES:
1. Ojeda, H.; Rigal, P.; Mikolajczak, M.; Samson, A.; Pages, B.; Schneider, R.; Archambault, G.; Caille, S.;
Escudier, Jl. Raisins verts: de la rcolte la transformation. Application llaboration de verjus. In: Le
Progrs Agricole et viticole, 2007, 8.
2. , ..; , ..; , ..; , ..; , .. -
. B: . . ,
2002, 3, . 28-30. .
3. Iorga, I.; Achimova, T.; Golubi, R.; Fiodorov, S.; Nojac, E.; Vladicescu, M. Alternative de valorificare a
strugurilor de soiuri Vitis Labrusca. n: Pomicultura, Viticultura i Vinificaia, 2012, nr. 2 [38], p. 23-24.
4. Iorga, E.; Achimova T.; Golubi R. Natural acidulants from grape. In: Technical University of Moldova.
Proceedings of the International Conference Modern Technologies in the Food Industry-2014 (2014,
Chisinau, 16-18 october). Chiinu: S. n., Bons Offices, 2012, p. 210-215.
5. Sabir, A.; Kafkas, E.; Tangolar, S. Distribution of major sugars, acids and total phenols in juice of five
grapevine (Vitis spp.) cultivars at different stages of berry development, Spanish Journal of Agricultural
Research 2010, 8(2), 425-433
6. Ribereau, Gayon J.; Peynod, E. Science et technique de la vigne, Biologie de la vigne, tome 1. Dunod, Paris,
1971.
PROPRIETILE BIOMETRICE, FIZICO-CHIMICE I TEHNOLOGII DE PRELUCRARE A
LEGUMINOASELOR DE SELECIE AUTOHTON
Linda L., Caragia V., Sarandi T., Odobescu L., Karelina M., Institutul tiinifico-Practic de
Horticultur i Tehnologii Alimentare, Laboratorul Tehnologia Produselor Alimentare
It is well known prominent role of legumes in the human diet. According to the economic importance of
legumes are second after cereals. The seeds of legumes are a component oldest in the rate of food all the time
and almost worldwide. Legume seeds are rich in protein and simultaneously have a high content of starch,
minerals (with a predominance of phosphorus and potassium), vitamins (especially B group and PP).
Key words: leguminous crops, vegetable protein, processing technology, canned nutritional value.
INTRODUCERE
Seminele uscate i decojite de leguminoase mature, n practica comercial i n cea culinar fac parte
dintr-un grup special. n cea mai mare parte din rata alimentar proteinele sunt un ingredient foarte important. La
nivel mondial leguminoasele ocupa un loc important n asigurarea populaiei cu proteine. Buctria naional
moldoveneasca este prezentat n mod tradiional de ctre preparatele din culturi leguminoase. Astfel de produse

68

tradiionale sunt considerate o prioritate de recuperare a sntii populaiei, n special ele sunt utilizate n
alimentaia vegetarian i n perioada de post [1].
n plus, culturile leguminoase sunt importante n asolamentul de culturi, mbogind mult solul cu azot.
Conform datelor statistice, printre culturile leguminoase, cultivate n republic, predomin fasolea i
mazrea. n condiiile agro-climaterice ale Moldovei culturile leguminoase asigura o recolt stabil de 1,52,9
t/ha.
Scopul cercetrii l constituie studierea proprietilor biometrice, compoziia fizico-chimic i
diversificarea sortimentului de conserve cu coninut sporit de proteine vegetale pentru fabricarea lor n industria
de procesare. Sunt prezentate rezultatele cercetrilor culturilor leguminoase a seleciei autohtone a diferitor
soiuri, este identificat sortimentul de conserve pe baz de culturi leguminoase, sunt stabilii indicii de calitate a
conservelor, este elaborat proiectul standard unde se include tehnologia de prelucrare a conservelor. Cercetrile
au fost efectuate din sfera bugetar i transfer tehnologic.
METODE DE CERCETARE
Proprietile biometrice a leguminoaselor s-au efectuat n conformitate cu Indicaiile metodice privind
testarea soiurilor noi de materie prim agricol pentru utilizare n industria de prelucrare [2, 3]. Determinarea
caracteristicilor fizico-chimice a leguminoaselor i a produselor finite sunt analizate conform metodelor
standardizate: fracia masic a substanelor uscate conform GOST 28567-90; lipidele conform GOST 8756.2189; zaharurile (glucoz, fructoz, zaharoz, amidon) conform GOST 8756.13-87 (metoda Bertran sau metoda
cromatografic a lichidelor); proteinele conform GOST 23327 98 (Kjelidahl), cenua conform GOST 25555.4
91, substanele minerale, elementele toxice prin metoda de absorbie atomic.
REZULTATELE CERCETRII
Caracteristicile biometrice i fizico-chimice a culturilor leguminoase
n continuare sunt prezentate rezultatele analizelor biometrice i fizico-chimice ale boabelor de
leguminoase, cultivate pe terenurile experimentale a Comisiei de Stat pentru testarea soiurilor de plante i
introduse n Registrul de Stat al Soiurilor de Plante din Republica Moldova.
Nut
Boabele nutului uscat sunt rotunde, cu cioc, fr desen i adncituri. Suprafaa
Icheli *
seminelor - neted. Culoarea cojii - roz-glbuie, culoarea bobului - galben
aprins. nlimea bobului 7,8 mm, diametrul 7,2 mm. Masa la 1000 boabe
262 g. Substane uscate SU 89,15%, proteine (la substana brut) 16,92%.
Coninutul de glucide (%): fructoz 0,16; glucoz 0,09; zaharoz 1,22;
amidon 38,80; celuloz 4,26; cenu 3,20. Substane minerale: (mg/100g)
- 718,8; Mg - 337,5; Na - 14,19; Ca - 120,2. (mg/kg) Fe - 84,3; Mn 34,2. Elemente toxice (mg/kg) Cd - 0,06; Cu - 10,2; Zn 42,0.
Boabele sunt rotunde cu cioc, neuniforme cu ncreituri, adncituri i dungi
ntunecate. Coaja de culoare cafenie, dur, cu desprindere grea de bob. Bobul
Botna *
tare de culoare galben aprins. Miezul de culoare cafenie. nlimea bobului
6,4 mm, diametrul 5,0 - 7,0 mm. Masa la 1000 boabe 220 g. Substane
uscate SU 90,18%, proteine (la substana brut) 16,34%. Coninutul de
glucide (%): fructoz 0,09; glucoz 0,02; zaharoz 1,16. Cota total, % la
substana uscat: amidon 31,60; celuloz 5,14; cenu 2,90. Coninutul de
minerale: mg/100g) - 706,3; Mg - 315,0; Na - 9,5; Ca - 126,21. (mg/kg)
Fe - 83,4; Mn - 35,5. Elemente toxice (mg/kg) Cu - 11,5; Zn 43,7.
Reuel *

Ceca 5 *

Boabele sunt uniforme dup form, aproape rotunde cu linii albicioase.


Culoarea coarjei este roz-glbuie. Bobul nutului este tare, fragil de culoare
galben. Miezul de culoare galben aprins, tare. Masa la 1000 boabe 247 g.
Substane uscate SU 90,80%, proteine (la substana brut) 16,11%.
Coninutul de glucide (%): fructoz 0,18; glucoz 0,11; zaharoz 1,08.
Cota total, % la substana uscat: amidon 37,36; celuloz 8,18; cenu
3,20. Coninutul de minerale: (mg/100g) 618,8; Mg 337,5; Na 6,4; Ca
127,4. (mg/kg) Fe 75,7; Mn 24,6. Elemente toxice (mg/kg) Cu 10,4;
Zn 43,2.
Bob obinuit
Bobul este mcat, acoperit cu coaj cafenie groas de form neregulat platoval, cu desprindere grea de miez. Miezul de culoare galben deschis.
Grosimea medie 6,0 mm. nlimea bobului 19,3 mm, diametrul 15,2 mm.
Masa la 1000 boabe 1145 g. Substane uscate SU 90,68%. Coninutul de
zahar total, exprimat n invert (%) 4,80. Proteine (la substana brut) 29,07%.
Cota total, % la substana uscat: amidon 45,30; cenu 3,65. Coninutul de
minerale: (mg/100g) 760,0; Mg 86,6; Na 42,1; Ca 48,1. Elemente
toxice (mg/kg) Cd 0,2; Cu 8,10; Zn 24,50.

69

Cenureasa *

Fitonisa *

Bogdan *

Linte
Bobul este rotund-plat, uniform dup diametru (5,5 - 7,0) mm, grosimea - 2 mm.
Bobul este curat, de culoare roz, bej sau verde-deschis. Miezul tare de culoare
galben-aprins. nlimea bobului 6,7 mm, diametrul 6,6 mm. Masa la 1000
boabe 710,16 g. Substane uscate SU 90,4%, proteine (la substana brut)
25,31%. Coninutul de glucide (%): fructoz 0,05; glucoz 0,12; zaharoz
0,78. Cota total, % la substana uscat: amidon 28,90; celuloz 3,55; cenu
2,17. Coninutul de minerale: (mg/100g) 512,0; Mg 187,5; Na 3,13;
Ca 250,2. (Mg/kg) Fe 97,5; Mn 12,7. Elemente toxice (mg/kg) Pb
0,84; Cd 1,8; Cu 10,2; Zn 41,8.
Fasole de Lima
Bobul - alb, alungit, de form oval-plat, dup mrime neuniforme (10 - 15)
mm. Grosimea - 4,8 mm. Miezul este tare, frmicios, de culoare alb. nlimea
bobului 12,5 mm, diametrul 9,3 mm. Masa la 1000 boabe 470 g. Substane
uscate SU 86,3%, proteine (la substana brut) 15,6%. Coninutul de glucide
(%): fructoz 0,50; glucoz 1,20; zaharoz 1,30. Cota total, % la substana
uscat: amidon 34,50; celuloz 2,24; cenu 2,93. Coninutul de minerale:
(mg/100g) 505,13; Mg 500,0; Na 6,48; Ca 69,85. (mg/kg) Fe
54,6; Mn 14,56. Elemente toxice (mg/kg) Pb 0,48; Cd 0,22; Cu 8,10;
Zn 25,42.
Lintea pratului
Bobul are forma unui dinte (forma ptrat triunghiular ascuit), cu
adncitur n miez, fr desen, de culoare alb-glbuie, fragil. Grosimea medie a
bobului 4,0 mm. nlimea bobului 8,4 mm, diametrul 8,0 mm. Masa la 1000
boabe 254,5 g. Substane uscate SU 87,6%, proteine (la substana brut)
24,96%. Coninutul de glucide (%): fructoz 1,26; glucoz 1,12; zaharoz
0,43, coninutul de zahar total, exprimat n invert (%) 2,38. Cota total, % la
substana uscat: amidon 36,1; celuloz 4,90.

* Creator - Institutul de Genetic i Fiziologie a Plantelor al AM.


Dup calitate (indicii biometrici i fizico-chimici) boabele analizate a culturilor leguminoase corespund
cerinelor de procesare n industria alimentar, au coninut sporit de proteine - (16-29)%, n special bobul
obinuit, lintea, lintea ratului. Soiurile de nut prezint interes ca surs de proteine. Cultura s-a manifestat
perfect prin recolt stabil, grad nalt de tehnicitate n cultivare i recoltare.
Soiurile de culturi leguminoase cercetate se caracterizeaz prin coninut nalt de potasiu i magneziu.
Consumul a 250 g de nut, linte, fasole asigura necesitatea diurn de potasiu pentru organismul uman.
Sortimentul i schemele tehnologice de prelucrare a culturilor leguminoase, recomandri privind
utilizarea leguminoaselor n industria de prelucrare
Rezultatele biometrice i fizico-chimice a culturilor leguminoase studiate au determinat direcia de
utilizare a acestora.
Pentru fabricarea conservelor din leguminoase au fost folosite urmtoarele soiuri: nut Icheli,
Reuel, Botna, bob obinuit Ceca 5, linte Cenuereasa, fasole de Lima.
Au fost preparate urmtoarele conserve din culturi leguminoase: fasole psti, fasole n sos de tomate,
fasole cu ciuperci, fasole naturale, fasole n bulion, nut cu legume, nut cu ciuperci, nut cu carne.
Valoarea nutritiv i energetic la 100 g de produs
Denumirea materiei prime i a
Valoarea nutritiv, g
Valoarea energetic,
produselor
kcal
glucide
proteine
grsimi
Conserve din leguminoase:
- naturale
3,7-13,6
4,4-9,5
0,3-4,7
62,4- 95,1
- cu legume
8,1-17,2
5,0-9,5
0,3-3,2
64,4-118,8
- n sos de tomate
7,1-16,1
4,9-8,3
0,3-3,7
74,0- 94,9
- cu carne
8,9-10,3
6,5-13,1
3,4-7,0
99,0-149,0
- cu ciuperci
2,0-10,0
5,2-8,1
0,3-3,7
60,0- 73,7
Pateu din leguminoase:
- cu legume
16,0 - 27,2
3,9- 7,7
4,0- 7,8
121,1 - 253,0
- cu ficat
25,6 - 28,8
3,7- 8,1
4,8- 5,2
168,0 - 187,0
- vegetariene
35,0 - 38,4
5,0- 7,8
3,5- 3,8
139,0 - 202,0
n produsul final, n funcie de materia prim utilizat, coninutul de proteine constituie 3,99,5% pentru
conservele vegetale, iar pentru conservele cu carne sau ficat pn la 13,1%.

70

Schema tehnologic de fabricare a conservelor din culturi leguminoase


n figura 1 este prezentat schema tehnologic de producere a conservelor din culturi leguminoase.
Schema tehnologic include pregtirea legumelor, cu sau fr prjire, fierberea boabelor de leguminoase pn la
preparare culinar, mrunirea legumelor i boabelor de leguminoase la prepararea pateurilor. Tehnologiile sunt
adaptate pentru producerea conservelor la liniile tehnologice de fabricare a mazrii verzi, n afara sezonului de
prelucrare, cu condiia completrii lor cu utilaj necesar adugtor. Elementele tehnologiilor elaborate sunt protejate
prin brevetele de invenie a Republicii Moldova [4, 5, 6, 7, 8, 9, 10, 11, 12].
ceap

morcov

separarea

sortarea

splarea

sortarea, inspectarea

curirea

inspectarea

splarea

tierea

leguminoase

splarea
macerarea

tierea
prjirea

fierberea
rcirea

ulei (filtrarea, clirea)

separarea uleiului
amestecarea componenilor

cernerea

ambalarea

sare, zahr,
mirodenii

ermetizarea
sterilizarea
depozitarea

Fig.1. Schema tehnologic de producere a conservelor din culturi leguminoase


n figura de mai jos sunt prezentate mostre experimentale a produselor conservate din culturi
leguminoase. (1 fasole psti, 2 fasole n sos de tomate, 3 - fasole cu ciuperci, 4 fasole naturale, 5 fasole
n bulion, 6 - nut cu legume, 7 nut cu ciuperci, 8 nut cu carne).

Fig. 2 Mostre de conserve fabricate din culturi leguminoase.


CONCLUZII:
1. Au fost determinate proprietile biometrice i fizico-chimice a culturilor leguminoase i s-a stabilit c
culturile leguminoase cercetate corespund standardelor naionale i anume: nutul corespunde cu GOST 875876, lintea - GOST 7066-77, fasole de Lima - GOST 7758-75.
2. Au fost fabricate mostre de conserve din culturi leguminoase i anume: fasole psti, fasole n sos de tomate,
fasole cu ciuperci, fasole naturale, fasole n bulion, nut cu legume, nut cu ciuperci, nut cu carne.
3. A fost elaborat schema tehnologic de producere a conservelor din culturi leguminoase cu coninut sporit de
proteine vegetale pentru fabricarea lor n industria de procesare.

71

BIBLIOGRAFIE:
1. , .; , .; , .
. : , 1991.
2. ,
. : , 2003 .
3. Indicaii metodice pentru testarea chimico-technologic a soiurilor de fructe, legume, pomioare destinate
prelucrrii industriale, aprobat de Consilium tinfic a Institutului de Cercetri tiinifice i Proiectri
Tehnologice n industria Alimentar la 28 decembrie 1999.
4. Celac, V.; Nicolaeva, D.; Linda, L.; Juc, V. Produse de producere a conservelor din nut n sos de tomate.
Brevet de inventie nr. 2443.
5. Celac, V.; Nicolaeva, D.; Linda, L.; Juc, V. Produse de producere a conservelor din nut. Brevet de inventie
nr. 2394.
6. Celac, V.; Nicolaeva, D.; Linda, L.; Juc, V. Produse de producere a conservelor de legume cu carne. Brevet de
inventie nr. 2417, 2004.04.30, BOPI, nr. 4/2004
7. Celac, V.; Nicolaeva, D.; Linda, L.; Juc, V. Produse de producere a conservelor de gustere din nut. Brevet de
inventie nr. 2470.
8. Celac,V.; Linda, L.; Iorga, E.; Juc, V. Produse de producere a cremei de nut. Brevet de inventie nr. 2471.
9. Celac,V.; Linda, L.; Nicolaeva; D.; Juc, V. Procedeu de producere a conservelor de degustare din nut, nr.
depozit a 2002 0222.Hotrre nr. 3866 din 2004.04.15.
10. Linda, L.; Sunia, F.; Iorga, E.; Sarandi, T.; Soboleva, I. Procedeu de producere a pateului din linte
(variante), nr. depozit a 2004 0034, Brevet de inventie nr. 2624.
11. Linda, L.; Celac, V.; Iorga, E.; Sunia, F.; Nicolaeva, D .Procedeu de producere a pateului din leguminoase,
Brevet de inventie nr. 2623.
12. Linda, L.; Celac, V.; Sunia, F.; Stasiuc, S.; Nojac, E.; Juc, V. Procedeu de producere a pateului din linte cu
ficat. Brevet de inventie nr. 2660.
Cercetrile au fost efectuate n cadrul Proiectului Instituional 11.817.04.32A Tehnologii inovaionale de
prelucrare a materiei prime agricole, origine vegetal i animalier, anii 2011-2014.
PRODUCTIVITATEA CULTURILOR AGRICOLE LA APLICAREA NGRMINTELOR
MINERALE
Lungu Vasile, dr. n t. agricole, conf. univ., Institutul de Pedologie, Agrochimie i Protecie a Solului
Nicolae Dimo.
In the article are including systematic data on crop increases resulting from the application of mineral
fertilizers in the experience of field soil gray forest and levigated chernozem in the village Ivancea, Orhei and
carbonated chernozem v. Grigorievca , Causeni district.
Key words: nitrogen, phosphate, fertilizer, nutrient regime, harvest, sol.
INTRODUCERE
n prezent n Republica Moldova fr aplicarea ngrmintelor se poate de obinut doar 26 q/ha gru de
toamn, 33 q/ha porumb pentru boabe i 16 q/ha semine floarea soarelui. Potenialul de recolt a precipitaiilor
atmosferice este realizat numai n proporie de 5060%. Acest potenial poate fi valorificat pe deplin din contul
ridicrii eficacitii agronomice a aplicrii ngrmintelor, sporirii fertilitii solului i implementrii
tehnologiilor moderne de cultivare a plantelor agricole. Aplicarea sistematic i corect a ngrmintelor
minerale n agricultura Republicii Moldova pot asigura majorarea recoltelor cu 30-45%, iar pe soluri cu deficit
acut de elemente nutritive (n deosebi fosfor) acest adaos poate fi de 1,5-2 ori mai ridicat. Rolul ngrmintelor
crete considerabil n condiiile schimbrilor climatice deoarece ele reduc consumul de ap la formarea recoltelor
cu 20-25%.
MATERIALELE I METODELE DE CERCETARE
Pentru cercetare au fost generalizate i sistematizate datele privind sporurile de recolt i indicii
economici ai aplicrii ngrmintelor minerale, indicii agrochimici din anii 2011-2014 obinute pe sol cenuiu
de pdure i cernoziom levigat din staiunile de lung durat din comuna Ivancea, r-nul Orhei i cernoziom
carbonatic din comuna Grigorievca, r-nul Cueni.
REZULTATELE TIINIFICE ALE CERCETRILOR
Condiiile de umiditate n perioada efecturii cercetrilor sunt diferite. Din 4 ani de cercetare pe
staiunea Ivancea, 2 ani au fost relativ secetoi 2012 i 2014, cu un deficit de umiditate de 8-21% fa de media
multianual. Aproape de norm a fost anul 2011 i cu 15% peste norm, anul 2013. Pe cernoziomul carbonatic,
staiunea Grigorievca, condiiile de umiditate au fost relativ mai favorabile pentru majoritatea culturilor de cmp.
Aici s-a nregistrat 2 ani secetoi (2012 i 2014) i 2 ani cu suma de precipitaii cu 37-47% peste norm. n
perioada iunieaugust doar anul 2013 a fost fr deficit de umiditate pentru ambele staiuni. Dup temperatura
aerului atmosferic anii agricoli au fost aproape la nivelul mediei multianuale, excepie fiind temperaturile cu 2,22,4C mai ridicate din lunile iulie-august a anilor 2012 i 2014.

72

Tabelul 1. Recolta culturilor de cmp pe sol cenuiu de pdure, media 2011-2014

Nr.
var.

0
1
2
3
4
5
6
7
8
9
10

Variantele
Azot, kg/ha
P2O5
mg/
Orz,
Gru,
100
FloareaPoru
g sol
soarelui,
mb,

120
120
120
120
120
120
0
60
180
240

Martor nefertilizat
60
2,0
60
2,5
60
3,0
60
3,5
60
4,0
60
4,5
0
3,5
0
3,5
30
3,5
45
3,5

K2O
doza,
kg/ha

60
60
60
60
60
60
60
60
60
60

Gru de
toamn
Rec Spor
olta, ,q/ha
q/ha
23,8
37,2 13,4
37,4 13,6
38,2 14,4
38,1 14,4
38,5 15,7
39,9 16,1
25,2
1,4
33,4
9,6
40,3 16,5
39,2 15,4

Porumb boabe
Rec
olta,
q/ha
33,6
46,6
46,3
50,8
49,9
48,0
49,6
37,6
40,4
48,6
47,4

Spor,q/ha

13,0
12,7
17,2
16,3
14,4
16,0
3,1
6,8
15,0
13,8

Cultura
Floareasoarelui
Rec Spor
olta, ,q/ha
q/ha
13,9
17,0
3,1
19,2
5,3
19,3
5,4
18,9
5,0
19,6
5,7
18,0
4,1
14,4
0,5
18,3
4,4
19,5
5,6
19,6
5,7

Fasole
boabe
Rec Spor
olta,
,q/
q/ha
ha
12,2
13,6
1,4
14,0
1,8
14,2
2,0
14,0
1,8
13,7
1,5
14,1
1,9
12,4
0,2
13,5
1,3
13,8
1,6
14,0
1,8

Orz de
toamn
Rec Spor
olta, ,q/ha
q/ha
30,6
44,0 13,4
43,8 13,2
44,4 13,8
47,8 17,2
49,6 19,0
45,1 14,5
31,1
0.5
40,3
9,7
45,9 15,3
44,8 14,2

Recolta medie a grului de toamn pe fond nefertilizat a constituit 23,8 q/ha pe sol cenuiu de pdure,
22,5 pe cernoziom levigat i 17,9 q/ha pe cernoziom carbonatic (tab.1, 2, 3). Fondurile de nutriie mineral
natural au asigurat n aceti ani o recolt de gru de toamn de 14,428,5 q/ha. Variaia semnificativ a recoltei
grului de toamn pe variantele nefertilizate au determinat o oscilaie substanial a sporurilor de recolt obinute
pe variantele fertilizate. Pe fondurile de fosfor pe sol cenuiu de pdure sporul de recolt a variat de la de 9,2
q/ha n 2012 (an secetos) pn 18,2 q/ha n 2013 (an umed), iar pe cele cu azot respectiv de la 6,0 q/ha pn 21,2
q/ha, recolta medie fiind de 37-39 q/ha la nivelul de 2,5-3,5 mg /100 g. sol pentru fosfor i la N120 pentru azot.
Pe cernoziom levigat intervalul sporului obinut este de 6,5-18,8 q/ha pentru nivelurile cu fosfor i de
13,218,5 q/ha pentru variantele cu azot. Sporul mediu este de 16,5 q/ha la P 2,5 pentru fosfor i la N120 pentru
azot. O situaie mai puin favorabil s-a nregistrat pe cernoziomul carbonatic. Pe acest tip de sol sporul de
recolt a variat de la de 3,6 q/ha n 2012 (an secetos) pn 11,2 q/ha n 2011 (an umed) pe fondurile de fosfor, iar
pe cele cu azot, respectiv de la 2,6 q/ha pn 10,5 q/ha. Sporul mijlociu fiind 4,7 q/ha la nivelul de 2,5 mg /100
g. sol pentru fosfor i la 120 kg de azot. Pe variantele nefertilizate a solului cenuiu de pdure porumbul a
realizat o recolt de la 27,9 q/ha n 2012 ( an cu deficit de umiditate) pn la 39,2 q/ha n 2014 (an favorabil
dup umiditate). Media fiind de 33,6 q/ha.
Pe variantele nefertilizate a solului cenuiu de pdure porumbul a realizat o recolt de la 27,9 q/ha n
2012 (an cu deficit de umiditate) pn la 39,2 q/ha n 2014 (an favorabil dup umiditate). Media fiind de 33,6
q/ha. Pe cernoziom levigat recolta medie obinut pe martor a fost de cca 40,1 q/ha. Pe variantele nefertilizate a
cernoziomului carbonatic s-a obinut 21,3 q/ha (tab.1, 2, 3). Variaia sporurilor de recolt pe sol cenuiu de
pdure a fost de la 5,6 q/ha pn la 24,4 q/ha pe fondurile de fosfor cu 120 kg/ha de azot i de la 2,3 pn la 25,4
q/ha pe variantele cu azot. Media pe 2011-2014 constituind 6,8-15,0 q/ha.

Nr
.

1
2
3
4
5
6
7
8
9

Tabelul 2. Recolta culturilor de cmp pe cernoziom levigat, Ivancea, media 2011-2014


Variantele
Cultura
Gru de
Porumb
Floarea
Orz de
Azot, kg/ha
toamn
boabe
soarelui
toamn
K2 O
Gru
Legum P2 O5
Doz
de
in sol,
Fl.
ia,
toamn
Spo
Spo
Spo
Spo
mg/1
Soar
noase
Recolt
Recolt
Recolt
Recolt
gk/h
,
r,
r,
r,
r,
00 g
e-lui, (mazr
a, q/ha
a, q/ha
a, q/ha
a, q/ha
a
porum
q/ha
q/ha
q/ha
q/ha
orz
e,
b
fasole)
boabe
Martor
1,0
0
22,5
40,1
17,5
21,2
120
45
30
1,0
60
29,0
6,5
51,4
11,3
20,0
2,5
27,8
6,6
120
45
30
1,5
60
33,2
10,7
57,0
16,9
21,0
3,5
33,1
11,9
120
45
30
2,5
60
39,0
16,5
60,6
20,5
24,8
7,3
35,2
14,0
120
45
30
3,5
60
41,3
18,8
60,9
20,8
26,7
9,2
35,0
13,8
0
0
0
3,0
60
30,2
7,7
50,7
10,6
22,5
5,0
27,1
5,9
30
30
30
3,0
60
35,7
13,2
55,7
15,6
24,3
6,8
30,7
9,5
60
45
45
3,0
60
38,1
15,6
62,0
21,9
26,5
9,0
36,8
15,6
90
60
60
3,0
60
40,9
18,4
60,9
20,8
26,8
9,3
35,7
14,5

73

Pe cernoziom levigat s-a obinut 11,3-23,8 q/ha pe variantele cu fosfor pe fond de 120 kg/ha de azot i
15,6 - 0,8 q/ha pe variantele cu norme crescnde 74 de azot. Sporurile de recolt de porumb boabe pe cernoziom
carbonatic au variat ntre 3,3 q/ha i 12,7 q/ha pe parcelele cu fosfor i de la 3,5 q/ha pn la 16,3 q/ha pe
variantele fertilizate cu azot. Media fiind 4,1-8,7 q/ha.
Tabelul 3. Recolta culturilor de cmp pe cernoziom carbonatic, Grigorievca, medie 2011-2014

Nr

1
2
3
4
5
6
7
8
9

Variant
Azot, kg/ha
P2O5
mg/
Orz,
Gru,
100
Poru Mazre
g sol
mb,

120
120
120
120
0
60
90
120

Martor nefertilizat
60
1,0
60
1,5
60
2,5
60
3,5
0
3,5
60
3,5
90
3,5
120
3,5

K2O
doza,
kg/ha

60
60
60
60
60
60
60
60

Gru de
toamn
Rec
Spor
olta, q/ha
q/ha
17,9
22,6
4,3
23,1
4,7
21,9
5,2
21,6
4,2
21,1
1,1
19,9
5,2
21,9
2,0
22,6
4,0

Porumb boabe
Rec
olta,
q/ha
21,3
24,4
27,7
28,6
27,8
21,0
29,8
26,5
26,6

Sporq/ha

3,1
6,4
7,3
6,5
-0,3
8,5
5,2
5,3

Cultura
Floareasoarelui
Rec
Spor
olta,
q/ha
q/ha
9,8
12,5
2,7
11,8
1,9
13,0
3,2
13,2
3,4
11,9
2,0
13,7
3,8
12,6
2,8
12,4
2,5

Mazre
boabe
Rec Spor
olta,
q/
q/ha
ha
13,6
13,7
0,1
13,8
0,2
13,7
0,1
13,7
0,1
14,1
0,5
14,1
0,5
14,1
0,5
14,0
0,4

Orz de
toamn
Rec
Spor
olta,
q/ha
q/ha
13,9
17,5
3,5
16,7
2,8
19,3
5,4
19,6
5,7
16,2
2,2
22,5
8,6
19,7
5,8
19,5
5,6

Recolta de floarea soarelui pe martor a variat de la 4,3 q/ha pn la 21,4 q/ha pe sol cenuiu de pdure,
de la 14,2 q/ha n 2012 (an secetos) pn la 19,3 q/ha n 2013 (an cu precipitaii sporite) pe cernoziom levigat i
de la 6,9 pn la 15,0 q/ha pe cel carbonatic. Media recoltelor pe soluri a constituit respectiv: 13,9 17,5 i 9,8
q/ha. Pe sol cenuiu de pdure pentru fondurile de fosfor sporurile de recolt au fost de cca 3,1 - 5,3 q/ha, iar
pentru variantele cu azot, ele constituiau 4,4-5,8 q/ha. Sporurile de recolt pe cernoziom levigat pentru parcelele
cu fosfor au fost de la 2,5 q/ha pn la 7,3 q/ha, iar pentru cele cu azot au constituit 6,8 -9,3 q/ha. Pe cernoziom
carbonatic sporurile nregistrate au fost de 1,9-3,4 q/ha pe variantele cu fosfor i de 2,2-3,8 q/ha pe cele cu azot.
Fasola boabe a realizat pe fondurile naturale o recolt de la 6,8 q/ha (anul secetos 2012) pn la 11,9
q/ha pe sol cenuiu de pdure. Variaia sporurilor de recolt de fasole boabe pe sol cenuiu de pdure a fost de la
1,4 q/ha pn la 2,0 q/ha pe toate variantele studiate. Pe cernoziom carbonatic mazrea boabe a dat rezultate doar
n anul 2012 pe cmpul 2 al staionarului. Sporul de recolt a fost de 0,1q - 0,2 q/ha pe variantele cu fosfor i de
0,4-0,6 q/ha pe cele cu azot. Pe cernoziom levigat culturi boboase nu s-au cultivat.
Pe sol ceniiu de pdure orzul de toamn s-a cultivat doar n 2013 n loc de porumb boabe. Recolta pe
martor a fost de 30,6 q/ha. Variaia sporurilor de recolt de orz de toamn de la aplicarea ngrmintelor
minerale pe sol cenuiu de pdure a fost de la 43% fa de martor pn la 62% pe fondurile de fosfor i de la
32% pn la 50% pe variantele cu azot. Pe cernoziom carbonatic sporurile recoltei orzului de toamn nregistrate
au fost de 2,8-5,4 q/ha pe variantele cu fosfor i de 5,1-8,1 q/ha pe cele de azot.
Conform rezultatelor obinute putem afirma, c ngrmintele minerale au avut o influen major
asupra productivitii culturilor din asolament. Cel mai bine a reacionat la fertilizare grul de toamn i
porumbul boabe, n deosebi, n anii favorabili dup umiditate pe sol cenuiu de pdure i pe cernoziom levigat.
Leguminoasele boabe i floarea soarelui au o reacie mai lent la ngrminte fa de celelalte culturi din
asolament. Cernoziomul carbonatic a acionat mai slab la fertilizare n comparaie cu celelalte soluri din studiu.
BIBLIOGRAFIE:
1. Recomandri privind aplicarea ngrmintelor. Chiinu, 2012.


, .., , , ,
.., , , .., , .. , , .., .
In this article is reflectend the productivity of seed plants and especially the variability of double
flowering, indicators of plaidy, sterility and seed weight in stressful conditions of high temperature and field
conditions in the breeding materials of different genetic origin.
Key words: apozigotiya, testes, ploidy, cell, lines, conditions, stress, beet.

,
()
Beta L. , Corollinae: Beta
lomatogona (2n = 36), B. trigina (2n = 54), B. corolliflora (2n = 18) B. intermedia (2n = 36) [6, 13, 14].

74

, ,
[2].
, :
[3]; Beta L. [1].

. ,
[11]. ,

, ,
[12] .

,

. ,
:
, [4, 5].
2009 . .
150 .
- [10]. , - -
+380 +510.
,
(1)
50% [9].
20%.

.
,
, .

, ,

-
(1) (4).

2014 . -
.
(Lp / M-4 , Sv / M -9 - 1)
(12-38-82-5 , 12-38-109-5 - 4), ,
, .
2013 .
, ,
. ,
2014 . [10].
:

,
-
Lp/M-4
50
50
Sv/M -9
50
50
12-38-82-5
50
50
12-38-109-5
50
50
,
Partec
[8].

.. [7].
,
(-0 , -1 -2 ) [15].

,
,
(50,100,200), , 19,5% 26,0%,

75

6,0%.
, . 1,

(88,0%; 96,0%),
- 84,0%; 96,0%.
1.
1 4, , Partec
-

*, %

2
,2,4
2,4,8

1/**
42
2,4
73,2
19,5
4,9
Lp/M-4
1/
50
6,0
88,0
6,0
0
1/
50
8,0
66,0
26,0
0
Sv/M -9
1/
50
4,0
66,0
22,0
6,0
4/
50
0
84,0
12,0
4,0
12-38-82-5
4/
50
0
88,0
6,0
6,0
4/
50
0
96,0
4,0
0
12-38-109-5
4/
50
4,0
96,0
0
0
*
Partec.
** - -
2
Lp/M-4 8,3 12,5%,
12-38-109-5 16,6 32,7%.
, ,
,
.
, ,


(. 1).
1.


.


. , -0
28,2% 57,1% 23,4% 46,8% - .
2.

*,
-

%
, %

-0 -1

** , .

1 / ***
91,7
8,3
57,1
37,1
5,7
1,1-17,7
Lp/M-4
1 /
87,5
12,5
46,8
40,4
12,8
0,7-22,5
1 /
74,5
25,5
28,2
43,5
28,3
0,1-8,2
Sv/M -9
1 /
78,7
21,3
23,4
51,1
25,5
1,1-20,3
4 /
97,9
2,1
40,4
31,9
27,7
0,2-14,3
12-38-82-5
4 /
81,6
18,4
42,9
28,6
28,6
1,0-57,1
4 /
83,3
16,6
46,8
10,6
42,6
0,6-31,2
12-38-109-5
4 /
67,3
32,7
26,5
14,3
59,2
5,0-26,4
* - , -

76

** -2 ,

*** - -
(4)
(.
2). 2
.
2,
. 12-3882-5
57,1 . .
0,2 14,3 .
( 0,1 8,2 .) Sv/M-9
.

, .
, - , ,

.
:
,

,
.
,
.
,
,

.
:
1. , .. Beta
vulgaris L./ .. // Beta. , ,
, ; , . : , 2010, c. 504-513.
2. , .. Beta . / .. . B: .
. . . . , 2010, c.
295-297.
3. , .
. B: Verbesserung der Keimfahigkeit monokarper, poliploider Zuckerruben durch genetsche,
zuchterische und aufbereitungstechnische Methoden sowie Zuchtung auf Beregnungseigung bei Zuckerruben
// Akademie der landwirt schaftwissenschaften der deutschendemokratischen republic, 1976, c. 44-93.
4. , .. . / .. . B: :
: . . . , 1994, c. 106-108.
5. , ..
(Beta vulgaris L.)./ .. , .. , .. . B: :
. . . , 2005, c. 223-234.
6. , .. Beta (Chenopodiaceae)
.../ .. , .. , .. B:
, 2011, 1, c. 66-79.
7. , .. (, , ). / .. , ..
, ..; , . : , . , 1988, c. 168.
8. , ..
Partec./ .., .., ..
. B: . , 2006.
9. , .. ./ .. , .. , .. . B:
, 2010, 8, c. 19-22.
10. , .. O
. / .. , .. , .. // . , 2014, c. 21.
11. , ..
. / .. , .. , .. , .. . B: ,
1989, . 24, 3, c. 39-44.

77

12. , .. - . / .. , ..
B: .
: , 1988, c. 34-38.
13.Cleij, G. Crosses between Beta intermedia Bunge and Beta vulgaris L. / G. Cleij, T.S. Bock. In: Euphytica,
1968. V. 17, p. 11-20.
14.Jassem, B. Apomixis in the genus Beta./ B. Jassem. In: Apomixis Newsletter, 1990, 19, p. 7-23.
15.Owen, F.V. Cytoplasmikaly inherited male sterility in sugar beet./ F.V. Owen. In: Agric. Res., 1945, V. 71
(10), p. 423-440.

, . . , , . . ., ,

Cuticle of Gala apple cultivar under different storage conditions. In the paper were analyzed the
changes in the structure of the cuticle and epicuticular wax deposits from apple fruit of cv. Gala (Malus
domestica Borkh.) during storage in a regular atmosphere and controlled atmosphere. It was established the
features of the formation and dynamics of micro-cracks in the cuticle at various modes of storage of the fruit.
Key words: fruit, apple, structure, cuticle, epicuticular wax, microcracks, atmosphere storage, C.

,
,
, , , [2, 4, 7, 9. 11].
. ,
, ,
.
, .
,
Curry [8]. ,
[12],
,
.



.
, , () 2 0 8590%, 4 () 3 0
92-95% 180 .
2 2
, 0


, %
0,04% CO2 21% 2
2
85-90
5% CO2 3% O2
3
92-95
3% CO2 5% O2
3
92-95
2% CO2 4% O2
3
92-95
3% CO2 3% O2
3
92-95
180 .
,
[3, 5].
3- .
,
.

,
.
,
.
, Curry [8],

. ,
.
,
. ,
, ,

78

, Roy .
(1999). ,
, , ,
(. 1).
[9].

. 1. : ;
().
17,922,21
17,062,01 (. 2).

.

. 2. : ,
; , .

.

. ,
.
,
( ).

. 3. , , .

79

,
.
,
, .
[1, 6].
,
.
(. 4).
. 4.

.



,

. ,

2% CO 2
4% O2,
(. 5).

. 5. : 5% CO2 3% O2; - 3% CO2 3% O2; - 3% CO2 5% O2; - 2% CO2 4% O2.


:

,
, .
,
,
. ,
, , .

80

:
1. , .. . ,
. : . : Ko, 1983, c. 207-214.
2. , ..; , .. Malus domestica
(Rosaceae). B: . , 1989, 74 (3), c. 328-332.
3. , .. . : , 1960. 206 .
4. , ..; , ..
. B: . . . . . , 1990, 2, . 14-21.
5. , .. - . : ,
1979. 155 .
6. Barthlott, W.; Neinhuis, C.; Cutler, D.; Ditsch, F.; Meusel, I.; Theisen, I.; Wilhelmi, H. Classification and
terminology of plant epicuticular waxes. In: Bot. j. Linn. Soc. 1998, 126, . 237-260.
7. Costic, N.; Matienco, B.; Toma, C. Anatomia comparat i ultrastructura fructului la soiuri autohtone de mr.
Chiinu, 1997. 180 p.
8. Curry, E.A. Growth-induced microcracking and repair mechanisms of fruit cuticles. In: SEM Annual
Conference: Proceedings: Contributed papers, 2009 Jun Albuquerque, United States. New Mexico, Society for
Experimental Mechanics Inc. USDA, 2009, p. 7.
9. Konarska, A. The structure of the fruit peel in two varieties of Malus domestica Borkh. (Rosaceae) before and
after storage Protoplasma, 2013 Jun, 250(3), p.701714.
10. Roy, S.; Conway, W.S.; Watada, A.E.; Sams, C.E.; Erbe, E.F.; Wergin, W.P. Changes in the ultrastructure of
the epicuticular wax and postharvest calcium uptake in apples. HortSci. 1999, 34, .121124.
11. Tessmer, M.A.; Antoniolli, L.R.; Appezzato-da-Glria, B. Cuticle of Gala and Galaxy apples cultivars
under different environmental conditions. Braz. arch. biol. technol., vol.55, no.5, Curitiba, Sept. / Oct., 2012.
12. Veraverbeke, E.A.; Lammertyn, J., Saevels, S.; Nicolai, B.M. Changes in chemical wax composition of three
different apple (Malus domestica Borkh.) cultivars during storage. In: Postharvest biol. Technol. 2001, v. 23,
p.197-208.


, , ,
Sudzucker Moldova , , , . ., -,
, , , . .,

The article is describing the results of researches in the long-term polyfactorial experiment on action
and interaction between different crop rotations, different systems of soil tillage and fertilization on some
agrophysical properties of soil fertility on the yields of sugar beet on chernozem soil from the Balti steppe. The
most efficient water utilization per each unit of the main production was established for the crop rotation with
perennial leguminous crops by using non reversible soil tillage and organo-mineral system of fertilization in the
crop rotation. The yield of sugar beet in the crop rotation without perennial leguminous crops is determined in
greater extend by the influence of systems of soil tillage and fertilization than in the crop rotation whit the
perennial leguminous crops.

, ,
,
- . ,

. , , ,
, .
,
, , . ,
, , ,
. , ,
,
.
.

2013-2014 . ,
-

81

(. , ).
, .
: - 4,3-4,5%, ph - 6,8-7,1.
: - 0,24-0,26%, 0,13-0,14%, - 1,2-1,4%.
, : 1-
1- , 2- , 3- ,
, , , ; 2 ,
, , , , , .
: 1-
, 32-35 ;
2- 32-35.; ,
: 1. ( ); 2.
- 40/, 3. - 40/+ N60P60K60.
. 260 .
.
. 2013. - 430,9 , 2014 - 288,1 .
339,2 .
.
- ;
,
.. 40 , 10.
. .

, 1,0 / () 1,38 /
( ) . . ,
(0-40 ) ( ) ,
( ) 1,23-1,3 / ( 1,27 /) 1,18-1,25 / ( 1,22
/), ( 1).
30-40 1,29-1,38 / ( 1,33 /) 1,00-1,19 / (
1,14 /) 0-10 . .
.
, , 0-10
, . , 1
1,19 /, 1,0 /,
1,25 / 1,15/, .
2. .
( , 1
2, ) ,
,
0-40 .

. ,
, .
1: , /3

(. , "", 2013 )

1 ( )
2 ( )

,
32-35
32-35
32-35
32-35

+ NPK + NPK + NPK + NPK


0 - 10
1,19
1,25
1
1,15
1,15
1,2
1,09
1,12
1,14
10 - 20
1,29
1,31
1,34
1,26
1,27
1,33
1,2
1,3
1,29
20 - 30
1,36
1,35
1,22
1,41
1,27
1,35
1,26
1,32
1,32
30 - 40
1,38
1,29
1,35
1,36
1,31
1,26
1,37
1,3
1,33
0 - 40
1,3
1,3
1,23
1,29
1,25
1,28
1,23
1,26
1,27
0 - 10
1,2
1,13
1,05
1,06
1,17
1,16
1,18
1,17
1,14
10 - 20
1,11
1,3
1,26
1,15
1,36
1,36
1,18
1,07
1,22
20 - 30
1,16
1,32
1,3
1,21
1,34
1,21
1,3
1,28
1,27
30 - 40
1,27
1,17
1,28
1,3
1,32
1,28
1,3
1,28
1,28
0 - 40
1,18
1,23
1,22
1,18
1,29
1,25
1,24
1,2
1,22

82

0-200 , 2 ,
291,4 298,8
, ( 3).
, 0-200
329,9 289,4 ,
. 0-200
,
0-100 .
0-200 , 2 ,
- 317,4 296,7
.
, 0-200
332,5 309,5 , .
, ,
, , .
0-200
0-100 .
2013 2014 ,
, , .
- 2012-2013
2013-2014 335,4 175 , .
,
. , ,
0-200 ,
, 2 , 73,5 117 ,
58,7 115,3 . 0-200
, 2 ,
108,1 108,4 , 120,4 95,9 ( 3).


.
0-200
, , 217,9
181,8 , 271,2 174,1 , . ,

, .
0-200 , 2 ,
209,3 188,3 ,
, 212,1 213,6 , . ,
,
,
, , .
0-100 0-200 ,
0-100 0-200 .
2 , 0-100 0-200

42,4 54,9%, 48,2 50,0%,
. ,
,
,
,
.
, , 0-100
0-200
49,1 56,3%, ,
54,9 47,3%, . , ,
( 100-200
,
),
. , ,
,
, .

83


, .
, .
2013
2014 430,9 288,1 , .

2 , , ,
151,1 137,7 ,
210,4 199,0 , .
, .
, 2 ,
,
137,7 131,4 , ,
- 121,6 130,2 , .
,
, .
2013-2014
2.
2 ,
(38,2 39,3 /,
) ,
(41,3 41,7 /, ).
, , ,
.

29,6 26,8 /, ,
47,0 44,0 /, . , , -
,
.
,
.
:
1. , ,
( , , 0-40 ,
1,27 /3 1,22 /3 ).
2. , ,
, ,
.
3.

- .
4. , , -

.
2: (/)
, , 2013 - 2014

2013
2014

+ NPK + NPK
46,3
49,4
45,2
45,7
30,1
33,2
33,5
37,8
38,2
41,3
39,3
41,7

84

+ NPK + NPK
39,1
50,6
32,6
50,5
20,1
43,4
21
37,5
29,6
47
26,8
44

HCPO5,
/
1,92
2,05

2: , 2013-2014

3. , 2013-2014

2013
+
NPK

2014
+
NPK

2013
+
NPK

2014
+
NPK


+
NPK


+
NPK

0-100
0-200
0-100
0-200
0-100
0-200
0-100
0-200
0-100
0-200
0-100
0-200
0-100
0-200
0-100
0-200
0-100
0-200
0-100
0-200
0-100
0-200
0-100
0-200

130,6
320,9
161,8
345,2
139,5
262
142
289,6
150,3
326,7
146,5
314,5
141
271
148,3
279
135,1
291,4
151,9
317,4
145,6
298,8
147,4
296,7


0-100


, , %
57,6
73
29
68,8
252,1
70,3
91,5
45,5
144,1
201,1
27,8
111,7
60,8
78,2
183,8
28,1
113,9
52,4
72,2
217,4
61,4
88,9
44,3
125,6
201,1
50,5
96
54,5
138,3
176,2
30,2
110,8
68,2
108,5
162,5
32,4
115,9
57,8
78,5
200,5
42,7
92,4
42,4
73,5
217,9
49,2
102,7
49,1
108,1
209,3
45,8
99,8
54,9
117
181,8
41,4
106
56,3
108,4
188,3


0-100

, /

,
,

, , %
180,1
0
180,1
6830
46,3
147,5
48,8
369,3
0
369,3
430,9
365,2
117,5
247,7
6320
49,4
127,9
50,3
365,2
117,5
247,7
134,4
53,1
81,3
4719
30,1
156,8
51,6
290,5
132,9
157,6
288,1
147,1
38,9
108,2
5055
33,2
152,2
61,3
299,8
123,3
176,5
148,9
65,6
83,3
6320
45,2
139,8
54,9
322,5
170,9
151,6
430,9
143,3
52,5
90,8
6071
45,7
132,8
43,6
325,9
117,9
208
131,9
41,2
90,7
4506
33,5
134,5
46,1
256,3
59,7
196,6
288,1
139
27,7
111,3
4886
37,8
129,2
50,8
293,1
73,9
219,2
157,2
26,5
130,7
5774
38,2
151,1
48,2
329,9
58,7
271,2
430,9
167,6
51,2
116,4
5687
41,3
137,7
54,9
332,5
120,4
212,1
140,4
53,4
87
5413
39,3
137,7
50
289,4
115,3
174,1
288,1
141,1
40,1
101
5478
41,7
131,4
47,3
309,5
95,9
213,6

, /
,
,

8002

39,1

204,6

6786

50,6

134,1

4457

20,1

221,7

4646

43,4

107

5825

32,6

178,7

6389

50,5

126,5

4847

21

230,8

5073

37,5

135,3

6229

29,6

210,4

5716

47

121,6

5336

26,8

199

5731

44

130,2

430,9

288,1

430,9

288,1

430,9

288,1

ASPECTE GENERALE PRIVIND MORFOLOGIA I STAREA CERNOZIOMULUI OBINUIT SLAB


ERODAT DIN CADRUL BAZINULUI DE RECEPIE NEGREA
Cojocaru Olesea, doctorand; cercet. t. stagiar, Cerbari Valerian, dr. hab. n agricultur., prof. univ.;
Corman Iurie., dr. conf. univ., Institutul de Pedologie, Agrochimie i Protecie a Solului Nicolae Dimo,
Universitatea Agrar de Stat din Moldova
The paper presents data on morphological composition profile of chernozems with different degrees of
erosion on the territory reception basin Negrea district Hancesti. The existing natural conditions inside each
reception basin, depending on the mode of use and intensity of denudation processes of different evolutions
determine soils profile [8, 9, 10 and 11]. Rational use of soils is a primary condition to sustainable development
of the country.
Key words: morphological structure, catchment, mold weak eroded denudaie processes.
INTRODUCERE
Cernoziomul este bogia natural principal a Republicii Moldova. Cu regret, aceast bogie se
utilizeaz iraional. Ca rezultat, n ultimii ani suprafaa solurilor erodate sa majorat semnificativ. Solurile slab
erodate totui sunt fertile, dar supuse permanent unei degradri lente, cauzat de factorii naturali i antropici [1,
2, 4, 6].
Scopul cercetrilor const n evidenierea particularitilor genetice, evaluarea modificrilor negative
ale nsuirilor solurilor bazinului de recepie Negrea n rezultatul denudaiei (eroziunii). Bazinul de recepie
Negrea este situat n cmpia Prutului de Mijloc n limitele moiei comunei Negrea, raionul Hnceti. Suprafaa
cercetat este situat n zona colinar temperat i se caracterizeaz printr-o clim moderat continental,
clduroas, semiumed. Sub aspect geologic, formaiunile care se ntlnesc n zona bazinului de recepie
Negrea s-au format n pleistogen i cuaternar. Procese de denudaie conduc la stoparea (pe teritoriile nelenite)
dezvoltrii profilului sau la deteriorarea integritii profilului solurilor prin distrugerea orizontului arabil humifer
(solurile agricole). Dac ne referim la geneza solurilor, aceasta se bazeaz pe procesele de humificare, alterare i
migrare, fiind condiionate de factori bioclimaterici i locali. Evoluia progresiv a solului ntr-un anumit regim
bioclimatic se poate petrece pn la realizarea echilibrului ecologic al ecosistemului. Bioacumularea pe solurile
arabile slab erodate, ca proces esenial al solificrii, const n acumularea substanelor organice n partea
superioar a profilului de sol, unde deja exist un orizont bioacumulativ bine dezvoltat pn la deselenirea
teritoriului. Depinde, n primul rnd, de tipul de utilizare a acestor soluri n agricultur, realizndu-se n cea mai
mare parte pe seama masei mari de rdcini a culturilor agricole [3, 5, 6, 7, 10, 11].
Condiiile de relief, cele de clim i sol (la care se adaug i influena antropic), din cmpia Prutului de
Mijloc a bazinului de recepie au declanat procese de eroziune cu consecine deosebite asupra potenialului
productiv al solurilor. Eroziunea prezent n forme variate, constituie un factor destabilizator al ecosistemului. n
linii generale, este cunoscut faptul c, sub influena acestui proces, au loc degradarea funciilor biosferice i
ecologice a solurilor [4, 6, 9, 11].
MATERIAL I METOD
Situaia n sectorul agricol din zona colinar a bazinului de recepie Negrea s-a agravat odat cu
aplicarea programului de privatizare datorit parcelrii terenurilor agricole i nerespectrii tehnologiilor de
cultivare. O experien pozitiv ns n acest sens sa realizat n domeniul colectrii, transportrii i utilizrii
gunoiului de grajd, de la hotarul satului Negrea.
n procesul efecturii studiului pedologic s-a constatat c nveliul de sol al bazinului de recepie
Negrea este o exemplificare a unitii indestructibile dintre interaciunea sol, vegetaie, mediu i om ntr-o
regiune deluroas. Vegetaia, are un rol important n protecia solurilor mpotriva eroziunii, ndeosebi n
regiunile accidentate ale cmpiei Prutului de Mijloc, deoarece aici nveliul de sol este n permanen supus
degradrii, iar procesele pedogenetice sunt ntrerupte [2, 5, 7, 8, 12].
n teren au fost amplasate i studiate cca 60 profile de sol. Din fiecare s-au recoltat probe se sol pe
orizonturi genetice. Descrierea detaliat a solurilor bazinului de recepie Negrea sa realizat n baza datelor
obinute pentru 6 profile principale de sol:1) Nr. 1 cernoziom obinuit neerodat; 2) Nr. 3 cernoziom obinuit
slab erodat; 3) Nr. 6 cernoziom obinuit moderat erodat; 4) Nr. 4 cernoziom obinuit puternic erodat; 5) Nr.
15 cernoziom cumulic izohumic; 6) Nr. 10 sol cumulic tipic.
REZULTATE I DISCUII
Fragmentarea terenurilor agricole a exclus posibilitatea practicrii unei agriculturi durabile bazat pe
tehnologii moderne de prelucrare i conservare a solului. Ca rezultat s-au majorat suprafeele culturilor
pritoare, ceea ce nu corespunde ntotdeauna cerinelor agronomice i ecologice la utilizarea terenurilor.
Relieful accidentat, ploile toreniale, cotele mici de terenuri nierbate sau mpdurite, contribuie la erodarea
solurilor [1, 2, 3, 4, 7]. Comparativ cu solurile neerodate, cele erodate au pierdut parial sau total orizonturile
genetice, caracteristice solurilor iniiale neerodate. n continuare prezentm alctuirea profilelor cernoziomurilor
bazinului de recepie Negrea cu diferit grad de erodare:
1) neerodate - AhpAhBh1Bh2BCC, grosimea profilului humifer 85-95 cm;
2) slab erodate - AhpBh1Bh2BCC, grosimea profilului humifer 70-85 cm;

3) moderat erodate Bh1pBh2BCC, grosimea profilului humifer 50-70 cm;


4) puternic erodate - BhpBCC, grosimea profilului humifer 30-50 cm;
5) foarte puternic erodate - BCC, grosimea profilului humifer 0-30 cm.
Coninutul de humus n stratul arabil al solurilor menionate variaz de la 3,0-3,5% n cele neerodate
sau slab erodate pn la mai puin de 1,00% n solurile foarte puternic erodate.
n ultimul deceniu pe teritoriul bazinului de recepie Negrea suprafaa ocupat cu culturi pritoare a
crescut considerabil, ndeosebi cu floarea soarelui i porumb pentru boabe. Creterea suprafeelor cultivate cu
culturi pritoare a dus la intensificarea eroziunii, majorarea pierderilor de substan organic din sol, n deosebi
pe terenurile cu relief accidentat. De rnd cu aceasta i lucrarea loturilor mici reprezint un obstacol considerabil
n respectarea tehnologiilor de cultivare a culturilor de cmp, ceea ce contribuie mult la intensificarea procesului
de denudaie a solurilor. Sunt frecvente nclcri a legislaiei ecologice funciare, inclusiv prin modul de lucrare a
terenurilor agricole de-a lungul pantei, de asemenea i cultivarea culturilor pritoare pe versanii bazinului de
recepie Negrea [1, 2, 5, 10, 11,12]. Ameliorarea solurilor erodate poate fi efectuat prin utilizarea unui
complex de msuri antierozionale concomitent cu introducerea n sol a gunoiului de grajd, ngrmintelor
organice verzi n cuplu cu cele chimice.
n lucrarea dat ne referim la descrierea morfologic i alctuire a profilului Nr.3. cernoziom obinuit
slab erodat (figura 1.1-1.2).
Fig.1.1. Locul amplasrii
cernoziomului obinuit slab
erodat pe suprafaa slab
nclinat (2-3) a versantului
culmei principale (partea
superioar a bazinului de
recepie).

Fig. 1.2. Alctuirea profilului Nr. 3.


Descrierea morfologic a profilului Nr. 3, cernoziom obinuit slab
erodat moderat humifer cu profil humifer moderat profund, semicarbonatic,
luto-argilos, desfundat (10.04.2013, coordonatele: latitudinea - 2819,653;
longitudinea - 4650,912).
Ahp1 (0-21 cm) - stratul recent arabil format preponderent din
materialul orizontului Bh1, adus la suprafa prin desfundare i modificat de
procesul local de pedogenez caracteristic pentru stratul arabil, ud, gri
ntunecat, luto-argilos cu coninut ridicat de nisip mijlociu i fin, bulgrosglomerular, decarbonatat, afnat prin artur de toamn, foarte poros,
mbogit cu resturi organice, trecerea n urmtorul orizont clar.
Ahp2 (21-35 cm) - stratul postarabil format ca rezultat al micorrii
adncimii arturii. Se deosebete de stratul Ahp1 numai prin structur
masiv, compactare puternic i coninut mai mic de humus i resturi
organice. n stare umed poate fi frmiat n elemente structurale compacte.
Trecerea n urmtorul orizont clar dup culoare.
Ahb (35-53cm) fostul orizont Ahp adus n adncime prin
desfundare, umed, negru, luto-argilos, structura bulgroas-nuciform,
moderat poros, compact, decarbonatat, ptruns de rdcini subiri, trecerea n
urmtorul orizont clar.
Bh2k (53-75 cm) - al doilea orizont de tranziie, umed, brun deschis,
luto-argilos, n stare umed se frm uor n bulgri i glomerule mari i
mijlocii, poros, pori mici i fini, din cauza umiditii carbonaii practic nu se
evideniaz, crotovine i guri de rdcini ai fostei plantaii de vi-de-vie
umplute cu material negru humifer, trecere n urmtorul orizont treptat.
BCk (75-100 cm) roca parental foarte slab modificat de procesul
de pedogenez cu dungi surii ale fostelor guri de rdcini recent umplute cu
material humifer, luto-argilos, structura masiv, compact, poros, pori mici i
fini, carbonai sub form de eflorescene, trecere n urmtorul orizont
treptat.

