Sunteți pe pagina 1din 299


CRONICILE PMNTULUI conin urmtoarele cri :

2007 by Zecharia Sitchin


Prefa 7
1. Pietre de stele 9
2. Soarta are 12 staii 27
3. Generaii divine 48
4. ntre soart i destin 68
5. Moarte i nviere 90
6. Conexiunea cosmic: ADN 112
7. Cunotine secrete, texte sacre 131
8. Coduri ascunse, numere mistice 158

9. Profeia: Scrieri din trecut 184

10. Centrul Pmntului 203
11. Un timp al profeiei 237
12. Dumnezeul care s-a ntors din cer 265
Epilog 281

Seriile Cronicile Pmntului, cititorul i poate aminti,
ncep cu cercetarea mea cu privire la un fragment din Biblie
referitor la Nefilim. Cutarea s-a extins atunci n mitologie,
arheologie, lingvistic, astronomie, teologie... Ea a condus la
o serie de cri n care textele vechi i informaiile au fost
corelate cu Biblia ebraic i apoi combinate cu descoperirile
tiinei moderne. Rezultatul a fost o nou apreciere fa de
Biblie, neleas ca un compendiu ce are la baz tiina i o
nelegere a faptului c n antichitate - la nceputuri - Religia
era tiin, iar tiina era Religie.
Dei a trecut mai puin de un deceniu de la prima
publicare a Codului Cosmic, progresele tiinifice n genetic,
care au avut loc chiar i n acel scurt interval de timp, nu au
avut nimic revoluionar. Schimbarea paradigmelor s-a produs
dincolo de biologie sau medicin, ctre tiin n general; spre
surprinderea multora, ceea ce s-a gsit pe Pmnt pare s
corespund cu ceea ce s-a descoperit n spaiu de ctre
misiunile spaiale i de ctre diferite telescoape. n mod
neateptat, filosofii i teologii s-au alturat valului
schimbrii; brusc, o teorie a Inteligenei artificiale a aprut
pentru a contesta Evoluia.
Dar sunt tiina i Religia ireconciliabile sau progresele
tiinifice ne conduc napoi ctre vremurile antice cnd cele

dou erau pri ale aceleiai monede? Codul Cosmic reafirm

justeea povestirii Creaiei biblice din Genez i sursa
acesteia, scrierea sumerian Epopeea Creaiei i confirm
teoria cosmologic sumerian potrivit creia Smna Vieii,
adus n sistemul nostru solar de ctre un invadator din
spaiu numit Nibiru, a fost ntradevr rspndit pe Pmnt
n timpul unei ciocniri astrale. Ca produs al acelor germeni,
noi suntem, aadar, parte a Codului Cosmic.
Una dintre concluziile remarcabile ale crii - aceea c
alfabetul ebraic cu 22 de litere fusese format s imite cei 22
de cromozomi ADN, - structura verbal din trei litere
seamn cu cei trei aminoacizi ai nucleonului care alctuiesc
proteinele - ofer noi perspective nu doar n lingvistic, ci i
n teologie. A dat natere la dezvoltarea contiinei c zeii care
ne-au creat erau doar mesageri din spaiu, legtura noastr
cu cosmosul.
A fost nevoie de un rzboi - unul cumplit i sngeros pentru a aduce la lumin, acum cteva decenii, unul dintre
cele mai enigmatice locuri antice din Orientul Mijlociu. Dac
nu cel mai enigmatic, cu siguran este cel mai uimitor, i
care i are originea cu certitudine n perioada marii
antichiti. Este o structur unic printre ruinele marilor
civilizaii care s-au dezvoltat n spaiul Orientului Mijlociu n
mileniul trecut; o structur asemntoare nu s-a descoperit
aici, cel puin pn acum. Cea mai apropiat structur
similar se afl la o deprtare de mii de mile, peste mri i pe
alte continente; ce ne vine cel mai mult n minte este
construcia Stonehenge n ndeprtata Anglie.
Acolo, pe un cmp btut de vnturi din Anglia, la aproape

80 de mile de sud-estul Londrei, cercurile cu megalii

impresionani formeaz cel mai important monument
preistoric din ntreaga Marea Britanic. Un semicerc cu pietre
uriae verticale, ale cror vrfuri au fost unite prin praguri
de piatr, cuprinde n interior un semicerc din pietre
verticale mai mici care nconjoar la rndul su dou cercuri
cu ali megalii. Muli dintre cei care au vizitat locul cred c
doar civa dintre megalii au rmas n picioare, iar ceilali sau prbuit sau au disprut cumva de acolo. Dar savanii i
cercettorii au fost n msur s realizeze configuraia
cercurilor din interiorul cercurilor (Fig. 1, care arat megaliii
rmai n picioare) i s observe gurile unde celelalte dou
cercuri - de pietre sau probabil de rui din lemn - au
existat cndva, n perioada timpurie a construciei

Semicercurile n form de potcoav i un mare megalit

prbuit, numit Piatra de Sacrificiu, indic fr dubiu faptul
c structura a fost orientat pe o ax nord est-sud-vest.
Ele indic spre o linie care trece printre dou pietre

verticale printr-o lung alee ce duce ctre aa numita Piatr

Heel (Fig. 2).

Toate studiile arat c aliniamentul a fost folosit n scopuri

astronomice; la nceput, n cca. 2900 .Chr. (cu mai mult sau
mai puin de un secol) ele au fost direcionate ctre rsrit n
ziua solstiiului de var; apoi au fost reorientate n cca. anul
2000 .Chr. i din nou n cca. 1550 .Chr., indicnd rsritul
n ziua solstiiului de var din acele timpuri (Fig.3).

Unul dintre cele mai scurte, dar i cumplite rzboaie

recente din Orientul Mijlociu a fost rzboiul de ase zile din
1967, cnd armata Israelului, asediat i nconjurat, a
nfrnt armatele Egiptului, Siriei i Iordaniei i a cucerit
Peninsula Sinai, Malul Vestic al Iordanului i nlimile
n anii urmtori, arheologii israelieni au fcut cercetri i
spturi arheologice extinse n toate acele zone, aducnd la
lumin aezri din vremurile neoliticului timpuriu trecnd
prin perioada biblic i pn la perioadele greac, roman i
bizantin. Totui, nicieri nu a fost mai mare surpriza dect
pe platoul gol n mare parte i locuit sporadic, numit
nlimile Golan; nu doar pentru c s-a descoperit c a fost o
zon cultivat i locuit activ din cele mai vechi timpuri; nu
doar pentru c erau acolo rmie ale unor aezri datate
cu cteva milenii naintea erei noastre (.Chr).
Practic, n mijlocul unui spaiu nelocuit, pe un cmp
deschis (care era folosit de ctre armata israelian pentru
exerciii de artilerie), stlpii de piatr dispui n cercuri s-au
dovedit a fi - privite de sus - un Stonehenge al Orientului

Apropiat (Fig. 4).

Structura unic este alctuit din cteva cercuri de piatr
concentrice, trei dintre ele perfect circulare, iar dou dintre
ele formnd semicercuri sau potcoave. Cercul exterior are o
circumferin de o treime de mil, iar celelalte cercuri devin
tot mai mici cu ct se apropie de centrul structurii.
Pereii celor trei cercuri principale de piatr se nal pn
la opt picioare1 sau mai mult, iar limea lor depete 10
picioare2. Ele au fost construite din cmpuri de piatr variind
ca dimensiune de la unele mici pn la unele megalitice, care
cntresc cinci tone sau chiar mai mult. n cteva locuri,
pereii circulari concentrici sunt legai ntre ei prin perei
radiali mai nguti dar de aceeai nlime cu a pereilor
circulari. Chiar n centrul structurii se ridica o uria
grmad bine delimitat de pietre, unele msurnd peste 65
de picioare3.
Dincolo de forma sa unic, ea este, de departe, una dintre

8 picioare = 2,43 metri (

10 picioare = 3,04 metri (
65 picioare = 19,81 metri (

cele mai mari structuri de piatr din vestul Asiei, att de

mare nct poate fi vzut din spaiu, de pe staiile orbitale
ale Pmntului.
Inginerii care au studiat locul au estimat c, i n stadiul
actual, structura conine mai mult de 125.000 picioare
cubice1 de piatr cu o greutate de aproape 45.000 de tone. Ei
au apreciat c ar fi fost nevoie de 100 de muncitori timp de
cel puin ase ani pentru a ridica acest monument, incluznd
adunarea pietrelor de bazalt, transportul lor ctre locul
construciei, aezarea lor dup un plan arhitectural
preconceput i ridicarea pereilor (mai nali dect cei rmai
acum, fr dubii) pentru a forma o structur omogen
Toi s-au ntrebat cine a construit aceast structur, cnd
i pentru ce.
Cel mai uor se rspunde la ultima ntrebare, pentru c
structura nsi pare s indice scopul su sau cel puin
scopul su iniial. Cercul periferic are n mod clar dou
sprturi sau deschizturi, una n partea de nord-est, iar
cealalt n sud-est - locaii care indic orientarea ctre
solstiiul de var i ctre cel de iarn.
Lucrnd s nlture rocile czute i s verifice aspectul
original, arheologii israelieni au descoperit, la deschiderea
din nord-est, o structur masiv, ptrat, cu dou aripi
extinse care protejau i ascundeau sprturile mai nguste n
cei doi perei concentrici din spate (Fig. 5);

125.000 picioare cubice = 3500 m3 (

Aadar, construcia servea ca o poart monumental care

pzea intrarea n centrul complexului din piatr. n pereii
acestei intrri s-au gsit cei mai mari bolovani din bazalt,
msurnd fiecare cinci tone i jumtate. Deschiztura din
sud-est a inelului exterior oferea, de asemenea, acces ctre
partea interioar a structurii, dar acolo zona de intrare nu
avea o construcie monumental; dar grmezile de piatr
czute ncepnd cu aceast intrare i conducnd spre
exterior sugereaz contururile unui drum de piatr flancat
mergnd n direcia sud-est - un drum care ar putea schia o
linie astronomic a orizontului.
Aceste indicii c locul a fost ntradevr, ca i Stonehenge
din Anglia, construit pentru a folosi ca observator astronomic
(i, n principal, pentru a determina solstiiile) au fost ntrite
prin existena altor astfel de observatoare n alte spaii structuri care sunt chiar mai asemntoare celei de pe
platoul Golan, pentru c ele arat nu doar cercuri
concentrice, ci i perei radiali care unesc cercurile.
Uimitor este faptul c aceste structuri similare se regsesc
pe locurile antice aflate pe cealalt parte a lumii, n America.

Unul este situl maya Chichn Itza din peninsula Yucatan

n Mexic (Fig. 6a), numit Caracol (Melc) datorit scrilor
spiralate din interiorul turnului observatorului. Un altul este
observatorul circular de pe promontoriul Sacsahuaman din
Peru (Fig. 6b) care domin capitala inca, Cuzco; acolo a
existat probabil, ca i la Chichn Itza, un turn de paz;
astronomice ale structurii i arat n mod clar cercurile
concentrice i legturile de conectare.
Astfel de similariti au constituit un motiv suficient de
puternic care i-a determinat pe cercettorii israelieni s l
cheme pe dr. Anthony Aveni din SUA, o autoritate
recunoscut internaional n domeniul astronomiei antice i
n special pentru civilizaiile precolumbiene din America.

Sarcina sa a fost nu doar s confirme orientrile astronomice

care stau la baza planului sitului de pe platoul Golan, ci s
ajute la determinarea vrstei acestuia - aadar, pe lng un
rspuns la ntrebarea pentru ce?, se cuta un rspuns i la
ntrebarea cnd?
Faptul c orientarea structurii - alinierea ctre solstiii putea determina perioada construciei, fusese acceptat ca
instrument de lucru n paleoastronomie nc de la publicarea
lucrrii lui Sir Normal Lockyer, Zorii astronomici, din anul
1894. Micarea aparent a Soarelui de la nord spre sud i
napoi, astfel c anotimpurile vin i dispar, se datoreaz
faptului c axa Pmntului (n jurul creia se rotete acesta
pentru a forma ciclul noapte/zi) este nclinat pe un plan
eliptic n jurul cruia Pmntul orbiteaz n jurul Soarelui.
n aceast micare astral - dei Pmntul este cel care se
mic, i nu Soarele - unui observator de pe Pmnt i se pare
c Soarele, micndu-se napoi i nainte, ajunge ntr-un
punct ndeprtat, ezit, se oprete, apoi, ca i cum s-ar
rzgndi, pornete napoi; trece de Ecuator, merge spre
cealalt extrem, ezit i se oprete acolo, apoi se ntoarce;
cele dou treceri anuale peste Ecuator (n martie i
septembrie) se numesc echinocii; cele dou opriri, una n
nord, n luna iunie, i una n sud, n luna decembrie, se
numesc solstiii (Opririle Soarelui) - solstiiile de var i de
iarn pentru observatorii din emisfera nordic a Pmntului,
cum erau oamenii de la Stonehenge i cei de pe platoul
Studiind vechile temple, Lockyer le-a mprit n dou
categorii. Unele, ca Templul lui Solomon din Ierusalim i
templul lui Zeus din locul numit Baalbek, n Liban, au fost
construite de-a lungul unei axe est-vest care le-a orientat
ctre rsrit n zilele cu echinocii. Celelalte, ca templele
faraonilor din Egipt, erau aliniate dup o ax sud-vest-nord-

est, ceea ce nsemna c ele erau orientate ctre solstiii. El a

fost totui surprins s descopere c, n timp ce la primele
orientarea nu se schimb niciodat (astfel c le-a numit
Temple eterne), cele din urm - cum sunt marile temple de la
Karnak, din Egipt - artau cum faraonii, pentru ca razele
soarelui s loveasc Sfnta Sfintelor n ziua solstiiului,
trebuiau s schimbe direcia drumurilor i a coridoarelor
ctre un punct diferit de pe cer. Astfel de realiniere era
fcut, de asemenea, la Stonehenge.
Ce producea acele schimbri de direcie? Rspunsul lui
Lockyer a fost: schimbrile din nclinaia Pmntului,
rezultate n urma oscilaiei sale.
n zilele noastre, nclinaia axei Pmntului (oblicitate) pe
ruta orbital (eliptic) este de 23,5 grade i este nclinaia
care determin ct de departe, spre nord sau spre sud, ar
prea s se mite Soarele ntr-un anumit anotimp. Dac
unghiul de nclinare ar rmne neschimbat pentru
totdeauna, punctul de solstiiu ar rmne acelai. Dar
astronomii au ajuns la concluzia c nclinarea Pmntului
(cauzat de oscilaie) se schimb n decursul secolelor i al
mileniilor ridicndu-se i cznd n mod repetat.
Chiar acum, ca i n urm cu cteva milenii, nclinarea
este n faza de descretere. Erau peste 24 de grade n cca.
4000 .Chr., n scdere la 23, 8 grade n cca. anul 1000
.Chr., i continu s scad n prezent sub 23,5 grade. Marea
inovaie adus de Sir Norman Lockyer a fost s aplice aceast
schimbare a oblicitii Pmntului la templele antice i s
stabileasc datele construirii, n diferite faze, a Marelui
Templu din Karnak (Fig. 7), ca i fazele structurii Stonehenge
(aa cum indic schimbrile locaiei Pietrei Heel, Fig. 3).

Aceleai principii au fost folosite pentru a determina vrsta

structurilor orientate astronomic din America de Sud: n
secolul trecut de ctre Arthur Posnansky, n cazul ruinelor de
la Tiwanaku, de pe coasta Lacului Titicaca, de ctre Rolf
Mller pentru structura semicircular Torreon, din Machu
Picchu i pentru faimosul Templu al Soarelui din Cuzco.
Cercetrile lor aprofundate au artat c, pentru a
determina cu precizie unghiul de nclinare a Pmntului care indic vrsta structurii, dac sunt luate n considerare
altitudinea i poziia geografic - este esenial s se tie cu
precizie unde este nordul. Este, aadar, semnificativ faptul
c, n cazul sitului Golan, cercettorii au descoperit c, n
zilele senine, este vizibil c vrful muntelui Hermon se afl cu
precizie tocmai la nord de centrul structurii. Dr. Aveni i
colegii si israelieni, Yonathan Mizrachi i Mattanyah Zohar,
au putut s determine c situl era astfel orientat ca s
permit unui observator care st n centrul su i urmrete
o linie prin centrul porii de la nord-est, s vad de acolo

rsritul Soarelui n zorii unei zile de solstiiu din iunie 3000

Prin anul 2000 .Chr., au concluzionat cercettorii, Soarele
ar fi fost vizibil n afara centrului, dar probabil nc n
interiorul porii. 500 de ani mai trziu, structura i-a pierdut
valoarea de observator astronomic precis. A fost cndva ntre
1500 i 1200 .Chr. - aa cum confirm datarea cu carbon a
micilor artefacte descoperite acolo - cnd grmada de pietre
din centru a fost mrit pentru a forma un turn, o movil
sub care s-a spat pentru a fi folosit ca o camer de
n mod ciudat, aceste faze sunt practic identice cu cele
atribuite celor trei faze ale structurii Stonehenge.
Deoarece a fost protejat de movila de pietre de deasupra
sa, cavitatea de sub turn - presupusa camer de
nmormntare - a rmas cea mai neatins parte a sitului
antic. Ea a fost localizat cu ajutorul unor instrumente
seismice sofisticate i al unui radar de detectare la sol. Odat
detectat cavitatea, excavatoarele (supervizate de Dr.
Yonathan Mizrachi) au spat un an ce i-a condus ntr-o
camer circular de peste ase picioare 1 n diametru i
aproape cinci picioare2 nlime. Ea conducea la o camer
mai mare, de form oval, lung de aproape 11 picioare 3 i cu
o lime de aproape patru picioare 4. Pereii ultimei camere au
fost construii din ase rnduri de piatr de bazalt formnd
n sus o consol (nclinai spre interior pe msur ce pereii
se ridicau); tavanul camerei era fcut din dou lespezi masive
de bazalt, fiecare cntrind cam cinci tone.
Nu existau niciun fel de sicriu sau corp, nicio rmi
uman sau de animal, nici n camer sau n anticamer. Dar

6 picioare = 1,8 metri (

5 picioare = 1,5 metri (
11 picioare = 3,35 metri (
4 picioare = 1,2 metri (

arheologii au gsit, printr-o cernere meticuloas a solului,

civa cercei din aur, cteva iraguri de mrgele din carneol,
o piatr semipreioas, lame din cremene, capete de sgei
din bronz i cioburi de ceramic. Concluzia lor a fost c,
ntradevr, era o camer funerar, dar una care fusese
probabil jefuit n antichitate. Faptul c unele dintre pietrele
care pavau podeaua camerei erau smulse a ntrit prerea c
locul fusese spart de ctre jefuitorii de morminte.
Descoperirile au fost datate n perioada cunoscut ca
Epoca Bronzului Trziu, care a durat aproximativ ntre anii
1500 i 1200 .Chr. Acela a fost cadrul de timp al Exodului
Copiilor lui Israel din Egipt sub conducerea lui Moise i al
cuceririi Pmntului Promis, sub conducerea lui Iosua.
Dintre cele 12 triburi, triburile lui Ruben i Gad i jumtate
din tribul lui Manase au primit pri din Transiordania, de la
rul Arnon, n sud, ctre colinele de la poalele Muntelui
Hernon, n nord. Acele teritorii au inclus lanul muntelui
Gilad, la est de Iordan, i platoul numit astzi Golan. A fost
prin urmare inevitabil ca cercettorii israelieni s se ndrepte
ctre Biblie pentru un rspuns la ntrebarea cine?
Potrivit crilor Numeri i Iosua, partea nordic a munilor
Gilad era condus de ctre un rege numit Og din capitala sa,
Bashan. Cucerirea teritoriului este descris n Deuterom
(capitolul 3): Og i oamenii si s-au luptat mpotriva Copiilor
lui Israel, spune naratorul. Ctignd lupta, israeliii au
cucerit 60 de orae care erau fortificate cu ziduri nalte i
pori i granie, n afar de un numr mare de orae fr
ziduri. Construirea zidurilor nalte din piatr i a porilor aprute i la enigmaticul sit de la Golan - se fcea, aadar, n
cadrul regatelor din vremea Regelui Og.
Dup cum spune Biblia, Og era un brbat mare i voinic:
Patul su din fier are nou coi lungime i patru n lime
(echivalentul a peste 13 picioare i respectiv, 6 picioare).

Aceast dimensiune uria, sugereaz Biblia, era datorat

faptului c era descendent din Repha'im, o ras uria a
semizeilor care locuise cndva pe acel pmnt (ceilali
descendeni din uriai ai lui Repha'im, inclusiv Goliat, sunt
menionai n Biblie ca linie secundar cu filistinii din vremea
lui David). Combinnd referinele la Repha'im cu relatarea
biblic referitoare la structurile circulare din piatr ridicate
de Iosua dup traversarea Iordanului i numirea locului
Gilgal - Grmada rotund de piatr - unii israelieni au
numit situl Golan Gilgal Repha'im - Grmada rotund de
piatr a lui Repha'im.
n vreme ce doar versetele biblice nu accept o astfel de
numire, nici nu fac cu adevrat legtura ntre regele Og i
camerele funerare, afirmaiile biblice c acea zon a fost
cndva teritoriul lui Repha'im i c Og era un descendent al
lor sunt ciudate, pentru c noi i-am gsit pe Repha'im i pe
urmaii si menionai n miturile canaanite i n povetile
epice. Textele, care plaseaz n mod clar aciunile divine i
semidivine i evenimentele din zona despre care vorbim aici,
erau scrise pe tblie de lut descoperite n 1930 pe un loc
situat pe coasta de nord a Siriei, al crui nume antic era
Ugarit. Textele descriu un grup de zeiti al cror tat era El
(Zeul, Cel Mre) ale cror poveti i aveau n centru pe fiul
lui El, Ba'al (Stpnul) i pe sora sa, Anat (Cea care
rspunde). Atenia lui Ba'al era concentrat asupra cetii
montane i a locului sacru Zaphon (nsemnnd deopotriv
locul din nord i locul secretelor), iar arena lui Ba'al i a
surorii sale era locul unde astzi se afl nordul Israelului i
Golan. Cu ei cutreiera cerul din aceast zon i sora lor
Shepesh (nelesul incert al numelui sugereaz o asociere cu
Soarele); referitor la ea, textele spun clar c ea conduce
Repha'im, pe cei divini i domnete peste semizei i muritori.
Cteva dintre textele descoperite au legtur cu o astfel de

implicare din partea trioului. Unul, numit de savani The Tale

of Aqhat, se refer la Danei (Pe care l judec Zeul, Daniel n
ebraic), care - dei un Rapha-Man (descendent din
Repha'im) - nu putea avea un fiu. mbtrnind i descurajat
pentru c nu avea un fiu motenitor, Danei a apelat la Ba'al
i la Anat care, la rndul lor, au intervenit la El.
ndeplinindu-i dorina lui Rapha-Man, El i-a insuflat o
suflare nviortoare de via i l-a fcut capabil s se
uneasc cu soia sa i s aib un fiu pe care zeii l-au numit
O alt poveste, The Legend of King Keret (Keret, Capitala,
Metropola, este folosit ca nume deopotriv pentru ora i
pentru regii si), are legtur cu pretenia la nemurire a lui
Keret datorit descendenei sale divine. El s-a mbolnvit n
schimb; fiii si se ntrebau cu voce tare: Cum poate un
urma al lui El, Cel Milostiv, s moar? Poate cineva divin s
moar? Prevznd moartea aparent incredibil a unui
semizeu, fiii i imaginau nu doar Vrful Zappon, ci i
Circuitul Deschiderii Vaste plngndu-l pe Keret:
Pentru tine, Tat,
Va plnge Zaphon, Muntele lui Ba'al.
Circuitul sacru, circuitul puternic,
Circuitul deschiderii largi,
(pentru tine) va plnge.
Iat, aici, o referire la cele dou locuri foarte venerate care
vor plnge moartea unui semizeu: Muntele Zaphon, Muntele
lui Ba'al - i o structur circular sacr renumit - circuitul
sacru, circuitul puternic, circuitul deschiderii vaste. Dac
Muntele Zaphon, Muntele Nordului, era Muntele Hermon,
care se ntindea la nord de platoul Golan, era atunci Circuitul
Sacru enigmaticul site Golan?
Ascultnd rugminile de ndurare, n ultimul moment El a
trimis-o pe zeia Shataqat, o femeie care a ndeprtat boala,

pentru a-l salva pe Keret. Ea zboar peste o sut de orae,

ea zboar peste o mulime de sate n misiunea sa de salvare;
sosind la casa lui Keret, ntr-o frntur de timp ea reuete
s l renvie.
Dar fiind doar un semizeu, Keret a murit pn la urm. A
fost el oare cel ngropat n interiorul mormntului din
circuitul sacru, circuitul puternic, circuitul deschiderii
vaste? Dei textele canaanite nu dau nicio sugestie
cronologic, este evident c ele relateaz evenimentele din
Epoca Bronzului - un interval de timp care s-ar potrivi bine
cu datele despre artefactele descoperite n mormntul de la
situl de pe Golan.
Dac unii dintre aceti conductori legendari au sfrit
prin a fi sau nu ngropai n situl de pe Golan, nu vom ti cu
siguran niciodat; mai ales de cnd arheologii studiaz
situl, a aprut varianta unor nmormntri intrusive - i
anume, ngroparea unei persoane decedate mai trziu ntr-un
loc de nmormntare din timpuri anterioare, care nu
presupunea ntotdeauna i mutarea rmielor anterioare.
Ei sunt oricum siguri (se bazeaz pe aspectele structurale i
diferite date tehnice) c ridicarea construciei de tip henge ziduri concentrice cu ceea ce am putea numi Pietre de Stele
datorit funciei astronomice - a precedat cu 1000 pn la
1500 de ani adugarea movilei de pietre i a camerelor sale
La fel ca n cazul Stonehenge i al celorlalte situri
megalitice, i n cazul sitului Golan misterul legat de cei care
l-au construit s-a adncit prin stabilirea vrstei sale i a
faptului c la baza orientrii lor se afl cunotine avansate
de astronomie. Dac nu erau ei ntradevr fiine divine,
atunci cine a fost capabil s realizeze aceast construcie - n
cca. anul 3000 .Chr - pe situl Golan?
n anul 3000 .Chr. exista n vestul Asiei doar o singur

civilizaie suficient de dezvoltat, care dispunea de cunotine

astronomice extraordinare, capabil s proiecteze, s
orienteze astronomic i s realizeze astfel de structuri:
civilizaia sumerian. Ea s-a dezvoltat n partea de sud a
Irakului din zilele noastre, deodat, neateptat, de nicieri,
aa cum spun savanii. i pe parcursul ctorva secole - un
moment la scara evoluiei umane - a dat natere practic
tuturor acelor lucruri pe care le considerm necesare pentru
o civilizaie nalt, de la roat la cuptor, crmizi i cldiri
nalte, scrieri i poezie, muzic, coduri de legi i instane,
judectori i contracte, temple i preoi, regi i
administratori, coli i profesori, doctori i asistente;
cunotine uimitoare de matematici, tiine exacte i
astronomie. Calendarul lor, folosit nc de evrei, a fost
inaugurat n oraul numit Nippur, n anul 3760 .Chr.,
incluznd toate cunotinele complexe cerute de structurile
despre care discutm.
Civilizaia sumerian a precedat-o pe cea egiptean cu 800
de ani i cu 1000 de ani pe cea hindus. Babilonienii,
asirienii, hitiii, elamiii, canaaniii i fenicienii au urmat mai
trziu, mult mai trziu. Toi acetia au aplicat i mprumutat
cunotinele de baz de la sumerieni; la fel au fcut i
civilizaiile care s-au dezvoltat n timp n Grecia i insulele
din Mediteran. A ajuns aventura sumerian att de departe,
pe nlimile Golan? Cu siguran, pentru c regii i
comercianii lor s-au ndreptat ctre vestul Mrii Mediterane
(pe care ei au numit-o Marea Superioar) i au navigat pe
apele din Marea Inferioar (Golful Persic) ctre celelalte
teritorii ndeprtate. Cnd capitala lor era la Ur, comercianii
si erau cunoscui n toate zonele Orientului Apropiat. Unul
dintre cei mai faimoi regi sumerieni, Ghilgame - un rege cu
faim al Urukului (biblicul Erech) - a trecut prin acel loc,
dup toate probabilitile. S-a ntmplat n cca. anul 2900

.Chr., curnd dup ce a fost construit pentru prima dat

situl Golan.
Tatl lui Ghilgame a fost naltul Preot al oraului; mama
sa a fost zeia Ninsun. Urmrind s fie un rege puternic i s
extind autoritatea oraului su, Ghilgame i-a nceput
domnia prin contestarea autoritii principalului ora de
atunci al Sumerului, Kish. O tbli de argil descrie
episodul numindul pe regele oraului Kish, Agga, de dou ori
l descrie ca fiind curajos. Kish era atunci capitala unui
teritoriu ntins care s-ar fi putut extinde dincolo de fluviul
Eufrat; ne ntrebm dac nu cumva curajosul rege Agga n-ar
fi putut fi un precursor al uriaului Og, cunoscut n Biblie,
deoarece numirea regilor dup predecesori era o practic n
Orientul Apropiat.
Mndru, ambiios i teribilist n tineree, Ghilgame s-a
maturizat mai greu. Pentru a-i dovedi brbia, el i-a
ndreptat atenia ctre tinerii cstorii, pretinznd dreptul
regal de a fi primul care face dragoste cu mireasa. Cnd
locuitorii oraului nu au mai suportat, au fcut apel la zei
pentru ajutor; zeii au rspuns prin crearea unei dubluri
pentru Ghilgame, care a oprit tensiunile produse de rege.
mblnzit, Ghilgame a devenit posomort i meditativ. El a
vzut murind oameni de vrsta lui sau chiar mai tineri; i
atunci ceva i-a artat c exist o alt cale: el era, nainte de
toate, parial divin - nu doar un semizeu, ci dou treimi
divin, pentru c nu tatl su era zeu, ci mama sa era zei!
Trebuia aadar el, Ghilgame, s moar ca un muritor sau
era ndreptit la viaa venic, la fel ca zeii? El i-a vorbit
mamei sale despre asta. Da, i-a spus ea, ai dreptate. Dar
pentru a obine dreptul la viaa divin tu trebuie s urci n
cer i s ajungi la reedina zeilor. i locurile de unde urcarea
este posibil, i-a spus ea, se afl sub conducerea naului tu,
Utu (cunoscut mai trziu ca Shamash).

Utu/Shamash a ncercat s-l descurajeze pe Ghilgame:

Cine, Ghilgame s urce la cer? Numai zeii triesc pentru
totdeauna sub Soare. Pentru Omenire, zilele sunt numrate.
Pleac, stai cu familia i poporul tu i bucur-te de restul
de zile care i-au rmas, i-a spus zeul.
Povestea lui Ghilgame i cutarea nemuririi sale este
relatat n Epopeea lui Ghilgame, un text lung scris pe
tblie de lut i descoperit de ctre arheologi deopotriv n
forma original sumerien, dar i n diferite transcrieri
antice. Aa cum relateaz povestea, vedem c Ghilgame nu a
fost descurajat i un obiect care a venit din cer pare s fi fost
considerat de el ca un semn din cer c nu trebuie s renune.
Acceptnd s l ajute, Ninsun i-a dezvluit c exist un loc n
Munii Cedru - Locul Aterizrii - de unde Ghilgame ar putea
urca spre reedina divin. Ar putea fi o cltorie plin de
primejdii, l-a avertizat zeia pe Ghilgame. Dar care este
alternativa, a ntrebat-o el? Dac voi eua n cutarea mea, a
spus el, cel puin generaiile viitoare vor ti c am ncercat.
Dndu-i binecuvntarea sa pentru cltorie, Ninsun a
insistat ca un om artificial, Enkidu, s mearg n faa sa i s
l protejeze pe drum. Alegerea a fost potrivit, pentru c zona
spre care se ndreptau era chiar aceea de unde venise
Enkidu, dealurile pe care cutreierase cu animalele slbatice.
El i-a explicat lui Ghilgame ct de periculos ar putea fi
demersul su, dar Ghilgame a insistat s continue.
Pentru a ajunge la Munii Cedru, unde este acum Libanul,
din Sumer (care era n zona sudic a Irakului de astzi),
Ghilgame a trebuit s traverseze actualul platou Golan. i,
ntradevr, aflm din preambulul epopeii, n care sunt
enumerate aventurile i victoriile regelui, c el era cel care a
deschis trecerile muntelui. A fost o premier care trebuie
amintit pentru c acolo, pe pmntul Sumerului, nu exist

Pe drumul su, Ghilgame s-a oprit de cteva ori pentru a

vedea oracolele divine ale Zeului Soarelui. Cnd au ajuns pe
teritorii cu dealuri i pduri (care nu erau la fel n Sumer),
Ghilgame a avut o serie de vise prevestitoare. La o oprire
decisiv, de unde se puteau vedea deja Munii Cedru,
Ghilgame a avut un vis profetic stnd n interiorul unui cerc
care a fost fcut pentru el de ctre Enkidu. A fost oare
Enkidu, care avea puteri supraomeneti, cel care a aranjat
sfera de pietre pentru Ghilgame pentru a forma Pietrele de
Putem doar s presupunem. Dar dovezile fizice atestnd
familiarizarea celor care au trit pe nlimile Golan de
generaii, cu Ghilgame i cu povestea sa au fost descoperite
recent pe nlimi.

Unul dintre cele mai povestite episoade din aventurile

regelui se refer la incidentul n care a fost nconjurat de doi
lei nfricotori, a luptat cu ei i i-a ucis fr nicio arm.
Aceast fapt eroic a fost subiectul favorit al artitilor din
antichitate n Orientul Apropiat. A fost totui o descoperire
total neateptat gsirea la un sit de lng cercurile
concentrice a unei lespezi din piatr cu o astfel de descriere
(Fig. 8) (Artefactul este expus la noul i interesantul Muzeu
Arheologic Golan din Qatzrin).
Dei referinele din texte i descrierea de pe lespedea din
piatr nu reprezint dovezi convingtoare c Ghilgame a
ajuns la sit n drumul su spre Muntele Cedru din Liban,

mai exist un indiciu ciudat care trebuie luat n considerare.

Dup ce situl a fost identificat din aer, arheologii israelieni au
descoperit c el fusese marcat (cucerit) pe harta armatei
siriene cu numele Rugum el-Hiri - cel mai enigmatic nume,
pentru c el nsemna n limba arab Mormanul de pietre al
Explicaia pentru enigmaticul nume, sugerm noi, s-ar
putea gsi n Epopeea lui Ghilgame, amintind de Regele care
a Luptat cu Leii.
i, dup cum vom vedea, acesta este doar nceputul unor
asocieri complicate.
Oamenii de tiin au recunoscut de mult n teoriile
tradiionale ale diverselor naiuni aceeai tem, aceeai
legend, apariii i reapariii sub diverse nfiri, nume i
locuri. Nu este de mirare, aadar, faptul c piatra cioplit din
bazalt pe care Ghilgame este descris luptnd cu leii a fost
descoperit lng un sat purtnd numele Ein Samsun Aurora lui Samson. Pentru c, trebuie reamintit, Samson a
nfruntat i el i a ucis un leu cu minile goale. Acest lucru
s-a petrecut la 2000 de ani dup Ghilgame i, cu siguran,
nu pe nlimile Golan. Atunci este numele satului, doar o
coinciden sau amintirea persistent a unui vizitator numit
Ghilgame, devenit Samson?
O mai mare semnificaie are asocierea cu regele Keret. Dei
locul desfurrii povetii canaaniilor nu este precizat, muli
au presupus (ex. Cyrus H. Gordon, Notes on the Legend of
Keret) c numele care desemneaz deopotriv regele i
capitala sa identific, n fapt, insula Creta. Acolo, potrivit
legendelor cretane i greceti, civilizaia a nceput cnd Zeus

a vzut-o pe Europa, frumoasa fiic a regelui Feniciei

(Libanul de astzi) i, lund forma unui taur, a rpit-o i a
notat cu ea n spate peste Marea Mediteran, pn n insula
Creta. Acolo a avut trei fii cu ea, printre care i Minos, care,
n timp, a devenit cel cu care este asociat nceputul civilizaiei
Dup ce i-au fost dejucate planurile de venire la tron,
Minos a apelat la Poseidon, zeul apei, s-i dea un semn de
favoare divin. Ca rspuns, Poseidon a creat un Taur Divin,
alb, care a aprut din mare. Minos a promis zeului s-i ofere
frumosul taur ca sacrificiu, dar a fost att de entuziasmat de
el, nct l-a pstrat pentru sine.

Drept pedeaps, zeul a fcut-o pe soia regelui s se

ndrgosteasc i s se mperecheze cu taurul; urmaul a fost
legendarul Minotaur, o creatur jumtate om, jumtate taur.
Atunci Minos i-a cerut lui Dedal, artizanul divin, s
construiasc n capitala Cretei, Cnossos, un labirint
subteran de unde s nu poat scpa omul-taur.
O uria sculptur din piatr reprezentnd coarnele
taurului ntmpin vizitatorul la ruinele Cnossosului, dar
rmiele Labirintului nu s-au pstrat. Totui amintirea i
forma sa circular - un labirint cu perei circulari
concentrici, cu pasaje blocate de radiali (cum arat schema

sugerat n Fig. 9) nu au fost uitate.

El seamn, n mod cert, cu schia sitului de pe Golan; i
ne face s ne ntoarcem la Epopeea lui Ghilgame, la
ntlnirea eroilor cu Taurul Cerului.
Aa cum spune epopeea, n timpul ultimei nopi dinaintea
ncercrii de a intra n Pdurea Cedru, Ghilgame a vzut
ridicarea furtunoas a unei rachete, ntr-o ascensiune de foc,
de pe Locul Aterizrii, n dimineaa urmtoare ei au
descoperit intrarea ascuns ntr-o ncpere interzis; dar
imediat ce au ncercat s intre, un robot gardian le-a blocat
calea. Era puternic, dinii si erau ca cei ai dragonului, faa
era ca a unui leu feroce, mersul su era ca nvala izvoarelor.

O aureol de raze emana din fruntea sa, devornd

copacii i tufiurile; de fora sa nimicitoare nimeni nu putea
Vznd necazul lui Ghilgame i al lui Enkidu,
Utu/Shamash a cobort din cer i le-a vorbit eroilor. Zeul ia sftuit s nu fug i s se apropie de monstru imediat ce el
putea s sufle asupra lui un vrtej al crui praf l va orbi pe
gardian. Imediat ce s-a ntmplat asta, Enkidu l-a lovit pe
monstru i l-a ucis. Artitii antici descriu pe un sigiliu
cilindric (Fig. 10) pe Ghilgame, Enkidu i Utu/Shamash
mpreun cu robotul amenintor, descrierea lor ne aduce n
minte descrierea biblic a ngerilor cu spada nvolburat pe

care Dumnezeu i-a pus la intrarea n Grdina Edenului

pentru a fi sigur c Adam i Eva, alungai, nu vor reintra
Btlia a fost urmrit, de asemenea, de ctre Inanna
(cunoscut mai trziu ca Ishtar), sora geamn a lui
Utu/Shamash. Ea era cunoscut pentru faptul c ispitea
brbaii care rmneau o noapte cu ea, o noapte dup care
puini supravieuiau. Atras de frumuseea lui Ghilgame n
timp ce el fcea baie ntr-un ru sau cascad din apropiere,
ea l-a invitat: Vino, Ghilgame, fii iubitul meu!. Dar,
cunoscnd palmaresul zeiei, el a refuzat-o.
nfuriat de refuzul insulttor, Ishtar l-a chemat pe Taurul
Cerului s-l loveasc pe Ghilgame. Pentru a se salva, cei doi
au fugit napoi ctre Uruk; dar Taurul Cerului i-a prins pe
malurile fluviului Eufrat. n acel moment de pericol mortal,
Enkidu a fost din nou cel care a lovit i ucis Taurul Cerului.
Furioas, Inanna/lshtar a urlat ctre Ceruri cernd ca
cei doi tovari s fie trimii la moarte. Dei cruat temporar,
Enkidu a murit primul; aa a pit i Ghilgame (dup a
dou cltorie, care l-a dus la portul spaial din Peninsula
Ce era Taurul Cerului - GUD.ANNA - la sumerieni? Muli
care au studiat Epopeea, cum ar fi Giorgio de Santillana i
Hertha von Dechend, n Hamlet 's Mill, au ajuns la concluzia
c evenimentele din Epopee, care au avut loc pe Pmnt,
sunt o imagine n oglind a evenimentelor care au avut loc n
Cer. Utu/Shamash este Soarele, Inanna/lshtar este ceea ce
mai trziu au numit grecii i romanii Venus. Gardianul
amenintor de la Muntele Cedru, cu faa asemntoare unui
leu, este constelaia Leului (Leul) i Taurul Cerului este
grupul de stele care a fost numit - din timpurile sumeriene! constelaia Taurului (Taurul).
Exist, ntradevr, descrieri mesopotamiene cu tema

Leului/Taurului (Fig. 11a i 11b); i, aa cum a remarcat

pentru prima dat Willy Hartner, (The Earliest History of the
Constelations n the Near East), n mileniul 4 .Chr.,
sumerienii ar fi putut observa cele dou constelaii n poziii
cheie: constelaia Taurului (Taurul) ca fiind constelaia
echinociului de primvar, iar constelaia Leului (Leul) ca
aceea a solstiiului de var.
Atribuind conotaii zodiacale evenimentelor epice de pe
Pmnt, aa cum au fcut sumerienii, se presupune c ei
aveau astfel de cunotine cereti n mileniul 4 .Chr., cu trei
milenii nainte de perioada n care se presupune c s-a fcut
gruparea stelelor n constelaii i introducerea celor 12 zodii
de ctre greci. n fapt, chiar savanii greci (din Asia Mic) au
explicat c au primit cunotinele de la caldeenii din
Mesopotamia; i, aa cum atest textele astronomice
sumeriene i descrierile, ar trebui s-i credem. Numele i
simbolurile lor pentru constelaiile zodiacale au rmas
neschimbate pn n zilele noastre.

Listele zodiacale sumeriene ncep cu Taurul care era,

ntradevr, constelaia de unde Soarele era vzut rsrind n
zori, n ziua echinociului de primvar, n mileniul 4 .Chr.
Era numit n sumerian GUD.ANNA (Taurul Cerului sau

Taurul Ceresc) - chiar termenul folosit n Epopeea lui

Ghilgame pentru a desemna creatura divin pe care
Inanna/lshtar a chemat-o din cer i pe care au ucis-o cei doi
tovari de cltorie.
A reprezentat sau simbolizat acea ucidere un eveniment
ceresc de atunci, din cca. anul 2900 .Chr.? n vreme ce
aceast posibilitate nu poate fi exclus, datele istorice indic
evenimente majore i schimbri care s-au petrecut pe
Pmnt n acea perioad; uciderea Taurului Cerului a
reprezentat o profeie, o profeie cereasc, prezicerea sau
chiar declanarea unor evenimente pe Pmnt.
Pentru c, n cea mai mare parte a mileniului 4 .Chr,
civilizaia sumerian nu a fost doar cea mai mare civilizaie
de pe Pmnt, ci chiar singura. n cca. anul 3100 .Chr,
civilizaia Nilului (Egipt i Nubia) s-a alturat celei dintre
fluviile Tigru i Eufrat.
Oare aceast mprire de pe Pmnt - aluzie la povestea
biblic a Turnului Babei i la sfritul unei ere n care
omenirea vorbea aceeai limb - i-a gsit expresia n
descrierea (din Epopeea lui Ghilgame) a loviturii de graie
dat Taurului Cerului prin ruperea piciorului din fa de
ctre Enkidu?

nceputul civilizaiei lor cu ruperea prii din fa a
constelaiei Taurului (Fig. 12).

Aa cum am detaliat n The Wars of Gods and Men,

Inanna/Ishtar se atepta n acel timp s devin stpna noii
civilizaii, dar - simbolic i literal - i-a fost luat. Ea a fost
parial mpcat atunci cnd o a treia civilizaie, cea din
Valea Indusului, a fost pus sub egida sa, n cca. 2900 .Chr.
Pe ct de importante fuseser profeiile cereti pentru zei,
ele au fost chiar mai semnificative pentru muritorii de pe
Pmnt; mrturie este soarta care i-a urmrit pe cei doi
tovari. Enkidu, o fiin creat artificial, a murit ca o fiin
uman. Ghilgame, o fiin pe dou treimi divin, nu a putut
scpa de moarte. Dei a fcut a doua cltorie, ndurnd
greuti i pericole, i dei a gsit Maina Tinereii Venice, el
s-a ntors cu minile goale n Uruk. Potrivit Listei Regelui
Sumerian, Divinul Ghilgame, al crui tat a fost om, naltul
Preot al templului, a condus 126 de ani; Urlugal, fiul lui
Ghilgame, i-a urmat la conducere.
Aproape l putem auzi pe fiul lui Ghilgame strignd, aa
cum au fcut fiii Regelui Keret: Cum a putut, Milostivule, s
moar un urma al lui El? Poate muri cel divin? Dar
Ghilgame, dei mai mult dect un semizeu, i-a ncurcat
Soarta. A lui era Taurul Cerului, dar el l-a ucis; i Soarta sa,
o soart creat n Cer, s-a schimbat dintr-o ans la
nemurire n moarte, la fel ca a unui muritor.
La 1000 de ani de la trecerea probabil a lui Ghilgame pe
la locul Golan, acesta a fost vizitat de o alt personalitate
antic ce i-a vzut, de asemenea, Destinul scris n
constelaiile zodiacale. Era Iacov, nepotul lui Avraam; i
perioada era, dup calculele noastre, anul 1900 .Chr.
O chestiune care este adesea ignorat cu privire la
structurile megalitice din lume este: de ce au fost construite
ele pe acele locuri? Locaia, n mod evident, trebuie s aib
legtur cu un scop special. Marile piramide de la Gizeh, am
sugerat n scrierile noastre, au servit pentru fixarea

Coridorului de Aterizare conducnd la portul spaial din

Peninsula Sinai, i erau plasate precis, datorit acelei
legturi, pe paralela 30 nord. Stonehenge, au sugerat
astronomii, a fost construit acolo datorit faptului c acel loc
avea funcii astronomice care combinau deopotriv
observaiile solare i lunare. Pn la noi date se poate
presupune c Cercurile de la Golan cel mai probabil s-au
fcut acolo pentru c se aflau peste una dintre puinele
trasee de conectare a dou rute internaionale majore:
Drumul Regelui, care mergea peste dealurile din estul
Iordanului, i Drumul Mrii, care trecea pe la vest de-a
lungul coastei Mrii Mediterane (Harta). Cele dou rute legau
Mesopotamia i Egiptul, Asia i Africa - fie pentru comerul
panic, fie pentru invaziile militare. Legturile dintre cele
dou rute erau date de geografie i de topografie. La locul de
pe Golan trecerea se putea face deopotriv pe ambele pri
ale Mrii Galileei (Lacul Kinnereth); cea preferat - atunci i
acum - este cea de la nord, unde podul i-a pstrat numele
antic: Podul Fiicelor lui Iacov.
Situl de la Golan a fost, aadar, amplasat acolo unde
cltorii n diferite naiuni sau inuturi se puteau opri i privi
cerul pentru profeii, pentru a cuta indicii cu privire la
destinul lor i, probabil, pentru c era un loc neutru
deoarece era sacru; acolo se negociau chestiuni de pace i

Datorit informaiilor biblice i mesopotamiene, noi

credem c acesta a fost locul pe care l-a folosit Iacov.
Povestea a nceput n urm cu dou secole, n Sumer; i
nu a nceput cu bunicul lui Iacov, Avraam, ci cu strbunicul
su, Terah. Numele su sugereaz c el a fost un preot al
oracolului (Tirhu); interesul familiei de a fi cunoscut ca popor
Ibri (Ebraic) ne sugereaz c ei se considerau Nipurieni popor din oraul Nippur care n sumerian se traducea
NI.IBRU - Frumosul/Lcaul plcut de trecere. Centru
religios i tiinific al Sumerului, Nippurul era locul lui
DURAN.KI, Legtura Cer-Pmnt, localizat n zona sacr a
oraului. Era locul central unde se pstrau, studiau i
calendaristice i cereti; i tatl lui Avraam, Terah, era unul

dintre preoii si.

Prin cca. anul 2100 .Chr., Terah a fost mutat n Ur. Era
perioada cunoscut de sumerologiti ca Ur III, pentru c
atunci oraul Ur, pentru a treia oar, a devenit capitala, nu
doar a Sumerului i nu doar a entitii politice vaste
denumit Sumer i Akkad, ci a unui imperiu care a nflorit i
a rezistat nu prin fora armelor, ci printr-o cultur
superioar, un panteon unic (care este cunoscut ca Religie), o
administraie eficient i - nu n cele din urm - un comer
prosper. Ur a fost, de asemenea, centrul de cult al zeului
Lunii, Nannar (cunoscut mai trziu ca Sin de ctre poporul
semitic). Derularea rapid a evenimentelor a determinat la
nceput mutarea lui Terah la Ur, apoi n oraul ndeprtat
numit Harran. Situat n partea superioar a Eufratului i a
afluenilor si, oraul servea ca un important punct de
trecere i loc comercial (al crui nume nsemna Caravan).
Fondat de comercianii sumerieni, Harran se mndrea cu un
mare templu nchinat zeului Lunii, astfel c oraul era
considerat ca un fel de Ur departe de Ur.
n aceste mutri, Terah i-a luat familia cu el. La Harran,
familia includea pe Abram (cum se numea el atunci), primul
nscut al lui Terah; un fiu numit Nahor; soiile celor doi fii,
Sarai (mai trziu numit Sara) i Milcah; i nepotul lui Terah,
Lot, fiul fratelui lui Abram, Haran, care murise n Ur. Ei au
locuit acolo, n Harran, muli ani, potrivit Bibliei, iar Terah
a murit acolo, la vrsta de 205 ani.
Aceasta a fost dup ce Dumnezeu i-a spus lui Abram:
Pleac din ara ta, din locul unde te-ai nscut i din locul
unde a locuit tatl tau, ctre inutul pe care i-l voi arta...
Acolo voi face un mare neam din tine i te voi binecuvnta i
i voi face mare numele. Abram a luat-o pe soia sa, Sarai,
pe Lot, nepotul su, i toat lumea din casa sa i toate
lucrurile sale i a plecat ctre inutul Canaan; i Abram

avea 75 de ani cnd a plecat din Harran. Fratele su, Nahor,

a rmas cu familia, n Harran.
Acionnd dup instruciunile divine, Abram s-a mutat
repede n Canaan pentru a stabili o baz n Negev, o zon
arid la grania Canaanului cu Peninsula Sinai. ntr-o vizit
n Egipt, el a fost primit la curtea faraonului; la ntoarcerea n
Canaan, el a vorbit cu conductorii locali. El a jucat atunci
un rol ntr-un conflict internaional, cunoscut n Biblie
(Geneza 14) ca Rzboiul Regilor. Aceasta a fost dup ce
Dumnezeu i-a promis lui Abram c smna sa v-a moteni
i conduce pmnturile dintre Prul Egiptului i fluviul
Eufrat. Punnd la ndoial aceast promisiune, Abram a
spus c el i soia sa nu aveau copii. Dumnezeu i-a spus ns
lui Abram s nu-i fac griji. Privete acum ctre cer, i-a
spus el, i numr stelele dac poi... att de numeroas va
fi smna ta. Dar Sarai a rmas stearp chiar i dup
Atunci, la sugestia ei, Abram s-a culcat cu slujnica ei,
Hagar, care i-a adus un fiu, Ishmael. Apoi - n mod miraculos
- dup cderea Sodomei i Gomorei, cnd numele cuplului sau schimbat n Avraam i Sara - Avraam, atunci n vrst de
100 de ani, a avut un fiu cu soia sa, Sara, care avea 90 de
ani. Dei nu era primul nscut, fiul Sarei, Isaac, era
motenitorul legitim dup regulile sumeriene de succesiune,
urmate i de Patriarhi; pentru c era fiul surorii vitrege a
tatlui su: fiica tatlui meu, dar nu a mamei mele i-a spus
Dup moartea Sarei, cea care i-a inut companie pe timpul
ndelungatei sale viei, Avraam, btrn i mpovrat de ani
(137 de ani dup calculele noastre), a devenit ngrijorat n
privina fiului su necstorit, Isaac. Temndu-se c Isaac sar putea cstori n cele din urm cu o femeie canaanit, el a
trimis un supraveghetor al casei sale la Harran, ca s

gseasc o mireas pentru Isaac printre rudele care au

rmas acolo. Ajungnd n satul unde locuia Nahor, el a
ntlnit-o la un izvor pe Rebecca, cea care s-a dovedit a fi
nepoata lui Nahor i care a sfrit prin a merge n Canaan
pentru a deveni soia lui Isaac.
La 20 de ani dup ce s-au cstorit, Rebecca a nscut doi
gemeni, Esau i Iacov. Esau s-a cstorit primul, lundu-i
dou soii de drept, ambele servitoare hitite; ele au fost
sursa durerii pentru Isaac i Rebecca. Problemele nu sunt
detaliate n Biblie, dar relaia dintre mam i nurori era att
de rea, nct Rebecca i-a spus lui Isaac: Sunt dezgustat de
viaa cu femeile hitite; dac s-ar cstori i Iacov cu o femeie
hitit, dintre femeile locale, ce fel de via bun a avea?.
Aadar, Isaac l-a chemat pe Iacov i i-a spus s mearg n
Harran, la familia mamei sale, s-i gseasc acolo o
mireas. Ascultnd cuvintele tatlui su, Iacov a prsit
Beersheba i a pornit ctre Harran.
Din cltoria lui Iacov din sudul Canaanului spre
ndeprtatul Harran, Biblia relateaz doar un episod - totui
unul foarte semnificativ. Era despre o viziune pe care a avuto Iacov n timpul nopii cnd a ajuns ntr-un anumit loc
despre o scar ctre cer, de unde ngerii Domnului urcau i
coborau. Trezindu-se, Iacov a neles c el sosise la un loc al
lui Elohim i la o poart ctre cer. El a marcat locul punnd
acolo o piatr comemorativ i numind locul Beth-El -Casa
lui El, Domnul. i apoi el i-a continuat drumul ctre
Harran, pe o rut care nu este precizat.
La periferia oraului, el a vzut pstorii strngndu-i
turmele la un izvor din cmpie. Iacov li s-a adresat,
ntrebndu-i dac l cunosc pe Laban, fratele mamei sale.
ntradevr, l tim, au spus pstorii, iat-o pe fiica lui,
Rahela, cea care i pate turmele. Cu ochii n lacrimi, Iacov
s-a prezentat lui Rahela ca fiul Rebeci, mtua sa. Curnd

dup aflarea vetilor, Laban a venit alergnd, l-a mbriat i

srutat pe nepotul su, invitndu-l s stea cu ei i s o
cunoasc i pe cealalt fiica a sa mai mare, Lea. Tatl s-a
gndit la cstorie; dar Iacov se ndrgostise de Rahela i s-a
oferit s munceasc pentru Laban apte ani n loc de zestre.
Dar n noaptea cstoriei, dup banchet, Laban a nlocuit-o
pe Rahela cu Lea n patul miresei...
Cnd Iacov a descoperit identitatea miresei, a doua zi
dimineaa, Laban a fost nedumerit. Iat, a spus el, noi nu o
mritm pe cea mai mic naintea surorii sale mai mari; de
ce nu munceti pentru mine ali apte ani i apoi te
cstoreti i cu Rahela? nc ndrgostit de Rahela, Iacov a
acceptat. Dup apte ani el s-a cstorit cu Rahela; dar
vicleanul Laban voia s-l in pe Iacov, care muncea din greu
i era un pstor priceput, i nu dorea s-l lase s plece.
Pentru a-l ine acolo, Laban l-a lsat s-i creasc propriile
turme; dar cu ct Iacov avea mai mult succes, cu att mai
mult fiii lui Laban protestau invidioi.
Astfel c, atunci cnd Laban i fiii si erau plecai s tund
oile, i-a strns nevestele, copiii i turmele i a plecat din
Harran. i el a trecut fluviul - Eufratul - i s-a ndreptat
ctre muntele Gile'ad.
A treia zi i s-a spus lui Laban c Iacov a scpat; astfel, el
i-a luat rudele cu el i a pornit n urmrirea lui Iacov; dup
apte zile, el l-a prins la muntele Gilead.
Gilad - Movila Pietrei Venice n ebraic - locul
observatorului circular de pe Golan!
ntlnirea a nceput cu schimburi de acuzaii reciproce. Sa terminat cu un tratat de pace. Dup obiceiul tratatelor de
grani din acel timp, Iacov a ales o piatr i a ridicat-o
pentru a fi Stlpul Martor, pentru a delimita grania dincolo
de care nu putea trece Laban pe teritoriul lui Iacov i nici
Iacov nu putea trece dincolo, pe pmnturile lui Laban. Astfel

de pietre de granie (borne), numite Kudurru n akkadian

datorit vrfurilor rotunjite, au fost descoperite n diferite
locuri n Orientul Apropiat. Ca o regul, ele erau
inscripionate cu detalii ale tratatului ce includea invocarea
zeilor fiecrei pri, ca martori i garani. Adernd la acest
obicei, Laban i-a numit pe Dumnezeul lui Avraam i pe zeii
lui Nahor s garanteze nelegerea. Temtor, Iacov a jurat de
teama fa de tatl su. Apoi el a adugat marca sa
personal cu privire la ocazie i loc:
i Iacov le-a spus fiilor si:
Strngei pietre;
i ei au strns pietre
i le-au aranjat ntr-o movil...
i Iacov a numit movila de pietre
Gal 'ed.
Printro simpl schimbare de pronunie, de la Gilad la GalEd, Iacov a schimbat sensul numelui de la lungimea duratei
sale Movila Pietrei Venice, la Movila Pietrei Martorilor.
Ct de siguri putem fi c locul era acela al cercurilor de pe
Golan? Iat care credem c este indiciul final convingtor: n
jurmntul su din tratat, Iacov a descris, de asemenea,
locul ca Ha-Mitzpeh - Observatorul!
Cartea Jubileelor, o carte extrabiblic n care se relateaz
povetile biblice din variate surse timpurii, a adugat un
postscriptum la evenimentul nregistrat: i Iacov a fcut
acolo o movil pentru martori, motiv pentru care locul a fost
numit Movila Martorilor; dar nainte ei obinuiau s
numeasc pmntul Gilead, Locul lui Repha'im.
i astfel ne ntoarcem la enigmaticul sit Golan i la numele
care i s-a dat, Ghilgal Repha'im.
Bornele Kudurru pe care le-am gsit n Orientul Mijlociu
descriu, ca o regul, nu doar termenii nelegerii i numele
zeilor invocai drept garani, dar i simbolurile zeilor cereti -

uneori ale Soarelui, Lunii i planetelor, alteori ale

constelaiilor zodiacale (ca n Fig. 13) - toate cele 12. Pentru
c - din cele mai vechi vremuri sumeriene - 12 era numrul
constelaiilor zodiacale, evideniate dup numele lor:
GUD.ANNA - Taurul Ceresc (Taurul)
MASH.TAB.BA- Gemenii (Gemeni)
DAB - Racul, Cletii (Rac)
UR.GULA - Leul (Leu)
AB.SIN - Cea al crui Tat a fost Sin (Fecioara = Fecioara)
ZI.BA.AN.NA - Soarta Cereasc (Balana = Balana)
GIR.TAB - Care are gheare i taie (Scorpionul)
PA.BIL - Aprtorul (Arcaul = Sgettorul)
SUHUR.MASH - Capra-Pete (Capricorn)
GU - Stpnul Apelor (Vrstor)
SIM.MAH - Peti (Peti)
KU.MAL - Locuitorul Cmpului (Berbec)

Chiar dac nu toate simbolurile care descriau cele 12

constelaii zodiacale s-au pstrat din vremurile sumeriene

sau chiar din perioada babilonienilor, ele au putut fi gsite pe
monumentele egiptene, cu descrieri i nume identice (Fig.
Poate avea cineva dubii c Avraam, fiu al preotuluiastronom Terah, cunotea cele 12 case zodiacale cnd
Dumnezeu i-a spus s se uite pe cer i s vad acolo viitorul?
La fel ca stelele pe care le observi pe cer, aa vor fi urmaii
ti, i-a spus Domnul lui Avraam; i cnd servitoarea Hagan
i-a nscut primul fiu, Domnul a binecuvntat biatul,
Ishmael (Auzit de Dumnezeu), prin aceast profeie:

n ceea ce privete pe Ishmael:

ntradevr l-am auzit.
Prin asta l-am binecuvntat:

l voi face roditor

i l voi nmuli foarte mult;
Din el se vor nate 12 cpetenii,
A lui va fi marea naiune.
Geneza 17:20
Cu acea binecuvntare profetic, legat de cerul nstelat
aa cum a observat Avraam, Biblia a nregistrat pentru prima
dat numrul 12 i semnificaia sa. Se relata atunci (Geneza
25) c fiii lui Ishmael - fiecare un ef de trib - erau ntradevr
n numr de 12. Enumerndui pe toi dup nume, Biblia a
accentuat: Aceia erau fiii lui Ishmael potrivit cu cetile i
fortreele lor - 12 efi de triburi, fiecare cu propria sa
naiune. Pmnturile lor cuprind Arabia i terenurile
deertice de la nordul su.
Urmtoarea dat n care Biblia a folosit numrul 12 este n
enumerarea celor 12 fii ai lui Iacov la vremea cnd acesta s-a
ntors la casa tatlui su, n Hebron. i numrul fiilor lui
Iacov era de 12, spune Biblia n Geneza 35, enumerndui pe
toi cu numele care mai trziu au devenit familiare sub
denumirea de Cele 12 Triburi ale lui Israel:
ase ai soiei Lea:
Ruben, Simion, Levi, Iuda, Issachar, Zebulun.
Doi ai Rahelei: losif, Beniamin.
Doi ai lui Bilhah, servitoarea Rahelei: Dan, Naphtali.
i doi ai lui Zilpah, servitoarea Leei: Gad i Asher.
Exist totui o scamatorie n aceast list: aceasta nu este
cifra original a celor 12 copii care au venit cu Iacov n
Canaan: Beniamin, cel mai tnr, a fost nscut de Rahela
cnd familia ajunsese deja napoi n Canaan, n Betleem,
unde ea a murit la natere. Totui numrul copiilor lui Iacov
era de 12 nainte de asta: ultimul copil nscut de Lea era o
fiic, Dinah. Lista - probabil prin mai mult dect o
coinciden - a fost alctuit aadar din 11 brbai i o

femeie, marcnd lista constelaiilor zodiacale alctuit dintr-o

singur femeie (Fecioara) i cei 11 brbai.
Implicaiile zodiacale ale celor 12 copii ai lui Iacov (cruia i
s-a schimbat numele n Israel dup ce s-a luptat cu o fiin
divin cnd traversa rul Iordan) pot fi observate de dou ori
pe parcursul naraiunii biblice. O dat, cnd Iosif-maestru n
a avea i a interpreta visele profetice - s-a ludat frailor lui
c avusese un vis n care Soarele i Luna (btrnii Iacov i
Lea) i 11 Kokhavim i se nclinau. Cuvntul este tradus de
obicei prin stele, dar termenul (provenind de la akkadieni)
era folosit, de asemenea, pentru a denumi constelaiile. Cu a
lui losif, numrul total se ridic la 12. Aluzia sa, potrivit
creia constelaia sa era una superioar, i-a deranjat mult pe
fraii si.
A doua oar a fost cnd Iacov, btrn i pe moarte, i-a
chemat pe cei 12 fii s-i binecuvnteze i s le prevesteasc
viitorul. Cunoscute ca Profeiile lui Iacov, ultimele cuvinte ale
Patriarhului au nceput cu asocierea fiului cel mai mare,
Ruben, cu Az - constelaia zodiacal a Berbecului (care pn
atunci a fost constelaia echinociului de primvar, n locul
Taurului). Simion i Levi au fost pui mpreun ca Gemenii;
deoarece au ucis muli oameni cnd au rzbunat violul
surorii lor, Iacov a profeit c ei ar putea fi separai printre
celelalte triburi i i vor pierde propriile domenii. Iuda a fost
comparat cu Leul (Leo) i i s-a prezis c va fi deintorul
sceptrului regal - o prezicere a regatului Iudeei. Zebulun a
fost vzut ca Locuitor al Mrilor (Vrstor), ceea ce ntradevr
a devenit. Prezicerile despre viitorul celor 12 fii i triburi au
continuat, legai prin nume i simboluri de constelaiile
zodiacale. Ultimii au fost fiii Rahelei: Iosif a fost nfiat ca
Arca (Sgettorul); i ultimul, Beniamin, nlocuind-o pe sora
sa, Dinah (Fecioara) - descris ca animal de prad care se
hrnete de la ceilali.

Corelarea strict cu numrul 12, provenind din cele 12

case zodiacale, a presupus i o alt iretenie care nu este de
obicei observat. Dup Exod i mprirea Pmntului
Promis ntre cele 12 Triburi, au avut loc din nou cteva
reorganizri. Surprinztor, numrul celor 12 Triburi care i
mpreau teritoriile a cuprins i pe cei doi fii ai lui Iosif (care
i s-au nscut n Egipt) - Manase i Efraim. Oricum, lista a
rmas la 12 pentru c, aa cum a profeit Iacov, triburile lui
Simion i Levi nu au mai participat la distribuirea teritonilor
i, cum a fost prevestit, s-au dispersat printre celelalte
triburi. Cerina sfnt a numrului ceresc 12 a fost pstrat
din nou.
Arheologii care au fcut spturi la ruinele sinagogilor
evreieti din Pmntul Sfnt au fost uneori uimii s
gseasc pardosele decorate cu cercuri zodiacale ale celor 12
constelaii, descrise cu simbolurile lor tradiionale (Fig. 15).
Ei au nclinat s cread c anomaliile au provenit din
influenele greceti i romane din secolele dinaintea
cretinismului. O astfel de prere, rezultnd din credina c
practica este interzis de Vechiul Testament, face abstracie
de datele istorice - legtura culturii ebraice cu constelaiile
zodiacale i asocierea ei cu prezicerea viitorului cu Soarta.
De generaii ntregi i pn n aceste zile, se poate auzi
urarea Mazal-tov! Mazal-tov! la nunile evreieti sau cnd un
biat este circumcis. Pe oricine ai ntreba i va rspunde:
nseamn Noroc, urare adresat cuplului sau biatului.
Puini tiu, totui, c, dei aceasta este intenia urrii, nu
acesta este nelesul frazei. Mazeltov nsemn textual o
constelaie zodiacal bun/favorabil. Termenul provine din
akkadian (prima limb semitic de baz), n care Manzalu
nseamn staie - un punct zodiacal din care Soarele se
prea c staioneaz el nsui n ziua cstoriei sau a

O astfel de asociere a unei case zodiacale cu una a Soartei

se folosete n astrologia horoscoapelor, care ncep prin
stabilirea (dup data naterii) a unui semn - Peti, Rac sau
un altul din cele 12 constelaii zodiacale. Mergnd napoi,
putem spune c, potrivit Profeiei lui Iacov, Iuda a fost Leu,
Gad un Scorpion i Naftali un Capricorn.
Observarea cerului pentru indicaii profetice, o sarcin
ndeplinit de ctre un grup de preoi-astronomi, a avut un
rol cheie n deciziile regale din vremea babilonienilor. Soarta
regelui, soarta teritoriilor i a naiunilor era profeit n
funcie de poziia planetelor ntr-o anumit constelaie
zodiacal. Deciziile regale ateptau cuvntul preoilorastronomi. Era Luna, ateptat n Sgettor, ascuns de
nori? Era vzut cometa n Taur, mergnd spre alt

Ce nsemna pentru rege sau pentru ar observaia c, n

aceeai sear, Jupiter aprea n Sgettor, Mercur n Gemeni
i Saturn n Scorpion? Informaii culese din sute de tblie

dezvluie c acele fenomene cereti erau interpretate ca

prevestind invazii, foamete, inundaii, tensiuni sociale - sau,
pe de alt parte, via lung pentru rege, stabilitatea
dinastiei, victorie n rzboi, prosperitate. Multe dintre
informaiile cu astfel de observaii erau scrise n limbajul
obinuit pe tblie de lut; uneori, almanahurile astrologice,
ca i manualele de horoscoape, erau ilustrate cu simbolurile
constelaiilor zodiacale importante. n toate cazurile, Soarta
prea s fie indicat de ctre cer.
Horoscoapele astrologice de astzi i au originile n cele
babiloniene, caldeene aa cum le numeau grecii. Legat de
calendarul de 12 luni, ideea c Soarta i Zodiacul sunt dou
aspecte ale aceluiai curs de evenimente a aprut fr dubii
cnd a aprut calendarul - n Nippur, n anul 3760 .Chr.
(cnd a nceput numrtoarea calendarului evreiesc).

Faptul c astfel de asociere este ntradevr att de veche se

poate constata, n opinia noastr, dintr-unul dintre numele
constelaiilor sumeriene, acela a lui ZI.BA.AN.NA. Termenul
ce nseamn Soarta Cereasc se traduce textual prin
Hotrrea Vieii n Cer dar i prin Scara Cereasc a Vieii.
Acesta a fost un concept identificat n Egipt n Cartea
Morilor; exista credina legat de sperana unora c o via
de apoi etern depinde de greutatea inimii n Ziua Judecii.
Scena a fost descris minunat pe Papirusul lui Ani, unde

zeul Anubis este artat cntrind inima n balan, iar zeul

Thoth, Scribul Divin, nregistrnd rezultatul pe un suport
(Fig. 16).
Un mister nerezolvat n tradiia evreiasc este de ce
Domnul biblic a ales a aptea lun, Tishrei, ca lun n care
urma s nceap Anul Nou evreiesc, i nu a ales pentru
aceasta prima lun, ca n numrtoarea din Mesopotamia.
Dac a fost, aa cum s-a sugerat, dorina de a trasa n mod
clar separarea de venerarea mesopotamian a stelelor i a
planetelor, atunci de ce se numete nc a aptea lun i nu
au redenumit-o ca prima lun?
Credem c este adevrat contrariul i c rspunsul este
dat chiar de numele constelaiei ZI.BA.AN.NA i de conotaia
sa cu Scrile Soartei. Considerm c indiciul decisiv este
legtura calendarului cu zodiacul. n vremea Exodului
(mijlocul mileniului l .Chr.), prima constelaie, aceea a
echinociului de primvar, era Berbecul, nu Taurul.
ncepnd cu Berbecul, constelaia Scrilor Cereti ale Vieii,
era ntradevr, a aptea. Luna n care urma s nceap Anul
Nou evreiesc, luna n care s-ar fi decis n cer cine urmeaz s
triasc i cine s moar, cine s fie sntos sau s fie
bolnav, s fie bogat sau srac, fericit sau nefericit, a fost luna
care mergea n paralel cu luna zodiacal a Scrilor Cereti.
n cer, Soarta a avut 12 staii.
Zodiacul cu cele 12 pri i vechimea sa dau natere la
dou mistere: de unde provine el i de ce a fost mprit
cercul ceresc n 12 pri?
Rspunsurile presupun trecerea unui prag - pentru a
realiza c fundamentul semnificaiei astrologice a mpririi

cerului n 12 pri presupune cunotine sofisticate de

astronomie, o astronomie n fapt att de avansat, nct
Omul nsui nu le putea avea atunci cnd a nceput aceast
mprire a cercului ceresc.
n orbita sa anual n jurul Soarelui, Soarele pare s
rsar n fiecare lun - a 12 parte a anului - ntr-un punct
diferit. Dar cea care conteaz cel mai mult, aceea care a
prut s conteze decisiv n antichitate i care decidea
tranziia de la o Er la alta (de la Taur la Berbec i la Peti i
curnd la Vrstor) este aceea n care Soarele este vzut
rsrind n ziua echinociului de primvar (Fig. 17). Cnd se
ntmpl, Pmntul n orbita sa anual n jurul Soarelui nu
se ntoarce n exact acelai punct. Datorit unui fenomen
numit precesie, exist o uoar ntrziere; ea se adun cu un
grad la fiecare 72 de ani. ntrzierea (presupunnd c fiecare
din cele 12 segmente sunt egale, de 30 de grade fiecare)
necesit aadar 2.160 de ani (72 x 30) pentru a efectua o
schimbare de la rsritul unei zi de echinociu pe un cer
nstelat al unei constelaii zodiacale (ex. Taurul), la una de
dinaintea ei (ex. Berbecul); de vreme ce Pmntul orbiteaz n
jurul Soarelui n sensul invers al acelor de ceasornic,
ntrzirea face ca Ziua Echinociului s se ntoarc.

Figura 17

Acum, chiar n condiiile longevitii din vremurile

sumeriene/biblice (Terah 205 ani, Avraam 175), ar lua o
perioad de o via pentru a observa ntrzierea unui grad
(72 de ani) sau a dou grade (144 de ani) - i este
improbabil o astfel de realizare, fr echipament astronomic
avansat. Cu att mai mult abilitate este necesar pentru a
realiza i verifica o schimbare complet a Erei Zodiacale la
2.160 de ani. Chiar Patriarhii din perioada prediluvian, cu
ceea ce oamenii de tiin numesc longeviti fantastice 969 de ani pentru deintorul recordului, Matusalem i 930
de ani pentru Adam - nu au trit suficient pentru a observa o
perioad zodiacal complet. Noe, eroul Potopului, a trit
doar 950 de ani; totui, sumerienii i amintesc faptul c
evenimentul a avut loc n constelaia zodiacal a Leului.
Aceasta a fost doar o parte a cunotinelor aparent
imposibile pe care le posedau sumerienii. Cum au putut ei s
tie ceea ce tiau? Ei nii au dat un rspuns - Tot ceea ce
tim ne-a fost dat de ctre Anunnaki - Cei care au Venit din
Cer pe Pmnt. Iar ei, venind de pe o alt planet cu o orbit
vast i o longevitate dup care un an cuprindea 3.600 de
ani pmnteni, nu au avut nicio dificultate n hotrrea
precesiunii i conceperea Zodiacului alctuit din 12 pri.
O serie de texte care s-au constituit ca baz a tiinei i a
religiei antice i care au fost preluate mai trziu n alte limbi,
inclusiv cea ebraic din Biblie, povetile sumeriene despre
Anunnaki - zeii antici - au fost esena din care a luat natere
mitologia. n culturile occidentale, mitologia care ne vine
prima n minte este cea a grecilor; dar ea provine, la fel ca
toate mitologiile antice i panteoanele divine ale tuturor
naiunilor, din credinele i textele originale ale sumerienilor.
A existat un timp, au spus sumerienii, n care Omul
civilizat nu era nc pe Pmnt, cnd erau numai animale
slbatice, nedomesticite, iar recoltele nu erau cultivate nc.

n acea vreme ndeprtat a sosit pe Pmnt un grup de 50

de Anunnaki. Condui de un lider al crui nume era E.A.
(nsemnnd cel a crui cas este apa), ei au cltorit de pe
planeta lor mam, NIBIRU (planeta trecerii) i, ajungnd pe
Pmnt, au aterizat n apele Golfului Persic. Un text
considerat de oamenii de tiin drept mitul Ea i
Pmntul, spune cum primul grup a venit la rm unde au
dat de un teren mltinos. Primul lucru pe care l-au fcut a
fost s asaneze mlatina, s curee canalurile rului, s caute
surse de hran (care au fost petele i psrile). Apoi au
nceput s fabrice crmizi din argil i s ridice primele
aezri extraterestre pe Pmnt. Ei au numit habitatul
ERIDU, care nsemna Casa de Departe sau Casa departe
de cas. Acel nume st la originea numelui Pmnt n
unele dintre cele mai vechi limbi. Timpul; 445.000 de ani n
Misiunea astronauilor era de a obine aur prin extragerea
acestuia din apele golfului, aur de care aveau nevoie pentru a
supravieui pe Nibiru; pentru c planeta lor i pierdea
atmosfera i, astfel, cldura din interior, punnd treptat n
pericol viaa de pe Nibiru. Dar planul s-a dovedit irealizabil,
iar liderii de acas au decis c aurul putea fi obinut doar pe
calea cea grea - prin minerit, acolo unde era din abunden,
n sud-estul Africii.
Planul cerea i o cretere considerabil a numrului de
Anunnaki pe Pmnt i, cu timpul, au ajuns n numr de
600. Era nevoie, de asemenea, de o operaiune elaborat de
transport maritim al aurului rafinat i aducere a diverselor
provizii. Pentru aceasta, ali 300 de Nibiruani au fost angajai
ca IGI.GI (Cei care observ i vd) n operaiuni de
transport pe orbit a platformelor i navetelor. Pentru a
superviza extinderea operaiunilor i a prezenei lor, a sosit
pe Pmnt conductorul Nibiru, AN (Cel Ceresc - Anu n

akkadian). El a venit cu doi copii ai si: fiul su, EN.LIL

(eful comandamentului) i fiica sa, NIN.MAH (Doamna
Puternic) Ofier ef medical.
mprirea atribuiilor ntre primul sosit, Ea, i noul sosit,
Enlil, s-a dovedit complicat i, ntr-un moment de impas,
Anu s-a gndit s rmn pe Pmnt i s-l lase pe unul
dintre fiii lui s conduc Nibiru, ca vicerege. La final, cei trei
au tras la sori. Anu s-a ntors s conduc Nibiru; lui Elil i-a
revenit sarcina s rmn n zona unde s-a aterizat iniial i
s se extind ctre E.DIN (Casa celor Drepi). Sarcina sa era
s stabileasc i alte aezrii fiecare cu funcie specific
(portul spaial, Centrul de Control a Misiunii, centrul
metalurgic, centrul medical i faruri pentru aterizare). Rolul
lui Ea era s organizeze operaiunile din mina din sud-estul
Africii - o sarcin pentru care el, ca cercettor remarcabil, nu
era potrivit.
Faptul c sarcina intra n competenele sale nu nseamn
c lui Ea i-a plcut misiunea departe de Edin. n
compensaie pentru acest transfer, el a primit titlul-nume de
EN.KI - Stpnul Pmntului.
Enlil s-a gndit probabil c era doar un gest fr
semnificaie; Ea/Enki ns i-a luat titlul n serios. Dei
amndoi erau fiii lui Anu, ei erau frai vitregi. Ea/Enki era
Primul Nscut i n mod normal i-ar fi urmat tatlui su la
tron. Dar Enlil era un fiu nscut lui Anu de ctre sora sa
vitreg; i, potrivit regulilor de succesiune din Nibiru, aceasta
l fcea pe Enlil Motenitor Legal, chiar dac nu era primul
nscut. Acum cei doi frai vitregi se gseau pe o alt planet,
n faa unui potenial conflict: dac misiunea pe Pmnt s-ar
fi prelungit - devenind chiar o colonie permanent - cine ar
trebui s dein autoritatea suprem aici, Stpnul
Pmntului sau eful Comandamentului?

Chestiunea a devenit o problem de durat pentru Enki n

privina prezenei pe Pmnt a fiului su, Marduk, ca i
pentru Ninurta, fiul lui Enlil; pentru c, n vreme ce cel
dinti i-a fost nscut lui Enki de ctre soia sa oficial, cel
de-al doilea i-a fost nscut lui Enlil (pe Nibiru) de ctre sora
sa vitreg, Ninmah (cnd amndoi erau necstorii; Enlil s-a
cstorit cu Ninlil pe Pmnt, Ninmah nu s-a cstorit
niciodat). Aceasta i-a dat lui Ninurta un avantaj fa de
Marduk pe linia succesiunii.
Curtezan nestvilit cum era, Enki s-a decis s repare
situaia fcnd dragoste cu sora sa, spernd astfel c va avea
un fiu de la ea. Povestea de dragoste s-a finalizat cu o fiic.
Nenduplecat, Enki nu a pierdut timpul i s-a culcat cu fiica
sa, atunci cnd aceasta a crescut; dar i ea i-a nscut tot o
fiic. Ninmah a trebuit s l determine pe Enki s termine cu
tentativele sale conjugale.
Dei nu a putut obine un fiu de la sora vitreg, lui Enki
nu i-au lipsit urmaii pe linie masculin. n afar de
MAR.DUK (Fiul Colinei Pure), care a venit, de asemenea, de
pe Nibiru, mai existau fraii NER.GAL (Marele Observator),
GIBIL (Cel de Foc), NIN.A.GAL (Prinul Marilor Ape) i
DUMU.ZI (Fiul care Este Viaa). Nu este sigur dac toi au
fost nscui de soia oficial a lui Enki, NIN.KI (Doamna
Pmntului); n principiu, este o certitudine c al aselea

fiu, NIN.GISH.ZID.DA (Stpnul Vestigiului/Copacul Vieii)

s-a nscut dintr-o legtur a lui Enki cu nepoata lui Enlil,
Ereshkigal, cnd ea era pasager pe nava lui, pe drumul din
Edin ctre Africa. Un sigiliu cilindric sumerian l-a descris pe
Enki cu fiii si (Fig. 18).
Dup ce s-a cstorit cu soia sa oficial, o tnr
asistent medical care a primit numele-epitet NIN.LIL
(Stpna Comandamentului), Enlil i-a fost fidel pentru
totdeauna. Ei au avut mpreun doi fii - zeul Lunii NANNAR
(Cel Luminos), care a fost cunoscut mai trziu de ctre
popoarele semitice ca Sin; i un alt fiu mai mic, ISH.KUR
(Cel al Munilor), care a fost mai degrab cunoscut cu
numele Adad, fiul Cel ndrgit. Numrul su mic de
urmai, comparativ cu clanul lui Enki, ar putea explica de ce
cei trei copii ai lui Nannar/Sin i ai soiei, NIN.GAL (Marea
Doamn), au fost repede inclui n conducerea Anunnaki, n
ciuda faptului c formau a treia generaie, ndeprtat de
Anu. Mai erau ERESH.KI.GAL (Stpnele Marelui Pmnt),
menionat mai sus, gemenii UTU (Cel strlucitor) i
IN.ANNA (Iubit de An) - Shamash (zeul Soare) i Ishtar
(Astarte/Venus) din panteonul de mai trziu.
La apogeul prezenei lor pe Pmnt, Anunnaki erau n
numr de 600 i textele dau numele unora dintre ei - uneori
fr s indice rolurile i funciile lor. Chiar primele texte
referitoare la aterizarea iniial a lui Enki i amintesc pe
civa dintre locotenenii si i atribuiile acestora.
Conductorii fiecrei aezri stabilite de ctre Anunnaki se
numeau la fel ca toi cei 10 conductori din Edin, n perioada
antediluvian. Urmaele femei provenite din aventurile lui
Enki au fost identificate dup soii lor. Au fost amintii dup
nume ambelanii i emisarii zeului principal, pentru c ei
erau zeiti femei sau brbai nsrcinai cu diverse activiti
(ex. Ninkashi, nsrcinat cu facerea berii).