87

Ck (100-120 cm) - roca parental foarte slab modificat de procesul de pedogenez, umed, galben cu pete
albe de carbonai, luto-argilos, structura masiv, compact, poros, pori mici i fini, carbonai sub form de
bieloglasc i vinioare.
Calitatea solurilor pe terenurile agricole este influenat de procesele de eroziune, care duc la degradarea
acestora prin splarea orizontului humifer; intensificarea lor este condiionat de creterea suprafeelor de culturi
agricole pritoare i de defriarea fiilor de protecie.
CONCLUZII:
1. n scopul meninerii i sporirii fertilitii solurilor erodate este necesar ca n toate primriile rurale s se
elaboreze i implementeze programe complexe argumentate tiinific, privind protecia acestora de procesele de
eroziune.
2. Trebuie de precizat c aciunea factorilor naturali n declanarea i meninerea procesului de eroziune se
exercit ntr-o msur mai mare sau mai mic n raport cu impactul antropic.
3. Pentru obinerea recoltelor nalte pe solurile supuse eroziunii este necesar formarea unui bilan echilibrat sau
pozitiv al humusului i elementelor biofile n sol prin implementarea asolamentelor, ncorporarea n sol a
resturilor organice ale culturilor agricole, utilizarea ngrmintelor verzi i celor chimice, n primul rnd, a celor
cu fosfor.
BIBLIOGRAFIE:
1. Andrie, S. Solul parte component a mediului i obiect de studiu al Institutului Nicolae Dimo pe
parcursul a 60 ani de activitate. n: Revist tiinific, Mediul Ambiant, 2013, nr. 3(69), p. 41-47.
2. Andrie, S. Optimizarea regimurilor nutritive a solurilor i productivitatea plantelor de cultur. Chiinu: Ed.
Pontos, 2007. 374 p.
3. Bajureanu, R.; Mustea, M.; Holban, V. i al. Ghid ecologic pentru administraia public local i ceteni.
Chiinu, 2006.
4. Cerbari, V.; Leah T., i al. Sistemul informaional privind calitatea nveliului de sol al Republicii Moldova
(banca de date). Chiinu: Ed. Pontos, 2000. 86 p.
5. Cerbari, V. Practici ce in de lucrarea i protecia solului. n: Practici agricole prietenoase mediului. Chiinu,
2006, p. 36-69.
6. Cerbari, V. Condiii naturale i antropice ce provoac degradarea solului. n: Diminuarea impactului factorilor
pedoclimatici extremali asupra plantelor de cultur. Chiinu, 2008, p. 41-55.
7. Duca, Gh.; Stoleru, I.; Teleu, A. Starea factorilor de mediu din Republica Moldova. Chiinu, 2003.
8. K, . . . : , 1967. 427 .
9. Florea, N.; Blceanu, V.; Canarache, A. i al. Metodologia elaborrii studiilor pedologice. Partea III-a.
Bucureti, 1987. 226 p.
10. Mooc, M.; Stnescu, P.; Taloescu, I. Concepii actuale cu privire la fenomenul erozional i controlul
acestuia, ASAS-ICPA. Bucureti, 1978.
11. , ..; , .. . . I. , ,
. : , 1984. 351 .
12. Zagorcea, C. Optimizarea sistemelor de fertilizare n asolamente de cmp. Chiinu, 1990. 286 p.
TENDINE NOI N CREAREA I PROMOVAREA SORTIMENTULUI DE CAIS
Pntea Maria, dr. hab., cercet. principal, Institutul tiinifico-Practic de Horticultur i Tehnologii
Alimentare
New tendences in creaton and promotion of apricot assortment. In the article there are presented some
aspects of breeding of apricot culture for industrial promotion in the conditions of the Republic of Moldova.
Adaptability and ecological plasticity to changeable agroclimatic resources of new introduced and actually
created varieties remain the principal objectives of breeding works. A special attention is done to donors and
implemented varieties with characteristics such as: appearance (attractivity, red collored fruits) and firmness of
fruits, early and late ripening, medium and low vigour of trees, good level of sustainable productivity.
Key words: apricot, breeding, tendency of promotion, varieties, Republic of Moldova
INTRODUCERE
Crearea i implementarea n practic a soiurilor noi de cais, corespunztoare cerinelor moderne de
fructe este o sarcin important, mai ales, avnd n vedere schimbrile de clim i apariia pieelor externe noi. n
prezent, sunt sofisticate soiuri cu caracteristici valoroase ale fructelor, dar i pretabile la densiti mari de
plantare i pentru mecanizarea majoritii lucrrilor; sistem radicular al portaltoiului adaptabil la diferite tipuri de
soluri, n special din cele grele, specifice pentru multe teritorii ce revin caisului n cazul republicii Moldova;
rezisten genetic la ger, fluctuaii de temperaturi stresante din timpul iernii i primverii; potenial fiziologic de
echilibrare a creterii i fructificrii (1, 4, 5). nsui fructele trebuie s fie mari, foarte atractiv colorate, cu pulpa
ferm dar destul de suculent, textura fin, gust echilibrat i arom specific de cais, cu smbure ct mai mic,
detaabil de la pulp (4-6). Pentru fructele destinate procesrilor industriale este indispensabil ca ele s posede
form i mrime constant, detaarea bun a pulpei, pstrarea culorii dup fierbere, cu coninut ridicat de

88

substan uscat, zahr, pectine, macro- i microelemente etc. Pe lng adaptabilitatea i plasticitatea ecologic
nalt la condiiile pedoclimatice locale, soiurile noi trebuie s fie rezistente la bolile i duntorii principali ai
speciei, n special la Sharka i cancerul bacterian.
MATERIAL I METOD
Cercetrile experimentale au fost efectuate n coleciile naionale de cais (Staiunea Experimental
Codrul, Institutul tiinifico-Practic de Horticultur i Tehnologii Alimentare). n calitate de material biologic
pentru cercetarea comparativ s-au utilizat peste 470 soiuri i selecii introduse din principalele ri cultivatoare
de cais, precum i create n cadrul institutului. Ca portaltoi a fost folosit biotipul de zarzr MVA, schema de baz
de plantare: 5 x 4 m, n lipsa irigrii. Pentru ndeplinirea cercetrilor s-au utilizat principiile metodologice i
metodele aprobate n ameliorarea i studiul speciilor pomicole (2).
REZULTATE I DISCUII
Gama sortimentului de cais actualmente nregistrat pentru nmulire n Republica Moldova const din
20 soiuri, dintre care 9 sunt create la IPHTA, iar 11 introduse din strintate. n calitate de soiuri de perspectiv
se mai testeaz temporar n producie nc 7 soiuri (Bebeco, Big Red, Faralia, Farbaly, Litoral, Olimp,
Tirynthos), introduse din diferite arealuri de cultivare cu perioada de maturizare a fructelor timpurie, medie i
tardiv. Aproape toate soiurile sunt pretale att pentru consum proaspt, ct i pentru diferite tipuri de procesare
separat sau mpreun cu alte specii de fructe. Prin cercetrile comparative s-a stabilit c conveierul de caise
proaspete se ncadreaz n perioada: prima decad a lunii iunie a doua decad a lunii august. De notat c
datorit maturrii mai timpurii a caiselor, fa de alte specii, cnd piaa local dispune de puine fructe (cpune,
ciree, parial piersic, prun, etc.), costul normat al producerii fructelor este mai jos comparativ cu alte specii, la
care se adaug cheltuieli pentru protecia contra bolilor i duntorilor, alte cheltuieli suplimentare pentru
efectuarea procedurilor agrotehnice privind asigurarea dezvoltrii favorabile/optimale a fructelor iar preul de
realizare a fructelor mai nalt. n scopul introducerii n producie a celor mai bune soiuri de cais autohtone i
din selecia mondial, ct i pentru utilizarea n procesul de selecie a genitorilor cu caracteristici valoroase, este
necesar cercetarea genotipurilor n condiiile pedoclimaterice ale Moldovei, conform provenienei lor ecologogeografice. Astfel de cercetare, ne d posibilitatea de a determina mai corect soiurile crui grup sunt mai
adaptate la condiiile rii noastre i de a dirija corect att lucrrile de introducere ale soiurilor, conform
caracteristicilor de valoare, ct i procesul de ameliorare i de creare a soiurilor noi. Caracteristicele nfloritului
(nceputul, sfritul, durata) pentru cais au o mare nsemntate n vederea posibilitii evitrii ngheurilor de
primvar. Spre exemplu, cu ct durata nfloririi este mai ealonat i ndelungat, cu att probabilitatea evitrii
ngherii (pierderii totale ale florilor) i obinerea recoltei stabile este mai mare.
Tabelul 1. Analiza dispersional a nfloritului
nceputul
Izvorul de
variabilitate
General
Grupele
ec.-geogr.
Anii
Erori
Sfritul
General
Grup ec.-georg.
Anii
Erori
Durata
General
Grup ec.-geog.
Anii
Erori

Partea de
aciune %

Semnificaia
F tabelar
0,95 0,99 0,999
2,3
3,2
4,8

Suma
patratelor
SS
837
18,6

Gradele de
libertate
df
35
11

Patratul
mediu ms
1,69

1,2

F
calc.
3,77

808,5
9,86

2
22

40,2
0,44

97,5
1,29

901,7
-

3,4
-

5,7
-

9,6
-

1165,5
20,5
1123,4
21

35
11
2
22

1,86
561,7
0,9

6,1
97,3
2,04

1,8
571,6
-

2,3
3,4
-

3,2
5,7
-

4,8
9,6
-

47,9
2,1
31,5
14,7

35
11
2
22

0,19
15,5
0,6

0
65,0
34,9

0,29
23,3
-

2,3
3,4
-

3,2
5,7
-

4,8
9,6
-

Din datele tabelului 1este evident, c condiiile anilor au cea mai mare influen asupra nceputului,
sfritului i duratei perioadei de nflorire, partea de aciune a lor fiind respectiv de: 97,5%, 97,3% i 65%.
Deosebirea dintre grupele ecologo-geografice constituie numai 0,19-6,1%. Aceasta nseamn c grupele
cercetate sunt identice, se deosebesc puin una de alta, iar introducerea soiurilor conform acestei caracteristici
poate fi din orice grup. Notm, c cel mai timpuriu ncep nfloritul soiurile Robada,Vittilo, NJA 19, Bucuria.
Soiurile Tudor, Traian i Venus, Early blush, Orangered, precum i marea majoritate a soiurilor moldoveneti. Sa evideniat c soiurile Litoral, Mamaia, i, mai ales Olimp, Umberto, Colorao i soiul autohton Vasile Cociu

89

ncep a nflori cu 2-4 zile mai trziu dect majoritatea soiurilor luate n studiu. Gradul maximal de nflorire n
permanen s-a notat la soiurile Litoral, CR-263, Erevani,Tudor, Sulina, Sirena i Bucuria. Sfritul nfloritului,
n condiii deja mai calde are loc aproape n acelai timp pentru toate soiurile studiate. nsi durata nfloritului
att pentru soiurile introduse, ct i cele moldoveneti rar cnd depete o sptmn. Termenele de maturare a
fructelor (nceputul, sfritul) variaz slab de la an la an, att n incinta soiurilor introduse, ct i cele create n
ar. Perioada de maturare variaz la unele soiuri mult. Spre exemplu, dac soiurile Sirena, Boreana i Stark
Early Orange se caracterizeaz printr-o perioad relativ scurt de maturare a fructelor (7-8 zile), apoi la soiul
CR-263, din contra, fructele se coc ncet, pe parcursul a dou sptmni. Maturarea extratimpurie i timpurie a
caiselor mai des cultiv Bucuria, NJA-42, Kiiniovskii rannii. Ealonarea maturrii fructelor este urmat de
soiurile Early blush, Orangered, Vasile Cociu, Detskii, Moldavschii olimpie, Nadejda, alah, Krasnociochii.
Printre soiurile cu maturarea tardiv se noteaz urmtoarele: Kostiujenskii, Sirena, Raduga, Litoral, Olimp,
Farbaly, Ketch-Par. De notat c conform caracterizrii productivitii prin analiza dispersional a soiurilor
introduse i create n republic se poate conchide c deosebirea dintre grupele ecologo geografice (din diferite
ri din Europa, Asia, SUA, Canada), din care fac parte soiurile introduce este nesemnificativ, alctuind 19,5%,
iar diferena dintre ani este semnificativ la nivelul de probabilitate 0,95 sau 95%, constituind - 23,8% (tab. 2).
Astfel se poate concluziona c productivitatea soiurilor conform grupelor ecologo-geografice depinde mai mult
de condiiile climatice ale anilor i de ali factori ne analizai, ei avnd o aciune de 56,5%.
Majoritatea soiurilor cercetate se ncadreaz n grupul celor de vigoare medie (Traian, Saturn, Venus,
Sulina, Selena, Sirena,), fiind comparate cu soiurile create i omologate pentru Republica Moldova (Bucuria,
Nadejda, Costiujenskii, Raduga). Vigoarea cea mai-mare au manifestat-o soiurile Sulmona, fiind urmat de CR263, Litoral i Tudor. Ultimul posed o cretere erect foarte bine exprimat.
Tabelul 2. Caracteristicile generale ale unor soiuri i selecii de perspectiv de cais
GENOTIPUL Vigoare Rezistena Productivitatea Calitate Destinaia Capacitate
Caracteristici
de
complex la
fructe prioritar de renovare
importante
- fructe a pomilor
cretere
factorii
nefavorabili
externi.
Soiuri introduse
Cream ridge +++
+++
+++
CP, PR ++
Productivitate , calitatea
+++
fructelor. Rezisten bun
la factorii nefavorabili
abiotici locali
Orange red
+++
++
+++
+++
PR, CP ++
Calitatea fructelor,
timpurietatea maturrii
NJA 42
++
+++
++
+++
CP, PR ++
Extratimpurietatea
maturrii fructelor
Tom cot
++
++
++
+++
PR
++
Timpurietatea maturrii,
calitatea fructelor
Goldrich
+++
++
+++
++
CP, PR ++
Productivitate, calitatea
fructelor
Soiuri i selecii noi create n Republica Moldova
Vasile Cociu ++
+++
+++
+++
CP, PR ++
Productivitate , calitatea
foarte bun a fructelor la
procesare. Rezisten bun
la factorii nefavorabili
Codrean
++
+++
+++
++
CP, PR ++
Productivitate stabil ,
calitatea fructelor
N1
++
++
+++
+++
CP, PR ++
Calitatea foarte bun a
fructelor la procesare.
Rezisten complex la
factorii nefavorabili
1B26
+++
+++
+++
+++
PR, CP ++
Calitatea fructelor la
procesare
1B47
+++
++
+++
+++
PR, CP ++
Timpurietatea maturrii,
calitatea fructelor
4-5-3b
++
++
++
+++
CP, PR ++
Rezisten complex la
factorii nefavorabili

90

Tabelul 3. Analiza dispersional a productivitii


Izvorul de
variabilitate

Suma
patratelor SS

Gradele de
libertate df

Patratul
mediu ms

Partea
de aciune
%
19,5

F calc.

Semnificaia
F tabelar
0,95
0,99
2,8
4,5

0,999
General
386,5
23
Grupele ec.201,7
11
18,3
1,69
7,8
geogr.
Anii
65,6
1
65,6
23,8
6,05
4,8
9,7
19,7
Erori
119,2
11
10,8
56,5
Prin aprecierea vigorii de cretere a pomilor pn la intrarea pe rod i, n special, n timpul fructificrii
s-au evideniat soiuri cu vigoare mic, medie i mare. Cea mai mic vigoare s-a notat la soiurile Lorna, Olimp, el
fiind urmat de Roxana, Mamaia i Comandor. Comparativ cu soiurile omologate-martor de aceiai perioad de
maturare a fructelor (Detskii, Moldavschii olimpie, Nadejda, Kostiujenskii, Raduga) volumul coronelor lor (i n
special al soiului Roxana si Olimp) este aproape de dou ori mai mic. Soiurile Olimp i Comandor se deosebesc
de asemenea prin capaciti nalte de formare a formaiunilor fructifere simple scurte i de tip buchet. Asemenea
tipuri de soiuri sunt ateptate n procesul de intensificare a plantaiilor de cais i de trecere la o perioad de
exploatare a livezilor mai redus.
Cercetrile efectuate asupra caracteristicilor de baz biologice i de producie a genofondului de
perspectiv sus numit, viznd scopul general de a stabili potenialul de plasticitate ecologic i adaptibilitate
bun la condiiile locale i obinere de fructe cu caliti moderne au permis de a evidenia un ir de soiuri,
reprezentabili ca donatori de anumite caracteristici preioase (tab. 3). Aceste genotipuri pot fi utilizate att pentru
producere de fructe pentru anumite scopuri, ct i pentru utilizare n programele de ameliorare genetic i de
creare de noi soiuri de cais pentru condiiile Republicii Moldova.
CONCLUZII:
1. Sortimentul de cais actualmente nregistrat pentru cultivare n Republica Moldova parial corespunde
cerinelor pieei moderne de fructe (maturare timpurie, atractivitatea, fermitatea pulpei, etc.).
2. Tendinele noi n promovarea caisului in de lrgirea sortimentului cu soiuri de maturare uniform, ct mai
timpurie i ct mai tardiv cu conservarea calitilor performante a fructelor, n special capacitatea de
transportare la distane lungi (fermitatea pulpei) i coloraia aprins (roie, oranj) a pieliei.
3. Dintre soiurile cele mai bine adaptate la condiiile locale se pot considera: Vasile Cociu, Nadejda (soiuri
autohtone), Oranjered, Olimp (introduse), precum i o serie de hibrizi de perspectiv.
4. Pentru promovare i testarea parial n producie se utilizeaz soiurile extra timpuriu NJA-42 i a patru soiuri
tardive: Olimp i Litoral (romneti) i Faralia i Farbaly (franuzeti). Toate soiurile sus numite vor fi propuse
ca s fie utilizate ca genitori pentru diferite perioade de maturare a fructelor, precum i pentru potenialul nalt de
adaptabilitate la condiiile locale de cultivare a caisului n programele de ameliorare genetic a sortimentului
local de cais.
BIBLIOGRAFIE:
1. Catalogul soiurilor de plante al Republicii Moldova pentru anul 2015. Chiinu, 2013, p. 64-65.
2. Cociu, V.; Oprea, t. Metodele de cercetare n ameliorarea plantelor pomicole. Cluj-Napoca, 1989. 123p.
3. Isacova, M.D.; Smcov, V.K. Selecia abricosa v SSR Moldova. B: Sortoizucenie i selecia plodovh cultur.
K, 1991, c. 37-53.
4. Pntea, M. Sortimentil de cais omologat i de perspectiv. n: Cercetri n Pomicultur. Vol. I. (Institutul de
Cercetri pentru Pomicultur). Chiinu, 2002, p. 59-65.
5. Pntea, M. Cultivarea caisului. Chiinu, 2003. 56 p.
6.Piagnini, M.C.; Castelloni, L.; Squardi, S.; Bassi, D. Fruit quality evaluation on diverse apricot cultivars. In:
Aspect of applied Biology, 2013, Vol. 119, p. 131-144.
7. Souty, M.; Audergon, J.M.; Chambroy, L. Apricot, le critere de qualite. In: Larboriculture fruitiere, 1990, nr.
91, p. 16-24.
ACIUNEA DIFERITELOR TIPURI DE GUNOI DE GRAJD
ASUPRA INDICILOR AGROCHIMICI AI SOLULUI I RECOLTEI CULTURILOR DE CMP
Plmdeal Vasile, dr. n tiine agricole, conf. cercet., Rusu Alexandru, dr. hab., Bulat Ludmila,
Institutul de Pedologie, Agrochcmie i Protecie a Solului ,,Nicolae Dimo
The application of pig manure mixed with garbagecoming from different species of animals and birds in
doses that contain 340 kg N/ha increased the content of organic matter in the 0-20 cm layer by 2640 2940
kg/ha and of the mobile phosphorus by 77 92 kg/ha. Based on the specific increase of total harvest for a period
of four years, the types of manure, used in the experiments in doses equivalent by the content of nitrogen,
formed the following sequence: bovine manure 64 kg/t; pig manure 76 kg/t; mixed manure coming from
different species 118 kg/t, and poultry manure 127 kg/t of grain units.
Key words: manure, humus, phosphorus, potassium exchangeable harvest, specific spor, sol.

91

INTRODUCERE
Gunoiul de grajd constituie un ngrmnt organic natural cu valoare agronomic avansat, care se
utilizeaz n agricultur din cele mai vechi timpuri. Fiind ncorporat n sol, el contribuie la ameliorarea
proprietilor agrofizice, agrochimice i biologice care, n final, sporete productivitatea plantelor i eficacitatea
folosirii ngrmintelor chimice. Eficiena aplicrii gunoiului de grajd s-a constatat n numeroase experiene de
lung durat pe diferite soluri [2, 3, 5, 6, 8, 9, 10]. Fiind un ngrmnt universal complex compoziia gunoiului
de grajd difer n funcie de specia de animale de la care provine i de condiiile lor de ntreinere. n condiiile
social-economice actuale [1] sectorul zootehnic al rii n mare parte (92%) se afl n gospodriile populaiei
rurale. n majoritatea cazurilor se obine gunoi de grajd amestecat de la speciile de animale ntreinute n aceste
gospodrii. Compoziia acestui gunoi de grajd i aciunea lui asupra indicilor fertilitii solului este studiat
fragmentar [4, 5]. Mai puin studiate sunt i deeurile organogene obinute de la creterea porcinelor i fermelor
avicole n condiiile actuale, cnd la evacuarea gunoiului se folosete din ce n ce mai puin ap. Scopul acestei
lucrri const n studierea aciunii comparative a diferitelor tipuri de gunoi de grajd asupra indicilor agrochimici
ai solului i productivitii culturilor de cmp.
MATERIAL I METOD
Ca material de studiu au servit deeurile organogene: gunoiul de grajd amestecat, gunoiul de bovine,
gunoiul de psri i gunoiul de porcine. Cercetrile s-au efectuat n perioada 2011- 2014 la Staiunea
experimental a IPAPS Nicolae Dimo situat n com. Ivancea, r-nul Orhei. Solul experienei este reprezentat
de cernoziom levigat, luto-argilos, cu coninutul de humus 3,8-4,0%, P2O5 - 1,8 - 2,0 mg/100 g sol, K2O-27
mg/100 g sol (metoda Macighin), pH - 6,7, aciditatea hidrolitic - 2,65 me/100g sol. S-au testat dou doze de
gunoi, fiind calculate dup coninutul de azot ncorporat cu ele -170 kg i 340 kgN/ha. Schema experienei
include urmtoarele variante: 1. - martor nefertilizat; 2. - gunoi bovine 32 t/ha; 3. - gunoi bovine 64 t/ha; 4. gunoi amestecat 20 t/ha; 5. - gunoi amestecat 40 t/ha; 6. - gunoi psri 18 t/ha; 7. - gunoi psri 36 t/h;8. gunoi porcine 30 t/ha;9. - gunoi porcine 60 t/ha. Suprafaa de eviden a parcelei 120 m2. Numrul de
repetiii 4. n anii de studiu s-a cultivat: porumb boabe, mazre boabe, gru de toamn i porumb boabe.
La analiza deeurilor s-au folosit urmtoarele metode: umiditatea - GOST 26713-85; substana organic
GOST 27980-88; pH - GOST 27979-88; azot total GOST 26715-75; fosfor total GOST 26717-85; potasiu
total GOST 26718- 85. Metodele utilizate la analiza solului: humusul metoda Tiurin; N-NO3 dup
Grandval Leaju; N-NH4- GOST 26716-85; fosforul mobil prin dozarea colorimetric dup Macighin; potasiu
schimbabil dup Macighin prin fotometrie n flacr; pH-metoda poteniometric. Prelucrarea statistic a
rezultatelor obinute n cadrul investigaiilor a fost efectuat dup B.A. Dospehov [7].
REZULTATE I DISCUII
Pentru studierea comparativ a potenialului fertilizator al noilor tipuri de gunoi de grajd obinut n
condiiile actuale s-a analizat i ncorporat: gunoi de bovine, gunoi amestecat din gospodriile populaiei rurale,
gunoi de psri cu aternut i gunoi de porcine nlturat din ncperi cu ajutorul apei, cu un termen de pstrare
de 5 ani. Gunoiul de grajd utilizat (tab.1) se caracterizeaz cu o umiditate de la 37,9% pn la 73,2% n
dependen de tipul i termenul de pstrare.
Tabelul 1. Compoziia chimic a deeurilor aplicate la fondarea experienei
Componentul i unitatea Gunoi bovine
Gunoi amestecat
Gunoi psri
Gunoi porcine
de msur
Umiditate, %
66,5
60,7
73,2
37,9
Substan organic, %
17,2
21,8
16,2
14,2
Azot total, %
0,53
0,83
0,92
0,56
Fosfor total, %
0,36
0,84
1,66
2,25
Potasiu total, %
0,64
0,71
0,98
0,50
pH
8,6
8,3
7,8
7,0
Coninutul carbonului variaz de la 7,1 pn la 10,9%, a azotului total - de la 0,53 pn la 0,83-0,92%, a
fosforului total - de la 0,36 pn la 2,25%. Coninutul potasiului total variaz de la 0,50% n gunoiul de porcine
i pn la 0,71-0,98% n cel amestecat i de psri. Raportul C:N oscileaz de la 9:1 n gunoiul de psri i pn
la 16:1 n cel de bovine. Datele medii pe patru ani au demonstrat, c cu gunoiul de grajd s-au ncorporat de la
2916 kg/ha pn la 5504 kg/ha materie organic. Sporul n coninutul ei n stratul 0-20 cm este semnificativ
Tabelul 2 Influena gunoiului de grajd asupra coninutului de substane nutritive n stratul arabil a
cernoziomului levigat
Varianta

Martor
Gunoi bovine 32 t/ha
Gunoi bovine 64 t/ha
Gunoi amestecat 20 t/ha

Materie organic,%
medie
sporul fa
2011de martor
2014
%
kg/ha
3,87
3,99
0,12
2616
4,05
0,18
3960
3,91
0,04
896

92

P2O5, mg/100g sol


medie sporul fa
2011de martor
2014
mg
kg/ha
2,39
3,44
1,05
22,3
4,73
2,34
51,5
3,86
1,47
32,9

K2O, mg/100g sol


medie sporul fa
2011de martor
2014
mg kg/ha
27
32
5
106
38
11
242
30
3
67

Gunoi amestecat 40 t/ha


4,01
0,14
2940
6,04
3,65
76,7
37
10
210
Gunoi psri 18 t/ha
3,91
0,04
904
3,64
1,25
28,3
30
3
68
Gunoi psri 36 t/ha
3,99
0,12
2592
5,48
3,09
66,8
33
6
130
Gunoi porcine 30 t/ha
3,91
0,04
840
4,89
2,50
52,5
28
1
21
Gunoi porcine 60 t/ha
3,99
0,12
2640
6,59
4,20
92,4
29
2
44
DL 05,%
0,09
2180
2180
0,85
0,85
18,5
2,1
2,1
46
P, %
4,32
4,32
4,32
14,8
14,8
14,8
8,7
8,7
8,7
Aplicarea gunoiului de bovine - 0,12 % sau 2616 kg/ha (tab.2). Administrarea dozei ce coninea N 340 la
hectar, unde s-au ncorporat de la 5800 kg/ha materie organic, (cu gunoiul de psri) pn la 11000 kg/ha (cu
gunoiul de bovine) a condus la majorarea coninutului de materie organic n stratul arabil pn la 3960 kg/ha.
Acest spor n comparaie cu varianta martor a constituit 0,12% sau 2640 kg/ha la gunoiul de porcine i cel de
psri, 0,14% sau 2940 kg/ha la gunoiul amestecat i 0,18% sau 3960 kg/ha la gunoiul clasic de bovine.
La ncorporarea diferitelor tipuri de gunoi de grajd n dou doze ce conineau N 170 i N340, n sol sa
mrit coninutul substanelor nutritive. n comparaie cu varianta martor coninutul N-NH4 a crescut cu 0,07-0,08
i 0,16-0,27 mg/100 g sol sau 1,47-1,81 kg/ha la aplicarea gunoiului de porcine i a celui de psri. ncorporarea
gunoiului de bovine i a celui amestecat a mrit coninutul azotului mineral cu 0,15 - 0,17 mg/100 g sol s-au cu
3,18-3,36 kg/ha. Dublarea dozei de gunoi de grajd nu a contribuit la creterea coninutului de azot amoniacal n
comparaie cu administrarea unei doze. La administrarea dozei de N 170 sporul n coninutul azotului nitric este
semnificativ n cazul gunoiului amestecat i gunoiului de porcine, constituind 8,86 i 5,67 kg/ha. Dublarea dozei
(N340) de gunoi mrete coninutul azotului nitric: la aplicarea gunoiului de bovine cu 7,0 kg; gunoiului
amestecat cu 9,0 kg/ha, gunoiului de porcine cu 6,2 kg/ha i a gunoiului de psri cu 11,0 kg/ha. Investigaiile au
demonstrat, c sporurile n coninutul fosforului accesibil, sunt asigurate statistic. Cea mai nalt diferen fa de
varianta nefertilizat s-a constatat la aplicarea gunoiului de porcine i gunoiului amestecat. Sporul n coninutul
fosforului accesibil a constituit la gunoiul de porcine 2,50-4,20 mg/100 g sol sau 53-92 kg/ha, la gunoiul de grajd
amestecat 1,47-3,65 mg/100 g sol sau 33-77 kg/ha. La ncorporarea gunoiului de bovine i psri sporul de P 205
a constituit respectiv 22-51 kg/ha i 28-67 kg/ha. Gunoiul de grajd ncorporat pe cernoziomul levigat a schimbat
mai puin coninutul potasiului schimbabil n comparaie cu coninutul azotului i fosforului. Cea mai mare
diferen n comparaie cu varianta martor s-a nregistrat la variantele cu gunoi de bovine (106-242 kg/ha) i
gunoi amestecat (67-210 kg/ha). La variantele cu ncorporarea gunoiului de porcine sporul n coninutul
potasiului schimbabil a fost nesemnificativ (tab. 2). Aadar, din rezultatele obinute putem constata, c
ncorporarea deeurilor organogene din zootehnie a avut un efect pozitiv asupra coninutului de elemente
nutritive i semnificativ pe durata aciunii deeurilor.
Tabelul 3. Influena ngrmintelor aplicate asupra productivitii unui segment de asolament pe cernoziom
levigat , t/ha
Recolta de producie principal
Recolta total Sporul de recolt pe
pe 4 ani,
4 ani, uniti cereale
2011,
2012,
2013,
2014,
Varianta
Porumb
Mazre
Gru de
Porumb uniti cereale
tone
%
boabe
boabe
toamn
boabe
Martor
6,66
3,01
3,51
3,51
16,73
Gunoi bovine 32 t/ha
8,02
3,31
4,06
4,06
19,30
2,57
15
Gunoi bovine 64 t/ha
7,91
3,40
4,29
4,29
19,72
2,99
18
Gunoi amestecat 20
7,51
3,73
4,48
4,48
19,64
2,91
17
t/ha
Gunoi amestecat 40
8,39
3,67
4,14
4,14
20,28
3,55
21
t/ha
Gunoi psri 18 t/ha
8,30
3,32
4,64
4,64
19,64
2,91
17
Gunoi psri 36 t/ha
8,02
3,61
4,50
4,50
20,05
3,32
20
Gunoi porcine 30 t/ha
8,36
3,52
4,00
4,00
19,41
2,68
16
Gunoi porcine 60 t/ha
8,32
3,47
4,63
4,63
20,45
3,72
22
DL 05 t/ha
0,34
0,10
0,35
0,31
0,28
0,28
1,68
P, %
2,14
2,6
8,1
5,1
4,49
4,49
Tabelul 4. Indicii de calitate ai produciei principale ale plantelor cultivate pe cernoziom levigat, com. Ivancea
2011,
2012,
2013,
2014,
Sporul total
Porumb,
Mazre,
Gru de toamn
Porumb,
de protein
Varianta
coninutu coninutul
coninutul
l
proteinei, coninutul
proteinei,
coninutul
proteinei,
%
%
proteinei, %
glutenului,%
kg/ha
%
%
Martor
8,04
19,6
10,2
23,3
7,74
Gunoi bovine 32 t/ha
8,94
19,6
11,2
24,5
7,68
385
20
Gunoi bovine 64 t/ha
9,30
20,3
11,6
26,7
7,62
503
26

93

Gunoi amestecat 20
8,58
21,1
11,3
26,0
7,92
498
26
t/ha
Gunoi amestecat 40
8,70
21,4
11,3
26,5
8,34
608
32
t/ha
Gunoi psri 18 t/ha
8,58
20,1
10,0
26,5
7,26
342
18
Gunoi psri 36 t/ha
8,70
19,2
12,0
25,6
6,36
408
21
Gunoi porcine 30 t/ha
8,64
19,8
9,7
25,9
6,18
255
13
Gunoi porcine 60 t/ha
8,88
20,2
11,6
27,5
7,20
528
28
Analiznd datele medii pe patru ani, am constatat c cele mai nalte recolte s-au obinut n primul i al
patrulea an, cnd condiiile meteorologice au fost mai adecvate cerinelor plantelor, inclusiv cu mai multe
precipitaii. Cea mai nalt recolt n medie pe patru ani s-a format la variantele cu aplicarea gunoiului de porcine
i gunoiului amestecat n doza echivalent N340 kg/ha (tab.3). Sporul de recolt a alctuit 3,72- 3,55 t/ha,
cereale convenionale fiind urmat de variantele cu gunoi de psri i de bovine, unde sporul de recolt a
constituit 3,32 i 2,99 t/ha cereale convenionale.
ngrmintele organice aplicate au avut o aciune pozitiv i asupra calitii produciei de baz. Cea
mai mare cantitate de protein brut a fost obinut n primul an de aciune a gunoiului de grajd. n total pe patru
ani cel mai nalt spor de protein (608 kg/ha, sau 32,0%) s-a cptat la aplicarea gunoiului de grajd amestecat n
doz de 40 t/ha, echivalent cu N340 (tab.4). Fiind urmat de gunoiul de porcine i bovine, unde sporul de protein
brut a alctuit corespunztor 528 i 503 kg/ha. Cel mai mic spor de protein brut a fost obinut la aplicarea
gunoiului de psri n medie pe variantele studiate - 375 kg/ha, sau 20%.
Aplicarea gunoiului de grajd a creat condiii favorabile i pentru sintetizarea glutenului n boabele de
gru de toamn. Coninutul glutenului n boabele de gru obinut de pe varianta martor a constituit - 23,3%, n
cazul gunoiului de grajd 26,5%. La ncorporarea ngrmintelor organice coninutul glutenului a crescut
proporional cu doza ncorporat, cu excepia gunoiului de psri. La ncorporarea dozei echivalente cu N 170
coninutul de gluten a crescut n comparaie cu martorul cu 1,2-3,2% n dependen de tipul de gunoi de grajd.
Dublarea dozei de gunoi de grajd a condus la creterea mai mare a coninutului de gluten cu 2,3-4,2% n
comparaie cu varianta martor. Analiznd rezultatele obinute la aprecierea exportului elementelor nutritive
observm, c la variantele fertilizate exportul din sol a elementelor biofile cu plantele cultivate a fost mai mare
dect la martor. Cel mai nalt export de elemente nutritive primare a avut loc la aplicarea gunoiului de grajd
amestecat. Exportul de elemente primare aici n comparaie cu varianta martor a crescut: la azot cu 127-153
kg/ha, la fosfor cu 40-41 kg/ha i la potasiu cu 65-91 kg/ha. Dup coeficientul de asimilare a elementelor
primare pe primul loc se plaseaz azotul dup care urmeaz potasiu i fosforul. Coeficientul de folosire a
azotului din ngrminte variaz de la 33 pn la 76%, a potasiului de la 5 pn 43% i a fosforului de la 4 pn
24%. Cel mai nalt coeficient de asimilare a elementelor primare din ngrminte s-a constatat la aplicarea
gunoiului de grajd amestecat: la azot 46-76%, la fosfor 12-24% la potasiu 23-24%. Fiind urmat de gunoiul de
porcine, psri i bovine.
Sporul de producie ce s-a format la variantele fertilizate cu gunoi de grajd pe parcursul a patru ani s-a
calculat i valoarea lor bneasc la nivelul preurilor anului 2014. Cu cel mai mare spor de recolt i valoare
bneasc, n cadrul variantelor experimentate, s-au evideniat variantele cu doza de N340 a gunoiului de porcine, a
gunoiului amestecat i celui de psri. Dar i cheltuielile pentru folosirea gunoiului menionat au fost destul de
nalte. Cele mai mari venituri de 6271 i 6809 lei/ha n patru ani s-a obinut la ncorporarea a 20 t/ha gunoi
amestecat i 18 t/ha gunoi de psri. Rentabilitatea cheltuielilor la aceste variante se estimeaz la 196 i 236%.
Fiecare leu cheltuit la aplicarea acestor procedee s-a recuperat cu 1,96 i 2,36 lei. Cu un profit bun de 4217 lei/ha
s-a caracterizat i varianta cu aplicarea a 36 t/ha gunoi de psri. Rentabilitatea acestui procedeu de fertilizare
alctuind 73%. Cu alte cuvinte, fiecare leu cheltuit a adus venit de 0,73 lei. Un profit semnificativ de 3069 i
3257 lei/ha s-a obinut i la variantele cu aplicarea gunoiului amestecat 40 t/ha i gunoiului de porcine n doz 30
t/ha. Rentabilitatea cheltuielilor alctuind 48-68%, s-au fiecare leu cheltuit a adus un venit de 0,48-0,68 lei.
CONCLUZII:
1. Rezultatele obinute au demonstrat, c gunoiul de grajd de diferite tipuri a majorat cantitatea de materie
organic humificat n sol cu 2640-3960 kg/ha. Aplicarea gunoiului de porcine i gunoiului amestecat de la
diferite specii de animale i psri din ogrzile populaiei rurale au asigurat un spor semnificativ de 77-92 kg/ha
fosfor mobil i 130-242 kg/ha de potasiu schimbabil.
2. Gunoiul de bovine cu aternut (convenional) aplicat n doz de 32-64 t/ha a format n medie pe patru ani un
spor specific de recolt cuprins ntre 47-80 kg uniti cereale pe 1 ton de ngrmnt, s-au n medie 64 kg/t.
Gunoiul de grajd amestecat, aplicat n doz de 20-40 t/ha a asigurat un spor specific de recolt cuprins ntre 89146 kg pe 1 ton de ngrmnt s-au n medie 118 kg/ton n comparaie cu 64 kg/t obinut de la gunoiul de
bovine. Cel mai nalt spor specific de recolt s-a obinut la aplicarea gunoiului de psri n doze de 18 i 36 t/ha,
care a constituit 92-162 kg sau n medie 127 kg pe 1 ton de ngrmnt. ngrmintele aplicate au contribuit la
sintetizarea i acumularea proteinei brute n producia vegetal. La aplicarea gunoiului de grajd sporul de
protein n patru ani s-a mrit cu 13-32%.

94

BIBLIOGRAFIE:
1. Anuarul statistic al Republicii Moldova. Chiinu: Statistica, 2014, p. 350-352.
2. Andrie, S. Agrochimia elementelor nutritive. Fertilitatea i ecologia solurilor. Chiinu: Ed. Pontos, 2011, p.
148-151.
3. Lixandru, Gh.; Filipov, F. ngrminte organice: protecia calitii mediului. Iai: Editura Ion Ionescu de la
Brad, 2012, p. 378-384.
4. Plmdeal, V.; Bounegru, T.; Siuris, A. Indicii agrochimici i potenialul fertilizator a deeurilor provenite
din sectorul zootehnic privat, gospodria comunal i industria vinicol. n Revista tiina Agricol, 2013, nr. 2,
p. 17-21.
5. Rusu, A.; Plmdeal. Descrierea agrochimic a principalelor tipuri i forme de gunoi de grajd n Republica
Moldova. n: tiina Agricol, 2011, nr. 2, p. 6-9.
6. Stadnic, S. Factorii fertilitii solului la folosirea diferitor sisteme de fertilizare n asolament. n ,,Pedologia
modern n dezvoltarea agriculturii ecologic. Materialele conf. t.-practice, Chiinu, 5-6 mai, 2006, p. 195199.
7. , . . . B:
. hiinu tiina, 1999, p. 29-33.
8. , . . : , 1990, . 272-289.
9. , .. . , 1990, . 26-55.
10. , .. . : ,
1985, . 177-195.
EFECTUL TRATAMENTELOR FOLIARE CU FOLIRUS ACTIV ASUPRA PRODUCTIVITII SOII
CULTIVAT PE CHERNOZIOM CARBONATIC
Rotaru Vladimir, dr. conf. cercet., Ivantova Irina, Budac A., Institutul de Genetic, Fiziologie i
Protecie a Plantelor al AM
The aim of this investigation was to estimate the effect of foliar fertilization with Folirus activ on
soybean (Glycine max. L.,) productivity cultivated on chernoziom carbonated.
Four treatments of fertilization were tested: control (no fertilization), Wuxal suspension (3 l ha -1), Folirus activ
(3 l ha-1) and Folirus activ in rate of 6 l ha-1. Foliar fertilization was applied two times at the vegetative growth
stage. Results showed that foliar fertilizers significantly increased the values for all quantitative traits as well as
soybean grain yield. Likewise, the application of Folirus activ increased production of proteins and oil per
hectare. Thus, the foliar treatments of plants with Folirus activ have beneficial impact on grain yield and quality
of soybean.
Key words: foliar fertilization, soybean, morphological traits, productivity
Soia constituie cultur principal de cmp i se cultiv pentru producii nalte de proteine i grsimi
vegetale necesare pentru alimentaia oamenilor i hran pentru animale. n mediu, n boabele de soia se conin
cca 40% de proteine i 20% de grsimi vegetale. n Republica Moldova recolta de boabe de soia este sczut.
Unul din impedimentele principale ale realizrii potenialului de productivitate const n fertilizarea slab, iar
deseori ea este neglijat n tehnologia cultivrii acestei plante valoroase. Asigurarea insuficient a plantelor cu
nutrieni afecteaz considerabil nivelul i calitatea recoltei de boabe. Exist dovezi experimentale care arat c
soia manifest rspuns semnificativ la aplicarea ngrmintelor, mai ales pe solurile cu fertilitate joas [1, 12].
Trebuie de menionat c n majoritatea experienelor de cmp s-a evaluat efectul asupra productivitii la
aplicarea lor n sol. Cu regret, exist puine investigaii cu folosirea fertilizanilor extraradicular la soia.
Utilizarea lor prin acest procedeu tehnologic are avantaje. n primul rnd, se reduce evident doza de
ngrminte, iar n al doilea rnd, eficiena lor este mai mare, deoarece administrarea fertilizanilor n sol
contribuie la fixarea elementelor minerale, n deosebi a fosforului, n compui greu accesibili pentru plante, pe
cnd tratamentele foliare asigur plantele cu nutrieni n fazele critice de dezvoltare. Mallarino A.P. i
colaboratorii [7] au demonstrat c utilizarea lor foliar n perioada vegetativ timpurie de dezvoltare a soii
sporete recolta de boabe de la 15 pn la 30%. ns cercettorii Schmitt M.D. i colegii (2001) precum i
Binford D.U. cu colaboratorii (2004) au raportat c administrarea foliar a N-P-K n-a contribuit la creterea
recoltei de soia. De asemenea, savanii Kaiser D.E. i coautorii [8] au stabilit c fertilizarea foliar cu dou
soluii 3-8-15 i 28-0-0 (N-P-K) administrate la fazele V5 ori R2 de cretere n-a majorat productivitatea
plantelor. Totodat trebuie de menionat c n majoritatea investigaiilor s-a evideniat efectul benefic al utilizrii
ngrmintelor foliare asupra produciei plantelor agricole [1, 2, 4]. Prin urmare, n literatura de specialitate
exist rezultate controversate i, astfel, este necesar efectuarea experienelor n condiii de cmp pentru a stabili
rspunsul soii la tratamentele foliare. Cercetrile despre fertilizarea foliar reprezint o important cale pentru
diminuarea consumului neproductiv de ngrminte fr a reduce nivelul produciei i profitului. n ara noastr
cercetrile cu privire la fertilizarea foliar a soii practic lipsesc.
Scopul studiului a fost de a determina efectul fertilizrii foliare cu Folirus activ asupra recoltei i calitii
boabelor de soia cultivat pe solul cernoziom carbonatic.

95

MATERIALE I METODE
Pentru realizarea acestui studiu s-au organizat experiene n condiii de cmp pe solul de cernoziom
carbonatic, cu un coninut de 2,6% humus i un pH=7,8. Experienele au fost efectuate n anii 2013-2014. S-a
cultivat soiul Albioara cu norma de semnat 100 kg la hectar. Suprafaa parcelei a fost de 30 metri ptrai.
Schema experimental a alctuit patru tratamente: martor nefertilizat, Wuxal Microplant suspensie (3 l/ha),
Folirus activ n doz de 3 i 6 litri la hectar. Toate variantele s-au montat n trei repetiii. Tratamentele s-au
efectuat manual cu pulverizator, primul tratament - n faza de ramificare a lstarilor i al doilea - la interval de
dou sptmni de la prima tratare. Norma de consum a soluiei nutritive a fost de 300 l/ha. Recoltarea s-a
efectuat n faza coacerii boabelor. Analizele de calitate s-au efectuat dup metodologia acceptat n literatura de
specialitate, iar rezultatele obinute s-au calculat prin metoda analizei varianei. Coninutul de azot n boabe s-a
determinat dup metoda lui Kjeldahl, fosforul cu molibdatul de amoniu i potasiu la fotometru cu flacr [12].
Proteina bruta s-a estimat ca produsul coninutului de azot nmulit la coeficientul 6;25. Coninutul grsimilor s-a
cuantificat cu ajutorul eterului etilic utiliznd aparatul Sosclet. Rezultatele recoltei de boabe s-au prelucrat
statistic dup B. Dospehov [11]. Condiiile climatice din anii de experimentare (2013-2014) s-au situat sub
nivelul mediei multianuale a zonei de influen, toi anii fiind mai puin favorabili culturii soii.
REZULTATE I DISCUII
Condiiile meteorologice au marcat creterea i dezvoltarea plantelor. De obicei, verile au fost secetoase,
precipitaiile atmosferice au fost insuficiente i neuniform repartizate pe perioada de vegetaie a soii. n ambii ani
de cercetare temperaturile medii au fost mai nalte dect media multianual. Cantitatea de precipitaii a fost
minim n iulie-august - faza critic de dezvoltare i cretere a soii.
Importana sistemului de fertilizare al soii const n faptul c este direct implicat n procesele de cretere
si dezvoltare, drept urmare condiioneaz nivelul cantitativ al recoltelor, particip si determin procesele
biochimice din sol, influennd starea de fertilitate a solului cu implicaii deosebite i asupra recoltelor culturilor
viitoare. Din datele obinute n anul de experimentare, rezult rolul benefic al ngrmintelor foliare asupra
produciei de semine la soia (Glycine Max L.). Din tabelul 1 se observ c producia de semine a nregistrat
diferene semnificativ pozitive n toate variantele n care s-au aplicat fertilizanii. Rezultatele noastre au fost n
concordan cu ale altor cercettori. Astfel, Sultan M.S. i colaboratorii [9] au raportat c stropirea cu fertilizatori
foliari la a 45-a zi dup semnat a sporit recolta de boabe. La fel, Haq M.U. i Mallarino A.P. [5] au demonstrat
c aplicarea azotului foliar a condus la creterea produciei de proteine i grsimi datorit majorrii recoltei la
soia. Cea mai nalt productivitate s-a stabilit n varianta cu aplicarea Folirus activ n doz de 6 l/ha. Adaosul la
recolt a constituit 3,9 q/ha. De asemenea i masa miei de boabe a nregistrat valori mai mari n aceast variant
comparativ cu martorul nefertilizat. Utilizarea unei doze mai mici (3 l/ha) la fel a contribuit la majorarea recoltei,
ns sporul a fost mai mic i nivelul lui a fost ca i n varianta cu folosirea fertilizatorului etalon Wuxal suspensie
(tab. 1). Fa de varianta nefertilizat, prin aplicarea ngrmintelor s-au obinut sporuri de producie cuprinse
intre 13,8-21%, ceea ce reprezint 2,5-3,8 q/ha.
Tabelul 1. Influena tratamentelor foliare cu ngrminte lichide asupra produciei de boabe la soia, q/ha
(media pe anii 2013-2014)
%, fa de
Variante
Recolta, q/ha
Sporul, q/ha
martor
Martor nefertilizat
18,1
Wuxal Microplant 3 l/ha
20,6
2,5
13,8
Folirus activ 3 l/ha
21,0
2,9
16,0
Folirus activ 6 l/ha
21,9
3,8
21,0
DL5% - 1,29 q/ha
Sporurile au fost asigurate statistic ca foarte semnificative (DL,5% - 1,29 q/ha). De notat c si ali savani
au constatat influene pozitive ale nutriiei suplimentare la plantele de soia [3, 8, 9].
Conform datelor din literatur, productivitatea plantelor este determinat de elementele de producie a
plantelor [12]. Elementele de productivitate prezint variabilitate n funcie de factorii agrofitotehnici i
climatici. Datele experimentale au stabilit c aplicarea fertilizanilor a marcat benefic structura recoltei de soia
(tab. 2). Rezultatele observaiilor cu privire la efectul tratamentelor foliare cu ngrminte lichide asupra taliei
plantelor de soia prezentate n tabelul 2 arat c aplicarea tratamentelor n perioada creterii vegetale a plantelor
de soia au determinat diferenieri privind nlimea acestora. Rezultatele medii obinute arat c numrul i
greutatea seminelor pe plant au nregistrat valori superioare la variantele fertilizate suplimentar comparativ cu
variantele fr fertilizare. La varianta nefertilizat, numrul mediu de semine pe plant a fost de 53,9 iar
greutatea seminelor a fost de 7,33g. S-stabilit c la variantele cu aplicarea Folirus activ cu norma de consum de
6 l/ha, numrul de semine i greutatea seminelor per plant s-a majorat i a fost de 73,5 i respectiv 11,0g.
Prin urmare, fertilizanii foliari au sporit att talia plantelor, ct i numrul de psti pe plant. Cel mai
bun efect avndu-l produsul Folirus activ, mai ales n ce privete numrul de psti pe plant. Astfel, folosirea
Folirus activ a majorat numrul i greutatea seminelor per plant cu 35% i 41% fa de martor. De asemenea,
acest fertilizant a sporit talia plantelor cu cca 14cm. S-a demonstrat c valorile maxime s-au stabilit la doza
fertilizatorului nou de 6 l/ha.

96

belul 2. Influena fertilizrii asupra unor elemente de productivitate ale soii


Talia,
Numrul
Numrul
Greutatea
Greutatea
Greutatea
Variante
m
psti,
semine,
semine,
semine,
psti, g
buc/plant
buc/plant
g/plant
g/pstaie
Martor nefertilizat
88,2
28,2
11,0
53,8
7,33
2,10
Wuxal Microplant 3 l/ha
88,3
35,3
14,7
62,9
9,61
2,00
Folirus activ 3 l/ha
103,0
37,8
16,3
75,4
10,71
1,90
Folirus activ 6 l/ha
89,6
38,2
16,7
73,5
11,00
1,92
Cantitatea de boabe per plant este un caracter morfologic variabil i se schimb evident sub aciunea
factorilor abiotici. S-a constatat c n variantele fertilizate numrul de psti a constituit 35-38 la o plant. n
varianta martor s-a nregistrat cel mai mic numr de boabe (28,2/plant). Trebuie de remarcat c n variantele cu
fertilizare cantitatea de psti pe tulpina principal s-a majorat comparativ cu martorul. Insuficiena nutriiei
minerale (varianta fr nutriie suplimentar) a redus numrul de psti per plant. Un indice cantitativ ce
determin nivelul recoltei precum i calitatea materialului semincer este greutatea miei de semine. n studiul
nostru valoarea greutii a 1000 semine a variat de la 136 la 142g. n acest aspect s-au evideniat variantele cu
utilizarea nutriiei extraradiculare cu Folirus activ. Prin urmare, pe baza rezultatelor obinute se poate de tras
concluzia c utilizarea foliar a manifestat aciune benefic asupra numrului i greutii pstilor, precum i
asupra greutii seminelor de soia.
Un indice ce caracterizeaz calitatea recoltei este coninutul de elemente minerale. Utilizarea
ngrmintelor reprezint un procedeu de stimulare a acumulrii lor n seminele de soia. S-a stabilit (tab. 3) c
concentraia cea mai mare de azot s-a obinut n urma tratamentelor cu Folirus activ n doz de 6 l/ha. n acest
caz, coninutul de azot s-a majorat pn la 6,12% contra 5,72% n varianta martor. Referitor la coninutul de
fosfor n semine se poate de remarcat c s-au obinut modificri semnificative n dependen de fertilizare.
Tabelul 3. Coninutul azotului i fosforului n seminele de soia n dependen de fertilizarea foliar
Variante
Azot, %
Fosfor, mg/g.
Potasiu, %
Martor nefertilizat
5,72
7,21
1,92
Wuxal Microplant 3 l/ha
5,92
9,50
1,93
Folirus activ 3 l/ha
5,53
8,46
1,86
Folirus activ 6 l/ha
6,12
9,70
1,92
Astfel, nutriia suplimentar cu Folirus activ a majorat concentraia elementului de la 7,21 mg/g
nregistrat la martor pn la 9,7 mg/g. Aceiai aciune pozitiv s-a observat i la varianta etalon (Wuxal
suspensie, 3 l/ha). Concentraia potasiului din semine nu s-a modificat sub influena fertilizanilor. Acest efect
se lmurete prin faptul c solul lotului experimental este asigurat suficient cu potasiu schimbabil. Aadar,
folosirea nutriiei foliare a contribuit la acumularea n recolta de boabe a elementelor azot i fosfor.
Proteinele i grsimile sunt componenii principali ai boabelor de soia. Aceast specie, comparativ cu
alte leguminoase; posed nu numai un coninut ridicat de proteine, dar prezint i o valoare furajer nalt,
astfel contribuind la ameliorarea calitii furajelor.
Rezultatele experimentale au artat c coninutul de proteine brute depinde de tipul fertilizantului. La
cultura de soia s-a constatat o variaie a coninutului de protein in funcie de condiiile de nutriie.
Coninutul maxim al proteinei s-a stabilit n varianta cu folosirea Folirus activ. Probabil acest ngrmnt
a stimulat activitatea de asimilare a azotului i a contribuit la utilizarea mai bun a acestui nutrient.
Tabelul 4. Coninutul de proteine i grsimi n boabele de soia n dependen de fertilizarea foliar cu Folirus
activ
Variante

Coninutul de
proteine brute,
%

Coninutul de
grsimi, %

Producia de
proteine brute,
kg/ha

Producia de
grsimi, kg/ha

Martor nefertilizat
36,5
20,1
663
365
Wuxal Microplant 3 l/ha
37,4
19,1
768
392
Folirus activ 3 l/ha
36,1
20,1
746
422
Folirus activ 6 l/ha
38,9
19,5
847
427
De asemenea, efectul pozitiv asupra calitii recoltei de boabe s-a demonstrat i n varianta cu aplicarea
fertilizantului Wuxal suspensie (tab. 4). Cantitatea de grsimi din boabe s-a schimbat nesemnificativ pe variante.
Cel mai evident, folosirea fertilizanilor a sporit cantitatea de proteine brute i grsimi la hectar, depind
considerabil nivelul din varianta martor. Producia de substane proteice i grsimi brute s-a majorat cu 27% i
17% n varianta cu aplicarea Folirus activ (6 l/ha).
Aadar, utilizarea fertilizantului Folirus activ n calitate de nutriie foliar a manifestat eficacitate
agronomic semnificativ la cultivarea soii pe solul cernoziom carbonatic din zona centru a Republicii Moldova.
CONCLUZII:
1. n condiiile climatice n care s-au efectuat experienele, fertilizarea foliar n perioada de vegetaie determin
mbuntirea recoltei i a calitii soii.

97

2. Aplicarea fertilizantului Folirus activ n doz de 6 L/ha (dou tratamente) a condus la obinerea unui spor de
producie de 3,9 q/ha sau cu 21,1% mai mult n raport cu martorul nefertilizat.
3. Fertilizarea plantelor cu ngrmintele etalon (Wuxal Microplant suspensie 3 l/ha) a asigurat aceeai recolt,
ns dup indicatorii calitativi ele au cedat variantei cu aplicarea Folirus activ;
4. Aplicarea tratamentelor cu fertilizani foliari a influenat calitatea boabelor de soia prin creterea coninutului
n proteine, azot i fosfor.
Prin urmare, pentru a obine producii maxime de semine, dar i de ulei i proteine, este necesar
fertilizarea foliar a plantelor de soia cu Folirus activ.
BIBLIOGRAFIE:
1. Binford, G.D.; Hearn, B.K.; Isaacs, M.A.; Hansen, D.J.; Tayor, R.W. Foliar fertilization of roundup ready
soybeans. In: Plant Management Network, November 24, 2004.
2. Chowdhury, I.R.; Paul, K.B.; Eivazi, F.; Bleich, D. Effects of foliar fertilization on yield, oil and elemental
composition of two soybean varieties. In: Communications in Soil Science and Plant Analysis, 1985, 16, p. 681692.
3. El-abady, M.I.; Seadh, S.E.; Attia, A.N.; El-saidy, A.E.A. Impact of foliar fertilization and its time of
application on yield and seed quality of soybean. Proceedings the Sec Field Crops Conference, 2008, 4, p. 299313.
4. Haq, M.U.; Mallarino, A.P. Soybean yield and nutrient composition as affected by early season foliar
fertilization. In: Agronomy Journal, 2000, 92, p. 16-24.
5. Haq, M.U.; Mallarino, A.P. Response of soybean grain oil and protein concentrations to foliar and soil
fertilization. In: Agronomy Journal, 2005, 97, p. 910-918.
6. Kaiser, D.E.; Mallarino, A.P.; Haq, M.U. Foliar fertilizer and fungicide combinations for soybean: Impacts on
leaf diseases, grain yield, and grain quality. In: International annual meeting, 2007, November 4-8, New Orleans,
Louisiana, p. 320-329.
7. Mallarino, A.P.; Haq, M.U.; Wittry, D.; Bermudez, M. Variation in soybean response to early season foliar
fertilization among and within fields. In: Agronomy Journal, 2001, 93, p. 1220-1226.
8. Schmitt, M.A.; J.A. Lamb, G.W. Randall, J.H. Orf, and G.W. Rehm. In-season fertilizer nitrogen applications
for soybean. In: Minnesota. Agron. J. 2001, 93, p. 983-988.
9. Sultan, M.S.; Sharief, A.E.; Ghonema, M.H.; EL-Kamshishy, S.S. Response of oybean (Glycine max L.
Merr.) to plant distributions and microelements foliar spraying: II- Yield and its components. In: Journal of
Agricultural Sciences Mansoura University, 2003, 28, p. 1631-1643.
10. Woon, C.K.; Porter, O.A. Effect of foliar fertilizers on the growth of soybean cultivars. In: Journal of Agro
Crop Science, 1986, 157, p. 79-85.
11. , .. . , 1985.
12. , . a .. , 1989.
13. , ..; , ..
. B: , 2012, 3, c. 23-28.
PRETABILITATEA SOLURILOR LA IRIGAIE N REPUBLICA MOLDOVA
Rozloga Iurie, dr., FilipciucVladimir, dr. conf,. Institutul de Pedologie, Agrochimie i Protecie a
Solului Nicolae Dimo
The paper presents the assessment of soil suitability for irrigation in Republic of Moldova using
geoinformation system for soil quality. There were deminsionat and spatially localized 12 groups of soil
according to their suitability for irrigation. All these groups of soils were divided into five groups by restrictions
for irrigation and was elaborated digital map.
Key words: soil suitability for irrigation, digital soil map, soil structure cover, irigation fund.
INTRODUCERE
Dup amplasarea geografic, teritoriul Republicii Moldova (]n continuare RM), se ncadreaz n zona
cu umiditate insuficient i instabil. Schimbrile climaterice din ultima perioad, provoac intensificarea
secetelor, avnd n timp un caracter tot mai agresiv. Ele mresc deficitul de umiditate n sol i aer ce conduce la
reducerea considerabil a recoltelor culturilor agricole i chiar pierderea lor. Aplicarea irigaiei devine practic
principala soluie pentru optimizarea regimului de umiditate n sol i asigurarea culturilor agricole cu ap.
Posibilitatea organizrii irigaiei este condiionat de pretabilitatea solurilor i calitatea apelor.
MATERIALE I METODE
Structura nveliului de sol al RM este foarte complex i neomogen. Utilizarea chiar i apei dulci la
irigaie, conduce la intensificarea proceselor de degradare a solurilor [1, 2, 3].
Pretabilitatea solului i calitatea apelor pentru irigare se refer la normele de calitate a solurilor i apelor
de irigaie care necesit a fi respectate la aplicarea ameliorrii hidrice, n scopul evitrii i prevenirii degradrii
solului. Ea trebuie s reflecte principiile de baz privind supravegherea i prentpinarea consecinelor negative
a irigaiei solurilor [4, 5].

98

Pentru elaborarea hrii digitale a pretabilitii solurilor la irigaie a fost folosit metoda
geoinformaional [6, 7] utiliznd programele ArcGis i MapInfo. Lucrrile au fost efectuate n sistema de
coordonate MoldRef 99 proiecia Non Earh. Drept baz informaional a crerii hrii digitale a pretabilitii
solurilor la irigaie au servit planetele structurii nveliului de sol (137 foi) la scara 1:50000 elaborate la
Institutul de Pedologie, Agrochimie i Protecie a Solului Nicolae Dimo care, la rndul su, au fost ridicate de
pe materialele ciclului I, II a cartografierii solurilor din Moldova la scara 1:10000.
REZULTATE I DISCUII
ntocmirea hrii digitale a solurilor dup pretabiltate la irigaie al RM permite vizualizarea spaial
destul de precis a arealelor care uor pot fi stabilite i identificate n natur. Fondul funciar constituie 70475
areale de soluri ocupnd o suprafa de 3109343 ha dintre care 62% l constituie cernoziomurile.
n cadrul arealelor solurilor cu un potenial nalt de fertilizare se ntlnesc i cele supuse diferitor forme
de degradare cum ar fi cele erodate, compactate, halomorfe, hidromorfe, afectate de alunecri de teren .a. Unele
soluri brune, cenuii i cernoziomuri sunt supuse proceselor de degradare prin eroziune, srturare, soloneizare,
slitizare, gleizare (tabelul 1). Ele sunt excluse din sistemul irigaional.
Toate solurile dup pretabilitatea lor la irigaie au fost mprite n 12 grupe.
Prima grup este cea mai optimal i constituie obiectul principal pentru irigaie care include
cernoziomurile carbonatice, obinuite, sudice. De asemenea, ea este cea mai mare (798768 ha) unde ponderea ei
din toate solurile pretabile la irigaie constituie 47%. Aceste soluri sunt rspndite preponderent att n raioanele
de sud i sud-est al republicii, ct i pe terasele aluviale din centrul i nordul Moldovei (figura 1). Prezena
carbonatului de calciu n orizonturile superioare are efect inhibitiv asupra procesului de decalcifiere la aplicarea
apelor cu gradul de mineralizare de 0.7 0.8 g/l.
Tabelul 1. Pretabilitatea la irigaie a subtipurilor de sol
Denumirea solurilor
Cernoziomuri xeroforestiere,
obinuite, carbonatice, sudice
Cernoziomuri argiloiluviale,
levigate, tipice
Soluri brune i cenuii
Soluri aluviale
Soluri halomorfe
Soluri erodate

Grupele Numru
de
l
solurilor arealelor

Suprafa, ha
total

erodate

vertice

gleice

24549

1374135

552830

9086

II

15132

741577

235335

6219

109

III
IV
V
VI

5110
3954
474

300664
314866
8396
864641

66332

585
28968
2313

4107

Alunecri de teren

VII

3737

133255

Soluri vertice
Soluri deluviale
Soluri hidromorfe
Antropice i ravene
Rendzine

VIII
IX
X
XI
XII

710
1881
12905
1613
410

18908
68475
133036
3198
12833

3403

4124

20

70475

3109343

864631

72241

TOTAL

128
864631

2478

halomor
fe

Pretabile
la irigaie

13450

798769

5614

494301

94269
8397

73

6694

18908
2
6066

132

159
205
19928

4348

148716

229640
174271

1696980

Grupa a doua o constituie cernoziomurile argiloiluviale,


levigate i tipice avnd o rspndire larg n Cmpia de Nord,
Colinele Tigheciului, Podiului Moldovei Centrale [8]. Ele ocup o
suprafa de 494301 ha constituind circa 29% din posibilele
amenajri irigaionale. Ele se caracterizeaz prin lipsa carbonatului
de calciu n stratul 0 - 50 cm. Pentru irigaia acestor soluri se
recomand utilizarea apelor cu grad redus de mineralizare (0,40,6
g/l) i cu compoziie chimic favorabil.
n cea de a treia grup ntr solurile brune i
cenuii (229640 ha), care au cptat o rspndire larg n Podiul
Codrilor, Dealurile Prenistrene i Podiul de Nord a republicii. Ele
ocup 14% din potenialul irigaional al solurilor i sunt lipsite de
carbonatul de calciu n partea superioar a profilului. Irigaia
acestor soluri se efectueaz cu ap dulce (0.4 0.6 g/l) care posed
compoziie ionic favorabil. Un factor limitativ pentru includerea
acestor soluri n fondul irigaional este prezena orizontului
argiloiluvial (sau a unei pri a acestuia) cu permeabilitate redus
pentru ap.
Fig.1. Rspndirea spaial a grupelor de soluri dup pretabilitate
la irigaie

99

Grupa a patra este format din complexul de solurile aluviale. n sistemele de irigaie pot fi incluse cele
nesrturate i fr risc de srturare, neafectate de hidromorfizm i fr caractere morfologice de slitizare care
constituie 174271 ha sau 10% din potenialul irigaional. Ele sunt rspndite n luncile tuturor rurilor interioare
predominnd n luncile rurilor transfrontaliere a Nistrului i Prutului. Irigaia lor se efectueaz pe fond drenat
pentru stabilizarea nivelului apelor pedofreatice sub nivelul critic (>2.0 m). Gradul de mineralizare a apelor
pentru irigaie nu va depi 0.8 1.0 g/l.
Grupa a cincea este constituit din solurile saline, alcalice i cele afectate de stturare. Aceste soluri au
o rspndire n toate zonele pedogeografice ale republicii, n lunci i pe podiuri ocupnd o suprafaa de 148716
ha. Formarea acestor soluri este condiionat de acumularea srurilor solubile sau a sodiului schimbabil n profil.
Acestea soluri la prima etap se exclud din irigaie.
n grupa a asea ntr solurile cu grad slab, moderat i puternic de eroziune (864631 ha). Pentru a evita
declanarea procesului de eroziune irigaional ele sunt excluse din amenajrile de irigaie.
Grupa a aptea include solurile afectate de alunecri (133254 ha) i se exclud din fondul irigaional din
cauza riscului sporit de activizare a proceselor de alunecare.
Cea de a opta grup l constituie vertisolurile i solurile cu caractere morfologice vertice (72240 ha) ce
nu se ncadreaz n ameliorarea hidric n legtur cu nsuirile fizice defectuoase: textura fin argiloas,
compactare natural excesiv, porozitate redus i permeabilitate pentru ap extrem de mic.
Grupa a noua se caracterizeaz prin soluri deluviale colmatate (68474 ha). Condiiile de formare a lor
este acumularea recent a depozitelor de sol ca rezultat al eroziunii prin ap. Uneori se pot forma straturi
gleizate. Din cauza procesului de depozitare permanent ele se exclud din irigaie.
Grupa a zecea este format din solurile cu exces de umiditate, geneza cror este legat de influena
apelor freatice, de suprafa sau combinate. Sunt rspndite n cadrul terenurilor cu soluri fertile ocupnd o
suprafa de 133036 ha i sunt excluse din amenajrile de irigaie.
Grupa a unsprezecea este reprezentat de ravene (3198 ha) n care lipsete completamente profilul de
sol i de asemenea se exclud.
n grupa a dousprezecea sunt incluse rendzinele (12832 ha) - soluri cu caractere morfogenetice
specifice: prezena la adncime mic a rocii de solificare dure; profil de sol scurt, n cele mai frecvente cazuri
scheletic i nu se includ in cadrul sistemelor de irigaie.
Toate acestea grupe de soluri dup restricii la irigaie au fost divizate n cinci grupe. Primele patru
grupe sunt identice cu grupele expuse anterior i ocup o suprafa de 1696980 ha. Ele sunt pretabile pentru
irigaie cu diferit grad de restricii (tabelul 2) i constituie 55% din ntreaga suprafa a solurilor republicii (figura
2). Dintre solurile pretabile la irigaie partea major (76%) o constituie grupele I i II reprezentate prin
cernoziomuri. Prima grup cu 47% se poate folosi sub irigaie fr restricii, cea de a doua (29%) cu restricii
minime. Grupa a treia reprezentate de soluri brune i cenuii (14%) se poate folosi sub irigaie cu restricii
moderate.
Grup a patra pretabil la irigaie constituit din soluri aluviale (10%) la ncadrarea n sistemul irigaional
necesit restricii severe.
Solurile grupelor de la V pn la XII sunt excluse din amenajrile hidrice si alctuiesc 45% din suprafaa
tuturor solurilor.
Tabelul 2. Gruparea solurilor dup pretabilitate la irigaie
Tip
Fr restricii
Restricii minime
Restricii moderate
Restricii severe
Se exclud
TOTAL

Grupele
de soluri dup restricii

Numrul
arealelor

Suprafaa, ha

% din suprafaa
total, ha

I
II
III
IV
V

6186
4990
2167
2962
51170
70475

798768
494301
229640
174271
1412363
3109343

25.69
15.90
7.38
5.60
45.42
100

Fig. 2. Rspndirea procentual a grupelor de


soluri dup pretabilitatea la irigaie
Harta digital elaborat a pretabilitii solurilor la
irigaie din RM permite localizarea spaial
operativ a arealelor de soluri pentru
implementarea sistemelor irigaionale i permite
tiinific-argumentat prevenirea proceselor de
degradare irigaionale i folosirea raional a
resurselor de sol.

100

CONCLUZII:
1. Solurile pretabile pentru irigaie ocup o suprafa de 1696980 ha care constituie 55%. Dintre ele cele fr
restricii i cu restricii minime sunt cernoziomurile.
2. Din suprafeele sub amenajri hidrice au fost excluse solurile degradate sau cu potenial de iniiere a acestor
procese care alctuiesc 1412363 ha.
BIBLIOGRAFIE:
1. Filipciuc, V. Recomandri privind prevenirea degradrii cernoziomurilor irigate. Chiinu, 1996. 28 p.
2. : . ...: - . .., 1996. 72 .
3. K, .. . , , ,
. hiinu: Ed. Pontos, 2008. 288 .
4. Filipciuc, V. Pretabilitatea solurilor i apelor la irigaie. Seceta i metode de minimalizare a consecinelor
nefaste. Chiinu, 2007, p. 10-11.
5. . .2:
. Chiinu: Ed. Pontos, 2005. 148
6. , ..; , ..; , ..; , ..; , ..; , ..;
, ..; , ..
. : . - . .., 2008. 243 .
7. , .. a
. : P, 2006. 160 .
8. Ursu, A. Solurile Moldovei. Chiinu: .E.P. tiina, 2011. 323 p.
ALTENERIA,

,
This article presents the results of the laboratory experiment to determine the most and least virulent
isolate Alternaria. The best result for the protection of tomato plants from blight was obtained by the using the
least virulent isolates in dilution at 1:5 for seed treatment. The efficacy of this culture liquid was of 1,5 times
higher control.
Key words: Alternaria, culture liquid, tomato, seed treatment, induced resistance.