Spre deosebire de absena total a genealogiei lui Yahve,

Dumnezeul biblic, zeii Anunnaki erau pe deplin cunoscui
dup genealogie i generaii succesive. Ele exist ca parte a
informaiilor secrete inute n Listele Zeului din temple, n
care zeii Anunnaki erau trecui dup succesiunea
genealogic. Unele liste descoperite enumer nu mai puin de
23 de Cupluri Divine care au fost precursori ai lui Anu (i
deci ai lui Enlil i Enki) pe Nibiru. Unele liste i numesc pe
zeii Anunnaki doar n ordine cronologic; celelalte liste
noteaz cu grij numele mamei divine alturi de cel al tatlui
divin, pentru c cel al mamei este decisiv pentru statutul
urmaului dup Regulile de Succesiune.
Deasupra tuturor se afla ntotdeauna un cerc cu cei 12
Mari Zei, precursorii celor 12 zei Olimpieni din panteonul
grecesc. ncepnd cu Zeii Vechi, apoi schimbndu-se prin
vremuri i generaii, componena Cercului celor 12 variaz,
dar ntotdeauna rmn 12; dac unul se prbuea, altul se
ridica n loc; dac cineva trebuia crescut n rang, un altul
trebuia deczut.
Sumerienii i-au descris zeii purtnd coroane distinctive
cu coarne (Fig. 19) i noi am sugerat c numrul de perechi
sau de coarne reflecta rangul numeric al zeitilor. Rangul n
panteonul sumerian original ncepea cu 60 (numrul de baz
n matematica sumerian) pentru Anu, apoi continua cu 50
pentru succesorul legal, Enlil, 40 pentru Enki, 30 pentru
Nannar/Sin, 20 pentru Utu/Shamash i 10 pentru
Ishkur/Adad. Femeilor li s-au dat rangurile 55, 45, 35 i 25
pentru soiile Antu, Ninlil, Ninki i Ningal, apoi 15 pentru
zeia necstorit, Ninmah i 5 pentru cea singur,
Inanna/Ishtar; reflectnd schimbrile de generaii, ultima a
obinut n timp rangul 15, iar Ninmah a cobort la 5.
Este remarcabil faptul c cei doi pretendeni la
Succesiunea pe Pmnt, Ninurta i Marduk, erau inui n

afara listei Olimpienilor. Dar cnd cearta s-a ncins,

Consiliul Zeilor l-a recunoscut pe Ninurta ca succesor legal i
i-a atribuit rangul 50 - acelai ca tatl su, Enlil. Pe de alt
parte, lui Marduk i-a fost dat rangul mic 10.
Aceste ranguri erau considerate secrete divine, dezvluite
doar preoilor alei, iniiai. Tbliele pe care erau nscrise
numerele secrete ale zeilor (ca tblia K.170 de la templul
din Ninive) includeau o interdicie strict de a le arta celor
mudu'u - neiniiai.

n mod frecvent, informaiile despre zei erau nregistrate

fr a-i numi pe acetia dup nume; erau folosite ns
numerele secrete, ca de exemplu zeul 30 pentru
Tblia din Fig. 20 i identific pe Marii Zei dup
descenden i dup rang, artndu-i pe cei 12 Mari Zei.
Dar de ce 12?
Rspunsul, credem noi, este dat de o alt problem major
cu care s-au confruntat Anunnaki dup ce misiunea lor s-a
schimbat, dintr-o expediie de scurt durat pentru
extragerea mineralului, n una de colonizare pe termen lung,

n care s-au implicat aproape 1000 dintre ei. Ei veniser de

pe o planet cu o orbit normal pe una care se rotea
nebunete n jurul Soarelui, orbitndu-l de 3.600 de ori ntrun singur (Nibiru) an (o perioad orbital).
Pe lng reglarea fizic, exista cumva nevoia unei raportri
a Timpului Pmntesc cu cel de pe Nibiru.

Stabilindu-i echipamentul complex la Centrul de Control

al Misiunii, n Nippur (un dispozitiv numit DUR.AN.KI Legtura Cer-Pmnt) - ei erau contieni de ntrzierea
gradual pe care au numit-o precesiune i au neles c
Pmntul, pe lng orbita care dura un an, avea de
asemenea un alt ciclu mai lung; 25.920 de ani i lua
Pmntului pentru a se ntoarce n acelai punct ceresc, un

ciclu care a nceput s fie cunoscut la Marele An. Aa cum

arat descrierile de pe sigilii cilindrice (Fig. 21), Anunnaki
credeau c familia Soarelui include 12 membri: Soarele (n
centru), Luna (pentru motive care au fost spuse), nou
planete pe care le tim n prezent i nc una - propria lor
planet, Nibiru.

Pentru ei acest numr, 12, era un numr de baz aplicat n

toate chestiunile cereti influennd Legtura Cer-Pmnt,
inclusiv mprirea cercului stelar n jurul Soarelui. Folosind
hrile lor cereti detaliate, ei au grupat stelele din fiecare
segment ceresc n constelaii. Cum s le numeasc? De ce nu
chiar dup propriii lor conductori?
Iatl pe Ea, Cel a crui cas este Apa, care a aterizat pe
Pmnt n apele din Golful Persic, cruia i place s
navigheze prin mlatini, n corabie, care umple lacurile cu
pete. Ei l-au onorat numind dup el dou constelaii - cea a
Vrstorului i a Petilor; n perioada sumerian, el a fost
astfel descris pe sigiliile cilindrice (Fig. 22a), iar preoii care
supravegheau cultul su erau mbrcai n chip de Pescar

(Fig. 22b). Enlil - puternic, ncpnat, comparat frecvent cu

un taur, a fost onorat prin numirea constelaiei sale cu
numele de Taur.
Ninmah, dorit dar niciodat cstorit, a fost cea dup
care s-a numit constelaia Fecioarei. Ninurta, numit deseori
Cel dinti Rzboinic al lui Enlil, a fost onorat dnd numele
su constelaiei Sgettorului; primul nscut al lui Ea,
ncpnat i cu capul greu, a fost asociat Berbecului.

Inanna/lshtar, o constelaie (Gemenii) a fost numit n
cinstea lor. (Pentru recunoaterea rolurilor lui Enlil i Utu n
activitile zeilor Anunnaki n spaiu, preoii Enlilii se
mbrcau ca oameni-vulturi, Fig. 22c). Deoarece rangurile
ierarhice s-au schimbat, iar generaiile Anunnaki a doua i a
treia s-au alturat vieii de pe Pmnt, toate cele 12
constelaii zodiacale au fost atribuite omologilor Anunnaki.
Nu oamenii, ci zeii au conceput zodiacul. i numrul,
indiferent de schimbri, trebuia s rmn ntotdeauna 12.

La 40 de Repetiii (orbitri) ale lui Nibiru de la prima

sosire, zeii Anunnaki care lucrau la minele de aur s-au
rsculat. Un text numit Atra Hasis descrie evenimentele care
au precedat rscoala, rscoala nsi i consecinele sale.
Cea mai important consecin a fost crearea lui Adam:
textul relateaz cum a fost creat Omenirea. ncurajat de
ctre Enki, rscoala a fost ndreptat n primul rnd
mpotriva lui Enlil i a fiului su, NIN.UR.TA (Domnul care
desvrete Fundaia). Enlil a cerut ca rzvrtiii s
primeasc pedeapsa maxim; Enki a spus c este imposibil
s se continue munca dur; Anu a fost de partea lui Enki.
Dar era n continuare nevoie de aur pentru supravieuire;
aadar, cum putea fi el obinut?
ntr-un moment de impas, Enki a lansat conducerii
Anunnaki propunerea sa surprinztoare: Haidei, a spus el,
s crem un Muncitor Primitiv care s poat s fac aceast
munc! Cnd Consiliul zeilor a ntrebat, uluit, cum poate fi
creat o astfel de fiin, Enki a explicat c aceasta exist
deja - un hominid care a evoluat pe Pmnt, dar nu a ajuns
nc la stadiul de evoluie al Anunnaki. Tot ceea ce trebuie
s facem, a spus el, este s punem semnul zeilor pe el - s
l transformm genetic pentru a semna cu Anunnaki.
Discuia i soluia sugerat sunt reflectate n Biblie: i
Elohim a spus:
Haidei s facem Omul dup chipul nostru
i asemnarea noastr.
o fiin care ar putea semna cu Anunnaki, deopotriv
fizic i mintal. Aceast fiin, a promis Enki, va fi n serviciul
zeilor, astfel c ei vor avea tihn. ncntai de perspectiva de
a scpa de munca grea, zeii au acceptat.
Cteva texte sumeriene descriu cum, cu ajutorul lui
Ninmah i dup multe ncercri i erori, a fost creat un Lullu
- Cel Amestecat. Mulumit de modelul perfect pe care la

obinut, Ninmah l-a ridicat i a strigat: Minile mele l-au

Ea s-a gndit s marcheze importana evenimentului.
La fel i noi - pentru c, n descrierea momentului de
ctre un artist sumerian pe un sigiliu cilindric (Fig. 23),
suntem prezentai ca fiind cel mai important eveniment
din analele Omenirii: momentul n care noi, Homo
sapiens, am aprut pe Pmnt.

Folosindu-se combinaia genetic reuit, s-a nceput

procesul ncet de realizare a dublurilor, un proces pe care noi
l numim clonare. Copia, presupunnd nevoia femeilor
Anunnaki de a servi ca Zeie ale Naterii, a fost clonat din
Muncitorul Primitiv n seturi de cte apte brbai, apte
femei. Biblia (Geneza, capitolele 1 i 5) povestesc astfel:
n ziua n care Elohim l-a creat pe Adam,
l-a fcut dup asemnarea lui Elohim;
el i-a creat pe brbai i pe femei.
Clonarea a fost un proces de durat, fiind nevoie de
ajutorul Zeielor Naterii deoarece noua fiin, fiind hibrid,
nu se putea procrea pe ea nsi. Astfel c, pentru a grbi
procesul, Enki a realizat o alt creaie de inginerie genetic de aceast dat din proprie iniiativ. Lucrnd cu ceea ce noi
numim astzi cromozomii X i Y, el a dat rasei umane

calitatea de a procrea. Biblia a nregistrat evenimentul n

povestea lui Adam i a Evei din Grdina Edenului
(sumerianul E.DIN), n care Enki juca rolul lui Nachash - un
termen tradus prin arpe care nsemna, de asemenea, i
Cel care tie/deine secrete.
Dei a votat pentru experimentul genetic, Enlil a fost mai
rezervat. Spre deosebire de cercettorul Enki, el nu era atras
de provocrile tiinei. n mod bizar, ni-l putem imagina
spunnd: Nu am venit pe alt planet s ne jucm de-a
Dumnezeu... El s-a nfuriat cnd Enki a realizat a doua
(neautorizat) experien genetic. L-ai fcut pe Adam s fie
ca unul dintre noi, capabil s procreeze, a strigat el; nc un
pas i el ar putea, de asemenea, s mprteasc fructul din
Copacul Vieii!
Astfel, Omenirea a fost alungat din Grdina Edenului, s
se apere singur; dar n loc s dispar, ea s-a nmulit i a
umplut Pmntul. Nemulumirea lui Enlil a crescut cnd
tinerii Anunnaki au nceput s se amestece cu Fiicele Omului
i chiar s aib copii cu ele. n Biblie (Geneza, capitolul 6),
povestea lui Nefilim (Cei care au Venit de Sus), fiii lui
Elohim'' care s-au cstorit cu femeile umane, a servit ca
nceput al povetii Potopului, ca explicaie pentru decizia de a
terge Omenirea de pe faa Pmntului.
Enlil i-a expus planul n Consiliul Zeilor. O mare
calamitate, a spus el, este pe cale s se ntmple. La
urmtoarea sa trecere, Nibiru va provoca un uria val mareic
ce va cuprinde Pmntul. S nu avertizm Omenirea - s-i
lsm s dispar! Zeii au fost de acord i au jurat s
pstreze secretul. Aa a fcut i Enki; dar el a gsit o cale sl avertizeze pe credinciosul su adorator Ziusudra (Noe n
Biblie) i s-l sftuiasc s construiasc Arca, pentru a-i
salva familia i prietenii i pentru a pstra vie smna

Povestea Marelui Potop este una dintre cele mai lungi

poveti ale Bibliei; totui, orict de lung ar fi, ea este o
versiune scurt a celor mai lungi i amnunite texte
sumeriene i akkadiene cu referire la acest eveniment. n
perioada ce a urmat, chiar Enlil s-a nduplecat. Realiznd c
tot ce au construit ei pe Pmnt fusese distrus, Anunnaki iau dat seama c aveau nevoie de Oameni ca parteneri pentru
a face din nou locuibil Pmntul. Cu acceptul lui Enlil, zeii
Anunnaki au contribuit la progresul cultural i tehnologic al
Oamenilor, n intervalul care a durat 3.600 de ani (ce a
marcat perioada orbital a lui Nibiru). Procesul a culminat cu
mreaa civilizaie sumerian.
La nceputul Potopului, Anunnaki au urcat pe navele lor
pentru a scpa de calamitate i au privit la dezastrul i
distrugerea Pmntului din cer. Nu doar Omenirea a fost
distrus: Tot ce au construit Anunnaki n ultimii 432.000 de
ani a fost ters de pe faa Pmntului sau ngropat sub
straturi groase de noroi; asta a inclus i portul spaial pe
care l aveau n E.DIN.
Curnd dup ce mareea a nceput s se retrag, ei au
putut s-i coboare nava, cu care au orbitat Pmntul, pe cel
mai nalt vrf muntos din Orientul Apropiat, vrful Ararat.
Dup ce a aprut din ape i pmntul uscat, ei au putut
folosi Locul Aterizrii - o platform uria din piatr care
fusese ridicat naintea Potopului n Munii Cedru, aflai pe
teritoriul Libanului de astzi. Dar pentru a relua operaiunile
spaiale, ei aveau nevoie de un port spaial; s-a luat decizia
ca acesta s fie construit n Peninsula Sinai. Pasajul
Aterizrii ca nainte de Potop a fost legat la vrfurile gemene
proeminente ale Muntelui Ararat; Locul Aterizrii a fost
ncorporat; a fost ales un nou Centru de Control a Misiunii
(care l nlocuia pe cel care n perioada prediluvian a fost la
Nippur); au fost ridicate i dou vrfuri gemene artificiale

pentru a lega terminalul Pasajului Aterizrii - cele dou mari

piramide la Gizeh, n Egipt, care rezist pn azi.
Vizat de rivalitile dintre cei ce preau s se grupeze n
dou clanuri distincte pe Pmnt, locaia portului spaial cu
dispozitivele sale auxiliare a cptat o importan major.
Pentru a diminua tensiunile, mprirea de facto a teritoriilor
ntre Enlil, n Edin i Enki, n Abzu, a fost formalizat,
primul i descendenii si au primit teritoriul din Asia i
prile vecine din Europa, iar ultimul a primit ntregul
continent african. Aceasta nsemna c Locul Aterizrii din
perioada prediluvian i noul Centru de Control al Misiunii
se aflau pe teritoriu Enlilit, iar marile piramide cu sistemul
lor complex de ghidare erau n minile zeilor Enki. S-a decis
apoi ca zona portului spaial din Peninsula Sinai s fie
atribuit, neutru, lui Ninmah. Pentru a marca evenimentul,
ea a primit titlul-epitet NIN.HAR.SAG (Doamna Vrfurilor
Prerea noastr c zeii Egiptului nu au fost alii dect Enki
i clanul su poate prea greu de crezut la prima vedere. Nu
erau numele lor, ca s ncepem cu ele, diferite total? Marele
Zeu Vechi al egiptenilor, de exemplu, se numea PTAH, Cel
care a dezvoltat; dar acesta a fost, de asemenea, nelesul
epitetului sumerian al lui Enki, NUDIMMUD, Furitorul
Lucrurilor Meteugite. El era Cunosctorul Secretelor,
arpele Divin, n ambele panteoane; i (reamintind epitetul
su cel al crui cas este apa) n ambele a fost descris ca
Omul Divin al Apelor (Fig. 14, 22), Vrstorul nostru. n
panteonul egiptean, Stpna Sinaiului a fost HATHOR, creia
i se spunea Vaca n perioada sa veche; la fel era numit i
Ninharsag n Sumer, atunci cnd a mbtrnit.
Fiul i principalul succesor al lui Enki n Egipt era RA, Cel
Pur, analog al lui Marduk, Fiul Movilei Pure, n
Mesopotamia. Multe alte asemnri ntre cele dou au fost

expuse n The Wars of Gods and Men. Acolo sunt artate i

motivele pentru identificarea zeului egipten THOTH, un fiu al
lui Ptah i pstrtor al cunotinelor secrete divine, cu zeul
Ningishzidda din textele sumeriene.
n timp, Ptah/Enki a transmis conducerea Egiptului fiului
su, Marduk/Ra; dar acesta din urm nu s-a potolit. Domnia
asupra ntregului Pmnt era dreptul su din natere,
continua el s afirme; i aceasta a condus la conflictul cu
Enliliii, pe care l-am descris ca Rzboaiele Piramidei. La un
moment dat - circa 8700 .Chr., dup calculele noastre - el a
fost obligat s prseasc Egiptul; potrivit lui Manetho (un
preot egiptean care a scris despre istoria i preistoria
Egiptului, n perioada greac), regatul a fost atunci
ncredinat fratelui lui Marduk, Thoth. Unde a plecat
Marduk/Ra? Posibilitatea ca el s fi fost trimis napoi pe
Nibiru (egiptenii o numeau Planeta de Milioane de Ani) nu
poate fi exclus. Un vechi text egiptean nscris n mormintele
faraonilor, numit Atribuirea Funciilor ctre Thoth, l arat pe
Ra transfernd puterile lui Thoth i desemnndu-l ca Thoth,
nlocuitorul. Tu vei fi n locul meu, a anunat Ra, un
nlocuitor. Explicnd unde este el, Ra i-a spus lui Thoth:
Eu sunt aici, n cer, n locul meu potrivit. Faptul c o parte
a absenei, aceea a semizeilor, a durat 3.650 de ani - aproape
media de 3.600 de ani a orbitei Nibiru - sugereaz n mod
convingtor c acolo i-a petrecut timpul Marduk cnd a
lipsit de pe Pmnt. Textele, deopotriv cele egiptene i cele
sumeriene, care descriu o cltorie spaial grea, ce devenise
primejdioas n special lng Saturn, pot s aib foarte bine
legtur cu cltoria de ntoarcere a lui Marduk pe Pmnt.
La ntoarcere, Ra/Marduk a gsit Pmntul greu de
recunoscut, n acest interval, civilizaia sumerian nflorise
foarte mult. n plus fa de extinderea centrelor lui Enlil i al
lui Enki unde zonele sacre erau nconjurate de orae

aglomerate (Nippur i respectiv Eridu), s-au creat Orae ale

Oamenilor. Instituia nou creat, Regalitatea, a fost
inaugurat n noul ora Kish, sub egida lui Ninurta.
Nannar/Sin primise conducerea noului centru urban numit
Ur. O zon sacr construit pentru vizita lui Anu i Antu a
fost extins i a devenit oraul Uruk (biblicul Erech) i a fost
druit lui Inanna/Ishtar. Funciile Preoiei au fost instituite;
a fost introdus un calendar - faimosul calendar din Nippur bazat pe cunotine astronomice complicate i pe festivaluri
oficiale. Aprut n 3760 .Chr., el este nc folosit la evrei.
ntors pe Pmnt, Marduk trebuie s fi strigat tatlui su
i ctre Consiliul Zeilor: i eu?
El a pus ochii pe un loc aflat nu departe de unde fusese
portul spaial n perioada prediluvian, i s-a hotrt s l
transforme ntr-o Bab-Ili - Poarta Zeilor (de aici numele su,
Babilon). Urma s fie un simbol i o expresie a supremaiei
Ceea ce a urmat este amintit n Biblie ca incidentul Turnul
Babel; a avut loc n Shine'ar (numele biblic pentru Sumer).
Acolo, discipolii zeului Babilonului au nceput s
construiassc un turn al crui vrf putea ajunge la cer - un
turn de lansare, am putea spune n zilele noastre.
Hai s ne facem un Sem, au spus ei - nu un nume, cum
este tradus obinuit, dar sensul originar din sursa
sumerian a cuvntului MU - un obiect asemntor unei
rachete. Era anul 3450 .Chr., dup calculele noastre.

Cobornd din cer, eful lui Elohim a ordonat ca turnul s

fie distrus. Deopotriv versiunea biblic i textele sumeriene
arat c n urma acestui incident, Elohim a hotrt s
creeze confuzie n limba Omenirii pentru a mpiedica
Omenirea s acioneze n mod unitar. Pn atunci existase o
singur limb i un singur fel de cuvinte peste ntregul
Pmnt(Geneza 11:1). Pn atunci existase ntradevr o
civilizaie, cea a Sumerului, cu o singur limb i form de
scriere (Fig. 24a). n urma incidentului de la Babilon, o a
doua civilizaie, Civilizaia Nilului (Egipt i Nubia) s-a
ntemeiat, cu propria sa limb i scriere (Fig. 24b); i cteva
secole mai trziu, a treia civilizaie a luat natere n Valea
Indusului, cu propria sa limb i scriere (Fig.24c), o scriere
care nu a fost nc descifrat. Astfel, Omenirii i-au fost
atribuite trei Regiuni; a Patra Regiune a fost pstrat de zei:
Peninsula Sinai, unde se afla portul spaial.
Dispreuit n Mesopotamia, Ra/Marduk s-a ntors n Egipt
pentru a-i reafirma supremaia acolo, ca Mare Zeu al noii
civilizaii. Era anul 3100 .Chr. Exista, desigur, o mic
problem cu Thoth, care fusese zeitatea domnitoare n Egipt

i Nubia n perioada n care Ra/Marduk a fost plecat. Fr

prea mult ceremonie, el a fost ndeprtat... Am artat n The
Lost Realms c, lundu-i un grup de discipoli africani, el s-a
ndreptat ctre Lumea Nou, pentru a deveni Quetzalcoatl,
zeul arpelui naripat. Primul calendar pe care l-a instituit el
n America de Sud (calendarul calculului lung) a nceput n
anul 3113 .Chr; credem c aceasta este data precis a sosirii
n Lumea Nou a lui Thoth/Quetzalcoatl.
nc afectat de eecul din Mesopotamia, crudul Marduk sa orientat spre stabilirea altor succese. n timpul absenei
sale, varianta divin a cuplului Romeo i Julieta - fratele
su Dumuzi i Inanna/Ishtar, nepoata lui Enlil - s-au
ndrgostit i urmau s se cstoreasc. Aceast uniune a
fost criticat de Ra/Marduk; el era ngrijorat n mod special
de speranele zeiei Inanna, care voia s devin Stpna
Egiptului prin cstorie. Cnd emisarii lui Marduk au
ncercat s-l prind pe Dumuzi, acesta a murit accidental,
ncercnd s scape. Marduk a fost nvinovit de moartea sa.
Textele care au fost descoperite n cteva copii i versiuni
dau detalii cu privire la procesul lui Marduk i pedeapsa sa:
s fie ngropat de viu n Marea Piramid, care a fost sigilat
bine, transformndu-se ntr-o nchisoare divin. Avnd doar
aer ca s respire, fr ap i mncare, Marduk a fost
condamnat la moarte n acel mormnt uria. Dar soia i
mama sa au fcut un apel, cu succes, la Anu s-i comute
acestuia pedeapsa n condamnarea la exil. Folosind planurile
originale de construcie, a fost spat un canal care s-a
transformat n pasaje ce duceau deasupra gurii de ieire.
Rentoarcerea lui Marduk din moarte, ridicarea sa din
mormnt au fost aspecte ale concepiei c textele - intitulate
de ctre traductorii vechi Moartea i nvierea Domnului au precedat povestea din Noul Testament cu privire la
moartea, ngroparea i nvierea lui Iisus.

Condamnat la exil, Ra/Marduk a devenit Amen/Ra, zeul

nevzut. De aceast dat, totui, el a cutreierat Pmntul.
ntr-un text autobiografic n care a fost profeit ntoarcerea
sa, Marduk i-a descris rtcirile astfel:
Sunt divinul Marduk, un mare zeu.
Am fost alungat pentru pcatele mele.
Am plecat ctre muni,
Pe multe pmnturi am fost rtcitor.
De acolo unde rsare soarele
Ctre acolo unde apune el, am fost.
i oriunde mergea, el continua s-i ntrebe pe Zeii
Destinului: Pn cnd?
Rspunsul cu privire la Soarta sa, a realizat el, vine din
cer. Era Taurului, era zodiacal ce aparinea lui Enlil i
clanului su, era pe sfrite. nceputul avea s vin cnd
Soarele ar fi rsrit n prima zi de primvar, ziua Anului
Nou n Mesopotamia, n constelaia zodiacal a Berbecului constelaia sa. Ciclul ceresc al Sorii prevestea supremaia sa,
a lui Marduk!
Nu toi au fost de acord. S-a ntmplat aa din cauza unor
calcule ale timpului sau a unui fenomen ceresc vizibil? Lui
Marduk nu i-a psat; el a lansat un mar spre Mesopotamia,
n timp ce fiul su, Nabu, i-a organizat pe discipoli pentru a
invada Sinai i confisca portul spaial. Escaladarea
conflictului este descris ntr-un text cunoscut ca Erra Epos:
el spune cum, nevznd o alt soluie, zeii s-au opus lui
Marduk folosind armele nucleare pentru a distruge portul
spaial (i, ca un element colateral, oraele necredincioase,
Sodoma i Gomora).
Dar Soarta a intervenit de partea lui Marduk. Vnturile
vestice au purtat norul nuclear mortal spre est, ctre Sumer.
Babilonul, aflat mai spre nord, a fost cruat. Dar n sudul
Mesopotamiei Vntul Ru a provocat moartea brusc i

pustiirea pentru o perioad lung. Marea capital a

Sumerului, Ur, era locul unde hoinreau cinii slbatici.
i astfel, n ciuda eforturilor extraordinare ale oponenilor
lui Marduk, Era Berbecului a inaugurat, ntradevr, ridicarea
A fost Soarta sau Destinul ceea ce l-a condus cu o mn
nevzut prin toate problemele i necazurile sale de-a lungul
a multe milenii, ctre scopul su final: supremaia pe
Puine limbi au astfel de forme ale cuvintelor pentru acel
ceva care poate influena rezultatele evenimentelor nainte
ca acestea s se ntmple i chiar n limba englez pentru
muli ar fi greu s explice diferena. Cele mai bune dicionare
(cum ar fi al lui Webster) explic un termen prin cellalt,
privindu-le ca sinonime pentru soart, destin i noroc.
Dar n limba sumerian i astfel, n filosofia i religia
sumerian, exista o distincie clar ntre cele dou. Destinul,
NAM, era cursul hotrt al evenimentelor care era
neschimbat. Soarta era NAM.TAR - cursul hotrt al
evenimentelor ce putea fi schimbat; literal, TAR nsemna a
tia, a schimba, a tulbura, a rupe.
Distincia nu era doar o chestiune de semantic, ci una de
profunzime, afectnd i dominnd relaiile dintre zei i
oameni, teritorii i orae. Era ceva care urma s se ntmple,
ceva care chiar s-a ntmplat - un Destin, rezultatul (i, dac
vrei, destinaia spre care conducea) neschimbat; sau era o
combinaie de evenimente norocoase, decizii voite sau cderi
i urcuuri temporare ce puteau fi sau nu fatale, c un alt
eveniment norocos, o rugciune sau o schimbare a modului

de via putea conduce la un sfrit sau rezultat diferit?

Linia fin de demarcaie dintre cei doi termeni poate fi
astzi confuz, dar ea era foarte bine delimitat n vremurile
sumeriene i biblice. Pentru sumerieni Destinul ncepea n
cer, pornind cu cile orbitale prestabilite ale planetelor. Odat
ce a luat natere Sistemul Solar cu formele i compoziia sa,
dup Btlia Cereasc, orbitele planetelor au devenit Destine
venice; termenul i conceptul a putut fi aplicat atunci
cursului de evenimente viitoare de pe Pmnt, ncepnd cu
zeii care aveau omologi cereti.
n conceptul biblic, Yahve era cel care controla deopotriv
Destinele i Sorii, dar, n vreme ce primele erau predestinate
i neschimbate, cele din urm puteau fi schimbate prin
deciziile omului. Datorit puterilor celui dinti, cursul
evenimentelor viitoare putea fi prezis cu ani, secole i chiar
milenii mai nainte, ca atunci cnd Yahve i-a dezvluit lui
Avraam viitorul descendenilor si, inclusiv cltoria de 400
de ani n Egipt (Geneza 15:13 - 16). Cum avea s se ncheie
acea cltorie care a nceput cu cutarea de mncare n
perioada marii foamete era o chestiune de Soart; faptul c
acea cltorie a nceput cu o primire neateptat (pentru c
Iosif, dup o serie de ntmplri consecutive, devenise
Supraveghetor peste Egipt) a fost o chestiune de Soart; dar
faptul c acea cltorie (dup o perioad de sclavie) s-a
terminat cu un Exod al eliberrii ntr-un timp predefinit era
una de Destin, prestabilit de ctre Yahve.
Deoarece au fost chemai s profeeasc alturi de
Dumnezeu, profeii biblici puteau prezice viitorul regatelor i
al rilor, al oraelor, regilor i indivizilor. Dar ei spuneau clar
c profeiile lor erau, pur i simplu, expresia deciziilor divine.
Astfel a spus Yahve, Stpnul Mulimilor, era un mod
frecvent prin care i ncepea Profetul Ieremia prezicerea
despre viitorul regatelor i conductorilor. Aa a spus

Stpnul Yahve, anuna Profetul Arnos.

Dar cnd este vorba despre Soart, ar putea intra i a
intrat n joc voina i libera alegere a oamenilor i a
naiunilor. Spre deosebire de Destine, Soarta poate fi
schimbat, iar pedepsele ar putea fi evitate dac dreptatea
nlocuiete pcatul, evlavia nlocuiete blasfemia, dac
rufctorului este ceea ce caut, dar ca cel ru s se ntoarc
de pe drumul su i s triasc, a spus Stpnul Dumnezeu
Profetului Ezechiel (33:11).
Distincia fcut de ctre sumerieni ntre Soart i Destin
i cum puteau ele deopotriv s joace un rol chiar n viaa
unui singur individ, devine evident n povestea vieii lui
Ghilgame. El a fost, dup cum am menionat, fiul lui Uruk,
nalt preot, i al zeiei Ninsun. Cnd a crescut i a nceput s
mediteze la problemele vieii i ale morii, el i-a pus o
ntrebare naului su, zeul Utu/Shamash:
n oraul meu omul moare; mpovrat este inima mea.
Omul dispare, grea este inima mea...
Omul, cel mai nalt, nu se poate ntinde spre cer;
Omul, cel mai lat, nu poate acoperi Pmntul.
Voi privi peste zid i eu?
Voi fi i eu predestinat astfel?
Rspunsul lui Utu/Shamash nu a fost ncurajator: Cnd
zeii au creat Omenirea, a spus el, i-au dat moartea; Viaa
au pstrat-o n propria lor stpnire. Acesta este Destinul
tu; aadar, ct trieti i ceea ce faci n acest timp este
Soarta pe care o poi schimba sau influena, bucur-te de ea
i triete din plin:
Umple-i pntecul, Ghilgame,
Fii vesel ziua i noaptea!
Din fiecare zi f o srbtoare a bucuriei;
Zi i noapte, danseaz i joac!

mbrcmintea ta s fie proaspt strlucitoare,

mbiaz-te n ap, las capul tu s fie splat,
D-i atenie celui mic care i ine mna,
Las soia s fie ncntat la snul tu.
Aceasta este soarta Omenirii.
Primind acest rspuns, Ghilgame i-a dat seama c ceea
ce trebuie el s fac este s ia nite msuri care s-i schimbe
Destinul, nu doar Soarta; altfel, ar putea avea acelai sfrit
ca orice muritor. Cu binecuvntarea mamei sale, el a pornit
n cltoria ctre Locul Aterizrii, n Munii Cedru, pentru a
se altura zeilor de acolo. Dar Soarta a intervenit, din nou i
din nou. Prima dat a fost sub nfiarea lui Huwawa,
gardianul robot din Pdurea Cedru, apoi prin pofta zeiei
Inanna/Ishtar pentru rege, iar refuzul a condus la uciderea
Taurului Ceresc. Rolul Soartei - Namtar - a fost recunoscut i
luat n considerare de ctre Ghilgame i tovarul su
Enkidu, chiar atunci, dup uciderea lui Huwawa. Textul
epopeii povestete cum cei doi tovari stteau i se gndeau
la pedeapsa care avea s vin. Fiind cel care a ucis de fapt,
Enkidu cugeta la cum va fi Soarta sa. Ghilgame l alina: Nu
te ngrijora, spunea el; ndurtorul Namtar ntradevr
poate devora - dar el poate, de asemenea lsa pasrea
prins s se ntoarc la locul ei, lsa omul prins s se
ntoarc la snul mamei sale. Cderea n minile lui Namtar
nu este o ntmplare ce nu ar putea fi schimbat; deseori,
soarta se inverseaz.
Refuznd s renune, Ghilgame a pornit n a doua
cltorie, de aceast dat ctre portul spaial din Peninsula
Sinai. Problemele i necazurile sale pe drum au fost
nenumrate, dar el i-a continuat drumul, n cele din urm,
el a reuit s obin fructul care i-ar fi putut da tinereea
venic; dar, n final, un arpe i l-a smuls n timpul n care
obosit, Ghilgame a adormit, astfel c s-a ntors cu minile

goale n Uruk, unde a i murit.

O serie de ntrebri i dac? ne vin evident n minte. Dac
lucrurile s-ar fi desfurat diferit n Munii Cedru, ar fi reuit
Ghilgame s urce la cer i s se alture zeilor pe planeta
lor? Dac nu ar fi adormit, ar fi pstrat Planta Tinereii
Un text sumerian, numit de ctre oamenii de tiin
Moartea lui Ghilgame, ne d un rspuns. Sfritul, explic
el, a fost predestinat; nu exista nicio cale ca Ghilgame,
lundu-i Soarta n propriile mini de mai multe ori, s-i
poat schimba Destinul. Textul precizeaz aceast concluzie
prin descrierea visului profetic al lui Ghilgame, vis care i
prevedea sfritul. Iat ce i s-a spus lui Ghilgame:
O, Ghilgame,
Acesta este nelesul visului:
Marele zeu Enlil, tatl zeilor,
A hotrt destinul tu.
A decis soarta pentru regat;
Viaa etern nu i este destinat.
Soarta lui Ghilgame, i s-a spus, fusese prescris de
Destin. Lui i-a fost sortit s fie rege; nu i-a fost destinat s
evite moartea. i, aa cum i-a fost destinat, Ghilgame a fost
descris murind. El care a avut muchi tari, sttea ntins
incapabil s se ridice... El, care a urcat munii, sttea ntins,
nu se putea ridica. n patul lui Namtar sttea ntins, nu se
putea ridica.
Textul enumera toate ntmplrile fericite prin care a trecut
Ghilgame - domnia, victoriile n btlii, o familie
binecuvntat, servitori credincioi, mbrcminte frumoas;
dar, recunoscnd interferena Soartei cu Destinul, i explic
lui Ghilgame concluzia: Deopotriv lumina i ntunericul
Omenirii i-au fost date ie. Dar n final, deoarece Destinul a
prescris Soarta, Ghilgame, fiul lui Ninsun, este mort.

ntrebarea i dac? poate fi extrapolat de la un individ la

Omenire n ansamblul su.
Care ar fi fost cursul evenimentelor pe Pmnt (i n
ntregul Sistemul Solar), a reuit planul original al lui Ea de a
extrage aur din apele Golfului Persic?
ntr-un moment crucial al evenimentelor, Anu, Enlil i Ea
au tras la sori pentru a vedea cine va putea conduce Nibiru,
cine va merge la minele din Africa de sud-est i cine va
conduce expansiunea Edinului. Ea/Enki a mers n Africa i
ntlnind acolo hominizi evoluai, a putut spune zeilor: Fiina
de care avem nevoie exist - tot ceea ce trebuie s facem este
s i dm trstura noastr genetic!
Textul Atra Hasis, care a fost adunat laolalt din mai multe
interpretri i fragmente de ctre W. G Lambert i A. R.
Millard, a descris astfel momentul inevitabil:
Zeii i-au strns minile,
Au tras la sori i au mprit.
Ar fi avut loc experimentul de inginerie genetic dac fie
Anu, fie Enlil era cel care mergea n Africa de sud-est?
Am fi aprut noi pe planeta noastr oricum, evolund
singuri? Probabil - pentru c aa au evoluat i Anunnaki pe
Nibiru (din aceeai smn a vieii!) dar cu mult naintea
noastr. Dar noi am aprut pe Pmnt printr-un experiment
de inginerie genetic, atunci cnd Enki i Ninmah au srit o
etap a evoluiei i l-au fcut pe Adam primul copil n
Lecia desprins din Epopeea lui Ghilgame este c Soarta
nu poate schimba Destinul. Evoluia lui Homo sapiens pe
Pmnt, credem noi, a fost o chestiune de Destin, un rezultat
final care ar fi putut fi amnat sau atins altcumva, dar atins
fr niciun dubiu. ntradevr, credem c, dei venirea zeilor
Anunnaki pe Pmnt prea s fi fost decizia lor, pentru
propriile lor nevoi, aceasta a fost predestinat, rezultat al

unui plan cosmic. i credem, n aceeai msur, c Destinul

Omenirii va fi s repete ceea ce au fcut Anunnaki cu noi, s
mearg pe alt planet i s nceap din nou procesul.
Cel care a neles conexiunea dintre Soart i cele 12
constelaii zodiacale a fost nsui Marduk. Ele constituiau
ceea ce am numit Timpul Ceresc, legtura dintre Timpul
Divin (perioada orbital a lui Nibiru) i Timpul Pmntean
(anul, lunile, anotimpurile, zilele i nopile ce rezultau din
orbita Pmntului, nclinaia i micarea de revoluie n jurul
propriei axe). Semnele cereti pe care le-a invocat Marduk sosirea Erei Zodiacale a Berbecului - erau semne din zona
Sorii. De ceea ce avea el nevoie pentru a-i consolida
supremaia pentru a elimina noiunea potrivit creia, ca
Soart, ea putea fi schimbat, revizuit sau inversat - era
un Destin Ceresc. i n acest scop el a poruncit ceea ce noi
considerm cea mai ndrznea falsificare.
Vorbim despre textul originar i cel mai sacru al popoarelor
antice: Epopeea Creaiei, centrul i temelia credinei, a religiei
i tiinei lor. Uneori numit dup primele sale versuri,
Enuma elish (Atunci cnd n nlimile Cerului) era o poveste
despre evenimentele din cer care i implicau pe zeii cereti i
o Btlie Cereasc, al crei rezultat favorabil a fcut posibile
toate lucrurile bune de pe Pmnt, inclusiv apariia
Fr excepie, textul a fost considerat de ctre oamenii de
tiin, care l-au adunat din mai multe fragmente, un mit, o
alegorie a eternei lupte dintre bine i ru. Faptul c peretele
sculptat descoperit n Mesopotamia descria un zeu naripat
(ceresc) luptnd cu un monstru naripat (ceresc), (Fig. 25) a
ntrit opinia c exista un precursor strvechi al povetii cu
Sf. George i Balaurul. ntradevr, cteva dintre traducerile
timpurii ale unei pri a textului l-au numit Bel i Dragonul.
n acele texte, Dragonul era numit Tiamat, iar Bel

(Stpnul) nu era altul dect Marduk.