. (, ,
, .), .
-

.
, .. [1], ,
Phytophthora infestans
(100 /) ,
(, ). (5 /)
, ,
,
( 3 ). -,

( , ,
).

Pnicillium, ,
A. solani.
[2].
.. [3] ,
Sclerotinia sclerotiorum :
8%, 15%, 8-15 .
(5
).
.
H .
FS-94 Fusarium sambucinum (),
, ,
. ,

101

F. Culmorum F. oxysporum
f. sp. lycopersici, ,
, ,
Fusarium Bipolaris sorokiniana,
.

Botrytis [4],
. Botrytis cinerea,
, , , [5].

,

.

()
28 250
- .
Alternaria alternata: LG-14, K66, G348, A9-1, -7.
4- . .
50 . 24 .
24 .
.
,

. (. 83 . )
12 , .
.
, . 83 (
) ( ). ,
50 90 , 100 .
13 , .. 26 . 12 .
: 0 ; 0,1 ; 110%
; 2 25% ; 3 50% ; 4
75% ; 5 75% .

LG-14 ( 1) ,
, .
LG-14 , 1:4 . 9-1
, -7.
G348.
1.
(. ) 2014.


9-1
-7
G 348
LG-14
K 66
()
.-
46,3

51,6

48,1

55,1

50,6

1:1
46,8

55,3

41,7

44,4

50,7

1:3
52,4

48,3

57,2

52, 3

60,9

1:4
43,8

53,2

58,7

52,7

62,7

1:5
51,8

55,6

61,3

51,6

55,3

. 2
65,2
0,05
5,6
()
.
15,9

12,8

14,0

11,6

13,8

1:1
14,2

13,3

13,7

9,6

11,7

1:3
13,2

11,9

14,7

11,3

11,8

1:4
11,7

13,7

18,0

11,4

12,4

1:5
13,0

13,4

14,3

12,0

12,9

. 2
14,5
0,05
2,0

102

, 1,

. ,
. , (G 348 - . 66 . )
, .
2. B
(2014., 3- ).
G348 .
G348 1:5
66 .
66 1:4
.

. 83

2,15
1,05
2,45
1,1
1,9
1,9

40,1
43,2
22,0
38,9
21,0
31,0
(%)

-3
- 11,1
43,4
0
46,5
20,2

, %
S
0,09
0,05
0,25
.

3,3
1,3
2,51
1,4
2,1
2,4

65,2
44,1
26,1
46,3
27,3
37,7
(%)

- 40,2
4,8
43,6
0
41,1
18,6

, %
S
0,16
0,05
0,32
,
(21%
), (31% ),
. .
..,
( 1,3 ), .
,
, 1:5.
.
. Alternaria alternata sensu lato (
) Alternaria alternata, A.tenuissima, A.arborescens.
Alternaria , ,
,
(. Simmons, 2007 A.C., 2011).
:
1. , LG-14,
- in vitro
. K66 G348 .
2.
.
:
1. , ..; , .. .
. B: , 2002, . 38, 2, . 552-555.
2. , .. .
. . . . . . . , 2001.
3. , .. Sclerotinia sclerotiorum (Lib.) De Bary
. . . . . ... .
, 1989. 21 .
4. Prusky, D.; Freeman, S.; Rodriguez, R. J.; Keen, N. T. A nonpathogenic mutant strain of Colletotrichum
magna induced resistance to C. Gloeosporioides in avocado fruits. In: Mol. Plant-microbeInteract, 1994, 7, p.
326-333.
5. , ..; , . Botrytis cinerea
. B: . , . . . . .
1991, c. 170-176.
6. , . . .
. . . . ... -, 2011. 25.

103



.., .., ,
The specific response of apple trees to substance natural iridoid glycoside Linarozid action have been
studied. It shows the effect of the change Linarozida plastid pigments, which are undergoing major changes
chlorophylls and carotinoids. The positive action of Linarozid was manifested in more degree to perspective
apple trees. Preparation can be used for increase the productivity of an apple trees.
ey words: iridoid glycoside, Linarozid, apple tree, leaves, pigments.


.
, ,
.
- ,
.
, , , ,

,
. ,
,
, ,
,
- .
,
.

,
,

.
,
Linaria vulgaris Mill.(L.) ,
.
: 1) - ; 2)
0,001%- .
.. [7].
-
, [2].
,
. ,
.

, ,
, ,
.
,
.
, , :
,
. ,
, - ,
, ,
.
,
, ,
, .
,
, ,
. , ,
, . ,
,

104

,
,

.
.

. ,
. ,
. ,
, , ,
,
. ,
, ,
: , , , ..
. ,

,
.
. , /
/ , ,
, .
.
, , ,
.
.
-
, . ,
, ,
.
,
,
.
.
,
,
, .
, ,
, , ,
,
. .

,
, . ,
. , ,
, , . ,
, . ,
.
, ,
, (, ,
).
. , ,
, , ,
. ,
(, , , ).
, ,
.
, .
,
, ,
. ,
, , ,
, ,

105

.
.
:
1. ,
. ,
, , ,
, ,
.
,
, , , , ,
.
2.
, , , -,
, , ,
, ,
.
3.

, ,
.
:
1. , .. . : , 2004.
2. , ..; , ..; , ..; , ..; , ..; , ..
- - . : ,
1986.
3. , ..; , ..; , ..; , ..
. : , 1981.
5. , .. . B: , 1983, . 38, . 806.
6. , ..; , ..; , ..; , .. -
. 10 H
, 17-21 2013. , .
7. , .. . B: ,
2008, . 55, 1, .140-154.
8. , .. . : , 1971, . 154-170.
ASPECTE METODOLOGICE ALE DETERMINRII CONINUTULUI DE HUMUS N SOL I
PROBLEMA DEHUMIFICRII CERNOZIOMURILOR N REPUBLICA MOLDOVA
Taran Mihail, dr. n t. agricole, IP Institutul de Cercetri pentru Culturile de Cmp Selecia
The purpose of this article is to present the methods of content determination of soil organic matter, the
precision of which depends mostly on the way the soil samples are taken and their right preparation for the
analysis. The results of the chemical analyses of the content of soil humus, carried out at different periods of
time, by different methods, need to be interpreted correctly in the case of estimation of the loss of humus in the
chernozem in the Republic of Moldova.
Key words: soil organic matter, soil fertility, elemental analisys, methods for determination of carbon.
INTRODUCERE
Coninutul de humus n sol constituie indicele principal al fertilitii i st la baza determinrii bilanului
elementelor nutritive si a sistemului de aplicare al ngrmintelor organice i minerale la cultivarea plantelor
agricole. Din an n an statutul humic al solului sufer inevitabil schimbri, ele fiind nregistrate prin analiza
chimic a solului. La rndul su, analiza chimic, iar n cazul concret determinarea coninutului de humus n sol
se efectueaz prin diferite metode chimice, fizice i fizico-chimice, fiecare din ele avnd specificul su,
avantajele i dezavantajele operaiilor de pregtire ale probelor de sol etc. Toate aceste metode permanent s-au
perfectat i acest lucru numaidect necesit a fi luat n consideraie i interpretat corect, cnd se compar
rezultatele referitor la coninutul de humus, obinute n diferite perioade de dezvoltare ale tiinei pedologice,
agrochimice, ale progresului tehnic n ramura agriculturii .a.
CARACTERSTICA METODELOR DE DETERMINARE ALE CONINUTULUI DE HUMUS N SOL
De la bun nceput, e foarte important s deosebim i s nu folosim ca sinonime noiunile de humus i
substan organic a solului. Conform standardului de terminologie GOST 27593-88 humusul este o parte a
substanei organice a solului, reprezentat de o totalitate de substane organice specifice i nespecifice ale lui, cu

106

excluderea compuilor, ce intr n componena organismelor vii i a rmielor lor [12]. Conform diferitor
surse humusul reprezint 85-90% din substana organic a solului, iar restul 10-15% sunt substane organice
nespecifice pentru humus [15].
Metodele de determinare ale humusului n sol s-au perfectat odat cu progresul tehnico-tiinific n
chimie i fizic n ultimii 100 de ani, dar ne vom limita la o caracteristic a metodelor mai noi, mai corect se va
atrage atenia la momentele eseniale, sau la operaiile principale ale diferitor metode, de care depinde direct
precizia lor.
La mod general metodele de determinare ale humusului n sol se divizeaz n dou grupuri mari - cu
oxidare uscat i oxidare umed a substanei organice a solului.
Oxidarea uscat conform metodei Gustafson const n calcinarea solului n prezena aerului la
temperatura de 600C. Cantitatea de dioxid de carbon, ce se degaj n rezultatul descompunerii substanei
organice a solului poate fi determinat prin metoda gravimetric, volumetric, sau titrimetric. n varianta clasic
metoda este laborioas i cere mult timp pentru analiz, dar din cauza preciziei nalte este utilizat pe larg n
analizatoarele automate de determinare a coninutului de carbon n sol. Datorit faptului c n aceste aparate se
poate de meninut cu precizie nalt temperatura necesar de 600C se evit practic unicul neajuns al metodei pericolul descompunerii carbonailor din sol cu degajarea dioxidului de carbon la temperaturi mai nalte de
700C [5].
Metodele din grup a doua se bazeaz pe tratarea probei de sol special pregtit cu amestec oxidant de
dicromat de potasiu i acid sulfuric, luat n exces i fierberea uniform a coninutului balonului timp de cteva
minute. Cea mai larg rspndire a cptat varianta Tiurin a acestei metode, care const n oxidarea chimic a
humusului n soluie de dicromat de potasiu i acid sulfuric pe plit electric timp de 5 minute i titrarea
excesului de oxidant cu soluie de sare de fier(II), care a devenit metoda de baz n standardul unional GOST
26213[10]. n scurt timp, acest standard a fost perfecionat, nlocuindu-se metoda titrimetric de determinare a
cantitii de oxidant rmas n soluie prin metoda spectrometric de analiz, care e mai precis i mai productiv.
Proba de sol, tratat cu amestec oxidant n eprubete se supune nclzirii la temperatura de 140 C timp de 20 de
minute n dulap de uscare [11].
Un punct slab al metodelor cu oxidare umed a substanei organice a solului const n faptul c solul
analizat nu trebuie s conin cationi de Fe2+, iar coninutul de anioni cl- n cantitatea de sol luat pentru analiz
s nu depeasc 2 mg. Aceast cerin este stipulat att n standardul rus GOST 26213-91, ct i n standardul
internaional ISO 14235:1998 [4]. Acest lucru nseamn c nainte de determinarea coninutului de humus n
prealabil e necesar s se determine coninutul de cl-i s se in cont de el, de altfel rezultatele determinrii
coninutului de humus pot fi mai nalte.
Precizia metodelor de determinare a humusului n sol este destul de joas. De exemplu, eroarea admis
la determinarea coninutului de humus prin metoda Tiurin, stipulat n standardul GOST 6213-84 e de pn la
20%, iar n cazurile de arbitraj pn la 30%. Aceste lucruri se explic nu numai prin compoziia foarte diferit
a substanei organice a solului, dar i prin procedura de luare a probei medii de sol pe teren, cunoscndu-se faptul
variaiei mari a compoziiei chimice a solului.
Conform instruciunilor agrochimice cu ct mai mare este numrul probelor individuale de sol, cu att
mai precis proba medie caracterizeaz coninutul al indicelui agrochimic, care se determin, de exemplu, a
humusului [3]. Urmtoare etap const n uscarea i mcinarea solului cu trecerea lui prin sit cu diametrul de 1
mm, pregtirea probei medii de sol i pregtirea probei nemijlocit pentru determinarea humusului. Ultima
operaie este foarte migloas i prevede alegerea cu ajutorul lupei i a pencetei a rdcinuilor din sol, iar cnd
acestea sunt multe ca de exemplu n stratul de 0-20 cm se recomand folosirea unui bastona de sticl electrizat
[8]. Standardul GOST 28168 referitor la metodele de luare a probelor de sol i pregtirea lor pentru analiza
chimic recomand folosirea unui bastona de ebonit. Fiind efectuat cu prea mult rvn n timpul acestei
operaii din proba de sol se pot nltura o parte din particulele humificate, de aceea, efectuarea ei necesit o
atrnare foarte serioas, sau chiar un control permanent, sau supraveghere a executanilor, fiindc operaiile de
pregtire ale solului pentru analiza chimic sunt lsate pe seama lucrtorilor slab pregtii i slab motivai i mai
puin sunt efectuate de specialiti cu pregtire tiinific special. Nu-i exclus c din aceste considerente n
ultimele ediii ale ghidurilor de analiz agrochimic a solului aceast operaie nu se recomand de efectuat [16].
Din cele expuse mai sus se vede c cerinele ctre pregtirea probei de sol pentru determinarea humusului
difer esenial. n primele perioade de studiu ale substanei organice din sol predominau metodele tiinifice, care
mai apoi fiind perfectate au devenit metode standardizate n cadrul standardelor de ramur, elaborate de
Institutul Unional de Deservire Agrochimic din Moscova. Mai trziu ele au primit statut de standarde de stat ale
ex-URSS i sunt n vigoare i n Republica Moldova, indicaiile i cerinele lor necesit a fi respectate, dar s nu
uitm c n diferite perioade au dominat i alte cerine, care au lsat diferite amprente metodice asupra
rezultatelor determinrii coninutului de humus n sol.
PROBLEMA REDUCERII CONINUTULUI DE HUMUS N SOL
Cnd se discut despre reducerea coninutului de humus, pierderile de humus, sau aa numita
dehumificare a solurilor n Republica Moldova (n continuare RM) se compar coninutul de astzi al humusului
n solurile arabile, utilizate intens n cadrul tehnologiilor moderne cu coninutul de humus de 5-9%, determinat
de marele pedolog rus V. Docuceaev n soluri virgine de step, neatinse de unealta agricultorului n timpul

107

expediiei sale n gubernia Basarabia la sfritul sec. XIX i se fac concluzii incorecte la acest subiect. Se
vorbete mult despre tragedia cernoziomurilor, se propun soluii, care presupun o exploatare mai lejer, dar i o
diminuare a produciei culturilor agricole [14]. O simpl comparaie a coninutului de humus nu-i suficient
pentru un face o concluzie radical, fr o analiza detaliat a situaiei concrete pe aceste terenuri, innd cont i
de metodele de lucrare de baz a solului.
Deintorul unei informaii foarte bogate cu privire la fertilitatea solurilor n RM i schimbrile ei este
Serviciul Agrochimic de Stat al RM, laboratoarele zonale ale cruia pe parcursul anilor 1965-1999 au efectuat
3235 de experiene de cmp cu ngrminte i 4-5 cicluri de cercetri agrochimice. n baza rezultatelor
analizelor agrochimice ale fiecrui ciclu, ce se efectuau cu o periodicitate de cinci ani, au fost elaborate
cartogramele de asigurare cu elemente nutritive ale solurilor fiecrei gospodrii agricole la nivel de asolament
[3] .
Determinarea coninutului de elemente nutritive, a formelor lor mobile i inclusiv a humusului n
decursul tuturor celor 4-5 cicluri de cercetri agrochimice a solului s-a efectuat n stratul arabil de 20 cm.
Aceast adncime e absolut insuficient pentru cercetarea schimbrilor coninutului de elemente pe profilul
solului, dar la nceput e posibil c accentul s-a pus, n primul rnd, pe o acoperire agrochimic ct mai mare a
terenurilor n detrimentul analizei mai adnci a solului, de exemplu de cel puin la 40-60 cm. Aceleai erori au
fost comice i n unele asolamente ale instituiilor tiinifice, n care s-a studiat adncimea de lucrare de baz a
solului n tehnologiile de cultivare ale plantelor agricole. Astfel, n anii 1965-1985 la culturile tehnice-sfecla de
zahr i floarea-soarelui se studiau variante cu adncimea arturii de 35-37 de cm i chiar se recomandau aceti
parametri n cadrul tehnologiilor intensive de cultivare ale lor [13].
La nceputul etapei de chimizare a agriculturii adncimea lucrrii de baz a solului determina, n mare
msur, nivelul de producie al culturilor de cmp i acest lucru argumenta tendina de majorare a ei. Aceste
lucrri adnci ale solului au dus nu numai la amestecarea, omogenizarea straturilor de sol de 0-20 cm i 20-40
cm, dar i la egalarea coninutului de substane minerale i humus n stratul 0-40 cm. Ca rezultat s-au fcut
primele concluzii neargumentate precum c chimizarea agriculturii, lucrarea adnc a solului i ali factori de
intensificare a agriculturii contribuie la scderea coninutului de humus, la pierderea humusului, fr a concretiza
special c se are n vedere numai stratul arabil de 20 cm. n cazul terenurilor ocupate cu culturi multianuale
artura de plantaj, n rezultatul creia s-au amestecat straturile de sol de pn la 60-70 cm, concluzia formal
despre scderea fertilitii solurilor s-a ntrit i mai mult.
Mai trziu, odat cu majorarea dozelor de ngrminte aplicate, cu creterea preurilor la carburani .a.
factori adncimea lucrrii de baz a solului n tehnologiile de cultivare ale plantelor agricole a fost considerabil
redus, dar probele de sol n reeaua de deservire agrochimic au continuat s fie luate numai din stratul de 0-20
cm. Cu prere de ru, acelai lucru s-a ntmplat i n unele asolamentele staionare din instituiile de cercetri n
domeniul agriculturii din republic i chiar n unele instituii prestigioase de nvmnt superior din fosta URSS
[9, 13]. La fondarea lor i n primii 20-30 de ani probele de sol pentru analiza agrochimic a coninutului de
forme mobile ale NPK i humus au fost luate numai din stratul 0-20 cm. Aceste date nu pot fi utilizate n
calculele bilanului de humus,a pierderilor anuale de humus din cauza c aceti indici trebuie studiai ntr-un
strat, de cel puin, de 100 cm, n special n asolamentele cu lucrare adnc a solului.
La sfritul anilor 90 ai sec. XX, coninutul mediu de humus n solurile RM a fost de cca 3,1% [1]. E o
cifr alarmant, dar care necesit a fi precizat, lundu-se n consideraie cele expuse mai sus. Profesorul A.
Krupenicov a stabilit c solurile RM sunt supuse aciunii a 5 tipuri de degradri, clasificate de el n 40 de forme
de degradri. De aceste degradri sunt afectate practic toate terenurile agricole [14]. n acest caz, e absolut
necesar de precizat nsi noiunea de degradare a solului. n dicionare gsim mai multe definiii de degradare de la procese de schimbare n ru, stricare, deteriorare, ruinare, pn la micorarea valorii agricole a unui sol,
a unui teren. Pentru a nu confunda noiunea grav de degradare humic cu noiunile de sectuire, diminuare sau
reducere a coninutului de humus, n categoria de terenuri degradare necesit a fi incluse numai acelea, pe care
bonitatea solului s-a redus cu mai mult de 10 grade, sau 10 uniti de bonitate i ele au cobort cu o clas de
bonitate mai jos, dar nu cu 2-3 uniti, care este de fapt o diminuare i nu o degradare. Anume acest interval de
10 uniti de bonitate este pasul fixat n clasificarea solului dup bonitate de la a doua clas pn la a cincea, sau
de la 80 pn 50 uniti.
CONCLUZII:
1. Principala bogie natural a RM necesit a fi gestionat n mod corect, ceea ce nseamn tiinific argumentat,
lundu-se n consideraie specificul metodelor chimice, fizice i fizico-chimice cu punctele lor forte i cele slabe,
atrgndu-se o mare atenie operaiilor de luare a probelor de sol n cmp, formarii probei medii i pregtirea
probei finale pentru determinarea ct mai precis a coninutului de humus.
2. Laboratoarele acreditate din sistemul de certificare al solului, laboratoarele de profil agrochimic din instituiile
de cercetri tiinifice i din universiti necesit s-i coordoneze aciunile, s utilizeze n studiul coninutului
total de humus i a fraciilor lui aceleai metode standardizate n scopul elaborrii unor concluzii corecte i
msuri efective de ameliorare a fertilitii solurilor RM.

108

BIBLIOGRAFIE:
1. Andrie, S.; Cerbari, V.; Filipciuc, V. Starea de calitate a nveliului de sol i msuri de remediere. n:
Akademos, 2010, nr. 3, p. 80-87.
2. Andrie S.;Leah, T.; Lupacu, T.; Povar, I.; Filipciuc, V. Analiza cercetrilor ptrivind utilizarea
ngrmintelor pe diferite tipuri de sol. n: Akademos, 2013, nr 1, p.123-131.
3. Burlacu, I. Deservirea agrochimic a agriculturii Republicii Moldova. Chiinu: Ed. Pontos, 2000. 230 p.
4. ISO 14235-1998. Soil quality. Determination of organic carbon by sulfochromic oxidation.
5. ISO 10694-1995. Soil quality. Determination of organic and total carbon after dry combustion (elemental
analysis).
6. Instruciuni metodice privind cercetarea agrochimic a solurilor. Red. Baleanschi D. Chiinu: Agroinform
reclama, 1994. 36 p.
7. Ursu, A. Problema degradrii solurilor. n: Akademos, 2008, nr. 4, p. 63-65.
8. A, .. . , 1961. 491 .
9. , ..
. . - . ,1998. . 39 .
10. 26213-84. . .
11. 26213-91. . .
12. 27593-88. . .
13. , .. . :
, 1970, 289 .
14. , ... , , , ,
. : , 2008. 285 .
15. , .. . : , 1961. 422 .
16. . . .. : - , 2001. 688 .
PRODUCTIVITATEA I CALITATEA DIFERITELOR SOIURI ALE SFECLEI DE ZAHR
chiopu, Leonid, IP Institutul de Cercetri pentru Culturile de Cmp Selecia
In this article are presented the results of the survey about the efficiency of cultivation for industrial
purposes of different sugar beet varieties. From an economic point of view, the economic productivity of native
an fo foreign cultivation are the same. The use of foreign sorts is associated with the risk of yield loss and
product quality as they are not adapted to soil-climatic conditions of the Republic of Moldova. The real
profitability increases with the proper use of technical means in the performance of the technological process.
Key words: sugar beet, efficiency, cultivation, industrial purposes, different, varieties, economic,
productivity, yield, quality, profitability.
INTRODUCERE
tiina i practica a propus diferite tehnologii de cultivare ale sfeclei de zahr pentru mai multe zone
pedoclimatice [2, 3, 4, 5, 6]. Reieind din condiiile pedoclimatice se implementeaz cele mai efective i optime
procedee tehnologice, care au fost elaborate i testate n cercetrile anilor precedeni.
Principalele procedee tehnologice la cultivarea culturii sunt: lucrarea solului, procesarea i tratarea
seminelor, administrarea fertilizanilor, ngrijirea semnturilor n timpul vegetaiei i recoltarea. Orice eroare
comis la un procedeu tehnologic se reflect asupra produciei finale, de aceea, fiecare procedeu trebuie de
efectuat corect.
n producere se constat ca cele mai efective erbicide i lucrri mecanice sinestttoare nu sunt efective.
De aceea, mbinarea lucrrilor mecanice cu erbicidarea, dup prerea unor cercettori, este mai efectiv [5].
Cercetrile efectuate n anul 2012 ntr-un lot experimental demonstrativ au confirmat, ca cea mai
efectiv metod de ngrijire a semnturilor sfeclei de zahr cultivate n scopuri industriale din punct de vedere
economic i ecologic sunt lucrrile mecanice mecanizate [6].
n anul 2012, care a fost un an secetos s-a cptat cca 30 t/ha de rizocarpi. Mai favorabili pentru
cultivarea sfeclei de zahr au fost anii 2013-2014, unde ntr-un lot experimental demonstrativ s-au studiat diferite
soiuri de sfecl de zahr.
MATERIALE I METODE
Cercetrile experimentale au fost fondate pe un lot demonstrativ cu o suprafa de 6 ha anual att n
2013, ct i n 2014.
Anual au fost semnate 6 soiuri: 5 autohtone - Vodolei, Rada, Vilia, Albia i Favorit, care n anul 2013
a fost nlocuit cu Victoria n anul 2014 n comparaie cu hibridul strin Impact. n anul 2013 erbicidarea s-a
efectuat numai pe vegetaie de 2 ori cu erbicidul ARAMO 45, iar n anul 2014, erbicidele s-au administrat n sol.
n afara erbicidrii anual n ambele cazuri s-a efectuat dou lucrri mecanice mecanizate n timpul vegetaiei.
Toate lucrrile au fost efectuate mecanizat n afar anului 2014, cnd s-a efectuat suplimentar controlul densitii
n mod manual.
Datele obinute dup recoltare s-au prelucrat conform metodelor standard. Indicii principali fiind
densitatea plantelor, recolta biologic, coninutul de zahr i producia de zahr [1].

109

REZULTATE I DISCUII
n anii 2013-2014 condiiile climatice au fost favorabile pentru cultivarea sfeclei de zahr. Recolta
biologic n medie n aceti ani a constituit corespunztor 62,0 i 63,6 t/ha (tab.1). Tendina majorrii recoltei n
anul respectiv n diferit msur a constituit un factor determinat aproape la toate soiurile sfeclei de zahr
autohtone i cel strine. Numai soiul Albia nesemnificativ cedeaz recoltei anului 2013. Densitatea plantelor la
un hectar se afl la nivelul de 90-100 plante/ha cu excepia soiurilor Albia i Victoria, care au fost respectiv egal
cu 83,0 i 84,0 plante/ha n anul 2014, dar soiul strin Impact a atins un indici minim de 81,0 plante/ha. Nectnd
la numrul mic de plante recolta a fost maxim, care se explic prin administrarea uniform a plantelor pe
suprafaa cmpului. De aceea, e important nu numai numrul de plante pe o unitate de suprafa, dar i
uniformitatea administrrii plantelor, ce duce la o egal dezvoltare a lor. De asemenea, n 2013 recolta soiului
Impact a fost egal cu soiului Vilia depind celelalte soiuri cu excepia soiului Favorit, care a dominat
semnificativ cu o producie de 82,2 t/ha, dar cu coninutul de zahr minim de numai 15,6%, respectiv a constituit
maximala producie de zahr 12,82 t/ha.

Nr.

1
2
3
4
5
6
7
8

Tabelul 1. Produciei i calitatea diferitelor soiuri de sfecl de zahr cultivate n scopuri industriale
Soiul, hibridul
Densitatea
Recolta
Coninutul de Producia de zahr,
plante/ha
rizocarpilor,
zahr, %
t/ha
t/ha
2013
2014
2013
2014
2013
2014
2013
2014
media
Vodolei
102,0
110,0
52,8
59,8
17,7
17,6
9,30
10,58
9,94
Rada
100,0
90,0
55,5
66,2
18,1
18,0
9,99
11,98
10,99
Vilia
97,0
90,0
60,7
64,7
18,4
17,8
10,80
11,91
11,36
Albia
98,0
83,0
59,2
57,4
18,2
17,3
10,23
10,45
10,34
Favorit
95,0
82,2
15,6
12,82
12,82
Victoria
84,0
64,1
18,1
11,60
11,60
Impact
90,0
81,0
60,7
69,5
18,0
16,8
11,26
11,68
11,47
Media
97,0
89,7
62,0
63,6
17,4
17,88
10,72
11,57
11,22

n afar de soiul Favorit celelalte soiuri au format un coninut de zahr de cca 18,0% cu o mic reducere
la soiul Vodolei. n anul 2014 se observ la toate soiurile o mic scdere a coninutului de zahr, dar o reducere
semnificativ la soiul Impact. Putrezirea a 30% de rdcini n realitate, reduce n mod suficient producia de
zahr. n medie pe 2 ani dup coninutul de zahr se afl la un nivel cu indici minime la Favorit n anul 2013 i
la Impact n anul 2014.
Producia de zahr, care n total pe doi ani se afl n limitele 10,0-11,0 t/ha cu excepia Favoritului
(12,82 t/ha), cultivat numai n 2013. Totodat, producia de zahr ca i recolta este sporit n 2014. De asemenea,
din totalul produciei, media de zahr constituie un indice satisfctor 11,22 t/ha. Evident c din soiurile
autohtone la capitol produciei de zahr s-a manifestat mai pozitiv soiul Favorit cu o recolta sporit i coninutul
de zahr redus, ce, n mod considerabil, mresc cheltuielile la recoltarea i transportarea materiei prime la uzin.
Din soiurile autohtone care s-a manifestat relativ pozitiv se evideniaz hibridul Vilia i soiul Victoria n anul
2014, care sunt la nivel cu soiul strin Impact. Aproape de aceste soiuri s afl i hibridul Rada cu 10,99 t/ha.
CONCLUZII:
1. La cultivarea sfeclei de zahr n scopuri industriale n condiiile pedoclimatice ale anilor 2013-2014, cu
respectarea procesului tehnologic s-au cptat recolte cca 60 t/ha de rizocarpi i cu o producie de zahr de cca
10-12 t/ha.
2. Soiurile autohtone de sfecl de zahr se manifest pozitiv i nu cedeaz n productivitatea i calitatea
produciei finale soiului Impact.
3. Lucrrile mecanizate efectuate la ndeplinirea procedeelor tehnologice sunt necesare de perfecionat reieind
din condiiile pedoclimatice concrete ale anului.
BIBLIOGRAFIE:
1. , .. . . 5-, . . : , 1983. 351 .
2. Lcust, I.; Lco, Gh. Mecanizarea proceselor n fitotehnie. Chiinu: Centrul Ed. al UASM, 2003. 360 p.
3. Pesek, John. Alternative Agriculture. Washington, 1989, p.135-194.
4. , ..; , ..; , .. . : ,
1976. 512 .
5. Tcaci, L. Combaterea buruienilor culturilor de cmp. n: Cultura plantelor de cmp i perspective: Lucrrile
Conferinei Internaionale. Bli, 2004, p. 360-363.
6. chiopu L. Evaluarea eficienei diferitor procedee tehnologice de cultivare a sfeclei de zahr. n: Rezultatele i
perspectivele cercetrilor la cultura plantelor de cmp n Republica Moldova: Mat. conf. tiinifico-practice
consacrate aniversrii a 70 a fondrii ICCC Selecia, Bli, 20 iunie 2014. Chiinu, 2014, p. 325-327.

110


/
.., . ., ,
In this article it was presented the schemes for cultivation technologies of field crops and their change
for 70 years. It has been established that the climate change and the implementation of new cultivars was
changed the phytosanitari situation specifics of some technological elements and technological schemes in
general.
Key words: climate, cultivation technologies, field crops, diseases, pests.

- , ,
,
, . ,

, .
, ,
I XX ,
45-50 .

( .. , , (, ,
.). 5 : , , ,
. -
.

:
/ 2-3 ,
( ,
)
.
(1971-95 .) ,
, ,
. ,
.
, (
). 2 ,
(93,4%, 40,1 44,2% -
). :
:
(II ), ( 1,8 ,
). ,
, 2,9 , 1,4 . ..
,
( )
: . ,
,
2,7 2,4 , ,
1,9 1,88 , . ,
(, .),
(1,87 2,11 ) (
),
: , .

1,5-3,0-
() - .
: , , , ,
. [, 2005].
,
. 18-20% (30-33% -
), - 25-30% (

111

). 4-5 ,
2-3 .
. ,
,
,
() (
, ) .. , ,
.
()
(,
, ..).
, : ( 2-5
) ,
. (
) 5,5-6,0 ,
1,3 , 1,34 ..
( 1,88) ,
( 2,0 )
(1,95 ) ( 1,3 ).

. , ,

( 2,9 ) ( 2,8 ), ( 1,5 )
( 1,9-4,0 ).
. , , (I-II
), (I-II ),
39,5%, I 18,0%
[, 1971]. III I
c : 97,0 40,7% ( 2,4 ). ,
7 30
( I II 2,01 , ..
2,7 , 2,35; 2,2;
2,0 ..
, ..
/ , , ,
. ,
( ) , ,
.
,
(20 / 40 /)
: 1,19 1,49 - 1,59 1,66 , .
: 1,06 1,07 . , ,

(1,11 ) -
( 1,12 ). , (
)
( 1,37 1,06 ).
- [, , 1973].

( 2,4 3,3 ), ( 1,8
). [.. , 1936]
.
1,21 , ( 1,33 )
( 2,25 ). :
N30 N90 10,4 19,3% (.. 1,85
).
, - ,
( 1,37 ),
( 1,63 ). ()
( 1 )
-
: 1,67 - 1,57

112

. ,
,
- , ,
.
. , 2 ,
1,25-1,45 ,
() ( 1,2-1,5 ).
: 1,3 , 1,45 1,4 . ,
: 1,13
1,32 - .
, , .
.
1971-91 .
45 , (
)
.

/ . ,
():
( ), ,
.
, . , , . : ( )
, .
,
, : , .

.
: ,
, ,
, . ,
, , ,
, () ,
.
, ..
70-
, ( ),
,
( , , .).
(mini-till, no-till, stri-till
.),
: , ,
,
: :
, ;
; , , . ..
:
1. Ca
( , , ).
2
,
.
ACIUNEA FERTILIZRII FOLIARE ASUPRA PRODUCTIVITII I CALITII FRUCTELOR
Grican Sava, Dadu Zinaida, Polihovici Lidia, Crivaia Parascovia, Institutul tiinifico-Practic de
Horticultur i Tehnologii Alimentare
It was researched the comparative efficiency of foliar treatment of apple trees with the water-soluble
complex fertilizer (Cosir, Vitalviso Calmag+TE, Algomax Forte, Borviso) as wel as fertilizers containing
nitrogen applied by installments on the background of fertilizers with phosphorus and potassium.

113

It was established that the physiological state of the apple trees improved, the apple harvest increased
and duration of fruits storage enhanced.
Key words: foliar fertilizer, fertilizer, crop, pigments, nutrition.
INTRODUCERE
Aplicarea ngrmintelor, este o metod eficient de cretere a produciei de fructe. Ele se introduc att
n sol nainte de plantare, ct i ca hrni suplimentare n timpul perioadei de cretere a pomilor.
Este cunoscut c n cazul aplicrii ngrmintelor n sol principala cale de absorbie de ctre plante a
substanelor de nutriie mineral are loc prin rdcini. De rnd cu avantaje, aceast metod are i dezavantaje:
efectul ngrmintelor se observ dup civa ani, trecerea a unei pri din elemente n form neaccesibil,
levigarea elementelor n straturile adnci a solului i altele. n prezent, pe larg este folosit metoda aplicrii
ngrmintelor foliare prin care asigur productivitatea i calitatea produciei de fructe. Cea mai promitoare
metod de nutriie a plantelor o constituie hrnirea foliar, ceea ce nseamn nutriia prin aspirarea
ngrmintelor n form ionic prin frunze i alte pri ale plantelor. Pomii fructiferi absorb diferite cantiti de
substane nutritive pentru a crea o recolt mai mare n timpul perioadei de vegetaie. La nceputul perioadei de
cretere, pomii consum o cantitate mica de elemente nutritive, ns lipsa lor n aceast perioad reduce brusc
productivitatea plantelor. n aceasta i const efectul hrnirii foliare a pomilor cu substane nutritive, ntruct
pomii sunt cei mai sensibili la lipsa lor n perioada de vegetaie.
Scopul cercetrilor noastre const n studierea eficacitii aplicrii ngrmintelor complexe care nltur
deficitul substanelor nutritive pe parcursul perioadei de vegetaie a pomilor.
MATERIAL I METODE
Experiena a fost montat n secia experimental a Institutului tiinifico-Practic de Pomicultur i
Tehnologii Alimentare n plantaia de mr pe rod sdit n anul 2009, soiul Redcief, schema de plantare 4 x 1m.
ntr-o variant 30 pomi, cte 10 n 3 repetri. Solul cernoziom obinuit cu coninut mediu de fosfor i potasiu
i sczut cu azot.
Fertilizarea foliar cu soluii de ngrminte s-a fcut concomitent cu tratamentele pentru combaterea
vtmtorilor. n intervalul dintre rnduri solul s-a ntreinut ca ogor negru n alternare cu nierbare, care s-a
lucrat mecanic cu cultivatorul, grapa cu discuri i cositul masei vegetale a ierburilor. Pe fia de-a lungul
rndului cu limea de 1,0 m s-au aplicat erbicide pentru combaterea buruienilor.
Variantele s-au amplasat dup cum urmeaz n schema experienei.
Schema experienei

Tratamente
Creterea intensiv
La
d/o
a
fructelor
14
zile
Variante
nainte de
Dup
(mrimea
fructului)
dup
nflorire
nflorire
precedentu
1,5 cm
3,0 cm
l tratament
1
Martor
2
Cosir
2,0 l/ha
2,0 l/ha
2,0 l/ha
2,0 l/ha
3
Vitalviso Calmag+TE
5,0 kg/ha
5,0 kg/ha
4
Algomax Forte
3,0 l/ha
3,0 l/ha
5
Borviso
2,0 l/ha
2,0 l/ha
Pe parcursul perioadei de vegetaie s-a efectuat tratarea pomilor cu fertilizantul Cosir (patru tratamente)
Vitalviso Calmag+TE, Algomax Forte i Borviso cte dou tratamente. Pomii la martor au fost stropii cu ap
curat.
REZULTATE I DISCUII
Investigaiile au artat, c datorit fertilizrilor foliare s-a schimbat coninutul de substane nutritive
NPK i clorofil n frunze, care determin
potenialul activitii fotosintetice.
3
Valorile nivelului optim al coninutului
2,5
elementelor nutritive n frunze pentru specia
mr deviaz ntre 2,2-2,5% de azot, 0,3-0,45%
2
de fosfor i 1,2-1,8% de potasiu.
azot
1,5
Datele prezentate n figur ne relev
fosfor
faptul
c
coninutul de azot s-a mrit cu 181
potasiu
22%, iar coninutul de fosfor s-a mrit cu 240,5
52%, de potasiu cu 13-20% fa de martor.
0
Martor

Cosir
2+2+2+2
l/ha

Vitalviso
Calmag 5+5
kg/ha

Algomax
Forte 3+3
l/ha

Fig. 1. Aciunea fertilizrii foliare asupra


coninutului de NPK n frunze, % din masa
uscat.

Borviso 2+2
l/ha

114

n tabelul 1 sunt prezentate datele coninutului de clorofil A, B i suma acestora, precum i carotinoide,
determinate n faza de cretere intensiv a lstarilor i fructelor.
Aceste date ne arat o cretere a coninutului de clorofil i carotinoide in frunze dup aplicarea
fertilizanilor foliari, ceea ce a avut un impact pozitiv asupra creterii i dezvoltrii pomilor. Valoarea sumei
clorofilei (A+B) la martor a fost de 0,203% i carotinoide - 0,029%, la Cosir 2+2+2+2 l/ha - 0,266% i 0,034%.
La fertilizantul Vitalviso Calmag+TE 5+5 kg/ha - 0,349% i 0,044%, la Algomax Forte 3+3 l/ha- 0,389% i
0,036% iar la fertilizantul Borviso 2+2 l/ha- 0,250% i 0,033%.
Tabelul 1. Aciunea fertilizrii foliare asupra coninutului de clorofil i carotinoizi n frunzele de mr
Variante
% fa de
Clorofil, %
Carotinoide, %
martor

B
+B
Martor
0,120
0,083
0,203
100
0,029
Cosir 2+2+2+2 l/ha
0,163
0,103
0,266
131
0,034
Vitalviso Calmag+TE 5+5 kg/ha
0,200
0,149
0,349
171
0,044
Algomax Forte 3+3 l/ha
0,036
0,189
0,200
0,389
191
Borviso 2+2 l/ha
123
0,107
0,143
0,250
0,033
05
0,11
0,06
0,14
0,08
Studiile au artat c toate dozele au acionat pozitiv asupra masei i suprafeei foliare. Mrimi
semnificative se observ la aplicarea fertilizantului Algomax Forte 3+3 l/ha i Vitalviso Calmag+TE 5+5 kg/ha
comparativ cu Cosir 2+2+2+2 l/ha i Borviso2+2 l/ha. Indici de cretere a frunzelor au fost cel puin 13,22 cm2
pentru martor i 14,02 cm2 la Borviso 2+2 l/ha, n timp ce la variantele Algomax Forte 3+3 l/ha i Vitalviso
Calmag +TE 5+5 kg/ha respectiv 15,35 cm2 i 15,68 cm2.
O dovad direct a eficienei fertilizanilor foliari pentru culturile pomicole o reprezint productivitatea
pomilor i intensificarea proceselor de cretere i dezvoltare. n timpul perioadei de vegetaie a fost estimat
numrul de fructe, definite prin greutatea lor medie i productivitatea la hectar (tabelul 2). Pentru a evalua
calitatea a fost determinat masa medie i compoziia biochimic. Diferena numrului de fructe pe variantele
fertilizate a fost nesemnificativ, iar masa medie a unui fruct este mai mare dect la martor. Recolta fructelor la
hectar este cu 23-25% mai mare la utilizarea fertilizanilor Algomax Forte 3+3 l/ha i Vitalviso Calmag+TE 5+5
kg/ha i cu 13-18% mai mare la Borviso 2+2 l/ha i Cosir 2+2+2+2 l/ha comparativ cu martorul fr
ngrminte.

2014

Media

2013

2014

Media

% fa de
martor

2013

% fa de
martor

Tabelul 2. Aciunea fertilizrilor foliare asupra masei medii a fructelor i produciei de mere
Recolta ,
Masa medie a unui fruct, g
c/h
Variante

Martor
270,3 285,2
277,8
100
154
152
153
100
Cosir 2+2+2+2 l/ha
320,5 336,3
328,4
118
159
161
160
104
Vitalviso Calmag+TE 5+5 kg/ha
340,7 352,7
346,7
125
168
166
167
109
Algomax Forte 3+3 l/ha
332,2 349,7
340,9
123
167
170
169
110
Borviso 2+2 l/ha
310,8 318,9
314,8
113
156
159
158
103
05
0,04
0,06
0,05
0,07
n fructele mature colectate din toate variantele experienei s-a determinat coninutul de substan
uscat, zaharuri, acid ascorbic, acid titrabil, substane tonante i colorante (tab. 3). Dup rezultatele obiunute se
observ tendina de cretere a parametrilor biochimici n comparaie cu martorul. n variant Algomax Forte 3+3
l/ha s-au obinut fructe cu cel mai nalt coninut de substan uscat, zahr i vitamina C.
n variantele Cosir 2+2+2+2 l/ha i Borviso 2+2 l/ha coninutul de substan uscat este la nivelul
controlului.
Tabelul 3. Aciunea fertilizrii foliare asupra componenei biochimice a fructelor
Substane
Zahr
ZahaAcizi
Substane
VitaVariantele
uscate,
total,
roza,
titrabili,
colorante i
mina ,
%
%
%
%
tonante, %
mg/%
Martor
11,00
7,12
1,63
0,36
25,00
7,43
Cosir 2+2+2+2 l/ha
11,83
8,08
1,99
0,37
27,02
9,35
Vitalviso Calmag+TE 5+5
12,03
8,54
2,96
0,48
27,50
9,90
kg/ha
Algomax Forte 3+3 l/ha
12,23
7,76
2,78
0,46
33,26
11,88
Borviso 2+2 l/ha
11,70
8,5
1,74
0,48
32,70
9,15

115

CONCLUZII:
1. Aplicarea fertilizanilor au influenat pozitiv asupra calitii comerciale i compoziiei biochimice a fructelor,
au mrit coninutului de azot, fosfor i potasiu n frunze i a contribuit la sporirea clorofilei, carotinoidelor i
suprafeei foliare.
2. S-a obinut un spor a recoltei fa de martor cu 23% la aplicarea fertilizantului Algomax Forte 3+3 l/ha i cu
25% la Vitalviso Calmag+TE 5+5 kg/ha.
BIBLIOGRAFIE:
1. , .. . : , 1990. 351 .
2. ndrumri metodice pentru testarea produselor chimice i biologice de protecie a plantaiilor de duntori,
boli i buruieni n Republica Moldova. Chiinu, 2012. 286 p.
3. , .. .
, 2010. 398 .
4. Grigheli, Gh.; Dadu, C.; Lungu, V.; Galbur, O. ngrmintele organice i rolul lor n restabilirea fertilitii
solului. Chiinu, 2012. 90 p.
5. Balan, V.; Cimpoe, Gh.; Barbroie, M. Pomicultura. Chiinu, 2001. 452 p.
6. , .. . , 1983. 323 .
EFICIENA LUCRRII SOLULUI I ERBICIDRII
ASUPRA CRETERII I DEZVOLTRII BURUIENILOR PERENE CU RIZOMI
Grican, Sava, dr. n agricultur, Instilutul tiinifico-Practic de Horticultur i Tehnologii Alimentare
In this article are presented the results of research regarding the effectiveness of applying different
methods for the control of weeds in orchards. It was found that the use of mechanical method does not allow for
destruction of perennial weeds. That is why, it is necessary for the carrying out of several works during the
period of vegetation. Application of herbicides allows complete destruction of the aerial parts, but the root
system is not completely destroyed, this fact leads to their regeneration after a period of time.
Performing in complex, the application of herbicides and mechanical works are more effective at
destroying the aerial parts and root system.
Key words: soil, herbicides, weeds perennials, rhizomes.
INTRODUCERE
Ecosistemul se caracterizeaz prin componena speciilor, numrul lor, biocenoza pe care o formeaz
raportul dintre diferite grupe trofice, intensitatea de sintez i distrugere a substanei organice.
Buruienile sunt partea component a biocenozei pomicole i de aceea se impune studierea speciilor de
buruieni, numrul lor, biomasa pe care o formeaz n agroecosistemele pomicole n scopul elaborrii sistemului
integrat de combatere a buruienelor.
Dintre buruienile perene cu rizomi, n livezi predomin gramineele, din ele au fost evideniate
urmtoarele (n ordine de frecven descrescnd) pirul trtor, pirul gros, rocoel (Stellaria graminea), costreiul
mare i pe locuri mai joase i umede, buruiana Equisetum arvense care se nmulete cu rizomi, cu spori i cu
bulbi. Pe fond de multe specii anuale i bienale, aceste buruieni formeaz vetre uneori foarte dese i formeaz
tipul de mburuienare anuale perene cu rizomi.
Scopul cercetrilor const n a studia rezerva de organe vegetative de nmulire ale celor mai frecvente
buruieni perene cu rizomi: pirul trtor i pirul gros.
MATERIALE I METODE
Investigaiile au fost efectuate n plantaiile pomicole de prun i mr plantate n anii 1996, 2000, 2002
amplasate n zona central i sud-vest a Republicii Moldova cu diferite scheme de plantare.
Evidenierea buruienilor s-a fcut conform ndrumrilor metodice elaborate de VIZR (1990, 1995, 2002).
Buruienile n faza de plantule s-au identificat dup I. Vasilcenco, 1979; buruienile mature dup
ndrumtorii lui A. Fisunov, 1976 1984; V. Nichitin, 1983; T. Gheideman, 1986; seminele de buruieni s-au
identificat dup manualul V. Dobrohotov, 1961.
mburuienarea n plantaii a solului cu organele vegetative de nmulire a buruienilor perene cu drojoni i
cu rizomi conform metodei lui B. Smirnov. S-au dezgropat pe orizonturi cte 10 cm pn la adncimea 60 cm
rdcinile, drojonii, rizomii de pe o suprafa 0,25 m n 4 repetri, s-au numrat mugurii i s-au cntrit
rdcinile, drojonii, rizomii.
Buruienile perene cu rizomi au aprut n anul trei dup plantare, la nceput n numr mic, apoi a fost
mpnzit tot terenul, ndeosebi n fiile de-a lungul rndurilor de pomi, iar n intervalele dintre rnduri solul a
fost ntreinut ca ogor negru, pn la intrarea pomilor n rod, apoi s-au semnat ierburi perene graminee peste un
interval. n fiile de-a lungul rndurilor (0,8-1 m) au fost studiate urmtoarele variante - Martor prit, Martor
neprit, Uragan 5 l/ha, combatere mixt 2 prile manuale + Uragan 3 l/ha.
Sau colectat probe pe straturi pe parcele 0,25 m2 pe vetrele evideniate i s-a cercetat starea lor i
eficiena diferitelor metode de combatere.

116

REZULTATE I DISCUII
Investigaiile au artat, c buruienile perene cu rizomi au aprut n anul trei dup plantare, la nceput n
numr mic, apoi a fost mpnzit tot terenul, ndeosebi n fiile de-a lungul rndurilor de pomi.
n tabelele 1 i 2 sunt prezentate rezultatele cercetrii prii aeriene la pirul gros Cynodon dactyum
(L.) Pers. i pirul trtor Elytrigia repens (L.) Nevski.
n varianta Martor neprit pe 1 m2 au fost n mediu 4336 lstari aerieni la pirul trtor i 3600 la pirul
gros cu masa uscat corespunztor 1648 g/m2 i 1552 g/m2, deci lstari aerieni mai muli la pirul trtor i masa
sumar a lstarilor mai mare, dar masa fiecrui lstar este mai mic dect la pirul gros.
n varianta Martor prit de 4 ori n perioada de vegetaie s-a micorat esenial numrul de lstari aerieni
la fiecare din aceste buruieni, a sczut masa lor sumar, dar masa fiecrui lstar care a supravieuit a sczut
numai la pirul trtor cu 24% fa de Martor neprit, la pirul gros lstarii care au supravieuit nu i-au diminuat
masa.
Tabelul 1. Eficiena combaterii pirului gros Cynodon dactylon (L.) Pers. (medie pe 1 m2)
Numrul
Masa, grame
Variantele experienei
lstarilor aerieni
a tuturor
a unui lstar
lstarilor
Martor neprit
3600
1552
0,43
Martor prit - de 4 ori n perioada de vegetaie
2148
948
0,44
Uragan, 5 l/ha
4408
1748
0,40
Tabelul 2. Eficiena combaterii pirului trtor Elytrigia repens (L.) Nevski (medie pe 1 m2)
Numrul
Masa, grame
Variantele experienei
lstarilor aerieni
a tuturor
a unui lstar
lstarilor
Martor neprit
4336
1648
0,38
Martor prit de 4 ori n perioada de vegetaie
2884
844
0,29
Uragan, 5 l/ha
6496
1844
0,28
n varianta cu erbicidare cu Uragan n doz mare 5 l/ha (2,4 kg s.a. la 1 ha stropit) ambele buruieni au
regenerat i lstarii nou formai au fost foarte muli 6496 /m2 la pirul trtor i 4408 /m2 la pirul gros cu masa
sumar respectiv 1844 i 1748 g/m2, dar fiecare mugur cu rezerv de substane nutritive mult mai mare dect n
variantele fr erbicidare.
Partea subteran este foarte diferit la pirul gros i pirul trtor dup numrul de rdcini i rizomi i
lungimea lor, numrul de muguri pe rizomi, substane nutritive pentru fiecare mugur i adncimea de rspndire
n sol.
La pirul gros se tie c rizomii sunt mai groi dect la pirul trtor i au capacitate de a se transforma n
lstari aerieni i dup un timp oarecare s ntre n sol i se prefac iar n rizomi. Pirul trtor n-are aceast
capacitate, la el se deosebete cert ce este tulpin i ce este rdcin sau rizomi.
n varianta Martor neprit la pirul gros, rizomii au fost pn la adncime mare 70 cm, la Martor cu 4
prile manuale n perioada de vegetaie pn la 60 cm, n varianta cu Uragan 5 l/ha (fr prile manuale)
pn la 60 cm i n variante cu combatere mixt (dou prile manuale + Uragan 3 l/ha) pn la 50 cm adncime
(tab. 3 - 4).
Lungimea sumar a rdcinilor i rizomilor n tot stratul studiat la Martorul neprit a atins la pirul gros
47120 cm/m2, la Martorul prit de 4 ori n perioada de vegetaie 40988 cm/m2, n varianta cu dou prile +
Uragan 3 l/ha 45424 cm/m2 i n varianta fr prile cu doza mare de Uragan 5 l/ha buruienile a regenerat i
au atins 73892 cm/m2.
Pirul gros acumuleaz n sol foarte mult mas organic 4,892 kg/m2 la Martor neprit sau 48,92
t/ha. Rdcinile i rizomii lui mpart solul n elemente structurale.
Sa constatat c numrul de muguri pe rizomi la pirul gros scade cu adncimea, iar la Martorul neprit
fiecare rizom este asigurat cu substane nutritive mai multe la adncime mai mare (tab. 3).
Patru prile manuale n perioada de vegetaie nu numai nu scad numrul de muguri pe rizomi, dar nici
nu micoreaz masa organic n stratul studiat. Cantitatea de substane nutritive cu care este asigurat fiecare
mugur este maxim n stratul 40-50 cm, ceea ce contribuie la capacitate foarte mare de regenerare. Aadar, prin
prit manual pirul gros este de necombtut. Prilele manuale nu diminueaz vitalitatea pirului gros, rizomii i
mugurii pe ei sunt sntoi i au putere mare de regenerare dup fiecare pril.
Dezvoltarea prii subterane la pirul gros este foarte diferit pe variantele cu Uragan. Erbicidarea cu
doz maxim admisibil a distrus complet partea aerian, dar peste cteva sptmni s-a regenerat fiindc n sol
au rmas la adncimea 20-60 cm 1308 rizomi vii la 1 m2 cu masa 284 g/m2. n stratul arabil procentul de pieire a
rizomilor i mugurilor a fost nalt, n stratul 0-10 cm 95% dup numr i 88% dup mas, n stratul 10-20 cm
corespunztor 90 i 81%. Spre deosebire de stratul arabil, n straturile subiacente, procentul de pieire dup numr
a fost mai mic dect dup mas (tab. 4). Deci doza nalt de Uragan nu este acceptabil, produsul nu se transfer
spre mugurii pe rizomii adnci, dar scade esenial masa lor, fiindc a fost distrus partea aerian care
fitositetizeaz.

117

n varianta cu metoda mixt tot n-a fost combatere eficient. n sol au rmas multe rdcini vii cu
rizomi i muguri, masa crora s-a diminuat abia cu 44-54% fa de cea iniial.
Pirul trtor are rizomii amplasai mai la suprafa dect pirul gros i cantitatea lor, precum i numrul
de muguri scade brusc cu adncimea (tab. 5, 6). Aa, n varianta Martorul neprit s-au evideniat 30272
muguri/m2 n stratul 0-10 cm, 3760 muguri/m2 n stratul 10-20 cm i numai 416 muguri/m2 n stratul 20-30 cm
(la pirul gros n acest strat de 8 ori mai muli muguri i de 3,68 ori mai multe substane nutritive pentru fiecare
mugur).
Patru prile manuale n perioada de vegetaie nu scad esenial numrul i lungimea rdcinilor i
rizomilor la pirul trtor, iar masa lor crete, de asemenea crete numrul de muguri pe rizomi, adncimea la care
ei se gsesc i, mai ales, crete cantitatea de substane nutritive pentru fiecare mugur. Pirul trtor este mai mult
afectat de Uragan dect pirul gros. n comparaie cu Martorul neprit numrul de rizomi s-a micorat n varianta
cu dou prile + Uragan 3 l/ha de 3 ori, lungimea lor de 2 ori i masa de 3,2 ori. Uragan n doz mare nu este
eficient, probabil sunt bariere fiziologice i morfologice care mpiedic transmutarea produsului aplicat n
concentraie mare spre locul de aciune.
Este de remarcat, c n varianta cu Uragan 5 l/ha la pirul trtor n straturile 30-40 i 40-50 cm au rmas
336 rdcini vii, care pot regenera i vor da noi lstari.
Tabelul 3. Influena ntreinerii i lucrrii solului asupra prii subterane a pirului gros (media pe 1 m2)
Rdcini i rizomi
Substane
Variantele
Adncimea,
Muguri pe
nutritive
numr
lungimea,
masa,
experienei
cm
rizomi
pentru un
cm
grame
mugur, mg
0-10
1760
25968
1748
12992
134,54
10-20
1488
14464
1684
6912
243,63
20-30
752
6688
1092
3424
318,92
Martor neprit
30-40
3712
116
40-50
3328
120
50-60
2496
84
60-70
1280
48
0-70
14816
47120
4892
23328
0-10
1584
21256
1648
14364
114,73
10-20
1204
13368
1596
9244
172,65
Martor prit 4
20-30
1088
6364
1124
4084
275,22
ori
30-40
2844
156
2248
69,39
n perioada de
40-50
2384
188
468
401,71
vegetaie
50-60
1724
132
0-60
10828
40988
4844
30408
Tabelul 4. Influena erbicidrii i metodei complexe (prit manual + erbicidare) asupra prii
subterane a pirului gros (media pe 1 m2)
Rdcini i rizomi
Rizomi cu muguri
Substa
Rizomi cu muguri
Procentul
Variant Adnci
vii
ne
necrozai
de
ele
mea,
nutriti
pieire
experie
cm
ve
num lungi
mas num lungi
mas
num lungi
mas
dup du
nei
pentru
r
mea,
a,
r
mea,
a,
r
mea,
a,

p
un
cm
gra
cm
gra
cm
gra
num ma
me
me mugur
me
r
s
, mg
0-10
170 24768 876 836 15676 428 511,9 872
9092
448
51
51
Dou
10-20
8
12428 428 484
4844
196
6
640
7584
232
57
54
priri
20-30
112
4036
316 348
1248
152 404,9 440
2788
164
56
52
manual
30-40
4
2884
35, 168
836
20
6
156
2048
15,
48
44
e+
40-50
788
1308
6
112
468
121 436,7
16
840
6
12
51
Uragan 0-50 324 45424 24, 194 23072 808
8
212 22352 12,
, 3 l/ha
128
4
8
119,0
4
4
407
168
5
872
2
0
107,1
4
0-10
202 29316 136 108
1248
168 1555, 192 28068 119
95
88
10-20
8
16632
4
136
1396
156
55
0
15236
6
90
81
Uragan
20-30
136 13248 844 440
2048
212 1147, 122 11200 688
65
73
,
30-40
4
8632
788 336
484
36
06
8
8148
576
62
94
5 l/ha
40-50
126
3988
596 288
388
24
481,8 828
3600
560
59
95
50-60
8
2076
348 244
168
12
2
540
1908
324
45
95

118

0-60

608
192
96
32
8
936
192
144
336

421,05
416,67
375,00
450,00
1050,00
-

10640
2736
936
256
56
14624
-

256
80
36
14,4
8,4
394,8
-

640
448
96
32
8
1224
1120
96
16
112
1344

10240
6384
904
256
56
17840
6416
576
128
7120

404
160
20
11,2
5,2
600,4
-

dup
numr
dup mas

Substane
nutritive pentru
un mugur, mg

660
240
56,0
25,6
13,6
995,2
174,4
18,4
5,6
4,4
2,0
204,8

masa,
grame

numrul de
rizomi
lungimea
rizomilor,
cm
masa,
grame

20880
9120
1840
512
112
32464
13536
1216
272
15024

lungimea,
cm

masa,
grame

1248
640
192
64
16
2160
1120
96
16
309
144
1680

numr

lungimea,
cm

Uragan,
5 l/ha

0-10
10-20
20-30
30-40
40-50
0-50
0-10
10-20
20-30
30-40
40-50
0-50

numr

Dou
prile
manuale +
Uragan, 3
l/ha

Adncimea, cm

Variantele
experienei

876 73892 252 155


5732
608 107,1 416 68160 240
704
419
2
4
204
358
448
2
83,33 513
4
668
49,18
6
8
Tabelul 5. Influena ntreinerii i lucrrii solului asupra prii subterane a pirului trtor (medie pe 1 m2)
Rdcini i rizomi
Numrul
Substane
Adncimea,
de muguri
nutritive
Variantele experienei
cm
pe rizomi
pentru un
numr
lungimea,
masa,
mugur,
cm
grame
mg
0-10
3328
63584
2704
30272
89,32
10-20
768
6720
168
3760
44,68
Martor neprit
20-30
128
1040
36
416
86,54
30-40
2576
104
0-40
6800
71344
3012
34448
0-10
3172
60048
2836
33560
84,50
Martor prit 4 ori
10-20
828
6388
244
3912
62,37
n perioada de vegetaie
20-30
232
884
68
604
112,58
30-40
2044
168
124
248
500,00
0-40
6276
67488
3272
38324
Tabelul 6. Influena erbicidrii i metodei complexe (prit manual + erbicidare) asupra prii
subterane a pirului trtor (medie pe 1 m2)
Rdcini i rizomi
Rizomi i muguri vii
Rizomi cu muguri
Procent
necrozai
de pieire

51
70
50
50
50
-

61
73
46
44
38
-

CONCLUZII:
1. Din cauza imposibilitii de artur adnc pe toat suprafaa,buruienile perene cu rizomi n livezi sunt greu de
combtut din cauz c artura adnc nu se petrece pe toat suprafaa dar numai n intervalele dintre rnduri, de
aceea n fiile de-a lungul rndului buruienile perene pentru combaterea complet necesit timp ndelungat.
2. Prirele manuale opresc, ncetinesc pe un scurt timp creterea acestor buruieni, iar dozele mari de Uragan nu
sunt eficiente. Metoda complex este mai eficient dect prilele manuale, dar trebuie repetat muli ani la rnd
pentru o combatere eficient.
3. Pirul gros i pirul trtor sunt foarte vivace i de aceea orice metod poate doar s ncetineasc creterea lor,
ceea ce duce la dispariia temporar a lstarilor aerieni, iar n sol rmn rdcini i rizomi vii care pot regenera.
4. Factorul principal de regenerare la pirul gros este cantitatea mare de substan de rezerv n partea subteran,
iar la pirul trtor capacitatea de a trece n stare latent pe timp nelimitat.
BIBLIOGRAFIE:
1. , .. . , 1979. 344 .
2. , .. . , 1983. 453 .
3. , ..; , ..; , .. . . , 2001. 357 .
4. , .. . , 1976.175 .
5. , .. . , 1984. 319 .
6. , .. . ,1986. 638 .

119

STAREA ELEMENTELOR NATURALE RARE DIN UNELE ARII PROTEJATE DE STAT


Begu Adam, dr. hab. n biologie, conf. univ., cerct. t. principal, Liogchii Nina, dr. n biologie, cerc. t.
coodonator, Brega Vladimir dr. n chimie, cerc. t. coordonator, Braoveanu Valeriu, conf. cercet., cerct. t.
coordonator, Donica Ala., dr. n biologie, cerc. t. coordonator, Fasola Regina, dr. n biologie, cerct. t. sup.,
Institutul de Ecologie i Geografie a AM
The state of natural rare elements from certain state protected areas. This article presents the study
results of the natural elements` state from certain natural areas protected by the state, located in the Dniester river
basin from the North of Moldova. The emphasis is on evaluating the impact of the pollution sources, the
concentration of the heavy metals in soil, the state of specific elements and biological diversity. The abundance
of rare species was established and for some of them new habitats were registered.
Key words: state protected natural areas, pollution sources, negative impact, specific elements,
biological diversity, rare species, abundance, new habitats.
INTRODUCERE
Protecia i conservarea ecosistemelor naturale este o prioritate a multor ri, inclusiv i a Republicii
Moldova. Msuri stricte n aceast privin sunt stabilite n tratatele internaionale din domeniul diversitii
biologice i n materialele Conveniilor de la Ramsar (1971), Washington (1973), Bon i Berna (1979), Florena
(2000). n Republica Moldova exist o reea de arii naturale protejate de stat (ANPS) [15], care include obiectele
i complexele naturale cu valoare incontestabil pentru conservarea i protecia elementelor biotice i abiotice
rare, specifice categoriilor de protecie. Prin respectarea regimului de protecie n ANPS pot fi asigurate condiii
favorabile de conservare i restabilire a diversitii biologice i habitatelor naturale, pentru studierea proceselor
naturale, restabilirea echilibrului ecologic i pentru educaia ecologic a populaiei.
Actualmente, securitatea ecosistemelor naturale i, n acelai timp, condiiile de via ale omului sunt
ameninate de impactul antropic i procesele atmosferice, care continu s influeneze tot mai mult asupra
mediului nconjurtor. n acest context, se impune un studiu de evaluare a ANPS n scopul stabilirii strii
elementelor naturale rare i naintarea propunerilor de asigurare a funcionalitii stabile a ecosistemelor i a
dezvoltrii durabile. Rezultatele evalurii ANPS din bazinul fluviului Nistru vor contribui la formarea i inerea
Bncii de date a Cadastrului ANPS, de care Institutul de Ecologie i Geografie este responsabil prin HG Nr. 414
din 02.05.2000.
MATERIALE I METODE
Obiectul de cercetare include 25 arii protejate din bazinul fluviului Nistru (Fig. 1). Pentru realizarea
scopului acestui studiu au fost efectuate cercetri n teren i laborator pe parcursul perioadei 2011-2014.
Cercetrile n teren au constat n: studiul ecosistemelor naturale n principalele faze fenologice de
dezvoltare a vegetaiei efemeroide, anuale i perene i a lumii animale; inventarierea speciilor rare; stabilirea
abundenei speciilor valoroase [4]; evaluarea strii elementelor specifice; nregistrarea surselor de poluare;
colectarea probelor de sol i biot [13].
Cercetrile n laborator au inclus: determinarea apartenenei sistematice a speciilor colectate i a
statutului de protecie al speciilor rare, utiliznd literatura de specialitate [1-3, 5, 6, 8-11, 16-20, 22];
determinarea coninutului metalelor grele n sol prin metoda spectroscopiei fluorescente cu raze X [23];
caracteristica surselor de poluare ale aerului atmosferic i cantitile de noxe emise n baza informaiei Anuarelor
Departamentului de Statistic [12] i programul EMEP [21].