Era doar anul 1876 cnd George Smith, lucrnd la Muzeul
Britanic la mbinarea fragmentelor de tblie de lut din
Mesopotamia, a publicat capodopera sa, The Chaldean
Genesis, n care sugereaz existena unei poveti babiloniene
care se aseamn cu pri ale Creaiei din Geneza biblic;
dup aceea, custodele Muzeului de Antichiti Babiloniene, L.
W. King, a lucrat susinut la Cele 7 Tblie ale Creaiei pentru
a vedea corelaiile dintre cele apte zile biblice ale Creaiei i
sursele mesopotamiene timpurii.
Dar, n acest caz, cum putea textul babilonian s fie nc
numit o alegorie? Pentru c fcnd asta, trebuia de
asemenea ca povestea Genezei s fie considerat tot o
alegorie, i nu un Act Divin de neschimbat, temelia
monoteismului i a credinelor iudeocretine.
n cartea noastr din 1976, A 12-a Planet, am artat c
nici textul mesopotamian, nici versiunea sa comprimat din
Biblie nu erau un mit sau o alegorie. Ele erau bazate, am
sugerat, pe cea mai complicat cosmogonie care, avnd la
baz tiina avansat, a descris crearea Sistemului nostru
Solar pas cu pas; apoi, apariia unei planete rtcitoare din
spaiul exterior care a intrat ncet n Sistemul nostru Solar,
urmnd o ciocnire ntre ea i un mai vechi membru din
familia Soarelui. Btlia Cereasc ce a urmat ntre invadator
-Marduk - i planeta veche - Tiamat - a dus la distrugerea
lui Tiamat. Jumtate din el s-a rupt n buci, care au
devenit Centura de Asteroizi; cealalt jumtate a trecut pe o
nou orbit, a devenit planeta Pmnt, purtnd cu ea cel mai
mare satelit al lui Tiamat, pe care noi l numim Luna.
Invadatorul, atras n centrul Sistemului nostru Solar i
ncetinit n urma coliziunii, a devenit, pentru totdeauna, al
12-lea membru al Sistemului nostru Solar.
n cartea urmtoare, Genesis Revisited (1990), am artat

c toate progresele din domeniul cunotinelor astrale au

confirmat legenda sumerian, poveste n care se explic n
mod satisfctor istoria Sistemului nostru Solar, misterul
continentelor Pmntului care ncepe doar pe de o parte cu o
imens prpastie (bazinul Pacificului), originea Centurii de
Asteroizi i a Lunii, motivul pentru care Uranus st pe o
parte, iar Pluto are o orbit ciudat etc. Cunotinele
suplimentare pe care le-am strns din studierea cometelor,
folosirea telescopului Hubble i probele de pe Lun
(disponibile) i alte planete din Sistemul nostru Solar (din
nave spaiale fr pilot) continu s confirme informaiile
sumeriene aa cum le-am neles noi.
Numind cosmogonia care st la baza Epopeii Creaiei mai
degrab sumerian dect babilonian, obinem un indiciu
despre adevrata surs i origine a textului. Descoperirea
fragmentelor din versiunea sumerian timpurie a lui Enuma
Elish i-a convins pe oamenii de tiin c Epopeea Creaiei a
fost un text de origine sumerian, n care planeta invadatoare
se numea NIBIRU, nu Marduk. Ei erau convini acum c
versiunea babilonian existent a fost un fals deliberat,
avnd ca scop s ateste c Marduk era cel care a fost pe
Pmnt cu zeul ceresc/planetar care a schimbat aspectul
cerului nostru, a dat Sistemului nostru Solar forma actual
i - ntr-un fel - a creat Pmntul i tot ce este pe el. Aceasta
a inclus i Omenirea, pentru c, potrivit versiunii originale
sumeriene, Nibiru a fost cea care, venind dintr-o alt parte a
Universului, a adus cu ea i a mprit pe Pmnt n timpul
coliziunii, Smna Vieii.
De fapt, trebuie s nelegem c ilustraia reprezentrii lui
Marduk n lupt cu Dragonul, este, de asemenea, greit.
Este o descriere din Asiria unde zeul suprem era Ashur, nu
Babilon; zeitatea este descris ca un om-vultur, care indic o
fiin Enlilit; el poart o casc divin cu trei perechi de

coarne, indicnd rangul 30, care nu era rangul lui Marduk;

arma sa este un fulger bifurcat, care era arma divin a lui
Ishkur/Adad, fiul lui Enlil, nu al lui Enki.

Nu mult dup ce Marduk i-a instituit suveranitatea n

Babilon, principalele ritualuri de Anul Nou au fost
schimbate, cerndu-se citirea n public (n a patra sear a
festivalului) a poemului Enuma elish n noua sa versiune,
babilonian; n el, supremaia lui Marduk pe Pmnt era
egalat numai de supremaia sa n cer, ca planet cu cea mai
mare orbit, care le include pe toate celelalte n curba sa.
Cheia acestei distincii era termenul Destin. Era termenul
folosit pentru a descrie cile orbitale. Orbita venic,
neschimbat, era cea a planetei Destinului; i, potrivit
poemului Enuma elish, aceasta a fost dat lui Marduk.
Odat ce nelegem c acestea sunt sensul i semnificaia
termenului vechi pentru orbite, se pot urmri paii prin
care Marduk a atins Destinul. Termenul este folosit pentru
prima dat n text n legtur cu principalul satelit al lui
Tiamat (pe care textele l numesc Kingu). La nceput este doar
unul dintre cei 11 satelii (luni) ai lui Tiamat; dar cnd a
crescut n dimensiune, el a devenit conductorul mulimii
sale. Fiind cndva singura planet mare i nsoitoare a lui

Apsu (Soarele), Tiamat a devenit trufa i nu a fost prea

ncntat s vad ceilai zei cereti aprnd n pereche:
Lahmu i Lahamu (Marte i Venus) ntre ea i Soare (unde
fusese nainte doar mesagerul Soarelui, Mammu/Mercur) i
perechile Kishar i Anshar (Jupiter i Saturn, ultimul cu
mesagerul su, Gaga/Pluto), apoi Anu i Nudimmud (Uranus
i Neptun). Tiamat i grupul su de luni, pe de o parte, i
noile planete, pe de alt parte, ntr-un Sistem Solar nc
instabil, au nceput s-i ncalce unii altora domeniile.
Ceilali erau n mod special ngrijorai cnd nelegiuitul
Tiamat i-a extins lui Kingu, cel mai mare satelit al ei,
privilegiul de a avea propria sa orbit, devenind o planet cu
drepturi depline:
Ea a instituit o Adunare...
Ea a suportat zeii-monstru;
Peste 11 de acest fel ea duce mai departe.
Dintre zeii care formeaz Adunarea ei
Ea a ales pe Kingu, primul ei nscut,
l-a fcut pe el ef printre zei;
Ea la slvit pe Kingu,
n mijlocul lor l-a fcut mare...
Ea i-a dat o Tbli a Destinelor,
Ea i-a fixat-o pe piept, (spunnd):
Acum conducerea nu va fi schimbat niciodat,
Decizia va rmne neschimbat!
Incapabili s opun ei nii rezisten furiei lui Tiamat,
zeii cereti au vzut salvarea venind din afara Sistemului
Solar. Cum a fost cazul lui Adam, creat cnd a aprut un
impas, la fel a fost i acum, n cerurile primordiale. Ea
(Nudimmud, Creatorul Priceput) a fost cel care a adus
creatura salvatoare. Fiind cea mai ndeprtat planet,
confruntndu-se cu Adncul - spaiul exterior el a atras un
strin, o planet nou. Trecnd prin vecintatea Sistemului

nostru Solar ca rezultat al unei catastrofe, un accident

cosmic ndeprtat, noua planet este rezultatul Soartei i nu
orbita nc Soarele - el nu are Destin pn acum:
n Camera Sorii,
Sala Desenelor,
Bel, cel mai nelept dintre zei,
A fost creat;
n inima Adncului a fost zeul creat.
Este de remarcat c nou sosita planet, un zeu ceresc, este
numit chiar n interpretarea babilonian Bel, Stpnul, iar
n versiunea asirian cuvntul Bel este nlocuit cu cel de
Ashur. Versiunea babilonian - folosit cel mai frecvent n
zilele noastre - repet ultimul rnd, i a doua oar l
interpreteaz: n inima Adncului pur a fost creat Marduk,
adugarea cuvntului pur are ca scop s explice originea
numelui MAR.DUK, Fiul Locului Pur. (Aceast dubl
interpretare este unul dintre indiciile care arat falsificarea).
n afar de Ea (Neptun), Anu (Uranus) l-a primit bine pe
invadator. Fora gravitaional n cretere l-a fcut pe
invadator s aib patru luni i l-a mpins spre centrul
Sistemului Solar. Cu timpul, el a ajuns la Anshar (Saturn) i
a atras alte trei luni; invadatorul era deja atras inevitabil n
cmpul gravitaional al Soarelui. Cursul su s-a curbat n
interior (Fig. 26), ncepnd s-i formeze un traseu orbital n
jurul Soarelui. Cu alte cuvinte, invadatorul i prevedea un
Destin pentru el nsui!
O dat el a fost srutat de ctre Anshar/Saturn.
Zeii, strmoii lui,
Destinul lui Bel l-au hotrt atunci;
Ei l-au pus pe un drum,
Calea spre succes i realizare.
Calea predestinat lui, aadar, a aflat Bel, era ndreptat
ctre o coliziune cu Tiamat. El a acceptat provocarea cu o

Zeii cereti au acceptat condiia lui Marduk. Pentru
Marduk, Rzbuntorul lor, ei au decis un destin; i acel
Destin, acea orbit, va fi de neegalat. Acum, au spus,
mergi i ucide-o pe Tiamat!
Btlia Cereasc ce a urmat este descris n a patra tbli
din Enuma elish. Stabilite inevitabil pe un curs de ciocnire,
Marduk i Tiamat au aruncat fulgere, flcri i capcane
gravitaionale unul ctre altul, scuturnd cu furie. Cnd se
apropiau unul de cellalt -Tiamat micndu-se, ca toate
planetele, n sensul invers acelor de ceasornic, Marduk
nvlind n direcia acelor de ceasornic - una dintre lunile
satelit ale lui Marduk a lovit-o prima pe Tiamat.
Apoi una cte una, celelalte luni ale sale au lovit-o pe
Tiamat -rupnd-o, fisurnd-o. Un fulger divin, un trsnet
electric imens a pornit atunci de la Marduk i a ptruns n
fisur, iar suflarea lui Tiamat s-a stins.
Intact, Marduk a trecut pe lng ea, a fcut un traseu pe
orbit i s-a ntors la locul btliei. De aceast dat el nsui
a lovit-o pe Tiamat cu consecine majore. Jumtate din ea a
fost spart de ctre Marduk n buci pentru a deveni Marea
Centur (Centura de Asteroizi); cealalt jumtate, lovit de
luna lui Marduk, s-a numit Vntul Nordic, a fost orientat
spre un nou loc din cer, pentru a deveni Pmntul pe o orbit
nou. Numele su sumerian, KI (de unde vine termenul
akkadian/ebraic Gei i cel grecesc Gheea) nsemna cel
separat (Fig. 27).
Deoarece lunile lui Tiamat s-au dispersat - multe
schimbnd direcia orbitelor n sensul acelor de ceasornic
(retrograd) - o soart special a fost hotrt de ctre Marduk
pentru cea mai mare dintre acestea, Kingu:
El a luat de la el Tblia Destinelor,
Nu era pe bun dreptate a lui Kingu,

l-a sigilat cu un sigiliu

i l-a fixat pe propriul su piept.
Acum, n sfrit, Marduk a obinut un Destin permanent,
neschimbat - un traseu orbital pe care de atunci aduce
mereu invadatorul de odinioar ctre locul Btliei Cereti
unde fusese odat Kingu. mpreun Marduk i lundu-l n
considerare i pe Kingu (Luna noastr), pentru c el avea un
Destin, Soarele i familia sa au ajuns la numrul 12.
Acest numr a fost, sugerm noi, cel care a fcut ca 12
s fie numr ceresc i, astfel, cele 12 staii (case) ale
zodiacului, 12 luni ntr-un an, un ciclu noapte-zi ce
dureaz 24 ore - dublul cifrei 12, 12 triburi ale Israelului,
12 apostoli ai lui Isus.
Sumerienii consider lcaul (numit centru de cult de cei
mai muli oameni de tiin) lui Enlil ca Centrul Pmntului,
locul fa de care celelalte locaii cheie se aflau la distan
egal, epicentrul locurilor concentrice divine. Cel mai bine
cunoscut cu numele su akkadian/semitic de mai trziu,
oraul Nippur, avea numele sumerian NIBRU.KI - Locul
Trecerii, reprezentnd pe Pmnt Locul Ceresc al Trecerii,
locul Btliei Cereti, la care Nibiru continua s se ntoarc
la fiecare 3.600 de ani.
Funcionnd ca Centru de Control al Misiunii, Nippur a
fost locul lui DUR.AN.KI, Legtura Cerului cu Pmntul, de
unde erau controlate operaiunile spaiale ale Anunnaki i
unde hrile cerului, toate datele cu privire la micrile
cereti ale membrilor Sistemului nostru Solar la urmrirea
Timpului Divin, Timpului Ceresc i a celui Pmntean,
precum i interconectarea lor erau meninute i calculate.

Urmrirea a ceea ce preau s fie traseele orbitale

neschimbate se fcea cu ajutorul Tblielor Destinelor. Putem
ntrezri funciile lor i camera sacr unde vibrau i
murmurau citind ce s-a ntmplat cnd funcionarea lor s-a
oprit brusc. Textul sumerian, numit de traductori Mitul lui
Zu, descrie asta n legtur cu trdarea zeului Zu (numele
su ntreg, s-a descoperit mai trziu, era AN.ZU Cunosctorul Cerului) care a vrut s uzurpe Legtura CerPmnt, apucnd i lund Tbliele Destinelor. Totul s-a
oprit; lumina s-a stins ncet; s-a rspndit linitea; i n
ceruri cei care se aflau pe navete spaiale i rachete, Igigi, n
spaiu erau confuzi. (Povestea se termin cu nfrngerea lui
Zu de ctre Ninurta, fiul lui Enlil, reinstalarea Tblielor
Destinelor la Duranki i executarea lui Zu).
Distincia ntre un Destin invariabil i o Soart ce poate fi
schimbat sau evitat, a fost exprimat n a doua parte a
Imnului lui Enlil, care descrie deopotriv puterile lui ca factor
de decizie al Soartei i ca un rostitor al Destinelor:

n ceruri el este Prinul,
Pe Pmnt el este eful.
Conducerea sa este vast,
Rostirea sa este mrea i sfnt;
Pstorul Enlil decide Soartele.
Conducerea sa n nlimi face cerurile s tremure,
Dedesubt el face Pmntul s se cutremure.
El rostete destinele pentru viitorul ndeprtat,
Deciziile sale sunt de neschimbat.
El este Stpnul care tie destinul Pmntului.
Destinele, credeau sumerienii, erau de natur cereasc.
Dar, dei era un zeu cu rang nalt, rostirile sale cu privire la
Destinele neschimbate nu erau un rezultat al planului su
sau al propriilor sale decizii. Informaiile i erau aduse la
cunotin; el era un stpn care cunotea Destinul
Pmntului, el era un numit de ncredere - nu un profet

uman, ci un profet divin.

Era total diferit cnd - consultndu-se cu ceilali zei - el
decidea Soartele. Uneori n consulta doar pe vizirul su de
ncredere, Nusku:
Cnd n mreia sa el decide soartele porunca sa, cuvntul care se afl n inima sa preamritului su vizir, ambelanul Nusku,
i aduce la cunotin, pe el l consult.
Nu doar Nusku, ambelanul lui Enlil, dar i soia sa, Ninlil,
este descris n imnul su ca fiind cea care particip la
procesul de decizie al soartelor:
Mama Ninlil, sfnta soie,
Ale crei cuvinte sunt binevoitoare...
Cea priceput la vorbe al crei discurs este elegant,
St ea nsi de partea ta..
Ea vorbete convingtor cu tine,
optind cuvinte lng tine,
Hotrte soartele.
Soartele, credeau sumerienii, erau fcute, hotrte i,
schimbate pe Pmnt; i n ciuda cuvintelor de adorare sau
consultare din imn, se pare c hotrrea Soartelor - inclusiv
cea a lui Enlil - s-a realizat printr-un proces care a fost mai
democratic, mai apropiat de cel al unei monarhii
constituionale. Puterile lui Enlil preau s provin nu doar
de sus, de la Anu i Nibiru, ci i de jos, de la Adunarea Zeilor
(un fel de parlament sau congres). Cele mai importante
decizii decizii cruciale - erau luate n cadrul Consiliului
Marilor Zei, un fel de Cabinet al minitrilor, unde uneori
discuiile deveneau dezbateri i deseori se transformau n
dispute aprinse...
Referirile la Consiliu i la Adunarea zeilor Anunnaki sunt
numeroase. Crearea lui Adam a fost un astfel de subiect
dezbtut; la fel i decizia de a terge Omenirea de pe faa

Pmntului n vremea Potopului. n cazul acesteia din urm,

se arat clar c: Enlil a deschis gura s vorbeasc i s-a
adresat Adunrii zeilor. Ideea de a distruge Omenirea a fost
refuzat de ctre Enki care, nereuind s echilibreze
adunarea, a ajuns s se sature de edina din Adunarea
Zeilor. Citim mai departe, c, atunci cnd zeii orbitau
Pmntul, n nava lor, observnd paguba de pe pmnt,
Ishtar a deplns ceea ce vedea i se ntreba cum a putut s
voteze pentru distrugerea Omenirii: Cum am putut eu, n
Adunarea Zeilor, eu nsmi, s dau un sfat greit?
i dup Potop, atunci cnd oamenii rmai au nceput s
umple din nou Pmntul, iar Anunnaki au dat Omenirii
civilizaia i au instituit Regalitatea ca o modalitate de a
dezvolta rasa uman:
Marii Anunnaki care hotrsc Soartele
Au schimbat sfaturile lor cu privire la pmnt.
Acest mod de decizie asupra Soartelor nu se limita doar la
relaiile Oamenilor; se aplica de asemenea i la zei nii.
Astfel, cnd Enlil, n vremurile timpurii ale sosirii sale pe
Pmnt, a plcut o tnr femeie Anunnaki i a fcut
dragoste cu ea mpotriva voinei ei, el a fost condamnat la
exil, la nceput de ctre cei 50 de Zei Seniori din adunare,
apoi de ctre zeii hotrtori ai Soartei, apte dintre ei.
Acesta a fost modul n care, potrivit versiunii babiloniene a
poemului Enuma elish, a fost confirmat Destinul lui Marduk
de a fi suprem pe Pmnt (i la fel n ceruri). n acel text,
Adunarea Zeilor este descris ca fiind o adunare a Zeilor
Seniori, venii din locuri diferite (i probabil nu doar de pe
Pmnt, pentru c, n plus fa de Anunnaki, delegaiile i
includeau i pe Igigi). Numrul de membri ai acestei adunri
era de 50 - un numr care semnifica rangul numeric al lui
Enlil. n textele akkadiene ei erau numii Ilani rabuti sha
mushimu shimati - Seniori/Mari Zei care decid Soartele.

Descriind cum Zeii Seniori s-au strns ca s proclame

supremaia lui Marduk, Enuma elish zugrvete o scen
camaradereasc, cu zeii care se comportau ca nite prieteni
ce nu se mai vzuser de mult timp. Ei au sosit la un Loc
special al Adunrii; s-au srutat unul pe altul... Au fcut
conversaie; s-au aezat s petreac; au mncat pine de
srbtoare, au but vin ales. Apoi camaraderia s-a
transformat n solemnitate cnd cei apte Zei ai Destinului
au intrat n Sala Adunrii i s-au aezat s nceap imediat
Din motive inexplicabile, Marduk a fost testat n privina
puterilor sale magice. Arat-ne, a spus adunarea
Anunnaki, cum poi s ceri distrugerea la fel cum ceri
Ei au format un cerc i au pus n el imaginile
constelaiilor. Termenul Lamashu nseamn, fr dubiu,
imagini/simboluri ale zodiacului. Deschide gura ta, au
spus ei, f imaginile s dispar! Vorbete din nou i f
constelaiile s reapar!
ndatoritor, Marduk a realizat miracolul:
El a vorbit i constelaiile au disprut;
El a vorbit din nou, iar imaginile au reaprut.
Cnd zeii, btrnii lui,
Au vzut puterea rostirii sale.
Ei s-au bucurat, ei au anunat:
Marduk este suprem!
Ei i-au conferit sceptrul, tronul i o rob regal - cea mai
strlucitoare rob, dup cum au artat descrierile
babiloniene (Fig. 28). Din aceast zi, au spus ei, decizia ta
va fi fr rival, comanda ta ca cea a lui Anu... Niciunul dintre
zei nu va nclca graniele tale.
n timp ce textul babilonian sugereaz c supremaia lui
Marduk a fost testat, confirmat i declarat ntr-o singur

edin, celelalte texte care se refer la procesul de luare a

deciziei afirm c etapa ntlnirii celor 50 de Zei Seniori
participani a fost urmat de o alta, separat, a ntlnirii
celor apte Mari Zei care Judec.

i apoi proclamarea deciziei, a Soartei sau a Destinului, a

fost fcut de ctre Enlil, cu consultarea sau dup aprobarea
lui Anu. ntradevr, nevoia acestei proceduri, etap cu etap,
i a declaraiei finale a lui Enlil n numele lui Anu, a fost
recunoscut chiar de ctre urmaii lui Marduk. Renumitul
rege babilonian Hammurabi, n preambulul la faimosul su
cod de legi, a preamrit supremaia zeului su cu aceste
Mree Anu,
Stpn al zeilor care au venit din cer pe Pmnt,
i Enlil, Stpn al cerului i al Pmntului
Care hotrte destinele pmntului,
Decide pentru Marduk, primul nscut al lui Enki,
Funciile lui Enlil peste toat omenirea.
Un astfel de transfer al autoritii lui Enlil ctre Marduk,
susin textele babiloniene, a fost efectuat i reprezentat prin
rspltirea lui Marduk cu 50 de nume. Ultimul i cel mai
important dintre titlurile cu care a fost rspltit a fost acela

de Nibiru - chiar numele planetei pe care babilonienii au

redenumit-o Marduk.
Adunrile zeilor erau cteodat ntrunite nu pentru a
anuna noile Soarte, ci ca s constate ce fusese hotrt n
timpurile vechi pe Tbliele Destinelor.
Relatrile biblice reflect nu numai obiceiul regal de a nota
ntmplrile pe pergamente sau tblie care erau apoi sigilate
i pstrate ca documente mrturie; obiceiul a fost atribuit
zeilor (de la care a fost fr ndoial preluat). Cea mai
important dintre aceste referiri a fost gsit n Cntecul lui
Moise, testamentul i profeia sa dinainte de a muri. Fcnd
apologia mreiei lui Yahve i a puterii sale de a prezice
Destinele, Moise l-a citat pe Stpn, care spunea despre
Ia te uit:
Exist un secret cu mine ascuns.
Pstrat i sigilat n visteriile mele.
Texte hitite descoperite n biblioteca regal din capitala lor,
Hattushas, conineau poveti despre conflictele dintre zei,
acestea servind ca surse directe pentru mitologia greac. n
acele texte numele Vechilor Zei erau cele cunoscute n
vremurile sumeriene (ca Anu, Enlil i Enki); sau nume n
hitit pentru zei cunoscui din panteonul sumerian (ca
Teshub, Vntul care Sufl pentru Ishkur/Adad); sau,
uneori, pentru zeiti ale cror identiti au rmas obscure.
Dou cntece epice aparin zeilor numii Kumarbis i
Illuyankas. n primul, Teshub a cerut ca Tbliele Soartei tbliele vechi cu poruncile Soartei - s fie readuse din
lcaul lui Enki n Africa de sud-est i duse la Adunarea
Zeilor. n cellalt, dup conflict, zeii s-au ntlnit n Adunare
pentru a-i stabili succesiunea i rangurile - o succesiune i
ranguri ce au fost descrise n picturile de pe pereii din piatr
ai sanctuarului sacru cunoscut astzi ca Yazilikaya (Fig. 29).

Dar, fr niciun dubiu, cea mai important, lung,

nverunat i fatidic a fost Adunarea Zeilor n care s-a
decis s se aprobe folosirea armelor nucleare pentru a
distruge portul spaial din Peninsula Sinai. Folosind n
primul rnd consemnarea lung i detaliat cunoscut ca
Erra Epos, am reconstituit evenimentele n desfurare, am
identificat protagonitii i oponenii i am interpretat aproape
textual (n The Wars of Gods and Men), procedurile Adunrii.
Rezultatul involuntar a fost, aa cum am menionat deja,
distrugerea Sumerului i sfritul vieii n oraele sale.
Cazul a fost, de asemenea, unul dintre cele mai clare, dac
nu tragice exemple pentru cum Soarta i Destinul pot fi
Cel mai dur a fost afectat n Sumer capitala sa glorioas,
Ur, locul i centrul poporului iubit al zeului Nannar/Sin (zeul
Lunii) i al soiei sale, Ningal. Textele de jale (Lamentation
Over the Destruction of Summer and Ur, Lamentation Over the
Destruction of Ur) descriu cum, cnd s-a realizat c Vntul
Ru purtnd norul morii, sufl ctre Sumer, Nannar/Sin s-a
npustit ctre tatl su, Enlil, cerndu-i ajutorul, un miracol
divin care s evite calamitatea pentru Ur. Nu este incredibil,
l-a ntrebat pe tatl su, s vezi c un ora faimos, cu
renume, dispare? El s-a adresat lui Anu: Groaznic, ajunge!.
A fcut apel la Enlil: Rostete o Soart favorabil! Dar Enlil
a vzut c nu era cale de schimbare a sfritului care venea.
Disperat, Nannar/Sin a solicitat ntrunirea zeilor n cadrul
Adunrii. Cnd seniorii Anunnaki s-au aezat, Nannar/Sin a

strigat cu ochii ndreptai ctre Anu, implorndu-l pe Enlil:

Nu las oraul meu s fie distrus, le-am spus lor, a spus
Nannar/Sin mai trziu. S nu piar oamenii!
Dar rspunsul, venind de la Enlil, a fost aspru i hotrt:
Ur a primit Regalitatea;
Nu a primit regatul venic.
Lecia distrugerii Sumerului i a oraului Ur a fost aceea
c norocul i o Soart schimbtoare nu pot nlocui Destinul
de neschimbat. Dar oare exist o alt cale - poate o Soart,
indiferent de cine o decide, s fie nlocuit de ctre Destin?
La aceast chestiune s-a cugetat cu siguran n
antichitate, altfel care s fi fost motivul rugciunilor i
implorrilor care au nceput atunci, al avertismentelor
Profeilor cu privire la dreptate i pocin? Cartea biblic a
lui Iov ridic ntrebarea dac Soarta - care afecteaz omul
pn la a-l face neputincios - prevaleaz chiar dac dreptatea
i pietatea i-au fost destinate lui Iov pe parcursul vieii.
A fost o tem ale crei origini pot fi gsite n poemul
sumerian numit de ctre oamenii de tiin Omul i Zeul Su,
al crui subiect este martirul neprihnit, o victim a soartei
crude i a nenorocirii necuvenite. Soarta m-a prins n
minile sale, duce cu ea suflarea mea de via, se plngea
un suferind necunoscut; dar el vede Porile Iertrii
deschizndu-se n faa lui acum tu, zeul meu, mi-ai artat
pcatele mele. Mrturisirea pcatelor i pocina l-au fcut
pe zeul lui s alunge Demonul Sorii, iar credinciosul
triete o via lung i fericit.
Aa cum povestea lui Ghilgame a demonstrat c Soarta
nu a putut trece peste Destinul su final (s dispar ca un

muritor), la fel i celelalte poveti transmit morala c nici

mcar Soarta nu poate aduce moartea, dac ea nu a fost
destinat. Un exemplu foarte sugestiv este nimeni altul dect
nsui Marduk, care, dintre toi zeii antichitii, a atins un
record al suferinei i eecurilor, cu dispariii i reapariii,
exiluri i reveniri, mori aparente i nvieri neateptate; un
record att de mare nct, atunci cnd ntregul scop al
evenimentelor prin care a trecut Marduk a fost cunoscut,
dup descoperirea inscripiilor antice, cercettorii au
dezbtut dac nu cumva istoria sa era prototipul celei a lui
Cristos. (Ideea a fost susinut de legtura apropiat dintre
Marduk i tatl su, Enki, pe de o parte, i cea cu fiul su,
Nabu, pe de alt parte, dnd impresia unei Triniti timpurii).
Impactul ncercrilor lui Marduk i lecia sa pentru
umanitate au fost evideniate ntr-o Pies Misterioas, n care
moartea sa fals i ntoarcerea din mori a fost jucat de
actori. Piesa Misterului a fost jucat n Babilon, n timpul
ceremoniilor Anului Nou, i diferite izvoare antice sugereaz
c a existat i un scop ascuns - s arate cu degetul acuzator
ctre inamicii si i s judece cine era responsabil pentru
sentina morii sale i a nmormntrii. Aa cum indic o
variant de interpretare, identitatea celor responsabili s-a
schimbat n timp, n funcie de schimbrile de pe scena
Unul dintre acuzai a fost Inanna/Ishtar; i este paradoxal
faptul c, n timp ce ea a murit i a nviat cu adevrat,
experiena sa nu a fost nici recreat (cum a fost a lui
Marduk), nici amintit n calendar (cum a fost moartea
iubitului ei, Dumuzi, dup al crui nume a fost denumit
luna Tammuz). Este o dubl ironie, deoarece rezultatul morii
lui Dumuzi a fost acela c Inanna/Ishtar a sfrit prin
Nici chiar Shakespeare nu ar fi putut concepe tragica

ironie a evenimentelor care au urmat nmormntrii i

nvierii lui Marduk, ca rezultat al strigtului Inannei. Pentru
c lucrurile s-au ntors, n timp ce el nu a murit cu adevrat
i nici nu s-a ntors din mori, acuzatoarea sa, Inanna, a
murit cu adevrat i a realizat adevrata nviere. i, n vreme
ce moartea lui Dumuzi a fost cauza care a stat la baza
ambelor ntmplri, motivul morii i al nvierii Inannei a fost
propria sa decizie inevitabil.
Folosim n mod logic termenul de inevitabil, pentru c
era Soarta, nu Destinul su, de a-i ntlni moartea; i
datorit acestei distincii ea a putut fi readus la via.
Relatarea acelor evenimente a lmurit chestiunile de Via,
Moarte i nviere, nu doar, ca n Epopeea lui Ghilgame,
printre muritori i semizei, dar i printre zei nii. n
povestea ei despre Soart contra Destin exist indicii pentru
soluionarea enigmelor la care s-au cutat rspunsuri.
Povestea plin de suspans a morii i nvierii lui
Inanna/lshtar dezvluie chiar de la nceput c ea i-a ntlnit
moartea - moartea adevrat, nu doar ngroparea - ca
rezultat al propriilor sale decizii. Ea i-a creat propria ei
Soart; dar moartea nu a fost Destinul ei (cel puin nu la
momentul acela) - la final ea a fost readus la via.
Povestea este relatat n texte scrise la nceput n limba
original sumerian, cu interpretri ulterioare n akkadian.
Cercettorii se refer la diferite interpretri ca fiind povestea
Coborrii lui Inanna n Lumea de Jos, dei unii prefer
termenul de Iad n locul celui de Lumea de Jos, nsemnnd o
zon infernal a morilor. n fapt, Inanna s-a ndreptat ctre
Lumea de Jos, care era termenul geografic pentru partea cea
mai sudic a Africii. Era teritoriul surorii sale, Ereshkigal, i
a lui Nergal, soul su; i se pare c fiind frate al lui Dumuzi,
era sarcina lui s aranjeze funeraliile. Dar, dei Inanna a fost
avertizat s nu mearg acolo, ea a decis s fac oricum

aceast cltorie.
Participarea la ritualurile funerare ale iubitului ei Dumuzi
a fost motivul Inannei pentru a face cltoria; dar este
evident c nimeni nu a crezut-o... Presupunerea noastr este
c potrivit unui obicei (care mai trziu a orientat legile
biblice), Inanna inteniona s-i cear lui Nergal ca, fiind
fratele mai mare al lui Dumuzi, s se culce cu ea, astfel ca
fiul care se nate s fie pseudo-fiul lui Dumuzi (care murise
fr niciun fiu). Acea intenie a enervat-o pe Ereshkigal.
Celelalte texte descriu cele apte obiecte pe care Inanna lea luat pentru a le folosi pe durata cltoriei sale n Barca
Cerului - printre ele, un coif, cercei, o tij de msurare toate inute bine de curelue. Sculpturile o descriu n mod
similar nvemntat (Fig. 30). Cnd a ajuns la cele apte
pori ale locuinei surorii sale portarul i-a dat jos toate acele
obiecte care o protejau, unul cte unul. Cnd ntr-un final a
ajuns la camera tronului, Ereshkigal a izbucnit cu furie. A
fost o ceart cu strigte puternice. Potrivit textului sumerian,
Ereshkigal a cerut ca Inanna s fie supus Ochilor Morii un fel de raze mortale - care au transformat corpul Inannei
ntr-un cadavru; i cadavrul a fost spnzurat de un stlp.

Potrivit versiunii akkadiene de mai trziu, Ereshkigal i-a

cerut ambelanului su, Namtar, s elibereze mpotriva lui
Ishtar cele 60 de nenorociri - vtmarea ochilor, inimii,
capului, picioarelor, a tuturor prilor, a ntregului ei corp omornd-o astfel pe Ishtar.
Prevznd c vor fi probleme, Inanna/lshtar i-a instruit
ambelanul, pe Ninshubur, s protesteze n cazul n care nu
se va ntoarce n decurs de trei zile. Deoarece Inanna nu a
reuit s se ntoarc, Ninshubur a mers la Enlil s-l roage s
o salveze pe aceasta de la moarte, dar Enlil nu a putut s
ajute. Ninshubur a fcut apel la Nannar, tatl Inannei, dar
nici el nu a fost de ajutor. Atunci Ninshubur a apelat la Enki
i el a fost capabil s ajute. El a creat dou fiine artificiale ce
nu puteau fi rnite de ctre Ochii Morii i le-a trimis ntr-o
misiune de salvare.

Unuia dintre androizi i-a dat Mncarea Vieii, celuilalt i-a

dat Apa Vieii; astfel aprovizionai, ei au cobort n lcaul lui
Ereshkigal pentru a cere corpul lipsit de via al lui Inanna.
Peste cadavrul, spnzurat de stlp,
Ei au ndreptat Impulsul i Emitorul.
Peste corpul care a fost lovit,
De 60 de ori Mncarea Vieii,
De 60 de ori Apa Vieii,
Ei au stropit peste el;
i Inanna s-a ridicat.
Folosirea radiaiei - un Impuls i Emitor - pentru nvierea
morilor a fost descris pe un sigiliu cilindric (Fig. 31) n care
vedem un pacient a crui fa era acoperit cu o masc, fiind
tratat prin metoda radiaiei. Pacientul care a fost nviat (este
neclar dac este om sau zeu), stnd pe o lespede, era
nconjurat de Oameni-Pete - caracteristici ale lui Enki. Este
un indiciu care trebuie reinut, mpreun cu detaliul din
poveste, acela c, n timp ce nici Enlil, nici Nannar nu au
putut s o ajute pe Inanna, Enki a putut. Androizii pe care ia creat Enki pentru a o ntoarce pe Inanna de la moarte, nu
erau preoii-doctori/Oameni-Pete artai n descrierea de
mai sus. Neavnd nevoie nici de mncare, nici de ap,
asexuai i fr snge, ei puteau semna mai mult cu

figurinele sau mesagerii androizi divini (Fig. 32).

Androizii nu au fost afectai de razele mortale ale lui
Ereshkigal. Dup ce au nviat-o pe Inanna/lshtar, ei au
nsoit-o n siguran pe drumul ctre Lumea de Sus. Pe
Inanna o atepta credinciosul ambelan Ninshubur, cruia
ea i-a adresat cuvinte de recunotin. Apoi ea a mers la
Eridu, locuina lui Enki, cel care a adus-o napoi la via.
Dac povestea Coborrea Inannei n Lumea de Jos ar fi fost
pus ntr-o Pies a Pasiunii, aa cum a fost povestea lui
Marduk, ea cu siguran ar fi inut publicul cu sufletul la
gur; pentru c, n vreme ce moartea lui Marduk a fost doar
o ngropare n urma unei condamnri la moarte, iar
nvierea sa o salvare naintea morii, Inanna/lshtar a murit
cu adevrat, iar nvierea sa a fost ntradevr o ntoarcere din
moarte. Dar cineva din audien familiarizat cu nuanele
terminologiei sumeriene ar fi tiut de la mijlocul povetii c
totul se va sfri cu bine... Pentru c cel cruia i-a ordonat
Ereshkigal s o trimit pe Inanna la moarte era ambelanul
su, Namtar - nu NAM, Destinul care nu putea fi schimbat,
ci NAM.TAR, Soarta, care putea fi schimbat.

Namtar a fost cel care a trimis-o pe Ishtar la moarte

elibernd mpotriva sa cele 60 de nenorociri i cel care,

dup ce ea a fost readus la via, a trecut-o prin cele apte
pori i i-a napoiat, la fiecare poart, vemintele, podoabele
i nsemnele puterii ei.
Noiunea de trm al lui Namtar ca Iad, un lca al morilor
dar, n acelai timp, un loc de unde se poate scpa i ntoarce
printre cei vii, a stat la baza textului sumerian referitor la
experiena din apropierea morii a prinului numit Kumma.
La fel ca ntr-un episod din seria TV, Zona Crepuscular,
prinul se vede pe sine sosind n Iad. Imediat, el vede un om
stnd naintea lui Namtar: n mna sa stng el inea prul
capului su, n mna dreapt el inea o spad. Namtaru,
iubita lui Namtar, sttea alturi. Erau nconjurai de montri:
un arpe-dragon cu mini i picioare de om, un monstru cu
cap de leu i patru mini de om. Erau acolo Mukil
(Biruitorul), pasrea cu mini de om i picioare i Nedu
(Cel abtut) care avea cap de leu, mini de om i picioare ca
o pasre. Ceilali montri aveau amestecate membre de om,
psri, boi, lei.
Continund, prinul ajunge la scena judecii. Omul
judecat avea corpul negru ca smoala i purta o manta roie.
ntr-o mn inea un arc, n alta o sabie; cu piciorul su
stng clca pe un arpe. Dar judectorul su nu este Namtar,
care este doar vizirul Iadului; judectorul este Nergal,
stpnul Lumii de Jos. Prinul l vede aezat pe un tron
maiestuos, purtnd o coroan divin. Din minile sale
pornesc fulgere i Iadul era umplut de teroare.
Tremurnd, prinul s-a nchinat. Cnd s-a ridicat, Nergal a
ipat la el: De ce mi-ai jignit iubita soie, Regina Iadului?
Prinul era fr grai. Era acesta sfritul lui?
Dar nu, nu n aceast curte a lui Namtar, nu acela a fost
sfritul amar. Totul a fost, s-a dovedit, un caz de identitate
greit. Regina Iadului nsi a ordonat eliberarea sa i

ntoarcerea pe trmul lui Shamash, Lumea de Sus a

luminii. Dar Nergal a intervenit; prinului i se va crua viaa,
dar el nu se putea ntoarce nevtmat din moarte. El trebuia
s sufere pentru experiena sa din apropierea morii i s
aib dureri, chinuri i insomnii. El trebuie s sufere de
ntoarcerea mortului Dumuzi din Lumea de Jos a fost total
Readus la via i liber s se ntoarc n Lumea de Sus,
Inanna nu l-a uitat pe iubitul ei. La porunca ei, cei doi
mesageri divini au luat cu ei napoi corpul fr via al lui
Dumuzi. Ei au dus corpul la Bad-Tibira n Edin; acolo corpul
a fost mblsmat la cererea Inannei:
Pentru Dumuzi, iubitul tinereii mele:
Splai-l cu ap pur,
Ungei-l cu ulei dulce,
mbrcai-l n vetminte roii,
Punei-l pe o lespede de lapislazuli.
Inanna a dat ordin ca trupul pstrat s fie pus pe o
lespede de piatr din lapislazuli i s fie inut ntr-un altar
special. El trebuie pstrat, a spus ea, pentru ca ntr-o zi, la
Ziua de Apoi, Dumuzi s se poat ntoarce din moarte i s
vin la mine. Pentru c, a susinut ea, ar putea fi ziua cnd
Cei mori se vor ridica
i vor mirosi tmia dulce.
Aceasta, se poate spune, este prima meniune a credinei
n Ziua de Apoi, cnd morii se vor ridica. Aceast credin
care a dat natere ritualului de jelire a lui Tammuz
(traducerea semitic a lui Dumuzi), care a continuat peste
milenii chiar n vremea Profetului Ezechiel.
Moartea i mumificarea lui Dumuzi, dei descris pe scurt
aici, a furnizat importante informaii. Cnd el i
Inanna/Ishtar s-au ndrgostit - el un Enkiit, iar ea o Enlilit

- n mijlocul conflictelor dintre cele dou clanuri divine,

logodna a primit binecuvntarea prinilor Inannei,
Nannar/Sin i soia sa, Ningal/Nikkal. Unul dintre textele din
seria cntecelor de dragoste Dumuzi i Inanna este discuia
cu autoritatea, n care Ningal i spunea lui Dumuzi:
Dumuzi, dorina i dragostea Inannei
i voi da via pentru zile ndeprtate;
Le voi pstra pentru tine.
Voi veghea peste Casa Vieii tale.
n fapt, Ningal nu avea o astfel de autoritate, pentru c
toate chestiunile de Destin i Soart depindeau de Anu i de
Enlil. i, cum am vzut mai trziu, Dumuzi a avut o moarte
tragic i timpurie.
Eecul promisiunii divine n privina vieii i a morii nu a
fost singurul aspect tulburtor al soartei divine a lui Dumuzi.
A ridicat i problema nemuririi zeilor; am explicat n scrierile
noastre c este vorba numai despre o longevitate relativ, o
durat a vieii ce rezulta din faptul c un an pe Nibiru
echivala cu 3.600 de ani pmnteni. Dar pentru cei care n
antichitate i considerau pe Anunnaki zei, povestea morii lui
Dumuzi trebuie s fi fost un oc. Oare pentru c Inanna se
atepta ntradevr ca Dumuzi s revin la via n Ziua de
Apoi a ordonat ea mblsmarea i punerea lui pe o lespede
de piatr i nu ntr-un mormnt - sau n vederea pstrrii
iluziei nemuririi divine pentru mase? Da, ar fi putut ea
spune, zeul a murit, dar acest lucru este temporar, o faz de
tranziie, pentru c la timpul potrivit va fi nviat, el se va
ridica i se va bucura de mirosurile mbietoare de tmie.
Povetile canaanite referitoare la Ba'al, Stpnul nclin
s considere c trebuie fcut distincia ntre eroii pozitivi i
cei negativi, ncercnd s-i afirme i s-i instaureze
supremaia pe vrful Zaphon (Locul Secret al Nordului), Ba'al
a luptat pn la moarte cu adversarii fratelui su. Dar n

btlia aprig cu evlaviosul Mot (Moartea), Ba'al a fost

Anat, iubita sor a lui Ba'al i sora lor, Shepesh, a adus
teribila veste tatlui lui Ba'al, El: Puternicul Ba'al este mort,
Prinul, Stpnul Pmntului a disprut! i-au spus ei
tatlui aflat n stare de oc; n cmpurile Dabrland l-am
gsit pe Ba'al, czut la pmnt. Auzind vestea, El s-a dat jos
de pe tron i a stat pe un scaun, cum este obiceiul de doliu
(printre evrei) pn n zilele noastre. El i-a turnat praf pe
cap, a mbrcat pnz de sac, i-a fcut tieturi cu un cuit
din piatr; i-a ridicat vocea i a strigat: Ba'al este mort!
ndoliat, Anat s-a ntors pe cmpul unde a czut Ba'al i,
la fel ca El, a mbrcat pnz de sac, i-a fcut tieturi i s-a
umplut de lacrimi. Apoi a chemat-o pe sora sa, Shepesh, s
vin s o ajute s duc trupul nensufleit la Fortreaa de la
Zaphon, pentru a nmormnta trupul acolo:
Ascultnd, Shepesh, fecioara zeilor,
l-a ridicat pe Puternicul Ba 'al,
l-a pus pe umrul lui Anat.
Sus, la fortreaa de pe Zaphon l-a dus ea,
l-a jelit i l-a ngropat;
la pus ntr-o scobitur,
s fie cu fantomele pmntului.
Dup ce a terminat cele necesare nmormntrii, Anat s-a
ntors la locuina lui El. A spus cu amrciune celor strni
acolo: Acum putei merge s v bucurai, pentru c Ba'al este
mort, iar tronul su este liber! Zeia Elath i rudele ei,
ignornd ironia lui Anat, au nceput pur i simplu s discute
despre succesiune. A fost recomandat unul dintre ceilali fii
ai lui El, dar acesta din urm a refuzat, spunnd c este
slab. Unui alt candidat i s-a permis s mearg la Zaphon s
ncerce s obin tronul lui Ba'al; dar picioarele sale nu au
ajuns jos la taburet, i a fost eliminat de asemenea. Nimeni,

se prea nu l putea nlocui pe Ba'al.

Aceasta i-a dat speran lui Anat: nvierea. Apelnd din
nou la ajutorul lui Shepesh, ea a intrat n lcaul lui Mot.
Folosind un iretlic, s-a apropiat de el, ca oaia de mielul ei...
Ea l-a apucat pe credinciosul Mot i cu o sabie l-a tiat. Apoi
i-a ars trupul, i-a pisat resturile, iar cenua a rspndit-o
peste cmpuri.
Uciderea lui Mot, cel care la omort pe Ba'al, a declanat
un miracol: mortul Ba 'al a revenit la via!
ntradevr, Puternicul Ba 'al a murit;
ntradevr, Stpnul Pmntului a pierit.
Dar ia te uit:
n via este Puternicul Ba 'al!
Iat, triete prinul Stpn al Pmntului!
Primind vetile, El s-a ntrebat dac totul este un vis, o
viziune. Dar este adevrat! ndeprtnd pnza de sac i
obiectele de doliu, El s-a bucurat:
Acum voi sta i mi voi gsi linitea,
i inima mea va fi uoar;
Pentru c Puternicul Ba 'al este n via,
Prezent este prinul, Stpnul Pmntului.
n ciuda nencrederii evidente a lui El, dac nvierea este o
viziune iluzorie, doar un vis, povestitorul canaanit a ales s-i
asigure pe oameni c, n final, chiar El a acceptat miracolul.
Asigurarea se regsete n povestea lui Keret, care este un
semizeu; totui, fiii si vzndu-l n chinurile morii, nu
putea crede c un fiu al lui El va muri.
Ideea de nviere a fost adus n discuie probabil din cauza
neacceptrii morii zeului. i dac Inanna a crezut sau nu c
iubitul ei se ntoarce din mori, pstrarea corpului lui
Dumuzi i cuvintele care au nsoit-o au meninut printre
masele de oameni iluzia nemuririi zeilor.
Procedura pe care a urmat-o ea pentru pstrarea corpului,

astfel ca n Ziua de Apoi Dumuzi s se poat ridica i veni la

ea, este, fr ndoial, procedura cunoscut ca mumificare.
Aceasta se poate s fi fost un oc pentru egiptologi care
susineau c mumificarea a nceput n Egipt, n vremea
Dinastiei a Treia, n cca. 2.800 .Chr.

Acolo procedura presupunea splarea corpului Faraonului

rposat, ungerea lui cu ulei i mbrcarea cu haine esute pstrarea corpului astfel ca Faraonul s poat face Cltoria
ctre Viaa de Apoi.Totui, avem un text sumerian care
menioneaz mumificarea cu cteva secole mai nainte!
Detaliile procedurii, pas cu pas, sunt identice n acest text
cu cele practicate mai trziu n Egipt, pn la culoarea hainei
care acoperea corpul.
Inanna a poruncit ca trupul pstrat s fie pus pe o lespede
din lapislazuli, s fie inut pe un altar special. Ea a numit
altarul E.MASH - Casa/ Templul arpelui. A fost probabil
mai mult dect un gest simbolic s-l pun pe fiul mort al lui
Enki n minile tatlui su. Pentru c Enki nu a fost doar
Nachash - arpele, ci i Cunosctorul Secretelor - ale Bibliei.
n Egipt, de asemenea, simbolul su a fost arpele, iar
hieroglifa numelui su PTAH reprezenta spirala dubl a ADNului (Fig. 33), care a fost cheia n materie de via i moarte.

Dei venerat n Sumer i Akkad ca logodnic al lui Inanna i

deplns n Mesopotamia i dincolo de ea ca Tumuz, rposatul
lui Ishtar, Dumuz era un zeu african. A fost probabil
inevitabil ca aceast moarte i mblsmare s fie comparat
de ctre oamenii de tiin cu povestea tragic a marelui zeu
egiptean, Osiris.

Povestea lui Osiris este asemntoare cu povestea biblic a

lui Cain i Abel, n care o rivalitate s-a finalizat cu un
fraticid. Ea ncepe cu dou cupluri divine, doi frai vitregi
(Osiris i Seth) cstorii cu dou surori (Isis i Nepthys).
Pentru a evita conflictele, Regatul Nilului a fost mprit ntre
cei doi frai. Egiptul de Jos (partea de nord) a fost dat lui
Osiris, iar partea sudic (Egiptul de Sus) lui Seth. Dar
regulile divine de succesiune erau complexe, favoriznd
Motenitorul Legal n faa Primului Fiu Nscut, ceea ce a
amplificat rivalitatea dintre frai pn acolo nct Seth,
folosind un vicleug, i-a ntins o capcan lui Osiris,
nchizndu-l ntr-o lad care a fost aruncat apoi n Marea
Mediteran, iar Osiris s-a necat.
Isis, soia lui Osiris, a gsit lada cnd a fost adus pe
rmul locului numit astzi Liban. Ea a luat corpul soului ei
Osiris napoi n Egipt, cernd ajutorul zeului Thoth s l
renvie pe Osiris. Dar Seth, aflnd ce urma s se ntmple, a
luat corpul, l-a tiat n 14 buci i le-a risipit pe ntregul
teritoriu al Egiptului.

Nenduplecat, Isis a cutat bucile i le-a gsit pe toate,

cu excepia (spune povestea) falusului lui Osiris. Ea a pus
toate bucile mpreun, legndu-le cu o hain purpurie
esut, pentru a reconstitui trupul lui Osiris - astfel a
nceput mumificarea n Egipt. Toate descrierile lui Osiris din
vremurile faraonice l nfieaz nfurat strns n giulgiu
(Fig. 34).

La fel ca Inanna naintea ei, Isis a pus n giulgiu i a

mumificat trupul soului mort, dnd natere n Egipt (cum
au fcut i faptele Inannei n Sumer i Akkad) la ideea nvierii
n vreme ce n cazul Inannei, faptele zeiei ar fi putut avea
ca intenie satisfacerea refuzului personal al pierderii, dar i
ideea nemuririi zeilor, n Egipt, aciunea a devenit un pilon i
o credin a faraonului c regele uman putea, de asemenea,
suferi o transfigurare i, prin asemnare cu Osiris, putea
obine nemurirea ntr-o via de apoi alturi de zei. E. A.
Wallis Budge, n prefaa capodoperei sale Osiris & The
Egyptian Resurrection, spune c Figura central din religia

Egiptului Antic a fost Osiris i principalul fundament al

cultului su a fost credina n divinitatea, moartea i nvierea
sa i controlul absolut al destinelor corpurilor i sufletelor
umane. Principalele altare ale lui Osiris din Abydos i
Denderah descriu etapele nvierii zeului (Fig. 35). Wallis
Budge i ceilali cercettori au crezut c aceste descrieri au
fost preluate dintr-o Pies a redrii Patimilor sau a Misterelor
care a fost jucate n fiecare an n acele locuri - un ritual
religios care, n Mesopotamia, era nchinat lui Marduk.
Textele Piramidei i celelalte referiri funerare din Cartea
Morilor egiptean relateaz cum Faraonul mort, mblsmat
i mumificat, era pregtit s ias din mormntul su
(considerat doar un loc temporar pentru odihn) printr-o u
fals situat spre est i ncepea Cltoria ctre Viaa de Apoi.
S-a presupus c era o cltorie care simula pe cea a lui
Osiris nviat, ctre tronul ceresc din Lcaul Venic; i dei
era o cltorie care l fcea pe Faraon s se avnte ctre cer
ca un oim divin, ea ncepea cu trecerea printr-o serie de
camere i coridoare subterane pline cu fiine i priveliti
miraculoase. n The Stairway to Heaven am analizat din
punct de vedere geografic i topografic textele antice i am
ajuns la concluzia c era vorba despre o simulare a unei
cltorii ctre un hangar subteran de lansare din Peninsula
Sinai - nu mult diferit de descrierea unui sit din peninsul
din mormntul lui Hui, un guvernator faraonic al acesteia
(Fig. 36).
nvierea lui Osiris a fost asociat cu alt eveniment
miraculos, acela al naterii fiului su, Horus, dup ce Osiris
nsui a murit i a fost dezmembrat. n ambele evenimente,
pe care egiptenii le consider, pe drept cuvnt, magice, un
zeu numit Thoth (ilustrat ntotdeauna n arta egiptean cu
cap de ibis, Fig. 37) a jucat un rol decisiv. El a fost cel care a
ajutat-o pe Isis s mbine membrele lui Osiris, a nvat-o

apoi cum s extrag esena lui Osiris din corpul

dezmembrat i mort al acestuia i s se insemineze artificial.
Fcnd asta, ea a reuit s rmn nsrcinat i s dea
natere fiului su, Horus.
Chiar cei care au interpretat povestea ca fiind o amintire a
evenimentelor reale i nu un mit consider c Isis a extras
smna din corpul mort al lui Osiris i, odat cu ea,
esena sa. Dar acest lucru a fost imposibil, de vreme ce
singura parte pe care Isis nu a putut-o gsi i reuni a fost
organul su brbtesc. Magia lui Thoth trebuie s fi fost
dincolo de inseminarea artificial, nu foarte comun.

El a trebuit s obin pentru ea esena genetic a lui

Osiris. Deopotriv textele i descrierile pe care le avem din
Egiptul antic confirm faptul c Thoth deinea, ntradevr,
cunotine secrete necesare pentru astfel de fapte.
Capacitile biomedicale - magice dup prerea omului ale lui Thoth au fost nc o dat folosite de dragul lui Horus.
Pentru a proteja biatul de cruzimea lui Seth, Isis a inut
secret naterea lui Horus, ascunzndu-l ntr-o zon
mltinoas. Netiind de existena fiului lui Osiris, Seth - la

fel cum i Enki ncercase s obin un fiu de la sora sa

vitreg Ninmah - a ncercat s o foreze pe Isis, sora sa
vitreg, s aib o relaie cu el, astfel nct s poat avea un
fiu de la ea i, deci, un motenitor incontestabil. Ademenindo pe Isis n locuina sa, el a inut-o captiv pentru un timp;
dar Isis a reuit s scape i s se ntoarc la mlatinile unde
era ascuns Horus. Spre durerea sa, l-a gsit pe Horus mort
din cauza unei mucturi de scorpion.

Ea nu a pierdut timpul i la chemat n ajutor pe Thoth:

Atunci Isis a strigat ctre cer
i a adresat apelul ei
Brcii Milioanelor de Ani...
i Thoth a cobort;
El era nzestrat cu puteri magice,
i definea marea putere ce fcea
Cuvntul s devin fapt...
i el i-a spus lui Isis:
Am venit n aceast zi n Barca Cereasc
Disc din locul unde era ieri.
Cnd noaptea vine,

Lumina aceasta (aureola) va ndeprta (otrava)

Pentru vindecarea lui Horus...
Am venit din ceruri s salvez copilul
Pentru mama sa.
Astfel readus la via din moarte (i probabil imunizat
pentru totdeauna) prin puterile magice ale lui Thoth, Horus a
crescut pentru a deveni Netch-Atef Rzbuntorul tatlui
Puterile bio-medicale ale lui Thoth n materie de via i de
moarte au fost menionate ntr-o serie de texte ale Egiptului
Antic cunoscute ca Povetile Magilor. ntr-unul dintre ele
(Papirusul din Cairo 30646) apare o poveste lung despre un
cuplu de descendeni regali care au intrat ilegal n posesia
Crii Secretelor lui Thoth. Drept pedeaps, Thoth i-a ngropat
ntr-o camer subteran ntr-o stare de existen suspendat
- mumificai ca nite mori, dar capabili s vad, s aud i
s vorbeasc. n alt poveste, scris pe Westcar Papyrus, un
fiul al faraonului Khufu (Keops) i-a vorbit tatlui su despre
un btrn care a fost iniiat n misterele lui Thoth. Printre
ele se afla i capacitatea de a nvia morii. Dorind s vad cu
propriii si ochi, regele a poruncit s se taie capul unui
prizonier, apoi l-a provocat pe nelept s reconstituie capul
tiat i s readuc omul la via. neleptul a refuzat s
realizeze aceast magie a lui Thoth pe o fiin uman;
astfel, el a tiat capul unei gte. neleptul a spus anumite
cuvinte de putere din Cartea lui Thoth; i iat, capul tiat s-a
alturat napoi la corpul gtii, aceasta s-a ridicat i a
nceput s scoat sunete ca nainte.
Faptul c Thoth deinea ntradevr capacitatea de a renvia
persoanele moarte care fuseser decapitate, le reataa capul
i readucea victima la via, a fost cunoscut n Egiptul Antic
datorit unui incident care s-a ntmplat atunci cnd, n
final, Horus a ridicat armele mpotriva unchiului su, Seth.

Dup btlii care au avut loc pe pmnt, n ap i n aer,

Horus a reuit s-i captureze pe Seth i pe locotenenii si.
Aducndu-i n faa lui Ra pentru judecat, acesta a pus
destinele captivilor n minile lui Horus i ale lui Isis. Dup
aceasta, Horus a nceput s-i ucid pe captivi, tindu-le
capetele; dar cnd a ajuns la Seth, Isis, neputnd s vad ce
i se ntmpl fratelui ei, l-a oprit pe Horus. Furios, Horus s-a
ntors ctre mama sa i a decapitat-o! Ea a supravieuit doar
pentru c Thoth s-a npustit acolo, i-a reataat capul i a
readus-o la via.
Pentru a evalua capacitatea lui Thoth de a realiza toate
acestea, s ne reamintim c l-am identificat pe acest fiu al lui
Ptah cu Ningishzidda (fiul lui Enki n cunotinele
sumeriene), al crui nume sumerian nsemna Stpnul
Copacului/Artefactului Vieii. El era Pstrtorul Secretelor
Divine, al tiinelor exacte, nu n ultimul rnd al secretelor de
genetic i biomedicin care fuseser folosite de ctre tatl
su, Enki, n vremea Creaiei Omului. n fapt, textele
sumeriene arat c, odat, Marduk s-a plns tatlui su,
Enki, pentru faptul c nu l-a nvat toate cunotinele pe
care el le deine.
Fiule, a rspuns Enki, ce anume nu cunoti? Ce i-a
mai putea da? Informaia ascuns, a artat Marduk, era
secretul nvierii din mori; cunotina secret a fost
Ningishzidda/Thoth, dar nu i lui Marduk/Ra.
mesopotamian i n imnurile de veneraie care l descriu
alturi sau purtnd cu el simbolul erpilor mpletii (Fig.
38a) - un simbol pe care l-am identificat cu reprezentarea
spiralelor duble ale ADN-ului (Fig. 38b) - un simbol care a
supravieuit pn n vremurile noastre ca emblem a

medicinei i vindecrii (Fig. 38c).

A existat, fr dubii, o conexiune ntre toate acestea i
crearea de ctre Moise a unui arpe din cupru pentru a opri
boala care a atins numeroi israelii n timpul exodului.
Crescut la curtea faraonului i instruit de ctre magicienii
Egiptului, Moise, la instruciunile Domnului, a fcut un
arpe din cupru i l-a pus n vrful Stlpului Miracolului, i
cnd cei care au fost afectai de boal s-au uitat n sus, la
arpele de cupru, ei au rmas n via (Numeri 21:8-10).
A fost probabil mai mult dect o coinciden faptul c una
dintre cele mai recunoscute autoriti n plan internaional n
domeniul metalurgiei i al mineritului n cupru, profesorul
Benno Rothenberg (Midianite Timna i alte publicaii), a
descoperit n Peninsula Sinai un altar datnd din vremea
perioadei midianite - vremea cnd Moise, pentru a scpa din
deertul Sinai, a locuit cu midianiii i chiar s-a cstorit cu
fiica unui nalt preot midianit. Aflat n zona unde avuseser
loc unele dintre cele mai timpurii exploatri de cupru,
profesorul Rothenberg a gsit, ntre rmiele unui altar, un
mic arpe din cupru; a fost singurul obiect de cult de acolo
(Altarul a fost reconstituit la o expoziie aflat n Pavilionul
Nechushtan de la Muzeul Eretz Israel, n Tel Aviv, unde poate
fi vzut, de asemenea, i arpele).
Sursele biblice i descoperirile din Peninsula Sinai au o
legtur direct cu descrierea lui Enki ca un Nachash.
Termenul nu are doar cele dou nelesuri pe care le-am
menionat deja (arpele, Cunosctorul Secretelor), dar i
un al treilea - Cel de Cupru, pentru c termenul evreiesc
pentru cupru, Nechoshet, provine din aceeai rdcin. Unul
dintre epitetele lui Enki n sumerian, BUZUR, avea de
asemenea un dublu neles: Cel care tie/rezolv secretele
i Cel al minelor de cupru.
Acele interconectri variate pot oferi o explicaie pentru

alegerea Inannei, altfel confuz, a locului de odihn pentru

Dumuzi: Bad-Tibira. Nicieri n textele relevante nu este nicio
indicaie a conexiunii dintre Dumuzi (i Inanna) i acel Ora
al Zeilor.

Singura conexiune posibil este faptul c Bad - Tibira a

fost cunoscut ca centrul metalurgic al Anunnaki. L-a pus
Inanna pe mblsmatul Dumuzi nu doar lng un centru de
rafinare a aurului, ci i lng unul unde era rafinat cuprul?
Alt posibilitate semnificativ se refer la construirea
Templului i a Cortului ntlnirii n deert a exodului,
conform instruciunilor foarte detaliate i explicite date lui
Moise de ctre Yahve: unde s se foloseasc aurul i argintul
i cum, ce fel de lemn sau cherestea i n ce cantiti, ce fel

de haine i piele, cum s fie cusute i cum s fie mpodobite.

O mare atenie a fost dat n aceste instruciuni cu privire la
ritualurile care trebuiau realizate de ctre preoi (numai
Aaron i fiii si la acea vreme): hainele lor, obiectele sacre pe
care trebuiau s le poarte, chiar n mod explicit ingredientele
din care trebuia fcut tmia din care putea rezulta un nor
potrivit care s-i apere de radiaia mortal din Chivotul Legii.
i nc o cerin: crearea unui lavoar n care ei trebuiau s se
spele pe mini i pe picioare, astfel nct ei nu mureau cnd
intrau la Chivotul Legii. i lavoarul, Exodul 30:17 specific,
trebuia s fie din cupru.
Toate aceste fapte i informaii dispersate, care par doar n
aparen conectate, sugereaz faptul c cuprul a jucat cumva
un rol n bio-genetica uman - un rol pe care tiina modern
abia ncepe s-l descopere (un exemplu recent este un studiu,
publicat n revista Science din 8 martie 1996, despre
distrugerea metabolizrii cuprului la nivelul creierului
asociat cu boala Alzheimer).
Un astfel de rol, dac nu face parte din primele eforturi
genetice ale lui Enki i Ninmah n crearea lui Adam, trebuie
s fi intrat cu certitudine n genomul uman atunci cnd
Enki, ca Nachash, s-a angajat n al doilea experiment, n
urma cruia Omenirea a fost nzestrat cu capacitatea de a
Cu alte cuvinte, cuprul a fost n aparen o
component a Destinului nostru, iar o analiz atent a
textelor sumeriene ale creaiei ar putea conduce la
descoperiri medicale ce ar putea afecta viaa noastr
n ceea ce-i privete pe zei, Inanna a crezut c cuprul ar
putea ajuta la renvierea iubitului ei.

naintea televiziunii, dramele din curile de judecat au
entuziasmat pe muli, iar procesele au fcut istorie. Am fcut
un drum lung de la regula biblic, prin doi martori se d
verdictul. De la probele oferite curii de ctre martorii
oculari, s-a trecut la probele pe baz de documente, la
probele criminalistice i - ceea ce pare n acest moment, ca
un rezumat - la probele date de ADN.
Descoperind c viaa este decis de frme mici de acizi
nucleici care prezint ereditatea i individualitatea pe lanuri
numite cromozomi, tiina modern a obinut capacitatea de
a citi acele caractere ADN care se ntreptrund pentru a
forma unitile lor distincte, unice, numite cuvinte.
Folosirea analizelor ADN pentru a dovedi vinovia sau
nevinovia a devenit atracia dramelor din instanele de
O fapt de neegalat a complexului secol 21? Nu, o fapt din
urm cu 100 de secole - o dram a instanelor din 10.000
Cazul antic a avut loc n Egipt, n vremea cnd nu oamenii
domneau pe pmnt, ci zeii. El se refer la adversarii Seth i
Horus i i are originea n rivalitatea dintre fraii vitregi Seth
i Osiris. Seth, vom reaminti, a recurs la o viclenie pentru a
scpa de Osiris i a-i prelua teritoriile. Prima dat, el l-a
nchis pe Osiris ntr-o lad pe care a sigilat-o repede i a
aruncat-o n Marea Mediteran; dar Isis a gsit lada i, cu
ajutorul lui Thoth, l-a nviat pe Osiris. A doua oar, frustrat,
Seth l-a prins pe Osiris i l-a tiat n 14 buci. Isis a gsit
bucile risipite, le-a unit i l-a mumificat pe Osiris pentru a
ncepe legenda Vieii de Apoi. Ea nu a gsit, oricum, falusul
zeului, pentru c Seth avusese grij ca Osiris s nu poat

avea motenitori.
Hotrt s aib unul, astfel nct s-l poat rzbuna pe
tatl su, Isis a cerut ajutorul lui Thoth, Pstrtorul
Secretelor Divine. Extrgnd esena lui Osiris din prile
pstrate ale corpului zeului, Thoth a ajutat-o pe Isis s se
insemineze i s dea natere unui fiu, Horus.
Esena (nu smna), tim acum, era ceea ce numim
astzi ADN - acizi nucleici genetici care formeaz lanurile de
cromozomi, lanuri care sunt aranjate n perechi ntr-o
spiral dubl (vezi figura 38b). La concepie, cnd sperma
masculin penetreaz ovulul feminin, cele dou spirale
ntreptrunse se separ, iar un fir de la brbat se combin
cu unul de la femeie pentru a forma o nou spiral dubl
ADN pentru urmaii lor. Este, aadar, esenial nu numai s
se uneasc mpreun cele dou spirale duble ADN, dar s se
obin i o separare - o derulare - a firelor duble, i apoi o
recombinare a unui singur fir din fiecare surs ntr-o nou
dubl spiral ntreptruns ADN.
Picturile din Egiptul antic arat c Thoth - fiul lui
Ptah/Enki -era cunosctor al acestor procese biogenetice i
le-a folosit n experimentele sale genetice. n Abydos, un
perete pictat (Fig. 40), n care faraonul Seti I a jucat rolul lui
Osiris, l arat pe Thoth sednd Viaa (simbolul Ankh) zeului
mort, dup ce obinuse de la acesta cele dou trsturi
distincte ale ADN-ului. ntr-o descriere din Cartea Morilor
referitoare la naterea lui Horus, vedem (Fig. 41) cum cele
dou Zeie ale Naterii, asistndul pe Toth, ineau fiecare
cte un fir de ADN, dubla spirala ADN fiind separat astfel
nct doar un fir s se recombine cu cel al lui Isis (artat
innd pe noul nscut Horus).
Isis a luat biatul n secret. Cnd biatul a crescut, mama
sa a decis c a venit momentul ca el s pretind motenirea
tatlui su. Astfel c, ntr-o zi, spre surprinderea total a lui

Seth, Horus a aprut n faa Consiliului Marilor Zei i a

anunat c el este fiul i motenitorul lui Osiris.
Era o revendicare incredibil i totui una ce nu putea fi
respins. Era, ntradevr, tnrul zeu fiul lui Osiris?

Aa cum arat un text cunoscut ca Chester Beatty Papyrus

No. 1, apariia lui Horus a uimit adunarea zeilor i, desigur,
pe Seth mai mult dect pe oricine. Atunci cnd consiliul a
nceput s dezbat neateptata revendicare, Seth a venit cu o
sugestie mpciuitoare: S ntrerupem discuiile n consiliu,
astfel nct s-i dm ocazia s se familiarizeze cu Horus i s
vedem dac problema poate fi rezolvat amical. El l-a invitat
pe Horus s vin s petreac o zi frumoas n casa mea, iar
Horus a fost de acord. Dar Seth, care ncercase o dat s l
prind n capcan pe Osiris, avea n minte o nou trdare:
Cnd era pe nserat,
A fost ntins patul pentru ei,
i cei doi au pus deasupra.
i noaptea Seth a fcut membrul su s devin rigid

i l-a fcut s mearg ntre coapsele lui Horus.

Cnd dezbaterile au fost reluate, Seth a fcut un anun

uimitor. El a spus c nu conteaz dac Horus este sau nu
fiul lui Osiris. Pentru c acum smna sa, a lui Seth, este n
Horus i aceasta l face pe mai degrab succesor al su dect
concurent la succesiune!
Apoi Horus a fcut un anun chiar mai surprinztor.
Dimpotriv, a spus el, nu sunt eu cel descalificat - Seth este!
i el a continuat s povesteasc faptul c nu dormea cu
adevrat cnd Seth a vrsat smna sa. Nu a intrat n
corpul meu, a spus el, pentru c Am prins smna n
minile mele. Dimineaa a luat smna s o arate mamei
sale, Isis, i aceasta a avut o idee. Ea l-a pus pe Horus s
ejaculeze smna sa ntr-o can; apoi a rspndit smna
lui Horus pe salata verde din grdina lui Seth - masa favorit
la micul dejun al lui Seth. Netiind, Seth a ingerat smna
lui Horus. Aadar, a spus Horus, smna mea este cea care
se afl n Seth, i acum el mi poate fi succesor, dar nu mi
poate preceda la tronul divin...
ncurcat complet, Consiliul Zeilor s-a ndreptat ctre Thoth
pentru a rezolva problema. Folosind cunotinele sale n
genetic, el a verificat smna pe care Isis o pstrase ntr-un
vas i a aflat c ntradevr era cea a lui Seth. El la examinat

pe Horus i nu a gsit la el urme ale ADN-ului lui Seth. Apoi

la examinat pe Seth i a gsit c acesta ingerase ntradevr
ADN-ul lui Horus.
Lucrnd ca un expert criminalist ntr-un tribunal modern,
dar nzestrat cu capaciti tehnice pe care nu le deinem
nc, el a prezentat rezultatele analizelor Consiliului Zeilor. Ei
au votat n unanimitate s ofere conducerea Egiptului lui
(Refuzul lui Seth de a ceda conducerea a dus la ceea ce noi
am numit Primul Rzboi al Piramidei, n care Horus a inclus,
pentru prima dat, oamenii ntr-un rzboi ntre zei. Am
detaliat acele evenimente n Rzboaiele Zeilor cu Oamenii).
Descoperirile recente n genetic arunc o lumin nou
asupra unui persistent i aparent ciudat obicei al zeilor i, n
acelai timp, scoate n eviden complexitatea lor biogenetic.
Importana soiei-surori n regulile de succesiune ale zeilor
din Mesopotamia i Egipt, evident din toate pe care le-au
raportat pn acum, a fost transmis n mitologia greac
referitoare la zei. Grecii au numit primul cuplu divin,
provenit din Haos, Gheea (Pmntul) i Uranus (Cer sau
Rai). Din ei au luat natere 12 Titani, ase brbai i ase
femei. Cstoriile mixte i urmaii diferii au pus bazele
viitoarelor btlii pentru supremaie. Din primele btlii, cel
care s-a ridicat n vrf a fost Cronos, cel mai tnr fiu dintre
Titani, a crui soie era sora sa, Rhea; copiii lor au fost trei fii
Hades, Poseidon i Zeus i trei fiice Hestia, Demetra i Hera.
Dei Zeus i-a croit calea ctre supremaie, el a trebuit s
mpart puterea cu fraii si. Cei trei i-au mprit domeniile
ntre ei - unele versiuni spun c prin tragere la sori; la fel ca
Anu, Enlil i Enki aveau: Zeus era zeul cerurilor (cu
reedina pe Pmnt, pe Muntele Olimp); lui Hades i s-a dat
Lumea de Jos; iar lui Poseidon, mrile.

Cei trei frai i cele trei surori, urmai ai lui Cronos i ai

Rheei, au format prima jumtate a Cercului Olimpian de 12.
Ceilali ase au fost urmaii lui Zeus, nscui cnd Zeus a
convieuit cu diverse zeie. Cu una dintre ele, Leto, el a avut
Primul su Nscut, pe marele zeu grec i roman, Apollo.
Cnd a venit timpul, pentru a obine un fiu motenitor n
acord cu regulile de succesiune ale zeilor, Zeus s-a ntors
ctre propriile sale surori. Hestia, cea mai n vrst, era, din
descrieri, o pustnic, prea n vrst i prea bolnav pentru
cstorie sau copii. Zeus a dorit aadar un fiu de la sora sa
mijlocie, Demetra; dar n locul unui fiu, ea i-a druit o fiic,
Persefona. Aceasta i-a pregtit drumul n direcia unei
cstorii cu Hera, sora cea mai mic; ea i-a druit lui Zeus
un fiu, Ares, i dou fete (Ilithyia i Hebe). Cnd grecii i
romanii, care au pierdut cunotinele despre planetele de
dincolo de Saturn, au numit planetele cunoscute, ei au
desemnat-o pe una - Marte - pentru Ares; dei nu era Primul
Nscut, el era Cel Dinti Fiu al lui Zeus. Apollo, dei era unul
dintre zeii mari, nu a avut o planet numit dup el de ctre
greci i romani.
Toate acestea au mrit importana soiei-surori n cronicile
zeilor. n chestiuni de succesiune, problema aprea mereu:
Cine va fi succesorul la tron - Primul Fiu Nscut sau Fiul Cel
Dinti, dac ultimul a fost nscut de o sor vitreg, iar cel
dinti nu? Aceast problem pare s fie dominat i dictat
cursul evenimentelor de pe Pmnt din momentul n care
Enlil s-a alturat lui Enki pe aceast planet, iar rivalitatea a
fost transmis fiilor lor (Ninurta i, respectiv, Marduk). n
povetile egiptene ale zeilor, un conflict din raiuni similare a
aprut ntre descendenii lui Ra, Seth i Osiris.
Rivalitatea, care periodic se transforma ntr-un adevrat
rzboi (Horus, la final, a luptat cu Seth ntr-o singur btlie
n cer n zona Peninsulei Sinai) nu a nceput pe Pmnt,

dup toate relatrile. Au existat conflicte similare de

succesiune pe Nibiru i Anu nu a preluat conducerea fr
La fel ca obiceiul potrivit cruia vduva lsat fr un fiu
putea cere fratelui soului s o cunoasc ca un nlocuitor al
soului i s-i dea un fiu, la fel erau regulile de succesiune
ale zeilor Anunnaki, dnd prioritate unui fiu de la sora
vitreg, i s-au regsit n obiceiurile lui Avraam i ale
descendenilor si. n cazul su, primul fiu a fost Ishmael,
nscut de servitoarea Hagar. Dar cnd, la o vrst incredibil
de naintat, dup intervenia divin, Sara l-a nscut pe
Isaac, acesta a fost numit Motenitor Legal. De ce? Pentru c
Sara era sora vitreg a lui Avraam. Ea este sora mea, fiica
tatlui meu, dar nu a mamei mele, a explicat Avraam
(Geneza 20:12).
Cstoria cu sora vitreg era preponderent printre
faraonii Egiptului, ca un mijloc de legitimare a domniei
regelui i, deopotriv, a motenirii. Obiceiul exista i printre
regii incai din Peru, att de frecvent nct apariia unor
calamiti n timpul domniei unui anumit rege a fost
atribuit faptului c femeia cu care acesta s-a cstorit nu
era sora sa vitreg. Obiceiul inca i are originile n
Legendele nceputurilor popoarelor din Anzi, unde zeul
Viracocha a creat patru frai i patru surori care s-au
cstorit ntre ei i au fost orientai ctre diferite pmnturi.
Un astfel de cuplu frate-sor, care a primit o baghet din aur
cu care s gseasc Centrul Pmntului n Africa de Sud, ia nceput domnia n Cuzco (capitala inca de odinioar). De
aceea - artnd c sunt nscui din cuplul regal frate-sor ei puteau pretinde apartenena la linia direct a Zeului
Creator, Viracocha.
(Viracocha, potrivit legendelor din Anzi, a fost un mare Zeu
al Cerului care a venit pe Pmnt n antichitate i a ales s

locuiasc n zona munilor Anzi. n cartea Regatele Pierdute lam identificat cu zeul mesopotamian Adad = zeul hitit
Teshub i exist o mulime de asemnri ntre cultura
Anzilor i cele din vechiul Orient Apropiat).
Persistena cstoriei mixte i semnificaia considerabil
acordat acesteia, printre zei i oameni deopotriv, este
enigmatic. Obiceiul pare s fie mai mult dect o atitudine de
tipul s inem tronul n familie i n cel mai ru caz poate
atrage degradarea genetic. De ce atunci strduina cu care
zeii Anunnaki (exemplu: eforturile repetate ale lui Enki de a
avea un fiu de la Ninmah) doreau s obin un fiu dintr-o
astfel de unire? Ce era att de special la genele unei surori
vitrege - fiica, s reinem, de la tat, i categoric nu de la
Cutnd rspunsul, este bine s observm celelalte
practici biblice cu privire la chestiunile mam/tat. Este
obinuit referirea la perioada lui Avraam, Isaac, Iacov i
Iosif, ca la Era Patriarhal i muli oameni ar putea spune c
istoria Vechiului Testament a fost prezentat dintr-o
perspectiv masculin. Totui, adevrul este c mamele, nu
taii, erau cele care controlau actul care, din punctul de
vedere al anticilor, acorda subiectului unei poveti statutul
su de fiin - i anume numirea copilului. ntradevr, nu
doar o persoan, dar i un loc, un ora, un teritoriu,
ncepeau s existe dup ce li se ddea un nume.
Ideea, n fapt, se ntlnete nc, de la nceputul timpului,
pentru c primele versuri ale Epopeii Creaiei, dorind s
impresioneze, spun c povestea ncepe naintea crerii
ntregului Sistem Solar, i afirm c povestea lui Tiamat i a
celorlalte planete ncepe:
Enuma elish la nabu shamamu
Cnd nlimile cerului nu fuseser numite
Shapiltu ammatum shuma la zakrat

i, dedesubt, solul tare (Pmntul) nu fusese numit.

n chestiunea important a numirii unui fiu, acest
privilegiu revenea fie zeilor nii, fie mamei. Aflm, aadar,
c atunci cnd Elohim l-a creat pe Homo Sapiens, ei au fost
cei care au numit noua fiin Adam (Geneza 5:2). Dar cnd
Omului i s-a dat capacitatea de a procrea singur, Eva - nu
Adam - a fost cea care a avut dreptul i privilegiul de a da un
nume copilului de sex masculin, Cain (Geneza 4:1 ), precum
i lui Seth care l-a nlocuit pe Abel cel ucis (Geneza 4:25).
La nceputul Erei Patriarhilor(!), aflm c privilegiul
numirii celor doi fii ai lui Avraam a fost preluat de ctre fiine
divine. Primul su nscut, de ctre Hagar, servitoarea soiei
sale, a fost numit Ishmael de ctre un nger al lui Yahve
(Geneza 16:11); iar Motenitorul Legal, Isaac (Itzhac, Care
provoac rs) a fost astfel numit de ctre unul dintre cele
trei fiine divine care l-au vizitat pe Avraam naintea
distrugerii Sodomei i Gomorei (pentru c atunci cnd Sara la auzit pe Dumnezeu spunnd c va avea un fiu, a rs;
Geneza 17:19; 18:12). Nu este dat nicio informaie n Biblie
cu privire la cei doi fii ai lui Isaac cu Rebecca, Esau i Iacov
(se spune simplu c aa au fost numii). Dar apoi se spune c
Lea a fost cea care i-a numit pe fiii lui Iacov dup ea i
slujnica sa, cum a fcut Rahela (Geneza, capitolele 29 i 30).
Dup mai multe secole, dup ce israeliii s-au stabilit n
Canaan, mama lui Samson a fost cea care i-a numit fiul
(Judectori 13:24); la fel a fcut i mama Omului lui
Dumnezeu, Samuel (Samuel I 1:20).
Textele sumeriene nu furnizeaz acest fel de informaie. Nu
tim, de exemplu, cine i-a dat numele lui Ghilgame - mama
sa, zeia, sau tatl su, naltul Preot. Dar povestea lui
Ghilgame ofer un indiciu important pentru soluionarea
acestei enigme: importana mamei n determinarea statutului
ierarhic al fiului.

Cutarea sa n vederea obinerii longevitii zeilor, trebuie

reamintit, l-a dus la nceput n Locul Aterizrii din Munii
Cedru; dar el i tovarul su, Enkidu, au fost mpiedicai s
intre de ctre robotul gardian i de ctre Taurul Cerului.
Ghilgame a cltorit apoi ctre portul spaial din Peninsula
Sinai. Accesul la el era supravegheat de oameni-rachet care
au ndreptat spre el reflectoare nfricotoare ce au strbtut
munii, a cror privire era mortal (Fig. 42); dar Ghilgame
nu a fost afectat; dup aceea, un om rachet a strigat
tovarului su:
Cel care vine,
Din carnea zeilor
Este corpul su!
Permindu-i-se s se apropie, Ghilgame a confirmat
concluzia gardianului: ntradevr, el era imun la razele
mortale, pentru c trupul su era din carnea zeilor. El era,
a explicat, nu doar un semizeu - el era dou treimi divin,
pentru c nu tatl su, ci mama sa era o zei, una dintre
femeile Anunnaki.
Iat, credem noi, care este cheia misterului regulilor de
succesiune i accentul care cade pe mam. Este faptul c
prin mam i-a fost dat eroului sau motenitorului (fie el
Anunnaki sau patriarh), acel plus de doz necesar.
Aceasta prea s nu aib sens chiar dup descoperirea, n
1953, a structurii dublu spiralat a ADN-ului i a nelegerii
modului n care cele dou fire se mbin i se separ, astfel
nct doar un fir de la ovulul femeii i un fir de la sperma
brbatului se recombin fcnd ca urmaul s preia
trsturi jumtate-jumtate de la ambii prini. ntradevr,
aceast nelegere, aa cum explic preteniile semizeului,
justific pretenia inexplicabil a lui Ghilgame de a fi dou
treimi divin.
Abia n anul 1980, solicitarea antic a nceput s aib

sens. Aceasta s-a ntmplat odat cu descoperirea faptului

c, n plus fa de ADN-ul depozitat n celule, deopotriv la
femei i brbai, n structura dublu spiralat pe tulpinile
cromozomilor formnd nucleele celulelor, exista acolo alt fel
de ADN care plutete n celul n afara nucleului.
Denumindu-l ADN Mitocondrial (mtADN), s-a descoperit c
se transmite doar de la mam i c se afl n afara combinrii
i divizrii cu ADN-ul masculin.