Figura 1. Schema amplasrii ANPS cercetate.

120

REZULTATE I DISCUII
Impactul surselor de poluare. Impactul antropic asupra ecosistemelor studiate i riscurile de mediu
asociate de acest impact se manifest preponderent prin poluarea atmosferic de la sursele locale i
transfrontaliere i n urma scurgerilor de suprafa ori amplasarea deeurilor n preajma acestora.
Analiza emisiilor de la sursele locale pe parcursul ultimei perioade ne permite s constatm o dinamic
uor cresctoare, mai cu seam, a emisiilor de la sursele de poluare mobile (Fig. 2), ceea ce demonstreaz
aportului sporit al transportului auto la poluarea local i ntr-o msur mai mic - a sectoarelor energetic i
industrial.
Figura 2. Dinamica emisiilor de la sursele
150
fixe () i mobile () de poluare din
Republica Moldova, kt/an.
100

Impactul magistralelor auto se face resimit


la distana de 50-100 m, iar cel de la sursele fixe
are o aciune semnificativ la distana de 4-5 km
0
de la sursa de poluare. Aceti parametri au fost
1997 1999 2001 2003 2005 2007 2009 2011 2013
stabilii prin utilizarea programului de calcul a
concentrailor de NOX i SO2 provenite de la
sursele de poluare din Soroca, Floreti, Drochia, Bli, Rezina, Rbnia, care la nivelul solului sunt mai mici de
0,1 CMA. Comparnd cantitile emisiilor n precipitaii, conform datelor Programului European de Monitoring
i Evaluare (EMEP) [21], constatm prevalarea cotei emisiilor de la sursele de poluare transfrontalier.
Coninutul metalelor grele n sol. Dintre noxele poluante, dup toxicitate i gradul de afectare a
componentelor ecosistemului, un rol deosebit revine metalelor grele, care sunt eliminate n atmosfer mpreun
cu gazele de eapament, emisiile de la ntreprinderile industriale, substanele chimice utilizate n agricultur etc.
n acest context a fost determinat coninutul metalelor grele n mostrele de sol (0-20 cm) din obiectele de studiu.
n baza scalei de gradaii a nivelului concentraiei metalelor grele n solurile din Republica Moldova [7]
am constatat c coninutul metalelor grele n stratul superior al solului, dintre cele ase niveluri, s-a ncadrat n 4
din ele, acestea fiind: sczut, mediu, sporit i mare, excluznd nivelurile foarte sczut i foarte mare (Tab. 1).
50

Nr.
d.o.
1.
2.
3.
4.
5.
6.

Obiectul de studiu

Tabelul 1. Coninutul metalelor grele n sol (0-20 cm), mg/kg s. u.


Cu
Ni
Pb
Zn
Co
Cr

MNB Lipnic
29
24
7
53
14
79
RNS Mestecni
28
38
2
55
20
81
RNS Climui
12
33
3
56
22
78
RP Clreuca
39
25
15
65
14
70
RP La 33 de Vaduri
34
30
11
50
16
70
MNGP Falia tectonic de lng s.
11
28
12
57
24
74
Naslavcea
7.
RNPM Cernoleuca
37
36
61
14
80
8.
MNB Rudi-Gavani
40
30
13
66
6
72
9.
AMM Lunca cu iarba cmpului
52
39
63
81
stolonifer (s. Briceva)
10.
AMM Lunca mltinoas cu trestie (s.
45
38
68
6
75
Maramonovca)
11.
RNS Bxani
31
32
12
52
21
89
12.
RP Holonia
48
52
<8
91
50
87
13.
MNB Blata
37
39
<8
72
39
97
14.
MNB Cuhureti
51
55
<8
85
48
103
15.
RP Cosui
41
43
3
77
46
84
16.
RNMP Rdoaia
48
75
<8
127
17.
MAP Parcul din s. Temeleui
56
52
<8
77
18.
MAP Parcul din s. Cubolta
57
84
5
156
19.
MAP Parcul din s. Cuhuretii de Jos
33
63
9
152
20.
Sistemul de perdele forestiere de protecie
90
53
70
din preajma mun. Bli
Pragul de alert (PA) [14]
100
75
50
300
30
100
Pragul de intervenie (PI) [14]
200
150
100
600
50
300
Diapazonul n solurile RM [7]
2-400
5-75
5-30
10-166
4-18 25-145
Legenda: MNGP monument al naturii geologic i paleontologic, MNB monument al naturii botanic,
RNS rezervaie natural silvic, RNPM rezervaie natural de plante medicinale, RP rezervaie peisajer,
AMM arie cu management multifuncional, MAP monument de arhitectur peisajer.

121

n unele cazuri se atest concentraii sporite ale Ni, Co i Cr astfel, nct, o depire a pragului de alert a
Ni se atest n MAP Cubolta, a coninutului de Co - n RP Holonia, MNB Cuhureti, RP Cosui i MNB
Blata, iar la limita pragului de alert este coninutul Cr n MNB Cuhureti i MNB Blata. Cu toate acestea,
concentraiile metalelor grele nregistrate nu ating valori ce depesc pragul de intervenie, cu att mai mult ale
celui de poluare, fapt ce nu prezint pericol de toxicitate pentru plante i organismele din sol, dar nu exclude
posibilitatea transmiterii lor prin lanul trofic spre nivelurile mai superioare i acumularea lor n organismul
animalelor.
Starea elementelor specifice i a diversitii biologice. n cadrul cercetrilor n teren a fost evaluat
starea elementelor specifice ale ariilor n studiu, apreciat corespunderea categoriei de protecie, nregistrate
speciile valoroase de flor i faun i stabilit starea i abundena speciilor rare. A fost constatat c n majoritatea
ANPS elementele specifice sunt n stare satisfctoare i corespund categoriei de protecie a ANPS cu excepia
unor arii, precum MNB Lipnic i MNB Blata, unde, la momentul evalurii, au fost nregistrate exemplare de
arbori seculari n stare de degradare complet. n stare precar sunt i elementele arhitecturale i peisajere ale
categoriilor de arii protejate MAP, mai cu seam ale MAP Parcul din s. Cubolta, unde au fost nregistrate urme
de ruguri i depozite de gunoi menajer. Cldirea conacului i havuzul din fa sunt n stare dezastruoas.
Aspectul estetic al parcului este diminuat de o serie de construcii ale fostului sanatoriu. Aleile s-au transformat
n poteci nguste, greu de strbtut, mpnzite de ierburi, iar speciile rare, att locale, ct i formele exotice de
arbori sunt reprimate de speciile invazive, ca ararul american (Acer negundo) i oetar (Ailanthus altissima).
De rnd cu elementele specifice protejate n funcie de categoria de protecie, ANPS sunt i habitate
favorabile pentru conservarea i protecia diversiti biologice. n acest sens, prezena speciilor rare cu statut de
protecie la nivel naional, regional i internaional este un indicator al valorii ariei protejate. Rezultatele
cercetrilor pun n eviden c cea mai bogat i mai divers este flora i fauna ariilor protejate amplasate n
fondul forestier, mai cu seam n: RP La 33 de Vaduri, RP Rudi-Arioneti, MNB Rudi-Gavani, RP Cosui i RP
Holonia. Acestea dispun i de un relief foarte variat, ceea ce creeaz condiii favorabile pentru diferite tipuri de
vegetaie. n ariile menionate au fost nregistrate cele mai multe specii rare de plante cu statut de protecie la
nivel naional, regional i european, demonstrat prin prezena lor pe Lista speciilor rare i n Cartea Roie a
Republicii Moldova (2001), Lista Roie i Cartea Roie a Romniei, Cartea Roie a Ucrainei, Lista Roie
European i Anexele Conveniilor de mediu (Fig. 3).
120
110
100
90
80
70
60
50
40
30
20
10
0
1

6
R

CRRM

9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
LRR

CRU

LRE

C Wash

C Berna

Figura 3. Efectivul i statutul de protecie ale speciilor rare de plante


Legenda: 1.MNB Rudi-Gavani, 2. RP Rudi-Arioneti, 3. RP Cosui, 4. RP Holonia, 5. RP La 33
de Vaduri, 6. RP Clreuca, 7. MNGP Falia tectonica de ling s. Naslavcea, 8. RNS Climui, 9. RNS Bxani,
10. RNPM Cernoleuca, 11. RNPM Rdoaia, 12. MNB Lipnic, 13. MNB Blata, 14. MNB Cuhureti, 15. RNS
Mestecni, 16. MNGP Afloriment de cremene compact, 17. MNGP Rpa Carpov Iar, 18. MNGP Rpa Rudii
Iar, 19. MNGP Stnca Japca, 20. MNGP Rpa Nmlvii, 21. MAP parcul din s. Temeleui, 22. MAP parcul din
s. Cubolta, 23. MAP parcul din s. Cuhuretii de Jos.
Mai srace n biodiversitate sunt ariile protejate din categoriile MNGP - menirea crora este de a proteja
elementele geologice i paleontologice i MAP unde sunt protejate edificii arhitecturale i elemente de
arhitectur peisajer. Dar aceasta nu exclude i protecia diversitii florei i faunei. Din acest punct de vedere
menionm aria MNGP Falia tectonic de lng satul Naslavcea, unde a fost nregistrat un numr destul de mare
de specii rare de plante i animale. ns, criteriul cantitativ nu ntotdeauna reflect valoarea obiectului protejat.
Bunoar, n RNS Mestecni stratul ierbos nu este foarte bogat n specii rare, dar aici este protejat specia de
mesteacn (Betula pendula), aria prezentnd limita de rspndire sud-vestic a mesteacnului n Europa de Est.
n baza evalurii strii RNS Mestecni au fost nregistrate doar cteva exemplare de arbori de mesteacn care,

122

30

30

10

R, CRU, LRE
CRRM

30
10

20
10

10

8
10

Galanthus nivalis

CRRM, LRR,
CRU, CWash

80

30

10

Pulsatilla
grandis

CRRM, LRR,
CRU

Fritillaria
meleagroides

CRRM, CRU

Phyllitis
scolopendrium

CRRM

Convallaria
majalis

2
3
4

5
-

10

15
-

5
-

25

10

10

25

60

5
7

5
-5

7
30

50

MNPM
Rdoaia

RP Cosui

MNB RudiGavan

CRRM, LRR,
CRU, CWash.
R, CRU

Denumirea
speciei

RP RudiArioneti

MNGP
Falia tect.
s. Naslacea

Cephalanthera
damasonium
Staphylea
pinnata
Lilium martagon
Athyrium
filix
femina

Nr.
d.o.

RP
Clreuc
a
RP
Holonia

Statut
de protecie

RP La 33
de Vaduri

dup starea de sntate, pot fi atribuii la categoria arbori sntoi. Multe exemplare au vrfurile frnte (rezultat
al aciunii vntului, ploilor toreniale, chiciurii), crengile i tulpinile afectate (circa 20%) i prezena frecvent a
scorburilor. O perspectiv n pstrarea valorii acestei rezervaii este conservarea celor circa 80 exemplare de
puiei de mesteacn, amplasate pe malul abrupt al ravenei, de-a lungul frontierei cu Ucraina.
n aria protejat MNPM Rdoaia elementele floristice specifice sunt prezentate de speciile de plante
medicinale, care sunt prezente aici din abunden. Printre acestea au fost nregistrate i specii rare precum: lalea
pestri (Fritillaria meleagroides), crin de pdure (Lilium martagon), strigoaie neagr (Veratrum nigrum). n
rezervaie se atest unele parcele de lcrmioare (Convallaria majalis), cu gradul de acoperire de 50-70% i lalea
pestri, cu gradul de acoperire de circa 25-30%. Aici au fost semnalate i specii rare de animale: bursuc (Meles
meles), cprior (Capreolus capreolus), rdaca (Lucanus cervus), care ntregesc valoarea ariei protejate.
Incontestabil este i valoare ariilor RP Clreuca i MNGP Falia tectonic de lng s. Naslavcea,
ca habitate pentru specia Pulsatilla grandis, a RP La 33 de Vaduri cu cel mai extins areal al speciilor
Galanthus nivalis i Hepatica nobilis a RP Rudi-Arioneti - cu Phyllitis scolopendrium. Pentru unele specii rare
de plante a fost nregistrat abunden (Tab. 2).
Tabelul 2. Abundena /acoperirea substratului speciilor valoroase.

10

Scopolia
CRRM, CRU
5
carniolica
12
Hepatica nobilis
CRRM
70
10
40
10 7
7
13
Polystichum
CRRM
10 aculeatum
14 Epipactis
R; LRR; CRU
5
7
helleborine
Legenda: R specie rar pe teritoriul Republicii Moldova, CRRM sp. n Cartea Roie a Republicii
Moldova, LRR sp. pe Lista Roie a Romniei, CRU sp. n Cartea Roie a Ucrainei, LRR sp. pe Lista Roie
a Europei, CWash. sp. n Anexele Conveniei de la Washington, CBerna sp. n Anexele Conveniei de la
Berna.
Din datele referitoare la abundena speciilor rare constatm c gradul de acoperire a substratului n
multe rezervaii este mai mic de 10%. Aceasta ne demonstreaz importana ariilor protejate n pstrarea i
conservarea diversitii biologie i ne motiveaz de a propune fortificarea msurilor de protecie.
Studiul literaturii de specialitate [5, 20, 22] privind rspndirea speciilor rare ne permite s stabilim c
unele specii rare nu au fost menionate anterior n ariile cercetate. Astfel, pentru speciile Galanthus nivalis i
Athyrium filix-femina, aria protejat RP Clreuca servete drept habitat nou, iar pentru speciile Hepatica
nobilis i Pulsatilla grandis drept habitate noi au fost identificate ariile MNGP falia tectonic de lng s.
Naslavcea i RP Clreuca. Pentru specia Polystichum aculeatum, care se ntlnete mai frecvent n
ecosistemele din bazinul r. Prut, aria protejat RP Rudi-Arioneti a fost identificat ca unicul loc de cretere din
bazinul r. Nistru. Aceast rezervaie este un habitat nou i pentru speciile de animale: Felis silvestris, pentru care,
conform CRRM (2001), drept areal de rspndire este indicat zona cursului inferior al Nistrului, Mustela

123

erminea - indicat pentru pdurile din cursurile mijlociu i inferior ale Prutului, cel inferior al Nistrului i zona
central a Codrilor i Xylocopa valga, cu areal restrns, indicat doar n dou locuri din zona central a RM.
Pentru prima dat au fost semnalate i speciile de plante: Pulsatilla grandis, Crocus reticulatus i
Tulipa biebersteiniana i de animale: Lutra lutra, Mustela erminea, Felis silvestris, Xylocopa valga i
Callimorpha quadripunctaria. - n MNB Rudi-Gavani; speciile: Crocus reticulatus, Cephalanthera
damasonium, Scutellaria supina Rhytidiadelphus triquetrus - n RP Cosui; speciile Fritillaria meleagroides,
Cephalanthera damasonium, Scopolia carniolica i Athyrium filix femina - n RP Holonia; Galanthus nivalis i
Ramalina farinacea - n MNB Cuhureti; Lunaria annua n RNS Bxani i Fritillaria meleagroides n
RNPM Rdoaia. Pentru aceste specii ariile protejate menionate servesc ca habitate noi nregistrate i meninerea
unui echilibru rezonabil ntre componentele biotice i abiotice, n special legat de calitatea habitatului, este o
condiie strict necesar pentru conservarea acestor specii n ariile respective.
CONCLUZII:
1. Principalele surse de poluare a obiectelor de cercetare sunt sursele transfrontaliere, ns nu se atest poluarea
aerului cu SO2 i NOx, coninutul acestora constituind 0,1 CMA.
2. Concentraia metalelor grele n solul din majoritatea ariilor cercetate nu ating valori ce depesc pragul de
intervenie, cu att mai mult ale celui de poluare, fapt ce exclude prezena polurii solului cu metale grele i
riscul de toxicitate pentru plante i animale.
3. Elementele specifice ale ariilor cercetate corespund categoriilor de protecie, starea lor fiind satisfctoare, cu
excepia ariilor din categoria MAP, care necesit restaurare i amenajare. Se recomand monitorizarea i
eliminarea din ariile protejate a speciilor invazive de arar american i oetar, care reprim speciile de baz.
4. Valoarea floristic i faunistic a obiectelor cercetate const n conservarea unei diversiti mari de specii
comune i rare, care este mai bogat i mai divers n ariile protejate din fondul forestier, n special n RP La 33
de Vaduri, RP Rudi-Arioneti, MNB Rudi-Gavani, RP Cosui i RP Holonia. Pentru unele specii rare ANPS
cercetate servesc ca habitate noi.
5. Majoritatea speciilor rare au fost nregistrate n exemplare foarte puine i puine, ceea ce impune fortificarea
msurilor de protecie a arilor cercetate.
BIBLIOGRAFIE:
1. Begu, A.; Manic, .; alaru, V.; Simonov, Gh. Lumea vegetal a Moldovei. Ciuperci, plante fr flori, vol. I.
Chiinu: Ed. tiina, 2005. 204 p.
2. Botnariuc, N.; Tatole, V. Cartea Roie a vertebratelor din Romania. Muzeul Naional de Istorie Natural Gr.
Antipa. Bucureti, 2005. 260 p.
3. Bilz, M.; Kell, Sh.P.; Maxted, N.; Lansdown, R.V. European Red List of Vascular Plants. Luxembourg:
Publications Office of the European Union. 2011. 144 p.
4. Braun-Blanquet, J. Pflanzensoziologie. 3 Aufl. Wien, N. Y. 1964. 865 p.
5. Cartea Roie a Republicii Moldova. Ediia a doua. Chiinu: Ed. tiina, 2001. 288 p.
6. Cheklist of CITES species and Annotated CITES appendices and Reservations. Washington. 1979. 417 p.
7. Chiriliuc, V. Microelementi v componentah biosferi Moldovi. hiinu: Ed. Pontos, 2006. 156 p.
8. Convention on Migratory Species. Bonn, 1979.
9. Convention on the Conservation of European Wildlife and Natural Habitats. Berrn, 1979.
10. Convenia privind diversitatea biologic. Rio de Janeiro, 1992.
11. Convenia privind zonele umede de importan internaional ca habitat pentru psrile cltoare. Ramsar,
1971.
12. Evidenele statistice. Rapoartele Inspectoratului Ecologic de Stat pentru perioada 1990-2013.
13. Ivan, D.; Doni, N. Metode practice pentru studiul ecologic i geografic al vegetaiei. Centrul de
multiplicare a Universitii din Bucureti, 1975. 47 p.
14. Kloke, A. Orientierungsdaten fur tolerierbare gesamtgehalte einiger elemente in kulturboden, mitt.
VDULFA, H1-3. 1980, p. 9-11.
15. Legea privind fondul ariilor naturale protejate de stat. Chiinu, 2002.
16. Lista Roie a Europei. European comunities, 2009.
17. Lumea animal. Cartea Roie a Ucrainei. 2009. Kiev: Maister-print. 608 p.
18. Lumea vegetal. Cartea Roie a Ucrainei. 2009. Globalconsalting. iev. 912 p.
19. Munteanu, A.; Lozan, M. Mamifere. Lumea animal a Moldovei. Chiinu: Ed. tiina, 2004. 132 p.
20. Negru, A. Plantele rare din flora spontan a Republicii Moldova. Chiinu: CE USM, 2002. 198 p.
21. Transboundary Acidifying Air Pollution in Europe, EMEP, Co-operative programme for monitoring and
evaluation of the long range transmission of Air pollutants in Europe. MSC-W Status Report 1998. Part 2:
Numerical Agendum.
22. , . . . : . , 1975.
23.
. O . , 2002.

124

ARII FAVORABILE PENTRU CONSERVAREA BIODIVERSITII


Begu Adam, dr. hab. n biologie, conf. univ., cerct. t. principal, Liogchii Nina, dr. n biologie, cerc. t.
coodonator, Ajder Vitalie, cerc. t. sup., Institutul de Ecologie i Geografie a AM
Favorable areas for biodiversity conservation. This article includes the research results regarding the
biological diversity of Stanca and Humaria representative ecosystems, which are located in the Dniester river
basin. In these ecosystems, species of flora and fauna were registered, the abundance and the protection status of
rare species was set. The studied ecosystems serve as new habitats for some rare species. For the preservation of
the valuable species, these areas are proposed to be protected.
Key words: representative ecosystems, biological diversity, valuable species, the abundance of rare
species, preservation of flora and fauna, protected areas.
INTRODUCERE
Una dintre cele mai valoroase bogii ale umanitii este biodiversitatea Terrei. Lumea vegetal i cea
animal s-a format n decurs de milioane de ani. Graie condiiilor ecologice cu diveri indici de temperatur,
umiditate, reacie a solului, determinate de amplasarea geografic a Republicii Moldova, flora i fauna rii
noastre se caracterizeaz printr-o vast diversitate taxonomic, care include peste 5500 specii de plante i circa
14800 specii de animale [4].
Dei biodiversitatea a creat premisele pentru apariia i evoluia omului, pe parcursul ultimelor decenii
unele specii de plante i animale se afl n declin numeric. De rnd cu factorii de mediu, asupra reducerii
efectivului florei i faunei sunt ndreptate i unele activiti umane, cum ar fi: distrugerea i poluarea habitatelor,
colectarea ilicit a speciilor de plante, capturarea i nimicirea multor specii de animale etc. Situaia creat
impune desfurarea unor cercetri ce ofer argumente tiinifice, propuneri i posibiliti de soluionare a
problemelor de conservare a diversitii biologice.
Cele mai favorabile condiii de conservare si restabilire a diversitii biologice pot fi asigurate prin
respectarea regimului de protecie n ariile naturale protejate [14].
Deoarece, dup componena floristic a speciilor de plante vasculare, cele mai bogate sunt ecosistemele
forestiere, n cercetri au fost incluse 2 ecosisteme reprezentative din sectorul silvic. Cunoaterea diversitii
biologice i valorii speciilor ce-i gsesc habitatul n aceste ecosisteme va servi ca baz tiinific pentru
protecia eficient i asigurarea unui management durabil al diversitii biologice din bazinul fluviului Nistru.
METODE DE CERCETARE
Cercetrile au fost efectuate pe parcursul perioadei 2011-2014. Scopul acestui studiu const n
evaluarea strii ecologice a ecosistemelor reprezentative forestiere Stnca i Humria amplasate n bazinul
fluviului Nistru (Fig. 1).

Figura 1. Schema amplasrii obiectelor de studiu

125

Accentul este plasat pe studiu diversitii biologice, stabilirea speciilor valoroase de flor i faun i a
statutul de protecie la nivel naional, regional i internaional.
Studiul floristic i faunistic a fost efectuat sezonier cu descrierea strii biocenotice a ecosistemelor
studiate, determinarea abundenei [3] i colectarea mostrelor pentru determinarea apartenenei sistematice a
speciilor utiliznd literatura i determinatoarele de specialitate [1, 7, 10-12, 17, 19-21, 24] i microscoapele
MBS10 i Micmed-5. Gradul de raritate i periclitate al speciilor de flor i faun a fost stabilit conform
clasificatorului UICN, Cartea Roie a Republicii Moldova (CRRM), Cartea Roie a Ucrainei (CRU), Cartea
Roie a Romniei (CRU), Lista Roie European (LRE), Anexele Conveniilor de la Berna, 1979 (CBerna), Bon,
1979 (CBon), Washington, 1973 (CWash), Rio de Janeiro (1992) [2, 4-6, 8, 9, 14, 15, 16, 18, 22].
REZULTATE I DISCUII
Obiectele supuse cercetrii sunt amplasate n partea de Nord a Republicii Moldova, n bazinul
hidrografic al fluviului Nistru, n raionul geomorfologic Platoul Moldovenesc, care constituie o cmpie puin
nalt, nclinat spre sud. Altitudinea variaz ntre 240-320 m. Condiiile climatice din regiune sunt mai
favorabile, comparativ cu raioanele din centrul i sudul republicii. Clima este temperat-continental. Iarna este
blnd, scurt, cu puin zpad, vara clduroas i lung. Durata zilelor cu soare pe parcursul anului este n
medie de 2060 ore, iar temperatura medie anual a aerului constituie +8, +9 C. n perioada activ de vegetaie
suma temperaturilor diurne ale aerului constituie 2750-2800 C, iar a precipitaiilor - 330-350 mm [13].
n nordul republicii, unde este amplasat obiectul de studiu, predomin tipul de soluri cenuii (cenuiudeschise i cenuiu-nchise) [25], iar vegetaia silvic este dominat de pduri de stejar pedunculat cu cire [23].
Ecosistemul Stnca, cu suprafaa de circa 100 ha, este amplasat la nord de satul Naslavcea i face parte
din ocolul silvic Ocnia, trupul de pdure Stnca.
Conform LFANPS [14] aceast suprafa este protejat de stat, deintorul funciar fiind ntreprinderea
Silvic de Stat Edine. Aria face parte din categoria Monumente ale Naturii Geologice i Paleontologice
(MNGP) i este menit s protejeze elementele geologice i paleontologice redate de isturile negre cu
concreiuni de fosforite, ieite la lumina zilei, lutiuri istoase, cu amprente i resturi de peti sarmaieni i plante
fosile, de unele roci cretacice din apropierea s. Naslavcea [26].
Relieful neuniform al acestei arii cu ravene i pante abrupte, stnci cu roci dezgolite i lacul din preajm
creeaz condiii favorabile pentru creterea, dezvoltarea i adpostirea unei diversiti specifice de flor i faun,
care au fost puse n eviden pe parcursul studiilor noastre.
Vegetaia arboricol este dominat de gorun (Quercus petraea), subdominante fiind speciile de jugastru
(Acer campestre) i viin turcesc (Cerasus mahaleb) iar n lizier, pe alocuri, este prezent pinul (Pinus
sylvestris).
Printre arbuti i semiarbuti, cel mai frecvent sunt ntlnite speciile de porumbar (Prunus spinos),
mce (Rosa canina), corn (Cornus mas), lemn cinesc (Ligustrum vulgare), pducel ncovoiat (Crataegus
curvisepala), migdal pitic (Amygdalus nana), verigariu (Rhamnus tinctoria), scumpie (Cotinus coggygria),
drobior turtit (Genista depressa), caragan moale (Caragana mollis), caprifoi (Lonicera xylosteum), brebenoc
mic (Vinca minor), cimbru moldovean (Thymus moldavicus).
Stratul de ierburi este bine dezvoltat i este format din specii comune, printre care i un numr
considerabil de specii rare cu statut de protecie la nivel naional, regional i internaional (Tab. 1).
Tabelul 1. Ponderea speciilor nregistrate de plante/animale cu diferit statut de protecie
Nr. Denumirea
Numrul
Numrul speciilor valoroase cu diferit statut de protecie
d.o. ecosistemului speciilor
R
CRRM LRR CRU LRE CWash CBerna CBon
reprezentative
1.
Stnca
57/12
19/7
6/1
2/2
6/0
1/5
1/0
0/6
2.
Humria
35/19
10/13 3/0
2/3
3/0
1/8
0/11
0/1
n locurile deschise, poiene largi i lizier, primvara, au fost nregistrate numeroase specii efemere
ciuboica cucului (Primula veris), dediel mare (Pulsatilla grandis), rucua de primvar (Adonis vernalis),
floarea vntului de dumbrav (Anemone nemorosa), iar sub coronamentul arborilor boglari golai (Ranunculus
cassubicus), poplnic (Hepatica nobilis), crin de pdure (Lilium martagon). Printre speciile edificatoare ale
stratului ierbos, caracteristice pdurilor de stejar cu cire, au fost evideniate: pecetea lui Solomon/cercelu
latifoliu (Polygonatum latifolium), cercelu odorant (Polygonatum odoratum), rutior mic (Thalictrum minus),
umbra iepurelui (Asparagus tenuifolius), mrgic uniflor (Melica uniflora). Sectoarele cu stncrii i substrat
calcaros sunt populate de specii petrofile i calcifile: oaldin acr (Sedum acre), oaldin mare (Sedum
maximum), acul pamntului (Asplenium trichomanes), spinarea lupului (Asplenium ruta muraria), feriga
feminin (Athyrium filix-femina). Au fost ntlnite i speciile comune, precum: clopoel persicifoliu (Campanula
persicifolia), pojarni (Hypericum perforatum), rostopasc (Chelidonium majus), unghia gii (Astragalus
glycyphyllos), vulturic piloas (Hieracium pilosella), veronic prostrat (Veronica prostrata), gua
porumbelului (Silene nemoralis), lucerna galben (Medicago minima), opai (Melandrium album), npraznic
(Pyrethrum corymbosum), ghizdei (Lotus corniculatus), coronite variat (Coronilla varia), creuc
(Filipendula vulgaris), bumbior (Leucanthemum vulgare) etc.
Pe tulpina arborilor, pe sol i pe roci frecvent este nregistrat specia de briofite Polytrichum formosum,
care, pe anumite pante, formeaz un covor compact, iar dintre licheni au fost nregistrate: Cladonia pyxidata,

126

Evernia prunastri, Parmelia sulcata, Peltigera canina, Usnea hirta, Graphis scripta, Parmelia olivacea,
Xanthoria parietina.
Printre reprezentanii faunei ecosistemului au fost semnalate speciile: mistre (Sus scrofa), cprior
(Capreolus capreolus), ciocnitoare de stejar (Dendrocopos medius), sturz cnttor (Turdus philomelos), piigoi
mare (Parus major), scatiu (Carduelis spinus), corb (Corvus corax), melcul viei de vie (Helix pomatia), Cepaea
vindobonensis, Amata phegea . a.
Analiza literaturii privind repartiia speciilor rare n cadrul districtelor geobotanice ale Republicii
Moldova (Negru, 2002), a hrilor de repartiie a speciilor rare din Cartea Roie a Republicii Moldova (ediia II,
ed. III), precum i datele obinute din cercetrile echipei de lucru, a pus n eviden noi habitate de cretere i
dezvoltare n ecosistemul Stnca, pentru urmtoarele specii de plante: Pulsatilla grandis, Hepatica nobilis,
Rhamnus tinctoria, Peltigera canina, Usnea hirta. Speciile Rhamnus tinctoria i Pulsatilla grandis sunt inducate
i n ecosistemele din lunca fluviului Nistru de pe malul stng, n Ucraina. Pentru specia Pulsatilla grandis,
prevaleaz mai cu seam, habitatele din nord-vestul Ucrainei, iar pentru Rhamnus tinctoria n CRU sunt indicate
doar cteva habitate, 2 dintre ele vis--vis de ecosistemul forestier studiat. Cele menionate sunt n favoarea
argumentrii proteciei ecosistemul forestier Stnca, care va servi drept coridor ecologic de legtur ntre
obiectele din reeaua forestier naional i regional.
Elementele specifice ecosistemului Stnca sunt prezentate de relieful neuniform, rpi i pante abrupte,
stnci cu roci dezgolite, lacul din preajm i diversitatea biologic bogat n specii rare, care ntrunesc
caracteristicile categoriei de protecie Monument al Naturii Mixt.
Ecosistemul Humria are suprafaa de circa 300 ha (314,5 ha) i reprezint un ecosistem forestier
amplasat la nord-estul satului Horodite, raionul Dondueni, la altitudinea de circa 250 m, expoziie nordic.
Aria se caracterizeaz prin prezena arboretului natural ce include exemplare cu vrsta de 80-100 ani i nlimea
de circa 25 m, care se afl n stare satisfctoare.
Specia dominant este stejarul pedunculat (Quercus robur), care determin i tipul de vegetaie
ierboas din ecosistem. n subarboret ntlnim: salb moale (Euonymus europaea), mce (Rosa canina), corn
(Cornus mas), brebenoc (Vinca minor).
Ierburile acoper pe deplin suprafaa solului. Printre speciile comune prezente sunt: toporai (Viola
mirabilis), cercelu odorant (Polygonatum odoratum), pecetea lui Solomon/cercelu latifoliu (Polygonatum
latifolium), sugel (Lamium purpureum), ochiul broatei (Ranunculus repens), urzic dioic (Urtica dioica),
stnjenel (Iris pseudacorus), fragi (Fragaria vesca), pur (Alium rotundum), pecetea lui Solomon multiflor
(Polygonatum multiflorum), creuc (Filipendula vulgaris), dree (Lysimachia vulgaris) .a. De rnd cu acestea
au fost nregistrate i specii rare, cu diferit statut de protecie. Dintre speciile ce se regsesc n Nomenclatorul
speciilor rare din flora spontan a Republicii Moldova (Negru, 2002) menionm: ciuboica cucului (Primula
veris), lcrmioare (Convallaria majalis), feriga comun (Driopteris filix mas), umbra iepurelui tenuifolie
(Asparagus tenuifolius). Merit atenie deosebit att speciile ocrotite prin CRRM - ceap bulgreasc
(Nectaroscordum bulgaricum) i stngenel pontic (Iris pontica), care anterior nu au fost identificate aici, ct i
speciile ocrotite prin documente internaionale ofrnel (Crocus reticulatus), strigoaie (Veratrum nigrum), crin
de pdure (Lilium martagon). Ultimele dou specii, pe unele parcele, aveau un grad de acoperire de circa 25%.
Pdurea Humria este un habitat favorabil i pentru specia de clocoei (Clematis integrifolia), care se ntlnete
aici frecvent i, dei, nu se regsete pe lista speciilor rare, se recomand pentru atribuirea unei categorii de
protecie. Aceasta este argumentat de frecvena mic a habitatelor acestei specii semnalate pe teritoriul rii.
Printre speciile de licheni cu o frecven mai mare se ntlnesc: Parmelia olivacea, Parmelia sulcata, Parmelia
caperata, Evernia prunastri, Lepraria aeruginosa.
n fauna pdurii se ntlnesc frecvent speciile de mamifere: mistreul (Sus scrofa), cpriorul (Capreolus
capreolus), iepurele de cmp (Lepus europaeus) i cele de avifaun, precum: sticlete (Carduelis carduelis),
cnepar (Carduelis cannabina), corb (Corvus corax), piigoi mare (Parus major), cintez (Fringilla coelebs),
piigoi albastru (Parus caeruleus), piigoi mare (Parus major), sturz cnttor (Turdus philomelos), silvie-capnegru (Sylvia atricapilla), muscar gulerat (Ficedula albicollis), pupz (Upupa epops) .a.
Pdurea Humria, amplasat n preajma s. Horodite, r. Dondueni, dispune de elemente specifice
caracteristice categoriei de arie protejat - Rezervaie Natural Silvic i este propus de a fi inclus n lista
Ariilor Naturale Protejate de Stat. Aceasta va contribui la conservarea diversitii biologice a ecosistemului i la
extinderea i diversificarea fondului ariilor protejate din acest raion.
CONCLUZII:
1. Ecosistemele forestiere Stnca i Humria asigur condiii optimale pentru o diversitate bogat de specii de
flor i faun, printre care specii valoroase cu statut de protecie la nivel naional, regional i internaional.
Pentru prima dat n ecosistemul reprezentativ Stnca au fost identificate speciile Pulsatilla grandis, Hepatica
nobilis, Rhamnus tinctoria, Peltigera canina, Usnea hirta, iar n pdurea Humria - speciile Nectaroscordum
bulgaricum i Iris pontica.
2. Ecosistemul forestier Stnca poate servi drept coridor de conexiune la Reeaua Ecologic Naional (REN) i
European, deoarece aici au fost nregistrate specii rare, att pentru regiunea de Nord-Est a Moldovei, ct i
pentru sectoarele de Vest ale Ucrainei, iar pdurea Humria poate servi drept coridor biologic local, asigurnd

127

integritatea fragmentului REN din zon. Pentru asigurarea conservrii speciilor rare de plante i animale se
recomand ca ambele ecosistemele forestiere cercetate s fie protejate de ctre stat.
BIBLIOGRAFIE:
1. Begu, A.; Manic, .; alaru, V.; Simonov, Gh. Lumea vegetal a Moldovei. Ciuperci, plante fr flori.
Chiinu: Ed. tiina, 2005. 204 p.
2. Bilz, M.; Kell, Sh.P.; Maxted, N.; Lansdown, R. European Red List of Vascular Plants. Luxembourg:
Publications Office of the European Union, 2011. 144 p.
3. Braun-Blanquet, J. Pflanzensoziologie. 3 Aufl. Wien, N. Y. 1964. 865 p.
4. Cartea Roie a Republicii Moldova. Ediia a doua. Chiinu: Ed. tiina, 2001. 288 p.
5. Cartea Roie a vertebratelor din Romnia. Botnariuc N. & Tatole Victoria. (Eds.). Bucureti: Ed. Muzeului
Naional de Istorie Natural Gr. Antipa, 2005. 260 p.
6. Cheklist of CITES species and Annotated CITES appendices and Reservations. Washington, 1979. 417 p.
7. Ciubotaru, A.; Postolache, Gh.; Teleu, A. Plante cu flori-III. Chiinu: Ed. tiina, 2010, vol. 4. 184 p.
8. Convention on Migratory Species. Bonn, 1979.
9. Convention on the Conservation of European Wildlife and Natural Habitats. Berrn, 1979.
10. Gheideman, T. Opredeliteli vsih rastenii Moldavscoi SSR. Chiinu: Ed. tiina, 1975. 636 p.
11. Grossu, Al.V. Gastropoda Romniei. 1. Subclasa Prosobranchia i Opistobranchia. Bucureti: Ed. Litera,
1986. 525 p.
12. Ivan, D. & Doni, N. Metode practice pentru studiul ecologic i geografic al vegetaiei. Centrul de
multiplicare a Universitii din Bucureti, 1975. 47 p.
13. Lasse, G. 1978. Climat Moldavscoi SSR. hiinu: Ed. Gidrometeoizdat. 186 p.
14. Legea privind fondul ariilor naturale protejate de stat. Chiinu, 2002. 107p.
15. Lumea animal. Cartea Roie a Ucrainei. Kiev: Maister-print, 2009. 608 p.
16. Lumea vegetal. Cartea Roie a Ucrainei. Globalconsalting, iev. 2009. 912 p.
17. Munteanu, A. & Lozan, M. Mamifere. Lumea animal a Moldovei. Chiinu: Ed. tiina, 2004. 132 p.
18. Negru, A.; abanov, G.; Cantemir, V. Plante rare din flora spontan Republicii Moldova. Chiinu: Ed.
tiina, 2002. 198 p.
19. Negru, A.; tefr A.; Cantemir, V.; Gnju, Gh. Plante cu flori-I. , vol. 2. Chiinu: Ed. tiina, 2005204 p.
20. Negru, A.; tefr, A.; Cantemir, V.; Gnju, Gh.; Ghendov, Gh. Plante cu flori-II, vol. 3. Chiinu: Ed.
tiina, 2006, 208 p.
21. Negru, A. Determinator de plante din flora Republicii Moldova. Chiinu: Ed. tiina, 2007. 391 p.
22. Oltean, M.; Negrean, G.; Popescu, A. Red List of higher plants in Romania. Studies, synthesis,
documentation of ecology. Bucharest: Ed.. Academiei, 1994, vol. 1(52). 198 p.
23. Postolache, Gh. Vegetaia Republicii Moldova. Chiinu: Ed. tiina, 1995. 340 p.
24. Simonov, Gh. Opredeliteli listostebelinh mxov Moldavscoi SSR. Chiinu: Ed. tiina, 1978. 167 p.
25. Ursu, A. Solurile Moldovei. Chiinu: Ed. tiina, 2011. 324 p.
26. , ..; , ..; , .. . ,
. 1976.
ANALIZA SWOT A PARCURILOR MOIERETI REPREZENTATIVE
DIN REGIUNEA DE DEZVOLTARE CENTRU
Ciobanu Cristina, cerc. t., Institutul de Ecologie i Geografie al AM
In this paper is presented the SWOT analysis of 4 historic gardens from Center Development Region of
Republic of Moldova. We investigated all gardens from the region (20 objects) and selected 4 for a detailed
SWOT analysis: Balabanesti, Criuleni district, Ivancea, Orhei district, Manuc-Bei in the town of Hincesti and
Mileti, Nisporeni district. During analysis were identified the strengthes, weaknesses opportunities and threats
of the studied parks. From identical strengthes we mention: protection by multiple laws, a museum in the manor,
a good accessibility for visitors and others; from weaknesses-demolation of the manor house, lack of
infrastructure etc. Opportunities are related to the political framework and European integration which will bring
numerous fund for local heritage. The main threats are generated by natural hazards and vulnerability of the
plants because of their old age.
INTRODUCERE
Pe teritoriul republicii au existat mai multe moii, ele erau amenajate n localitile rurale. Un domeniu
moieresc const dintr-un conac i anexele sale, un parc decorativ i/ sau livad i vie. n raioanele din Regiunea
de Dezvoltare Centru au fost create 14 parcuri moiereti [1], ulterior cercetrile au artat amenajarea a 20 de
parcuri. Din cele 14 parcuri, patru au fost selectate pentru analiza SWOT: Blbneti, raionul Criuleni, Ivancea,
raionul Orhei, Manuc-Bei, oraul Hnceti, Mileti, raionul Nisporeni. Criteriile pentru selectarea parcurilor au
fost: poziia n cadrul regiunii, starea actual, stilul, genul i conceptul amenajrii, biogeografia speciilor de
plante.

128

MATERIALE I METODE
Obiectul de studiu al acestui articol sunt parcurile moiereti din Regiunea de Dezvoltare Centru.
Metoda principal utilizat n cadrul studiului este analiza SWOT. Analiza SWOT [ 2 , 3 ] presupune identificarea
caracteristicilor mediului intern i extern al obiectului cercetat. Punctele forte (Strengthes) i punctele slabe
(Weaknesses) ale obiectului reprezint mediul intern, iar oportunitile (Opportunities) i riscurile sau
ameninrile (Threats) formeaz mediul extern. Utilizarea metodei n studiu a permis relevarea tuturor aspectelor
parcurilor studiate, pornind de la cele naturale i terminnd cu elementele economice sau politice. n aa mod, a
fost evideniat structura intern a parcurilor cu prile pozitive i negative i cea extern, avnd n vedere
conjunctura favorabil i negativ care ar putea aprea sau care exist. Rezultatele obinute din analiza SWOT
ale parcurilor menionate au fost dobndite din cercetarea bibliografic [4, 5, 6, 7], observaiile, datele din
deplasrile n teren, discuiile cu persoanele responsabile i rezidenii localitilor n care sunt situate parcurile.
REZULTATE I DISCUII
Pentru nceput, vom prezenta date despre parcurile studiate:
1. Parcul Blbneti (fig. 1 a) este situat n satul Blbneti, raionul Criuleni. El a fost creat la
sfritul secolului XIX , suprafaa iniial este de circa 10 ha. Parcul a fost amenajat n stil peisajer, pentru el sunt
caracteristice poienile de diferite dimensiuni. De-a lungul timpului compoziia parcului s-a degradat: reeaua de
poteci i crri este aproape pierdut, cldirea conacului a fost distrus, iazul a secat, lipsesc bncile,
indicatoarele i nodul sanitar. Speciile reprezentative de plante sunt: stejarul alb (Quercus alba L.), stejarul rou
(Quercus rubra L.), ienuprul (Juniperus communis L.), pinul galben (Pinus ponderosa Douglas ex. C. Lawson)
i altele. n prezent obiectul este ocrotit ca parc dendrologic inclus n Registrul monumentelor Republicii
Moldova i n calitate de monument de arhitectur peisajer, cu toate acestea parcul nu este ngrijit de
responsabili.
2. Parcul Ivancea (fig. 1 b) este amplasat n satul Ivancea, raionul Orhei. Obiectul a fost amenajat n
anul 1880 pe o suprafaa de circa 5 ha. Parcul a fost creat pe domeniul moierului K. Balioz. Planificarea
parcului este de tip mixt, n conceptul vila rustica, ceea ce nseamn c parcul are un sector gospodresc livad n cazul dat i sectoare decorative pentru odihn i recreere. Pentru acest parc sunt caracteristice
havuzurile i movilele artificiale. Printre speciile exotice plantate pot fi menionate pinul neted (Pinus strobus L),
bradul de Caucaz (Abies nordmanniana (Steven) Spach), ginkgo biloba (Ginkgo biloba L.) i altele. Cldirea
conacului s-a pstrat, n prezent ea se restaureaz. Aleile parcului sunt n stare bun, ns lipsesc bncile i
panourile informative i indicatoare. n prezent obiectul este ocrotit n cadrul monumentului istoric ,,conacul
Balioz inclus n Registrul monumentelor Republicii Moldova i n calitate de monument de arhitectur
peisajer, parcul este ngrijit de responsabili;
3. Parcul Mileti (fig. 1 c) este amplasat din satul Mileti, raionul Nisporeni. Parcul a fost creat n a
dou jumtate a secolului XIX i are suprafaa de 3 ha. El este situat la marginea localitii. Parcul a fost creat pe
domeniul moierului Kazimir, structura lui definitiv fiind realizat de ctre fiul mai mic al acestuiaIvan.
Planificarea parcului este de tip mixt, n conceptul vila rustica, ceea ce nseamn c parcul are un sector
gospodresclivad i sectoare decorative pentru odihn i recreere. Dintre speciile exotice menionam ginkgo
biloba, stejarul rou, pinul negru (Pinus nigra J. F. Arnold.), bradul de Caucaz i altele. Cldirea conacului s-a
pstrat i gzduiete un muzeu. n prezent parcul este ocrotit de stat n calitate de monument de arhitectur
peisajer, este inclus n Registrul monumentelor Republicii Moldova i este ngrijit bine.
4. Complexul cu parc Manuc-Bei (fig. 1 d) este situat n oraul Hnceti. Parcul a fost creat pe un
domeniu de 10 ha, amenajarea lui a nceput n 1812. Complexul a aparinut familiei prinului Manuc-Bei
(Mirzoian). Parcul a fost amenajat n stil peisajer. n prezent din compoziia i amenajrile iniiale ale parcului au
rmas doar civa stejari i ienuperi, arborii i arbutii au fost defriai n timpul celui de-al doilea rzboi
mondial. Parcul este njumtit de un zid n dou pri. O parte este n stare bun i ngrijit, iar cealalt n stare
de reconstrucie i reamenajare. ntreg ansamblul este protejat de stat n cadrul Registrului monumentelor. Din
edificiile complexului, castelul de vntoare s-a pstrat cel mai bine i gzduiete un muzeu. Alte cldiri ale
complexului (castelul, casa Iamandi, casa vechilului i havuzurile) sunt n proces de reconstrucie;
ANALIZA SWOT A PARCURILOR MOIERETI
Tabelul 1 prezint punctele puternice care sunt comune pentru toate parcurile sau, cel puin, pentru dou
din ele. Dintre acestea enumerm: existena cldirii conacului, gzduirea de ctre ea a unui muzeu, cunoaterea
datelor despre istoria parcului i altele. Cu toate acestea, parcurile studiate au unele caliti specifice. Pentru
parcul din Blbneti, diversitatea mare de specii numr circa 35-40 de arbori i arbuti, cele mai exotice
specii de conifere sunt: ienuprul de Virginia (Juniperus virginiana L.), bradul Douglas (Pseudotsuga menziesii
(Mirb.) Franco), pinul galben; din foioase: stejarul alb i stejarul rou; din arbuti: tamarixul de Odessa (Tamarix
ramosissima Ledeb.) i alii. Punctele forte specifice ale parcului din Ivancea sunt: gestionarea sa de ctre
Muzeul Naional de Etnografie i Istorie Natural, o instituie cu tradiii i care apreciaz patrimoniul republicii,
speciile de plante exotice, n special coniferele: tuia occidental (Thuja occidentalis L.), molidul caucazian
(Picea orientalis (L.) Link), bradul alb (Abies alba Mill.), pinul neted; din foioase: teiul cu frunza mare (Tilia
platyphyllos Mill.), ulmul de munte (Ulmus glabra Huds.); din arbuti: glicina chinezeasc (Wisteria sinensis
(Sims) DC.) i altele. Punctele forte specifice ale parcului Mileti in de speciile exotice: de conifere - molidul

129

Engelman (Picea engelmannii Parry ex Engelm), ginkgo biloba; din foioase: gutuiul japonez (Chaenomeles
japonica (Thunb.) Lindl. ex Spach), sophora japonez (Styphnolobium japonicum (L.) Schott) i altele [4, 5, 7].

protecie dubl: Legea privind fondul ariilor naturale protejate de stat nr. 1538-XIII din
25.02.1998 i Legea privind ocrotirea monumentelor nr.1530-XII din 22.06.1993 [8, 9]
existena informaiei despre istoria parcului
este accesibil pentru vizitatori, exist transport direct tur-retur
este amplasat la marginea localitii
amenajarea conform conceptului ,,vila rustic, cu zone de recreere i gospodreti
(livad)
este amenajat n amenajate n stil peisajer
parcul a fost conceput ca unul pentru odihn, relaxare i agreement
are n compoziia sa locuri umbrite i poieni mari, nsorite

130

+
+

+
+

+
+
+

+
+
+

+
+
+

+
+
+
+

Mileti

Manuc-Bei

Ivancea

Caracteristica/Parcul

Blbneti

Fig. 1 a. Poian n parcul Blbneti; b. Intrarea n parcul Ivancea; c Peisaj n parcul Mileti; d. Poian
n parcul complexului Manuc-Bei
Tabelul 2 prezint punctele slabe comune pentru parcurile cercetate, dar oricum ele au i caracteristici
specifice. Parcul Blbneti are ca puncte slabe demolarea cldirii conacului i faptul c este traversat de un
drum care leag uzina de nisip din sat cu arterele de circulaie. Din cauza acestui drum, parcul ese zilnic traversat
de tiruri care dezechilibreaz armonia natural a locului, creeaz poluare fonic, aerian i vibraii. Pentru parcul
din Ivancea, punctele slabe individuale in de procesul de judecat dintre Muzeul de Istorie Natural i
Etnografie care a dat parcul i cldirile n arend companiei S. A. Casa Vinului. Compania a efectuat
restaurarea cldirilor denaturnd aspectul lor iniial, fapt ce a cauzat nceperea procesului de judecat pentru
desfacerea contractului de arend. Procesul a nceput n anul 2009, dar continu i n prezent. Din cauza
reconstruciei cldirilor, pe teritoriul parcului sunt amplasate ustensile, materiale de construcie i gunoi, toate
acestea distrug armonia peisajului, cert este c dup terminarea lucrrilor ele vor fi nlturate. Parcul
complexului Manuc-Bei are ca element slab separarea sa n dou pri, cel puin se spune c e temporar pn
cnd cldirile ansamblului va fi restaurate. Pentru parcul din Mileti, menionm inactivitatea muzeului din
cauza reparaiei cldirii conacului.
Tabelul 1. Analiza SWOT. Punctele forte

parcul este o parte component a unui complex arhitectural cu mai multe cldiri
una din cldirile ansamblului adpostete un muzeu
localitatea n care este situat parcul are infrastructur bun: energie electric, ap potabil,
canalizare i reea de gaz natural

+
+
+

+
+

+
+

Mileti

Manuc-Bei

Caracteristica/Parcul

Ivancea

Blbneti

Tabelul 2. Analiza SWOT. Punctele slabe.

lipsa informaiilor despre istoria parcului, fotii stpni i crearea lui


+
nerespectarea prevederilor legislaiei privind statutul de protecie al parcului
+
+
+
lipsa infrastructurii: bnci, tomberoane, panouri semnalizatoare i indicatoare
+
+
+
secarea iazului din parc
+
dispariia cldirii conacului
+
prezena construciilor care deregleaz armonia peisajului
+
+
arborii, arbutii i poienile nu sunt ngrijite, covorul vegetal monoton,
+
+
neaccesibil pentru vizitatori
+
+
muzeul nu funcioneaz/nu exist
+
+
+
pierderea plantelor din parcuri
+
+
Oportunitile parcurilor studiate in mai mult de cadrul politic i integrarea european a republicii care
va aduce numeroase fonduri pentru patrimoniul local, utilizarea crora va introduce sau reintroduce ansamblurile
cu parcuri n circuitul turistic. Cele mai multe riscurile pe care le pot nfrunta parcurile sunt de categorie natural
i includ o varietate mare de hazarduri i sensibilitatea crescut a plantelor din cauza vrstei naintate. Att
oportunitile, ct i riscurile sunt prezentate detaliat n tabelul 3.

Manuc-Bei

Mileti

procesul activ de integrare european i semnarea Acordului de Asociere la UE


atragerea investiiilor
reamenajarea iazului i crearea unei zone pentru recreere
re/introducerea parcului n circuitul turistic naional
utilizarea materialului semincer pentru lucrri de nmulire a speciilor exotice
Riscurile
accentuarea indiferenei oamenilor i autoritilor publice locale
extinderea teritoriului localitii
hazardurile naturale: alunecrile de teren, eroziunea, secetele, suhoveiurile, etc.
schimbrile climatice
bolile i epidemiile plantelor
vrsta naintat a arborilor i arbutilor
extinderea fabricii de prelucrare a nisipului

Ivancea

Oportunitile/Parcul

Blbneti

Tabelul 3. Analiza SWOT. Oportunitile i riscurile

+
+
+
+
+

+
+

+
+

+
+

+
+

+
+

+
+
+
+
+
+
+

+
+
+
+
+
+

+
+
+
+
+
+

+
+
+
+
+
+

CONCLUZII:
1. Analiza SWOT a permis identifica structura intern a parcurilor cu prile sale pozitive i negative punctele
forte i punctele slabe i cea extern oportunitile i riscurile, avnd n vedere conjunctura favorabil i
negativ care ar putea aprea sau care exist.
2. Punctele slabe comune ale parcurile sunt: ngrijirea neadecvat, nerespectarea prevederilor legislative privind
regimul de ocrotire al parcurilor, vrsta naintat a speciilor i altele. Punctele forte comune ale parcurilor
studiate sunt: ocrotirea de legislaia Republicii Moldova, prezena speciilor exotice de arbori i arbuti care s-au
adaptat la condiiile republicii, materialul lor semincer putnd fi utilizat pentru amenajrile rurale i urbane;
3. Conjunctura extern n care se afl parcurile studiate a fost relevat prin determinarea oportunitilor de
dezvoltare i riscurilor posibile. Oportunitile comune sunt: atragerea investiiilor, parcursul european al
republicii i altele. Cele mai multe riscuri comune sunt determinate de schimbrile climatice, hazardurile
naturale i vulnerabilitatea plantelor.

131

BIBLIOGRAFIE:
1.Cocr, P.; Ciobanu, C. Parcurile vechi moiereti din zona central a Republicii Moldova. n Mediul
Ambiant, 2013, nr. 2 (68) aprilie, p. 41-45.
2.Analiza SWOT. http//:ro.wikipedia.wiki.analizaswot, (accesat 25.04. 2015).
3.Kotler, Ph. Managementul marketingului. Bucureti: Ed. Teora, 2001. 1040 p.
4.Tarhon, P. Parcuri vechi boiereti din Republica Moldova. Chiinu: Ed. Pontos, 2013. 637 p.
5. , B. c . : , 1992. 142 c.
6., . . . : , 1976. 312 c.
7., . . : , 1967. 95 c.
8.Legea privind fondul ariilor naturale naturale protejate de stat nr. 1538-XIII din 25.02.1998.
9.Legea privind ocrotirea monumentelor nr.1530-XII din 22.06.1993.
GESTIONAREA DEEURILOR O PROBLEM STRINGENT A REPUBLICII MOLDOVA
Bodrug Nicolae, cercet. t., Bulimaga Constantin, dr. hab. n biologie, Budeanu V., Institutul de Ecologie
i Geografie al AM
Currently, the waste problem becomes more important because of increasing of waste amount and sizes
of dump sites. It leads to further deterioration of the environment, especially near human settlements.
On national scale only 50% of the population benefits from sanitation, services - urban share of
approximately 80% and only 20% in rural localities.
Although environmental protection management in Moldova is supported by about 35 legislative and 50
Government Decisions, legal aspects of waste management need further development. At present, the most
widely used method of treating domestic waste is landfill. Wastes collected on such sites serve as an important
source of soil, groundwater pollution and have a negative impact on the health of the population. In this context,
sanitation and waste management in urban settlements should become an important objective for the
governmental and local authorities.
Key words: solid waste, waste management and waste management.
Gestionarea deeurilor reprezint una dintre problemele importante cu care se confrunt Republica
Moldova (n continuare RM) n activitile de protecie a mediului. n prezent, problema deeurilor se manifest,
tot mai acut, din cauza creterii cantitii i diversitii acestora, precum i a impactul lor negativ, tot mai
pronunat, asupra mediului nconjurtor. Dezvoltarea urbanistic i industrial a localitilor, precum i creterea
general a nivelului de trai al populaiei, cauzeaz generarea unor cantiti din ce n ce mai mari de deeuri.
O problem important a sistemului de gestionare a deeurilor o constituie aria sczut de acoperire a
localitilor cu servicii de salubrizare. Astfel, la nivel naional, doar 50% din populaie beneficiaz de servicii de
salubrizare, ponderea n mediul urban fiind de aproximativ 80% i de doar 20%, n mediul rural.
Gestionarea deeurilor rmne a fi o problem dificil i nesoluionat, att din punct de vedere
organizatoric, ct i legislativ. Cu toate c, domeniul proteciei mediului este reglementat de circa 35 de acte
legislative i peste 50 de Hotrri de Guvern, aspectul legal al gestionrii deeurilor las mult de dorit, fiind
necesar, att, restructurarea cadrului legal i instituional, ct i crearea unui sistem integru de reglementare
tehnic i ecologic, n domeniile de colectare selectiv pentru reciclarea, valorificarea, eliminarea i
depozitarea deeurilor.
Actualmente, cea mai utilizat metod de tratare a deeurilor menajere este depozitarea pe so l, care
reprezint o surs important de poluare a solului, apelor subterane i cu un impact negativ asupra strii de
sntate a populaiei. n acest context, salubritatea localitilor i managementul deeurilor urbane constituie
un obiectiv important al structurilor guvernamentale i locale.
Depozitele actuale de deeuri nu sunt operate corespunztor: deeurile depozitate nu sunt tasate i nu se
acoper cu materiale inerte (argil) n vederea prevenirii incendiilor; a rspndirii mirosurilor neplcute; n u
exist un control strict al cantitii i calitii deeurilor, care sunt evacuate la depozit; nu exist faciliti
pentru recuperarea biogazului generat sau pentru recuperarea/tratarea filtratului; lipsesc drumurile de acces
spre depozite i n interiorul acestora i nu sunt ntreinute conform cerinelor, mijloacele de transport nu sunt
splate la ieirea de la depozite; depozitele nu dispun de mprejmuire, cu intrare corespunztoare i panouri de
avertizare.
Alt aspect negativ al gestionrii inadecvate a deeurilor este acela c multe materiale reciclabile i utile
sunt depozitate mpreun cu cele nereciclabile (lipsa colectrii selective a deeurilor), ceea ce cauzeaz
pierderea a unor cantiti eseniale de deeuri reciclabile (hrtie, sticl, metal, material plastic); fiind
amestecate i contaminate din punct de vedere chimic i biologic, recuperarea lor este dificil.
Astzi, n ara noastr nu exist nici o uzin de prelucrare a deeurilor. RM practic este inundat de fluxul
de deeuri gestionate inadecvat. Circa 40 de milioane de tone de gunoi sunt mprtiate pe teritoriul rii. Potrivit
Ministerului Mediului, n ar exist circa dou mii de gunoiti aproximativ dou gunoiti la o localitate.
Conform datelor neoficiale, numrul lor este mult mai mare. Datorit faptului c sunt rspndite aa-numitele
depozitri stihinice, nimeni nu poate cunoate cu precizie numrul exact al acestora. Dei, n conformitate cu

132

standardele europene, ar trebui s existe n total zece. Dintre cele existente nu ndeplinesc standardele europene
i doar 15 corespund standardelor de proiectare tehnic i de mediu.
Tendina de cretere a cantitilor de deeurilor se va menine i n continuare, pn se va ajunge la un
nivel comparabil cu cel din rile dezvoltate. La acest moment, n rile dezvoltate se genereaz circa 800-1000
kg pe cap de locuitor. Spre exemplu: n SUA - 930 kg/locuitor; Elveia - (707); Frana - (532); Anglia - (521);
Bulgaria - (410); Ucraina - (380); Romnia - (365); RM (370) [1, 2].
Datele statistice privind volumul i dinamica deeurilor au fost preluate de la Biroul Naional de
Statistic al Republicii Moldova, pentru perioada anilor 2008-2013 [3, 4]. Informaia a fost prelucrat prin
metode matematice i procesate grafic cu programul Microsoft Excel, care sunt prezentate n figura 1.
Rezultatele privind dinamica
cantitilor de deeuri (a. 2008-2013),
indic c n Regiunea Nord a
republicii s-au acumulat n total
4753373.3 tone deeuri. Comparativ
cu anul 2008 volumul s-a micorat de
1,4 ori. Scoatem n eviden, c cel
mai mare volum de deeuri s-a
nregistrat n anul 2008 (1006741 t)
sau 21.2% din volumul total; iar cel
mai mic - n anul 2009 cu 676964.9 t
(14,2%). Cel mai mare generator de
deeuri i revine r-lui Fleti cu
1468403.6 t (30,9%), fiind urmat de
mun. Bli cu 776503.9 t (16,3%) i rl Briceni 617346.4 t (13%). La polul
opus se afl r-nelor Floreti 55319.6
t (1,0%) i Sngerei 10225,1 t (0,2%).
n Regiunea Centru, pe perioada de analiz, s-a acumulat 7116420 t de deeuri. Aadar, dac n anul
2008 acumulrile s-au estimat la 2180487 t, atunci ctre anul 2013 a sczut pn la 897972 t. Deci, a avut loc
o diminuare de 2,4 ori sau circa 41,2%. n zona respectiv, mun. Chiinu genereaz cele mai mari cantiti de
deeuri 2839522 t, ce constituie 39,9% din volumul total; fiind urmat de r-nul Streni cu 1181812 t (16,6%)
i r-nul Orhei 885033 t (12,4%). Cele mai mici valori se acumuleaz n r-nele Dubsari 2071,7 t (0,02%)
i Nisporeni 3252,2 t (0,05%).
n Regiunea Sud s-au acumulat cele mai mici volume de deeuri, (comparativ cu Regiunea Nord i
Centru) i constituie circa 2913313 t. n anul 2012 s-a acumulat cel mai nalt volum 969512,2 t, micornduse ctre anul 2013 pn la 911689,5 t. Totodat, menionm c comparativ cu anul 2008 acumulrile de
deeurilor s-au majorat de 3,9 ori. Raioanele cu cel mai nalt volum de deeuri generate sunt: Basarabeasca cu
1351027,5 t (46,4%); Cimilia 279096,8 (9,6%) i tefan-Vod 249025,2 (8,5%). Iar cele mai mici
cantiti s-au acumulat n r-nele: Cantemir 20288 t (0,7%) i Ceadr-Lunga 25112.2 t (0,9%).
Dac facem o analiz comparativ dinte regiunile de dezvoltare ale republicii, constatm c, cele mai
mari cantiti de deeuri s-a acumulat n Regiunea Centru - 7116420 t, ce constituie 48% din volumul total
acumulat, dup care urmeaz zona de Nord cu 4753373.3 t (32%) i Regiunea Sud - 2913313 t (20%).
Aadar, pe perioada de estimare, cel mai mare volum de deeuri acumulat pe teritoriul Republicii
Moldova s-a nregistrat n anul 2008 i a constituit 3422744 tone. Dup ce, are loc o descretere semnificativ,
atingnd valoarea minim n anul 2011 (1908456 t), ce constituie o diminuare de1,8 ori.
Este important de remarcat, c n ultimii ani se observ o redresare economic a rii, concomitent, are
loc i creterea nemijlocit a cantitii de deeuri acumulate. Aadar, ncepnd cu a nul 2011 volumul acestora
cretere de 1,3 ori i a constituit n anul 2013 - 2540865 t.
Rezultatele privind dinamica cantitii de deeuri acumulate pe teritoriul rii (anii 2008-2011), denot
faptul, c are loc, totui, diminuarea acestora, cu circa 26% fa de anul 2008 (fig. 1).
Problema deeurilor i gestionarea corect este o provocare pentru toi. Este necesar ca autoritile locale
s asigure, pe etape, colectarea separat a deeurilor, avnd organizat la nivelul fiecrei localiti un serviciu de
salubrizare. Colectarea separat trebuie s creasc, iar transportul deeurilor de pe teritoriul localitilor s fie
fcut la timp, aplicndu-se cu strictee legislaia care ine de protecia mediului. Este necesar s se pun accentul
pe contientizarea i educarea populaiei, agenilor economici i autoritilor publice locale privind impactul
deeurilor asupra mediului nconjurtor [5].
Ministerul Mediului al Republicii Moldova i propune s combat problema deeurilor. n acest sens a
fost elaborat Strategia naional de gestionare a deeurilor 2013-2027, care are drept scop promovarea unui nou
mod de colectare a deeurilor menajere, a celor de producie, recuperarea materialelor refolosibile, protecia
mediului i realizarea unui program de salubrizare stradal. n acest scop, se propune de a fi construite dou staii
de tratare mecanico-biologic a deeurilor n Regiunea 4 - Chiinu i Regiunea 7 - Bli i a apte depozite de
deeuri menajere solide pentru restul regiunilor.

133

Republica Moldova va fi mprit n 8 regiuni i urmeaz s fie construite 7 depozite mari, vor fi
construite staii de transfer, unde vor acumulate i reciclate.
Evaluarea iniial la nivel strategic privind costurile de investiii necesare pentru a realiza obiectivele
strategiei variaz ntre 375-470 mln. . Investiiile vor contribui la crearea locurilor noi de munc, mbuntirea
rezervelor de schimb extern prin exportarea materialelor de reciclare, favorizarea productivitii agricole i
securitatea energetic local prin recuperarea energiei din deeuri.
Din cele relatate mai sus putem scoate concluzia, c gestionarea deeurilor necesit adoptarea unor msuri
specifice, adecvate fiecrei faze de eliminare a deeurilor n mediu. Respectarea acestor msuri trebuie s fac
obiectul activitii de monitorizare a factorilor de mediu afectai de prezena deeurilor.
n concluzie se poate conchide, c problema deeurilor, nu poate fi soluionat fr organizarea unui
management adecvat al deeurilor, care prevede crearea infrastructurii complete privind gestionarea tuturor
fluxurilor de deeuri. Succesul managementul deeurilor depinde de realizarea procesului managerial, care are
menirea s asigure interdependena aspectelor ecologice i economice ale deeurilor [6, 7].
Ct timp nu se va ntreprinde msuri concrete pentru stabilirea unui management adecvat al deeurilor, n
baza unui cadru legislativ, normativ i tehnic n corespundere cu principiile directivelor Uniunii Europene, atta
timp problema va persista.
BIBLIOGRAFIE:
1. http://www.rec.md/blacksea/images/brosura/brochure-ro.pdf;
2. http://cim.mediu.gov.md/raport2004/ro/firstprobl/deseuri/deseu_ro6.htm;
3. Baza de date statistice a Biroului Naional de Statistic a RM pentru anii 2008-2013;
4. http://www.statistica.md/;
5. Bulimaga, C. Managementul deeurilor i cile de realizare. n: Conf. Inter. Mediul i schimbarea climei: de
la viziune la aciune. Chiinu, Republica Moldova; 5-6 iunie 2015. Chiinu, 2015, p. 59-62;
6. Bulimaga, C. Managementul deeurilor i impactul lor asupra mediului n ecosistemul urban Chiinu. n:
Dezvoltarea durabil a Regiunii de dezvoltare Centru: factori de mediu i contribuii. Seria Studii regionale.
ADR Centru, Agenia de Dezvoltare Regional, Chiinu 2014, p. 35-38;
7. Bulimaga, C.; Certan, C. Managementul deeurilor. Calitatea factorilor de mediu n contextul dezvoltrii
durabile a Regiunii de Dezvoltare Nord. Bli, 2015, p. 68-73.
ARMONIZAREA SISTEMULUI NAIONAL DE EVALUARE DE MEDIU LA CERINELE
COMUNITARE: PROVOCRI I DIRECII DE DEZVOLTARE
Cojocaru Mircea, doctorand, Institutul de Zoologie al AM, Head Environment, Black Sea Trade and
Development Bank, Hellenic Republic, Capcelea Arcadie, doctor habilitat n biologie, doctor n geografie,
Senior Environmental Specialist, World Bank, Washington DC
The article discusses the challenges of harmonizing the national Environmental Assessment system with
the requirements stipulated in the EU Association Agreement and tries to identify in this respect the necessary
directions for development. The analysis of post-accession experience of some countries suggests that the critical
factors in the process of reforming are the contextual ones that should be identified and assessed before
harmonizing the national system with the EU framework. The authors argue that developing appropriate
mechanisms for reforming the Environmental Assessment system that relies on a well-defined theoretical
foundation would increase the chances that this would result in a functioning and effective system in practical
terms.
Key words: Environmental Assessment, Association Agreement, Ministry of Environment.
INTRODUCERE
Odat cu ratificarea Acordului de Asociere la Uniunea European a Republicii Moldova s-a angajat
ntr-un proces amplu de reformare i modernizare. Capitolul Mediu al Acordului presupune crearea unui
sistem eficient de mediu prin realizarea unui set ntreg de reforme legislative i instituionale n conformitate cu
cerinele Uniunii Europene (n continuare UE). Unul din obiective n acest sens ine de reformarea sistemului
naional de Evaluare de Mediu (n continuare EM) ca instrument cheie de management ecologic al politicii
naionale n domeniu.
Cercetrile i studiile ce vizeaz sistemul naional de EM concluzioneaz c acesta nregistreaz
deficiene att la nivelul cadrului legal, ct i la cel instituional i de aplicare practic. Experiena de postaderare ale unor noi state membre UE demonstreaz c preluarea cadrului comunitar de EM n general a rezultat
n schimbri pozitive n ceea ce privete performana sistemelor naionale. n acelai timp, n unele state se atest
anumite deficiene la acest capitol, unele chiar cu riscul de a periclita scopul EM n sine. Cercetrile n acest
domeniu sugereaz c factorii determinani ce influeneaz buna funcionare a EM sunt cei contextuali exprimai
prin sistem politic, situaie economic i capacitatea actorilor implicai. Preluarea i transpunerea cadrului UE ce
nu este n deplin compatibilitate cu contextul local risc s rezulte n sisteme nefezabile ce nu produc efectul
ateptat. Spre deosebire, dezvoltarea unui sistem de EM ce are la baz o nelegere clar a factorilor contextuali
ce l influeneaz i pornete de la capacitatea actorilor cheie are anse mai mari de a fi unul de succes.

134

Prin urmare, naintea armonizrii sistemului naional de EM la cerinele cadrului UE este necesar de a
efectua o analiz complex multidimensional ale bazelor teoretice, tendinelor de dezvoltare, i particularitilor
EM n RM. Rezultatele acestei analize vor permite definirea bazelor teoretice de reformare ale EM n contextul
asocierii la UE. nelegerea clar a factorilor contextuali ce influeneaz sistemul de EM va permite elaborarea
mecanismelor adecvate de implementare a prevederilor Acordului de Asociere cu privire la reformarea EM.
Aceast abordare ar spori ansele ca sistemul naional s fie nu doar euroconform n intenii ci i unul
funcional i eficace n termeni practici. Astfel, acesta ar veni s asigure ntr-o msur mai mare c proiectele noi
i deciziile strategice nu vor afecta mediul, c prile potenial afectate vor fi consultate, i c deciziile pe
marginea acestora vor fi informate, asumate i bazate pe concluzii calificate.
EVALUAREA DE MEDIU I PROVOCRILE LEGATE DE ARMONIZAREA LA CERINELE
COMUNITARE
EM este un instrument de management ecologic care, de la apariia sa n 1969 n S.U.A., capt aplicare
larg n lume, n prezent fiind utilizat n peste 130 de ri [1]. Scopul principal al EM este prevenirea i
minimizarea impactului negativ i maximizarea celui pozitiv asupra mediului ce pot fi generate att de
activitile economice planificate i cele existente, ct i de deciziile strategice nainte ca acestea s fie
implementate. EM a fost conceput iniial cu scopul de a evalua impactul ce poate fi generat de proiecte
individuale planificate i a fost denumit Evaluare Impactului de Mediu (n continuare EIM), iar evaluarea
impactului generat de obiecte n funciune a cptat denumirea de audit de mediu. n scurt timp aplicarea EM a
fost extins i asupra evalurii impactului ce poate fi generat de deciziile strategice cum ar fi planurile,
programele i politicile regionale sau naionale, fiind denumit Evaluarea Strategic de Mediu (n continuare
ESM).
Pentru a preveni i reduce impactul potenial negativ asupra mediului Republica Moldova (n continuare
RM) i-a dezvoltat sistemul propriu de EM. Acesta este bazat pe modelul de Expertiz Ecologic elaborat n
fosta Uniune Sovietic care a fost ulterior modificat i dezvoltat prin adoptarea a mai multor elemente
caracteristice modelului clasic de EM aplicat n rile occidentale [2-5]. Astfel, la nivel legislativ i normativ au
fost introduse exerciiul de selectare (screening), definirea domeniului de studiu (scoping), analiza alternativelor,
participarea parilor interesate i/sau afectate, etc. La acel moment sistemul naional de EM a fost recunoscut de
Organizaia de Cooperare Economic i Dezvoltare (n continuare OCED) drept sistem model pentru alte ri din
Comunitatea Statelor Independente (n continuare CSI) [6].
Cu toate acestea, sistemul naional de EM nregistreaz anumite deficiene att la capitolul cadrului
legal i instituional, ct i la capitolul practicii aplicrii i corespunde doar parial cerinelor comunitare [2-5, 7].
Aceste deficiene afecteaz funcionarea sistemului i nu permit atingerea n deplin msur a obiectivelor pentru
care a fost creat i anume de a asigura c noile proiecte i decizii strategice nu vor duce la degradarea mediului,
c prile potenial afectate vor fi consultate i c deciziile pe marginea acestora vor fi informate, asumate i
bazate pe concluzii calificate.
Strategia Naional de Mediu pentru anii 2013-2023 elaborat n conformitate cu prevederile
capitolului Mediu al Acordului de Asociere UE-RM aprobat prin Hotrre de Guvern [8] i propune drept
obiectiv general crearea unui sistem eficient de mediu prin realizarea unui set ntreg de reforme legislative i
instituionale n conformitate cu cerinele UE. Astfel, din cele 25 de Directive europene de mediu care necesit a
fi transpuse n legislaia naional trei vizeaz direct EM i anume Directiva 2014/52/UE privind evaluarea
efectelor anumitor proiecte publice i private asupra mediului [9], Directiva 2001/42/CE privind evaluarea
efectelor anumitor planuri i programe asupra mediului [10] i Directiva 2003/35/CE de instituire a participrii
publicului la elaborarea anumitor planuri i programe privind mediul [11]. Pentru aplicarea acestora n RM i
armonizarea sistemului naional la cerinele comunitare urmeaz a fi create mecanisme de implementare, iar la
nivel de reforme instituionale strategia presupune reorganizri, crearea de noi instituii i consolidarea i
mbuntirea capacitilor operaionale, astfel ca acestea s poat asigura o bun implementare a prevederilor
cadrului UE de EM [8].
Experiena de post aderare a noilor state membre sugereaz c armonizarea legislaiei i practicii de EM
la cadrul UE au rezultat n general la schimbri majore pozitive n domeniul EM i la mbuntirea
semnificativ a performanei sistemelor naionale, fapt atestat n rapoartele Ageniei Europene de Mediu (n
continuare AEM) al UE [12]. n acelai timp, n unele state la nivelul contextului local sistemul de EM naional
nregistreaz anumite deficiene, unele chiar cu riscul de a periclita scopul EM n sine. Studiul de evaluare a
eficacitii sistemului de EM n Lituania, spre exemplu, atest drept deficiene principale estimarea subiectiv a
impactului, considerarea formal a alternativelor, i politizarea procesului de EM [13]. Analiza EM n Estonia
indic c o jumtate din numrul de studii de impact nu au nici o influen asupra factorilor de decizie [14]. n
Slovenia, la 10 ani de la aderarea la UE, ESM rmne a fi ineficace i costisitoare i nu contribuie la
mbuntirea proiectelor [15]. Astfel, n limite rezonabile se poate constata c la nivelul contextului local simpla
transpunere a cadrului UE de EM n legislaia naional nc nu garanteaz ca sistemul de EM va fi unul pe
deplin funcional.
Cercetrile n domeniul dezvoltrii, performanei i eficacitii sistemului de EM sugereaz c factorii
determinani n acest sens sunt cei contextuali definii prin sistemul politic naional, situaia economic,
capacitatea actorilor cheie, etc. [16-19]. Respectiv, anume factorii contextuali trebuie s stea la baza reformrii

135

unui sistem de EM, care trebuie realizat n dependen de particularitile acestor factori. O alta abordare n acest
sens este introducerea la nceput a unui model performant de EM care ar influena i schimba ulterior contextul.
Interveniile de acest gen ns, ce nu snt compatibile cu contextul, risc s rezulte n sisteme de EM nefezabile
care nu produc efectul scontat. Spre deosebire, dezvoltarea unui sistem de EM ce are la baz o nelegere solid a
factorilor contextuali i pornete de la capacitatea actorilor cheie, are anse mai mari de a fi unul de succes.
Astfel de sisteme de EM, poate mai puin ambiioase n comparaie cu cele performante cum ar fi cadrul UE de
EM, au anse mai mari de a fi funcionale [20].
PERSPECTIVE I DIRECII DE DEZVOLTARE:
Prin urmare, naintea reformrii i armonizrii EM la cerinele cadrului UE este necesar de efectuat o
analiz complex multidimensional ale bazelor teoretice, tendinelor de dezvoltare, i particularitilor EM n
contextul RM. Aceasta ar permite o mai bun nelegere a oportunitilor i limitrilor n definirea noilor
obiective de dezvoltare ale sistemului de EM naional. n acest sens, analiza trebuie s identifice: 1) elementele
cheie i principiile de baz acceptate care caracterizeaz modelul de EM de bun practic; 2) provocrile i
oportunitile legate de reformarea i armonizarea sistemului naional n baza experienei statelor care au fost
i/sau snt antrenate n procese similare; 3) lacunele existente n sistemul naional n comparaie cu cel cadru al
UE i legislaia internaional n domeniu; i 4) factorii critici ce influeneaz buna funcionare a sistemului
naional de EM prin prisma evalurii performanei i eficacitii acestuia.
Rezultatele acestei analize vor permite definirea bazelor teoretice de reformare i armonizare a EM n
contextul asocierii la UE. Identificarea factorilor limitativi care afecteaz buna funcionare a sistemului va
permite elaborarea msurilor de diminuare al acestor factori. La fel, identificarea factorilor permisivi care au
efect pozitiv asupra EM va permite elaborarea msurilor de dezvoltare n continuare al acestora. Per ansamblu,
nelegerea clar a factorilor contextuali cheie va permite elaborarea mecanismelor adecvate de implementare a
prevederilor Acordului de Asociere cu privire la transpunerea cadrului comunitar n practica naional. Aceast
abordare ar spori ansele ca sistemul naional de EM s fie nu doar euroconform la nivel de intenii ci i unul
funcional i eficace la nivel practic. Astfel, EM ar veni s asigure de o manier mai structurat, sistematic i
transparent c noile politici, programe, planuri i proiecte nu vor rezulta n degradarea mediului, c prile
potenial afectate vor fi consultate, i c deciziile pe marginea acestora vor fi informate, asumate i bazate pe
concluzii calificate.
BIBLIOGRAFIE:
1. Jay S, Jones C, Slinn P, Wood C. Environmental impact assessment: retrospect and prospect. In: Environ
Impact Assess 2007; 27(4): 287-300.
2. Kiseleva, O. Legal foundations of the environmental impact assessment process: comparative studies on EU
Directive on EIA, the Netherlands, and Moldova. MSc thesis. Budapest: CEU Press, 1997.
3. Kiseleva, O. Environmental impact assessment in Moldova. In: Environmental assessment in countries in
transition, eds. Bellinger, Ed, Norman Lee, Clive George, and Anca Paduret. Budapest: CEU Press, 2000.
4. Cojocaru M. Environmental Assessment and Environmental Audit in Moldova: the formal procedure and the
practice. Master of Science thesis, Department of Environmental Sciences and Policy, Central European
University, Budapest: CEU Press, 2001.
5. Capcelea, A.; Cojocaru, M. Evaluarea de Mediu. Chiinau: I.E.P. tiina, 2005.
6. OECD (Organization for Economic Co-Operation and Development). Environment in the transition to a
market economy: progress in Central and Eastern Europe and the New Independent States. Paris: OECD
Publications, 1999.
7. Capcelea, A. Managemenul Ecologic n tranziia economic. Cazul Republicii Moldova. Chiinau: .E.P.
tiina, 2013.
8. HOTRRE de Guvern Nr. 301 din 24.04.2014 cu privire la aprobarea Strategiei de mediu pentru anii 20142023 i a Planului de aciuni pentru implementarea acesteia. Publicat n Monitorul Oficial Nr. 104-109 art
Nr.328.
9. Directiva 2014/52/UE privind evaluarea efectelor anumitor proiecte publice i private asupra mediului.
Jurnalul Oficial al Uniunii Europene, 25.4.2014
10. Directiva 2001/42/CE privind evaluarea efectelor anumitor planuri i programe asupra mediului. n: Jurnalul
Oficial al Comunitatii Europene, 21.7.2001
11. Directiva 2003/35/CE de instituire a participrii publicului la elaborarea anumitor planuri i programe
privind mediul. n: Jurnalul Oficial al Uniunii Europene, 25.6.2003.
12. European Environment Agency. The European Environment-state and outlook. www.eea.europa.eu
13. Krupien, J.; idonien, S.; Dvarionien, J. Current practice and shortcomings of EIA in Lithuania. Environ
Impact Assess Rev 2009, p. 305-309.
14. Heinma, K.; Poder, T. Effectiveness of Environmental Impact Assessment system in Estonia. Environmental
Impact Assessment Review, 30 (4) 2010, p. 272-277.
15. Branko, K.; Urka, D. Confronting reality in strategic environmental assessment in Slovenia costs and
benefits. Environmental Impact Assessment Review, 50, 2015, p 42-52.
16. Cherp, A. EA Legislation and practice in Central and Eastern Europe and the former USSR: a comparative
analysis. Environ Impact Asses Rev 2001; 335-62.

136

17. Cherp, A.; Antypas, A. Dealing with continuous reform: towards adaptive EA policy systems in countries in
transition. J Environ Manage, 2003: 455-76.
18. Runhaar, H.; Driessen PPJ. What makes strategic environmental assessment successful environmental
assessment? The role of context in the contribution of SEA to decision-making. Impact Assess Proj Appraisal,
2007: 2-14.
19. Kolhoff, AJ.; Runhaar, HAC, Driesen PPJ. The contribution of capacities and context to EIA system
performance effectiveness in developing countries: towards a better understanding. Impact Assess Proj
Appraisal, 2009: 271-81.
20. Kolhoff, AJ.; Driesen, PPJ, Runhaar. HAC. An analysis framework for characterizing and explaining
development of EIA legislation in developing countries Illustrated for Georgia, Ghana and Yemen. Environ
Impact Assess Rev 2013: 1-15.


, , . .,

The assumption about the connection of species evolutionary advancement with the flowering period
and corolla anthocyanin and white coloring was checked on 85 species of concrete flora of the city of Chisinau
and 147 species of potential flora of Moldova. It was established that with flowering period increase the families
evolutionary advancement increases, the proportion of species with white and violet-blue corolla decreases,
while the proportion of species with rose-purple corolla increases.
Key words: corolla, anthocyanin coloring, white coloring, evolutionary advancement, flowering
periods.

[1938], ,
, :
,
.

[1966], ,
: , ,
.
[1993], ,
, . ,
74%,
51%. ( 10 15%) , , ,
. , , ,
.
,
, ,
- [, 2013].
Rausher [2008] ,
, -
. ,
,
,
. .

(20052014 ) .
. ,
. Negru [2005,
2006, 2007]; Ciocrlan [2000]; [1986].
[1987].
, 0 , 1-
, 2 , 3 , 4 , 5 6 - .

, [1966],
.
Exel.

137


,%


. 178
27 .
: (13 ), (34 ), (41 ), (34 ) (53 ).
(,
, , , , ) .
,
, (
, 1966)
. .
(85 ) 5 , 5
( 1).
1.
6,00
5,80

5,60

5,40
5,20

5,00

4,80
4,60

4,40
(1-5
1
2
3
4
5
).



. ,
70
60

50
,
40
30

20
4,8 0,26
10
0
9 (), ,
1
2
3
4
5


5,16
0,24; 5,66 0,14 5,18 0,17 ,
- 5,73 0,13 ().
,
?
(
2).
2.
(1-5 ).

,
.
(57,14%),
(28,35%). , ,
, .
,
, . Rauscher [2008],
Penstemon Ipomoea, ,

.
3.


(1-4
).

138


. , ,
.
,
.
( 3)
(2,4) (3,7)
.
,
Viola, Vicia Centaurea,
.
1 () 6 (),
, .
,
, ( )
. ( )
,
,
, .
Viola - Vicia Centaurea ( 1)
.
[, 1966],
,
, .
1. Viola, Vicia, Centaurea .


, t

, t

Viola

1,830,27

18

2,77**

4,050,14

22

6,37***

Vicia

3,190,41

16

5,050,06

18

4,620,27 21
2,31**
5,920,14
25
6,10***
Centaurea
: **P<0,01; ***P<0,001.
Viola, Vicia, Centaurea
(,1986)
. ,
Viola - 18 , Clematis - 4 , Pulsatilla 3 , Nigella - 4 , Fumaria - 4 Lythrum - 3 ,
Vicia -16 , Geranium 14 Veronica 27 . ,
Centaurea 21 , Cirsium - 13 Salvia 10 . -
, (
Viola).

4.
(1,2,3) .
4 5 ,
Viola, Vicia, Centaurea . ,

.

139

5.
(1, 2, 3) .
:
1.
.
2.
,
, ,
.
3. , ,
,
, -
.
4. .
:
1. , .. . : , 1966. 327 .
2. , T.. . : , 1986. 636 .
3. , .. ? B: .
. , 1938, . 234-236.
4. , .. . .
15.07.1994, N 1839-B94, 1994. 56 .
5. , .. . : - , 1987. 292 .
6. , .. / ,
. ... -: , 1966. 430 .
7., .. , . : , 1, 2013. http://elementy.ru/lib/431905.
http://elementy.ru/lib/431905
8. Ciocrlan, V. Flora ilustrat a Romniei. Bucureti: Ed. Ceres, 2000. 1138 .
9. Negru, A. Lumea vegetal a Moldovei. Vol. 2. Chiinu: tiina, 2005. 180 .
10. Negru, A. Lumea vegetal a Moldovei. Vol. 3. Chiinu: tiina, 2006. 203 .
11. Negru, A. Lumea vegetal a Moldovei. Vol. 4. Chiinu: tiina, 2007. 180 .
12. Mark, D. Rauscher. Evolutionary transitions in floral color. Int. J. Plant Sci, 169(1): 2008, .7-21
DIVERSITATEA FLORISTIC A ECOSISTEMULUI PETROFIT DEGRADAT PE EXEMPLUL
CARIEREI DE CALCAR LAFARGE CIMENT
Certan Corina, cerc. t., Bulimaga Constantin, dr. hab. n biologie, cerc. t., Institutul de Ecologie i
Geografie al AM, Grabco Nadejda, USM
The cement factory is located in the northern part of the Republic of Moldova approximately 100 km
from the capital town Chisinau, 7 km from the town of Rezina. From a biogeographic point of view the site of
quarry is placed at the contact of Central European, Eurasian and Mediterranean areas. The location is submitted
from the forest-steppe and steppe regions with petrofite ecosystems and aquatic ecosystems (water bodies, rivers,
wetlands). Terrestrial flora study confirms that herbaceous associations were formed from a wide range of
species: plants of economic importance, petrofite species and hydrophytes, etc. The flora of the quarry is
presented by 98 species of the jerboas vegetation, abuts and trees, but flora of the adjacent ecosystems is
presented with 109 species. Dominant species of the quarry ecosystem are: Verbascum nigrum L., Knautia
arvensis (L.)Coult., Grindelia squarrosa (Pursh) Dun., Erigeron annuus (L.) Pers., Melilotus officinalis (L.)
Pall.
Key words: biodiversity, ecosystems, waste, wood, quarry.

140

INTRODUCERE
Uzina Lafarge Ciment este situat la nordul Republicii Moldova, la o distan de cca 100 km de
Chiinu, la 7 km de or. Rezina. Platforma industrial a uzinei de ciment este amplasat n valea rului Ciorna, la
altitudinea de 50 m, mrginit la nord-est i la sud-vest de dealuri cu nlimea de 100-150 m i povrniuri de
40. Aceast uzin se situeaz pe Podiul Nistrului, care aparine regiunii geomorfologice denumit Platoul
Moldovenesc, caracteristic prin prezena dealurilor nalte i colinelor ale cror culmi coboar domol, spre sud,
sud-est, dup cursurile de apa, care le fragmenteaz i le desparte n vi largi, sau, mai rar, n pante repezi, pe
poriuni ale acelorai cursuri de ap i de pe coastele Nistrului.
MATERIALE I METODE
Obiectul cercetrii a servit flora din cariera de piatr Lafarge Ciment din r-nul Rezina. n analiza
compoziiei floristice s-au luat n considerare, n primul rnd, numrul de specii componente, care la rndul ei
ofer informaii asupra gradului de homeostazie a sistemului dat. Cercetrile n teren au fost efectuate dup
metoda transectelor lineare, care const n notarea succesiunii fitoindivizilor de-a lungul unei linii sau a unei
bande, a crei lungime se stabilete n funcie de tipul de vegetaie studiat [1]. La determinarea speciilor de
plante superioare s-au utilizat un ir ntreg de lucrri [2, 3, 4].
REZULTATE I DISCUII
n cadrul cercetrilor floristice axate pe studiul biodiversitii floristice i elaborarea planului de
management al redresrii florei ecosistemului carierei de calcar Lafarge Ciment ne-am orientat cercetrile
asupra studiului taxonomic al diversitii floristice n raioanele limitrofe carierei i n cariera propriu zis. n total
au fost depistate 117 specii de plante magnoliofite din 43 de familii, cea mai divers - fam. Asteraceae cu 29
specii, iar fam. Fabaceae - 7 specii, fam. Lamiaceae 7 specii i fam. Poaceae cu 6 specii. Dup abundena
speciilor pe primul loc se claseaz Asteraceae, dup care urmeaz Poaceae, Fabaceae i Scrophulariaceae.

Foto 1. Mslinul slbatic (g. Elaeagnus)


Din speciile lemnoase domin mslinul slbatic (g. Elaeagnus). Dendroflora carierei este reprezentat de
20 specii de arbori i arbuti. Pe pantele haldelor speciile nsoitoare care vegeteaz mpreun cu mslinul
slbatic (Elaeagnus argentea Pursh) sunt carpenul (Carpinus betulus L.), salcmul (Robinia pseudacacia L.),
ararul american (Acer negundo L.), iar din arbuti mai frecvente sunt speciile de mcie (Rosa canina L.) i
pducel (Crataegus monogyna Jacq.). Totodat, n locurile cu depozitri de diferit vrst au fost depistate
sporadic i specii de pomi fructiferi: cireul (Cerasus avium (L.) Moench), zarzrul (Armeniaca vulgaris Lam.),
nucul (Juglans regia L.), care au nimerit pe teritoriul carierei i s-au rspndit cu ajutorul psrilor. n ansamblu
flora ecosistemului reflect starea ecosistemelor cu un grad nalt de impact antropic. Cele 117 specii de plante
depistate n carier reprezint circa un sfert din diversitatea ecosistemelor petrofite, care conform datelor
bibliografice depesc 340 specii fr elementul segetal i ruderal care n cadrul carierei este destul de rspndit
[5]. Vegetaia carierei este n etapa de stabilire, de aceea sunt prezente speciile invazive, n primul rnd, trebuie
menionat specia dominant mslinul slbatic (Elaeagnus argentea Pursh), care s-a adaptat uor n condiiile
carierei datorit faptului c este o specie xerofit (rezist la lipsa umiditii). Astfel, pantele calcaroase din
mprejurimile ecosistemului dar i haldele de diferit vrst prezint un habitat ideal pentru aceast specie. n
depresiuni i locurile mai protejate pe teritoriul carierei crete salcmul (Robinia pseudacacia L.), plopul
(Populus sp.), ararul american (Acer negundo L.), carpenul (Carpinus betulus L.), ulmul (Ulmus sp.), seminele
crora au fost aduse pe teritoriul carierei cu ajutorul vntului din ecosistemele forestiere ale mprejurimilor.
Speciile invazive erbacee care s-au adaptat la condiiile de cretere n carier sunt grindelia (Grindelia squarrosa
(Pursh) Dun.), btrniul (Erigeron annuus (L.) Pers.), mucata dracului (Knautia arvensis (L.)Coult.). Aceste
specii au ptruns pe teritoriul carierei prin intermediul vntului din agrocenozele limitrofe, sau de pe marginea
traseelor rutiere, unde din abunden vegeteaz specia Grindelia squarrosa (Pursh) Dun.

141

Foto 2. Erigeron annuus (L.) Pers.

Foto 3. Grindelia squarrosa (Pursh) Dun.

Cele mai abundente plante erbacee de pe pantele haldelor n vara anului 2014 au fost lumnrica
(Verbascum nigrum L.), mucata dracului (Knautia arvensis (L.) Coult.), piuul (Festuca pratensis Huds.), iar
speciile grindelia (Grindelia squarrosa (Pursh) Dun.) i btrniul (Erigeron annuus (L.) Pers.) se dezvolt mai
abundent la baza pantelor haldelor i de-a lungul traseelor care traverseaz cariera.

Foto 4. Verbascum nigrum L.

Foto 5. Knautia arvensis (L.)Coult.

Zona umed din carier, amplasat n depresiune n jurul lacului de acumulare a apelor freatice este
reprezentat de speciile: Eupatorium canabium L., Lythrum salicaria L., Phragmites australis (Cav.) Trin. Et
Steud., specii de Typha i Salix.
n baza rezultatelor obinute, pentru ameliorarea strii vegetaiei carierei pe teritoriul restabilit sunt
necesare investigaii suplimentare pentru elaborarea metodelor de fortificare a pantelor prin sdirea unor specii
de arbori i arbuti rezisteni la condiiile de impact. Pentru aceasta sunt necesare cercetri pentru evidenierea
suprafeelor neocupate de arbori i arbuti, selectarea speciilor perspective pentru amplasarea lor n cadrul
acestui ecosistem degradat. Tot odat, stocarea rocilor n halde noi trebuie s fie coordonat cu specialitii
ornitologi, care ar recomanda anumite locuri pentru pstrarea ornitofaunei care prefer habitate nerestabilite.
Desigur, implicarea unor noi specii n ecosistemul carierei decurge spontan i este de ateptat c haldele n
urmtorii ani s fie populate i de unele specii de stejar, arar, precum i de alte specii de pdure, ns acest
proces fr implicarea omului decurge mult mai lent. Ecosistemul carierei reprezint i un mediu favorabil
pentru creterea plantelor cu pomuoare i nucifere. Una din speciile care ar putea fi sdit i cultivat poate fi
ctina de ru (Hippophae rhamnoides L.), care este o specie nepretenioas, are capacitate bun de ntrire a
solurilor, iar fructele ei au un coninut preios biochimic. Celelalte pomuoare - mceul (Rosa canina L.),
pducelul (Crataegus monogyna Jacq.) sunt prezente n ecosistemul carierei, posed o vitalitate bun, deoarece
s-au adaptat la condiiile de existen al ecosistemului carierei i pe alocuri fructific destul de abundent.
n ansamblu, starea vegetaiei ecosistemului carierei este satisfctoare, procesul de restabilire a
comunitilor vegetale decurge lent. Speciile edificatoare ale carierei (mslinul slbatic Elaeagnus argentea
Pursh i Elaeagnus angustifolia L.) nu sunt specii longevive, de aceea n urmtorii 40-50 de ani ele ar putea fi
nlocuite cu alte specii de plante lemnoase care eventual nimeresc n ecosistem prin intermediul factorilor
naturali sau antropogeni.

142

CONCLUZII:
1. n rezultatul investigaiilor florei carierei Lafarge Ciment i a teritoriilor adiacente au fost identificate 117
specii din 43 de familii. Flora carierei investigate este reprezentat de 98 de specii de plante erbacee arbuti i
arbori, iar flora ecosistemelor adiacente de 109 specii.
2. Diversitatea floristic n ansamblu pe ecosistemul carierei este bogat, ns n raport cu diversitatea
ecosistemelor naturale calcaroase este mult mai redus i este reprezentat n raport de 1:3, adic numrul de
specii nregistrat n carier este de circa 3 ori mai mic comparativ cu speciile din ecosistemele naturale petrofite.
3. Ecosistemul carierei poart un caracter degradat, deoarece flora lui este dominat, n ansamblu, de specii
invazive, speciile din ecosistemele naturale sunt reprezentate aici n raport redus i suport greu condiiile chiar
i n teritoriul restabilit al carierei.
4. Speciile dominante din ecosistemul carierei sunt: lumnrica (Verbascum nigrum L.), mucata dracului
(Knautia arvensis (L.)Coult.), grindelia (Grindelia squarrosa (Pursh) Dun.), btrniul (Erigeron annuus (L.)
Pers.), sulcina (Melilotus officinalis (L.) Pall.), care s-au adaptat mai ales pe haldele cu vrsta de 20 25 de ani,
vegeteaz din abunden i contribuie la restabilirea ecosistemului.
5. n condiiile ecosistemului carierei vegeteaz i unele specii de importan economic: pentru pomuoare mceul (Rosa canina L.), pducelul (Crataegus monogyna Jacq.), medicinale pojarnia (Hypericum
perforatum L.), troscotul (Polygonum aviculare L.), odoleanul (Valeriana officinalis L.), podbalul (Tussilago
farfara L.), brusturele (Arctium lappa L.), ppdia (Taraxacum officinale Wigg.), turicioara (Agrimonia
eupatoria L.), coronitea (Coronilla varia L.), coada-oarecelui (Achillea millefolium L.) etc, melifere sulcina
(Melilotus officinalis (L.) Pall.), salcmul (Robinia pseudacacia L.), salvia (Salvia verticillata L.) etc, eterouleioase pelinul (Artemisia absinthium L.) i salvia (Salvia verticillata L.).
6. Pe teritoriul carierei n-au fost depistate specii rare incluse n Cartea Roie a Republicii Moldova. ns specia
Vitis sylvestris C. C. Gmel. (via de vie slbatic) am depistat-o n imediata apropiere a carierei, ceea ce face
posibil ca n urmtorii ani aceast specie rar inclus n Cartea Roie a Republicii Moldova s fie prezent i n
componena florei carierei.
BIBLIOGRAFIE:
1. Cristea, V.; Gafta, D.; Pedrotti, F. Fitosociologie. Cluj-Napoca: Ed. Presa universitar, 2004. 184 p.
2. Ciocrlan, V. Flora ilustrat a Romniei. Pteridophyta et Spermatophyta. Ed. a II. Bucureti: Ed. Ceres, 2000.
1136 p.
3. , T. . : , 1986. 638 .
4. Negru, A. Determinator de plante din flora Republicii Moldova. Chiinu, 2007. 391 p.
5. , T.. () . B:
. : , 1980, c. 28-36.
STUDIEREA GRADULUI DE TOXICITATE A APELOR RURILOR MICI DIN PARTEA
INFERIOAR A BAZINULUI HIDROGRAFIC RUT
Drumea, Dumitru, dr. n geologie, conf. cerc., Debelaia-Buracinschi Svetlana, cercet. t., Portarescu
Anastasiia, Institutul de Ecologie i Geografie al AM
The lower part of the Raut basin is affected by human activities that are change the status of aquatic
ecosystems. This could be related to insufficiently purified emissions of the wastewater released from different
functional areas such as: living space, agriculture, transport etc. Based on the results of the actual study an
assessment of the degree of water pollution in Orhei and Telenesti districts was made on the base of applying
biotest method, which consists in assessing the response of aquatic organisms under the pollution.
Key words: toxic, pollution, g. Gammarus, small rivers.
INTRODUCERE
Studiu privind toxicitatea resurselor acvatice a rurilor mici din partea inferioar a bazinului hidrografic
a rului Rut au fost efectuate n cadrul cercetrilor privind elaborarea propunerilor pentru planul de
management. Acest document se elaboreaz n cadrul Institutului de Ecologie i Geografie, laboratorul
Ecourbanistic, conform prevederilor Directivei Apei al UE (2000/60/EC). Prima faza a cercetrilor prevede
identificarea condiiilor de referin. Colectarea probelor a fost perfectat din aria parcului naional Orhei ca
zona cu impact redus a factorului antropic i din diferite zone funcionale identificate: zone agricole, de locuit,
turistice i de transport, ct i probe de ap i scurgere de suprafa.
Conform rezultatelor obinute, partea solid a scurgerii de suprafa n or. Orhei constituie circa 680
g/m2 ce depete limita admisibil (500 g/m2) pe aproximativ cu 40% pentru landafturile agricole. Cele mai
mari cantiti a fazei solide (i lichide) se formeaz n partea inferioar pn la 900 g/m2. Ponderea
transportului n acumularea prafului n aceast zon poate fi estimat la nivelul 80% i compuilor de azot cu
predominana formei minerale aproximativ 60-70% din azotul total. Coninutul de fosfor mineral n scurgerea
colectat depete limita admisibil cu aproximativ de 30-50%. Aceasta poate fi explicat prin posibila folosire
neautorizat a detergenilor care conin fosfor i se folosesc pentru splarea ilegal a unitilor de transport n
lunc.

143

Partea inferioar a bazinului rului Rut este afectat de mai multe activiti umane care duc la
schimbarea strii ecosistemelor acvatice. Aceasta ar putea fi legata cu emisiile apelor reziduale insuficient
purificate, scurgerea din diferite zonele funcionale att din spaiu locativ ct i din spaiu agricol i transport.
Reieind din aceasta scopul studiului a fost aprecierea gradului de poluare al apelor rurilor din raioanele
Teleneti i Orhei, aplicnd metoda biotestrii.
OBIECTIVELE STUDIULUI:
1. Identificarea condiiilor de referin privind gradul de toxitate a apelor studiate;
2. Evaluarea gradului de toxicitate a resurselor acvatice din rurile mici din zona Rutului inferior (raioanele
Teleneti i Orhei);
3. Pregtirea propunerilor preliminare privind reducerea impactului compuilor biogeni asupra strii
ecosistemelor n zona studiat.
MATERIALE I METODE
n rezultatul analizei literaturii de specialitate, au fost sintetizate unele metode de utilizare a
hidrobionilor n aprecierea gradului de toxicitatea apelor. n studiul nostru ne-am axat pe una din metodele
clasice - biotestarea, care const n aprecierea reaciei organismelor acvatice n condiiile instalrii aciunii
toxice a substanelor poluante [10] pe un termen experimental scurt (24-96 ore).
Avantajele acestei metode const n: a) Reprezint controlul biologic operativ ce const n
monitorizarea strii mediului [10]; b) Permite aprecierea rapid i adecvat a calitii apei, disponibil vieii
hidrobionilor [6]; c) Indic aprecierea nivelului de poluare, bazat pe nregistrarea numrului de indivizi mori
din organismele-test [3].
Totodat, dezavantajele metodei n cauz sunt: e necesar biotestarea nu doar dup un singur indice [5],
ci dup un ir de caracteristici complexe (fiziologice,biochimice, morfologice etc.).
Experimentul a fost perfectat n urmtoarele faze: aprecierea gradului de poluare a apelor rurilor din
raioanele Teleneti i Orhei a fost posibil folosind metoda biotestrii. Metoda dat permite: aprecierea nivelului
de poluare, bazat pe nregistrarea numrului de indivizi mori din populaie [4]; controlul biologic operativ ce
const n monitorizarea strii mediului [7]; aprecierea rapid i sigur a calitii apei rezervoarelor, disponibil
vieii hidrobionilor [6].
Gammaruii fac parte din grupa organismelor mai puin sensibile i pot fi ntlnite n majoritatea
ruleelor cu ape de calitate bun sau medie, avnd o frecven i abunden destul de nalt. Ltuul este destul
de rezistent la aciunea diferitor substane toxice, ns el evit apele puternic poluate, fiind sensibil la
contaminarea mediului acvatic. Necesit condiii specifice de trai (prefer apa dulce cu mineralizarea nu mai
nalt de 2000 mg/l) [2, 5]. Fiind exceleni indicatori ai calitii apei din ruri, ei joac rolul principal n
monitorizarea biologic. Monitorizarea acestor organisme asigur un tablou clar al calitii apei pe parcursul
ultimelor cteva luni i totodat poate indica dac rul vizat asigur un habitat viabil i condiii adecvate de trai
n cea mai mare msur posibil.
n scopul aprecierii gradului de poluare a apelor rurilor din raioanele Teleneti i Orhei a fost instalat
experimentul acut, specia studiat Gammaruskishineffensis, cu o durat de peste 96 ore. Pe parcursul
experimentului animalele nu erau hrnite. Aplicarea criteriului de supravieuire n experienele cu organismele
bentonice presupune decurgerea experimentului nu doar cu exemplare unice, ci cu un grup de indivizi ai unei
specii, asemntori parametrilor biologici, ce se dezvolt n aceleai condiii. Densitatea acestora trebuie s fie
optim, adic acestea nu ar trebui s se inhibe una pe alta, iar n condiiile ntreinerii n comun acestea nu
trebuie s fie nici prea multe nici prea puine pentru a asigura interaciunea informaional, n lipsa creia muli
hidrobioni, mai cu seam, cei n grupuri, mor. n acelai timp, numrul indivizilor cercetai trebuie s fie
suficient pentru a obine valoarea de certitudine statistic a procentului de mortalitate sau supravieuire [3].
Tabelul 1. Indicii fixai n timpul analizei materialului experimental
Concentraii
Mortalitatea, %
Supravieuirea, %
Vitale (LC0)
0
100
Medii (LC50)
50
50
Letale (LC100)
100
0
Categoriile de calitate a apei se determin n baza nivelului de toleran a organismelor la poluare. n
conformitate cu Regulamentul privind protecia apelor de suprafa, aprobat de Guvernul Republicii Moldova, au
fost stabilite urmtoarele cinci stri ecologice pentru ruri i lacuri naturale.
Tabelul 2. Clasele de calitate a apelor continentale de suprafa i modul lor de reprezentare prin
culori diferite [1]
Clasa de calitate
Culoarea
Observaii
I (foarte bun)
Albastru
Comunitatea observat corespunde n totalitate sau aproape n totalitate
condiiilor n care nu exist factori antropici de stres sau acetia sunt considerai
nesemnificativi (comunitate neperturbat/ de referin)
II (bun),
Verde
Exist modificri mici n comunitatea observat, comparativ cu comunitatea de
referin
III (moderat)
Galben
Compoziia comunitilor observate difer moderat de comunitatea de referin.
Grupele taxonomice principale ale comunitii de referin sunt absente

144

IV (proast)

Compoziia comunitilor observate difer semnificativ de comunitatea de


referin. Multe grupe taxonomice ale comunitii de referin sunt absente
V (foarte proast) Rou
Comunitatea observat este puternic afectat, comparativ cu comunitatea de
referin. Sunt prezentate numai grupele taxonomice capabile s vieuiasc n
condiii extrem de perturbate
EXPERIMENTUL:
Pe perioada desfurrii experimentului, zilnic a fost monitorizat comportamentul ltuilor, innduse cont de schimbrile care intervin n mediul acvatic, n care se gsesc animalele respective.
Tabelul 3. Observaii asupra comportamentului gammaruilor, n dependen de starea mediului acvatic
Timpul
expunerii, ore Comportamentul
Starea mediului acvatic
Pn la 24
Gammaruii sunt mai activi, probabil din cauza Apa este curat, unele probe au nuan
spaiului i al stresului pe care l suport n urma glbuie i sedimente, din acest motiv nc
introducerii n borcanele cu probele de ap. nu se poate stabili gradul de poluare. n
Dup cteva ore are loc acomodarea acestora i apele mai tulburi persist un miros nu prea
activitatea lor se reduce
plcut
24 - 48
Unii gammarui sunt activi (probabil din cauza Pe pereii probelor de ap nr. 4, nr.8 i nr.
lipsei hranei, explornd ntreg borcanul pentru a 9 se observ bule de aer. Acest fenomen ne
o gsi). n probele nr.4 i nr. 7 a disprut cte un permite s facem concluzii preliminare
individ, probabil n urma canibalismului, n referitor la calitatea apei
celelalte probe au pierit unii indivizi. Se
nregistreaz moartea a 50% din efectivul
populaiei n proba nr. 3
48 - 72
n toate probele se observ o deviere a numrului La suprafaa probei de ap nr. 3 apar pete
de indivizi, fa de momentul iniial al ruginii. n probele nr. 7 i nr. 8 se observ
experimentului. Canibalismul se observ n o aglomeraie de alge verzi n form de
proba nr. 9
panglic
72 - 96
Nu se nregistreaz modificri evidente, ntruct Bulele de aer nu mai sunt evidente. Acest
amfipodele s-au acomodat condiiilor de fenomen se poate de explicat prin
laborator i mediului acvatic n care se gsesc
consumul oxigenului de ctre amfipode
Peste 96
Conform datelor din Tab., se observ o n probele cu calitatea bun a apei se
descenden a numrului de gammarui de la observ fenomenul de nflorire, ceea ce
10% n probele cu calitatea bun a apei, pn la denot c n ap se gsesc condiii pentru
50% n apele poluate
via
Tabelul 4. Determinarea calitii apei n baza ratei de supravieuire a gammaruilor dup anumite
intervale de timp
Nr.
prob

1.
2.
3.

Portocaliu

Locul colectrii probelor de ap

Sursa
acvatic
Rul
Ciulucul Mic
Rul
Ciulucul Mic
Rul Rut

5.

Rul
Coglnic
Rule

6.

Rul Rut

7.

Rule

8.

Izvor

9.

Iaz

10.

Rul Rut

4.

*Bun;

Sediment

Calitatea
apei

Nr.
indivizi

Nr.
gammaruilor
n urma experimentului

rmai

s. Zicani,
r-nul Teleneti
or.Teleneti

++

B*

10

Timpul expunerii, ore


24
24 - 48 48
72
9
9
9

++

PM**

10

10

s.Srtenii Vechi,
r-nul Teleneti
s. Incule,
r-nul Orhei
s. Step Soci,
r-nul Orhei
or. Orhei

+++

P***

10

B*

10

++

PM**

10

10

10

+++

FP****

10

s. Vatici,
r-nul Orhei
s. Curchi,
r-nul Orhei
s. Curchi,
r-nul Orhei
s. Trebujeni,
r-nul Orhei

++

PM**

10

10

B*

10

10

10

10

B*

10

10

10

+++

PM**

10

Localitatea

**Poluat moderat;

***Poluat;

Foarte proast****

145

72
96
9

96
9

Probele de ap au fost luate din diverse localiti ale raioanelor Orhei i Teleneti (Tab. 4).
Pentru experiene au fost alei indivizi aproximativ de aceeai mrime. Acetia au fost plasai n vase
transparente (cu probele respective de ap) a cte 750ml, n numr de 10. Numrarea indivizilor s-a desfurat
dup 1, 2, 3, 4, 5 zile de la instalarea experimentului. Vizual a fost apreciat raportul dintre indivizii mori i cei
vii. La fel, a fost luat n consideraie timpul de supravieuire a 50% din indivizii lotului experimental analizat.
Mortalitatea sau supravieuirea, drept criteriu al toxicitii, de obicei, se caracterizeaz prin indicele LC50 n
cazul cruia n experimentul acut ( 24, 48, 96 ore) mor 50% din animalele supuse experimentului.
CONCLUZII:
1. Prelevarea amfipodelor din habitatul lor i ntreinerea acestora n condiii de laborator provoac un stres al
spaiului evident, ce se manifest prin activitatea (micrile)sporit a acestora.
2. n lipsa hranei survine o a doua perioad de stres, care se manifest prin canibalism, unii indivizi mai slabi
revenind drept prad pentru cei mai puternici.
3. Dup cteva ore prima faz a stresului este nlocuit de acomodare, activitatea reducndu-se. A doua faz a
stresului este mai lung i dispare odat cu ncetarea canibalismului dup o perioad de 48 ore.
4. Starea ecosistemului rului Rut din or. Orhei degradeaz, ntruct indicele LC50 se nregistreaz n mai puin
de 24 ore. Starea ecosistemului rului Rut care trece prin s. Srtenii Vechi este poluat, indicele LC 50 fiind
nregistrat n 48-72 ore. Starea rului Rut care trece prin celelalte localiti (or. Teleneti, s. Step Soci, s. Vatici,
s. Trebujeni) este moderat poluat (satisfctoare).
5. Rezistena de 72-96 ore a mai mult de 80% din populaia vizat ne indic starea bun a apelor rurilor mici din
raioanele Teleneti i Orhei (Cogilnic, Ciuluc). ntruct au survenit unele modificri (neeseniale) i nr.
gammaruilor nu rmne acelai mai mult de 96 ore, starea ecosistemului nu este relativ bun.
RECOMANDRI:
1. n bazinul rului Rut, or. Orhei trebuie revizuit tot sistemul de management a rurilor pentru a preveni
statutul r. Rut de ru poluat pe viitor starea nesatisfacatoare.
2. Ar trebui de elaborat fie de proiect e privind mbuntirea activitii ntreprinderilor cu emisiile care
declaneaz starea proast a apei din s. SrteniiVechi i alte localiti din regiune.
BIBLIOGRAFIE:
1. Aevschi, V. Ecologie acvatic, manual. Chiinu, 2010, p.74-75.
2. Monitorizarea calitii apei n baza macronevertebratelor acvatice. Chiinu, 2015, p. 8, 9, 75, 111.
3. , ..; , ..; , .. . :
, 1987, . 82-86.
4. , ..; , ..; , .. B:
. , I, , 1988.
5. , ..; , ..
. B: , 32, 2, 1996, c.75.
6. , ..
. : VIII , II.
, 2001, .145.
7. , ..; , .., .
B: VIII , I. , 2001, .27.
8. http://www.scrigroup.com/diverse/Legea-tolerantei85224.php.
9. http://www.scribd.com/doc/105247824/Poluarea-apelor#scribd.
10. http://www.scritub.com/geografie/ecologie/Legile-generale-ale-ecologiei1114121020.php.
11. Dajos. Precis decologie. Paris: Dunod, 1970.
VESTIGIILE ARHEOLOGICE - COMPONENTE ALE PEISAJELOR CULTURALE DIN NORDUL
REPUBLICII MOLDOVA
Mironov Ion, dr. conf. univ., Universitatea de Stat din Tiraspol (cu sediul n Chiinu)
The article highlights the establishment of cultural landscapes in the northern of Republic of Moldova
through spatio-temporal analysis of archaeological remains.
Key words: cultural landscape, archaeological remains.
INTRODUCERE
Peisajele culturale, formate ca rezultat al interaciunii evolutive dintre societatea i natur, beneficiaz
de o atenie sporit din partea diferitor tiine, inclusiv i ale geografiei, prin orientarea cercetrilor sale n
stabilirea potenialului specific al peisajelor, n scopul gestionrii acestora. Gestionarea peisajelor, ns, trebuie
s urmreasc, nu numai asigurarea necesitilor materiale i culturale ale numrului populaiei n cretere, dar s
i asigure echilibrul ecologic, care ar garanta funcionarea optim a lor. Investigaiile actuale, ce in de definirea
peisajelor culturale, au generat discuii contradictorii benefice, multitudinea opiniilor i abordrilor expuse,
conturnd importana teoretic i practic a studiilor n acest domeniu [1].

146

Conform uneia din multiplele abordri, celei informaional-axiologice, peisajul cultural este neles ca
un produs comun al omului i naturii, ca un sistem complex de valori materiale i spirituale i cu un coninut
informativ ecologic, istoric i cultural. Astfel, peisajul cultural reprezint un complex teritorial natural-cultural,
format ca rezultat al interaciunii evolutive dintre societate i natur, a activitilor socio-culturale i economice,
constituite din combinaii specifice ale componentelor naturale i culturale aflate ntr-o relaie durabil i
interdependent [5].
Vestigiile arheologice din nordul Republicii Moldova (n continuare RM), pot fi considerate ca
componente ale peisajelor culturale, reprezentnd astfel o baz pentru cunoaterea evoluiei interaciunii dintre
societate i natur n acest spaiu, a creaiei sale materiale, culturale i spirituale.
MATERIALE I METODE
Procesul de nfiinare a peisajelor culturale, din nordul RM, a fost elucidat prin analiza diferitor
materiale cartografice, arheologice, istorice ct i surse bibliografice ce oglindesc procesul respectiv n diferite
perioade istorice.
Metodologia cercetrii se bazeaz pe abordarea peisajelor culturale, a analizei istorico-geografice
regionale, utiliznd metodele pe larg rspndite n studiile de acest gen ca: metoda cartografic, descrierii
interpretative, analizei i sintezei, comparativ.
REZULTATE I DISCUII
Numeroasele cercetri arheologice, efectuate de-a lungul timpului [3, 4, 6], pe teritoriul RM i n
deosebi n partea de nord, au remarcat faptul, c resursele i condiiile naturale favorabile, au atras populaia nc
din paleolitic n grotele Duruitoarea Veche, Buteti, Bobuleti, Vrvreuca, Rogojeni, staiunea Cosui,
Alexndreni, Cocodeni, Cotiujenii Mici, Dumbrvia, Iezrenii Vechi, Pepeni, Prepelia, Rdoaia ct i n alte
locuri ale rurilor bazinului Nistru i Prut (fig. 1a) [4].
Prezena omului paleolitic n peisajele regiunii podiurilor de silvostep se datorete condiiilor
favorabile pentru viaa lui (prezena peterilor pentru organizarea spaiului de trai); prezena rezervelor
nsemnate de cremene, necesare pentru confecionarea uneltelor de munc n depozitele senomaniene; a
resurselor de apa, animaliere, vegetale bogate n pete i molute comestibile, fructe i pomuoare de pdure.
Vestigii ale paleoliticului mediu, au fost la Trinca, Buzdujeni, Naslavcea, Floreti, Otaci (fig. 1b).
Monumente ale paleoliticului superior (fig. 1c) descoperite la Brnzeni, Corjeui, Corpaci, Viioara,
Gura Camencii, Racov etc. (fig. 1c), confirm majorarea arealelor peisajelor culturale. Cele mai multe situri
arheologice sunt concentrate n sectorul de mijloc a vii rului Prut (segmentul Lipcani-Costeti) i rului Nistru
(segmentul Naslavcea-Camenca), n limitele raionului Edine cca 25 vestigii paleolitice i Soroca - cu cca 20 de
staiuni.
Fig. 1. Vestigii arheologice
Prezente
sunt
i
vestigiile
arheologice
din
epocile de mai trziu. n
preajma acelorai sate ct i n
apropierea
altor
localiti
(Frumuica,
Bulboci,
Copceni,
Chirileni,
Chicreni, Pelinia, Bilicenii
Vechi,) au fost identificate
obiecte din mezolitic (fig. 1 d)
i neolitic. n neolitic, n
perioada dezvoltrii agriculturii
i domesticirii animalelor mai
solicitate pentru populare devin
peisajele de silvostep i step
cu soluri fertile.
n nordul RM peisajele culturale ale neoliticului i-au gsit reflectare n cele trei comuniti culturale
neolitice: Cri, Bugo-Nistrean i Ceramicii band-liniare. Cultura Cri se evideniaz cu siturile de la Viioara,
pe malul rului Prut i Drgneti-Sacarovca, pe cnd cultura Bugo-nistrean este reprezentat de o serie de
staiuni arheologice situate n lungul rului Nistru, ncepnd de la Otaci i pn n apropierea oraului Camenca.
Purttorii acestei culturi se organizau n aezri mici, cu 3-8 locuine, plasate pe terasele joase ale vii rului. Se
practica vnatul, pescuitul i culesul pomuoarelor. Siturile culturii Ceramicii band-liniare, pe teritoriul
Republicii Moldova, au fost descoperite la Gura Camencii, ira raionul Floreti. De rnd cu locuinele adncite
apar i cele de suprafa, descoperite lng Soroca. Ocupaia de baz a populaiei rmnnd creterea animalelor,
cultivarea plantelor, pescuitul, vnatul i culesul pomuoarelor. Aezrile din aceast perioad de obicei aveau o

147

suprafa redus n jur de 200 - 250 m2. Suprafaa total a tuturor aezrilor umane din neolitic se estimeaz la
circa 50-100 ha [6].
O nou etap important n extinderea peisajelor culturale este cultura Cucuteni-tripolie n care au
aprut aezri n luncile rurilor, iar ceva mai trziu i pe interfluvii. Cele mai cunoscute vestigii ale acestei
perioade sunt cele de la Brnzeni, Cuconetii Vechi, Trinca, Bdragii Vechi, Caracuenii Vechi, Gordineti
(Edine); Racov IX (Camenca); Zastnca II, Trifui II (Soroca) i lng oraul Floreti. Este necesar de
menionat c, n aceast perioada aceste nuclee ale peisajelor culturale erau situate att solitar ct i n grupuri cuiburi a cte 5-8 aezri. Dimensiunile lor variau de la 15000 m2 (Costeti, Corestui) pn la 40000 m2
(Saharna, Potrca). O trstur specific a acestei perioade este apariia locuinelor i a construciilor auxiliare
din piatr, lemn i argil. O dezvoltare intens a avut olritul. Astfel, au aprut i cuptoare de ars lutul. La
nceputul culturii bronzului modul de via seminomad al populaiei devine sedentar, fapt confirmat i de
vestigiile din apropierea localitilor Coteala i Hdrui raionul Briceni, ct i Grinui din raionul Dondueni
[3].
O nou etap n extinderea peisajelor culturale este descoperirea fierului. Astfel, folosirea metalului i a
uneltelor de metal, ncepnd cu sec. I .e.n. a contribuit la extinderea valorificrii nu numai a regiunilor
mpdurite de silvostep.
Cunotinele obinute despre mediul nconjurtor n primele secole ale erei noastre au intensificat
procesul crerii aezrilor umane att n vile rurilor, ct i pe terasele lor, extinznd astfel suprafaa peisajelor
culturale. Astfel, n structur morfologic destul de stratificat a peisajelor culturale se difereniaz i vestigiile
arheologice.
CONCLUZII:
1. Studiul vestigiilor arheologice, n aspect spaio-temporal, permite s evideniem etapele de constituire i
individualizare a peisajelor culturale.
2. Siturileile arheologice, ale diverselor culturi, prezente neuniform, n nordul RM, confirm existena
civilizaiilor umane din trecut, reprezentnd un tezaur esenial al motenirii culturale i constituind o punte de
legtur ntre prezentul i trecutul culturilor umane, de aceea considerm c vor avea un impact semnificativ n
studiul peisajelor culturale, de asemenea ele prezint un interes tiinific, au o valoare informativ, istoricocultural i turistic.
BIBLIOGRAFIE:
1. Gavra, C. Peisaje culturale n Munii Metaliferi. Rezumatul tezei de doctorat. Cluj-Napoca, 2012. 26 p.
2. Mironov, I.; Constantinov, T. Dinamica populrii teritoriului Republicii Moldova. n: Lucrrile simpozionului
Sisteme Informaionale Geografice. Iai, 2001, nr. 7, Tomul XLVI, p. 65-70.
3. , .. . . 3. :
, 1973. 128 .
4. , .. . . . 1
: , 1973. 176 .
5. , .. : , , . B:
. , 2000, . 3752.
6. , .. ; .2.
: , 1973.


, . . , ., . . ., , . . ,
., . . . , . . , ., . . . .,

Studied phytotoxicity Cu2 + and Pb2 + to modify the primary metabolic processes. It is found that copper
and lead, depending on the concentration showed neutral (adaptive) stimulating or phytotoxic effect on the
performance of the primary metabolic processes in the seeds of maize.
Key words: corn, heavy metals phytotoxicity, primary indicators of metabolic processes.


.
()
. 50.
, ,
. ( ) , , , , , .
( ) : , , , , ,
. () , , , , [1].

148

,
. .
,
.
[4]. ,
, [4].
:
( , , )
,
, ,
, , . ,
,
.
, , , , ,
. .
, ,
.
,
, .. - ,
[5].
, ,
, , - .
:
- 70 510 , - 13 110 , - 310 1500 - 740
5900 .
[5].
, ,
.

[3].

.

.
,
().

(Cu2+) (Pb2+)
: (CuSO4*5H2O) 0,025; 0,05; 0,1; 0,125;
0,2 / (Pb (CH3COO)2) 0,025; 0,05; 0,1; 0,125; 0,2 /.
- 450,
24 .
.

[6] 50 4-
.
+260 7 . (Cu2+ Pb2+)
, - , ,
12038-84.

,
[6]. 20 .
7 +26 0 . 7-
: , , , ,
, . Cu2+ Pb2+
7
.
.
- .
. [2]. Microsoft Excel 2010.

149


(Cu 2+ Pb2+)
.
,
, ,
,
. . 1. ,
,
20,1% 27,9 %.
,
0,1 / (39,6%), 0,125 / (29,5%) 0,2 / (32,9).
, , 0,10 0,125 /
, 13,0 19,7%
. 0,025 0,2 /, ,
6,9%, 6,4%
.
,
. 1. ,
. 0,025; 0,05 0,2 /,
36,7; 28,0 12,2%.
(0,025 0,2 /), 34,1 9,6 %.
.

150

. 1. Cu 2+ Pb2+

Pb 2+ (. 1)
11,1 17,0% .
Cu2+ , 0,025; 0,05 0,125 /
, 14,5; 10,7 7,2% , 0,1
0,2 / ().

, ,
.
,
, 5,2 21,0%
, 0,2 /. 15,1 25,8%
. 0,05 0,125 /
, , ,
8,6%. 0,20 /
17,1 14,0% .
8,4 14,8%
0,025; 0,1 0,2 /,
, 0,05 0,125 /. ,
12,3 22,6% 0,025; 0,05; 0,125 0,2 /,
0,1 / .
,
. , (. 2) (
, )
, , - ..
[3] ,
.
Cu2+ (
9,5-32,8%, 17,9-46,2%, 11,9-30,5%
) (. 2).