Cu alte cuvinte, dac mama lui Ghilgame era o zei,

atunci el a motenit ntradevr deopotriv jumtate din ADNul obinuit plus mtADN, fcndu-l, aa cum a pretins, pe
dou treimi divin. Aceast descoperire a existenei i a
transmiterii, mtADN-ului, le-a dat posibilitatea cercettorilor
ncepnd cu anul 1986 s identifice mtADN la omul modern,
la o Ev care a locuit n Africa n urm cu 250.000 de ani.
La nceput, cercettorii au crezut c singura funcie a
mtADN este s acioneze ca o fabric de celule, furniznd
energia necesar reaciilor biologice i chimice ale celulei.
Dar apoi s-a dovedit c mtADN era fcut din mitocondrii
coninnd 37 de gene aranjate ntr-un cerc nchis, ca o
brar; i c o astfel de brar genetic include peste
16.000 de perechi de baz din alfabetul genetic (prin

comparaie, fiecare dintre cromozomii care compun nucleul

celulei care sunt motenii n proporie de jumtate de la
fiecare printe conin 100.000 de gene i un agregat de mai
mult de trei miliarde de perechi de baz).
A durat mai mult de un deceniu s se neleag c acea
imperfeciune n alctuirea sau n funcionarea mtADN poate
produce dereglri n corpul uman, n mod special n sistemul
nervos, la inim, muchi i rinichi. n anii '90 cercettorii au
aflat c acele defecte (mutaii) din mtADN distrug, de
asemenea, producerea celor 13 proteine importante din corp,
producnd diverse afeciuni severe. O list publicat n 1997
n Scientific American ncepe cu boala Alzheimer i continu
cu o varietate de malformaii ale vzului, auzului, sngelui,
muchilor, oaselor, inimii, rinichilor i creierului.
La aceste probleme genetice se adaug o list mai lung de
malformaii i disfuncii ale corpului care i au cauza n
defectele din nucleul ADN. Deoarece oamenii de tiin au
descifrat i neles genomul - codul genetic complet - uman
(o descoperire recent realizat pe o singur bacterie), funcia
fiecrei gene (i, la polul opus defectele antrenate de lipsa lor
sau de proasta lor funcionare) au devenit cunoscute.
Neproducnd o anumit protein, enzim sau alt compus
cheie al corpului, s-a descoperit c gena care reglementeaz
aceast funcie cauzeaz cancerul de sn sau mpiedic
formarea oaselor, surzenia, pierderea vederii, dereglarea
inimii, luarea n greutate sau opusul su i aa mai departe.
Ceea ce este interesant n aceast privin este c ntlnim
o list asemntoare de defecte genetice cnd citim textele
sumeriene despre crearea Muncitorului Primitiv al lui Enki,
cu asistena lui Ninmah. ncercarea de a recombina firele
ADN-ului uman cu cele ale ADN-ului Anunnaki pentru a crea
o nou fiin-hibrid a fost un proces de ncercri i erori, iar
fiinele iniiale ieeau uneori cu membre i organe lips - sau

aveau prea multe. Preotul babilonian Berossus, care a

compilat pentru greci, n secolul III .Chr., istoria i
cunotinele timpurii sumeriene, a descris rezultatele greite
ale creatorilor Omenirii, preciznd c acele cteva fiine
euate aveau dou capete pe un trup. Astfel de montri au
fost ntradevr descrii de ctre sumerieni (Fig. 43a), la fel ca
alte anomalii - o fiin cu un cap, dar cu dou fee numit
Usmu (Fig. 43b).
Sunt menionate n mod special n texte o fiin care nu i
putea ine urina i o varietate de malformaii incluznd bolile
de ochi i de vedere, mini care tremurau, un ficat
necorespunztor, un auz slab i boli ale btrneii. Textul
numit Enki i Ninmah: Crearea Omenirii, a enumerat mai
multe disfuncii (mini rigide, picioare paralizate, scurgere a
lichidului seminal) i l-a descris pe Enki ca pe un zeu grijuliu
care, n loc s distrug acele fiine diforme, le-a gsit gsit
moduri de via utile. Astfel, cnd o astfel de fiin a fost un
om cu defect de vedere, Enki l-a nvat un meteug care nu
solicita vederea - arta de a cnta cu vocea i din lir.
Tuturor acestora, spun textele, Enki le-a decis un destin
sau altul. El atunci a provocat-o pe Ninmah s ncerce un
experiment genetic pe cont propriu. Rezultatele au fost
groaznice: fiinele pe care le-a creat aveau gura poziionat
greit, durere de cap, ochi iritai, gt dureros, coaste ubrede,
plmni malformai, disfuncii ale inimii, intestine
nefuncionale, mini prea scurte pentru a ajunge la gur i
tot aa. Dar pe msur ce ncercrile i erorile au continuat,

ntradevr, a ajuns n punctul de a cunoate genoamele

Anunnaki/uman astfel nct se luda c putea face o nou
fiin uman perfect sau imperfect, dup cum dorea: Ct
de bun sau ru este corpul omului?
Aa cum mi spune inima.
Pot face soarta lui bun sau rea.
Noi, de asemenea, am ajuns la nivelul n care putem
introduce sau nlocui o anumit gen al crui rol l-am
descoperit i ncerca s prevenim sau s vindecm o anumit
boal sau un defect. ntradevr, a aprut o nou industrie,
cea biotehnologic, cu un potenial nelimitat pentru medicin
(i cursul valorilor). Am nvat chiar s realizm ceea ce se
numete experiment transgenic - transferul genelor ntre
diferite specii, o aciune realizabil deoarece toate materialele
genetice de pe aceast planet, de la cea mai mic bacterie la
cea mai complicat fiin (Omul), toate organismele vii care
cutreier pmntul sau zboar, noat sau cresc, sunt fcute
din acelai ABC genetic - aceiai acizi nucleici care formeaz
smna adus n Sistemul nostru Solar de Nibiru.
Genele noastre sunt, n fapt, legtura noastr cosmic.
Progresele moderne n genetic s-au fcut pe dou ci
paralele i totui interconectate. Una a fost stabilirea

genomului uman, componena genetic a fiinei umane;

aceasta presupune citirea unui cod care, dei scris cu doar
patru caractere (A-G-C-T, iniialele numelor date celor patru
acizi nucleici care compun tot ADN-ul), este fcut din
combinaii nenumrate ale acelor litere care formeaz apoi
cuvinte ce se combin n propoziii i paragrafe i n
final ntr-o carte a vieii complet. Cealalt cale de cercetare
este s se determine funcia fiecrei gene; este o sarcin chiar
mai descurajant, generat de faptul c dac aceeai gen
lumea genetic poate fi gsit ntr-o simpl creatur (cum
ar fi o bacterie mic sau un oarece de laborator), iar funcia
sa poate fi determinat experimental, este cu siguran sigur
c aceeai gen n lumea uman are aceleai funcii (iar
absena ei genereaz aceleai disfuncii). Descoperirea
genelor legate de obezitate, de exemplu, a fost realizat pe
aceast cale.
Scopul final al acestei cercetri pentru a afla cauza i,
astfel, vindecarea disfunciilor i deficienelor umane, este
dublu: s gseasc genele care controleaz fiziologia corpului
i pe acelea care controleaz funciile neurologice ale
creierului. Pentru a gsi genele care controleaz procesul
mbtrnirii, ceasul intern al celulei n cursul vieii - genele
longevitii - i genele care controleaz memoria, raiunea,
inteligena. Experimentele pe oarecii de laborator, pe de o
parte, i pe gemeni umani, pe de alta, precum i alte
cercetri extinse, au indicat existena genelor i a grupurilor
de gene care le explic pe ambele. Ct de dificile i greu de
concretizat sunt scopurile cercetrii poate fi artat de
concluzia cercetrii genei inteligenei prin compararea
gemenilor: cercettorii au ajuns la concluzia c exist nu mai
puin de 10.000 de spaii ale genelor sau cuvinte genetice
rspunztoare de inteligen i boli cognitive, fiecare avnd
un rol mic prin ea nsi.

Avnd n vedere astfel de complexiti, se dorete c

cercettorii moderni ar putea recurge la un parcurs
furnizat de - da! - sumerieni. Progresele remarcabile n
astronomie continu s confirme cosmogonia sumerian i
informaiile tiinifice furnizate de Epopeea Creaiei: existena
altor sisteme solare, traseele orbitale eliptice, orbitele
retrograde, catastrofele, ap pe alte planete - la fel ca i
explicaiile pentru care Uranus este nclinat pe o parte,
originea Centurii de Asteroizi i cea a Lunii, cavitatea de pe o
parte a Pmntului i continentele de pe cealalt parte. Toate
sunt explicate prin cunotinele tiinifice complexe din
povestea lui Nibiru i a Btliei Cereti.
De ce nu am lua n serios, atunci, ca pe un parcurs
tiinific, cealalt parte din povetile sumeriene ale
creaiei - cea privind crearea lui Adam?
Textele sumeriene ne informeaz, nainte de toate, c
smna vieii - alfabetul genetic - a fost adus pe Pmnt de
Nibiru n timpul Btliei Cereti, acum patru miliarde de ani.
Dac procesele de evoluie pe Nibiru au nceput nainte ca ele
s fie lansate pe Pmnt, evoluia acolo trebuie s fi nceput
cu 40 de milioane de ani naintea celei de pe Pmnt. Este,
aadar, foarte plauzibil ca super-oamenii Anunnaki s fi fost
capabili s cltoreasc n spaiu acum jumtate de milion
de ani. Este, de asemenea, plauzibil ca atunci cnd au sosit
aici, s fi gsit pe Pmnt fiine inteligente asemntoare, n
stadiul de umanoizi.
Dar, venind de la aceeai smn, experimentul
transgenic a fost posibil, aa cum a descoperit i sugerat
apoi, Enki. Fiina de care avem nevoie exist deja!, a
explicat el. Tot ceea ce trebuie s facem este s punem
semnul nostru (genetic) pe el.
Se poate presupune c Anunnaki erau deja contieni de
genomul complet al Nibiruanilor i capabili s gseasc un

genom al umanoizilor, aa cum suntem noi azi. Ce trsturi,

mai exact, au ales Enki i Ninmah s le transfere de la
Anunnaki la umanoizi? Deopotriv, textele sumeriene i
versetele biblice au artat c n vreme ce primii oameni
deineau - unii (nu toi) - longevitatea zeilor Anunnaki, cuplul
creator a renunat n mod deliberat s-i dea lui Adam gena
nemuririi (longevitatea Anunnaki care era legat de perioada
orbital a planetei Nibiru). Ce defecte, pe de alt parte, au
rmas ascunse n profunzimea genomului recombinat al lui
Credem cu trie c au existat cercettori calificai
pentru studierea informaiilor furnizate de textele
sumeriene, c au fost obinute informaii medicale i
biogenetice de valoare. Un caz uimitor este deficiena
cunoscut ca sindromul Williams. Afectnd dur una din
20.000 de nateri, victimele sale au un IQ foarte sczut, la
limita strii retardrii; dar n acelai timp ei exceleaz n
unele domenii artistice. Cercetri recente au descoperit c
sindromul ce provoac astfel de savani idioi (cum sunt ei
descrii uneori) este cauzat de un mic decalaj n Cromozomul
7, lipsind persoana de 15 gene. Una dintre cele mai frecvente
insuficiene este incapacitatea creierului de a recunoate
ceea ce vd ochii - afectarea vederii; unul dintre cele mai
obinuite talente este cel muzical. Dar asta este exact ceea
ce spune textul sumerian despre omul a crui vedere era
afectat i pe care Enki l-a nvat s cnte!
Deoarece Adam nu a putut, la nceput, s procreeze
(facndu-i pe Anunnaki s nceap donarea), trebuie s
tragem concluzia c, la acel nivel, fiina-hibrid deinea doar
cei 22 de cromozomi de baz. Tipurile de dureri, deficiene (i
remedii) pe care biomedicina modern trebuie s le gseasc
n acei cromozomi sunt tipurile i seriile enumerate n textele

lui Enki i Ninmah.

Experimentele genetice ulterioare (transmise de Biblie prin
povestea lui Adam i a Evei n Grdina Edenului) au dat
capacitatea procrerii - adugarea cromozomilor X (feminin)
i Y (masculin) la cei 22 de baz (Fig. 44). Contrar
convingerilor nrdcinate c aceti doi cromozomi nu au alt
funcie dect cea de determinare a sexului copilului, cercetri
recente au artat c cei doi cromozomi joac roluri mult mai
diverse i extinse. Din mai multe raiuni aceasta i-a uimit pe
cercettori, n special cu privire la cromozomul Y (masculin).
Studiile publicate la sfritul anului 1997 sub titlul tiinific
Functional Coherence of the Human Y Chromosome a inut
prima Pagin a ziarelor, cum ar fi Cromozomul Masculin nu
este o iluzie genetic n fapt (New York Times, 28 octombrie
1997). (Aceste descoperiri, au confirmat, ca un plus
neateptat, faptul c Adam, ca i Eva, au plecat n Africa de

De unde a obinut Enki - Nachash - cromozomii X i Y? i

care a fost sursa mtADN? Sugestiile din textele sumeriene

arat c Ninki, soia lui Enki, a jucat un rol crucial n stadiul

final al crerii omului. Ea a fost cea care, a decis Enki,
trebuia s dea umanitii un ultim dar, nc o motenire
Soarta noului nscut,
Tu o vei pronuna;
Ninki va putea ntipri peste el
Imaginea zeilor.
Cuvintele s-au reflectat n relatarea biblic ce spune c
dup chipul i asemnarea lor au creat Elohim pe Adam. i
dac ntradevr Ninki, soia lui Enki i mama lui Marduk, a
fost sursa mtADN-ului transmis Evei, importana acordat
liniei sor-soie ncepe s aib sens; pentru c ea constituie
nc o legtur cu originile cosmice ale Omului.
Textele sumeriene subliniaz c, n vreme ce zeii i-au
pstrat pentru ei Viaa Venic, ei au dat Omenirii
nelepciunea, o doz n plus a genelor inteligenei. Aceast
contribuie genetic suplimentar, credem, este subiectul
unui text pe care oamenii de tiin l-au numit Legenda lui
Identificat clar n text ca Un fiu al lui Eridu, centrul de
cult al lui Ea/Enki n Edin, el era numit de asemenea n text
fiul lui Ea - un urma, sugereaz alte fragmente, al lui
Ea/Enki nsui de la o alt femeie dect soia sa. n virtutea
acestei descendene, dar i printr-o aciune deliberat,
generaiile i-au amintit de Adapa ca fiind Cel mai nelept
Brbat i a fost numit neleptul lui Eridu:
n acele zile, n acei ani.
Ea l-a creat pe neleptul lui Eridu
Ca un model al omului.
O larg nelegere i-a pregtit lui
Dezvluindu-i planurile Pmntului.
I-a dat lui nelepciunea;

Via Eterna nu i-a dat.

Ciocnirea dintre Soart i Destin ne-a dus la momentul
apariiei lui Homo sapiens-sapiens; Adapa, de asemenea,
fiind fiul unui zeu, a cerut nemurirea. Asta, dup cum tim
din Epopeea lui Ghilgame, putea fi obinut urcnd la cer n
lcaul lui Anunnaki; i asta este ceea ce i-a spus Ea/Enki
lui Adapa. Nenfricat, a cerut i a primit parcursul de la
Enki pentru a ajunge la locul acela: El l-a fcut pe Adapa s
ia drumul ctre cer i a urcat pe cer. Enki i-a dat
instruciuni corecte despre cum s aib acces la camera
tronului lui Anu; dar i-a dat sfaturi complet greite despre
cum trebuie s se comporte cnd i s-ar oferi Pinea Vieii i
Apa Vieii. Dac vei accepta i vei mpri acestea cu ei, l-a
avertizat Enki pe Adapa, cu siguran vei muri! Astfel,
ndrumat greit de ctre propriul su tat, Adapa a refuzat
mncarea i butura zeilor i a sfrit prin a suporta
Destinul su de muritor.
Dar Adapa a acceptat mbrcmintea ce i s-a adus, s-a
nfurat n ea i s-a uns cu uleiul pe care zeii i l-au oferit i
pe care l-a luat cu el. Apoi, a spus Anu, Adapa va fi iniiat n
cunotinele secrete ale zeilor. El i-a artat ntinderea
cereasc, de la orizontul cerului la zenitul su. Lui i s-a
permis s se ntoarc la Eridu ntreg i n siguran, iar acolo
a fost iniiat de ctre zeia Ninkarrak n secretele bolilor care
au fost atribuite Omenirii, boli care au fost trimise corpurilor
muritorilor, i a nvat de ea cum s aline astfel de dureri.
Ar putea fi relevant s reamintim aici asigurrile biblice pe
care Yahve le-a dat israeliilor n pustiul din Sinai. Rtcind
trei zile fr ap, ei au ajuns la o gur de ap care nu era
potabil. Dumnezeu i-a artat lui Moise un anume copac i ia spus s l arunce n ap, iar apa a devenit potabil. i
Dumnezeu le-a spus israeliilor: Dac vei asculta poruncile
mele, nu i voi da bolile Egiptului; Eu, Yahve, voi fi

vindectorul tu (Exodul 15:26). Promisiunea lui Yahve de a

aciona ca vindector al poporului su ales se repet n
Exodul 23:25, unde se face o referire special pentru a i se
permite unei femei sterpe s poarte un copil. (Acea
promisiune special s-a ndeplinit n cazul Sarei i al
celorlalte femei din naraiunea biblic).
De vreme ce ne referim aici la entitatea divin, putem
afirma cu siguran c avem de-a face de asemenea cu
vindecarea genetic. Evenimentele cu Nefilim, care au
descoperit n zorii Potopului, faptul c fiicele lui Adam erau
compatibile cu ei i puteau s aib copii mpreun, a
implicat, de asemenea, genetica.
Au avut aceste cunotine de genetic scopuri de
vindecare, mprtite lui Adapa i celorlali semizei sau
iniiai? i dac da - atunci cum? Cum a putut fi transmis
codul genetic complex Pmntenilor n acele vremuri
Pentru un rspuns, credem, trebuie s cercetm literele i
tiina - nelegerea modului n care funcioneaz cerul i
Pmntul - era n posesia zeilor; aa credeau fr ndoial i
popoarele antice. Era un secret al zeilor ce trebuia ascuns
Omenirii sau trebuia dezvluit din timp n timp i numai
parial unor indivizi alei - iniiai n secretele divine.
Tot ce tim ne-a fost transmis nou de ctre zei, spun
sumerienii n scrierile lor; acolo se afl fundamentul, prin
milenii, pn la vremurile noastre, al tiinei i Religiei, al
descoperirilor i esoterismului.
La nceput era Cunotina Secret, care a fost dezvluit

cnd Omenirea a primit nelegerea devenit Judecata Sacr,

ntemeierea civilizaiilor umane i avansate. n ceea ce
privete secretele pe care zeii le-au pstrat pentru ei - acelea,
la final, s-au dovedit cele mai devastatoare pentru Omenire.
Unii au nceput s se ntrebe dac cercetarea nesfrit a
Ceea ce Este Ascuns, uneori prin metoda misticismului,
provine nu din dorina de a atinge starea de divinitate, ci din
teama pentru ceea ce Soarta zeilor - n adunrile lor secrete
sau n coduri ascunse - a hotrt pentru Omenire.
Unele dintre cunotinele care au fost, sau ar fi putut fi
mprtite Omenirii cnd Judecata i nelegerea au fost
date, pot fi acumulate prin provocarea lui Iov de ctre
Dumnezeu cu privire la ce nu tie el (dar Dumnezeu tie).
Spune dac ai cunoate tiina, i-a spus Stpnul biblic
suferindului Iov:
Cine a msurat Pmntul,
Ca acesta s fie cunoscut?
Cine a ntins o frnghie peste el?
De ce au fost lucrate platourile sale?
Cine a fcut piatra din capul unghiurilor?
De unde vine nelepciunea,
i unde este ascuns nelegerea?
Muritorii nu tiu nvinuirea lor,
Ea nu se gsete pe Pmntul oamenilor.
Cile lui Elohim sunt cunoscute,
Domnul tie locul;
Pentru c el vede pn la sfritul Pmntului
i el vede toate ce sunt sub Ceruri.
Cu aceste cuvinte la provocat Domnul biblic pe Iov
(capitolul 28) pentru a opri ntrebrile referitoare la motivele
Soartei sale sau la scopul su final; deoarece cunotinele
Omului - Judecata i nelegerea - sunt att de departe de
cele ale Domnului, nct ele nu au ca scop s cerceteze sau

s ncerce s afle voina divin.

Acea abordare antic a Judecatei i nelegerii secretelor
cerului i Pmntului - a tiinei - ca un domeniu divin la
care doar civa muritori puteau avea acces, i-a gsit
expresia nu doar n scrierile canonice dar, de asemenea, i n
misticismul iudaic, cum a fost Cabala, potrivit creia
Prezena Divin simbolizat prin Coroana Domnului se
bazeaz pe penultimele suporturi denumite Judecata
(Hochnah) i nelegerea (Binah) (Fig. 45). Ele au fost aceleai
dou componente ale cunotinelor tiinifice n legtur cu
care fusese provocat Iov.
Referirile la Hochmah (nelepciunea) din Vechiul
Testament dezvluie faptul c se considera c aceasta fusese
dat n dar de ctre Dumnezeu, pentru c el era Stpnul
Universului care deinea nelepciunea necesar pentru
crearea cerului i a Pmntului. Ct de minunate sunt
faptele tale, O, Stpne; cu nelepciune le-ai lucrat pe toate,
spune Psalmul 104, cnd descrie i preamrete, etap cu
etap, lucrarea Creatorului. Cnd Stpnul a dat
nelepciunea unor oameni alei, susine Bilia, El a mprit,
de fapt, cu ei cunotinele despre ceruri, Pmnt i toate de
pe Pmnt. Cartea lui Iov descrie astfel de cunotine ca fiind
Secretele nelepciunii, care nu-i fuseser dezvluite lui.
umanitatea, prin iniiaii alei, a nceput naintea Potopului.
Lui Adapa, urmaul lui Enki, cruia i fuseser date
nelepciunea i nelegerea (nu i Viaa Venic) i s-a artat
de ctre Anu cum s-a extins cerul nu doar cu o privelite
nfricotoare. Referirile postdiluviu se fac la el ca fiind
autorul unei lucrri cunoscute cu titlul Scrieri cu privire la
timp (de la) Divinul Anu i Divinul Enlil - care trateaz despre
calcularea timpului i despre calendar. Pe de alt parte,
cartea Povestea lui Adapa menioneaz n mod special, faptul

c el a fost nvat, n Eridu, arta medicinei i a vindecrii. El

a fost, aadar, un om de tiin complet, expert deopotriv n
noiuni cereti i pmnteti; el a fost, de asemenea, uns ca
Preotul lui Eridu - probabil primul care deinea cunotine de
Religie i tiin.
Consemnrile sumeriene vorbesc despre un alt Ales din
perioada prediluvian, cel care a fost iniiat n secretele
divine fiind luat sus, n lcaul ceresc al zeilor Anunnaki. El
venea din Sippar (Oraul Psrii), condus de Utu/Shamash
i era probabil un urma al acestuia, un semizeu. Cunoscut
n texte ca EN.ME.DUR.ANNA, dar i ca EN.ME.DUR.AN.KI
(Stpn al Tblielor Divine Referitoare la Cer sau (Stpn
al Tblielor Divine al Legturii Cer-Pmnt), el a fost luat
sus, de asemenea, pentru a fi nvat cunotinele secrete.
Iniiatorii i profesorii au fost zeii Utu/Shamash i
Shamash i Adad l-au (mbrcat? uns?)
Shamash i Adad l-au pus pe un tron mare din aur
Ei i-au artat cum s observe uleiul i apa,
Un secret al lui Anu, Enlil i Ea.
Ei i-au dat o tbli divin
Kibbu, un secret al Cerului i Pmntului.
Ei au pus n minile lui un instrument din cedru,
Un preferat al marilor zei.
Ei l-au nvat s realizeze calcule cu numere.

Dei Povestea lui Adapa nu spune n mod explicit, se pare

c i-a fost permis, dac nu chiar i s-a cerut s mprteasc
unele dintre cunotinele secrete tovarilor si umani, altfel
de ce ar fi scris el renumita carte? n cazul lui Enmeduraki,
transmiterea cunotinelor nvate a fost permis - dar cu
precizarea c trebuia s se limiteze la preoi, de la tat la fiu,
ncepnd cu Enmeduraki:
Care pzesc secretele marilor zei
Vor lega cu fiul lor favorit un jurmnt
naintea lui Shamash i Adad.
Prin Tblia Divin, cu o peni,
El l va iniia n secretele zeilor.
Tblia pe care a fost nscris acest text (aflat acum la
Muzeul Britanic) are un postscriptum. Astfel a fost linia
preoilor creat, cei crora li se permite s se apropie de
Shamash i Adad.

Biblia a mai nregistrat, de asemenea, ridicarea la cer n

perioada prediluvian, a patriarhului Enoh - al aptelea pe
lista celor zece, cum a fost Enmeduraki pe Lista Regilor
Sumerieni. Despre aceast experien extraordinar, Biblia
spune doar c, la vrsta de 365 de ani, Enoh a fost luat sus
pentru a fi cu Dumnezeu. Din fericire, o surs extrabiblic,
Cartea lui Enoh, care s-a transmis peste milenii i s-a pstrat
n dou versiuni, ne d mai multe detalii; nu se poate ti ct
a fost original, ct a fost fantezie i speculaie atunci cnd
crile au fost compilate aproape de nceputul erei
cretinismului. Dar coninutul reprezint un rezumat de
valoare, mai ales pentru asemnarea cu povestea lui
Enmeduraki i pentru povestirea scurt i totui mult mai
extins dect n alt carte extrabiblic, Cartea Jubileelor.
Din aceste surse rezult c Enoh nu a fcut doar una, ci
dou cltorii n cer. n prima, el a fost nvat Secretele
Cerului i s mprteasc aceste cunotiine fiilor si, la
ntoarcerea pe Pmnt. Urcnd ctre Lcaul Divin, el a fost
purtat printr-o serie de sfere cereti. Din locul celui de-al
aptelea Cer, el a putut vedea forma Planetelor; n al Optulea
Cer el a putut distinge constelaiile. Al Noulea Cer era casa
celor 12 semne ale zodiacului. n al Zecelea Cer era Tronul
Divin al lui Dumnezeu.
(Trebuie precizat c lcaul lui Anu, potrivit textelor
sumeriene, a fost pe Nibiru, pe care am identificat-o ca fiind
a 10-a planet a Sistemului nostru Solar. n credinele
Cabalei, drumul ctre locuina Domnului Atotputernic trecea
prin 10 Sefirot, traduse ca strluciri, dar descrise, de fapt,
ca fiind 10 sfere concentrice - Fig. 46 - n care cea central se
numete Yessod (Fundaia), a opta i a noua Binah i
Hokhmah, iar a zecea Ketter, Coroana a Domnului Prea
nalt. Dincolo de aceea se ntindea Ein Sof, Infinitul).
nsoit de doi ngeri, Enoh a sosit la destinaia sa final,

Lcaul lui Dumnezeu. Acolo i-a dat jos hainele pmnteti;

a fost mbrcat n haine divine i uns de ctre ngeri (cum i sa fcut i lui Adapa). La porunca Domnului, arhanghelul
Pravuel a adus crile din cmara sacr i i s-a dat o peni
din stuf cu care s noteze tot ceea ce i dicta arhanghelul.
Timp de 30 de zile i 30 de nopi Pravuel i-a dictat, iar Enoh
a notat secretele lucrrilor creaiei cerului, Pmntului i
mrilor; toate elementele, trecerile i micrile lor, zgomotul
tunetului; i (secretele) Soarelui i Lunii, micrile i
schimbrile planetelor; anotimpurile i anii, zilele i orele... i
toate lucrurile despre oameni, limbi i fiecare cntec uman...
i toate lucrurile care trebuiau nvate.
Potrivit Crii lui Enoh, toate acele vaste cunotine,
secrete ale ngerilor i ale Domnului, au fost notate n 360
de cri sacre pe care Enoh le-a luat cu el pe Pmnt.
Chemndu-i fiii, el le-a artat crile i le-a explicat
cuprinsul lor. El nc vorbea cu ei i i instruia cnd s-a
ntunecat deodat i cei doi ngeri care l aduseser pe Enoh
napoi pe Pmnt, l-au ridicat pe Enoh i l-au dus pe acesta
napoi n cer; erau cu precizie ziua i ora celei de-a 365-a
aniversri a lui Enoh. Biblia (Geneza 5:23-24) spune simplu:
Toate zilele lui Enoh au fost de 365 de ani; i Enoh a mers la
Domnul, el n-a mai venit, pentru c a fost luat de Elohim.
O asemnare evident ntre toate cele trei poveti (Adapa,
Enmeduranki i Enoh) este implicarea celor dou fiine divine
n experiena cereasc. Adapa a fost ntmpinat la Poarta lui
Anu, a fost apoi nsoit nuntru i afar de ctre cei doi zei
tineri, Dumuzi i Gizidda; iniiatorul/nvtorul lui
Enmeduranki era Shamash/Adad; i cei doi arhangheli ai lui
Enoh. Povetile au inspirat n mod cert o descriere asirian a
porii cereti a lui Anu, care este pzit de doi Oameni vulturi. Poarta are simbolul lui Nibiru, Discul naripat, iar
locaia cereasc este indicat prin simbolurile cereti ale

Pmntului (ca a aptea planet), Luna i Sistemul Solar

complet (Fig. 47).
Un alt aspect care se evideniaz - dei nu n mod explicit
n cazul lui Enoh - este tradiia druirii nelepciunii i
nelegerii persoanelor alese, nu doar unui om de tiin, dar
i unui preot sau mai mult urmailor pe linie preoeasc.
Gsim acest principiu folosit n Pustiul Sinai n timpul
Exodului, cnd Yahve, Domnul biblic, la ales pe Aaron
(fratele lui Moise) i pe fiii si s fie preoii Domnului (Exodul
28:1). Deja recunoscut ca aparinnd tribului lui Levi
-deopotriv de pe partea mamei, dar i a tatlui (Exodul 2:1)
- Moise i Aaron au fost iniiai n puterile magice i li s-a
permis s realizeze miracole, dar i s declaneze calamitile
care l-au convins pe faraon s-i lase pe israelii s plece.
Aaron i fiii si au fost atunci sfinii - promovai n
limbajul actual - pentru a deveni preoi nzestrai cu
nelepciune i nelegere considerabile.

Cartea Leviticului arunc lumin asupra unor cunotine

care au fost primite de ctre Aaron i fiii si; acestea cuprind

secretele calendarului (destul de complex de vreme ce era un

calendar lunar-solar), bolile umane i remedii i cunotine
de medicin veterinar. Informaii anatomice substaniale
sunt incluse n capitolele relevante ale Leviticului, iar
posibilitatea ca preoii israelii s fi primit lecii de
transmitere nu poate fi exclus avnd n vedere faptul c
acele modele din lut reprezentnd pri anatomice,
inscripionate cu instruciuni medicale, erau frecvente n
Babilon chiar naintea perioadei Exodului - (Fig. 48).
(Biblia l descrie pe Solomon ca fiind cel mai nelept om
care putea discuta pe teme biologice diverse, despre toate
plantele, de la cedrul din Liban pn la isopul care cretea
pe zid, de la animale, psri, lucruri trtoare i pn la
peti. El putea face asta deoarece n plus fa de
nelepciune i nelegere (inteligen) pe care i le-a dat
Dumnezeu, el a primit de asemenea Da'ahth - cunotine
Linia preoeasc nceput cu Aaron a fost subiect al
impunerii unor legi maritale i constrngeri de procreere
Cu cine puteau avea relaii conjugale i n mod special care
erau cerinele maritale, pentru c smna preoeasc nu
trebuia s fie profanat, iar dac smna cuiva nu va fi
perfect - va avea un cusur, o mutaie, un defect genetic omului i era interzis, pentru toate generaiile, s realizeze
ndatoririle preoeti, pentru c Eu, Yahve am sfinit toat
linia preoeasc a lui Aaron.
Aceste cerine stricte au intrigat generaiile de cercettori
ai Bibliei; dar adevrata lor semnificaie a devenit evident
odat cu cercetrile ADN-ului. n ianuarie 1997, un grup
internaional de cercettori au scris n revista Nature despre
existena unei gene preoeti printre evrei, a crei linie
mergea pn la Aaron. Tradiiile neschimbate ale evreilor cer

ca anumite ritualuri i binecuvntri de Sabat i servicii ale

Srbtorilor de toamn s fie realizate numai de un Cohen.
Termenul nsemnnd preot, a fost folosit pentru prima dat
n Biblie pentru ai descrie pe Aaron i pe fiii si.

Chiar de atunci, desemnarea s-a transmis prin generaii de

la tat la fii, iar singura cale de a deveni Cohen este s fii fiul
unuia. Acest statut privilegiat se identifica la fel de des prin
folosirea termenului Cohen ca nume de familie (transformat
n Kahn, Kahane, Kuhn) sau cu un adjectiv adugat dup
numele persoanei, uneori Ha-Cohen, preotul.
Exista un aspect al tradiiei evreieti de natur patern
care a intrigat echipa de cercettori din Israel, Anglia,
Canada i SUA. Concentrndu-se pe cromozomul masculin
(Y") care trece de la tat la fiu, ei au testat sute de Coheni
din diferite ri i au aflat c, n ansamblu, ei au dou
semne unice pe cromozomi. La fel este cazul pentru evreii
Apropiat/Africa) care s-au rspndit dup distrugerea
Templului din Ierusalim n anul 70 d.Chr, indicnd vechimea
semnelor genetice.
Cea mai simpl i direct explicaie este c aceti oameni
au cromozomul Y al lui Aaron, a explicat dr. Karl Skorecki de
la institutul israelian al Tehnologiei din Haifa.

Povetile celor care au fost iniiai n cunotine secrete

afirm ca malformaiile au fost notate n cri. Acestea nu
erau cu siguran ceea ce numim noi cri - pagini scrise i
legate mpreun.

Numeroasele texte descoperite n peterile de lng Marea

Moart din Israel sunt numite pergamentele de la Marea
Moart, deoarece erau texte nscrise pe buci de pergament
(fcute n mare parte din piei de oaie) cusute mpreun i
rulate pentru a forma suluri, Pergamentele Legii (primele
cinci cri ale Bibliei ebraice) sunt nscrise i rulate pn n
zilele noastre. Profeii biblici (mai ales Ezechiel) descriau
pergamentele ca parte a mesajelor divine oferite lui. Textele
vechilor egipteni erau scrise pe papirusuri - coli fcute din
stuful care cretea pe fluviul Nil. Cele mai vechi texte
cunoscute din Sumer erau nscrise pe tblie de argil;
folosind peni din stuf, scribul putea face semne pe bucata
de argil umed care, dup uscare, devenea o tbli

Sub ce form au fost scrise crile lui Adapa,

Enmeduranki i Enoh (360 de cri ale celui din urm!)?
Gndindu-ne c ele au fost scrise n perioada de dinainte de
Potop - 1000 de ani chiar naintea civilizaiei sumeriene probabil c n niciuna dintre formele postdiluviene, dei
regele asirian Asurbanipal se luda c el putea citi scrieri de
dinaintea Potopului. Deoarece n fiecare caz ceea ce se nota
era dictat de Stpnul divin, ar fi logic s ne ntrebm dac
scrierile se fceau pe ceea ce textele sumeriene i akkadiene
numeau Kitab Hani - scrierile zeilor. Referirile la astfel de
scrieri ale Anunnaki pot fi gsite, de exemplu, n inscripiile
referitoare la reconstruirea templelor afectate, n care se
cerea ca reconstruirea s urmeze planurile din timpurile
vechi i scrierea Cerului de Sus. Sumerienii au menionat o
zei, Nisaba (pronunat uneori Nidaba), ca fiind zeia ce
patrona scribii i cea care inea nregistrrile pentru zei;
simbolul ei era Penia Sfnt.
Una dintre referinele la scrierile zeilor din cele mai vechi
timpuri se gsete ntr-un text hitit numit de ctre cercettori
Cntul lui Ullikummis. Scris pe tblie de argil care au fost
descoperite n capitala antic hitit Hattushas (lng satul
Boghaskoy de astzi, n centrul Turciei), ele relateaz o
poveste enigmatic despre un zeu puternic care a fcut
piatra diorit i c un zeu vechi pe care hitiii l-au numit
Kumarbis a creat-o pentru a-i provoca pe ceilali zei. Zeii,
incapabili s reziste sau s se opun zeului care i-a provocat,
Ullikummi, s-au npustit n lcaul lui Enki, n Lumea de
Jos, pentru a obine de la el tbliele vechi cu cuvintele
soartei, care erau ascunse. Dar dup ce depozitul antic a
fost deschis, iar sigiliile vechi cu care erau securizate
tbliele au fost scoase, s-a descoperit c scrierile erau n
vechile cuvinte, fiind nevoie de Zeii Vechi pentru a le

n Egipt, Thoth era cel venerat ca Scribul Divin. El a fost

cel care, dup ce Consiliul Zeilor a reuit s-l recunoasc pe
Horus ca Motenitor legal, a nregistrat pe o tbli din metal
Hotrrea Zeilor, iar tblia a fost depozitat atunci n
Camera divin a Rapoartelor. n plus fa de rapoartele
pentru folosina zeilor, egiptenii credeau c Thoth se ocupa i
cu scrierile care ghidau muritorii. Cartea Morii susineau ei,
era o compoziie scris de Thoth cu propriile sale degete, ca
un ghid pentru Cltoria ctre Viaa de Apoi. O lucrare mai
scurt numit de egipteni The Book of Breathings conine, de
asemenea, afirmaia c Thoth era cel care a scris aceast
carte cu propriile degete. Iar n cartea Povestea Magilor, la
care ne-am referit deja, se spune c regele i regina care
triau, dar erau nensufleii, pe care Thoth i-a pedepsit
punndu-i ntr-o camer subteran, era cartea pe care zeul
Thoth a scris-o cu propria mn i n care erau dezvluite
cunotine secrete cu privire la Sistemul Solar, astronomie i
calendar. Cnd cuttorul unor astfel de cri vechi ale
scrierilor sacre a intrat n camera subteran, el a vzut
cartea emannd o lumin ca i cum Soarele strlucea
Ce erau acele cri divine i ce fel de scrieri erau n ele?
Numele-epitet al lui Enmeduranna, Stpnul Tblielor
Divine referitoare la Cer, atrage atenia asupra termenului
ME din numele su, tradus aici ca Tblie Divine. n
realitate, nimeni nu poate fi sigur n legtur cu ce anume
era ME, dac erau tblie sau ceva mai asemntor unui cip
sau unui disc de memorie pentru computer. Ele erau obiecte
suficient de mici pentru a fi inute n mn, pentru c se
spunea c Inanna/Ishtar, ncercnd s ridice oraul su,
Uruk, la statutul de capital, a obinut de la Enki nsemnri
ale ME care erau codificate cu secrete ale Puterii Supreme,
Regalitate, Preoie i alte aspecte ale naltei civilizaii. Ne

amintim c diabolicul Zu a furat din Duranki al lui Enlil

Tbliele Destinelor i ale ME, care au fost codificate cu
Formulele Divine. Poate vom nelege ce erau ele dac vom
privi tehnologia mileniului viitor.
Lsnd deoparte problema propriilor scrieri ale zeilor i
pstrarea informaiilor lor pentru scopuri personale,
chestiunea cu privire la limba i la sistemul de scriere,
folosite atunci cnd cunotinele secrete au fost dictate
Pmntenilor pentru folosul lor, a devenit una de o mare
semnificaie atunci cnd este vorba despre Biblie - n mod
special n ceea ce privete evenimentele de pe Muntele Sinai.
Asemntoare povetii lui Enoh care a stat n lcaul
ceresc 30 de zile i 30 de nopi, scriind dup dictare, este
consemnarea biblic a lui Moise, care a urcat ctre Domnul
Dumnezeu n vrful Muntelui Sinai, a stat acolo cu Yahve 40
de zile i 40 de nopi - nu a mncat pine i nu a but ap i a scris pe tblie cuvintele Legmntului i cele 10
Porunci, aa cum i-a dictat Dumnezeu (Exodul 34: 28).
Acelea, oricum, erau al doilea set de tblie, nlocuind
primul set pe care Moise le-a spart cu furie cnd a cobort de
pe Muntele Sinai data trecut. Biblia furnizeaz amnunte
substaniale i uluitoare cu privire la acea prim dovad a
scrierilor sacre; apoi Biblia spune explicit, Dumnezeu nsui a
Povestea ncepe n capitolul 24 al crii Exodului, cnd
Moise, Aaron, doi fii ai si i 70 dintre Btrnii Israelului au
fost invitai s se apropie de Muntele Sinai, pe vrful unde
Domnul a venit n Kabod-ul su. Acolo demnitarii au putut
ntrezri prezena divin printr-un nor gros aprins ca un foc
mistuitor. Apoi doar Moise a fost chemat n vrful muntelui
pentru a primi Tora (nvturile) i Poruncile pe care
Domnul Dumnezeu le nsemnase deja:
i Yahve i-a spus lui Moise:

Urc la mine pe Munte

i rmi acolo,
i i voi da ie tbliele din piatr nvturile i Poruncile Pe care le-am scris,
Aa nct tu s-i poi nva pe alii.
Exodul 24:12
i Moise a mers n mijlocul norului i a urcat pe Munte; i
a stat acolo 40 de zile i 40 de nopi . Apoi Yahve:
I-a dat lui Moise
Cnd a terminat de vorbit cu el,
Cele dou Tblie mrturie Tblie de piatr.
nscrise cu degetul lui Elohim.
Exodul 31:17
O informaie uimitoare cu privire la tblie i la modul n
care ele au fost inscripionate este dat n Exodul 32:16-17,
care descrie evenimentele care au avut loc n timp ce Moise a
cobort de pe Munte dup o lung (pentru oameni) i
inexplicabil absen:
Moise a cobort de pe Munte,
Cu cele dou Tblie mrturie n mna sa Tblie nscrise pe ambele pri,
Inscripionate pe o parte i pe cealalt parte.
i Tbliele erau lucrarea lui Elohim,
i scrierile au fost fcute de Elohim,
i au fost gravate pe tblie.
Dou tblie din piatr, lucrate cu mna divin,
inscripionate pe fa i pe spate n scrierea lui Elohim
- care trebuie s nsemne deopotriv limba i scrierea; i
astfel nsui Dumnezeu a gravat n piatr!
i toate acestea n limba i scrierea pe care Moise le putea

citi i nelege pentru c el urma s transmit toate acestea

Aa cum tim din celelalte surse biblice, Moise a spart cele
dou tblie cnd, ajungnd la tabr, el a vzut c n
absena sa poporul fcuse un viel din aur pentru a-l venera,
la fel ca n obiceiurile egiptene. Cnd criza a luat sfrit,
Yahve i-a spus lui Moise:
Taie-i dou tblie din piatr
La fel ca primele dou,
i voi scrie pe acele dou tblie
Cuvintele care erau pe primele tblie
Pe care le-ai spart.
Exodul 34:1
Moise a fcut cum i s-a spus i a urcat din nou pe Munte.
Acolo Yahve s-a ndreptat ctre el, iar Moise s-a nclinat i a
repetat rugminile sale de iertare. Ca rspuns, Dumnezeu ia dictat porunci n plus, spunnd: Noteaz aceste cuvinte,
pentru c, potrivit lor, fac un Legmnt cu tine i cu poporul
lui Israel. Moise a stat pe Munte 40 de zile i 40 de nopi,
scriind pe tblie cuvintele Legmntului i cele 10 Porunci
(Exodul 35: 27-28). De aceast dat, Moise a scris dup
Nu doar pri din Exodul, Levitic i Deuterom, incluznd
nvturile i Poruncile, ci toate cele dinti cri din Biblia
ebraic (cele de mai sus plus Geneza i Numeri) au fost
considerate, chiar de la nceput, scrieri sacre. Cuprinse n
termenul general de Tora, ele sunt cunoscute, de asemenea,
ca Cele Cinci Cri ale lui Moise, datorit tradiiei potrivit
creia nsui Moise le-a scris, el fiind autorul tuturor celor
cinci, n urma unei revelaii pe care a avut-o. Prin urmare,
sulurile Torei, care sunt luate din arc n sinagogi i citite de
Sabat i la Srbtorile de Toamn, trebuie copiate (de scribi
speciali) la fel cum au fost de-a lungul vremii - carte cu carte,

capitol cu capitol, verset cu verset, cuvnt cu cuvnt, liter

cu liter. O greeal a unei litere descalific toate sulurile
celor cinci cri.
n timp ce aceast precizie de liter cu liter a fost studiat
de nelepi evrei i cercettori biblici de-a lungul erelor (cu
mult nainte de recentul interes pentru codurile secrete din
Tora), a fost ignorat complet un aspect chiar mai provocator
cu privire la dictarea lung i la acurateea copierii liter cu
O astfel de metod de scriere ca cea de pe Muntele
Sinai nu putea fi scrierea lent cuneiform din
Mesopotamia, pentru c aceasta se fcea de obicei cu o
peni pe tblia umed, nici pictogramele hieroglifice
ale scrisului din Egipt. Volumul i viteza, precum i
cerina acurateii liter cu liter la copiere presupunea o
scriere alfabetic!
Problema era c, n vremea Exodului, cca. 1450 .Chr.,
nicieri n lumea antic nu exista nc o scriere alfabetic.
Conceptul de alfabet este lucrarea unui geniu; i oricine a
fost geniul, el s-a bazat pe date preexistente. Scrierea
hieroglific egiptean a avansat de la pictograme ce descriau
obiecte la simboluri permanente pentru silabe sau chiar
consoane; dar a rmas un sistem complex de scriere cu
nenumrate pictograme (vezi Fig. 24b). Scrierea sumerian a
avansat de la pictogramele sale originare la cuneiforme (Fig.
49), iar semnele au dobndit sunet silabic; dar pentru a
forma din ele un vocabular era nevoie de sute de semne
diferite. Geniul cuiva a combinat uurina cuneiformelor cu
consoanele egiptene avansate i din aceast combinare a
realizat doar 22 de semne!
ncepnd cu asta, inventatorul ingenios s-a ntrebat pe
sine, dar i pe discipolul su: Pentru ce este cuvntul pe care

l vezi? Rspunsul - n limba israeliilor semitici - a fost Aluf.