151

. 2. Cu 2+ Pb2+

, , Pb2+
8,5 25,5%,
11,0-12,2%, 10,2-30,5% .
, ,
,
, .
:
1. (),

.
2. , Cu2+ Pb2+ 0,025; 0,1 0,2 /
.
3.
, .
:
1. , ..; , ..

http://www.rgazu.ru/db/conferencii/web/07_1/works/012.htm
2. , . . a : , 1985. 351 .
3. , ..; -, .. .
. (, Zn, )
- . : , 1983, . 5, 22-42.
4. , ..; , ..; , ..
. :
, 2005, 4, . 67-68.
5. , .. http://www.o8ode.ru/article/planetwa/mere/heavy.htm
6. , .. . : - , 1959.
STUDIUL RADIOLOGIC AL ARIILOR NATURAL PROTEJATE DE STAT
DIN ZONA DE NORD A REPUBLICII MOLDOVA
Stegrescu Vasile, dr. n tiine biologice, conf. ceercet., cercet. t. coordonator, Motelica Liliana,
cercet. t. superior, Vatamaniuc Galina, dr. n tiine biologice, conf. ceercet., cercet. t. superior, Institutul de
Ecologie i Geografie AM
This work represents the radiological study of State Protected Natural Areas in the North of Republic of
Moldova as a consequence of the Chernobyl NPP (April 26th 1986). It was assessed radiologically external
gamma background level, content of natural radioactive elements 40K, 226Ra and 232Th in soil and anthropogenic
radionuclide biologically significant 137Cs which has contributed significantly to radiological pollution in
Moldova.
Key words: radioactivity, radiological substance, radionuclide natural, technogenic radionuclides.
INTRODUCERE
Cercetrile radioecologice au luat amploare la nceputul dezvoltrii energeticii nucleare. Accidentul de
la Centrala Nuclear-Electric de la Cernobl (26 aprilie 1986) cu consecinele sale enorme a avut un impact

152

esenial asupra strii radioecologice a teritoriului Republicii Moldova [4], inclusiv i asupra Ariilor Natural
Protejate de Stat. n urma acestui accident a fost nregistrat un nivel nalt de contaminare cu radionuclizi
antropogeni a landafturilor Platoului de Nord al Moldovei. De menionat c fondul radiologic gamma pe
parcursul lunii mai a anului 1986 a variat de la 60 pn la 430 R/h. Nivelul fondului gamma pe unele sectoare
agricole n primele zile ale acestei luni constituia pn la 1000 R/h [2, 7]. Este cunoscut faptul c n jurul
teritoriului rii noastre la distana de 125-450 km se afl 7 centrale nucleare, care contribuie considerabil la
poluarea mediului. Polund mediul ambiant, radionuclizii artificiali (cesiu-137, stroniu-90) sporesc nivelul
fondului radioactiv al lui, constituit ndeosebi din toriu, radiu i potasiu-40. Lucrarea de fa i propune studiul
radioecologic al unor Arii Natural Protejate de Stat din zona de Nord al RM, care sunt desemnate pentru a
contribui la protejarea i conservarea celor mai valoroase elemente ale patrimoniului natural i cultural [1].
MATERIAL I METODE
n calitate ca obiect de studiu au servit Ariile Naturale Protejate de Stat din bazinul fl. Nistru, zona de
nord a RM: Rezervaia Natural Silvic ,,Bxani (RNS), Rezervaia Peisajer ,,Cosui (RP), Rezervaia
Peisajer ,,Holonia (RP). Pentru determinarea coninutului de radionuclizi antropogeni de via lung 137Cs
i a celor naturali - 40K, 226Ra i 232Th n sol [6] au fost prelevate probe din aceste arii conform metodelor
cunoscute [5]. Analiza radiospectrometric a probelor de sol la coninutul de 137Cs, 40K, 226Ra i 232Th (Bq/kg) a
fost realizat prin radiospectrometrie gama de nalt rezoluie n condiiile Institutului de Fizic i Inginerie
Nuclear Horia Hulubei.
REZULTATE I DISCUII
Nivelul fondului gamma n zona studiat este determinat n principal de coninutul n sol al
radionuclizilor naturali Potasiu-40, Radiu-226 i Toriu-232. ns, un aport semnificativ l are radionuclidul Cs137 depus drept rezultat al precipitaiilor radioactive dup accidentul de la CNE Cernobl din anul 1986.
Datele obinute relev c dup 29 ani de la accidentul de la CNE Cernobl nivelul fondului radiologic
gama variaz de la 11,21 R/h (RNS Bxani) pn la 20,1 R/h (RP Cosui) (tab. 1). Este cunoscut, c
radionuclizii ptruni n cuvertura de sol din aer, iniial se concentreaz n stratul superior al solului 0-5cm,
apoi, n funcie de timp, ncep a migra n adncime [3]. Migrarea pe vertical a radionuclizilor n sol depinde de
un ir de factori, unul dintre care este tipul i subtipul de sol.
Tabelul 1. Caracteristica radiologic a solului din ariile studiate
Nr.
Locul
Tipul de sol Adncimea,
Activitatea radionuclizilor, Bq/kg
Fondul
d/o
prelevarii
cm
gama,
137
40
226
232
Cs
K
Ra
Th
R/h
1.
RP Cosui
cernoziom
0-5
37,56,0
49023,0 22,05,5
38,04,0
20,1
levigat, lut
5-10
9,03,0
52525,0 25,06,0
43,04,0
argilos,
10-20
<4,0
48,824,0 20,06,0
43,04,0
erodat
20-30
<3,0
51625,0 28,06,0
44,04,0
moderat
2.
RP Holonia cernoziom
0-5
79,310,0 43625,4 215,6
364,0
19,0
levigat, lut
5-10
36,86,3
51424,0 225,5
404,0
argilos,
10-20
<4,0
52124,0 236,0
384,0
neerodat
20-30
<2,0
48824,0 236,0
374,0
3.
RNS Baxani
sol cenuiu
0-5
78,58,6
28322,0 <13
124,0
11,2
molic, lut
5-10
35,26,0
32220,4 <10
144,0
argilos,
10-20
5,52,0
30620,7 <11
124,0
neerodat
20-30
6,72,0
31420,0 <8
124,0
Analiza radiospectrometric gama a probelor de sol a permis relevarea coninutului radionuclizilor
antropogen 137Cs ct i a celor telurici: 40K, 226Ra i 232Th.
Des. 1. Coninutul radionuclidului
Cs137 (Bq/kg) n solul Ariilor Naturale
Protejate de Stat.
Au
fost
relevate
particularitile distinctive de migrare a
radionuclidului
longeviv,
biologic
semnificativ 137Cs din sectoarele silvice,
concentraia maximal a cruia s-a
acumulat n stratul superior al solului,
fapt confirmat prin analiza litierei i a
probelor de sol Concentraii maxime de
137
Cs au fost relevate n solul RNS

153

Baxani (78,5 Bq/kg) i RP Holonia (79,3 Bq/kg) (tab. 1, des. 1). De menionat, c de regul, n ecosistemele
naturale, unde nu au fost efectuate lucrri agricole, concentraia cea mai mare a fost remarcat n straturile
superioare ale solului, iar n ecosistemele agricole n stratul arabil.
Datele analizelor de laborator (tab. 1, des. 1) au demonstrat, ca migrarea radionuclidului longeviv 137Cs
are o specificitate proprie, coninutul lui n stratul 0-5 cm este mai mare de cteva ori fa de celelalte orizonturi
de sol. De menionat c perioada de semidezintegrare (T1/2) a 137Cs este de 30 ani. Aceasta ne demonstreaz,
particularitile de absorbie a radionuclizilor de ctre complexul adsorbativ de sol, care asigur meninerea de
lung durat n mediul terestru a proceselor de acumulare de ctre plante a radionuclizilor longevivi.
Radioactivitatea naturala a solurilor i plantelor, n temei, depinde de coninutul de 232Th, 226Ra i 40K.
Fondul radioactiv natural al solurilor este determinat mai cu seam de 40K. De menionat c fluxul potasiului-40
n biosfer nu este supravegheat, iar n solurile Republicii Moldova coninutul mediu al K-40 constituie 1,62,410-4 %. Dup analizele radiospectrometrice a 40K, 226Ra i 232Th concentraia acestor radionuclizi n sol este
determinat n temei de componena granulometric a solului. Radiul este un radionuclid natural mobil i cu ct
textura solului este mai uoar cu att cantitatea radionuclidului se micoreaz. Concentraia medie a 226Ra n
Republica Moldova este de 49-50 Bq/kg [16]. Din analizele radiospectrometrice n solul ariilor de studiu (tab.
1), coninutul radionuclizilor naturali 40K, 226Ra i 232Th variaz n raport cu tipul de sol.
CONCLUZII:
1. Studiul efectuat pe parcursul anilor 2012-2013 a permis stabilirea dup o perioad ndelungat de aprox. 30
de ani de la accidentul de la CAE Cernobl a nivelului debitului de doz gama extern, coninutului
radionuclidului antropogen cesiu (137Cs), precum i a celor naturali - potasiu (40K), toriu (232Th) i radiu
(226Ra) n Ariile Naturale Protejate de Stat din zona de nord a Republicii Moldova.
2. A fost remarcat faptul diminurii nivelului debitului de doz gama extern precum i a coninutului
radionuclizilor naturali i antropogeni n funcie de timp i tipul de sol.
3. Au fost stabilite fenomenele de acumulare a radionuclidului 137Cs n straturile superioare ale solului
ecosistemelor naturale, precum i procesele de migrare n profunzime n ecosistemele naturale.
4. Lund n consideraie faptul informaiilor contradictorii din literatura de specialitate privind gradul i suprafaa
contaminat cu radionuclizii antropogeni drept rezultat al accidentului Cernobl considerm necesar de a extinde
cercetrile de acest tip pe ntreg teritoriul Republicii Moldova.
BIBLIOGRAFIE:
1. Stanciu, E. Ghid pentru managementul operaional al ariilor protejate din Republica Moldova. Chiinu:
ProPark, 2013. 108 p.
2. Stasiev, G.; Nedealcov, S.; Burlacu, I. Starea radioecologic a mediului Republicii Moldova. Chiinu, 1998.
115 p.
3. Stegrescu, V.; Motelica, L. Starea radiologic a ecosistemelor silvice din Zona de nord est a Republicii
Moldova. n: Materialele conferinei tiinifice internaional ,,Cernoziomurile Moldovei - evoluia, protecia i
restabilirea fertilitii lor, 12-13 septembrie 2013. Chiinu: Ed. Pontos, 2013, p.323-326.
4. , ..; , .. .
n: Materialele simpozionului tiinific internaional ,,Problemele i perspectivele radioecologiei n Republica
Moldova, 16-17 octombrie, 1996. Chiinu, 1996, p. 4-6.
5. , . . : . : , 1998, 486 .
6. -90 -137 ,
. . . . : , 1985. 64.
7. , .. . n: Agricultura
Moldovei, 2001, nr. 3, p. 16.
,

.., ..,
This article provides the GIS-cartographic technique for emergency risks estimation, caused by heavy
precipitation in the form of torrential rains and their coupled with hail, strong winds, etc. at the Republic of
Moldovas territory.
Key words: emergency, natural risks estimation, mapping techniques.
, ,
, .
: , , ,
.. ,
, , ,
(),

154

.
, , 2000, 2002, 2007 2012 ,
. 2008 2010
,
.
,
1998-2014 . , - 75,2%
: , , ,
. ,
, , .
, ,
. ,
, . .
-
, .
-
, ,
. ,
. ,
- ,
.
:
,
-
(.1). , - ,
, ,
.


: ,
,

. 1.
(%)

,


.

%
1

15

23,2

0,6
0,4

9,9

20,1

, ,
,

,
,

,
1998-2014 . 3186,1 . , 22 (. 2).
2,3

0,3

6,7

155

1201667,5

836261,3

795695,2

. 2.
19982014 .

157834,7

,
,
,,


,
.
, .
,
.

, :
30 , 1 ; 20
25 / .

, ,
.

. Arc View,

17 .
,
, .

.

.
,
,
.
. 3 -
,
1998-2014 .
.
305574,9

. 3. ,

1998-2014 .

120000

40

.
35

100000

30
80000

25

60000

20
15

40000

10
20000

0
1998

2000

2002

2004

2006

2008

2010

2012

.
(
0-4) ,
- .
( 5-10)
.
( 11-13)
- .
(14-16)
.

2014

. 4. 1998-2014 .
.
1998, 2001 2012 ., 1998 . ,
1 2 .
.

156

,
, , , (.4).
,
, , 1998-2005 .
2 12 2006 . - 6 34.

305574,9 . .
.
,
,
.
,
(2002 .),
(2001, 2004 .).

-
, ,
, 19982014 .
. 5.
, 1998-2014 .
.
250000


40
.
35

. .
200000

30
25

150000

20
100000

15
10

50000
5

,
1 2,
3 ( 2003 .).


.
1998-2014 . 795695,2 .
(.6).
.6.
1998-2014 .



, ,
. 7.
0

1999

2001

2003

2005

2007

2009

2011

2013

. 7. , :
) , ) (1998-2014 .).
, ,
. 8.

157

40000

60

35000
.
30000

300000

60

50

250000

40

200000

40

30

150000

30

20

100000

20

10

50000

10

50

25000
20000
15000

. 8.
:
) ; )

1998-2014 .

10000
5000
0

0
1998

2000

2002

2005

2007

2009

2011

2013

0
1998 2001 2004 2005 2006 2008 2009 2010 2011 2012 2013 2014

,

.
. (0-4) .
5-10 . ,
11-16.
,
, .

.
.
,
, , .
, , ,
.

,
.
RELAIA NTRE COMPONENA APEI RURILOR I A MONUMENTELOR NATURALE
HIDROLOGICE PROTEJATE DE STAT DIN BAZINUL LOR
Sandu Maria, dr. n chimie, conf. cercet, cercet. t. coordonator, Tr Anatol, dr. n biologie, conf.
cercet., sef. lab. t., Lozan Raisa, dr. n chimie, conf. cercet., cercet. t. coordonator, Mosanu Elena, cercet. t.,
Goreacioc Tatiana, cercet. t. sup., Institutul de Ecologie i Geografie al AM
.
Hydrological Natural Monuments are represented by springs, lakes, ponds, swamps, old river bed, other
aquatic sources of national interest and valuable ecological, economic, social, recreational and possibly curative
(mineral, geothermal, muds, etc.). Springs - Natural Hydrological Monuments often play a crucial ecological
status - water quality in the river basins. The Hydrological Natural Monuments include a number of springs
spread throughout the country. According to the Law Nr. 1538-XIII dated 25.02.98 in the Republic of Moldova
there are 31 Hydrological Natural Monuments protected by the State. Thus this study related to assessing said
role of Natural Hydrological Monuments in hydrological basins of rivers Raut, Cubolta and Cainari.
Key words: Hydrological Natural Monuments, Rut, Cubolta and Cinari rivers, water quality, self
purification, nitrification.
INTRODUCERE
Cercetrile, rezultatele crora sunt prezentate n articol au fost efectuate n cadrul proiectului aplicativ
11.817.08.05A Impactul factorilor naturali i antropici asupra geo- i ecosistemelor de pe teritoriul Republicii
Moldova n scopul perfecionrii managementului resurselor naturale i conservrii ariilor reprezentative.
Monumentele naturale hidrologice sunt reprezentate de izvoare, lacuri, bli, mlatini, albii fluviale vechi,
alte surse acvatice de interes naional i valoroase din punct de vedere ecologic, economic, social, recreativ i,
eventual, curativ (ape minerale, geotermale, nmoluri etc.) [1].
Izvoarele - Monumentele Naturale Hidrologice (MNH) joac un rol, adesea esenial n starea ecologic
calitatea apei din bazinele rurilor. Conform Legii Republicii Moldova Nr. 1538-XIII din 25.02.98 privind
fondul ariilor naturale protejate (anexa 1/B) 31 de MNH sunt protejate de stat.
Monumentele naturii de origine hidrologic includ un ir de izvoare repartizate pe tot teritoriul republicii
(2 MNH n bazinul hidrografic al r. Prut i 29 n bazinul fluviului Nistru). Prezentul studiu ine de evaluarea
rolului menionat al MNH din bazinele hidrografice ale rurilor Rut, Cubolta i Cinari.
METODE I METODOLOGIA INVESTIGAIILOR
Metode: spectrofotometria, poteniometria, titrimetria [2-4].
Metodologii: prelucrare statistic, analiza corelaional, calcule; pentru verificarea validitii
rezultatelor obinute s-au folosit balanele ionice.

158

REZULTATE I DISCUII
Rul Rut
Rutul i are nceputul n partea ridicat a Podiului Moldovenesc de Nord, n apropierea satului Rediu
Mare, raionul Dondueni.
Componena fizico-chimic a apei rului este influenat n mare msur de activitatea agricol i
industrial desfurat n bazinul lui, deoarece n valea Rutului se afl 67 sate, 3 orae (Bli, Orhei, Dubsari).
Coninutul macroionilor anorganici sunt n cretere nesemnificativ pe cursul rului spre or. Orhei cu excepia
Mg2+, dar nu este influenat de cel al MNH din s. Fntnia (fig. 1).

Figura 1. Componena chimic a apei r. Rut (s. Baraboi, Briceva, or. Orhei) n comparaie cu apa din MNH, ce
curge n ru
Coninutul substanelor tensioactive anionice (STAAn) n apa rului i valoarea CCO-Cr n preajma s.
Baraboi i s. Briceva denot c apa MNH nu contribuie la poluarea rului, dar pe cursul lui spre i aval de or.
Orhei apa devine tot mai poluat (fig. 2), motivul fiind deversrile de ape uzate neepurate i depozitarea
neregulamentar a deeurilor.

Fig. 2. Coninutul n ap a substanelor tensioactive anionice (STAAn) i valoarea CCO-Cr pe cursul r. Rut (s.
Baraboi, s. Briceva, or. Orhei)
Rul Cubolta
Rul Cubolta izvorte din s. Lipnic, raionul Ocnia i debueaz n r. Rut de pe malul stng lng s.
Putineti, raionul Floreti. Lungimea rului este de 101,3 km, suprafaa bazinului de recepie - 943 km2. n
bazinul r. Cubolta sunt izvoarele MNH din s. Plop.
n componena chimic a apei din ru se evideniaz o corelare cu cea a apei din MNH i o cretere a
coninutului macrocomponentelor, tipul i calificativul apei fiind acelai pn la revrsarea n r. Rut, (fig. 3).
r. Cubolta, s. Plop
1000

MNH, s. Plop, curge n. R. Cubolta


MNH, s. Mndc

mg/dm3

800

r. Cubolta, s. Cubolta

600
400
200

Na+K

Ca2+

Mg2+

Cl-

SO4 2-

HCO3-

Reziduu fix

Figura 3. Componena chimic a apei r. Cubolta (s. Plop i s. Cubolta) comparativ cu a celei din MNH, ce curge
n ru.

159

a) b)
Figura 4. Coninutul cuprului (a) i a substanelor tensioactive anionice (b) n apa rului Cubolta

a) b)
Figura 5. Valoarea CBO5 (a) i CCO-Cr (b) n apa rului Cubolta
Coninutul cuprului, al substanelor tensioactive anionice (STAAn) i total al substanelor organice
(CBO5 i CCO-Cr) n apa rului Cubolta, s. Plop, este n descretere pe cursul lui comparativ cu cel din apa
rului din preajma s. Lipnic: de 3,3 ori pentru cupru, 8,3 ori STAAn i de cca 23 ori - pentru CBO5 i CCO-Cr
mai mic (fig. 4 i 5), ceea ce demonstreaz influena pozitiv a izvoarelor de mbuntire a calitii apelor de
suprafa din teritoriu.
Tipul i calificativul apei r. Cubolta corespunde cu cea a MNH, izvorul din s. Plop.
Rul Cinari
Rul Cinari, afluent pe stnga al Rutului, are o lungime de 113 km, izvorte la o altitudine de 217 m,
n partea de est a Cmpiei Moldovei de Nord (lng s. Briceni, raionul Dondueni).
n bazinul r. Cinari sunt izvoarele MNH din s. Horodite i Cotova. Comparnd componena chimic a
apei izvoarelor cu cea din ru se evideniaz o acumulare pe cursul rului a sodiului, sulfailor, ce condiioneaz
i creterea mineralizrii apei pn la 1060 mg/dm3, tipul i calificativul apei fiind acelai. (Fig. 6).
1200

MH, s. Horodite

1000

MH, s. Cotova (media)

800

r. Cinari, s. Cotova

600

r. Cinari, s. Gura Cinarului

400
200
0
Na+K

Ca2+

Mg2+

Cl-

SO42-

HCO3-

Reziduu fix

Figura 6. Componena chimic a apei rului Cinari comparativ cu a celei din MNH (s. Horodite i s.
Cotova), ce curge n ru.
Starea satisfctoare a apei rului se menine pn la revrsarea n rul Rut (s. Gura Cinarului),
raionul Floreti.

160

m g/dm3

Procesul de nitrificare a ionilor de amoniu din apa diferitor ruri.


innd cont c apa din diferite uniti acvatice are diferit grad de poluare s-a modelat oxidarea ionilor
de amoniu, verig important n procesul de autoepurare a apelor naturale. Probele au fost recoltate din cteva
ruri mici (r. Rut, s. Baraboi i n aval de or. Bli; r. Cubolta, s. Mndc; r. Cinari, s. Gura Cinari; r.
Camenca, s. Gura Camencei;
4,5
fluviul Nistru, s. Mereeuca,).
r. Rut, s. Baraboi
4
S-a constatat c etapa NH4+
r.
Rut,
aval
or.
Bli
3,5
NO2- n modelul apelor din
r. Cubolta, s. Mndc
3
rurile Rut (s. Baraboi) are
r. Cinari, s. Gura Cinari
loc analog celei realizate pe
2,5
r. Camenca, s. Gura Camencei
apa
fluviul
Nistru
(s.
2
fl. Nistru, s. Mereeuca
Mereeuca) i dureaz 8-10
1,5
zile. n apa r. Cinari (s. Gura
1
Ginari) 13 zile, iar n apa
0,5
din celelalte ruri procesul
0
parcurge 17 i mai multe zile.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
(Fig. 7).
zile
Figura 7. Etapa nh4+ no2- a procesului de nitrificare din apele rurilor.
Procesul NO2- NO3- are loc timp de 10-11 zile n apa din r. Rut (s. Baraboi) i Camenca; n apa r.
Cubolta i Cinari 14-15 zile i a fluviul Nistru (s. Mereeuca) timp de 16-17 zile (Fig. 8).
r. Rut, s. Baraboi
r. Rut, aval or. Bli
r. Camenca, s. Gura Camencii

r. Cubolta, s. Grbova
r. Cinari, s. Gura Cinari
fl. Nistru, s. Mereeuca

Figura 8. Procesul no2- no3- din


apele rurilor.

4,5
4

mg/dmc

3,5
3
2,5
2
1,5
1
0,5
0
1

10 11 12 13 14 15 16 17 18 19 20

CBO5

45

Figura
9.
Corelarea
timpului de oxidare a nitriilor cu
CBO5 i CCO-Cr

CCO-Cr

40

mg/dm3 O

35
30

Rezultatul modelrilor de
laborator denot o corelare pozitiv
(r2=0,9872) a timpului de oxidare a
ionilor
NO2cu
coninutul
substanelor
(poluanilor)
ce
degradeaz greu biochimic (CCOCr), astfel ele inhib temporar
procesul,
iar
cu
cel
al
componentelor ce degradeaz uor
biochimic corelarea practic lipsete.

25
20
15
10
5
0
15

20

25

zile

Rezultatele studiului realizat


pe apa din diferite uniti acvatice
sunt obinute n aceleai condiii i
pot fi comparate. Influena impactului
antropic asupra oxidrii biochimice a
ionilor de amoniu n apele naturale se
demonstreaz prin corelarea timpului
nitrificrii cu coninutul substanelor
organice prezente n ap (CBO5 i
CCO-Cr) (fig. 9).

zile

CONCLUZII:
1. Concentraia n descretere a diferitor poluani din ap pe cursul rurilor n studiu (cuprului, substanele
tensioactive anionice, al substanelor organice - CBO5 i CCO-Cr) demonstreaz influena pozitiv a izvoarelor,
Monumente Naturale Hidrologice, de mbuntire a calitii apelor de suprafa din teritoriu.
2. Substanele ce degradeaz greu biochimic (CCO-Cr) influeneaz negativ oxidarea ionilor NO 2-, iar
componentele ce degradeaz uor biochimic (CBO5) nu afecteaz procesul.
BIBLIOGRAFIE:
1. Hotrrea Guvernului Republicii Moldova Nr. 782 din 03.08.2000 pentru aprobarea regulamentelor-cadru ale
parcurilor naionale, monumentelor naturii, rezervaiilor de resurse i rezervaiilor biosferei, Publicat : MO., Nr.
102 din 17.08.2000. Promulgat: 03.08.2000.

161

2. SM SR EN 1899-2:2007. Calitatea apei. Determinarea consumului biochimic de oxigen dup n zile (CBOn).
Partea 2: Metoda pentru probe nediluate.
3. SM SR ISO 6060:2006. Calitatea apei. Determinarea consumului chimic de oxigen.
4. , . , . . .
.. . : , 1975. 200 .
CAPACITATEA DE AUTOEPURARE I NITRIFICARE A APELOR DE SUPRAFA DIN
TERITORIUL ZONEI UMEDE UNGURI-HOLONIA
Tr Anatol, dr. n biologie, conf. cercet., ef lab. t., Sandu Maria, dr. n chimie, conf. cercet., cerc.
t. coordonator, Lozan Raisa, dr. n chimie, conf. cercet., cerc. t. coordonator, Zlotea Alexandru, cerct. t.
stagiar, Comarnichi A., Sidoren Iulia, cerct. t. stagiar, Institutul de Ecologie i Geografie
In this scientific work are displayed the results concerning the quality parameters of the surface water
from the Dniester river and tributaries in the Wetland of International importance no.1500 Unguri-Holosnita
Ramsar Site, located on the left bank of the Dniester River in north-eastern Moldova in administrative territories
of Ocnita, Soroca and Donduseni districts.
Self-purification capacity of the water is very low (small river near village Unguri, the Chisinau Otaci
route, 0,003) and low in other rivers. A good Self-purification capacity was found in the stream water in village
Tatareuca (0.63). Nitrification process of ammonium ions takes 14-28 days except small river near Unguri
village (stone bridge) and stream water in village Tatareuca (>35 days).
Key words: Wetland Unguri- Holosnita surface water self-purification capacity, nitrification.
INTRODUCERE
Zonele umede sunt componente valoroase ale patrimoniului natural, de starea cruia depinde n mare
msur eficiena dezvoltrii durabile a economiei naionale. n Republica Moldova sunt 3 Zone Umede de
Importan Internaional (din punct de vedere ecologic, botanic, zoologic, limnologic, hidrologic i cu
importan internaional pentru psrile acvatice) cu suprafaa total - 94 705 ha din teritoriul rii. Republica
Moldova a devenit membru al Conveniei RAMSAR n iunie 2000, atunci cnd zona Lacurile Prutului de Jos
(19152,5 ha), a fost inclus n Lista zonelor umede de importan internaional. A doua zon umed acceptat
de Secretariatul Conveniei este reprezentat de aria natural Nistrul Inferior, care cuprinde sectorul de lunc a
Nistrului de Jos dintre comunele Copanca i Palanca. Suprafaa zonei constituie cca 60000 ha.
n septembrie 2005 [HG RM Nr. 204 din 25.02.2008, MO Nr. 45-46, art. Nr: 275] n Lista Zonelor
umede de importan internaional a fost inclus i zona Unguri-Holonia, amplasat n raioanele Ocnia,
Dondueni i Soroca. Ea ocup 15553 ha. Aceasta include terenuri i bazine acvatice amplasate n perimetrul
drumului Soroca-Otaci i hotarului de stat de-a lungul fluviului Nistru i se ntinde de la nord-vest de satul
Clruca pn la hotarul comunei Holonia n partea de sud-est. Regiunea cuprinde versani stncoi cu
surpturi, ndreptai spre fluviul Nistru, precum i lunca ngust de pe malul drept al acestuia.
Protecia ariilor naturale inclusiv a zonelor umede este un obiectiv important pentru Republica Moldova
n contextul recunoaterii economiei verzi ca fiind economia viitorului. Zonele umede (mlatini) ndeplinesc
diferite funcii ecologice: absorb apa, mpiedic extinderea inundaiilor, servesc drept sistem natural de filtrare,
purific apa, realimenteaz apele freatice, adpostesc mii de specii de psri, insecte, i alte vieuitoare. De
asemenea Zonele umede absorb poluanii i amelioreaz calitatea apei naturale, joac un rol central n
combaterea schimbrilor climatice, protejndu-ne mpotriva inundaiilor i a altor efecte negative ale modificrii
condiiilor meteorologice, ofer societii o serie de bunuri i servicii valoroase, importante din punct de vedere
economic, precum purificarea apei, fertilizarea solului, stocarea carbonului.
La 8 martie 2011 Comisia UE pentru mediu, sntate public i siguran alimentar a propus adoptarea
de msuri orientate viznd meninerea punilor, refacerea zonelor umede i a turbriilor, reducerea sau
eliminarea sistemului de lucrri ale solului, reducerea eroziunii i dezvoltarea pdurilor.
Zonele umede i habitatele naturale de colin mpreun cu terenurile agricole creeaz o integritate
pentru marea parte a lumii slbatice. Pdurile ofer mediu de trai pentru 34 de specii de mamifere, 72 specii de
psri clocitoare, 9 de reptile i 8 de amfibieni. Teritoriul Zonei Umede Unguri-Holonia este intersectat de 9
rulee mici, cel mai mare avnd lungimea de 7,6 km. n zon mai exist 9 bazine acvatice cu suprafee de 0,251,3 ha i 19 lacuri de pn la 6,5 ha. Reeaua hidrografic nu este dens mai puin de 0,1 km/km2. Versanii
Nistrului sunt intens secionai de defileuri adnci, iar scurgerea de suprafa nu este intensiv i n mare parte se
transform n scurgere subteran. Stncile permeabile fisurate constituie un mediu favorabil pentru circularea
apelor subterane i de suprafa [7].
Evaluarea strii ecologice a apelor de suprafa din teritoriul Zonei Umede Unguri-Holonia au fost
obiectivul studiului de fa.
METODE I METODOLOGIA INVESTIGAIILOR
Metode: spectrofotometria, poteniometria, titrimetria [1-4].
Metodologii: prelucrare statistic, analiza corelaional, calcule; pentru verificarea validitii
rezultatelor obinute s-au folosit balanele ionice.

162

REZULTATE I DISCUII
Pentru evaluarea calitii resurselor de ap i a impactului antropic asupra capacitii de autoepurare i
nitrificare a apelor de suprafa din ecosistemul natural Zona Umed Unguri-Holonia au fost colectate probe
de ape curgtoare ce strbat teritoriul ei.
Tabelul 1. Componena chimic a apelor curgtoare din teritoriul Zonei Umede Unguri-Holonia
Nr.
Localizarea
Duritatea
Reziduu fix
NO3probei
pH
me/dm3
mg/dm3
1.
s. Unguri, de la traseu spre sat, ruleul
7,53
8,65
668
3,8
ce curge prin stufri, supr. cca 0,5 ha
2.
s. Unguri, fl. Nistru, la pod
8,47
4,5
333
10,4
3.
or. Otaci, fl. Nistru
8,07
4,6
325
10,5
4.
s. Unguri, ruleul de la marginea
8,43
8,65
723
17,0
satului, podeul de piatr
5.
s. Holonia, fl. Nistru
8,15
4,75
332
10,0
6.
s. Ttrauca, prul ce se vars n
8,19
8,95
579
8,9
Nistru, 500 m mai sus de vrsare
7.
s. Unguri, ruleul de la marginea
8,47
6,35
408
9,2
satului, aproape de mnstirea
Clreuca
8.
s. Ttruca, fl.Nistru
8,07
4,8
336
10,7
9.
s. Arioneti, pru.
7,81
9,3
656
20,6
n perioada de primvar a anului 2013 la momentul colectrii probelor erau inundate doar 2 rulee cu
o ntindere de cca 500 m2 din ntreg teritoriul zonei umede. Majoritatea ruleelor din zon au scurgere
intermitent (discontinuu).
n condiii de laborator s-a determinat un ir de indici de calitate a acestor ape, respectnd Standardele
naionale i internaionale privind metodele de prelucrare i de determinare a parametrilor fizico-chimici: pH,
turbiditatea, CCO-Cr, CCO-Mn, CBO5, ionii de amoniu, azotii, azotai, Fe, Cu, Cd, Pb i Zn. Duritatea apei,
pH-ul, coninutul ionilor NO3-, mineralizarea i concentraia substanelor organice sunt reflectate n tabelul 1 i
figura 1.
Duritatea apei n praiele zonei umede variaz de la 6,35 la 9,3 me/dm3, fiind de 1,4-2 ori mai mare ca
cea a fl. Nistru, iar mineralizarea de la 408 la 723 (de 1,2-2,2 ori mai mare ca cea a fluviul Nistru).
Figura 1.
Concentraia substanelor organice (CCO-Cr i
CBO5) n apele de suprafa din ZU Unguri-Holonia (1.
fluviul Nistru, s. Unguri, pod; 2. fluviul Nistru, s. Ttreuca
Nou; 3. fluviul Nistru, s. Holonia; 4. ruleul lng s.
Unguri, traseul Chiinu-Otaci; 5. ruleul lng s. Unguri,
podul de piatr; 6. Prul din s. Ttreuca, vrsare n Nistru; 7.
ruleul lng s. Unguri, mnstirea Clreuca, spre Otaci).
Concentraia substanelor organice n apele de
suprafa din Zona Umed Unguri-Holonia (fig. 1), apreciat
dup consumul chimic de oxigen (CCO-Cr), variaz de la 1,94
mg/dm3 O (prul din s. Ttreuca, ce curge n fluviul Nistru)
la 9,7 (ruleul lng s. Unguri, mnstirea Clruca, spre
Otaci i cel de lng s. Unguri, podeul de piatr), la 10,6-21,3
(fl. Nistru) i pn la 23,2 mg/dm3 O (ruleul lng s.
Unguri, traseul Chiinu - Otaci), unde coninutul substanelor
degradabile biochimic (CBO5) este foarte mic (0,06 mg/dm3
O), iar n celelalte probe este de la 1,22 la 1,87 mg/dm3 O, n
apa fluviul Nistru 1,1-2,35 mg/dm3 O.
Figura 2.
Capacitatea de autoepurare a apelor de suprafa din
ZU Unguri-Holonia conform valorilor CCO-Cr i CBO5
din ap (1. fluviul Nistru, s. Unguri, pod; 2. fluviul Nistru, s.
Ttreuca Nou; 3. fluviul Nistru, s. Holonia; 4. ruleul
lng s. Unguri pe traseul Chiinu-Otaci; 5. ruleul lng s. Unguri, sub podeul de piatr; 6. Prul din s.
Ttreuca, vrsare n Nistru; 7. ruleul lng s. Unguri, mnstirea Clreuca, spre Otaci).

163

Prin raportul CBO5/CCO-Cr se calculeaz capacitatea de autoepurare (CA) a apei 5, 8: la CBO5/CCOCr >0,6 autoepurarea este uoar; la valoarea 0,2-0,4 autoepurarea este medie, iar la raportul < 0,2 este mic.
S-a constatat c CA este cea mai mic (practic lipsete) n apa ruleului de la marginea s. Unguri pe
traseul Chiinu Otaci (0,003), fiind mic n ale rulee i chiar n apa fluviul Nistru, apa cruia este evacuat
din straturile adnci ale bazinului de acumulare Novodnestrovsc, cu temperatur joas, i pe parcurs poluat cu
apele reziduale ale oraelor Otaci, Moghilev-Podolsc. O capacitate bun de autoepurare s-a constatat n apa
prului din s. Ttreuca (0,63) (fig. 2).
Autoepurarea este influenata negativ de curgere lent i neturbulent, de temperaturi prea joase sau
prea nalte ale apei, de concentraii prea mari de toxice, de spume sau substane ce formeaz pelicule la suprafaa
apei etc. Motivele capacitii mici de autoepurare a apei fl. Nistru pot fi cteva: apa este evacuat din lacul de
acumulare Novodnestrovsc din straturile adnci i este rece i vara i primvara; apa era colectat dup ploaie cu
nivel ridicat de ap; n apa fluviul Nistru de lng s. Holonia se resimte impactul deversrilor de ape uzate
insuficient epurate din or. Otaci (Republica Moldova) i Moghilev Podolsc (Ucraina), care au reuit s se agite
mai intens pe traseu, i creeaz un CCO-Cr mare (21,3 mg/L O) i un CBO5 mic (1, 72 mg/L O), deci prevaleaz
substanele greu biodegradabile. Apa din ruleele s. Unguri (de sub podeul de piatr i de lng mnstirea
Clruca, spre Otaci) are o capacitate mic de autoepurare similar cu a apei fluviul Nistru lng s. Ttreuca
Nou. Prul din s. Ttreuca are ap practic nepoluat cu cea mai mare capacitate de autoepurare 0,63, iar
ruleul de pe traseul Chiinu-Otaci la indicatorul s. Unguri 8 km are ap, n care practic lipsete capacitatea
de autoepurare (0,003) (fig. 2).
Studiul capacitii de nitrificare a apelor de suprafa s-a realizat prin modelarea oxidrii ionilor de
amoniu, verig important n procesul de autoepurare (comparare cu ap din fluviul Nistru), s-a constatat c
etapa NH4+ NO2- n modelul apelor din majoritatea probelor are loc analog celei realizate pe apa fl. Nistru i
dureaz cca18 zile (fig. 3), pe cnd n apa din prul ce curge n fluviul Nistru, mai sus de vrsare n acelai timp
se oxideaz doar cca 50% din ionii de amoniu. Chiar dup 25 de zile n ap mai rmn cca 11% de NH 4+.
1
2
3
4
5
6
7

2,5
mg/dm3 NH4+

2
1,5
1

Figura 3.
Dinamica procesului NH4+ NO2- n
apele de suprafa ale ZU UnguriHolonia
(1. ruleul lng s. Unguri, traseul
Chiinu - Otaci; 2. fluviul Nistru, s.
Unguri; 3. fluviul Nistru, or. Otaci; 4.
ruleul de lng s. Unguri, pode de
piatr; 5. fluviul Nistru, s. Holonia; 6.
Prul, ce curge n fluviul Nistru, s.
Ttreuca; 7. ruleul de la lng s.
Unguri, mnstirea Clreuca, spre
Otaci).

0,5

0
1

10

12

14

16

18

20

22

24

26
zile

1
2
3
4
5
6
7

12

mg/dm3 NO2-

10
8
6

Figura 4.
Evoluia procesului NO2- NO3- n
apele de suprafa ale ZU UnguriHolonia (1. ruleul lng s. Unguri,
traseul Chiinu - Otaci; 2. fluviul
Nistru, s. Unguri; 3. fluviul Nistru, or.
Otaci; 4. ruleul de lng s. Unguri,
pode de piatr; 5. fluviul Nistru, s.
Holonia; 6. Prul, ce curge n fl.
Nistru, s. Ttreuca; 7. ruleul de la
lng s. Unguri, mnstirea
Clruca, spre Otaci).

4
2
0
1

8 10 12 14 16 18 20 22 24 26 28 30 32 34
zile

Procesul NO2- NO3- are loc timp de 22-26 zile, iar n apa ruleului de la marginea s. Unguri (sub
podeul de piatr) i prul, ce curge n fluviul Nistru (mai sus de vrsare proba 6) timp de 34 de zile s-au
oxidat doar jumtate din nitriii formai (fig. 4).

164

CONCLUZII:
1. Reieind din capacitatea mic de autoepurare i nitrificare a apelor de suprafa din teritoriul Zonei Umede
Unguri-Holonia este necesar restaurarea complet a condiiilor naturale (ecologice) prin elaborarea unui
program de msuri de reconstrucie ecologic.
2. Lucrrile de asanare a Zonelor Umede este un proces care are unele aspecte negative privind meninerea
echilibrului biologic natural. Se tie, c un hectar de mlatin produce anual cca 22 t substan organic uscat
fa de 3,4 t ct produce aceeai suprafa de teren cultivat cu gru, ceea ce conduce la concluzia c zonele
umede reprezint un mare productor de biomas care fertilizeaz solurile [6].
BIBLIOGRAFIE:
1. SM SR EN 1899-2:2007. Calitatea apei. Determinarea consumului biochimic de oxigen dup n zile (CBOn).
Partea 2: Metoda pentru probe nediluate.
2. SM SR ISO 6060:2006. Calitatea apei. Determinarea consumului chimic de oxigen.
3. SM EN ISO 5667-23:2013 (E) Calitatea apei. Prelevare. Partea 23: Ghid privind prelevarea pasiv n apele de
suprafa.
4. SM SR ISO 6059:2012. Calitatea apei. Determinarea sumei de calciu i magneziu. Metoda titrimetric cu
EDTA.
5. . : - , 1981.
6. Ursu, A. Solurile Moldovei. Chiinu, 2011.
7. Scenariul de management pentru Zona Ramsar Unguri-Holonia (Proiect). Societatea Biotica. Chiinu,
2008.
8. , . , . . .
.. . : , 1975. 200 .
DIMENSIUNEA ETIC A SCHIMBRILOR CLIMATICE
Valeriu Capcelea, dr. hab. n filosofie, conf. univ., secretar tiinific al Filialei Bli a AM
Ethical dimensions of climate change. This article addresses the ethical dimensions of climate change
and global warming. The author makes a brief analysis of the published work on the ethical dimensions of
climate change that shows that, on the one hand, there are very few studies examining the relationship between
global climate change and morality, on the other hand, they show that philosophers failed to focus attention on
these issues. It is noted that studies are needed on this area and that climate change should become a serious
concern of both moral philosophy and social and humanitarian sciences in general. However, there are elucidated
a lot of problems to be addressed and resolved by moral philosophers: developing the theoretical basis of a new
global ethic on climate change; member role in solving these problems and their moral obligations in response to
global warming; ethical and moral rules on climate change and their proliferation; relationship between the
ethics of global climate change and the international relations; common responsibilities of states in this field, etc.
Key words: ethics, morals, ethics global, climate change, global warming.
Etica i morala au fost i sunt fenomene permanente ale vieii spiritual-umane, care n secolul XXI,
trebuie s contureze profiluri etico-morale corespunztoare noilor condiii, fiindc normele, principiile i valorile
morale au fost profund zdruncinate i, posibil, denaturate iremediabil. Astzi am ajuns la o limit a mizeriei
morale care este distinct pentru diferii oameni: unora li se pare c au comis o crim, cnd au clcat o floare, iar
alii nu consider o crim cnd a furat ceva, sau a distrus mediul nconjurtor. n aceste condiii, suntem obligai
s revenim la fundamentele etice ale existenei omenirii pe care le-am pierdut n aceast perioad de criz
profund pe care o traverseaz civilizaia. Pentru a realiza acest imperativ categoric este necesar s revenim la
normele i principiile morale general-umane i, totodat, s instituim o nou dimensiune a discursului teoretic
moral care s nu se mulumeasc doar cu reflecia realitii ca atare, ci s fie n stare s analizeze transformrile
care se produc n societatea postmodern i, n acelai timp, ca etica s fie n stare s neleag, s descrie, s
prognozeze procese i fenomene care nu exist, dar care ar putea s apar. Etica postmodern trebuie s intuiasc
i s propun modaliti de rezolvare a problemelor de ordin moral care apar n societate odat cu dezvoltarea
umanitii, cu impactul asupra mediului nconjurtor a tehnicii i tehnologiilor contemporane, ca civilizaia
uman s reziste n faa pericolelor ce amenin omenirea n viitorului apropiat i ndeprtat, inclusiv i
subiectele ce in de fenomenul schimbrilor climatice i nclzirii globale.
Astzi existena unor probleme care se refer la existena social a umanitii pe Terra a cror
soluionare corespunztoare intereseaz toate rile, reprezint o realitate necontestabil. De aceea, ntreaga
omenire - de la opinia public i pn la factorii de decizie sau forurile internaionale de colaborare i cooperare
concep n mod cert problemele multiple i complexe pe care le au raporturile omului cu semenii si, raporturile
dintre state, locul i rolul moralei n politic, n raporturile cu mediul nconjurtor etc. A devenit din ce n ce mai
evident faptul, c activitile umane trebuie s fie ghidate de normele, valorile i principiile morale ntruct ele
au profunde repercusiuni asupra esenei umane, asupra naturii i resurselor ei, mai ales, n condiiile n care

165

influenele omului asupra mediului nconjurtor sunt din ce n ce mai intense ca urmare a creterii populaiei, a
aglomeraiilor umane i dezvoltrii industriilor i tehnologiilor.
Viziunea global asupra planetei a condus la numeroase constatri nelinititoare i la atitudini imediate,
inclusiv i n domeniul eticii. Astfel, problematica contemporan a tehnicii, medicinii, mediului nconjurtor,
reprezentnd un pericol pentru supravieuirea i existena vieii pe Pmnt reclam tot mai mult intervenia eticii
n soluionarea lor. Preocuprile i idealurile omului mileniului trei trebuie s-i ndrepte atenia asupra acestor
probleme, dezvoltndu-se astfel aa ramuri ale eticii aplicate precum etic ecologic, bioetica, etica vitalitii,
etica pmntului, tehnoetica, dimensiunea etic a schimbrilor climatice i a nclzirii globale etc.
Cercetrile tiinifice ne denot c globul pmntesc se nclzete, clima se modific, iar fenomenele
meteorologice extreme sunt tot mai frecvente: inundaiile, seceta, creterea temperaturilor medii la nivel global,
creterea nivelului mrii i micorarea calotei glaciare toate sunt semne ale schimbrilor climatice. Cauza
principal a acestor schimbri o reprezint creterea emisiilor de gaze cu efect de ser. Pentru a combate aceast
cauz, reducerea emisiilor a devenit o prioritate pentru toate statele lumii. Republica Moldova, la rndul su,
trebuie s acioneze rapid att pentru combaterea cauzelor (prin reducerea emisiilor), ct i pentru diminuarea
efectelor (prin aciuni de adaptare).
Este evident c combaterea schimbrilor climatice i adaptarea la acestea cu scopul de a dezvolta i
evalua msuri inovatoare, rentabile i sustenabile de acomodare la schimbrile climatice i de atenuare a
efectelor acestora, prin care s fie vizate att reducerea emisiilor CO2, ct i a gazelor cu efect de ser, altele
dect CO2, necesit ca s fie puse n eviden soluii ecologice tehnologice i netehnologice, prin generarea de
argumente care s permit s se ntreprind aciuni preventive i eficace n acest domeniu.
Preedintele S.U.A. Barack Obama a lansat oficial n august 2015 planul ateptat de toi ndreptat contra
marii ameninri reprezentate de schimbrile climatice, insistnd asupra urgenei de a aciona imediat i
anunnd o restricie fr precedent asupra centralelor electrice. Aceasta este una dintre provocrile cheie ale
epocii noastre, a declarat B. Obama la Casa Alba, anunnd America's Clean Power Plan (Planul american
pentru energie curat), care reunete o serie de reguli i reglementri impunnd pentru prima dat centralelor
electrice s-i reduc cu 32% pn n 2030 emisiile de carbon fa de nivelurile din 2005.
Reieind din gravitatea problemelor ce se refer la schimbrile climatice, n ultimele decenii filosofii
moralei au nceput a trata problemele raportului dintre etic i schimbrile climatice globale [a se vedea: 2, 3, 4,
5]. ns, n opinia lui Stephen M. Gardiner, problema este, din punct de vedere teoretic, o provocare, att n sine,
ct i n virtutea problemelor globale ale contemporaneitii [2, p. 559]. Spre exemplu; D. Jamieson, n studiile
sale a ajuns att de departe nct a sugerat ideea c abordarea cu succes a schimbrilor climatice va necesita o
schimbare a paradigmei fundamentale a eticii [4, p. 288-289]. Are dreptate St. Gardiner, care scrie c exist o
prezumie puternic pentru care filosofii moralei ar trebui s ia n serios schimbrile climatice. Dar, se ntreab
el, de ce aceste probleme sunt neglijate? n opinia lui, explicaia cea mai plauzibil const n faptul c studiul
schimbrilor climatice reprezint un fenomen ce este situat la frontiera dintre tiin, economie, drept, relaii
internaionale i, n mod necesar, poart un caracter interdisciplinar [2, p.565]. Totodat, el insist asupra
faptului c schimbrile climatice reprezint, n mod fundamental, o problem de etic. Prin urmare, problema n
cauz ar trebui s devin o preocupare serioas att din partea filozofiei moralei, ct i a tiinelor umanitate i
sociale n general.
O analiz succint a lucrrilor publicate cu privire la dimensiunea etic a schimbrilor climatice i a
nclzirii globale ne arat c, pe de o parte, nu exist prea multe studii care examineaz relaiile existente ntre
schimbrile climatice globale i moralitate, iar pe de alt parte, ne demonstreaz c filosofii nu au reuit s-i
concentreze atenia asupra acestor probleme. Ea ne permite s scoatem concluzia c etica schimbrilor climatice
globale este nc ntr-o faz incipient. Suntem de acord cu S. Gardiner, c doar n ultimele decenii oamenii de
tiina au nceput s abordeze implicaiile etice n ceea ce privete schimbrile climatice la nivel global,
ncercnd s formuleze principalele direcii de studii n acest domeniu. Totodat, este dificil de explicat de ce
filosofii nu a luat n serios i nu au studiat problema schimbrilor climatice, cu toate c problem n cauz este
recunoscut pe plan internaional ca una din cele mai imperioase pentru ntreaga civilizaie. n primul rnd, este
greu de explicat i faptul de ce ei au fost destul de reticeni n a efectua astfel de studii n acest domeniu, n timp
ce reprezentaii multiplelor tiine particulare au publicat foarte multe lucrri dedicate schimbrilor climatice. n
al doilea rnd, dup cum afirm diveri specialiti din cadrul diferitor discipline tiinifice, schimbrile climatice
reprezint o problem ce ine de etic, care necesit o schimbare fundamental de paradigm nu doar n
domeniul economic, n modurile actuale de producie, etc., dar, mai ales, n cadrul eticii globale [a se vedea: 1].
n acelai timp, lucrrile publicate ne indic n mod cert necesitatea unor studii suplimentare cu privire la acest
domeniu i, totodat, faptul c schimbrile climatice ar trebui s devin o preocupare serioas att a filozofii
morale, ct i a tiinelor umanitare i sociale n general. n opinia noastr, reieind din documentele adoptate de
diverse foruri internaionale i, n acelai timp, din puinele lucrri tiinifice elaborate n acest domeniu,
schimbrile climatice reprezint probleme etice i filosofice destul de dificile, printre care putem specifica
urmtoarele: a) elaborarea bazelor teoretice ale unei noi etici globale privind schimbrile climatice; b) rolul
statelor n soluionarea schimbrilor climatice i obligaiile lor morale, ca rspuns la aceste fenomene naturale; c)
normele etice i morale cu privire la schimbrile climatice i proliferarea acestora; d) raportul dintre etica
schimbrilor climatice globale i relaiile internaionale; e) responsabilitile comune ale statelor n acest

166

domeniu etc. Desigur, ar putea exista i alte probleme, care pot fi abordate de ctre eticieni cu privire la
schimbrile climatice i nclzirea global, dar cele menionate anterior sunt cele mai importante.
n opinia noastr, pentru a rezolva problemele ce in de schimbrile climatice i nclzirea global, este
necesar, n primul rnd, o schimbare profund de mentalitate. A devenit evident faptul c resursele naturale nu
pot fi exploatate fr discriminare, nu numai pentru c o astfel de atitudine uit de faptul c fiinele umane sunt o
parte integrant a vieii, al acestui sistem unic, ci i faptul c mediul nconjurtor reprezint o entitate cu aceleai
drepturi ca i fiinele umane.
Omul ce triete n comunitatea uman trebuie s contientizeze necesitatea coexistenei nu numai cu
semenii si, dar i cu toate fiinele i fpturile de pe suprafaa Pmntului, n spiritul eticii Pmntului lui A.
Leopold [a se vedea: 6]. n aceast ordine de idei, omul intr ntr-o dilem etic a coexistenei, care ine tocmai
de responsabilitatea social a lui, care este conceput ca o entitate sau individ ntr-o organizaie. ncorporarea
dimensiunii etice a nclzirii globale, ar trebui s presupun respectarea mai eficient, a urmtoarelor condiii,
care sunt vitale pentru pstrarea vieii pe Terra i pentru dezvoltarea n continuare a civilizaiei umane: viaa
uman trebuie s existe i s se dezvolte la nesfrit; particularitile culturale trebuie s supravieuiasc;
activitile umane trebuie s fie efectuate n limitele care nu pun n pericol diversitatea, complexitatea i funciile
sistemului ecologic care st la baza vieii umane. n mod evident, aceste principii presupun existena unei
economii mai umane, care ar trebui s serveasc drept baz pentru un model de dezvoltare orientat nu numai spre
realitile sociale i economice, dar i spre cele ecologice.
Astfel, gndirea tiinific i economic, ar trebui s solicite politicilor de mediu, care se fundeaz pe
principiul c resursele naturale sunt patrimoniul comun care, prin urmare, presupune o prioritate, asigur accesul
echitabil la acestea. Totui, aceste cerine pot s apar numai n contextul unui discurs etic, de ngrijire i
democraie participativ. Aceasta este, o filosofie practic pentru a depi inechitile sociale, politice, de mediu
i economice, printr-o dezvoltare durabil.
Etica trebuie s fie promotorul tuturor aciunilor n vederea durabilitii aciunilor umane, mai ales, n
domeniul nclzirii globale, care este o problem global a contemporaneitii. n aceast ordine de idei,
politicile sociale de dezvoltare economic, de mediu i politicile instituionale durabile, trebuie s fie realizate
numai n cazul n care omul devine contient de necesitatea de a tri n armonie cu mediul lor, astfel nct s
arate ca un imperativ etic pentru sustenabilitatea vieii de pe planet i ar trebui s fie ncorporate n diferite
aciuni ndreptate spre diminuarea schimbrilor climatice i a nclzirii globale.
Aceast schimbare n modelul de dezvoltare economic i de hegemonie tiinific i tehnologic va
conduce la aceea c omul nsui va fi considerat ca parte a naturii i va fi nsfrit abandonat ideea
antropocentrist c omul este centrul Universului. Aceast provocare, fr ndoial, implic o schimbare de
atitudine n omului din mileniul trei, permindu-i s nlocuiasc comportamentul lor ca homo sapiens, care
triesc n armonie cu sine i cu celelalte pri ale ecosistemului de pe Pmnt.
Prin urmare, este necesar de a rearanja resurselor tehnice, tiinifice, ecologice, economice i sociale de
o asemenea manier nct sistemul eterogen rezultat s poat fi meninut n stare de echilibru spaio-temporal,
dar aceasta se poate realiza doar prin intermediul unei dimensiuni morale umane corespunztoare.
BIBLIOGRAFIE:
1. Capcelea, V. Elaborarea eticii globale modalitate de a asigura dialogul dintre civilizaii. n: Dialogul
civilizaiilor: etic, educaie, libertate i responsabilitate ntr-o lume n schimbare/ co. red. Victor Moraru [et.
al.]; coord. M. Feredun Tufekci. Chiinu: S. n., 2015 (Tipogr. Almor-Plus, p. 179-184.
2. Gardiner, St. M. Ethics and Global Climate Change. In: Ethics, Vol. 114, No. 3, April 2004, p. 555-600.
3. Jamieson, Dale. Global Responsibilities: Ethics, Public Health and Global Environmental Change. In: Indiana
Journal of Global Legal Studies, 1998, No. 5, pp. 99-119.
4. Jamieson, Dale. Climate Change and Global Environmental Justice. In: Changing the Atmosphere: Expert
Knowledge and Global Environmental Governance, ed. P. Edwards and C. Miller, 2001, p. 287-307.
5. Page, Ed. Intergenerational Justice and Climate Change. In: Political Studies, 1999, No. 47, p. 53-66.
6. , . . : , 1983. 248 c.
ASPECTE FILOSOFICE ALE COMUNICRII SEMIOTICE
Mohorea Efim, dr. hab, prof. univ.,USARB
Philosophical aspects of the communication semiotics. Based on concepts of modern semiotics and
practice of sign communication, the author of this article determines the necessary and essential properties of the
notions signs, meaning, message, communication and formulates the respective philosophical
interpretation.
Keys words: signs, meaning, message, communication.
INTRODUCERE
Comunicarea se numr printre tematizrile filosofice fundamentale, de rnd cu cea a realitii i a
cunoaterii. La finele secolului al 20-lea i la nceputul secolului al 21-lea comunicarea a devenit un fenomen
global. n prezent exist un numr considerabil de teorii i direcii ale comunicrii (tehnice, psihologice,

167

lingvistice, socio-culturale etc.) ce reprezint un conglomerat de discipline, un compozitum, construit din


elemente disciplinare disparate, lipsit de un fundament epistemologic solid, unanim acceptat [5, p.17].
Comunicarea se intersecteaz cu semioza (producerea i utilizarea semnelor). Printre termenii de baz ale
teoriilor comunicrii sunt semnul, semnificaia, masajul, codul i comunicarea. Avnd n vedere c
aceti termeni au diferite interpretri att n teoriile comunicrii, ct i n cele ale diverselor semiotici sau
semiologii, este necesar de a preciza coninutul i sfera lor de aplicabilitate din punct de vedere universal ca
noiuni de maxim generalitate posibil. Deci, o viziune filosofic a problemelor de baz a semioticii i teoriilor
comunicrii este necesar. Cu att mai mult, termenii acestora au ptruns n numeroasele teorii care au format
chiar o nou direcie n studiul fenomenelor i proceselor comunicrii sociale. Aceast direcie poart numele de
comunicologie sau comunicativistic [Vezi, spre exemplu: 8, 9]
COMUNICAREA FENOMEN PLURIDIMENSIONAL
Comunicarea este un atribut al omului ca fiin social raional (zoon politicon, cum spunea Aristotel).
Ea reprezint una din activitile umane pe care fiecare dintre noi o poate recunoate, ns puini o pot defini
satisfctor [3, p.15].
Specialitii constat c termenul comunicare este polisemantic, imprecis (volatil, tulbure), deoarece
nu are coninut, semnificaie bine determinate i sfer, denotat, referent etc. precise; de aceea nici o definiie de
tip gen - diferen specific nu-i poate fi aplicat.
Comunicarea fenomen extrem de complicat este reprezentat prin numeroase modele din diferite
tiine. Spre exemplu, ea poate fi tratat de ctre psihologi ca tip aparte de comportament, de ctre sociologi ca
factor decisiv de socializare, de antropologi ca instrument de constituire i rspndire a culturii, de semioticieni
ca proces de configurare i reconfigurare a semnificaiilor semnelor etc. [2, p.5].
Cea mai dificil problem este aceea c noi nu dispunem de un criteriu unitar formal pentru a determina
n mod incontestabil numrul i natura parametrilor fundamentali ai comunicrii. Dar, n pofida acestui fapt,
majoritatea specialitilor opereaz cu un numr limitat de parametri fundamentali (factori de baz) ai
comunicrii ca entitate ontic: emitentul, receptorul, mesajul, codul, situaia (repertoriul comunicanilor),
canalul de transmitere, interaciunea comunicanilor sau conexiunea invers (feedback) .a. Spre exemplu, Gh.I. Frte consider c pentru a investiga procesul de comunicare sunt necesari urmtorii ase factori (variabile):
emitentul (sau locutorul), receptorul (sau alocutorul), mesajul, codul, situaia i canalul de transmitere. El
menioneaz c exist doar trei constatri, ce par s asigure, totui, motivare suficient: (a) nici una dintre
variabilele enumerate nu poate fi redus la celelalte; (b) nu exist alte variabile care s aib un impact major
asupra comunicrii i care s nu se regseasc, ntr-o form sau alta, n cmpul celor ase variabile asumate; (c)
antrenarea acestor variabile n analiza comunicrii permite obinerea unor rezultate teoretice remarcabile [2,
p.5-6].
Esena procesului de comunicare, consider majoritatea specialitilor, const n circulaia, transportul
unor mesaje, informaii ntre doi poli: emitorul (iniiatorul comunicrii) i receptorul (destinatarul
mesajului). n procesul comunicrii interumane, receptorul i emitorul sunt dou persoane. Unii specialiti
consider, c exist un asemenea tip de comunicare i n lumea animalelor, ntre sistemele cu inteligen
artificial.
Primele teorii ale comunicrii au fost elaborate n legtur cu dezvoltarea tehnicii telecomunicaiilor.
Modelul tehnic va fi decisiv chiar i n cadrul tiinelor umaniste, pentru definirea i nelegerea a ceea ce
reprezint fenomenul comunicrii [4, p.31].
Schema grafic elementar (primitiv) a procesului de comunicare majoritatea specialitilor o prezint
astfel:
Codare
Emitor (E)

Mesaj
(informaie)

Decodare

Receptor (R)

Retroaciune (conexiune invers sau feedback)


nlocuind termenii de baz cu majusculele lor, vom obine urmtoarele structuri elementare ale procesului
comunicativ: a) E C M D R: b) R C M D E.
E de menionat c comunicrii propriu zise (ce se bazeaz pe recunoatere i interpretare) i precede un
anumit grad, nivel de cunoatere. Altfel spus, subiecii comunicrii (emitorul i receptorul) intr n actul
comunicrii avnd deja un bagaj de cunotine, denumit repertoriul comunicanilor. Eficiena comunicrii
depinde de zona de intersecie a celor dou repertorii (cunotine despre lume, limbaj comun, orientri valorice,
principii, reguli etc.).
Interaciunea dintre comunicani (contiinele acestora) se obine prin canalul de comunicare,
reprezentat de mediul fizic, prin care se transmit semnalele codate (mesajul). n cadrul acestuia pot interveni
perturbaii, bruiaj etc. ce pot modifica sau denatura parametrii sau structura semnalelor emise.

168

n structura comunicrii un rol important l joac sistemului de coduri utilizat. Codul (cifrul, cheia)
este un obiect semiotic ce reprezint regulile de utilizare ale semnelor. Stimulii (semnalele), prin care se produce
comunicarea, sunt organizai ntru-n anumit mod, adic cifrai, codificai de ctre comunicani. Altfel spus,
informaia, ce se conine n stimuli, are alt semnificaie dect coninutul natural al acestora. Pentru ca mesajul
s poat fi neles de comunicani, e necesar ca acestea s cunoasc dinainte codurile (normele deontologice,
principiile raionale, regulile sintactice etc.) respective.
n cercetrile comunicrii interpersonale au fost elaborate i alte modele, mai complicate, dect cel
menionat supra, spre exemplu, modelul SMCR al lui Berlo. Acest model (aprut n 1960 n SUA) se ocup de
natura psihologic a comunicrii [4, p.72-73]. Acest model pune accentul pe diferite componente, inclusiv pe
atitudini, intenii i precizeaz condiiile unei transmiteri eficace. Abreviatura SMCR denot, respectiv, S sursa;
M mesajul; C canalul; R receptorul.
Sursa are scopul de a transmite ceva, adic un mesaj. Transformrile n mesaje ale anumitor idei, nevoi,
intenii ale sale prin semnele necesare i comunicarea lor receptorului depind de anumii factori. Printre acetia
se afl: abilitatea comunicaional a sursei (aptitudini pentru codarea mesajului, spre exemplu, a ti s scrie;
competena de a decoda evenimentul, spre exemplu, a ti s vad; capacitatea de analiza raional o situaie, n
funcie de obiective, spre exemplu, a ti s conving); atitudinile sale, ce constituie predispoziia de a aciona n
diverse situaii (spre exemplu, atitudinea negativ, autoritar fa de interlocutor, atitudinea de team n faa
situaiei etc.); cunotinele sale n legtur cu subiectul tratat, cu auditoriul etc.; sistemul social i cultural (de
pild, rolul pe care l joac sursa n societate).
Mesajul, alctuit din elemente (cuvinte, fraze, imagini, idei) i structura (modul de organizare a
elementelor), trebuie analizat.
Canalul trimite mesajul la simuri (vz, auz, pipit, miros, gust).
Receptorul deine caracteristici asemntoare cu ale sursei i acestea de asemenea influeneaz
comunicarea.
Modelul lui Berlo, fiind dinamic i continuu, are i unele neajunsuri. Printre acestea se observ
urmtoarele lipse: a retroaciunii dintre receptor i surs i a relaiei dinamice ntre elementele, ce formeaz
modelul [4, p.73].
n literatura de specialitate sunt analizate i multe alte modele ale comunicrii [vezi, spre exemplu, 4, 5].
Toate aceste modele ale comunicaiei conin triada termenilor fundamentali: semn, semnificaie, mesaj.
Divergenele conceptuale n interpretarea acestor termeni reprezint una dintre piedicile ce stau n calea crerii
unei teorii bine determinate, coerente i consecvente a comunicrii.
SEMN, SEMNIFICAIE, MESAJ
Cercetnd un mare numr de lucrri, consacrate semioticii, am putut constata c ele conin urmtoarea
idee invariant: Funcia de semn poate fi atribuit oricrui obiect perceptibil (lucru, fenomen, relaie etc.), ce
ine locul altui obiect (de natur material sau spiritual, denumit desemnat, referent .a.) pentru subiecii
semiosei (interprei, comunicani etc.), care, prin semne, realizeaz anumit scop, intenie (de a memoriza,
informa, ordona, manipula etc.).
Considerm c la astfel de definiii ale semnului mai trebuie adugate unele note eseniale ce au o mare
importan, din punct de vedere conceptul i metodologic. n primul rnd, trebuie de avut n vedere c obiectul
respectiv sau este creat de cineva anume pentru a ndeplini funcia semiotic, sau unui obiect real i se atribuie
aceast funcie. n al doilea rnd, nu orice obiect semnificativ este, n mod obligator, anume semn, adic are i
semnificaie. Muli specialiti consider c nu exist raiuni suficiente ce ar permite s identificm obiecte cu
diferit statut real semnele i indicii (simptome, nsemne etc.).
Ceea numim indici sunt fenomene naturale, rezultate ale manifestrii legturilor cauzale (cu transformri
de energie i substan n lumea anorganic sau determinate de procese informaionale i reglare n lumea
organismelor vii). Spre exemplu, micarea frunzelor i a norilor sunt indicii (dar nu semne) ale vntului. Vntul
este cauz, iar micarea frunzelor i a norilor efectul acestea cauze. n baza cunoaterii efectului tragem
concluzia despre cauz. De asemenea, simptomele sunt indicii (dar nu semne) ale maladiei. Cauza maladiei o va
stabili medicul, avnd n vedere simptomele (inclusiv, cele mrturisite de pacient), n baza pregtirii profesionale
(a cunoaterii manifestrii cauzalitii n funcionarea organismului omenesc), i a rezultatelor unor investigaii
suplimentare.
Semnele, dimpotriv, sunt rezultate ale activitii raionale (ale gndirii prin noiuni, judeci,
raionamente .a. invenii ale minii), acte ale imaginaiei i fanteziei omeneti i se introduc prin convenie sau
n mod arbitrar. (Spre exemplu, nu putem gsi o legtur natural faptului c aceeai pasre poart numele
gin i ). Altfel spus, indicii au statut ontic (natural, obiectiv), n timp ce semnele au caracter
logico-gnoseologic i teleologic (raional, subiectiv).
Simptomele, indicii, nsemnele etc. sunt fenomene naturale semnificabile n baza determinrilor
obiective (informaionale, reglatorii), legturilor cauzale (de tip cauz efect), ns nu sunt produse n mod
intenionat ca semne.
Aadar semnul este un obiect (n accepiune gnoseologic) detaat (mintal, prin abstractizare) de suportul
(coninutul) su material, cruia productorii i utilizatorii (subieci ai cunoaterii i comunicrii) i-au atribuit o
valoare funcional de a desemna, de a reprezenta alte obiecte (ale gndirii i ale comunicrii) iar, prin funcia

169

ce i s-a atribuit s fie intermediarul ce leag prin semnale (informaie) subiecii respectivi i referenii,
desemnaii, adic obiectele gndirii i comunicrii. Esenial pentru semne este caracterul lor convenional i
funcional. Adic coninutul material este doar corpul semnelor, iar semnalele (optice, fonice etc.), produse de
semne, leag (pun n contact, informeaz) contiinele subiecilor gndirii i comunicrii. Problema const n
aceea c contiinele, fiind entiti ideale, nu pot comunica, contacta nemijlocit. Pentru a face legtur ntre
contiine este nevoie de a transforma gndurile n semnale (optice, fonice etc.) i de a deplasa (transporta)
semnalele de la emitor ctre receptor. De aceea, oamenii (n practica lor istoric) au trecut de la
comunicarea prin lucruri la comunicarea prin semne, ce nlocuiesc lucrurile.
Semnele ca realiti cu suport ontic (obiectiv), ce au corp (materie) elemente distincte ale semiozei
sunt obiecte unidimensionale. Imaginile lor ideale sunt reprezentate n contiinele subiecilor (gndirii i
comunicrii) ca un complex tridimensional, ce include obiectul (desemnatul), conceptul (semnificatul) i numele
(semnificantul). Aici e de menionat c am fcut abstracie de la aspectele psiho-fiziologice ale semiozei obiect
de studiu al altor tiine particulare (lingvistica cognitiv, psoholingvistica, neurofiziologia etc.) despre semne.
Unul dintre elementele eseniale ale semiozei l reprezint semnificaia. n continuare, vom cerceta,
succint, conceptul semnificaie.
Semnificaia se produce prin contientizarea relaiei dintre dou obiecte i anume dintre semnalele
(stimulii) transmise (de semn) ce actualizeaz n contiin ideea despre altul (desemnat, referent) i acel altul
(despre care ne comunic semnul) i spre care se orienteaz contiina. Aa se ntmpl, de pild, atunci cnd
nlnuirea de semne grafice t r a n d a f i r genereaz n contiin ideea: Plant decorativ, cu
flori mari, parfumate. Iar pentru un frate aceasta poate avea o semnificaie individual, sensul: Floarea
preferat a sorei mele. Aadar, semnificaia este un factor subiectiv, de contiin (i nicidecum o component a
semnului ca entitate cu suport material); ea coreleaz cu entiti ideale conceptul, noiunea, intesiunea,
extensiune etc.
Din cele expuse supra conchidem c, n baza cunoaterii anterioare a obiectelor are loc recunoaterea,
interpretarea lor ulterioar prin semne n actele de gndire i comunicare.
Am mai spus c printre elementele eseniale ale comunicaiei se afl mesajul.
E de menionat faptul c nu exista un punct de vedere unanim acceptat cu privire la proprietile eseniale
ale mesajului, dei forma lapidar i cea mai frecvent ntlnit n teoriile comunicrii este urmtoarea: Mesajul
este acea combinaie de semne pe care emitentul transmite receptorului [2, p.41]. Ali autori consider c
mesajul reprezint acea informaie pe care o primete receptorul de la emitor. Spre exemplu, T. Slama-Cazacu
susine ca mesajul material poarta cu sine i semnificaia, astfel nct alocutorul primete data cu stimulii
perceptibili i germenii productivi ai sensului [2, p.42].
Nici acest punct de vedere nu poate fi ntru totul acceptabil. Desigur, atunci cnd formuleaz un mesaj,
emitentul are intenie de comunicare i coreleaz semnele din coninutul mesajului cu semnificaiile aferente.
nsa intenia de comunicare i semnificaiile n cauz nu intr n componena mesajului, pentru a-i forma
coninutul. Dac ar fi aa, atunci receptorul l-ar nelege perfect pe emitent, prelund att intenia de comunicare,
ct i semnificaiile emitentului. Aadar, receptarea corect a mesajului nu presupune scoaterea la lumina a unui
ipotetic coninut, ci asignarea, alocarea sau atribuirea din afara a unor semnificaii, n conformitate cu practica
de comunicare a comunitii din care face parte receptorul [2].
Deci ceea ce se transmite este semnal i nu semnificaie sau sens. Altfel spus, locutorul acioneaz n mod
intenionat asupra alocutorului prin intermediul unui complex de semne pur material i perceptibil, interpretarea
acestuia, adic corelarea lui cu anumite obiecte materiale sau mentale, cu anumite sisteme i practici sociale, cu
anumite comportamente etc. fiind opera exclusiva a receptorului. Firete, aceasta informaie recreat, dei
aparine alocutorului, este pusa apoi, cu mai mult sau mai puin ndreptire, n seama locutorului, ca autor al
mesajului primit [2].
Din cele expuse supra putem conchide c mesajul produs este, firete, o creaie a emitorului. ns fiind
transmis, el reprezint un material stimulator (ca factor reglator al semnalului codat primit de la emitor) pentru
actul de creaie a semnificaiilor de ctre receptor. Actualizarea semnificaiei n form de idei despre anumite
obiecte (sau clase de obiecte) se produce sau nemijlocit, n baza legturilor naturale dintre lucruri, sau prin
intermediul semnelor care, n baza unor date din cercetrile neurofiziologice, conin anumite coduri universale
ce aparin obiectelor cunoaterii sau coduri universale obiectuale, n viziunea lui N.I. Jinkin [6, p.122].
Comunicarea, considera N. Jinkin, genereaz dou limbi: a) limb pentru sine, n interiorul sinelui i b) limb
comun, limb pentru comunicani [6, p.127-128].
De asemenea, este important a distinge ntre dou situaii semnificative: 1) naturale, ce sunt determinate
de factori obiectivi i legturi cauzale (n lumea anorganic) sau reacii organice (la plante i animale); 2)
convenionale (artificiale), ce se realizeaz pe baza proceselor semiotice, gndirii discursive prin construcii
verbale (cuvinte, propoziii, fraze etc.) i noiuni abstracte, judeci, raionamente etc.
CONCLUZII:
1. Semnul reprezint o funcie atribuit (de ctre subiecii semiozei) unui obiect perceptibil (lucru, fenomen,
proces, relaie etc.), iar semnificaia este fapt al contiinei. Semnificaia este localizat n contiin i niciodat
nu prsete creierul omenesc. Atunci cnd are loc comunicarea semnificaiilor, strict vorbind, nu are loc

170

transmiterea lor. Mesajul semiotic are ca rezultat actualizarea n capetele comunicanilor a mesajelor egale sau
aproape egale, i de asemenea modificarea i apariia a noi semnificaii [7, p.24].
2. Funcia semnului nu poate fi conceput fr semnificaie. Semnul este obiect semnificativ doar n mod
convenional prin faptul c productorul semnului i-a atribuit unui obiect material funcia de semn. Deci
semnificitatea e determinat nu de coninutul i nsuirile materiale ale semnului. Misiunea semnului e
determinat de nsuirile lui ce permit transmiterea n mod stabil, durabil i invariabil a semnalelor (stimulilor),
ce unesc ntr-un circuit informaional organele de sim ale subiecilor care comunic. Aadar, obiectul-semn
devine un intermediar material ce i conecteaz pe participanii actului comunicrii semiotice la desemnat
(referent, denotat).
3. Nu exist semn fr semnificaie, ns exist semnificaie fr semn. Specialitii n domeniul etologiei au
demonstrat c n lumea insectelor i mamiferelor exist semnificaii cu coninut prelogic i fr limbaj
articulat. Spre exemplu, a fost descoperit faptul c albinele interacioneaz (comunic) prin semnale codificate
numite limbajul dansului [1, p.72-73].
4. Triada semiotic denotat semnificat semnificant (elemente ale unui obiect de natur psihic,mintal) este
localizat n contiinele subiecilor semiozei i nu sunt laturi imanente ale semnului (ca obiect perceptibil),
cum se constat n lucrrile de specialitate. Corpul semnului, prin fiina sa pur material, rmne un obiect
unidimensional (chiar dac se afl n anumite relaii cu subiecii comunicrii i cu obiectul pe care l nlocuiete),
deoarece nu conine nici desemnatul, nici semnificaia, ci doar semnalele (stimulii) cu cod, cifru, cheie
etc. introduse, prin convenie sau n mod arbitrar, de ctre subiecii comunicaiei.
5. Comunicarea este procesul i rezultatul interrelaiei contiinelor subiecilor comunicrii care, fiind asistate de
factori semiotici i legturi informaionale, i, bazndu-se pe cunotine despre lumea extern i intern, nu att
transmit, ct creeaz mesaje (enunuri, fraze, texte etc.) i le dau diverse interpretri conceptuale i valorice.
BIBLIOGRAFIE:
1. Dulcan, D.-C. Inteligena materiei. Ediia a 2-a, revizuit i adugit. Bucureti: Ed. TEORA,1992.
2. Frte, Gh.-Il. Comunicarea. abordare praxiologic. Iai: Casa editorial Demiurg, 2004.
3. Fiske, Jh. Introducere n tiinele comunicrii / trad. Monica Militaru. Iai: Ed. Polirom, 2003.
4. Lohisse, J. Comunicarea: de la transmiterea mecanic la interaciune. Iai: Ed. Polirom, 2002.
5. Prvu, Il. Filosofia comunicrii. Bucureti: Ed. Facultii de Comunicare i Relaii publice David Ogilvy,
2000.
6. , .. , : - , 1982.
7. , .. : . . -: - .
.. , 2007.
8. , .. : -, : , 2009.
9. , .. : . . :
- , 2010.
UNELE CONSIDERENTE PRIVIND REORGANIZAREA SISTEMULUI ADMINISTRATIVTERITORIAL NAIONAL
Varzari Pantelimon, dr. hab. n tiine politice, prof. cercet., conf. univ., Institutul de Cercetri Juridice
i Politice al AM
Some considerations concerning the reorganization of the administrative-territorial national
system. The article approaches some aspects of administrative-territorial reorganization of the country in the
context of European integration. It demonstrates that the implementation of this reform aims to strengthening the
role of local authorities for ensuring a higher level of transparency and efficiency of public budgets and improve
equitable access of population to basic public services. Particular attention is drawn to the principle of
regionalism in changing the current territorial administrative and granting a broad financial autonomy to new
territorial units.
Key words: administrative-territorial reform, European integration, good governance, the principle of
regionalism, the institutional challenge, administrative-territorial consolidation, new European regionalism.
Reforma de descentralizare, nceput n 2005, a progresat semnificativ, iar Strategia Naional de
Decentralizare a fost adoptat de Parlament la 5 aprilie 2012 [1]. Strategia are drept scop s consolideze rolul
autoritilor publice locale n asigurarea unui nivel mai mare de transparen i eficien a bugetelor publice i
mbuntirea echitabil a accesului la serviciile publice de baz, precum educaia, sntatea, apa i sanitaia.
Experii PNUD-Moldova apreciaz faptul c n timp ce provocrile majore ce in de reforma teritorialadministrativ urmeaz a fi abordate, pe termen lung se prevede ca reforma de descentralizare s contribuie la
depirea decalajului rural-urban [2]. n ciuda politicilor de modernizare a administraiei publice, implementarea
n practic a principiilor bunei guvernri este destul de modest. Reforma administraiei publice, fiind un proces
anevoios i de durat, cere implicarea accentuat a tuturor factorilor interesai, inclusiv a decidenilor politici i a

171

organizaiilor societii civile i avnd suportul instituiilor europene sunt obligai s schimbe radical guvernarea
local i central din ara noastr.
Despre necesitatea reorganizrii sistemului administrativ-teritorial n Republica Moldova (n continuare
RM) se vorbete tot mai insistent la diverse niveluri ale societii n contextul racordrii legislaiei naionale la
rigorile spaiului comunitar. Nimeni nu mai pune la ndoial faptul c vechea structur administrativ-teritorial,
motenirea regimului sovietic, a demonstrat c raioanele sunt uniti administrative mici, cu un potenial
economic foarte slab, ceea ce le fac total dependente de bugetul de stat. De altfel, la mijlocul anului 2015
Ucraina ar putea trece la judee astfel, vor fi numite actualele raioane. n viitoarele judee, n afar de
consiliile locale, vor fi constituite i executive locale. De asemenea, conform modificrilor respective
aprobate de ctre o comisie constituional, n urma acestei reforme teritorial -administrative din statul
vecin, judeele vor constitui regiuni care se vor bucura de o descentralizare i o autonomie financiar
adecvat [3].
Dup obinerea independenei (1991), RM a meninut sistemul de organizare administrativ-teritorial de
tip sovietic, n care teritoriul naional era divizat n 38 de raioane, dintre care 5 n regiunea transnistrean.
Ulterior, n 1998, a fost adoptat o alt reform, i anume, crearea a 9 judee prin reorganizarea administrativteritorial a 30 de raioane din dreapta Nistrului. Reforma administrativ-teritorial materializat prin introducerea
judeelor n calitate de uniti administrative (1998) urma s pun n aplicare principiile unei autonomii locale
autentice, consfinite de standardele i practicile europene. Efectele reformei nu au fost ns n concordan cu
obiectivele i inteniile fostului partid de guvernmnt (PCRM, 20012009), care, odat cu preluarea puterii
(2001), a revenit la formula precedent de organizare administrativ-teritorial pe raioane (2003), lichidnd toate
elementele de autonomie local ce se conturase la nivel local. Totodat, n acea perioad a nceput s creasc
numrul primriilor, n 2008 numrul acestora ajungnd la 902 [4].
n contextul celor menionate, la o reform administrativ-teritorial dramatic insist UE, confirmat
de eful Delegaiei UE la Chiinu, Pirkka Tapiola, n Raportul de progres al RM n cadrul Politicii Europene
de Vecintate 2014 din 30 martie 2015, subliniindu-se, n special, faptul c aceasta ar putea fi realizat chiar
nainte de alegerile locale generale din 14 iunie 2015. Numrul primriilor este foarte mare n comparaie cu
numrul locuitorilor. Acest sistem nu poate s creeze condiii adecvate cetenilor. n unele cazuri, ntr-o
primrie sunt nregistrai doar doi contribuabili, despre ce fel de dezvoltare se poate vorbi? [5]. Acelai ndemn
din partea europenilor este prezent i n Notele informative din partea partenerilor de dezvoltare (documentul de
informare cu recomandri de politici i reforme ale partenerilor de dezvoltare ai RM fiind transmis Guvernului la
nceputul lui martie 2015) care conine un capitol aparte Descentralizarea i dezvoltarea regional, occidentalii
invocnd motivul srciei n mediul rural, a veniturilor mici ale locuitorilor, dar i costurile administrative mari
pe cap de locuitor n primriile mici [6].
Un studiu efectuat de Asociaia pentru Democraie Participativ ADEPT arta c pentru ntreinerea
administraiilor publice locale (APL), care au mai puin de 1500 de locuitori, se fac cheltuieli de 10 ori mai mari
dect n primriile din comunele cu o populaie de 5000 de locuitori. Prin urmare, majoritatea APL-urilor rurale,
care constituie 94 la sut din numrul total, nu au capacitatea s asigure servicii de calitate locuitorilor [7, p. 4445]. Care sunt soluiile? n studiul lor, experii de la Centrul Analitic Independent Expert Grup propun dou
modele alternative de reorganizare administrativ-teritorial a RM: un model cu un singur nivel i un model cu
dou niveluri administrative [8].
Un alt studiu realizat de cercettorii de la Academia de tiine a Moldovei pune n eviden trei modele
de baz de organizare a administraiei sub-naionale: modelul cu un nivel, rspndit, n special, n rile mici
(Cipru, Estonia, Lituania, Letonia, Luxemburg, Malta, Slovenia, dar i Bulgaria i Finlanda); modelul cu dou
niveluri predomin numeric n UE-28 i este rspndit n rile cu suprafa medie (Austria, Cehia, Danemarca,
Grecia, Ungaria, Irlanda, Olanda, Portugalia, Romnia, Slovacia, Suedia), iar n ceea ce privete modelul cu trei
niveluri, el este mai rspndit n rile mari sau divizate din punct de vedere cultural/etnic (Belgia, Frana,
Germania, Italia, Polonia, Spania, Regatul Unit) [9].
Nu cunoatem cu certitudine de care model de reorganizare administrativ-teritorial a RM se va
conduce forul legislativ al rii, pentru c proiectul respectiv ajuns n Comisia parlamentar Comisia
administraie public, dezvoltare regional, mediu i schimbri climatice conine dou variante ale preconizatei
reforme: prima din acestea prevede formarea a 111 municipaliti, numrul mediu de locuitori pentru fiecare nu
va depi 10 mii de oameni, iar cea de-a doua variant se vor constitui 3 regiuni i 289 municipaliti. Ambele
variante presupun reducerea bugetului pentru ntreinerea aparatului administrativ: 2/3 i, respectiv, 50% [10; 11;
12].
De notat c reforma administrativ-teritorial este un subiect intens discutat nu numai de mediul
academic din ara noastr [13, p.465-466; 14; 15, p.43-59; 16; 17] i de experii locali care susin c
reforma administrativ-teritorial este una necesar pentru RM i propun c una din variantele optime ar fi
ca n ara noastr s fie 7-8 uniti teritoriale, sau de liderii politici, declarnd c este necesar
implementarea unei astfel de reforme i acordarea unei autonomii financiare mai largi actualelor raioane.
Provocarea instituional, care ine de complexitatea vieii politice, de mainriile societii
contemporane din partea funcionarilor i de aparatele birocratice sofisticate ale partidelor antrenate n
promovarea imaginii liderilor, devine grav nu numai prin prisma nesoluionrii la moment a multiplelor crize

172

sistemice (crizele politic, constituional, valoric, instituional, identitar, economico-social, transnistrean


etc.) cu efect dezolant asupra electoratului, dar i din alt perspectiv i anume a satisfacerii unor cerine
deseori nejustificate din partea unui sau altui segment al populaiei. Spre exemplu, n aprilie 2013 etnicii bulgari
solicitau autonomie cultural i administrativ, un statut special pentru regiunea naional-cultural, statut pe
care, de altfel, l-au avut n cadrul celei de-a doua organizare administrativ-teritorial din anii 19982001). Drept
c n data de 3 aprilie 2015 Legislativul rii a aprobat n prima lectur proiectul de lege privind acordarea
raionului Taraclia statut de raion naional-cultural [18]. Nu mai puin ingenioas este i tentativa colectrii
semnturilor de ctre un grup de iniiativ din UTA Gguzia n iunie 2013 pentru organizarea unui referendum
privind independena UTA Gguzia fa de RM, fapt realizat prin organizarea i desfurarea la 2 februarie
2014 a dou referendumuri: unul consultativ, privind vectorul de dezvoltare extern a RM, iar al doilea
legislativ, la care s-a propus aprobarea unui proiect de lege privind dreptul locuitorilor din Gguzia la
autodeterminare extern n cazul n care RM i pierde statutul de stat suveran. De altfel, conform studiului
sociologic realizat de Asociaia Sociologilor i Demografilor din Moldova n septembrie 2014, cel mai puin
populaia este ngrijorat de referendumul din februarie din Gguzia 0,2% i de pierderea regiunii
transnistrene 0,3% [19]. De asemenea, este curioas i iniiativa fraciunii PCRM din Consiliul Municipal Bli
de a organiza la 1 noiembrie 2015 un referendum consultativ privind autonomia local a municipiului [20; 21].
n opinia noastr, problema etnicilor bulgari poate fi rezolvat din perspectiva schimbrii actualei
structuri administrativ-teritoriale bazat pe principiul regionalismului i altor fundamente europene de
reglementare administrativ-teritorial ce se includ plenar n cerinele de funcionare a unui stat de drept. Ct
despre doleana grupului de iniiativ de la Comrat, care, nu este exclus, se va repeta, este de remarcat nu
numai aspectul politic al problemei (semnarea Acordului de Asociere dintre UE i Republica Moldova), dar i
aspectul operaional-aplicativ, fiind vorba n contextul provocrii instituionale att despre stresul decizional
(A. Toffler) ca urmare a imploziei decizionale, ct i despre costurile de decizie i costurile externe (J.M.
Buchanan i G. Tullock) ca urmare a procesului de luare a deciziilor bazate pe costuri.
Din punct de vedere teoretico-metodologic, politologul american Alvin Toffler n lucrarea ocul
viitorului vorbete despre trei nivele diferite ale suprasolicitrii (senzorial, cognitiv i decizional), ultimul nivel,
cel decizional, crend i stresul decizional care, indiferent dac supunem sau nu masele de oameni unei
suprasolicitri informaionale, noi influenm negativ comportamentul lor [22, p.242-243]. n alt lucrare a sa,
Al treilea val, el analizeaz mprirea deciziei ca pe un mijloc de depire a blocajului politic, aa nct sistemul
politic s poat funciona din nou [23, p.581-585].
A. Toffler mai precizeaz c incompetena deciziilor politice i guvernamentale de astzi se explic prin
faptul c trebuie adoptate prea multe decizii, ntr-un timp prea scurt, soluionate prea multe probleme, instituiile
noastre fiind zguduite de o implozie decizional. Pentru c se lucreaz cu o tehnologie pol-c nvechit,
capacitatea decizional la nivel guvernamental se deterioreaz. Mai mult, un sistem politic trebuie s fie capabil
nu numai de a elabora decizii, ci i de a le aplica. Prin urmare, cea mai important problem politic cu care se
confrunt contemporaneitatea este senilitatea celor mai fundamentale instituii politice i guvernamentale, dar i
a principiilor nsei pe baza crora au fost ntemeiate. Gaura neagr n societate este un tot mai mare vid al
puterii, nregistrat n toate rile celui de al treilea val al schimbrii. Mesajul lui Toffler este edificarea unor noi
structuri de guvernare, prin considerarea a trei principii-cheie: principiul puterii minoritilor, principiul
democraiei semidirecte i principiul mpririi deciziei.
La rndul lor, economistul american James M. Buchanan, laureat al Premiului Nobel pentru economie
n 1986 i profesorul de analiz economic a dreptului Gordon Tullock de la George Mason University din SUA
sunt autorii lucrrii de referin n ceea ce privete regulile majoritii optime. n lucrarea The Calculus of
Consent: Logical Foundations of Constitutional Democracy (1962) au analizat echilibrul la care trebuie s se
ajung n momentul stabilirii regulii majoritii pentru adoptarea unei decizii. Este un echilibru ntre dou tipuri
de costuri care se deplaseaz n sensuri opuse. Pe de o parte, prin anumite reguli de decizie, grupul poate face
alegeri contrare interesului individual. n aceste cazuri, implicarea n activitatea colectiv poate fi costisitoare
pentru individ. Autorii americani denumesc aceste costuri costuri externe. Este evident, n toat gama de reguli
de decizie, c funcia costurilor externe va fi n mod normal una descresctoare, adic dac numrul de indivizi
cerut pentru un acord va crete, atunci costurile ateptate se vor micora. Cnd regula de decizie cere
unanimitate, costurile ateptate pentru fiecare individ trebuie s fie zero, deoarece acest individ nu va permite ca
alii s impun costuri externe, pentru c poate evita ntr-un mod efectiv ca acest lucru s se ntmple. Pe de alt
parte, pentru ca aceast aciune colectiv s fie exercitat, va fi necesar ca individul s acorde timp i efort pentru
luarea deciziilor n grup, ca s ajung la un acord cu colegii lui. n acest caz, Buchanan i Tullock denumesc
aceste costuri costuri de decizie [24, p.61-62; 25].
Despre respectarea regulii majoritii simple i, respectiv, despre costurile externe i costurile de
decizie n cadrul UE atenioneaz i politologul romn Iordan Gh. Brbulescu [26, p.313-353]. Pentru a reduce
neclaritile cu privire la alocarea sarcinilor, UE a mbriat principiul subsidiaritii n Tratatul de la
Maastricht. Subsidiaritatea nseamn faptul c deciziile trebuie luate ct mai aproape de popor, c UE nu trebuie
s acioneze dect dac acea aciune este mai eficace dect dac s-ar aciona la nivel naional, regional sau local.
Nevoia aplicrii principiului subsidiaritii apare, pentru c centralizarea total este ineficient din punctul de
vedere al bunstrii economice. Acest lucru subliniaz faptul c deciziile trebuie luate la cel mai mic nivel

173

guvernamental, adic ele trebuie luate de structurile aflate ct mai aproape de nivelul alegtorilor i principiul
subsidiaritii realizeaz acest lucru.
Despre noul regionalism european vorbete i Michael Keating, care pleac de la asumpia c
teritoriile sunt produsul istoriei, dar sunt ncontinuu create i recreate. Pentru a sesiza ideea de regiune definit ca
sistem de aciune, Keating vede necesar introducerea unui nou concept, mai larg dect cel de guvernare
(government), dar mai puin vag i pluralist dect cel de guvernan (governance), identificnd conceptul de
coaliie de dezvoltare drept o alian bazat pe teritoriu a actorilor sociali i politici dedicai creterii
economice ntr-o locaie [27, p.157]. Sintetiznd viziunea lui Keating asupra noului regionalism, regiunile
reprezint o aren de aciune n domeniile economic, politic sau social; ofer o baz pentru identitate, mai ales
acolo unde posed propria limb, cultur sau tradiii istorice puternice; constituie actori n arenele naionale i
europene, acolo unde o coaliie de dezvoltare este capabil s formuleze un interes regional i un proiect propriu.
Iar acolo unde toate aceste definiii coincid, se regsete un regionalism puternic.
Cu titlu de concluzie, vom reliefa trei aseriuni. nti de toate, tranziia democratic nencheiat n RM a
determinat o transformare nu att n calitatea sistemului administrativ, ct n numrul angajailor, genernd un ir
de dileme i sfidri caracteristice dezvoltrii societii, pe de o parte. Pe de alta, extinderea i amplificarea
tehnologiilor administrative i a celor informaionale, depolitizarea gestionrii cadrelor publice, utilizarea
sistemului bazat pe merit i a carierei funcionarilor publici se dovedesc a fi n msur s consolideze guvernarea
i capacitatea administrativ a statului.
Cea de-a doua aseriune vizeaz optimizarea aparatului birocratic prin eforturi susinute de ctre
Guvernul i Parlamentul RM care ar avea sori de izbnd din perspectiva reformei administrativ-teritoriale,
bazat pe principiul regionalismului (cazul rilor membre ale Uniunii Europene, inclusiv al Romniei este
elocvent n acest sens). Modificarea structurii administrativ-teritoriale prin reconstituirea actualelor raioane n
5-6 regiuni va optimiza cheltuielile pentru ntreinerea aparatului de funcionari i s-ar transfera mijloacele
financiare eliberate pentru dezvoltarea regional, va stimula i facilita contractarea fondurilor de dezvoltare
regional, se va produce descentralizarea fiscal i acordarea unor prerogative sporite autoritilor de nivelul
nti i doi. Notm, n special, c acest sistem raional de organizare administrativ-teritorial va oferi posibiliti
noi de absorbie a fondurilor europene, oportuniti care vor asigura dezvoltarea echilibrat a teritoriului RM i
vor facilita rezolvarea problemelor de interes local, fr ingerina i asistena autoritilor ierarhic superioare.
A treia specificare se refer la activitatea unui sistem administrativ raional i eficient care solicit din
partea Guvernului RM reglementarea judicioas a activitii exercitate prin acte normative speciale, inclusiv un
cod de conduit privind managementul sectorului public. Se impune, de asemenea, adoptarea unor msuri care s
contribuie la depolitizarea sectorului public, profesionalizarea administraiei publice prin modificarea sistemului
de selecie, promovare, instruire i evaluare a funcionarilor publici, debirocratizarea economiei i demontarea
sistemului de presiuni economice, reducerea numrului de audituri i optimizarea funciilor de control, inclusiv
prin apelarea la structurile civile. n plan general, subliniem c mecanismul cel mai riguros de reglementare a
capacitii administrative a statului rezid n aprofundarea reformelor democratice i consolidarea democraiei
participative, afirmarea i dezvoltarea statului de drept, care i exercit puterea n conformitate cu legea. Cu alte
cuvinte, optimizarea funcional prin atribuirea strict a responsabilitilor i competenelor funcionarilor
publici, evitnd ambiguitatea, dublarea i suprapunerea lor, precum i optimizarea instituional prin edificarea
unei structuri moderne a Executivului, ar nsemna, de fapt, crearea unui sistem de instituii de administrare
public independente i eficiente, conform bunelor practici ale rilor membre ale Uniunii Europene.
BIBLIOGRAFIE:
1. Legea nr. 68 din 05.04 2012 pentru aprobarea Strategiei naionale de descentralizare i a Planului de aciuni
privind implementarea Strategiei naionale de descentralizare pentru anii 20122015. [on-line]
http://lex.justice.md/viewdoc.php?action=view&view=doc&id=344005&lang=1 (vizitat 21.02.2015).
2. Despre Moldova. [on-line] http://www.md.undp.org/content/moldova/ro/home/countryinfo/ (vizitat
17.02.2015).
3. Preasca, D. naintea Moldovei! Ucraina trece la judee. [on-line] http://www.moldova.org/inainteamoldovei-ucraina-trece-la-judete/ (vizitat 18.05.2015).
4. Reforma administrativ-teritorial iari lsat de izbelite... [on-line] http://www.timpul.md/articol/reformaadministrativ-teritoriala-iarai-lasata-de-izbelite----spre-europa-cu-raioane-sovietice-69856.html?action=print
(vizitat 16.02.2015).
5. Pirkka, Tapiola: E nevoie de o reform dramatic n R. Moldova. Ce recomandri are Delegaia UE pentru
guvernani. [on-line] http://ziarulnational.md/pirkka-tapiola-e-nevoie-de-o-reforma-dramatica-in-r-moldova-cerecomandari-are-delegatia-ue-pentru-guvernul-de-la-chisinau/; http://moldnews.md/rom/news/73397 (vizitat
30.03.2015).
6. Documentul integral cu recomandrile partenerilor externi transmise Guvernului. [on-line]
http://www.realitatea.md/documentul-integral-cu-recomandarile-partenerilor-externi-transmiseguvernului_18363.html (vizitat 30.03.2015).
7. Prohnichi, V. Reorganizarea administrativ-teritorial: o component esenial a unei descentralizri de succes
n Republica Moldova. n: Guvernare i Democraie. Revist de Analiz i Sintez / Asociaia pentru Democraie
Participativ ADEPT, 2011, nr. 1 (7), p. 41-48.

174

8. Osoianu, I.; Srodoev, I.; Veveri, E.; Prohnichi, V. Studiu analitic privind structura administrativ-teritorial
optimal pentru Republica Moldova. Chiinu: Expert Grup, 2010. [on-line] http://www.expertgrup.org/ro/biblioteca/item/746-studiu-analitic-privind-structura-administrativ-teritorial%C4%83optimal%C4%83-pentru-republica-moldova&category=180 (vizitat 13.03.2015).
9. Cunir, V.; Stratan, Al. Reforma administrativ-teritorial n Republica Moldova: de la constrngeri la
prerogative. [on-line] http://asm.md/?go=noutati_detalii&n=6536&new_language=0 (vizitat 13.01.2015).
10. - . [on-line]
http://rossiamoldova.ru/novosti-moldova-rossia/novosti-politiki/1946-administrativanya-reforma
(vizitat
30.05.2015).
11.

111

289
.
[on-line]
http://www.beltsymd.ru/2015/05/30/header/moldovu-mogut-razdelit-na-111-ili-289-municipalitetov
(vizitat
30.05.2015).
12.

111

289
.
[on-line]
http://novostimoldova.ru/novostiobshestvo/86-obshestvo/4331-2015-05-30-07-34-45 (vizitat 30.05.2015).
13. Teoria i practica administrrii publice (Materiale ale Conferinei tiinifico-practice cu participare
internaional, Chiinu, 23 mai 2014) / Com. org. A. Groza [et al.]. Chiinu: AAP, 2014. 498 p.
14. Caietul tiinific 5/2011. Sesiune de comunicri tiinifice, 29 -30 octombrie 2011 / Institutul de tiine
Administrative
din
Republica
Moldova.
[on-line]
http://www.academia.edu/5558826/Evolutia_delimit%C4%83rii_teritorialadministrative_a_R.Moldova_de_la_centralizare_la_recentralizare (vizitat 13.05.2013).
15. Cornea, S. Este necesar o reform teritorial-administrativ n Republica Moldova? n:
MOLDOSCOPIE (Probleme de analiz politic), 2014, nr. 3 (LXVI), p. 43-59.
16. Smboteanu, A. Administraia public: prin reformare spre modernizare. Culegere de studii. Chiinu: CEP
USM, 2013. 327 p.
17. Ptru, A.D. Dezvoltarea regional durabil n context european: aspectul juridico-administrativ / Teza de
doctor
n
drept
administrativ.
Chiinu,
2014.
[on-line]
www.cnaa.md/files/theses/2014/27735/alina_patru_abstract.pdf (vizitat 13.12.2014).
18. Taraclia, raion naional-cultural. Asta duce la separatism, se vrea federalizarea Moldovei. [on-line]
http://www.realitatea.md/taraclia-raion-national-cultural-asta-duce-la-separatism-se-vrea-federalizareamoldovei-18634.html (vizitat 03.04.2015).
19. Ce i ngrijoreaz cel mai mult pe cetenii moldoveni. [on-line] http://www.noi.md/md/news_id/47561
(vizitat 17.09.2014).
20.
Candu:
Ceea
ce
se
ntmpl
la
Bli
este
foarte
periculos.
[on-line]
https://news.mail.ru/inworld/moldova/politics/22149569/?frommail=1 (vizitat 26.05.2015).
21. Gaburici, despre referendumul privind autonomia local a Blului: Oamenii pot s fac ce vor. [on-line]
http://www.realitatea.md/gaburici-despre-referendumul-privind-autonomia-locala-a-bal-iului-oamenii-pot-safaca-ce-vor_21290.html (vizitat 26.05.2015).
22. Toffler, A. ocul viitorului. Bucureti: Ed. Z, 1995. 448 p.
23. Toffler, A. Al treilea val. Bucureti: Ed. Politic, 1983. 682 p.
24. Varela, D. Guvernarea Uniunii Europene. Iai: Ed. Institutul European, 2008. 228 p.
25.
Moberg
E.
A
Distinction
Overlooked
by
Buchanan
and
Tullock.
[on-line]
http://www.mobergpublications.se/arguments/distinction.htm (vizitat 13.01.2013).
26. Brbulescu, I.Gh. Procesul decizional n Uniunea European. Iai: Ed. Polirom, 2008. 520 p.
27. Keating, M. Noul regionalism n Europa Occidental. Iai: Ed. Institutul European, 2008. 255 p.
PUTEREA I OPOZIIA POLITIC N CONTEXTUL MODERNIZRII REPUBLICII MOLDOVA
Rusandu Ion, dr. n filosofie, Institutul de Cercetri Juridice i Politice al AM
Power and political oppozition in the republic of moldova modernisation context. In this article is
analyzed the results of local elections in the context of relations between governing and opposition parties.
Article is rich in factual data on election results data compared to those in 2011. The article concludes with some
generalizations essential to the importance of local elections in the context of power - opposition.
In the article is analyzed the size ratio between the opposition and political power, the importance of
collaboration and communication between them.
Key words: power, opposition, political opposition, political party, local elections, general elections,
the electorate
Dimensiunea metodologic, teoretic i istoric a binomului opoziia politic i puterea face posibil
rspunsului la ntrebarea care este mecanismul interaciunii, comunicrii, controlului reciproc ca nradevr
ambele componente ale fenomenului susnumit s fie orientate spre dezvoltarea societii. la Procesul de
democratizare n Republica Moldova (n continuare RM) este unul complicat, i, nu n ultimul rnd, este legat de

175

maturitatea elitei politice att guvernatoare ct i a celor din opoziie, ce este mult mai important, oportunitate
puterii i opoziiei de a conlucra, avnd n vedere problemele majore cu care se confrunt la ora actual statul i
societatea.
Aici voi face referire la o concluzie cu privire la situaia social-politic fcut de ctre Florin Ni nc
n 2009 (dup alegerile din 29 iulie 2009) i care, n opinia noastr, sunt valabile i actuale pn la aceast or.
Deci, scrie autorul, c micrile pro-democratice sunt greu de antrenat i de susinut n spaiul ex-sovietic, n
special n locurile unde populaia rusofon reprezint un procent considerabil din populaie, dependena
energetic i comercial fa de Federaia Rus este foarte puternic, puterea politic trebuie mprit cu actorii
loiali Moscovei, iar guvernele fie nu pot, fie nu vor sa recurg la reforme politice i economice fundamentale. n
acest sens, nevoia de compromis ntre forele politice reformatoare n RM este foarte mare, fiindc nici Rusia,
nici Uniunea European nu par a fi destul de influente pentru a trana situaia n favoarea lor, dar nici destul de
slabe pentru a nu-i exercita puterea de veto. Este important de tiut ns c orice eec al unei eventuale
guvernri a partidelor de opoziie va avea un impact negativ nu numai asupra credibilitii politice a forelor prooccidentale din RM, dar i asupra credibilitii Uniunii Europene de a susine procese de democratizare n
vecintatea ei estic .
Vorbind despre relaiile dintre putere i opoziia politic vom meniona c ele au fost i sunt foarte
complicate, multidimesnionale i multivectoriale i se schimb odat cu timpul politic. Totodat, vom meniona
c pe de o parte nu s-a finalizat instituionalizarea opoziiei politice, care ar stabili i ordona relaiile dintre putere
i opoziia politic. Acest aspect este foarte important dat fiind faptul c, n prezent, relaia dintre putere i
opoziie s-a deplasat de la for i constrngere spre comunicare, discurs pentru a gsi soluii politice i
economice 1. Totodat, numai n aa mod se poate de perceput cum se formeaz astzi puterea, dar i ceea c ea
i pierde autoritatea sa i, n schimb se ntrete opoziia. Aici vom remarca c pentru tiinele politice apare o
nou abordare i o metod nou de cercetare bazat i pe aspectul conflictual dar i pe cel al discursului.
Devenind parte legitimat ca instituie important a sistemului politic, opoziia politic se manifest ca
un mijloc eficient al rezolvrilor civilizate a diferendurilor/ contradiciilor dintre interesele diferitor categorii
sociale, expuse la nivelul politic.
Cercettorul englez E. Kolinsky menioneaz, c opoziia este un termen care se refer la dreptul
minoritii s critice majoritatea, s efectueze controlul i s caute susinerea popular/ electoral pentru aprarea
opiniilor alternative [1].
n acelai timp, dup cum au artat Ghi Ionescu i Isabel de Madariaga n studiul lor, numai ntr-un
regim democratic opoziia politic poate s se instituionalizeze devenind cunoscut i legitimat [2].
n contextul celor expuse un rol important cu privire la relaiile dintre putere i opoziia politic i
coraportul de for asupra proceselor politice l au alegerile inute la intervale egale i bazate pe decizia
majoritii. La rndul lor, alegerile locale, fiind un proces al obiectivitii/ realizrii voinei politice a populaiei
locale spaiat, au un rol important n democratizarea proceselor politice. Esena lor const n transformarea
democraiei directe n cea reprezentativ n autoadministrarea local. n linii mari esena sau natura puterii att la
reprezentanii puterii ct i la cei din opoziie este de acelai sorginte, anume alegerile, care sunt unica forma
politic n democraie ca posibilitatea real.
Alegerilor locale le sunt proprii urmtoarele semnificaii:
1. Sunt una dintre cele mai principale instituii ale democraiei directe, manifestare direct a voinei populaiei i
luare a deciziilor privind persoanele ce vor administra n viitorii patru ani o localitate sau alta;
2. Alegerile prin sine reprezint domeniul unde se unesc nemijlocit democraia direct i reprezentativ;
3. Alegerile, n conformitate cu normele de drept, sunt forma de realizare a drepturilor constituionale, libertii
cetenilor, cum ar fi dreptul de participare n gestionarea treburilor statale nemijlocit i prin intermediul
reprezentanilor;
4. Alegerile asigur evidenierea problemelor social-economice, spirituale care ar trebui soluionate de ctre
aleii locali [3].
Contextul actual al alegerilor din iunie 2015 este unul major. n primul rnd aceste alegeri pot fi
considerate un test att pentru partidele guvernatoare ct i pentru viitorul European al RM. Totodat, dac
utilizm termenii din domeniul nvmntului universitar, aceste alegeri pot fi considerate ca o sesiune
suplimentar dup ocul care l-au avut partidele proeuropene (Partidul Liberal Democrat din Moldova (n
continuare PLDM), Partidul Democrat (n continuare PD), i Partidul Liberal (n continuare PL)) la alegerile
locale parlamentare din 30 noiembrie 2014 din partea partidelor din opoziie, i n primul rnd din partea
Partidului Socialist din Republica Moldova (n continuare PSRM).
Alegerile locale generale din iunie 2015 au adus n vizorul cercettorilor cteva momente semnificative
care merit s fie analizate: de la rezultatul favorabil pentru partidele proeuropene pn la absenteismul
alegtorilor i coaliiile bizare postelectorale la nivelul consiliilor raionale. Rezultatele alegerilor locale din iunie
2015 au rsturnat ntr-o msur pronosticurile sondajelor sociologice cu privire la o rat sczut a numrului de
votani pentru PLDM i PD. ns, conform rezultatelor obinute de aceste partide i PL putem constata c
partidele sus-numite i-au pstrat controlul asupra raioanelor rii.
1

G. Ferrero meniona c opoziia este un organ al suveranitii populare la fel de important ca i guvernarea i, a suprima opoziia nseamn,
s suprimi suveranitatea popular.

176

Astfel, conform datelor finale ale alegerilor locale generale, PD i PLDM sunt partidele cu cei mai muli
primari alegi la nivel de sate, orae i municipii (PD au 287 primari, i PLDM respectiv 285, din total celor 898
primarii) [4].
Observm, deci, c PLDM i PD au obinut cele mai multe mandate de primari i consilieri locali. O
scdere uoar a avut la alegerile recente Partidul Liberal comparativ cu cele din anul 2011. Scderea este de 4%
la nivel de ar, ns PL a obinut un rezultat mai bun numai la nivelul municipiului Chiinu. Un rezultat relativ
bun pentru un novice, este cazul Blocului Electoral Iurie Leanc, ns cumulul de vot nu este ndeajuns
pentru ca acest partid s fie o alternativ partidelor proeuropene de la guvernare (faptul c au fost mai muli
susintori n municipiul Chiinu se datoreaz n primul rnd ratingului personal a lui Oazu Nantoi).
Un eveniment deloc minor din punct de vedere constituional, e dreptul omului ce s-a produs n cadrul
acestor alegeri: pentru prima dat n RM trei femei de etnie rom au fost alese n consiliile locale. Fiind la
capitolul gender vom constata c la nivel de ar n comparaie cu alegerile locale din 2011 s-a mrit numrul de
femei alese n funcia de primar de localitate. Astfel, la alegerile din iunie 2015 au acces la funcia de primar 183
de femei, ceea ce este cu 17% mai mult dect la alegerile locale din anul 2011.
Din analiza rezultatelor alegerilor din iunie 2015 se mai poate constata, i aceasta este important, c
PSRM i Partidul Politic Partidul Nostru (n continuare PN) i-au consolidat poziiile datorit scderii dramatice
a simpatizanilor Partidului Comunist din RM (n continuare PCRM), care comparativ cu anul 2011 au pierdut
aproape 30% din susintori. n acelai timp vom meniona c n pofida faptului ca PSRM s-a situat pe locul trei
(dup PLDM i PD) dup numrul de consilieri nu va putea influena situaia la nivel de ar, dat fiind faptul c
rezultatul pe care l-au obinut partidele proeuropene le permit lor formarea coaliiilor majoritare practic la nivel
de ar, cu unele excepii. Totodat, trebuie s constat c i n cadrul partidelor proeuropene s-au regsit imediat
nite fisuri cu privire la constituire coaliiilor la nivel local. Astfel, n pofida faptului c PLDM a acumulat cele
mai multe mandate de consilieri raionali i ntr-o total disonan cu afirmaiile liderilor partidelor proeuropene
(i viceversa a celor din partidele de opoziie) c nu vor face coaliii cu oponenii lor, observm c n cele 30 de
raioane n care s-au ales deja preedinii consiliilor raionale (urmeaz alegerile n Rcani i Basarabeasca) s-au
fcut coaliii bizare a partidelor proeuropene cu cele din opoziie pentru a-i promova candidaii si. Interesant,
c astfel de coaliii s-au produs i dup semnarea Acordului de constituire a Alianei pentru Integrare European
(AIE 3 ) din 23 iulie 2015. Astfel, la Ungheni datorit coaliiei dintre PD, PCRM, PL, PSRM preedinte a fost
ales reprezentantul PD, iar PLDM avnd cei mai muli consilieri, 10 s-au abinut de la vot. n raionul Cantemir,
locul PSRM a fost ocupat de Partidul Popular European din Moldova (n continuare PPEM). La Edine
preedintele raionului a fost ales n formula anterioar: PDM, PL, PCRM i PSRM. Nu cred c vom gsi
explicaii n operele clasicilor (R. Dahl, A. Liyphart, D. Sartori, G. Ionescu .a.) care s-au dedicat problemelor
relaiilor dintre putere i opoziie, partide aflate n opoziie, care sunt legitile politice, politologice care duc la
un astfel de comportament politic. Probabil vom gsi rspuns la capitolul cheltuieli financiare (oficiale depuse la
Comisia Electoral Central) n timpul campaniei electorale pentru alegerile locale din iunie 2015. Astfel, pe
primul loc la acest capitol se afl PD, care a investit n campania sa 23684420,36 lei, urmat de PSRM cu
1451398,99 lei, Partidul Nostru - 11583557,35 lei, PCRM 8252556,58 lei, PLDM 6013458,77 lei etc.
Rezultatele alegerile din iulie 2015 au artat c n comparaie cu alegerile locale din 2011 s-a mrit
procentul absenteitilor. Astfel, comparativ cu alegerile precedente nu au ieit la votare circa 10 % din alegtori.
Posibil cauza acestui absenteism se datoreaz dezamgirii profunde n partidele aflate la guvernare, i totodat la
regsirea PCRM n cadrul susintorilor PLDM i PD n cazul desemnrii noului guvern. Aceast dezamgire
este direct legat de acel enorm prejudiciu miliardul furat din reeaua bancar. Alte aspecte sunt legate de lipsa
reformelor i n primul rnd n domeniul justiiei, incapacitatea guvernanilor de a mbunti calitatea vieii
populaiei rii. Cel mai ngrijortor fapt cu privire la absenteism se refer c au ignorat alegerile n primul rnd
tineretul, adic viitorii probabili adepi ai proeuropenismului.
Alegerile locale generale din iunie 2015 au generat, n opinia noastr, nite procese majore care au
cuprins tot eichierul politic din RM. Astfel, se observ c pe segmentul de stnga s-au ivit dou noi partide care
i-au practic locul PCRM, este vorba de PSRM i PN. Din aceast constatare reiese nc un fenomen legat de
voina electoratului care i-a dat opiunea sa nu numai pentru partidele deja tradiionaliste parlamentare dar i
pentru alte partide, gen PPEM .a. Acest fapt ine, n opinia noastr, de aa numitul frame, termen care se
definete ca scheme interpretative, ce le permit indivizilor s localizeze, s perceap, s identifice i s determine
evenimente la care direct sau tangenial ei particip [5].
Studiul nostru cu privire la alegerile locale generale din iunie 2015 ne permite s concluzionm
urmtoarele. n primul rnd, alegerile locale generale din iunie 2015 s-au desfurat n condiiile crizei politice i
economice profunde i pe fundalul unui scandal financiar-bancar. n al doilea rnd, partidele proeuropene i-au
pstrat controlul asupra majoritii raioanelor rii. Rezultatele alegerilor le-au acordat acestor partide
posibilitatea de a forma Aliana pentru Integrare European (AIE 3). n al treilea rnd, alegerile locale au fost
marcate de factorul geopolitic, n acest sens alegerile primarilor din Chiinu i Bli sunt elocvente. n acelai
timp vectorul propus a devenit foarte segmentat. Avem n vedere faptul c n trecutul nu prea ndeprtat aveau
un singur juctor puternic pe acest segment PCRM, acum acest partid este nghesuit de PSRM i PN. n al
patrulea rnd, alegerile locale din iunie 2015 s-au evideniat printr-un absenteism, i, n primul rnd din partea
tineretului cauzele sunt multiple: de la nencrederea n funcionalitatea instituiilor statului pn la corupia cu

177

cot major la toate nivelurile, neimplementarea, i, n primul rnd, n domeniul justiiei. Prin urmare,
absenteismul are loc, pe de o parte, pe fundalul aspiraiilor prodemocratice i proeuropene, a creterii culturii
politice a populaiei, iar pe de alt parte, se observ o nencredere fa de guvernare.
La mod general vom meniona c previzibilitatea regulilor de joc care s-au constituit ntre putere i
opoziia politic parcursului existenei sistemului politic al Republicii Moldova nu corespund cerinelor i
ateptrilor societii. n acest aspect este relevant fenomenul Platformei civice Demnitate i Adevr.

BIBLIOGRAFIE:
1. Oppozition n Western Europe. Ed. By E. Kolinscky. London-Sitdney, 1987. p. 366.
2. Ionescu, Gh. Isabel, de Mdariaga. Opoziia. Trecutul i prezentul unei instituii politice. Bucureti: Ed.
Humanitas, 1992, 367 p.
2. Constituia Republicii Moldova. Art. 38, 39. Chiinu: Lavilat-Info, 2013. p. 11-12.
3. http://www.realitatea.md/rezultatele finale-ci-primari-are fiecare-fiecare-partid-n urma-celor-dou tururide-scrutin-ale-alegerilor-locale 23118. html( 29.06. 2015).
4. Snow, D.; Rochord, E. B.; Worden, S.; Benford, R. Frame Alignment Processes, Micromobilation and
Movement Participation. In: Americam Sociological Review, 1986, Vol. 51, nr. 4, p. 464.



, . , ., ,
,
The article deals with the results of an empiric research of ethnic affiliation held among Moldovans,
Russians, Ukrainians, Gagauz and Bulgarians. The research aimed to study dynamics of need in identification
with the in-group during the period of social transformations; it was carried out in the period of 2004-2013. The
results showed that in all of the age groups of Moldovans (high school students, young people, adults) there
consistently dominate the ethno-affiliative motifs. The groups of ethnic minorities (Russians, Bulgarians and
Gagauz) orient themselves on ethnic group as well, but there are differences in affiliation in dependence on the
age group. The group of Ukrainians showed tendency of self-orientation, most significant at the high school
students. The research of ethnic affiliative motifs dynamics allows diagnosing of interethnic relations and the
process of ethnic self-determination in different groups.
Key words: affiliation, ethnic identity, age groups.
, ,
,
- .
, , ,
.
, , -

[1, 6]. ,
, ,
, ,
.
,
.
, ..
.
, ,
. . :
(allocentric) , ,
(ideocentric). ,
, ,
, ,
[5, c.106]. - .
- [4,
c.151].
.
, , ,
, .

178

(16-18), (18-25
), (25-55). : 450; 400;
169. 1019 .
: 2004, 2008 . (); 2006, 2013 . (); 2007. ().
, , , , .

[5].

:
(); ,
(); ,
- .

1) ,
, ,
, , . ,
, .

-.
- .
, : , , ,
,
,
(2006 .) (2013 .).
, , ,
: (66%), (60%), (55%), (54%).
,
(48%) (39%) .

, ,
. ,
.., .
, ,
, ,
, .
( ),
(65,6%). -,
.
(2006, 2013 .).
.
2)
(. 1, 2, 3. 4, 5)
. ,
.
. 1.
.
80%

,
.

2004. (50%),

.

(27%), (4%).

60%
40%
20%
0%
2004

.
2006

.
2007

2008
2013

179

.
2.
.
70%
60%
50%
40%
30%
20%
10%
0%
2004

.
2006

.
2007

2008
2013

50%

.
,
,
, -
, .


(48%), (39%).
,
,

.
. 3.
.

40%
30%
20%
10%
0%
2004

.
2006

.
2007

2008
2013

80%

(2006-60%).
,

.
-
(43%).
. 4.
.

,

40%
, , .
, .
20%
,
0%
,
.
,
.

.
,
,

,
,
( ),
[3, c.151-152].
. 5.
.
80%
,
70%

,
60%

2013. (78%),
50%
40%
2008.
30%
(40%). -
20%
2008.
10%
0%
(46%). ,
2004
.
,
2006
.
,

2007
.
2008

2013
,
20
04

20
06

20
13

20
08

20
07

60%

180

(65,6%),
,
.
, ,
, , .
, ; . ,
. ,
, - ,
, .
,

.
:
1. , .. : - . B:
i i i i. i: I. ii. ii:
. . . : i, 2014, 6, .42-49.
2. , . B: /
.. . . : , 2005.
3. , .. : , , ( XX XXI .)
, 2007. 280.
4. , . : / .... :
, 2007. 384 .
5. , .. . , 1998.
6. Caunenco, I.; Gaper, L. Procesele de identificare etnic din Republica Moldova i problemele de integrare n
spaiul Euroregional n: Rolul Euroregiunilor n dezvoltarea durabil n contexstul crizei mondiale. Exemplu:
Euroregiunea Siret-Prut-Nistru, Volumul XVIII. Iai: Ed. Tehnopress, 2013, p.100-105.

( )
, ., . ,
One of the recent research fields, which is especially actual for the post-Soviet space, is the study of
social representations about the country, its history and its place in the world among the different groups of
population. The present article deals with the results of an empiric research of social representations about the
symbolic space of Moldova and namely about its symbolic personalities, which together with symbolic events
form the collective memory of a society. The main result of the research fixed the continuity of formation of the
symbolic capital of the relatively young state, for it has not been yet reflexed by the elite.
Key words: social representations, the symbolic sphere, symbolic identity, the image of the country.
, ,
,
.
.
,
.
,
.

. 225 .
: 18-23 (). : 45 , 45
, 45 , 45 , 45 .
. , : . (
), . () . (),
34% .

, . ,
. ,
, .
, .
: ,
, . , , ,

181

, ;
.
.
- (90%) .
(49%), (36%).
: -27%, -18%, - (13%),
(4%), (4%), (4%), (4%).
: (4%),
(9%), (7%), (7%), (9%).
(20%), (4%),
( -16%, -7%, -4%, -4%).
, ,
, ,
9% , ..
,
. (
, , ),
( , -).
,
XVIII ., , .
, ,
XX .
,
.
, .
,
,
, [, , 2013,
128)].
, ,
(48%). 11% .
, . .
( , ), ( ), (
, , ), ( , , ), (
, , , , ).
.
, ,
(52%). (36%), (24%) ,
(13%). 13% , , , . .
: ,
, . , , ,
, - , , , .
(91%).
: (16%), (9%), (7%).
(20%)
(16%). ,
(20%), . :
, , ,
.
, . , , ( ), -
( ,
). -, .
.
, , .
, ,
(40%). .
: (7%), (), , .
, , : .. , .. ,
, , (), (),
(), ( ), ,
( ). ,

182

, ( , - ,
, - , ,
, , , - ).
, : , ; ,
, , , .
. ,
, .
. , , (42%) (24% ).
(16%), , , , (16%), (7%) .
, , .
. ( ,
), , Apple ,
. , , .
: , , ,
, , -.
: , , , ;
; . :
, ; , ,
, .
(78%).
: (13%), (4%); :
(27%), (4%), (4%), (7%); , :
(18%), (11%), (18%), (4%), Zdob i
Zdub (7%), (4%).
2012 .
-
( - 27%). (19%): (11%), (9%),
. : (11%), , .
: ( , , ( )),
( , , ), (, , (
)), , ( , ,
), . , : , .
: ( , -), (
, , ), ,
(, , , ), , .
:
, , .
, , (47%) - 44% ,
(13%), (4%). (4%), ,
( , , , ). ,
. . :
, , , ; ( , , ,
, , , , );
, -; ; ; ;
(); ( -); .
( ); . (
, ); . (
); . ( ).
(84%)
. : (20%),
(4%), (4%), , (4%), , ,
-. : (13%),
, , , , , . :
(9%), (9%), , , , (4%),
Zdob i Zdub (4%) (, ), , ,
.
, , ,
, . ,
, , 40% ,

183

. 28% . : ( -5%,
, , ); (, , , ,
); , , ( , , ,
, , Scrillex, , , , );
( , DIMAGA ( StarCraft II),
, ); (, , , ,
, , , , , ;
). , ,
( ULIM ).
, , (25%)
(56% ). (16%) (13%). :
(, ), (, ),
( 19 , ), (6%).
: , - , (, ,
street workout ( ), , .
, , , : ,
, , ; , , , ,
, , , , , ; ,
, ; , ; : ,
; , ; ,
; ; .
(89%),
. - (36%). :
(7%), (11%), .. , , , ,
, , , . :
(9%), (7%), , , .
( (7%), (4%),
, ), .
-
: (29%), (11%), , , , , , .
, : , (,
), , , ( ),
, . : , ,
, . : (4%), ,
, . - Google .
- ( ), (,
). - , ,
, . .
, , : (38%), ,
.., (51% ). (13%) , (9%)
, , .
: (7%), ,
, ; (7%), , . : , , ,
, , , , ,
. (,
).
, ,
.
. ,
. ,
.
SECURITATEA UMAN N CONTEXTUL PERICOLELOR
I AMENINRILOR CONTEMPORANE
Sprincean Serghei, dr. n tiine politice, Institutul de Cercetri Juridice i Politice al AM
Human security in the context of contemporary dangers and threats. In the article the topic of
security is analyzed from the perspective of human beings interests, reflected in political and social theories and
practices. A wide range of dangers, menaces, risks and threats are carefully investigated in the contemporary
security studies. The human wellbeing is considered to become a basic fundament for a concept of human
security. The connection of human security with human rights and human development is essential for a

184

sustainable impact of such theories on social practice. The absence of threats and fears can assure the protection
of basic human rights and fundamental freedoms in the way to build a new and safer world.
Key words: security, human, safety, global crisis, security studies, danger, threats, the Copenhagen
School.
Studiile de securitate se confrunt actualmente cu un ir de ameninri i riscuri extrem de periculoase
att la adresa persoanei umane, ct i la cea a societii n sens global. n ultimul timp, noiunea de securitatea
uman capt o tot mai mare popularitate n aceste studii de securitate, fiind un domeniu care are o orientare
ferm i accentuat ctre aspectele civile, publice i globale, care asigur absena ameninrilor i a fricii i
asigur protecia drepturilor i libertilor fundamentale ale omului. ncepnd din cea de-a doua jumtate a sec.
XX, criza global i, mai cu seam, procesul globalizrii s-a extins semnificativ, avnd un impact decisiv asupra
comunitilor umane, asupra societilor i culturilor, dar i asupra persoanelor individuale ce tind s se
adapteze, n rezultat, la aceste noi realiti i prioriti mondiale. n consecin apar noi vulnerabiliti i
ameninri de ordin politic, economic, ecologic i social.
Proveniena etimologic a noiunii de securitate este nrdcinat n cultura i civilizaia Imperiul
Roman. La originea sa au stat termenii latini securitatis i securitas. Iar pe o moned din perioada domniei
mpratului Hostilian (Gaius Valens Hostilianus Messius Quintus care a domnit n anul 251 e.n.), era
reprezentat zeia Securitas care asigura protecia i bunstarea imperiului, cu sensul de libertate n faa
ameninrii, consider Florentina Funieru ntr-o lucrare de a sa ntitulat Societate i Securitate [1, p.171]. Mai
trziu, n perioada modern, semnificaia noiunii de securitate este organic legat de concepia raiunii de stat
care vizeaz asigurarea funcionrii i integritii organismului statului. n acest sens, conceptul de securitate a
fost mereu perceput n context comunitar, iar securitatea naional a devenit o sintagm consacrat n studiile
despre pace i rzboi. Aa nct Penelope Hartland-Thunberg conchidea n studiul su National economic
security: interdependence and vulnerability din 1982, c securitatea reprezint capacitatea unei naiuni de a
promova cu succes interesele sale naionale [2, p.48].
Noiunea de securitate, pe parcursul evoluiei contiinei social-umane, a constituit mereu un subiect
controversat i larg dezbtut att n cercurile de specialiti, ct i de ctre opinia public preocupat de
satisfacerea eficient a celor mai fundamentale necesiti ale societii i persoanei umane, precum nevoia de
siguran i adpost. Potrivit ilustrului savant Abraham Maslow, preocuparea omului pentru securitatea
personal i siguran a reprezentat, nc de la nceputul formrii individului uman ca entitate social, o
preocupare esenial n structura piramidei necesitilor, teorie expus pentru prima dat nc n 1943 n lucrarea
sa A Theory of Human Motivation [3, p.371]. Aceast concepie, aparinnd lui Maslow, reprezint una dintre
primele ncercri de a aborda problematica securitii din perspectiv comportamental-psihologic, accentund
valenele individual-personale ale noiunii de securitate, ce reprezint eminamente o categorie social-istoric, din
punct de vedere a genezei sale, fiind contientizat de omenire pe parcursul ntregii sale evoluii, potrivit ideilor
savantului moldovean C. Manolache expuse n opera sa Organismul militar al Republicii Moldova. Construcia
militar i securitatea statului [4, p.241].
Conceptualizarea noiunii de securitate din perspectiva cercetrilor tiinifice contemporane, a fost
realizat din multiple perspective, aparinnd unor coli i direcii bine cristalizate i argumentate factologic n
ultimele dou secole. coala tradiional-realist, cea liberal-idealist, behaviorist, constructivist i altele, au
determinat evoluia conceptului de securitate de la stadiul de caracteristic a puterii de stat n relaia cu alte
entiti statale pe arena internaional (n accepie tradiionalist) la stadiul de stare sinergetic specific tuturor
tipurilor de sisteme (tehnice, sociale i biologice) (n accepie post-neclasic), nsemnnd un echilibru,
armonizare i prosperare, mai ales, la nivel individual al personalitii umane ca msur a lucrurilor i element de
referin pentru toate tipurile de sisteme.
Cu toate acestea, studiile de securitate posed o istorie nu prea extins comparativ cu tiinele despre
societate i majoritatea teoriilor social-politice, dar desemnnd o arie relativ complex cu aspecte
interdisciplinare, ce au ca obiect de cercetare, n cele mai dese cazuri, problematica asigurrii securitii, viznd
direct laturile subiective i obiective ale anticiprii pericolelor i a estimrii riscurilor, vulnerabilitilor, precum
i a anvergurii i consecinelor febleii sistemelor social-politice. Printre primii, dubla perspectiv subiectivobiectiv asupra contientizrii problemelor de securitate a fost remarcat n 1962 de ctre importantul
teoretician al fenomenului securitii, Arnold Wolfers n opera sa Discord and collaboration: Essays on
international politics, n care se desprinde ideea c securitatea, alturi de fora bunstrii, reprezint o valoare i
o cale prin care o naiune poate accede la o poziie superioar n raport cu alte naiuni. Dar, spre deosebire de
bunstare, care se refer, mai mult, la aspecte materiale, implicnd posibilitatea de a controla aciunile altora,
securitatea, n sens obiectiv, denot absena ameninrilor la adresa valorilor achiziionate, iar, n sens subiectiv,
absena fricii c aceste valori ar putea fi atacate [5, p.150].
Potrivit Dicionarul Explicativ al Limbii Romne (1998), cuvntul securitate semnific faptul de a fi la
adpost de orice pericol; sentiment de ncredere i de linite pe care l d cuiva absena oricrui pericol; protecie,
aprare [6], ceea ce denot o dat n plus dublul aspect (subiectiv-obiectiv) ale termenului n cauz. Acest
aspect cu dublu sens se pliaz cel mai natural pe concepia constructivist de la sfritul sec. XX, precum c
securitatea nu mai poate continua s fie perceput exclusiv n contextul intereselor naionale ale statului, ci

185

trebuie s fie extins la nivelul individului uman. n acest context, Barry Buzan, ntemeietorul colii de la
Copenhaga, n 1993, n opera sa People, States, and Fear: An Agenda for International Security Studies in the
Post-Cold War Era, remarc deficienele concepiei realiste i a celei liberale a securitii, precum i
ambiguitatea termenului, considernd c percepia securitii ca produs al puterii n sens tradiional, fie ca
consecin al pcii n sens idealist, nu contribuie la o explicare deplin a noiunii. Ilustrul savant susine c, n
sens tradiional, securitatea reprezint un concept ideologizat, politizat, limitat, cci, dac ea este doar o
consecin a puterii militare, nu are mijloace pentru a defini noile ameninri, fiind subordonat specificitii
studiilor strategice i devenind dependent de evoluia tehnologiei [1, p.172]. Astfel c, n viziunea lui Barry
Buzan, concepia securitii devine una subiectiv, transpus n plan social, dar edificat pe baza percepiei unor
date i fapte cu caracter obiectiv.
Concluzionnd, vom reitera ideile cercettorilor V. Juc i V. Ungureanu expuse n lucrarea
Fundamentarea i instituionalizarea securitii naionale a Republicii Moldova: aspecte istoriografice i
teoretico-metodologice [7, p.15], potrivit crora, n pofida unei multitudini de definiii i sensuri ale categoriei de
securitate existente n literatura de specialitate i n actele normativ-juridice internaionale i naionale ale
diferitor state ale lumii, n prezent nu exist o definiie clar i unanim acceptat a acestei noiuni, nici o
concepie dominant referitor la cile cele mai eficiente i sustenabile de asigurare a securiti.
Baza teoretico-metodologic i noutatea concepiei securitii, aparinnd colii de la Copenhaga i
principalilor reprezentani ai ei - Barry Buzan, Ole Waever i Jaap de Wilde, care sunt adepii lrgirii sferei de
definire a fenomenului securitii, a constat, mai cu seam, n evidenierea a cinci sectoare noi specifice acestui
fenomen, i anume: militar, politic, economic, societal i de mediu, care sunt principalele domenii ce determin
securitatea colectivitilor umane [8, p.31]. Viziunea dat a fcut posibil separarea i identificarea mai exact a
ameninrilor i vulnerabilitilor, a cercetrii mai atente a naturii i specificului acestora. Reieind din aceast
concepie ce vizeaz separare pe sectoare, se presupune c securitatea militar opereaz cu ameninrile armate
i vizeaz vulnerabilitile interne ale statului n domeniul defensiv. Securitatea politic ine de stabilitatea
sistemelor politice, a regimurilor de guvernmnt i se refer la ameninri de securitate ce provin din specificul
doctrinar-ideologic dominant n societate, precum i la vulnerabiliti instituionale i funcionale ale comunitii
i statului. Securitatea economic, n viziunea reprezentanilor colii de la Copenhaga, ine de ameninri i
riscuri pentru bunstarea populaiei, dar i de vulnerabiliti economice a societii, precum rspndirea
fenomenului srciei, a subdezvoltrii, a lipsei sau insuficienei de resurse naturale, energetice sau financiare. Pe
cnd, securitatea mediului, strict legat de domeniul precedent, cel economic, vizeaz ameninri pentru societate
ce provin din natur, din starea ecologic a ei, totodat opernd i cu vulnerabiliti interne i limite logistice i
de mentalitate care mpiedic societatea i generaiile viitoare s beneficieze de un mediu nconjurtor, sustenabil
i calitativ. ns, sectorul securitii societale, aa dup cum a fost conceput de Barry Buzan, s-a dovedit a fi cel
mai aproape de concepia securitii umane, nsemnnd stabilitate comunitar, dezvoltare a tradiiilor de cultur
i civilizaie, a institutelor democratice i de familie, viznd riscuri provenite din insuficiena determinrii
identitare ori din conflicte interetnice sau religioase, referindu-se i la un ir de vulnerabiliti interne similare, la
ameninri externe cu scopul de a contrapune diverse grupuri sociale. Cu toate diferenele dintre sectoarele
susmenionate ale securitii, n concepia colii de la Copenhaga, acestea se afl ntr-o permanent
interdependen organic i funcional, determinnd, astfel, o mai mare eficien i coordonare a eforturilor de
stabilizare i securizare.
Pe de alt parte, ntr-o incursiune teoretic din cadrul lucrrii Riscuri i ameninri la adresa securitii
Romniei. Actualitate i perspectiv, menioneaz c tipologizarea ameninrilor conform cu sectoarele
securitii: fie militare, politice, economice, societale, de mediu sau de alt fel, sunt determinate nti de toate de
variaia i multitudinea planurilor vieii umane n care aceasta se manifest n mod firesc [9, p.17]. Aceast idee
poate avea sens doar n contextul n care viaa uman este privit din perspectiva securitii persoanei, din cea a
riscurilor i ameninrilor care pot viza n mod exclusiv, fiina uman n deplinul sens al acestui termen. De fapt,
disputa teoretic referitor la obiectul eforturilor i aciunilor de asigurare a securitii continu i n studiile
contemporane, pendulnd ntre trei piloni de baz ca subiecte ale cror securitate trebuie asigurat: sistemul
internaional, statul cu atributele sale i persoana uman. n ultim instan, aceast disput este influenat de
perspectiva metodologic i doctrinar care este pus la baza studiilor i analizelor de securitate. K. Booth, de
exemplu, se ntreba tranant: Care este obiectul de referin principal statele sau oamenii? Securitatea cui
anume este pe prim plan? [10, p.16]. Reprezentanii colii de la Copenhaga, de exemplu, consider c ntre cele
trei subiecte ale securizrii nu este identificat unul care s primeze pe termen lung, ci exist un echilibru dintre
ele, securitatea crora se completeaz i se fortific reciproc. Alegerea obiectului aciunilor de asigurare a
securitii, din perspectiva acestei concepii, depinde de valorizarea care i se confer de societate, opinia public
sau de comunitatea internaional. Totui, n opinia lui Barry Buzan, statul reprezint veriga care este capabil s
fac legtura cu celelalte subiecte ale securitii, deoarece, doar statul poate forma politici de asigurare a
securitii i tot statul este exponentul securitii, care, general vorbind, poate fi numai relativ i nu absolut [8,
p.34].
n acelai context, savantul moldovean acad. Alexandru Roca, n lucrarea sa Algoritmi ai tranziiei:
aspecte social-filozofice, remarc corelaia organic, dinamic i interdependent dintre Stat, Societate i Individ
care a persistat de-a lungul secolelor n tiinele sociale ca un subiect fundamental pentru nelegerea naturii

186

controversate i complexe a fenomenelor sociale, remarcnd i specificul sistemic al acestei triade [11, p.26].
Studiile de securitate, fcnd parte din domeniul cercetrilor sociale, sunt axate inevitabil pe investigarea acestei
conexiuni organice dintre persoana uman i stat cu legturile sale internaionale pe plan regional i mondial.
coala de la Copenhaga a contribuit decisiv la extinderea conceptul de securitate n perioada
contemporan spre deosebire de coala tradiionalist n domeniul cercetrii securitii. Concepia privind
securitatea societal, fiind definit ca unul dintre cele cinci sectoare ale securitii, a generat noi perspective i
abordri n studiile de securitate. Concomitent, domeniul securitii a trecut printr-un profund proces de
reconceptualizare, securitatea fiind neleas ca un anumit tip de politic cu valene aplicative i modernizante,
fcnd posibil distingerea dintre securizare i politizare. n acest domeniu aplicativ al concepiilor de securitate,
contribuia colii de la Copenhaga a fost definitorie pe multe decenii nainte, determinnd elaborarea strategilor
contemporane de securitate a blocurilor politice, a organizaiilor internaionale i statelor, bazate pe principii
conceptual noi n practica asigurrii securitii [12, p.53].
Odat cu ncheierea rzboiului rece i cderea cortinei de fier, a devenit clar c goana narmrilor i
simpla deinere a armelor nucleare nu mai poate garanta securitatea statului i, cu att mai mult a cetenilor din
statele ce posed acest tip de armament, fiind supui la o presiune psihologic semnificativ, contientiznd c
pot fi inta direct a unor atacuri cu arme asemntoare din partea statelor rivale. n acest context, securitatea a
fost necesar s fie conceptualizat n limite mult mai largi, iar dimensiunile non-militare a securitii, cele
ecologice, economice, de bunstare i dezvoltare durabil i altele, au devenit din ce n ce mai importante pentru
perceperea securitii de ctre persoana uman. n consecin, concepia dominant tradiionalist ce privea
restrns securitatea ca un domeniu al siguranei i bunstrii statelor pe arena internaional n concuren cu alte
state, securitate ce nu poate fi obinut fr ajutorul forelor militare, fiind garantat de acestea, a fost nevoit s
ia n considerare factorul uman, dar nu de rnd cu ali numeroi factori ce influeneaz n final starea de
securitate pe mapamond, ci ca element fundamental al procesului de securizare. In acest fel, persoana uman
devine att subiect, ct i obiect de referin al procesului de asigurare a securitii, iar starea de securitate a
persoanei devine punctul de pornire al oricrui studiu din acest domeniu, inclusiv la nivel comunitar, naional,
regional sau global. Prin urmare, extrapolnd concepia colii de la Copenhaga cu privire la securitate, n cel
mai general sens posibil, putem s afirmm c securitatea uman exprim percepia individual i a societii
referitor la absena riscurilor, pericolelor i ameninrilor n adresa persoanei umane.
Acest concept al securitii umane a fost utilizat pentru prima dat ntr-un act normativ internaional n
anul 1994 cnd a fost dat publicitii Raportul asupra dezvoltrii umane a Organizaiei Naiunilor Unite.
Evenimentul n cauz a fost precedat de numeroase dezbateri la sfritul anilor 80 nceputul anilor 90 n
comunitatea tiinific referitor la rolul fiinei umane n studiile de securitate, teoria i practica dezvoltrii
durabile i a drepturilor omului, precum i n cadrul studiilor de pace care au luat amploare dup evenimentele
internaionale din anii 70 ai sec. XX, precum criza din Cuba, rzboiul din Vietnam, micrile sociale din Frana
i S.U.A. etc.
Scopul principal al acestui nou concept n domeniul securitii a fost de a depi limitele impuse
conceptualizrii fenomenului securitii de sensul militar tradiional al ei. Noul concept al securitii umane
extinde ctre un nivel superior nelegerea fenomenului n cauz, prezentndu-l ca pe unul multidimensional ce
cuprinde securitatea economic, alimentar, a sntii, a mediului, securitatea personal, politic, a comunitii
etc. Astfel c, primele referine la securitatea uman le gsim corelate cu problematica drepturilor omului ce s-a
aflat n atenia ONU nc de la formarea acestei organizaii mondiale, ncepnd cu adoptarea Declaraiei
Universale a Drepturilor Omului din 1948, unde n articolul 3 este prevzut c Orice fiin uman are dreptul la
via, la libertate i la securitatea persoanei sale.
Problematica crizei globale a indus att n contiina social, ct i n discursul tiinifico-teoretic,
aspecte ce provin dintr-o ngrijorare general i nesiguran n ziua de mne. Acestea fiind convergente
subiectului securitii i elaborrii unei metodologii eficiente de asigurare a securitii la toate cele 3 nivele
instituional-obiectuale: la nivel internaional pe glob, la nivelul securitii statului i comunitii, precum i la
cel al securitii i siguranei persoanei umane.
Cercetnd problematica securitii umane n cel mai general i abstract mod, precum i suportul su
conceptual i teoretico-metodologic, conchidem c aceasta, n mod inevitabil i organic, trebuie s se plaseze la
interferena dintre cercetarea problematicii statului, reflectat n ntreaga gndire social i politic din
antichitate pn n prezent, pe de o parte, i studiul concepiei despre fiina uman, tratat n mod foarte divers n
ntreaga istorie a gndirii umane. Dac n antichitate problematica securitii intereselor statului n competiie cu
alte state a fost tratat ca fiind apanajul strict al organizaiilor i instituiilor sociale, n strict interdependen cu
virtuile i calitile individuale ale conductorilor statului, n perioada modern i contemporan, studiul asupra
naturii umane las o tot mai semnificativ amprent asupra nelegerii rolului factorului uman n procesul de
asigurare a securitii att a statelor, ct i a indivizilor.
Omul se definete, n cel mai vast sens, drept o fiin bio-psiho-social, prin urmare securitatea uman,
inevitabil, trebuie s se refere la cele trei componente ale naturii sale: la aspectul biologic, spiritual, ct i la
aspectul social. Cu alte cuvinte, securitatea neleas la nivelul individului este impus s graviteze n jurul
categoriilor de bunstare i asigurare a demnitii personale.