Bine, a spus inventatorul: S numim acest simbol Aleph i s
l pronunm simplu A". El a trasat pictograma pentru cas.
Cum numim asta? a ntrebat el, iar discipolul a rspuns:
Bayit. Bine, a spus inventatorul, de acum vom numi semnul
acesta Beth i l vom pronuna simplu ca B".
Nu putem garanta c o astfel de conversaie a avut loc, dar
suntem siguri c acesta a fost procesul crerii i inventrii
Alpha - Beth. A treia liter, Gimel (pronunat G") a fost
imaginea unei cmile (Gamal n ebraic); urmtoarea, Deleth
pentru D", reprezint Daleth, u (n balamalele sale); i
tot aa prin cele 22 de litere din alfabetul semitic (Fig. 50),
toate folosesc consoane i trei dintre ele pot fi dublate ca
Cine a fost ingeniosul inventator?
Dac este s acceptm opinia nvailor, a fost un
muncitor, un sclav n minele egiptene de turcoaz din vestul
Sinaiului, de lng Marea Roie, pentru c acolo a gsit Sir
Flinders Ptrie, n 1905, semne curbate pe perei, semne pe
care, un deceniu mai trziu, Sir Alan Gardiner le-a descifrat
ca acrofonice scrise L-B-A-L-T (Fig-51); nseamn Dedicat
Stpnei (probabil zeia Hathor) - dar n semitic, nu
egiptean! Mai multe scrieri asemntoare descoperite n
aceast regiune demonstreaz fr niciun dubiu faptul c
alfabetul provine de acolo; de acolo s-a rspndit n Canaan,
apoi n Fenicia (unde o ncercare de a exprima ideea
ingenioas cu semne cuneifome - Fig- 52-a fost de scurt
Frumos redactat, scrierea sinaitic originar a servit ca
scriere n Templul din Israel i ca scriere regal la regii Iudei
(Fig. 53a) pn ce a fost nlocuit, n vremea celui de-al
doilea Templu, cu o scriere dreptunghiular mprumutat de
la aramei (scriere folosit n pergamentele de la Marea

Moart, spre vremurile moderne, Fig. 53b).

Nimeni nu a acceptat pe deplin ideea atribuirii
revoluionarei inovaii, la sfritul erei Bronzului, unui sclav
din minele de turcoaz. Era nevoie de remarcabile cunotine
n domeniul lingvistic, al vorbirii i al scrierii, pe lng o
nelepciune considerabil i o nelegere, care cu greu
puteau fi deinute de un sclav. i care era scopul inventrii
unei noi scrieri cnd, chiar n zona minelor, monumentele i
zidurile erau pline de inscripiile cu hieroglife egiptene (Fig.
54)? Cum a putut o inovaie obscur dintr-o zon restrns
s se extind n Canaan i dincolo de el i s nlocuiasc
acolo o metod de scriere care exista i era folosit de mai
mult de dou milenii? Nu pare s aib sens; dar n lipsa altei
soluii, aceast teorie se menine nc.
Dar dac ne imaginm real conversaia care a condus
la acest alfabet, atunci Moise a fost cel cruia i s-a dat
prima lecie. El a fost n Sinai; el a fost acolo n vremea
potrivit; el s-a angajat s scrie texte lungi; i a avut
profesorul suprem - pe nsui Dumnezeu.
Puin remarcat n povetile biblice ale Exodului este faptul
c Moise a fost instruit de ctre Yahve s noteze lucruri chiar
naintea urcrii pe Muntele Sinai pentru a primi tbliele.
Prima dat a fost dup rzboiul cu amalekiii, un trib care, n
loc s acioneze ca un aliat, i-a trdat pe israelii i i-a atacat.
Trdarea, a spus Dumnezeu, ar trebui s i-o aminteasc
toate generaiile viitoare: i Yahve i-a spus lui Moise:
Noteaz asta n carte pentru amintire (Exodul 17;14). A doua
meniune a unei cri cu scrieri apare n Exodul 24:4 i 24:7,
unde se menioneaz c, dup ce Domnul Dumnezeu,
vorbind cu o voce tuntoare din vrful Muntelui, i
enumernd condiiile pentru Legmntul venic ntre El i
Copiii lui Israel, Moise a scris toate cuvintele lui Yahve, a
construit un altar la poalele Muntelui i a ridicat 12 stlpi

din piatr corespunztori numrului de triburi al israeliilor.

i apoi, el a luat cartea legmntului i a citit din ea pentru
a auzi poporul.
Dictarea i notarea au nceput, aadar, naintea urcrii lui
Moise pe vrful muntelui i a celor dou scrieri separate pe
tbliele din piatr. Trebuie s privim la capitolele mai
timpurii ale Exodului s aflm cnd i unde ar fi putut s
aib loc inovaia alfabetului - limbajul i scrierea folosite n
dialogurile Domnului cu Moise. Apoi citim c Moise, adoptat
ca un fiu de ctre fiica faraonului, a fugit pentru a se salva
dup ce a ucis un demnitar egiptean. Destinaia sa a fost
Peninsula Sinai, unde a sfrit prin a locui cu un nalt preot
midianit (i a se cstori cu fiica sa). i ntr-o zi, cnd ptea
oile, el a hoinrit prin deert, unde era Muntele lui Elohim,
iar acolo a fost chemat de ctre Domnul din rugul aprins i i
s-a dat sarcina de a conduce poporul su, Copiii lui Israel,
afar din Egipt.

Moise s-a ntors n Egipt doar dup moartea faraonului

care l condamnase (Tutmes III, dup calculele noastre), n
1450 .Chr., i a luptat cu urmtorul faraon (Amenofis II, n
opinia noastr) pe parcursul a apte ani, pn Exodul a fost
Discutnd cu Dumnezeu deja din deert i apoi n timpul
celor apte ani, a avut aadar mult timp pentru a nnoi i
nva o nou form de scriere, una care era mai simpl i
mai rapid dect cele ale marilor imperii ale timpului mesopotamian, egiptean, hitit.
Biblia relateaz conversaii lungi ntre Yahve, Moise i
Aaron din momentul n care Moise fusese chemat mai
departe ctre rugul aprins. Biblia nu spune dac mesajele
divine, uneori incluznd instruciuni detaliate, au fost
vreodat fcute n scris; dar ar putea fi semnificativ faptul c
magicienii de la curtea faraonului se gndeau c lor li s-au
scris instruciuni: i magicienii faraonului i-au spus: Acesta
este degetul zeului (Exodul 8:15).Degetul lui Dumnezeu,
trebuie reamintit, era termenul folosit de ctre textele
egiptene cu privire la zeul Thoth, pentru a arta c scrierea

era fcut de zeu nsui.

Dac toate acestea conduc la sugestia c scrierea alfabetic

a nceput n Peninsula Sinai - nu ar trebui s surprind
faptul c arheologii au ajuns la aceeai concluzie, dar fr a
putea gsi o explicaie la ntrebarea cum o inovaie att de
ingenioas i uimitoare a putut avea loc ntr-un deert.
A avut loc ntradevr conversaia pe care ne-am imaginat-o
sau Moise nsui a inventat alfabetul? n fond, el era n
Peninsula Sinai chiar n aceeai perioad, a avut parte de o
nalt educaie la curtea egiptean (unde se inea
corespondena deopotriv cu mesopotamienii i cu hitiii) i
fr ndoial a nvat limba semitic de la midianii (dac nu
cumva o tia deja de la fraii israelii din Egipt). A vzut el,
prin peregrinrile din pustiul Sinai, sclavi semitici (israelii
care fuseser pn atunci nrobii n Egipt) scrijelind
grosolan pe pereii minelor ideea sa cu un nou tip de scriere?
Unora le-ar fi plcut s-i poat atribui strlucita inovaie
doar lui Moise; ar fi fost plcut s-l crediteze pe liderul biblic
al Exodului ca fiind cel care a inventat alfabetul ce a
declanat o adevrat revoluie cultural, Moise fiind
singurul care a vorbit cu Dumnezeu fa n fa, potrivit
Bibliei. Dar referirile frecvente la Scrierea Divin, scrierea lui
Dumnezeu nsui i la faptul c Moise a scris dup dictare,
sugereaz c scrierea alfabetic i limbajul erau unul dintre
secretele zeilor. ntradevr, chiar aceluiai Yahve Biblia i

atribuie inventarea/inovarea celorlalte limbi i scrieri cu o

ocazie anterioar - n urma incidentului Turnului Babel.
ntr-un fel sau altul, avem senzaia c Moise a fost cel
iniiat, prin intermediul cruia inovaia a fost dezvluit
Omenirii. i astfel l putem numi, pe drept cuvnt,
Alfabetul Mozaic.
Alfabetul este mai mult dect un secret al zeilor. El
se bazeaz, n opinia noastr, pe cunotine complexe i
fundamentale - acelea ale codului genetic.
Cnd grecii au adoptat alfabetul mozaic, n urm cu 1000
de ani (dei l-au inversat ca o imagine n oglind, Fig. 55), ei
au considerat necesar s mai adauge litere pentru a permite
pronunia tuturor secretelor.
n fapt, n cadrul limitat de 22 litere al alfabetului mozaicsemitic, unele litere puteau fi pronunate moale (V, Kh, S,
Th) sau dur (B, K, SH, T), iar celelalte litere au trebuit
dublate cu vocale.
ntr-adevr, pe msur ce analizm aceast limitare la 22 nici mai mult, nici mai puin - nu putem s nu ne amintim
constrngerile impuse de numr sacru 12 (cerina ca zeitile
s fie adugate sau czute din Cercul Olimpian n aa fel ca
numrul lor s fie meninut precis numai la 12). A fost un
astfel de principiu secret - de inspiraie divin - aplicat ca un
fel de restricie la alfabetul original din 22 de litere?
Numrul ar trebui s ne fie familiar n aceste vremuri i n
aceast er. Este numrul de cromozomi umani de atunci
cnd Adam a fost creat. naintea celui de-al doilea
experiment genetic, cnd au fost adugai cromozomii sexuali
Y" i X"!
I-a dezvluit Atotputernicul lui Moise secretul
alfabetului atunci folosind codul genetic ca un cod secret
al alfabetului? Rspunsul pare s fie Da.

Dac aceast concluzie vi se pare ciudat, s citim ce a

spus Domnul n Isaia 45:11: Eu sunt Cel care a creat

Literele... Eu sunt cel care a fcut Pmntul i l-am creat pe
Adam pe el astfel a spus Yahve, Cel Sfnt al lui Israel.
Oricine a fost implicat n crearea Omului, a fost i cel
implicat n crearea literelor care alctuiesc alfabetul.
Sistemele actuale de computer formeaz cuvinte i numere
din doar dou litere, un sistem Da-Nu de unu i zerouri
care formeaz un flux de electroni On-Off (numit binar). Dar
interesul s-a schimbat deja spre codul genetic din patru
caractere i ctre viteza mai mare cu care are loc operaia n
interiorul celulei vii. n mod abstract, limbajul actual al
computerului care se exprim ntr-o secven cum ar fi
0100110011110011000010100 etc, (i n numeroase
variaiuni folosind 0" i 1") poate fi imaginat ca un limbaj
genetic al unui fragment al ADN-ului ca nucleotidele
CGTAGAATTCTGCGAACCTT i tot aa ntr-un ir al literelor
ADN-ului (care este ntotdeauna aranjat n cuvinte de trei
litere) legate ca perechi de baz, n care A se leag cu T, C cu
G. Problema i provocarea este cum s creezi i s citeti
cipuri de computer care nu sunt codate cu electroni 0" i
1", ci cu bii de material genetic. Progresele fcute din 1991
de ctre diverse instituii academice, precum i de companii
comerciale implicate n cercetri genetice au condus la
crearea de cipuri din silicon codate cu nucleotide.
Comparnd viteza i capacitatea Memoriei ADN-ului - aa
cum se numete noua tiin - un articol din revista de
cercetare Science afirma, n octombrie 1997, c puterea de
memorare a informaiei a ADN-ului este imens.
n natur, informaia genetic, ce este codificat n ADN,
este decodat cu viteza fulgerului de ctre un mesager numit
RNA care transcrie i recombin caracterele ADN-ului n
cuvinte alctuite din trei litere. Acele grupuri din trei litere,
s-a stabilit, stau la baza tuturor formelor de via de pe

Pmnt, pentru c ele explic biologic i chimic cei 20 de

aminoacizi ale cror iruri formeaz proteinele care formeaz
viaa pe tot Pmntul - i probabil oriunde n cosmos. Figura
56 ilustreaz schematic i ntr-o manier simplificat cum o
secven ADN este decodat i recombinat n aminoacizi
Propralini (Pro), Serine (Ser) etc. prin intermediul codului
din cuvinte de trei litere pentru a construi o protein.
Limba ebraic, precis i bogat, se bazeaz pe cuvinte
rdcin din care provin verbele, substantivele, adverbele,
adjectivele, pronumele, timpurile, conjugrile i toate celelalte
categorii gramaticale.

Din motive pe care nimeni nu le-a putut explica, acele

cuvinte rdcin sunt formate din trei litere. Aceasta este o

ndeprtare total de la limba akkadian, sursa tuturor

limbilor semitice, care era format din silabe - uneori doar
una, alteori din dou, trei sau mai multe.
Ar putea fi cuvintele-rdcin evreieti din trei litere sursa
limbajului ADN din trei litere - chiar nsi sursa alfabetului,
aa cum am concluzionat? n acest caz, acele cuvinterdcin din trei litere ntresc aceast concluzie.
Moartea i viaa sunt n limbaj, spune Biblia n Proverbe
(18:21). Afirmaia trebuie luat n sens figurat. Este timpul,
probabil, s o lum n sens ad litteram: limbajul Bibliei
ebraice i codul genetic ADN al vieii (i al morii) sunt cele
dou fee ale aceleiai monede.
Misterele care sunt codificate acolo sunt mai vaste dect iar putea imagina cineva; ele includ, printre alte descoperiri
nemaipomenite, i secretele vindecrii.

Este probabil inevitabil faptul c, odat cu apariia erei
computerului, unii maetri profesioniti n acest domeniu sau orientat ctre un nou scop esenial: cutarea codului
secret al Bibliei.
n vreme ce acesta este prezentat n reviste tiinifice i
chiar n cri ca un rezumat al experienei moderne, adevrul
este c aceasta este de fapt o cercetare actualizat, nu una
nou, dei o cercetare cu instrumente noi i mai avansate.
Biblia ebraic include trei pri, Tora (nvturile) care

conine Pentateuh (cele Cinci Cri ale lui Moise) i, istoric i

cronologic, acoper perioada de la Creaie, peregrinrile
Exodului i moartea lui Moise; Neviyim (Profeii) cuprinde
crile lui Iosua i Judectori, Samuel i Regi, apoi Profeii
mari i mici, Psalmii, Proverbe i Iov - istoric de la stabilirea
israeliilor n Canaan pn la distrugerea Primului Templu
din Ierusalim; i Ketuvim (Scrieri), ncepe cu Cntarea
Cntrilor i continu cu cele atribuite celor doi lideri care
au condus exilai napoi n Iudea pentru a reconstrui Templul
(Ezra i Neemia) i (dup canonul Bibliei ebraice) sfrind cu
Cronicile I i II. Toate cele trei pri sunt numite cu
acronimul TaNaKh; acele referine de interpretare au fost
fcute deja n vremea Profeilor.
Discuiile nelepilor evrei i ale liderilor religioi urmreau
s citeasc printre rnduri paragrafele din Tora, apoi ale
Profeilor, s-au intensificat n timpul exilului dup
distrugerea Primului Templu (de ctre regele babilonian,
Nabucodonosor) i chiar mai mult dup distrugerea celui deal Doilea Templu (de ctre romani). nregistrarea acelor
dezbateri se gsete n Talmud (Studiul). Misticismul ebraic,
cunoscut sub numele de Cabala, a preluat i a construit pe
acele cercetri timpurii semnificaii ascunse.
Acele semnificaii ascunse au existat, Biblia nsi atest
asta. Cheia a fost alfabetul cu cele 22 de caractere.
Un simplu dispozitiv de codare, pe care l folosete chiar un
colar, este nlocuirea n serie a literelor. nelepii cabalei din
Evul Mediu au folosit ca instrument de cercetare un sistem
cunoscut ca ATBSh, n care ultima liter din alfabetul ebraic,
Tav (T") este nlocuit cu prima liter Aleph (A"); penultima,
Shin (Sh) cu a doua, Beth (B") i aa mai departe.
Kabalistul Avraam ben Jechiel Hacohen a ilustrat sistemul i
a oferit cheia pentru el ntr-o carte publicat n anul 1788

Dar, n fapt, un astfel de sistem de codare a fost folosit de

Profetul Ieremia (secolul 7 .Chr) care, profeind cderea
puternicului Babilon, a nlocuit scrierea B-B-L (Babel) cu
literele Sh-Sh-Kh pentru a evita s fie nchis (Ieremia 25:26
i 51:42). Cartea Plngerii, atribuit Profetului Ieremia, n
care se deplnge cderea i distrugerea Ierusalimului,
folosete alt cod, numit Acrostihuri, n care prima (sau uneori
ultima) liter a unui verset formeaz un cuvnt sau un nume
sau (ca n cazul lui Ieremia) dezvluie identitatea literelor
alfabetice sacre. Primul cuvnt n primul vers (tradus alas)
ncepe cu un Aleph, al doilea vers ncepe cu un Beth i aa
mai departe pn la al 22-lea vers. Acelai acrostih folosete
profetul n al doilea capitol; apoi fiecare liter ncepe dou
versuri n al treilea capitol, revenind la unul pentru fiecare
vers, n al patrulea capitol. Psalmul 119 este construit cu opt
Autenticitatea anumitor versete din Psalmi a putut fi
verificat observnd c fiecare vers are dou pri, fiecare
ncepnd alfabetic (ex: Psalm 145); acelai indiciu se ascunde
n aranjamentul versului din Proverbe 31. n plus, n Psalmul
145, trei versuri (11, 12,13) care preamresc domnia lui
Yahve ncep cu literele Kh-L-M, care se citesc invers MeLeKh,
Folosirea acrostihului ca un cod secret, evident de
asemenea n celelalte cri ale Bibliei, se constat i n crile
postbiblice (unele dintre ele au fost incluse n adaptarea
cretin din Vechiul Testament). Un exemplu evident vine din
perioada revoltei mpotriva legilor greceti n secolul II .Chr.
Revolta a luat numele conductorilor si, Macabeii - un
nume care este de fapt un acronim bazat pe versul din
Cntecul lui Moise (Exodul 15:11) - Cine mai este ca tine
printre zei, o Yahve - primele litere ale celor patru cuvinte
ebraice formnd acronimul M-K-B-I, pronunat Macabeu.

Dup distrugerea celui de-al Doilea Templu de ctre

romani, n anul 70 d.Chr., pilonul spiritual i religios al
evreilor a fost reprezentat de Sfintele Scripturi - o veritabil
comoar de cuvinte profetice i divine. Au fost ele sortite, au
fost prezise? Ce este destinat, ce urmeaz s se adevereasc?
Cheile pentru trecut i pentru viitor trebuie s fie ascunse n
scrierile sacre, de atunci sanctificate nu doar cu privire la
coninut, dar i cu fiecare cuvnt i liter. Cercetarea
nelesurilor ascunse prin coduri secrete a devenit cunoscut
dup distrugerea Templului ca intrarea n dumbrava
interzis, termenul pentru dumbrav - PaRdES - fiind el
nsui un acronim creat din primele litere ale celor patru
sisteme de nelegere a mesajului scripturilor: Peshat (neles
literal), Remez (sugestie), Drash (interpretare) i Sod (secret).
O poveste talmudic a urmrit s ilustreze riscurile abordrii
premature a ceea ce trebuia s rmn nedezvluit, relatnd
cum patru nelepi rabini au ptruns n Pardes; unul dintre
ei s-a uitat i a murit, cellalt i-a pierdut minile, al treilea
a devenit slbatic i a nceput s smulg plante; doar unul,
rabinul Akiba, a revenit ntreg.
Cutarea nelesurilor ascunse a fost reluat n vremurile
medievale de ctre cabaliti i precursorii lor. Ce ar putea s
dezvluie o examinare a Bibliei prin codul ATBSh? Dac se
folosete reaezarea unei alte litere? Dac un cuvnt este
introdus doar pentru a ascunde sensul adevrat i astfel s
camufleze nelesul real al textului? Printr-o astfel de metod,
de exemplu, se poate dovedi c Psalmul 92 (Cntec de Ziua
Sabatului) a fost compus de fapt de Moise n Sinai i nu de
ctre regele David. n alt caz se afirm c marele savant evreu
Maimonide (Spania i Egipt, secolul 12 d.Chr.) a fost numit n
Cartea Exodului, unde primele litere din ultimele patru
cuvinte din versetul 11:9 formeaz acronimul R-M-B-M
-rezultat din numele ntreg al lui Maimonides, Rabbi Moshe

Ben Maimon (explicnd referirile frecvente la el ca Rambam).

Dar savanii medievali s-au ntrebat dac trebuie limitate
cercetrile doar la primele sau ultimele litere ale cuvintelor,
nceputul i sfritul versetelor. Ce s-ar ntmpla dac s-ar
cerceta nelesurile ascunse prin literele lips? Fiecare a
doua, fiecare a patra, fiecare a 42-a? Era inevitabil ca odat
cu apariia calculatorului, cineva s-l foloseasc n chip de
instrument n cercetarea rapid a codului bazat pe
spaierea literelor. Ultima avalan de interes pentru acest
subiect s-a reflectat ntr-o astfel de aplicaie pe computer a
unor cercettori israelii; a fost lansat prin publicarea, n
august 1994, a unui articol intitulat Equidistant Letter
Sequences n the Book of Genesis, n revista prestigioas
Statistical Science, semnat de Doron Witzum, Eliyahu Rips i
Yoav Rosenberg.
n perioada urmtoare, au aprut o serie de reviste,
analize, cri (The Bible Code de Michael Drosnin i The Truth
Behind the Bible Code de Jeffrey Satinover) au abordat, n
esen, o premis de baz: dac enumeri toate cele 304.805
litere din Pentateuh n ir i le aranjezi n grupuri care
mpart acele litere n seciuni constnd ntr-un anumit
numr de linii, iar fiecare linie cu un anumit numr de litere,
apoi se alege metoda omisiunii - anumite litere vor forma
cuvinte care, orict de incredibil ar suna, constituie predicii
pentru vremurile noastre i pentru toate timpurile, cum ar fi
de exemplu, asasinarea primului ministru rabin al Israelului
sau descoperirea teoriei relativitii a lui Albert Einstein.
Oricum, pentru a finaliza astfel de presupuse predicii ale
evenimentelor din viitor din textele scrise cu mii de ani n
urm, cercettorii trebuie s conceap reguli variabile i
arbitrare cu care s se poat citi cuvintele cod. Literele care
formeaz cuvintele prezictoare se afl uneori una lng
cealalt, uneori distanate (cu spaiile variate i flexibile),

uneori se citesc pe vertical, alteori pe orizontal i n

diagonal, uneori invers, uneori de jos n sus...
Un astfel de arbitrariu n alegerea lungimii i numrului de
linii, orientarea citirii, omisiunea sau prezena literelor i aa
mai departe trebuie s-i lipseasc pe cei neiniiai fr o
abordare critic a afirmaiilor codului, care se bazeaz
exclusiv pe litera Bibliei; i face asta fr o discuie aprins
asupra chestiunii dac textul actual al Pentateuhului este cu
precizie textul original, motenire divin, potrivire cuvnt cu
cuvnt. Credem c s-au produs nu doar din cauza unor
abateri mici (ex: scrierea anumitor cuvinte cu o vocal sau
fr), dar i potrivit convingerii noastre (expus n ntlniri
Divine) c a mai existat o liter, un Aleph, la nceputul
Genezei. Dincolo de implicaiile teologice, problema imediat
este reprezentat de o distorsionare a calculului literelor.
Cu toate acestea, criptarea cuvintelor i nelesurilor din
textul biblic trebuie acceptat ca o posibilitate, nu doar
datorit exemplelor prezentate mai sus, dar din alte dou
motive foarte importante.
Primul este c exemplele de codificare au fost gsite n
textele neebraice din Mesopotamia, deopotriv din Babilonia
i Asiria. Ele cuprind texte care ncep sau se termin cu
avertizarea c ele sunt secrete i trebuie artate doar
persoanelor iniiate (sau dimpotriv, c nu trebuie s fie
dezvluite neiniiailor), sub ameninarea cu moartea din
partea zeilor. Astfel de texte folosesc uneori metode de codare
descifrabile (cum ar fi acronimele) i alteori metode de
criptare care rmn o enigm. Printre ultimele se afl un imn
al regelui asirian Asurbanipal care i slvete pe zeul Marduk
i soia sa, Zarpanit. El folosete semnele silabice cuneiforme
la nceputul liniilor pentru a transmite un mesaj secret zeului
Marduk. n afara codului acronim, regele folosete o a doua
metod de criptare: silabele care au format mesajul secret

ncepe cu linia 1, linia 2 omis, linia 3 folosit, linia 4 omis

i aa mai departe, omind ntotdeauna o linie pn la 9.
Apoi mesajul codat omite dou linii deodat, ntorcndu-se la
o singur linie srit la linia 26, se ntoarce la elidarea a
dou linii cnd ajunge la linia 36 i srit revine la o linie
srit pn la ncheierea tbliei (inclusiv partea de pe verso).
Prin aceast dubl codificare, regele asirian explic regelui
urmtorul mesaj secret (redm transcrierea orizontal, dei
mesajul pe tbli este citit vertical, de la nceput la final):
A-naku Ahshur-baan-niap-li
Eu sunt Asurbanipal
Sha il-shu buul-lita nishi-ma Maru-duuk
Care pe zeul lui l cheam s-mi dea via Marduk (i)
Dali-leka luud-lu
Te voi slvi pe tine.
Descoperirea unei inscripii cu acrostih scris de
Shaggilkinam-ubbib, un preot din templul lui Marduk din
Babilon, indic nu doar accesul preoimii la un astfel de cod,
dar ridic i o problem cu privire la vechimea sa. n acel
acronim (n care exist o a 11-a linie omis ntre silabe
codificate) este dat numele codificatorului. Din cte se tie,
un preot cu acel nume a slujit n templul Esagil din Babilon
n cca. anul 1400 .Chr. Aceasta ar putea data conceptul de
codificare ctre perioada Exodului. Cei mai muli oameni de
tiin consider aceast dat timpurie prea greu de
acceptat, de aceea ei prefer s l dateze ctre secolul VIII
O metod de codificare oarecum diferit a fost folosit de
ctre regele asirian Esarhaddon, tatl lui Asurbanipal. Pe o
stel care comemoreaz invazia sa istoric n Egipt
(cunoscut de cercettori ca Piatra Neagr a lui Esarhaddon,
acum aflat n Muzeul Britanic - Fig. 57), el pretinde c a
lansat campania militar nu doar cu binecuvntarea zeilor, ci

i sub egida celor apte constelaii care decid soartele - o

referire cert la constelaiile zodiacale.
n inscripia aflat pe partea din spate a stelei el pretinde
c semnele cuneiforme care numesc constelaiile sunt
asemntoare scrierii numele meu, Asshur-Ah-Iddin
(Asarhaddon sau Esarhaddon n limba englez).
Este neclar cum funcioneaz exact acest cod sau criptare,
dar putem descifra un alt neles ascuns introdus de acest
rege n aceeai inscripie.

Ocupndu-se de refacerea templului lui Marduk din

Babilon, operaiune pe care regele asirian a iniiat-o ca pe o
metod de a fi acceptat i n calitate de conductor al
Babiloniei, el amintete c Marduk, fiind suprat pe
babilonieni, a decis ca oraul i templul su s rmn n
ruine timp de 70 de ani. Aceasta a fost, scrie Esarhaddon,
ceea ce Marduk a notat n Cartea Soartelor. Oricum,
rspunznd la apelurile lui Esarhaddon,

Milostivul Marduk,
ntr-un moment n care inima sa s-a linitit,
A ntors invers tblia
i n al 11-lea an,
A aprobat restaurarea.
Ceea ce poate fi neles cu privire la acest oracol ascuns
este c aciunea zeului reprezint o scamatorie cu cifre - cu
simboluri (de asemenea n cuneiforme) care nlocuiesc
numere. n sistemul sexagisima sumerian (nsemnnd baza
60), semnul pentru unu ar putea nsemna deopotriv 1 i
60, n funcie de poziie. Semnul pentru 10 a fost un simbolblazon. Esarhaddon afirma c zeul a luat Cartea Soartei n
care a decis ca perioada de pustiire s fie de 70 de ani (Fig.
58a) i a ntors invers, astfel nct semnele cuneiforme s
reprezinte cifra 11 (Fig. 58b).
Asocierea mesajelor ascunse i a nelesurilor secrete nu
doar pentru cuvinte, dar i pentru numere a fost mai vizibil
n scrierile lui Sargon II, bunicul lui Asurbanipal. n timpul
domniei sale (721-705 .Chr.) el a stabilit o nou capital
administrativ-militar pe locul unui sat, la 12 mile nord-est
de capitala regal antic i de centrul religios Ninive. Numele
su asirian era Sharru-kin (Regele cel drept) i a numit noul
ora Dur Sharrukin (Fortul Sargon - un sit arheologic
cunoscut acum ca Khorsabad). n inscripia comemorativ a
acestei construcii, el a scris c zidul puternic pe care l-a
construit n jurul oraului are o lungime de 16.283 coi, care
este numrul numelui meu.
O astfel de ntrebuinare a numerelor pentru a codifica
silabele-cuvinte apare ntr-un text cunoscut ca An Exaltation
to Ishtar, unde credinciosul i semna numele nu cu litere, ci
cu numere:
fiul lui 21-11-20-42

Cheia unei astfel de codificri a rmas nedescifrat.

Dar avem motive s credem c astfel de metode
mesopotamiene de codificare erau cunoscute de profeii
Unul dintre cele mai dificile pasaje din Biblie este profeia
lui Isaia despre vremea Pedepsei, cnd va veni vremea cnd
o mare trompet va rsuna, vor veni cei care s-au pierdut pe
pmntul Asiriei i cei care au fost alungai pe pmntul
Egiptului i ei se vor nchina lui Yahve pe Muntele Sfnt din
Ierusalim. La acea vreme, a profeit Isaia, va domni confuzia,
iar oamenii se vor ntreba unul pe cellalt, cine va primi
nelegerea mesajului care a fost schimbat pentru a-i
ascunde sensul:
Regula st peste regul,
Regula se afl nuntrul regulii;
Linia este peste linie
Linia este cu linie Puin aici, cumva acolo;
Pentru c ntr-o limb
i ntr-un grai ciudat
Se va adresa El poporului su.
Isaia 28:10-11
Nimeni nu a neles cu adevrat cum o regul st peste
regul i linie cu linie va conduce la o limb nedesluit
i un grai ciudat. Cuvintele ebraice sunt Tzav
(regulament) i Kav (linie) i a fost exprimat n
traducerile limbii engleze moderne ca ordin sau regul
respectiv (The New American Bible), oapt i murmur
(Tanakh, Scripturile Sfinte) sau chiar strigte aspre i
strigte rguite (!) (The New English Bible).
Ce limb ar putea fi nedesluit sau ce semne scrise au

neles ciudat prin schimbarea regulii i a unei linii ici

i colo? Sugestia noastr este c profetul Isaia contemporanul lui Sargon II i Sennacherib - vorbea
Nu era, desigur, o limb necunoscut; dar, aa cum arat
versul de mai sus, mesajul dat n acea limb nu putea fi
neles pentru c a fost codificat prin Kav cu Kav, schimbnd
o linie aici i o linie acolo, apoi schimbnd regula
mesajului. Regulamentul schimbat, Tzav, sugera metode de
codificare (ca A/T-B/Sh) prin schimbarea ordinii literelor.
Aceast soluie sugerat cu privire la misterul versetelor
28:10-11 poate explica descrierea ulterioar fcut de Profet
(29:10-12) a incapacitii de a nelege scrierile pentru c
verbele crii v-au fost date ca o carte care a fost sigilat.
Ultimul cuvnt, hatoom, este tradus de obicei ca sigilat, dar
la babilonieni avea sensul de ascuns, fcut secret. Era un
termen folosit n acelai sens n scrierile mesopotamiene
codificate care erau ascunse celor neiniiai. Este un termen
foarte folosit n profeticul Cntec al lui Moise (Deuteronomul
32:34), n care este citat Dumnezeu spunnd c lucrurile
predeterminate s vin sunt un secret ascuns de mine,
pstrat i ascuns n comorile mele. Termenul este folosit de
asemenea, n sensul de cale ascuns sau fcut n secret
n Isaia 8:17; i chiar mai mult n Cartea lui Daniel, n
viziunile i simbolistica lucrurilor ce urmau s vin la
Sfritul Vremurilor.
Isaia, ale crui profeii au fost preluate la nivel
internaional i codificrile mesajelor regale din vremea sa,
poate s fi dat chiar indiciul necesar la Codul Bibliei. El a
refcut de trei ori cuvntul Ototh (semne) care era folosit n
Biblie pentru a desemna semnele divine sau cereti pentru a
fi citit Otioth - pluralul lui Oth, care nsemna deopotriv

semn i liter, pstrnd nelesul de litere n profeia sa.

Am menionat deja referirea lui Isaia la Yahve ca un creator

al Literelor (alfabetului). n versetul 45:11, Profetul,
proslvind unicitatea lui Yahve, spune c El are aranjate
prin litere cele ce vor veni. O astfel de aranjare codificat ar
trebui s fie caiea pentru nelegerea versetului 41:23.
Descriind cum oamenii dezorientai pe Pmnt caut s
deslueasc viitorul prin interpretarea trecutului, el le citeaz
din milostivul Dumnezeu:
Spune-ne literele din urm!
Ar fi putut s nsemne termenul folosit n mod curent,
Ototh, spune-ne semnele din urm, de la nceputul
lucrurilor. Dar Profetul a ales - de trei ori - s scrie literele
Otioth. Dorina clar este de a permite nelegerea planului
divin prin artarea literelor din urm, ntr-un cod n care au
fost amestecate literele.
Dar aa cum arat exemplele mesopotamiene, acrostihul a
fost un instrument prea simplu i adevrata codificare - nc
nedescifrat n cazul lui Sargon II - se bazeaz pe valoarea
numeric a semnelor cuneiforme. Am menionat deja
secretul zeilor cu privire la numerele rangului lor - numere

care uneori sunt scrise sau invocate n locul numelor zeilor.

Celelalte tblie n care terminologia sumerian s-a meninut,
chiar i n textele akkadiene (multe rmase nedesluite
deoarece tbliele s-au sfrmat), indic faptul c
numerologia a fost folosit de timpuriu ca un cod secret, mai
ales cnd erau implicai zeii.
Nu este de mirare c literele alfabetului ebraic au primit
valori numerice (Fig. 59) i c astfel de valori au jucat un rol
mai mare n codificarea i decodarea informaiilor secrete
dect nsei literele. Cnd grecii au adoptat alfabetul, ei au
meninut practica acordrii de valori numerice literelor; de la
greci s-a preluat arta i regulile de interpretare a literelor,
cuvintelor sau grupurilor de cuvinte prin valorile lor
numerice, tiin care a primit numele de gematria.
ncepnd din perioada celui de-al Doilea Templu, gematria
numerologic a devenit un instrument folosit de cercettori i
de scolastici pentru a examina versetele biblice i numerele
nespuse ale cuvintelor din sensurile ascunse sau fragmentele
de informaii sau pentru a schia noi reguli atunci cnd cele
biblice erau incomplete. Astfel se considera c, atunci cnd
un brbat depunea jurmntul pentru a deveni nazireu,
perioada nespecificat de abstinen trebuie s fie de 30 de
zile, deoarece cuvntul explicativ YiHYeH (va fi) n Numeri
capitolul 6 are valoarea numeric 30. Compararea cuvintelor
i implicaiilor lor prin echivantele numerice deschide
numeroase posibiliti pentru sensurile ascunse. Ca
exemplu, s-a sugerat c Moise i Iacov au avut o experien
divin similar deoarece scara ctre cer (Suiam, n ebraic)
pe care Iacov a vzut-o ntr-o viziune pe timpul nopii i
muntele (Sinai) pe care Moise a primit Tbliele Legii au avut
aceeai valoare numeric, 130.