187

Securitatea uman i propune protecia persoanelor n mod individual, dar i ca totalitate social, prin
asigurarea condiiilor de via i trai, a necesitilor fundamentale. Pe de alt parte, securitatea uman nu poate s
fac abstracie de cel mai strategic scop al su de a educa, de a induce i forma prin amplificare i multiplicare a
calitilor i virtuilor umane fundamentale care stau la baza progresului domeniului securitii n cel mai larg
sens posibil.
Devine important procesul amplificrii influenei factorului uman n cercetarea problematicii securitii
umane odat cu aprofundarea cercetrilor asupra acestei concepii. Deoarece, asigurarea durabil i complet a
securitii individului uman nu poate fi efectuat fr asigurarea securitii mediului firesc de viaa a persoanei,
se impune o nou abordare a concepiei securitii umane, prin scoaterea n eviden a caracterului su biocentric
care vine s nlocuiasc caracterul antropocentric din cadrul primelor ncercri de teoretizare a acestei concepii a
securitii umane. Astfel c securitatea uman cu specific biocentric, poate fi neleas mai bine, ca o etap nou
a dezvoltrii teoriei cu privire la asigurarea securitii prin prisma intereselor individuale, schimbnd accentul
ctre asigurarea bunstrii individului uman doar n corelaie direct cu asigurarea sustenabil a bunstrii naturii
i mediului nconjurtor.
Dintr-o perspectiv nou, problematica securitii umane, se refer deci, nu doar la primatul proteciei
intereselor persoanei in faa celor de stat, dar, mai cu seam, vizeaz protecia calitii sau structurii calitative a
subiectului protejat, adic a persoanei umane. Similar cu alte tipuri sectoriale de securitate (economic,
energetic, alimentar, bancar etc.), securitatea uman are ca scop protecia dar i amplificarea (spre deosebire
de alte forme sectoriale ale securitii) a calitilor umane, cele care contribuie la sporirea aprecierii persoanei
att a valorii sale n sine, ct i n raport cu societatea, prin prisma utilitii i importanei individului uman
pentru ali oameni, pentru progresul social, pentru pstrarea mediului nconjurtor, pentru protecia naturii i a
biosferei ntr-un context sustenabil.
BIBLIOGRAFIE:
1. Funieru, F. Societate i Securitate. n: Revista Romn de Sociologie [Bucureti], anul XXII, 2011, nr. 12,
p. 170184.
2. Hartland-Thunberg, P. National economic security: interdependence and vulnerability. In: National economic
security: perceptions, threats and policies. Frans Alphons Maria Alting von Geusau & Jacques Pelkmans (Eds.).
Tilburg: John F. Kennedy Institute, 1982, p. 47-61.
3. Maslow, A. H. A Theory of Human Motivation. In: Psychological Review, Vol. 50(4), July, 1943, p. 370-396.
4. Manolache, C. Organismul militar al Republicii Moldova. Construcia militar i securitatea statului:
Monografie. Chiinu: Biblioteca tiinific Central Andrei Lupan, 2015. 386 p.
5. Wolfers, A. Discord and collaboration: Essays on international politics. Baltimor: John Hopkins University
Press, 1962. 312 p.
6. DEX: Dicionarul explicativ al limbii romne. Bucureti: Univers enciclopedic, 1998.
7. Juc, V.; Ungureanu, V. Fundamentarea i instituionalizarea securitii naionale a Republicii Moldova:
aspecte istoriografice i teoretico-metodologice. n: Revista Militar, 2010, nr. 1, p. 14-32.
8. Buzan, B. Popoarele, statele i teama. O agend pentru studiile de securitate internaional n epoca de dup
rzboiul rece. Chiinu: Ed: Cartier, 2000. 386 p.
9. Dolghin N. et al. Riscuri i ameninri la adresa securitii Romniei. Actualitate i perspectiv. Bucureti: Ed.
UNA, 2004. 48 p.
10. Bird, T.; Croft, S. coala de la Copenhaga i securitatea european. n: Studii de Securitate. Bucureti: Ed.
Cavallioti, 2005, p. 7-28.
11. Roca, A. Algoritmi ai tranziiei: aspecte social-filozofice. Chiinu: Tipogr. AM, 2007. 268 p.
12. Buzan, B., Wver O., de Wilde J. Securitatea. Un nou cadru de analiz. Cluj-Napoca: Ed: CA Publishing,
2011. 306 p.
RESURSE INOVAIONALE PENTRU O DEZVOLTARE INTELIGENT
A LUMII SPIRITUALE I MORALE LA ELEVI
Zolotariov Elena, dr., conf. univ., USARB
The content of this article highlights a new educational concept and new strategy to facilitate students'
spiritual and moral sensitivity.The focus and mission educator moves from absolute knowledge transmission
capacity of education to learn to work with reason, to move towards the immaterial sphere, modes, forms,
methods of thinking, to view the world from within through the spiritual and moral landmarks national and
universal.
Key words: moral awareness, innovative approach, speeches smart new educational concept, new
pedagogical strategy.
INTRODUCERE
Am abordat problematica articolului n unison cu raionamentele marelui om de tiin Albert Einstein
cu privire la esena interioar (spiritual) a comportamentului uman, orientat spre valori i principii morale.
Potrivit opiniei sale, ... conduita moral nu nseamn pur i simplu exigena de a renuna anume la plcerile

188

vieii, ci mai degrab interesul plin de solicitudine pe care-l depune cineva ca s fureasc o soart mai bun
pentru toi oamenii. Pentru contiina pedagogic ideile enunate de autor scot la suprafa problema capacitii
de contientizare teoretic corect a sensului moral al faptelor ca obiectiv educaional i potenial de dezvoltare
durabil a educatului pe dimensiunea spiritual-moral. n plus, enunul dat le sugereaz cadrelor didactice
oportunitatea abordrii modului teoretic corect de interpretare a calitii morale a aciunilor fa de alt persoan
de ctre elev ca pe un indicator de performan, dar i ca criteriu pentru evaluarea impactului i rezultatelor
aplicrii demersurilor special orientate.
Remarcm aici c acest scurt comentariu al mesajului autorului citat reactualizeaz supoziiile
cercetrilor noastre personale de pn acum viznd cile viabile pentru a stimula sensibilitatea spiritual i
moral n procesele educative oficiale. Pe acest segment practicienii se confrunt cu dificulti generate de lipsa
literaturii metodice relevante i de numrul insuficient de specialiti care au competene adecvate n domeniu. E
nevoie, deci, de un suport tiinifico-metodologic i de instruire specializat pentru a putea desfura activiti de
valorificare a rezultatelor cercetrilor tiinifice, a crea practici educaionale competitive pe baza transferului
tehnologic inovaional.
n actualul cadru legislativ i normativ al proiectrii, organizrii, funcionrii i dezvoltrii sistemului de
educaie la nivel naional activitatea inovaional ca implementare a unui produs bun (sau servicii), sau proces,
metod de management nou sau semnificativ mbuntit n practica colar este oglindit ntr-o msur
insuficient. Nu sunt clar determinate mecanismele prin care sistemul educaional particip la procesele
inovaionale i competenele autoritilor decizionale de profil, n aspiraia respectrii standardelor europene [2].
Principalul scop al articolului dat este lansarea unui set de iniiative inovaionale n vederea
mbuntirii practicii de promovare a reperelor spiritual-morale, aeznd rezultatele propriilor noastre
investigaii n baza demersurilor special elaborate. Aceste iniiative ar trebui s asigure creterea gradului de
funcionalitate i competitivitatea practicilor educaionale, astfel nct s obinem o fin echilibrare a forelor
inimii i raiunii omului n cretere pe filiera dezvoltrii lumii spirituale i morale la elevi.
Ideea const n crearea ocaziilor pentru transformarea educatului ntr-un subiect etic, iar aceast
experien, potrivit filosofului Francesc Torralba expus n lucrarea sa Inteligena spiritual, i gsete
fundamentul ntr-o educaie corect a inteligenei spirituale. Deschiderea spre ceilali, spre natur, spre tot ce
exist se datoreaz puterii inteligenei spirituale, care ne face capabili de a crea o conexiune cu interiorul
celorlali. Dezvoltarea inteligenei spirituale este, n viziunea autorului citat, un element fundamental n procesul
de educaie, n protejarea omului n cretere mpotriva efectelor a ceea ce este exclusiv intelectual [6].
O analiz general a calitii nvmntului din Republica Moldova (n continuare RM) denot, n
opinia multor experi, izolarea acestuia de normele moralei i de spiritualitate. n consecin, tnra generaie de
azi rmne privat de reperele de orientare pe baza valorilor spirituale. Tineretul crete, n general, fr tendine
spirituale i idealuri, ajungnd s fie preocupat doar de atingerea succesului personal n plan material. n urma
unei asemenea atitudini sunt neglijate dimensiunile spirituale ale personalitii umane. Lsarea deoparte a
dimensiunii spirituale n procesele educative oficiale, insuficienta stimulare a sensibilitii spirituale i morale, ea
rmnnd ntr-o stare de probabilitate va avea drept consecin rmnerea noilor generaii nchise ntr-o lume
material, ngust i limitat. O educaie complet impune n mod necesar s se ia n considerare educaia
spiritual, s se acorde mai mult atenie acestei dimensiuni [6, p.250-252].
Muli ani de experien arat c coala actual (postmodern) subestimeaz importana vieii spirituale a
fiinei umane n cretere, copilul fiind lsat de unul singur n constituirea lumii spirituale i a modului de via n
ea. Drept urmare, experiena social-moral, sentimentele i contiina moral sunt procesate de elevi n mod
spontan, aceasta fiind cea mai mare provocare pentru ei. Prin urmare, sistemul de nvmnt etic actual se afl la
un nivel sczut de eficien. n rezultat, discipolii, bine informai, nu sunt mpovrai cu contiin (moral).
Un impediment este i dominanta paradigmei etico-normative, care abordeaz procesul de formare a
contiinei discipolilor ca pe un rezultat direct i imediat al aciunilor didactico-educative. Se rateaz ansa
mobilizrii mecanismelor psihologice, a condiiilor de realizare a iniiativei proprii a copilului, n scopul
asigurrii orientrii acestuia spre sensul i valorile morale. Drept consecin, apare discrepana dintre nivelul
verbal i cel real al comportamentului.
Rezolvarea problemelor amintite implic o nou abordare, noi modaliti, un nou limbaj pedagogic, dar
i o nou metod care ar putea favoriza schimbarea spre bine a situaiei. Timpul nou solicit mbuntire
efectiv a proceselor educaionale n contextul tranziiei spre o societate bazat pe cunoatere. n perspectiva
dat noile obiective strategice europene prevd asigurarea cadrului pentru o dezvoltare inteligent durabil i
incluziv [4], integrarea proceselor de cercetare, dezvoltare i inovare cu cele educaionale, oferirea unui rspuns
adecvat provocrilor societale [8].
Sistemul nvmntului din RM, aflat ntr-un proces activ de reformare, se confrunt azi cu multiple
provocri crora trebuie s le fac fa pentru a armoniza asigurarea unei creteri sustenabile a calitii educaiei
cu creterea gradului de integrare social a generaiilor de ceteni. Principalele probleme sunt legate de
insuficienta capacitate a sistemului educaional autohton de a concura pe plan global; slaba integrare pe plan
practic a elementelor triunghiului cunoaterii educaie-cercetare-inovare; insuficienta concentrare a procesului
didactic pe abordarea trans- i interdisciplinar.

189

n noile condiii ale transformrilor social-culturale, pentru comunitatea de specialiti practicieni ai rii
noastre este un imperativ s se implice n procesul de schimbare reformatoare a discursurilor n vederea
optimizrii aciunii didactico-educative, orientndu-i eforturile ctre rezultate care corespund standardelor de
performan.
Astzi, din pcate, calitatea redus a metodelor tradiionale, lipsa unui sistem de evaluare care s
stimuleze performana real, excelena se face prezent, inclusiv pe filiera educaiei spirituale i morale a
elevilor. Rezultate modeste se atest la compartimentul articole i publicaii tiinifice care s reflecte fluxul
schimbrii n domeniul dat. O dificultate ar fi numrul insuficient de specialiti care dispun de competene
adecvate pentru a putea asigura o dezvoltare inteligent durabil a lumii spirituale i morale la elevi.
DESCRIEREA OFERTEI INOVAIONALE
Pornind de la situaia naional i contextul internaional, transformarea sistemului educaional pe
termen lung n conformitate cu prevederile Codului Educaiei (2014), prin proiectul nostru oferim o alternativ
viabil nou concepie pentru a favoriza dezvoltarea echilibrat a raiunii i inimii copilului n scopul
respectrii drepturilor omului, a satisfacerii nevoilor fundamentale ale indivizilor i ale societii n ansamblul ei
i pentru a face fa provocrilor actuale i viitoare n raport cu sfera spiritual/moral a fiinei umane.
Construit la intersecia dintre mai multe tiine (filosofie, etic, psihologie, pedagogie, valeologie), noul
model educaional s-a fructificat ntr-un demers, destinat copiilor cu vrsta cuprins ntre 5-6 i 10-11-12 ani.
Obiectivul strategic: crearea condiiilor pentru intensificarea i dinamizarea dezvoltrii capacitii de
contientizare a valorii (sensului) morale a faptelor, bazat pe criteriile eseniale ale idealului universal;
stimularea autoactualizrii dorinei educabilului de a aplica modul teoretic corect de interpretare moral a
comportamentului n viaa de zi cu zi. Accentul de baz este focalizat pe formarea unei anumite activiti interne,
care s-i asigure copilului funcionarea mecanismului psihologic responsabil de o asemenea contientizare.
Pentru comunitatea tiinifico-didactic valorificarea cilor viabile, descoperite prin cercetare-inovare,
pentru a facilita contientizarea calitii morale autentice a unui act la educai este o necesitate a timpului. Ea
reiese din importana stimulrii capacitii noilor generaii de a-i controla comportamentul n condiiile vieii
marcate de accentuarea globalizrii cu care astzi ne confruntm. Se impune educarea unor persoane creative,
care ar putea nfrunta fenomenele contradictorii, complexe ale realitii, avnd libertate n luarea unei decizii, dar
i asumndu-i responsabilitatea moral pentru consecinele faptelor svrite n mod intenional.
Desigur, la vrsta precolar (ca i la cea colar mic) grupele-int ale studiului nostru copilul, de
multe ori n comportamentul su, acioneaz n mod impulsiv, fr s se gndeasc. n acelai timp, nu putem
nega importana dezvoltrii posibilitii lui de a medita asupra scopurilor i inteniilor sale. Trebuie s-i nvm
pe educai s cunoasc valoarea (sensul) moral a acestora i s poat face alegerea contient n raport cu tot ce
i nconjoar. Menirea educatorului-nvtor const n a deschide lumea spiritual i moral a fiinei umane, nu
doar n a transmite cunotinele absolute. Discipolii s se nvee a lucra cu raiunea, s se orienteze spre sfera
imaterial, modurile, formele, metodele de gndire, spre viziunea lumii dinuntru [10].
inem s menionm n contextul dat opinia cunoscutului expert n educaie Vlad Pslaru, care
consider c ... sistemul nostru educaional nu conine nici o disciplin care s-i nvee pe educai s gndeasc,
toate disciplinele colare... avnd caracter informativ reproductiv [3, p.41-44]. Este i prerea scriitorului Victor
Teleuc, afirmnd c Partea cea mai slab... din nvmntul nostru de jos i pn sus este c, pe vrute sau
nevrute, dezvoltarea gndirii este lsat n voia sorii. De ea se ocup doar entuziatii, dar nvmntul nu se
poate bizui numai pe entuziasm [5, p.305]. Prin urmare, a devenit o necesitate stringent regndirea
coninuturilor i a discursurilor pedagogice n conformitate cu solicitrile (post)modernitii, avnd ca prioritate
esenial formarea unei fiine umane libere i autonome, capabile s gndeasc i s acioneze n spiritul
responsabilitii morale.
Cunoatem paradigma educaiei tradiionale, care scoate n prima linie a discursului pedagogic
conformarea la normele, valorile de comportament etico-moral. Noua optic de dezvoltare a tehnicii pedagogice
se concentreaz pe organizarea integrat a resurselor i a sarcinilor didactice n trei direcii strategice:
Prima nsuirea cunotinelor sistemice privind valoarea moral a unui act, modul justificat din punct
de vedere social de cumpnire a faptei.
A doua stpnirea procesului integru de contientizare a aspectului moral al faptelor n baza reperelor
idealului social semnificativ.
A treia consolidarea modului de judecat moral competent, n curs de asimilare, n procesul de
analiz i evaluare a aciunilor altora i ale sale fa de cei din jur.
NOUTATEA TIINIFIC I VALOAREA TEORETICO-PRAXIOLOGIC A STUDIULUI
Noutatea const n deplasarea centrului de interes de la scopul ngust, limitat de formare a unor
elemente separate ale contiinei morale a educailor (norme, reguli, abiliti etc.) pe tabloul general al
mecanismului de contientizare a valorii morale a unui act, n baza reperelor eseniale ale idealului socialsemnificativ. Ideea este c noi lum modelul mental, argumentat din punct de vedere moral, de interaciune a
contiinei i autocontiinei i organizm, n mod special, nsuirea acestuia de ctre educai. Finalitatea
preconizat: absorbia schemei logico-verbale de judecat moral de ctre copil n calitate de instrument i
criteriu de interpretare a sensului moral al aciunilor proprii i ale celorlali i autoactivarea angajamentului liber
n realizarea practic a comportamentului adecvat.

190

Este o inovaie complex, care implic schimbri de natur conceptual n arhitectura i designul
procesului pedagogic, un nou program educaional, metode i tehnici de nvmnt, care furnizeaz energie
suplimentar pentru dezvoltarea spiritual i moral a educailor. Eforturile de integrare a componentelor
educaie-cercetare-inovare sunt direcionate spre perfecionarea procesului didactic, ca s se poat asigura un
rezultat durabil pe dimensiunea respectiv. Totui, se lucreaz nu asupra rezultatului ci asupra procesului de
dezvoltare a copilului. Prioritatea-cheie: furnizarea mijloacelor potrivite pentru ca discipolii s se poat
autoguverna inteligent pe plan moral, aa nct gndurile i aciunile lor s fie organizate, coerente, adecvate att
nevoilor interne, ct i nevoilor celor din jur.
Caracteristicile de baz ale noului demers, abordate din perspectiva transformrilor sociale actuale,
evoc opiunile noastre pentru sprijinirea copilului n a deveni un membru responsabil al societii, a-i dezvolta
un sentiment de empatie i grij pentru alii, a dobndi abiliti de a-i forma, exprima, justifica opiniile, aplicate
cu referin la sfera vieii spirituale i morale, a asculta cu respect i a manifesta toleran fa de opiniile altora.
Demersul inovator urmrete trezirea interioar a fiinei umane n devenire, accentul determinant al
metodicii fiind concentrat pe contiina de sine, pe sfera de apreciere i de moralitate a discipolilor [7]. Oferim
ocazii pentru a stimula elevii s se nvee a pune n legtur aciunile fa de ceilali cu percepia subiectiv de
bunstare interioar sau de stare de spirit negativ (vinovie, remucare) de la anticiparea emoional a
consecinelor faptelor pentru persoanele spre care sunt ndreptate reperele eseniale ale idealului moral
naional i universal.
Ceea ce face noua concepie cu adevrat important este filosofia sa strategic, fapt care ne permite s o
percepem ca pe un temei, pentru reconsiderarea poziiilor depite ale modelului tradiional i promovarea
schimbrii de calitate pe filiera educaiei spirituale i morale a elevilor. Noua abordare a conceptului educaiei
pentru cultura spiritual/moral este orientat spre capacitatea de a tri nu doar pentru binele personal, dar i al
celorlali. Sperana este c, deja din perioada primei copilrii, educaii vor deveni capabili de a contientiza
valoarea acestei reguli i i vor crea propria atitudine fa de ea, prefernd n via anume acest principiu.
Noul concept educaional ne-a permis elaborarea unei noi strategii de aranjament al procesului
pedagogic specializat. Esena acesteia const n stabilirea unei conexiuni organice a nvrii metodei
generalizate de contientizare moral a faptelor cu nvmntul emoional al elevilor. Noua tehnologie ofer
copilului posibilitatea, ca, nvnd s-i autoactualizeze inteligent emoiile, s devin capabil de a le cupla la
deciziile i comportamentul su, ntr-un mod constructiv pentru sine i pentru cei din jur, apelnd la reperele
morale universale.
Datele studiului nostru, precum i analiza surselor bibliografice, ne-au permis s considerm c
mbuntirea experienei emoionale a educabilului, n conexiune cu consolidarea modelului de judecat moral,
axat pe criteriile idealului social semnificativ, poate fi una dintre cele mai importante condiii de protecie a
sntii spirituale i morale a subiectului interaciunii cu ceilali. Aceasta pe motiv, c, n lumina viziunilor
moderne asupra inteligenei emoionale, emoiile informeaz omul despre relaiile sale cu ali oameni sau
obiecte din jur. Acest lucru este absolut important i necesar n procesul de luare a deciziilor n alegerea modului
optim de aciune pentru rezolvarea problemelor, facilitnd, pe aceast cale, capacitatea subiectului de a judeca cu
sufletul [11]. Prin urmare, noua tehnologie le ofer copiilor oportunitatea de a-i asculta vocea interioar, a-i
nelege punctele forte i punctele slabe i a recunoate valoarea i importana lor pentru semeni, rude, prieteni
viziune realist a copilului despre el nsui pe plan moral. Experimentnd capacitatea de a fi un Eu reflexiv,
mobil, copilul nva, treptat, s pun stpnire pe propriile aciuni, s se perceap pe sine nsui ca subiect al
propriei sale viei, ca subiect etic, capabil de a crea o lume a toleranei, a respectului i a compasiunii.
Pe planul tehnic aranjamentul specific al procesului didactic presupune deplasarea accentului de pe
tehnologia cu caracter informativ reproductiv spre metodologiile bazate pe nvarea prin aciune, nvarea
prin descoperire, utilizarea metodelor de gndire critic. Asemenea modele de nvare permit asigurarea
corelaiei stimulrii autonomiei gndirii i autonomiei morale a discipolilor.
Oferim metoda real pentru a stimula capacitatea discipolilor de a se forma ca persoane inteligente
din punct de vedere spiritual i moral, n contextul reperelor eseniale ale idealului universal i naional. Natura
creativ a metodei presupune schimbarea principial a coninuturilor nvrii i caracterului relaiilor
educaionale, renunarea la tradiionalul autoritarism, solicitnd de la educatorul-nvtor atitudine grijulie i
atent fa de copii.
Din perspectiva dat punem la dispoziia practicienilor instrumente mbuntite pentru a stimula
renvierea rdcinilor spiritualitii i moralitii discipolilor, opernd cu discursuri inteligente, pornind de la
practic, de la nsi viaa copilului. Precum afirma Aristotel n lucrarea sa Etica Nicomahic, fiecare dintre noi
nu trebuie s porneasc de la principiul binelui ca s ajung la fapte morale, ci, dimpotriv, trebuie s plece de la
fapte ca s ajung la principiul de bine suprem i fericire [1].
Putem nelege relevana strategiei de lung durat a noii paradigme, care permite s punem nceputul
contiinciozitii morale a omului n cretere, compatibil cu criteriile idealului moral. Prin urmare suntem
martorii unui salt important n dezvoltarea teoriei i tehnicii de predare, care creeaz posibilitatea personalului
didactic de a lucra n sensul renaterii idealurilor spirituale/morale de judecat i de comportament al subiectului
obiectiv de cea mai mare semnificaie n condiiile actuale ale democratizrii societii.

191

Modelul tradiional nu ofer copilului capacitatea de a autoactualiza caracteristicile eseniale ale


idealului n situaiile de rezolvare a problemelor etico-morale ale vieii de zi cu zi, inclusiv abilitile practice,
deprinderile i dorina discipolilor de a le pune n aplicare, ceea ce duce la atrofierea acestora. Prin urmare, nu
putem vorbi despre un grad adecvat de funcionalitate i competitivitate a demersurilor, despre stabilirea unei
corelaii a acestora cu aptitudinile psihofizice ale discipolilor. n rezultatul aplicrii demersului inovator, potrivit
datelor noastre, dimpotriv, se atest o cotitur a gndirii discipolilor spre autoactualizarea nevoii de a avea grij
nu doar de propriile necesiti i cerine, ci i de cele ale celor din jur i dezvoltarea dorinei, contientizate pe
plan intern, de a efectua aciuni specifice n acest sens [9].
N LOC DE NCHEIERE:
Timpul nou a pus coala n situaia de schimbri interioare fundamentale, care pot fi asigurate prin
activitate inovaional bine gndit. Dezvoltarea unei culturi colare favorabile inovaiei, inovarea componentei
spiritual-morale a procesului de nvmnt este o provocare i o necesitate pentru sistemul educaional n
general i personalul didactic n special.
Prin strategia nvmntului etic bazat pe contientizarea valorii morale a comportamentului i
comunicrii am reuit s contribuim la promovarea imaginii ideale a aciunii morale, a conduitei morale, n viaa
real a educailor. Aceasta le va crea premisele pentru stpnirea n viitor a modului adecvat de judecat
(raionament), ca pe un instrument i test de interpretare i evaluare a calitii morale a faptelor proprii i strine,
asigurndu-le posibilitatea autoactualizrii liberului angajament n realizarea comportamentelor adecvate.
Asimilnd, cu ajutorul inteligenei cultivate n modul corespunztor, prin exerciii speciale, modelul de
evaluare moral competent a lucrurilor, elevii vor deveni capabili s explice organizarea lor intern, s le
clasifice i s le neleag, pornind de la idealul moral cu caracter universal. Astfel, ajungem ca fiina uman n
devenire s se contopeasc, ntr-un fel sau altul, cu valoarea universal a binelui, a frumosului, adncindu-se, n
mod concret, n ceea ce este esenial n aceast lume, n viaa zilnic. n acelai timp, noua strategie pedagogic
i propune s contribuie la facilitarea unei dezvoltri inteligente spirituale/morale a elevilor, cu ansa real de a
crea un model de educaie funcional competitiv la nivel global, care s favorizeze depirea limitelor i
mbuntirea calitii educaiei noilor generaii.
BIBIBLIOGRAFIE:
1. Aristotel. Etica Nicomahic. Bucureti: Ed. IRI, 2000.
2.
Codul
Educaiei
al
Republicii
Moldova
(2014)
[Accesat
29.06.2015].
Disponibil:
http://lex.justice.md/md/355156/.
3. Pslaru, V. Valorile moral-spirituale ale educaiei. In Memoriam Mihail Terentii, Simpozion Pedagogic
Internaional (2015, Chiinu). Chiinu: Institutul de tiine ale educaiei, 2015 (Departament Editorial
Poligrafic ASEM). 338 p.
4. Strategia European 2020. [Accesat 29.06.2015]. Disponibil: ec.europa.eu/europe2020/targets/eutargets/index_ro.htm.
5. Teleuc, V. Gnd i cuvnt. Cugetri ale personalitilor din Basarabia (1940-2012). Chiinu: Ed. Epigraf,
2012. 416 p.
6. Torralba, F. Inteligena spiritual. Bucureti, 2012.
7. Zolotariov, E.A Vedea cu Inima. Manual-suport pentru promovarea reperelor spiritual-morale n practica
nvmntului modern. Vol. I-II. Chiinu: SA Tipografia reclama, 2014. 400 p. (Biblioteca Meterul
Manole).
8. European Comission Horizon 2020 The Framework Programme for Research and Innovation. COM (2011),
808 final, p. 6-7.
9. , . . . Chiinu:
SA Tipografia Reclama, 2012. 344 p. (Biblioteca Meterul Manole).
10. , . . : Fclia, 15 mai 2015, p. 6.
11. . , , / . .. , .. .
: , 2004, . 29-36.
UNELE PARTICULARITI DE PRACTICARE A SPORTULUI
DE CTRE PERSOANELE VRSTNICE
Morari Alexandru, lector superior al Catedrei de tiine ale educaiei, eful Seciei de educaie fizic,
USARB
It is considered that old age is a disease that can be prevented and treated. Sport, physical exercise is a
natural, effective and less expensive medicine. Scientists recommend sport until deep old age to maintain health
in good condition.
Key words: sport events, physical exercises, sport inventory.
Organizaia Mondial a Sntii i Federaia Internaional de medicin sportiv identific
persoanele vrstnice ca fiind cele ce depesc 50 de ani. Acest punct de vedere prezint un interes att practic,

192

ct i teoretic, el regsindu-se n atributele medicinii moderne preventive, care n ceea ce privete btrneea
susine c profilaxia trebuie s nceap la o vrst ct mai timpurie.
Dup vrsta de 50 de ani realitile vieii contemporane atest faptul c ncepe s se manifeste mai
frecvent efectele mbtrnirii celulare (la brbai - glanda prostatic). Marea majoritate a organelor din corpul
uman sufer transformri involutive att pe plan cantitativ, ct i calitativ. Aceasta se refer la dimensiunile unor
organe vitale, lsnd la o parte aspectele patologice, la numrul de celule active din organism (neuroni, nefroni,
hepatocite etc.), la ntreaga morfologie i fiziologie uman n totalitate. Oamenii de tiin consider c la baza
acestor modificri stau n principal factori de mediu i modul de via (sedentarism, automatizare, erori
alimentare etc.), care ar grbi instalarea acestor procese nefavorabile i, n acelai timp, ar diminua capacitatea
de munc a omului, nsi calitatea vieii. De aceea, patologii consider btrneea drept o boal, nu neaprat a
vrstelor foarte naintate, care trebuie prevenit i tratat la momentul oportun.
n aceast ordine de idei, sportul i exerciiile fizice, joac un rol preventiv n ndeprtarea apariiei
unor procese negative ce pot aprea la aceast vrst, n meninerea unei snti i a unei capaciti de munc
adecvate, n corectarea unor stri defavorabile ale organismului sau n asigurarea recreerii dup munc,
evitndu-se astfel oboseala. Prin urmare, sportul la aceast vrst i mai trziu are dou valene principale: cea
de ntreinere, care se constituie i ntr-una profilactic, i cea de corectare, de compensare a unor neajunsuri
morfologice i funcionale.
Pentru ocrotirea sntii omului modern i se recomand, ca dup 50 de ani s se efectueze anual un
control medical complex, care s cuprind n mod obligator: un examen clinic general, pe aparate i sisteme,
radiologic cardio-pulmonar, un examen de laborator (hematologic, biochimic, serologic), un examen
neuropsihic, cardiologic incluznd frecvena cardiac, presiunea sngelui (sistolic i diastolic) i
electrocardiogram, n repaus i dup un efort standard efectuat n laborator la bicicleta ergometric (deci unde
putem stabili cu destul exactitate ncrctura prestat, limita de tolerabilitate la efort a sistemului cardiovascular
i bineneles timpul de revenire a acestor parametri). Chiar dac pentru unii pare exagerat un examen de acest
tip anual, specialitii susin c este un minim pe care fiina uman l merit cu prisosin. Acest examen pe lng
stabilirea nivelului sanogenetic are avantajul, c ne permite o dirijare obiectiv, tiinific a activitilor sportive
la aceast vrst.
Exerciiile sau probele de vitez, care reclam o mare rapiditate n execuie, deci un efort maximal,
solicitant pentru organism, nu convin persoanelor vrstnice. Att nivelul solicitrii sistemului cardiorespirator,
ct i cel neuromuscular streseaz, n mare msur, organismul persoanelor n vrst, fapt ce face ca asemenea
eforturi (de exemplu, alergrile de vitez pe distane scurte, sriturile i aruncrile, care reclam o anumit vitez
de lansare, jocurile sportive practicate n vitez etc.) s nu fie recomandate la aceast vrst, fiind periculoase
pentru sntate. n ceea ce privete exerciiile i sporturile care solicit rezisten ele antreneaz n principal
sistemul cardiorespirator i metabolismul, avnd un caracter mediu, cel mult sub-maximal n ceea ce privete
intensitatea efortului sau tipul de solicitare biologic. Sporturile din aceast categorie (alergri pe distane mediilungi, notul, mersul pe biciclet, unele jocuri sportive) reprezint mijlocul cel mai eficient de antrenament
cardiorespirator, cu o singur condiie, s nu fie solicitant (frecvena cardiac s nu depeasc 120-130
pulsaii/min), iar refacerea dup efort s se adreseze, cu precdere, funciilor cardiorespiratorii. Este genul de
efort cel mai potrivit din punct de vedere biologic pentru persoanele vrstnice. Exerciiile i sporturile bazate pe
for (haltere, aruncri, lupte etc.) sunt contraindicate la aceast categorie de vrst.
Referitor la exerciiile de ndemnare, coordonare neuromotric, exerciii care reclam o mare solicitare
din partea sistemului nervos, de asemenea, nu par a fi cele mai potrivite la aceast vrst, putnd fi uneori
stresante pentru sistemul nervos. n schimb, exerciiile, sporturile care acioneaz asupra mobilitii articulare,
calitate ce are tendina s se limiteze, sunt binevenite la oamenii vrstnici.
Dup aceste considerente cu caracter fiziologic, ne vom referi n continuare la ncadrarea sportului la
vrstnici, care are dou direcii: sportul pentru toi i sportul pentru sntate. Sportul pentru toi, activitate cu
profunde implicaii preventive, cu scop de recreere dup munc, de ntreinere i de meninere a sntii depinde
de faptul dac cel n cauz a practicat n tineree vreun sport (chiar de competiie) sau nu. n caz afirmativ se
recomand s practice aceast form, bineneles dac nu sunt contraindicaii medicale i n orice caz la alt nivel
de intensitate i volum (nu competiional). Din aceast categorie de activiti fizice i sportive sunt apreciate azi
ca cele mai eficiente urmtoarele: gimnastica igienic de nviorare, de antrenare, care dureaz 5-10 minute,
punndu-se accentul pe respiraie, pe mobilitatea articular, pe tonifierea muchilor (Bogomole spunea c, ziua
omului trebuie s nceap i s se ncheie cu gimnastic igienic), efectuat dimineaa dup deteptare, ntr-o
ncpere aerisit. Acelai moment de gimnastic, de ast dat cu caracter de relaxare, se poate introduce seara la
culcare, dup igiena personal i urmrete s induc o stare de relaxare neuromuscular, favoriznd astfel un
somn linititor, odihnitor, reparator.
Mersul pe jos i alergarea n ritm stabil (de 2 ori pe sptmn, cte 15-20 minute) reprezint
mijloacele cele mai eficiente n cadrul sportului pentru toi la vrst naintat, urmate de o refacere adecvat.
Mersul pe biciclet zilnic, constituie o activitate sportiv cu mari valene sanogenetice, care se nscrie
alturi de mers i alergare printre mijloacele cele mai indicate acestei vrste.
notul, acolo unde sunt condiii (bazine de not), completeaz n mod fericit acest ptrat al sporturilor
zise aerobe, cele care antreneaz inima i c irc u la ia.

193

Desigur c trebuie s lum n calcul eventualele contraindicaii, temporare sau definitive, pe motive de
boal ori contraindicaiile generale, legate de boli febrile ocazionale, traumatisme, care reclam imobilizri n
aparate gipsate etc.
Unele sporturi, dac au fost practicate n trecut i exist motivaie i condiii s fie continuate, pot fi
practicate, bineneles nu la nivel competiional, ci de plcere, recreativ.
Dac ne referim la sporturile de iarn la vrstnici, noi nu suntem de prere, c ele se nscriu, n
principiu, printre mijloace sanogenetice ale educaiei fizice i sportului de mas, pentru toi. Temperatura
sczut, frigul, zpada i gheaa pot constitui factori stresani, n special pentru inim, n condiii de efort fizic,
motiv pentru care apreciem c sporturile de iarn pot fi practicate de acele persoane n vrst, sntoase, care au
activat ca sportivi n aceste discipline sportive (schi, sanie, patinaj, etc.).
Un capitol aparte la persoanele vrstnice l constituie sportul pentru sntate, deci sportul practicat ca
urmare a unor indicaii medicale, pentru corectarea, tratarea sau recuperarea unor tulburri funcionale sau
organice. Avem de a face cu un mijloc al culturii fizice medicale (kinetoterapia prin sport). Practicarea sportului
i a exerciiilor fizice constituie un medicament, puin costisitor, natural i eficace.
n literatura de specialitate au fost prezentate unele detalii tehnice i metodologice privind principalele
indicaii i contraindicaii, dar i faptul c o asemenea terapie se supune regulilor medicale.
Valenele funcionale sau profilactice ale sportului se manifest nu numai la nivelul marilor sisteme i
aparate ale corpului omenesc, ci i la nivelul sistemului imunitar al organismului, cel care ne asigur o oarecare
protecie asupra unor ageni stresani sau patologici din mediul ambiant.
Practicarea sistematic a sportului, a exerciiilor fizice stimuleaz sistemul imunitar, crescnd astfel
rezistena nespecific general, factor extrem de important la persoanele vrstnice, la care se considera c
naintarea n vrst ar afecta i sistemul imunitar n sens negativ (depresiv). Ca atare, clirea organismului prin
sportul de mas, ar avea la baz i consolidarea sistemului imunitar, calitate ce difereniaz att pe vechii
practicani ai sportului fa de repracticani, ct i pe actualii practicani, vrstnici fa de actualii nepracticani,
indiferent dac n trecut au practicat sau nu sportul.
Din cele expuse anterior rezult, c persoanele n vrst, chiar dac nu au practicat sportul n tineree,
s-i includ n regimul de via igienic un minimum de timp pentru micare (sport), pentru clire, pentru
sntate, pentru recreere dup munc, pentru randament crescut n munc, pentru promovarea bunei stri fizice
i mentale, a sntii
Model de program sptmnal de practicare a sportului i a exerciiilor fizice:
Zilnic: gimnastica de nviorare, dimineaa 10-15 min; gimnastica de relaxare, seara 8-10 min;
Luni : mers pe jos nu mai puin de - 30 min; jocuri sportive - 60 min;
Mari : alergare 15-20 min; not 30 min.
Miercuri : mers cu bicicleta 60 min.
Joi : jocuri sportive (tenis de cmp, volei, badminton).
Vineri : alergare 20 min.;
Smbat : not 30 min;
Duminic: zi de odihn.
BIBLIOGRAFIE:
1. Demeter, A.; Dragan, I. Sport i sntate. Bucureti: Ed. Sport-turism, 1990.
2. Dragan, I. Sntatea o performan? Bucureti: Ed. Albatros, 1980.
3. Gheorghe, D. Sntate prin sport pe nelesul fiecruia. Bucureti: FRSPT, 1997.
4. Triboi, V. Metodologia sportului pentru toi: (curs universitar). Chiinu: USEFSA, 2012.
EDUCAREA CALITILOR INDIVIDUALE DE PREGTIRE TEHNIC I TACTIC CU
STUDENII LA ANTRENAMENTUL DE FOTBAL
Ceban Ion, lector universitar al Catedrei de tiine ale educaiei, Secia de educaie fizic USARB
Football is Sport sports is the mirage sport that combines strength, intelligence, courage; boldness and
elegance of movement, attracting around his children from the earliest age, that the trying to imitate the idols of
the arena, and remain thrilled and happy that they managed to discover beauties football game. Today football
activity is organized and conducted under the guidance and coordination football federation that ensures players
on a program, and we adjusted to the current game system. They are beautiful, but more important is that they
are effective.
Key words: football, technical exercies, tactical, combinations, sport inventory.
Astzi activitatea fotbalistic este organizat i se desfoar sub ndrumarea i coordonarea Federaiei
de fotbal, care asigur pregtirea juctorilor pe baza unui program i a sistemului adaptat specificului jocului
actual. Putem afirma cu certitudine c echipele profesionale joac un rol important n promovarea talentelor,
ns, trebuie s recunoatem c majoritatea vedetelor de azi i-au nceput cariera n echipe de amatori, copii i
juniori. Acest fapt scoate la iveal un lucru evident toate echipele de copii i juniori reprezint un loc sigur de
lansare a talentelor i juctorilor promitori. Anume aici este concentrat astzi un potenial mare pentru un

194

fotbal frumos i de succes al zilei de mine [6]. Din aceste considerente, nici o ar fotbalistic nu-i poate
permite s ignore tendinele fotbalului internaional sau s foloseasc mult timp concepiile nvechite, indiferent
de faptul ct de bune ele pot fi. Tendinele n cauz reprezint linii noi de dezvoltare a fotbalului naional i
mondial. Ele sunt frumoase, dar, cu mult mai important, este faptul c ele sunt eficiente.
Prin pregtire tehnic nelegem o multitudine de elemente efectuate cu picioarele avnd ca scop
controlarea mingii n diferite situaii de joc. Tehnica jocului de fotbal are anumite particularitii care o
difereniaz de tehnica celorlalte jocuri sportive. Execuiile tehnici cu picioarele sunt mai dificile, deoarece n
evoluia filogenetic s-a dezvoltat mai mult ndemnarea minilor [7].
Echipa care deine balonul, va avansa ctre poarta advers i va folosi: conducerea mingii, pasa,
preluarea, driblingul, utul la poart, demarcarea, iar echipa care nu deine balonul va cuta s rectige mingea
i, n acelai timp, s-i ncetineasc adversarul. Principalele aciuni vor fi urmtoarele: marcaj, intercepie,
deposedare, tatonare.
n timpul antrenamentului sportiv, studenii dau dovad de o atenie sczut la calitatea execuiei
tehnicii avnd dificulti, deoarece coordonarea micrilor nu le d posibilitatea de a executa. Coordonarea este
baza tuturor micrilor, dezvoltarea ei poate fi posibil numai cu ajutorul unor exerciii speciale cum ar fi:
srituri cu coarda; alergare prin obstacole; sriturile de pe un picior pe altul n diferite direcii; notul; dansurile
ritmice [4].
Pentru ajunge un bun juctor de fotbal, antrenamentul trebuie s fie nceput de la o vrst fraged (5-6
ani). Unde coordonarea micrilor i tehnica, va fi dezvoltat pe tot parcursul perioadei de practicare a acestui
gen de sport.
n fotbal pregtirea tehnic este o component de baz a antrenamentul sportiv i reprezint o activitate
de nsuire, consolidare i perfecionare a procedeelor specifice manevrrii mingii i deplasrii juctorilor n
teren. O pregtire tehnic de calitate presupune continuitate i progresivitate precum i aplicarea unor noi metode
de lucru corespunztoare nivelului de vrst i pregtire fizic a studenilor. n pregtirea fizic studenii trebuie
s-i dezvolte calitile: vitez, rezisten, for, ndemnare [2].
Pregtirea tactic reprezint una din componentele cele mai dinamice ale antrenamentului fiind
condiionat de pregtirea fizic, tehnic, psihic i teoretic. Prin intermediul ei studenii i nsuesc
modalitile organizrii, pregtirii i desfurrii aciunilor de atac i de aprare potrivit unei anumite concepii
de joc. Pregtirea tactic presupune:
1. Pregtirea logic i eficient a calitilor celor 11 juctori din echip.
2. Strategia de aprare i de atac realizat pe baza unor mijloace nsuite anterior n antrenament sau a unora
create spontan n joc.
3. Disciplin la ndeplinirea sarcinilor de joc, n relaii cu partenerii i cu adversarii.
n decursul jocului studentul i pune n practic toate calitile i deprinderile biometrice n confruntare
cu adversarul din teren. Exist 3 tipuri de tactic: atac, contra-atac, aprare.
1. Tactica de atac este folosit mpotriva echipei care are o pregtire fizic i tehnic mai slab.
2. Tactica de contra-atac este folosit n momentul cnd echipa advers se afl n jumtate de teren a
adversarului i prin greelile lor tehnice poate fi prins la contra-atac.
3. Tactica de aprare se folosete mpotriva echipelor care au o pregtire tehnic, fizic i psihic mai bun [1,
p.166].
Actul tactic realizat n joc are urmtoarele faze: perceperea situaiilor; analiza situaiilor; starea
psihic; starea motric.
Perceperile tacticii constau, de fapt, n capacitatea studentului de a aplica eficient, n situaiile variate,
formele de deplasare n teren i poziia corect fa de adversar cnd el este cu mingea. Antrenorul pune n
aplicare mai multe feluri de tactic: a) clasic 442 (4 aprtori, 4 mijlocai, 2 atacani); b) britanic 4231 (4
aprtori, 2 mijlocai la nchidere, 3 mijlocai ofensivi, 1 atacant); c) romb/modern 433 (4 aprtori, 3
mijlocai, 3 atacani) [1].
Un rol foarte important n timpul jocului de fotbal l au factorii psihologici. Avnd o pregtire
psihologic bun, juctorii n teren pot trece uor de perioadele n care echipa este condus de adversar avnd
putere de a juca ofensiv i de a nscrie mai multe goluri n poarta advers. Un antrenor bun poate ajuta echipa n
situaiile grele ale jocului dndu-le indicaiile necesare i utile de pe marginea terenului astfel, nct emoiile sale
s nu fie artate pe fa ca fiecare faz de joc s fie analizat corect i linitit.
Studenii notri au o prestare bun n cadrul petrecerii jocului de fotbal la nivel municipal participnd la
diverse competiii i jocuri amicale, ns obstacolele cele mai mari le ntlnesc n situaiile cnd adversarii sunt
mai tehnici i au o vitez mai bun de micare. Pentru a depi aceste dificulti este nevoie de o perioad mai
lung de pregtire a procesului de antrenament, astfel nct educaia fizic s aib o corelaie ct mai aproape de
fotbal. n timpul leciei de educaie fizic la universitate studenii trebuie s se ocupe ct mai mult cu dezvoltarea
calitilor fizice i jocurilor sportive, astfel nct educaia fizic s fie nu numai puin de 3 ori pe sptmn.
Exerciiile de stretching, dac sunt executate corect, vor mbunti mobilitatea, vor ajuta la refacerea n
urma efortului i vor mbunti calitatea alergrii. Un stretching incorect poate duce la autoaccidentare sau mai
grav la o supra ntinderii de muchi. Exerciiile speciale de ntindere i relaxare a muchilor vor dura 10-20 de
min., fiind supravegheate de antrenor sau de medicul sportiv. Aceste exerciii sunt: a) fandrile nainte i lateral;

195

b) stnd cu picioarele mult deprtate (sfoara); c) stnd culcat pe spate picioarele ridicate n sus vrfurile la degete
ntinse; d) stnd culcat pe abdomen piciorul drept deprtat mult ajungnd cu genunchiul la umrul drept; e) stnd
culcat pe spate ridicm abdomenul n sus i piciorul drept peste piciorul stng [5].
O selectare mai ampl a tinerilor fotbaliti i oferirea condiiilor bune de antrenament ar aduce rezultate
nalte n cadrul competiiilor la nivel de ar i plasarea ntre locurile de frunte a celor mai bune echipe.
n timpul efortului situaia cea mai favorabil este aceea n care vasele sangvine care alimenteaz
muchii angrenai n efort, se relaxeaz i se lrgesc, astfel alimenteaz creierul cu o cantitate bogat de oxigen i
organismul devine mai puternic acumulnd o imunitate de durat.
Datorit unei discipline n teren i realizarea obiectivului pus de antrenor va duce dup sine numai
rezultate bune. O inteligen de joc logic, flexibil ncoroneaz fotbalul ca fiind cel mai popular i mai iubit gen
de sport pe ntreaga planet.
BIBLIOGRAFIE:
1. Balaj, C. Pregtirea tactic. Bucureti: Ed. Sport-turism, 1997.
2. Cojocaru, V. Curs de fotbal specializare, vol. I. Bucureti: Ed. ANEFS, 1994.
3. Crciun, N.; Gavrilov, V. Unele aspecte psihologice ale juctorilor de fotbal, Chiinu: CEP USM, 2003.
4. Dragnea, A. Antrenamentul sportiv. Bucureti: Ed. Didactic i pedagogic,1996.
5. Dragnea, A.; Bota, A. Teoria activitilor motrice. Bucureti: Ed. Didactic i Pedagogic, 1999.
6. Epuran, M.; Horton, E. Mecanisme de influenare a comportamentului n fotbal. Bucureti: Ed. Sport, 2007.
7. Grigorescu, N.; Avram, V. Prestaia tactic a juctorilor de fotbal n terenul de joc. Chiinu: USEFS, 2012.
8. , .. . : , 1977.
CARACTERISTICILE I OBIECTIVELE DE NVARE A JOCULUI DE VOLEI
Butnaru Roman, lector univ. al Catedrei de tiine ale educaiei,Secia de educaie fizic USARB
In evolution, the game of volleyball has seen constant concern and substantial increase in yield actors,
both by enriching the content of shares of baggage te hnicotactic and by streamlining the execution processes,
resorting to all the opportunities and gains related sciences: biomechanics, physics geometry, computer. In this
context, the course tries to achieve improved arsenal of information and teaching techniques, which can select
those that offer the safest chances of achieving the goals in concrete terms in which it operates. In higher
education Physical Education and Sport, Volleyball is a fundamental discipline included in the curriculum, with
a particular role in acquiring knowledge.
Key words: volleyball, physical exercises, technical.
Obiectivele cursului de volei au ca scop s completeze cunotinele viitorului profesor cu un set de
noiuni teoretice, care s fie transformate n abiliti practice. Asimilarea noiunilor practice de baz i
metodologice, de aplicare a elementelor i procedeelor tehnice de ctre studeni are o importan deosebit,
avnd n vedere c voleiul este o disciplin de baz n coal, cu o activitate practic a elevilor i, de asemenea,
este una dintre probele olimpice. Pentru studeni, valorificarea cunotinelor de specialitate se concretizeaz prin
formarea profilului de executant i demonstrant la disciplina volei, dar i de a pregti viitori elevi n practicarea
i nelegerea acestei discipline. Iniierea/fixarea deprinderilor specifice jocului de volei (aciunile de baz) i
nsuirea tacticii de joc specifice modelului de joc specific voleiului.
Voleiul este un joc sportiv n care cele dou echipe au posibilitatea de a aciona cu mna liber asupra
mingii, sub form de lovire sau respingere, fr a fi mpiedicai de ctre adversari n timpul desfurrii fazei.
Voleiul este un joc practicat de mai muli sportivi (6), reunii ntr-o echip, ceea ce-i confer caracterul de joc
colectiv i care prin aciuni individuale i colective urmresc ctigarea punctului i a serviciului sau ctigarea
punctului prin pstrarea serviciului. Echipele sunt desprite de fileu, iar n teren fiecare juctor, dup terminarea
unei faze de joc, schimb zonele ntr-o rotaie specific strict (n sensul acelor de ceasornic), impus prin
regulament, ceea ce a dus la formarea unor juctori complei i compleci.
Plecnd de la descrierea voleiului de la nceputurile sale to volley the ball back and forth over the net,
gsim o alt caracteristic, respingerea mingii, neexistnd momentul de inere a mingii. Prin urmare, n volei
timpul de reacie este scurt, la fel momentul de gndire i de rspuns. Aceasta duce la o ndemnare deosebit,
datorit faptului c juctorii trebuie s transmit mingea precis partenerului de joc. Toate acestea pe un suport de
deprinderi motrice de baz, manifestate ntr-o combinaie specific, datorate faptului c deplasrile sunt scurte,
cu multe schimbri de direcie i efectuate ntr-un spaiu restrns, fr a reine mingea i transmind-o prin
respingere. Manifestarea ndemnrii n cadrul mijloacelor tehnico-tactice, trebuie s se fac cu o anumit vitez
ce trebuie s aib la baz for i rezisten. O alt caracteristic a acestui joc este faptul c n organizarea lui
ntr-un teren nu sunt permise mai mult de trei lovituri a mingii sau patru lovituri (cnd mingea atinge blocajul,
juctorii echipei respective mai au dreptul la nc trei lovituri), fa de alte jocuri unde trecerea din atac n
aprare este condiionat de timp. Voleiul se joac pe puncte i seturi, iar nvingtoarea setului este aceea care a
acumulat prima 25 de puncte sau diferen de 2 puncte (26-24 etc.) n primele IV seturi iar n setul V, 15 puncte
sau diferen de 2 puncte i apoi ctigtoarea meciului este aceea care i-a trecut n cont trei seturi ctigate.

196

Punctele se realizeaz n sistemul TIE-BREAK, fiecare aciune ctigat constituie un punct. Astfel, durata unui
joc variaz ntre 50-120 min. Rezumnd cele prezentate, principalele caracteristici ale jocului de volei ar fi:
1. Accesibilitatea este reprezentat prin numr redus de reguli, de elemente i procedee tehnice, tactice; se poate
practica la orice vrst; cere un echipament sumar i puin costisitor; necesit instalaii puine (2 stlpi, un fileu);
o minge.
2. Variabilitatea la efort juctorii necesit o pregtire multilateral datorit numrului mare srituri, prin
deplasri rapide i scurte, prin procedee acrobatice efectuate pentru recuperarea mingilor n aprare.
3. Obligativitatea rotaiei.
4. Mingea nu trebuie s cad n terenul propriu i trebuie trimis peste fileu prin maxim trei lovituri sau patru n
anumite condiii prevzute de regulament [a se vedea, 3].
Voleiul este unul dintre cele mai populare sporturi, att din punct de vedere competitiv, ct i
recreaional, fiind rapid, senzaional, cu aciuni explozive. El este alctuit din mai multe elemente suprapuse, a
cror complementaritate l fac unic printre celelalte sporturi:
Obiectivele i competenele unitii de nvare: cunoaterea suprafeei de joc; cunoaterea
dimensiunilor zonelor; cunoaterea fileului i accesoriilor sale; cunoaterea poziiilor n teren.
Competenele unitii de nvare: studenii se vor familiariza cu o terminologie specific activitii de
predare; asimilarea cunotinelor, pentru atingerea obiectivelor specifice voleiului; dezvoltarea unor abiliti
practice, care s-i confere calitatea de bun demonstrant n faa elevilor; deprinderea cu o profesie de top sau
executiv ce presupune un ansamblu de tehnici, de priceperi, abiliti i un sistem de relaii intra i
interorganizaional; contientizarea studentului n ce privete faptul c se pregtete pentru o profesie, o meserie;
dezvoltarea unor abilitai de a conduce oameni, a gestiona resurse, avnd drept scop realizarea n comun a
obiectivelor generale ale educaiei fizice i sportului; arta de a te descurca ntr-un context nou, dat de baza
material a scolii, care difer de la una la alta; dezvoltarea unor abiliti de comunicare, conducere, planificare,
control i evaluare; dezvoltarea unor abiliti de adaptare a activitii n funcie de nevoile i dorinele elevilor.
TEHNICA N JOCUL DE VOLEI
Tehnica reprezint ansamblul de procedee specifice ca form i coninut folosite n scopul practicrii cu
randament maxim a unui joc sportiv, n concordan cu cerinele de joc competiional. Am putea concluziona c
tehnica jocului de volei reprezint totalitatea aciunilor motrice, aciclice, bazate pe percepii spaio-temporale
specifice acestui joc, nsuite corect i raional n vederea obinerii unor rezultate cu eficien maxim n
competiii. Ea este ntr-un proces permanent de perfecionare i creativitate, ajungnd astzi la posibilitatea ca
mingea s fie trimis de ctre juctor acolo unde dorete. La evoluia tehnicii a stat necesitatea, ca fiecare juctor
sau antrenor, s rezolve mai eficient o situaie de joc aprut, datorit luptei permanente dintre atac i aprare, n
ansamblu, i n special dintre atacant i aprtor. Toate acestea la putem pune pe seama dorinei individului de a
se autodepi plecnd de la succesiunea fazelor (structuri) de joc, prin urmare, de la alternana structurilor
jocului, putem vorbi de o sistematizarea a elementelor i procedeelor tehnice. Pentru c jocul se raporteaz
mereu la cele dou compartimente ale lui, anume atacul i aprarea, vom face n continuare o sistematizare a
tehnicii jocului de volei n funcie de cele dou compartimente, care alterneaz mereu.
OBIECTIVELE I COMPETENELE UNITII DE NVARE A TEHNICII IN JOCUL DE VOLEI