Folosirea numerologiei i n mod special a gematriei,

pentru a nelege sensurile ascunse, a atins noi dimensiuni
odat cu intensificarea curentului mistic evreiesc cunoscut
sub numele de Cabala, n perioada evului mediu. n acele
cercetri, o atenie special a fost dat numelor divine.
Suprem a fost denumirea prin care Domnul s-a numit pe
sine nsui fa de Moise. YHWH: Eu sunt Cel ce sunt, Yahve
este numele meu (Exodul 3:14-15). Adunate cele patru litere
ale numelui divin (Tetragammaton) echivaleaz cu 26
(10+5+6+5); dar cu metode mai complexe susinute de
cabaliti n care numele explicite ale celor patru litere (Yod,
Hei, Wav, Hei) erau adunate numeric, totalul ajunge la 72.
Echivalentele numerice ale acestor numere formeaz semne
ale nelegerii celorlalte cuvinte.
(La nceputurile cretinismului, o sect din Alexandria
considera c numele creatorului primordial i suprem era
Abraxas, iar suma literelor sale era de 365 - numrul de zile
din anul solar. Membrii sectei obinuiau s poarte

medalioane din pietre semipreioase cu numele i imaginea

zeului - care nu era ntotdeauna echivalentul lui YaHU
(prescurtarea de la Yahve) - Fig. 60. Acesta este motivul
pentru care credem c Abraxas provine din Abresheet,
Tatl/Creatorul nceputului, pe care noi l-am propus ca
primul cuvnt ntreg ncepnd cu A" al Genezei, mai
degrab dect cel curent, Bresheet, care face ca Geneza s
nceap cu B". Dac Geneza are ntradevr o liter n plus,
codul secvenial, acum n vog, ar trebui reexaminat).
Ct de mult credit trebuie s acordm codurilor sau
sensurilor numerice - un cod inerent n literele nsei, i
nu ntr-o spaiere ntmpltoare ntre ele? Pentru c o
astfel de ntrebuinare ne conduce la timpurile sumeriene
- pentru c erau acceptate n perioada akkadian i au
fost destinate n toate perioadele s fie secretele ale
zeilor ce nu se dezvluiau neiniiailor - i, datorit
legturii cu ADN-ul, credem c acele coduri numerice
sunt codul secret!
n fapt, unul dintre cele mai evidente (i astfel, ca n
povestirile cu detectivi, cel mai ignorat) indiciu este chiar
termenul pentru carte, SeFeR n ebraic.

Provenind de la rdcina SFR, originile sale erau cuvintele

pentru scriitor/scrib (Sofer), a spune (Lesapher) o poveste
sau o istorie (Sippur) i aa mai departe.
Dar chiar rdcina SFR indic tot ce este conectat la
numere! A numra era Lisfor, numeral este Sifrah, numr
este Mispar, numrtoarea este Sephirah. Cu alte cuvinte,
chiar din momentul n care a aprut rdcina din trei litere a
cuvintelor n ebraic, s scrii cu litere i s numeri cu cifre
era considerat acelai lucru.
ntr-adevr, exist exemple n Biblia ebraic unde sensul
de carte i cel de numr erau alternative, ca n Cronici I
27:24 unde, anunnd un recensmnt cerut de regele
David, cuvntul numr a fost folosit de dou ori n aceeai
propoziie, o dat pentru a indica numrul (oamenilor
numrai), apoi pentru a se referi la nscrierile din cartea lui
Un astfel de dublu neles i probabil triplu sens a
reprezentat o provocare pentru traductorii versetului 15 din
Psalmul 71. Cernd ajutorul Domnului, dei nu tia tot
despre miracolele sale, psalmistul a promis s povesteasc
faptele salvatoare i drepte ale Domnului dei nu tiu
Sefuroth. Versiunea regelui Iacov traduce cuvntul ca
numere; mai multe traduceri moderne prefer termenul a
spune - vorbe. Dar, n felul su neobinuit, psalmistul a
inclus un al treilea neles, acela de secrete.
Cum vremurile au devenit mai agitate n Iudeea, o revolt
(a Macabeilor mpotriva legilor greceti) a fost urmat de o
alta (mpotriva stpnirii romane), cutarea mesajelor de
speran - mesianice - s-a intensificat. Cercetarea textelor
timpurii pentru a descoperi numere codate s-a transformat
n folosirea numerelor ca nite coduri secrete. Unul dintre
cele mai enigmatice i bine codificate exemple a fost gsit n
Noul Testament: numrul bestiei codificat ca 666 n

Iat nelepciunea;
Las pe cel care are nelegerea
S numere numrul bestiei;
Pentru c este Numrul Omului;
i numrul su este ase sute i trei de douzeci i ase.
Apocalipsa 13:18
Fragmentul are legtur cu ateptrile mesianice, cu
prbuirea rului i cu A doua Venire, ntoarcerea mpriei
Cerului pe Pmnt. S-au fcut ncercri numeroase peste
milenii pentru a descifra codul numeric al lui 666 i, astfel,
pentru a se nelege profeia. Numrul apare clar n
manuscrisul (grecesc) timpuriu al crii al crei titlu integral
este Evanghelia dup Ioan care ncepe cu afirmaia La
nceput a fost Cuvntul i Cuvntul era cu Dumnezeu i
Cuvntul era Dumnezeu i care este plin de referiri
numerice. Folosind valorile numerice ale literelor greceti
(care urmau ndeaproape ordinea ebraic) i metodele
gematriei, s-a sugerat c bestia a fost imperiul roman
deoarece valoarea numeric a LATEINOS era 666. Alii au
sugerat c acest cod numeric nsemna rul reprezentat de
nsui mpratul Roman (Traian) al crui nume din mijloc,
ULPIOS, exprim cifra 666. Totui, o alt sugestie a fost c
acest cod era n ebraic i fcea trimitere la Nero Cesar
(mpratul Nero), a crui scriere n ebraic N-R-W-N + Q-SR se potrivete cu cifra 666; i tot aa, ntr-o varietate de
interpretri ale gematriei, se folosesc deopotriv adunarea i
metode de triangulaie.
Posibilitatea ca secretul codului 666 s fie descoperit n
ebraic mai degrab dect n sensurile cuvintelor greceti
sau romane poate s fie la final cheia rezolvrii enigmei. Am
aflat c 660 n ebraic este echivalentul numeric al lui SeTeR
(Fig. 61a) - un lucru ascuns, un mister ascuns; era folosit n

Biblie n conexiune cu nelepciunea divin i nelegerea care

erau ascunse Omului. Pentru a-l face 666, trebuia adugat
litera Wav (=6) (Fig. 61b), schimbnd sensul de la un secret
la secretul lui, SiTRO, lucrul su ascuns. Unii au folosit
aceast referire la secretului su pentru a descrie
ntunericul apelor amintit n Btlia Cerestr cu Tiamat:
Pmntul s-a scuturat i s-a cutremurat,
Temeliile dealurilor s-au scuturat...
A ieit fum prin nrile sale,
Un foc devorator prin gura sa...
El a inut ascuns secretul su,
Acoperit de un ntuneric de ape i de nori.
Psalmi 18:8-12

Exist referiri frecvente n Biblie la acea Btlie Celest,

care n Epopeea Creaiei mesopotamian a avut loc ntre
Nibiru/Marduk i Tiamat, iar n Biblie ntre Yahve, Creatorul
Primordial, i Tehom, un adnc de ape. Tehom/Tiamat era
uneori numit Rahab, cel seme sau printr-o inversiune a
literelor RaBaH (cel mare) n loc de RaHaB. Formularea din
Psalmul 18 reia o exprimare mult mai veche din Deuterom
29:19, n care judecata lui Yahve pe ultima generaie este
prezis i descris ca o vreme n care fumul va iei prin
nrile Domnului. Vremea judecii finale este exprimat

adesea n Biblie prin adverbul Az - atunci, la acel timp

Dac autorul Apocalipsei, aa cum este evident, a avut, de
asemenea, n minte acel Az, acel atunci al Generaiei
Trecute cnd Domnul va reaprea ca Cel care crease Cerul i
Pmntul n vremea btliei cu Tehom Rabah (un termen
folosit prin asociere n Arnos 7:4, Psalmii 36:7, Isaia 5:10)
atunci interpretarea numeric a enigmei lui 666 ar putea
sugera c Apocalipsa vorbea despre ntoarcerea Domnului
Ceresc ntr-o reconstituire a Btliei Cereti; pentru c suma
total a valorilor numerice ale lui Az, Tehom i Rabah este
666 (Fig. 62).
ncercarea noastr de decodare a numrului 666 prin
convertirea lui n litere i apoi prin cutarea cuvintelor care
conin acele litere n Vechiul Testament nu epuizeaz
posibilitile. Schimbarea lui Abresheet n Abraxas (cu
numrul su valoric 365) ca zeitate arian, referirile biblice
(citate mai devreme) la codificrile din scrierile cuneiforme
prin schimbarea liniilor n semne cuneiforme precum i
referirea la citirea invers i la folosirea A-T-B-Sh pentru a
ascunde identitatea zeilor strini, ridic ntrebarea: n ce
msur, mai ales c destinul evreilor a devenit complicat n
soarta celorlalte naiuni i a zeilor lor, au ascuns de fapt,
codificrile biblice informaii secrete din scrierile i
panteoanele strine? Dac relatrile despre creaie din cartea
Genezei au fost de fapt versiuni scurtate ale secretelor
creaiei nregistrate n Enuma elish, ce putem spune despre
acele fragmente secrete care au fost dezvluite lui
Enmeduranki i Adapa (i Enoh)?

Am citit n Genez c, atunci cnd faraonul care l-a

promovat pe Iosif care interpreta visele la o nalt funcie, el
i-a dat, aa cum se fcea n cazul unui oficial egiptean, un
nume nou, egiptean: Zophnat-Pa'aneach. Dei cercettorii au
ncercat s reconstituie scrierea hieroglif i sensul egiptean
al numelui-epitet, era evident c n realitate era un nume al
crui sens a fost codificat n ebraic, pentru c n ebraic
acesta nsemna Cel care descifreaz (Pa'aneach) Lucrurile
Secrete/Ascunse (Zophnot).
Astfel de transformri de limb/liter/numr ntresc
ntrebarea (i posibilitatea) - i nu doar n ceea ce privete
logica lui 666 - dac codurile ar putea include trimiteri la
celelalte zeiti ale panteoanelor cunoscute n antichitate.
Unul dintre aspectele inexplicabile din alfabetul ebraic este
c cinci litere sunt scrise diferit cnd locul lor este la sfritul
unui cuvnt (Fig. 63a).
Dac vrem s ne aventurm pe cont propriu n Pardes,
dumbrava interzis i s acceptm premisa codului
combinrii liter + numr, putem spune c citirea invers (de
la stnga la dreapta) motivul codificrii pentru acele cinci
litere este un cod secret (Zophen) al lui 60 (M+Kh), care
este numrul lui Anu! (Fig. 63b).
Dac este aa, este doar o coinciden c prima liter din

cuvntul ebraic pentru secret - SOD - (S") are valoarea

numeric 60 i, mai mult de att, valoarea numeric a
ntregului cuvnt este 70 - numrul secret al pustiirii
decise de Marduk (i ntoars apoi de el) pentru oraul
Babilon? i de aceea, ar fi putut fi relatarea (n Ieremia i n
alte cri biblice) potrivit creia pustiirea Ierusalimului i a
Templului su a durat exact 70 de ani - o profeie care a fost
prezentat ca o revelaie a unui secret, Sod, al Zeului? (Fig.
O interpretare care accept posibilitatea c Vechiul
Testament, ca i Noul Testament, au preluat pentru
codificrile lor din scrierile secrete timpurii mesopotamiene,
iar rangurile divine conduc la o alt posibil soluie a enigmei
lui 666.
Unul dintre puinele (descoperite) exemple n care numrul
6" a fost revelat ca rang divin a fost n tblia care a fost
reconstituit de ctre Alasdair Livingstone n cartea Mystical
and Mythological Explanatory Works of Assyrian and
Babylonian Scholars. Tblia reconstituit - care conine un
avertisment cu privire la secretele pe care le are i ce nu
trebuie dezvluite - ncepe cu 60, ca rang al zeului
dominant, tatl zeilor, i apoi, pe o coloan separat,
dezvluie identitatea sa: Anu. Urmat de Enlil (50), Ea/Enki
(40), Sin (30) i Shamash (20), este trecut Adad, zeul ploii i
al tunetelor, cu rangul 6". Lista continu pe partea frontal
i pe prile opuse, enumernd 600 ca numrul secret al
lui Anunnaki.
Ce iese n eviden din tblia mesopotamian cu privire la
numerele secrete ale zeilor ar putea fi foarte bine cheia
soluiei finale pentru rezolvarea misterului numrului 666
prin abordarea sa ca un cod sumerian:
600 = Anunnaki, Cei care au venit din Cer pe
Pmnt 60 = Anu, conductorul lor suprem

6 = Adad, unul din zei, care i-a nvat pe iniiai

666 = Iat nelepciunea, Numarate de cel care are
(Apropierea lui Anu de Adad ncepe n mileniul 2 .Chr.
cnd a fost gsit nu doar n expresii textuale, dar i n
templele lor combinate. Ar putea suna incredibil, dar Biblia
de asemenea i pune pe Anu i pe Adad alturi n lista zeilor
celorlalte naiuni - Regii II 17:31 ).
Numerele secrete ale zeilor pot servi ca indicii pentru
descifrarea sensurilor secrete ale celorlalte nume divine.
Astfel, cnd a fost conceput alfabetul, litera M" - Mem, de la
Ma'yim, ap, era asemntoare cu descrierile egiptene i
akkadiene ale apei (o pictogram a valurilor) ca i pronunia
termenului n acele limbi pentru ap. A fost aadar o
coinciden c valoarea numeric pentru M"

n alfabetul ebraic era 40 - rangul numeric secret al lui

Ea/Enki, a crui cas este apa, prototipul Vrstorului?
A fost de asemenea, un cod numeric secret faptul c acesta
provine din termenul YaHU din Sumer - forma prescurtat
pentru tetragrama YaHWeH? A ncercat un iniiat sumerian
s aplice codul numerelor secrete la acest nume teoforic (cum
s-au folosit la prefixele i sufixele numelor personale), se
poate spune c YHU este un cod secret pentru 50 (IA = 10,
U = 5, IA.U = 1Ox5=50), cu toate implicaiile teologice din
n vreme ce atenia a fost orientat ctre sensul lui 666,
am descoperit n versul criptic din Apocalipsa o afirmaie cu
o semnificaie esenial. Codul secret, spune acesta, este
nelepciunea i ea poate fi descifrat doar de ctre acei care

au nelegerea.
Acetia sunt chiar termenii folosii de ctre sumerieni i cei
care au venit dup ei, pentru a decoda cunotiinele secrete
despre care doar iniiaii privilegiai fuseser nvai de ctre
La baza cunotiinelor incredibile i cuprinztoare ale
sumerienilor se afl, n egal msur, cunotiinele uimitoare
ale numerelor. Aa cum a observat la nceputul secolului
trecut matematicianul i astrologul Herman V. Hilprecht,
mesopotamiene (The Babylonian Expedition of the University
of Pennsylvania), toate tablele nmulirii i mpririi din
bibliotecile templelor din Nippur i Sippar i din biblioteca lui
Ashurbanipal din Ninive se bazeaz pe numrul 12.960.000
- un numr astronomic, un numr de o prea uimitoare
complexitate pentru a fi neles i a crui utilitate prea
discutabil pentru oamenii mileniului 4 .Chr.
Dar analiznd acest numr - cu care ncep unele tblie
matematice - profesorul Hilprecht a ajuns la concluzia c el
poate fi legat doar de fenomenul precesiunii - ntrzierea
Pmntului pe orbita sa complet n jurul Soarelui, care este
de 25.920 de ani (pn cnd Pmntul se ntoarce n exact
acelai punct). Acel ciclu complet al celor 12 case zodiacale a
fost numit Marele An; numrul astronomic 12.960.000
reprezint 500 astfel de Ani Mari. Dar cine, cu excepia
Anunnaki, ar putea pricepe sau folosi o astfel de ntindere
vast de timp?
Lund n considerare sistemele numerice i de calcul,
sistemul zecimal (baz 10) este cel mai evident omenesc,
rezultat din numrarea degetelor de la mini. Chiar i
uimitorul sistem calendaristic Maya numit Haab, care
mparte anul solar n 18 luni cu 20 de zile fiecare (plus 5 zile
speciale la sfritul anului) se poate presupune c a rezultat

din numrarea tuturor celor 20 de degete, de la mini i

picioare. Dar de unde au luat sumerienii sistemul
sexagesimal (baza 60) a crui expresie se menine nc n
diverse calcule (60 de minute, 60 de secunde) n astronomie
(un cerc de 360 de grade) i geometrie?
n cartea noastr, La nceputul timpului, am artat c
Anunnaki, venind de pe o planet a crei perioad orbital
(un an pe Nibiru) nsemna 3.600 de orbite ale planetei
Pmnt, aveau nevoie de un fel de numitor comun pentru
astfel de perioade diverse - i au gsit unul n fenomenul
precesiunii (pe care numai ei, nu oamenii cu durate mai
scurte de via determinate de ciclurile Pmntului, puteau
s l descopere). Cnd ei au mprit cercul ceresc n 12 pri,
ntrzierea precesional - pe care ei puteau s o descopere cu
uurin - era de 2.160 de ani pentru fiecare cas. Aceasta,
am sugerat, ducea la o proporie de 3.600:2.160 sau 10:6
(posibilul Raport de aur al grecilor) i la sistemul 60 care face
6 x 10 x 6 x 10 i aa mai departe (rezultnd 60, 360, 3600
i, astfel, numrul complex 12.960.000).
n acest sistem, cteva numere de nsemntate sacr sau
celest par s fie neobinuite. Unul este numrul apte, a
crui semnificaie n povestea Creaiei, ca a aptea zi de
Sabat, n numele reedinei lui Avraam Beer- Sheba
(Originea lui apte) i aa mai departe, este uor de
recunoscut. n Mesopotamia era aplicat Celor apte care
Judec, Cei apte nelepi, cele apte pori ctre Lumea de
Jos, cele apte tblie ale lui Enuma Elish. Era un epitet al
lui Enlil (Enlil este apte, spuneau sumerienii); i - iar
dubii, originea semnificaiei numrului - era un numr
planetar al Pmntului. Pmntul (KI) este *1 aptelea,
spuneau toate textele astronomice sumeriene. Aceasta,

aa cum am explicat, are sens numai pentru cineva care

venea din exterior ctre interiorul sistemului nostru solar.
Pentru el (ei) care venea/ veneau de pe ndeprtata Nibiru,
Pluto ar fi fost prima planet, Neptum i Uranus a doua i a
treia, Saturn i Jupiter a patra i a cincea, Marte ar fi fost a
aptea (apoi Venus a opta - aa cum aceste planete au fost
descrise pe monumente i sigilii cilindrice, Fig. 64).
(n imnurile sumeriene adresate lui Enlil binefctorul a
toate, el era vzut ca fiind cel responsabil de distribuirea
mncrii i a bunstrii pe pmnt; el era invocat de
asemenea ca garant al tratatelor i jurmintelor. Nu este de
mirare aadar, c n ebraic rdcina de la care pornete
cifra apte - Sh-V-A - este aceeai de unde deriv sensul de a
fi stul i a jura, a face un jurmnt).
Numrul 7" este un numr cheie n Apocalipsa (7 ngeri, 7
sigilii, i aa mai departe); aa a fost i cu urmtorul numr
extraordinar - 12 - sau multiplul su, 144.000 n Apocalipsa
7:33-5, 14:1 etc. Am relatat deja aplicaiile sale i
semnificaia sa, ca provenind din numrul membrilor
sistemului nostru solar (Soare, Luna i 10 planete - 9 pe care
le tim, plus Nibiru).
Apoi - aproape trecut cu vederea - era numrul neobinuit
72. S spunem, cum au fcut unii, c acesta este o simpl
nmulire a lui 12 cu 6, sau, c atunci cnd l nmulim cu 5,
rezult 360 (ca numrul de grade ntr-un cerc) nseamn s
spunem ceea ce este evident. Dar de ce 72 n primul rnd?

Am observat deja c misticismul Cabalei a ajuns, prin

intermediul metodelor gematriei la numrul 72 ca numr
secret al lui Yahve. Dei ascuns n relatarea biblic din
vremea cnd Dumnezeu i-a nvat pe Moise i pe Aaron s
vin la Muntele Sfan i s aduc 70 dintre btrnii
neamului Israel, adevrul este c Moise i Aaron au adus 72
de nsoitori: n plus fa de cei 70 de btrni, Dumnezeu i-a
instruit s-i aduc pe cei doi fii ai lui Aaron (dei Aaron a
avut 4 fii), fiind n total 72.
Peste tot gsim acest ciudat numr 72 n povetile egiptene
care se refer la rivalitatea dintre Horus i Seth. Relatnd
povestirea sa de surse hieroglife, Plutarh (n De Iside et
Osiride, unde face o paralel ntre Seth i Typhon din
miturile greceti), spunea c, atunci cnd Seth la atras pe
Osiris n lada fatal, el a fcuto n prezena a 72 de tovari
De ce apare, aadar, cifra 72 n momente att de diferite?
Singurul rspuns plauzibil, credem noi, poate fi gsit n
fenomenul precesiunii, pentru c acesta este un numr
crucial, el putnd fi echivalat cu numrul anilor ce semnific
ntrzierea Pmntului cu un grad.
Pn n zilele noastre nu este sigur cum a aprut
conceptul Jubileului, perioada de 50 de ani decis de Biblie
i folosit ca unitate de timp n Cartea Jubileelor. Iat un
rspuns: pentru Anunnaki, a cror orbit n jurul Soarelui
echivala cu 3.600 de ani pmnteni, orbita trecea prin 50 de
grade precesionale (50 x 72 = 3.600)!
A fost probabil mai mult dect o coinciden faptul c
numrul rangului secret al lui Enlil - i numrul dorit de
Marduk - era tot 50. Pentru c era unul dintre numerele care
exprimau relaia dintre Timpul Divin (provenind din micrile
lui Nibiru), Timpul Pmntesc (legat de micrile Pmntului
i ale Lunii sale) i Timpul Ceresc (sau timpul zodiacal,

rezultat din precesiune). Numerele 3-600, 2.160, 72 i 50

erau numere ce aparineau Tblielor Destinului n centrul
DUR.AN.KI al lui Nippur; ele erau ntradevr numere ce
exprimau Legtura Cer-Pmnt.
Lista Regelui Sumerian arat c 432.000 ani (120 de orbite
ale 'ni Nibiru) au trecut de la sosirea lui Anunnaki pe Pmnt
i pn la
Potop. Numrul 432.000 este, de asemenea, un numr
cheie n religia hindus i celelalte concepte ale Erelor i
perioadelor de catastrofe care au lovit Pmntul.
Numrul 432.000 cuprinde, de asemenea, cu precizie cifra
72 de 6000 de ori. i merit reinut c, potrivit nelepilor
evrei, numrtoarea anilor n calendarul evreiesc - 5.758
d.Chr. n 1998 - ajunge la o completare, la un punct
terminus, cnd atinge cifra de 6.000; atunci va fi un ciclu
Aa cum este evident din izvoarele vechi cu privire la astfel
de iniiai - Adapa, Enmeduranna, Enoh - esena
cunotinelor i nelepciunii care le-a fost dezvluit lor a
constat n astronomie, calendar i matematici (secretul
numerelor). ntradevr, aa cum au artat practicile de
codare i criptare din antichitate, legtura dintre ele,
indiferent de limba folosit, era dat de numere. Dac odat
a existat o singur limb universal pe Pmnt (aa cum
afirm textele sumeriene i Biblia), ea trebuie s se fi bazat
pe matematic; i dac - sau mai degrab cnd - vom lua
legtura cu extraterestrii, cum s-a ntmplat cndva cu
Anunnaki n vizitele lor pe Pmnt i cum vom face cnd ne
vom aventura n spaiu, limbajul cosmic va fi unul bazat pe
n fapt, sistemele actuale de computere au adoptat deja
limbajul universal al numerelor. Atunci cnd la maina de
scris este apsat tasta A", o prghie ce ine aceast liter

este activat i bate pe hrtie A". La computere, cnd este

apsat tasta A", este activat un semnal electronic care
exprim litera A" ca o serie de numere O" sau 1 - aceste
litere au fost digitalizate. Calculatoarele moderne, cu alte
cuvinte, au convertit literele n numere; se poate spune c ele
au scriere gematriatizat.
i dac se i-au n serios afirmaiile sumeriene i biblice
referitoare la faptul c includerea cunotinelor medicale n
Cunoatere i nelegere a fost motenit de ctre noi - exist
undeva n toate textele antice, att de meticulos copiate cu
precizie deoarece ele fuseser canonizate, cheia mprtirii
cu noi a cunotinelor genetice care au dus la crearea noastr
i astfel ne nsoesc nc n sntate, boal i moarte?
Am ajuns n stadiul n care cercettorii notri au identificat
o gen special - numindo, s spunem, P51 - la un loc
specific pe numrul de cromozom 1 sau 13 sau 22, care este
rspunztoare pentru via sau boal. Este o gen i o locaie
care pot fi exprimate pe computer - cu numere, litere sau
combinaii ntre acestea.
Exist acolo n acele texte antice i, n mod special, n
Biblia ebraic, astfel de informaii genetice codate? Dac am
putea s descifrm un astfel de cod, am putea deveni fiine
asemntoare Modelului Perfect, aa cum au dorit Enki i
Ninharsag s creeze.
Convingerea ndelungat a omenirii c cineva din trecut
putea s prevad viitorul - c, n limbajul sumerian, cineva a
cunoscut Destinul i putea decide Soarta - se baza pe
Cuvntul Scris. Dezvluit sau secret, direct sau criptat,
informaia trebuia nregistrat, notat. Un legmnt, un
tratat, o profeie - ce valorau ele pentru cei de atunci sau
pentru cei din viitor, dac nu erau notate cuvintele?
Cnd arheologii fac excavaii la un sit antic, nimic nu pare

mai semnificativ i captivant dect ceva scris - un obiect, o

crmid, o plac din piatr, cioburi din ceramic i, inutil
s mai menionm, un text sau un fragment inscripionate pe
o tbli de lut sau un pergament de papirus. Din ce loc
provine, care a fost numele su antic, crei culturi i-a
aparinut, cine au fost conductorii rii? Cteva litere
mzglite, un grup de cuvinte ofer rspunsuri; i cu att
mai mult, desigur, textele complete.
Unul dintre cei mai vechi arhiviti, dac nu chiar un
arheolog n toat puterea cuvntului, a fost regele asirian,
Asurbanipal. Avnd convingerea c propria sa soart i
Destinul su pe pmnt au fost decise n trecut, el a
nregistrat n scris despre premiile i przile din cuceririle
sale; biblioteca din palatul su din Ninive era pe atunci
(secolul 7 .Chr.) probabil cea mai mare colecie de tblie din
lut i de nenumrate texte vechi cu mituri i poeme, anale
regale i ceea ce se numeau atunci crile (pe tblie din
lut) de astronomie, matematici, medicin i celelalte texte
nepreuite. Tbliele au fost aranjate cu grij pe rafturi din
lemn i fiecare raft ncepea cu un catalog de enumerare a
tblielor care se aflau pe raft. Se afla acolo adunat o
minunat comoar de cunotine vechi, nregistrri i
profeii. O mare parte din textele cunoscute astzi vin de la
tbliele sau fragmentele gsite la Ninive. n acelai timp,
catalogul tblielor de la nceputul fiecrui raft arat ct de
multe s-au pierdut sau au rmas nedescoperite.
Ceea ce cu siguran s-a pierdut - pentru c nu s-au
realizat copii - a fost ceea ce nsui Asurbanipal a identificat
ca scrierile de dinainte de Potop; tim c ele au existat
pentru c Asurbanipal se luda c putea citi acea scriere.
Afirmaia regelui, trebuie notat, nu a fost luat n serios de
ctre asiriologii moderni. Unii au modificat afirmaia regelui
pentru a o citi ca scrieri n sumerian, pentru c pare

incredibil nu doar s pretinzi c a existat scriere cu milenii

naintea tblielor sumeriene, dar i c astfel de scrieri (sau
alte tblie) ar fi supravieuit catastrofei globale.
Totui celelalte texte sau surse, fr legtur cu
Asurbanipal sau vremea sa, chiar fac astfel de afirmaii.
Adapa - un iniiat din perioada prediluvian - a scris o carte
al crei titlu, preluat n sumerian, era U. s-ar Dingir ANUM
Dingir ENLILA (Scrieri cu privire la Timpul divinului Anu i
divinului Enlil).
Enoh, un alt strmo din prediluviu, ntors din cer cu 360
de cri - un numr nu doar cu o referire
celest/matematic, dar i cu una care arat, trebuie s
observm, c atunci cnd l convertim n litere se pronun
SeQeR (60+100+200) - care este ascuns. Numele locului
Saqqarah n Egipt, locul ascuns al vechilor piramide regale
i morminte, provine din aceeai rdcin.
Cartea lui Enoh (cunoscut ca Enoh I) se presupune a fi
scris de nsui Enoh, ca relatare la persoana nti. Dei,
dup opinia tuturor cercettorilor era o scurt compilaie
dinaintea erei cretinismului.
citatele din ea gsite n celelalte texte timpurii i
asemntoare cu celelalte scrieri extrabiblice (precum i
faptul c a fost canonizat n hemurile cretinismului
timpuriu), arat c ea s-a bazat cu adevrat Pe textele
antice). n nsi textul crii, dup o scurt introducere care
explic cine au fost Nefilim (renumii n Geneza 6), Enoh
declar c ceea ce urmeaz este cartea cuvintelor de
dreptate i dojana a eternului Nefilim, pe care le-a auzit n
timpul viziunii i pe care el le-a notat ntro limb uman un limbaj pe care Cel Mre la dat oamenilor s converseze
ntre ei.
Dup ce i s-au dat cunotine despre cer, Pmnt i
misterele lor, lui Enoh i s-a spus s noteze profeii despre

evenimentele viitoare (potrivit Crii Jubileelor, lui Enoh i s-a

artat ce a fost i ce urma s fie). Dei cercettorii cred c
profeiile erau de fapt retrospective, includerea n Enoh I a
textelor timpurii i canonizarea lor ulterioar arat c la
vremea Celui deal Doilea Templu exista convingerea ferm c
viitorul putea i a fost prevestit n trecut prin inspiraia
divin - chiar dictat oamenilor de nsui Domnul sau de
ngerii si, pentru a fi nregistrat, notat i transmis
generaiilor viitoare.
Chiar mai categoric n afirmaia potrivit creia Enoh a
adus cu el cri care conin nu doar cunotiine tiinifice,
dar i profeii despre viitor, este versiunea cunoscut ca Enoh
l sau cu titlul su complet Cartea Secretelor lui Enoh. Ea
spune c Dumnezeu la nvat pe Enoh s dea crile scrise
de mn copiilor si n aa fel nct ei s le poat transmite
din generaie n generaie i din naiune n naiune. Atunci
Dumnezeu i-a dezvluit secretele Creaiei i ciclurile de
evenimente de pe Pmnt. La nceputul celor 8000 de ani va
fi un timp tar Numrtoare, (o vreme) tar ani, luni,
sptmni, nici zile sau ore (Enoh l 33:1-2).
Este fcut o referire atunci la scrierile mai vechi care
aparineau strmoilor lui Enoh: Adam i Seth - scrierile de
mn care nu trebuiau distruse pn la sfritul timpului.
Exist o referire la o hart pe care Domnul a puso pe
Pmnt i a ordonat s fie pstrat i ca scrierile de mn
ale prinilor ti s fie pstrate i c aceasta nu va pieri n
Potopul pe care l voi aduce peste neamul tuReferirea la un viitor Potop, inclus n Enoh l ca o revelaie
profetic a Domnului dat lui Enoh, vorbete deci despre
scrieri de mn ale lui Adam i ale fiului su, Seth, i
despre o hart divin care au fost aduse pe Pmnt i
urmau s supravieuiasc Potopului. Dac astfel de scrieri
de mn au existat vreodat, ele trebuie s se fi numrat

printre scrierile prediluviene pierdute. La vremea celui deal

Doilea Templu s-a considerat c, printre astfel de scrieri
prediluviene, se aflau Crile lui Adam i ale Evei, n care
erau oferite multe detalii, completnd povestea biblic.
Cercettorii sunt de acord c Enoh I a inclus cu siguran,
cuvnt cu cuvnt, seciuni din cele mai timpurii manuscrise
numite Cartea lui Noe, o lucrare ce a fost menionat n
celelalte scrieri alturi de Cartea lui Enoh. Ea ar fi putut fi la
fel de bine sursa celor opt versete enigmatice din capitolul 6
al Genezei; precednd versiunea biblic a Potopului i pe
eroul su, Noe, acele versete vorbesc despre Nefilim, fiii lui
Elohim, care s-au cstorit cu Fiicele lui Adam, ca motivaie
a deciziei Domnului de a terge omenirea de pe faa
pmntului. n ea povestea este spus n ntregime, Nefilim
sunt identificai, natura furiei divine este explicat. Revenind,
dup toate probabilitile, la vremurile i sursele sumeriene,
ea cuprinde cteva detalii cunoscute doar din textul
mesopotamian Atra Hasis.
Este mai mult dect probabil ca cele dou cri menionate
mai sus - Crile lui Adam i ale Evei i Cartea lui Noe - s fi
existat, ntr-o form sau alta, i s fi fost cunoscute celor care
au compilat Vechiul Testament. Dup ce descrie crearea lui
Adam i a Evei, incidentul din Grdina Edenului i naterea
lui Cain i al lui Abel, apoi a lui Enosh, Geneza rencepe (n
capitolul 5) nregistrarea genealogic, spunnd,Aceasta este
cartea generaiei lui Adam i relateaz povestea creaiei.
Cuvntul ebraic pentru generaii (Toledoth) nseamn mai
mult dect generaii - vorbete despre istoria lui; textul
care urmeaz d impresia unui rezumat dup un text
anterior mai lung.
Cu acelai termen, Toledoth, ncepe povestea lui Noe i a
Potopului. Din nou traduse Acestea sunt generaiile lui Noe,
cuvintele ncep ntradevr povestea nu att a lui Noe, ct a

Potopului - o poveste bazat, tar dubii, pe textele sumeriene

timpurii, (i apoi akkadiene).
O lumin interesant i uimitoare asupra a ceea ce Cartea
lui Noe ar putea conine urmeaz s fie descoperit n Cartea
Jubileelor, ^ta dintre crile apocrife (extrabiblice) din
perioada celui deal doilea Templu (sau mai devreme). Ea
spune c ngerii iau explicat lui Noe toate despre medicin,
boli i despre cum s le vindece cu ierburi de pe pmnt; i
Noe a notat toate lucrurile ntr-o carte, referitor la fiecare fel
de medicament. Dup Potop, Noe a dat tot ceea ce notase
fiului su, Sem.
Un nou capitol, nu doar al Bibliei, ci i n chestiuni umane
care ncepe de asemenea cu cuvntul Toledoth este gsit n
capitolul 10 al Genezei. Avnd legtur cu vremurile
postdiluviu, el ncepe, Acum, acestea sunt,generaiile' fiilor
lui Noe: Sem, Ham i Iafet; i din ei s-au nscut fii dup
Potop. Lista general, numit de cercettorii biblici Tabla
Naiunilor, revine la Sem i descendenii si i acord o
atenie special liniei fiului mijlociu, Arpackhshad,
deopotriv n acest capitol i prin ntoarcerea la subiect n
capitolul 11 cu nceputul Acestea sunt,generaiile' lui Sem.
Semnificaia, vom constata curnd, este c era linia direct
veche a familiei lui Avraam.
Existena unei cri pe care am puteao numi arbitrar cu
titlul Cartea lui Sem, sau mai specific, Cartea lui
Arpackhshad, este sugerat de o alt tradiie cu privire la
scrierile de dinainte de Potop. Referirea este gsit n Cartea
Jubileelon ne spune c Arpackhshad, un nepot al lui Noe, a
fost nvat de ctre tatl su, Sem, s scrie i s citeasc;
cutnd un loc unde s se stabileasc, el a gsit o scriere pe
care primele generaii au cioplito pe o piatr, el a citito i a
transcriso. Printre alte informaii ea include nvturi de la
Nefilim despre cum s observe semnele de la soare, lun i

stele i semnele cerului. Aceast descriere a coninutului

scrierilor lui Nefilim - i deci de dinainte de Potop asemntoare formulrii din Cartea lui Enoh despre
cunotinele despre Soare, Lun i stele/planete pe care le-a
nvat din tbliele cereti i tot ce fusese scris deasupra.
Tot ceea ce fusese transmis de ctre Enoh fiului su
Matusalem, spunndu-i lui:
Toate aceste lucruri pe care i le povestesc fie
i leam notat pentru tine;
iam dezvluit ie totul
i i dau ie crile cu privire la toate.
Aadar pstreaz, fiul meu, Matusalem, Crile din minile
tatlui tu i transmitele generaiilor lumii.
O referin precis la scrierile prediluviene i la ce s-a
ntmplat cu ele, precum i distrugerea prin avalana de ape
este gsit n scrierile lui Berossus. Preot i istoric babilonian
care a compilat o istorie a Omenirii pentru conductorii greci
din Orientul Apropiat dup moartea lui Alexandru, el a avut
cu certitudine acces la o bibliotec cu scrieri antice n
akkadian (i, posibil, de asemenea, n sumerian: n primul
volum al scrierilor sale, descriind evenimente de la aterizarea
lui Ea la Potop, el la numit pe eroul Marii Inundaii cu
numele su sumerian, Ziusudra). n fragmentele din scrierile
lui Berossus, care sunt disponibile de la istoricii greci, se
spune c, dup ce Ea/Enki a dezvluit lui Sisithros
(=Ziusudra) c urma s vin un Potop, el i-a poruncit s
ascund fiecare scriere disponibil n Sippar, oraul lui
Shamash. Sisithros a ndeplinit toate aceste lucruri,
navignd imediat ctre Armenia, i apoi tot ce a anunat zeul
s-a ntmplat. Acele scrieri erau despre nceput, mijloc i
Berossus a continuat s relateze c, printre cei care erau
pe arc i au supravieuit Potopului, se afla Sambethe, soia

unuia dintre fiii lui Ziusudra/Noe - numele su provenind

din sumerianul sau akkadianul Sabitu (Al aptelea).
Potrivit lui Berossus ea a fost prima dintre sibile i ea a
profeit construirea Turnului din Babilon i tot ce s-a
ntmplat proiectanilor acestei construcii; aceasta a fost
naintea separrii limbilor.
Acestei prime femei din linia prezictoarelor (dintre care
cea mai renumit a fost Sybil din Delfi) i-a fost atribuit un rol
de intermediar ntre zei i supravieuitorii Potopului. Ea a
rostit ctre ei cuvinte care erau ca o voce din aer, care le-a
spus cum s supravieuiasc dup Potop i cum s rectige
din Sippar crile care descriau viitorul Omenirii.
Prezena tradiiilor i amintirile cu privire la scrierile de
dinainte de Potop persist n mod clar n susinerea faptului
c, dincolo de toate tipurile de cunotine, ele conin de
asemenea profeii referitoare la viitor. De cele mai multe ori,
astfel de profeii se refer nu doar la evenimente inevitabile ce
se pot ntmpla indivizilor i naiunilor, ci i la destinul final
al omenirii i al Pmntului.
Lui Enoh i s-a artat ce a fost i ce urma s fie i el a
notat pentru generaiile viitoare secretele creaiei i ciclurile
de evenimente de pe Pmnt. Domnul a pus o hart pe
Pmnt hotrnd destinul planetei i al tuturor de pe ea.
Scrierile de dinainte de Potop erau despre nceput, mijloc i
ntradevr, dup cum relateaz credinele ce conin toate
aceste afirmaii, se poate nelege de ce editorii Genezei n
versiunea sa ebraic au omis litera Aleph i au fcut ca
nceputul s porneasc cu un B" (Beth). Deoarece chiar
noiunea de nceput coninea n ea noiunea unui sfrit.
Chiar avertismentul c scrierile antice, coninnd tot ce
urma s fie cunoscut - acele antice informaii arhivate de
folosire a limbajului computerului - trebuie pstrate pn la

sfritul vremii, sfritul zilelor nseamn c un astfel de

sfrit a fost predestinat. Pornind cu nceputul, editorii
Bibliei subscriu la acea credin.
Aceste concepte au ptruns n Biblie chiar de la nceput, n
Genez trecnd prin crile Profeilor i pn la finalul
crilor (ale Bibliei ebraice). i Iacov i-a chemat pe fiii si i
le-a spus: Venii, strngeiv i v voi spune ce vi se va
ntmpla la sfritul zilelor (Geneza 49:1). Temnduse c
israeliii ar putea abandona poruncile dup moartea sa,
Moise i-a alarmat cu privire la rul care li se va ntmpla n
ultimele zile (Deuteronom 31:29). mpreun cu acest
avertisment era i o predicie - o profeie - a Soartei i a
viitorului fiecruia dintre triburile lui Israel. Viziunile
profetice ale lui Isaia se deschid cu afirmaia i va fi la
sfritul zilelor (2:2); i profetul Ieremia a explicat n mod
clar c ceea ce va fi la sfritul zilelor a fost plnuit n
inima lui Yahve chiar de la nceput (23:20). El spune
Sfritul nc de la nceputul, la ludat Isaia pe Domnul
Dumnezeu (46:10).
Domnul a fost cel mai de seam profet i sursa profeiilor.
Acea opinie biblic i gsete expresia chiar acolo unde
textul pare doar s relateze evenimente. Pedeapsa dat lui
Adam i Evei dup ce ei au mncat din fructul interzis n
Grdina Edenului prevede viitorul fiinelor umane. Lui Cain i
s-a dat un semn protector pentru c altfel el i descendenii
si puteau fi rzbunai pentru 77 de generaii. ntr-un
legmnt fcut de Dumnezeu cu Noe i fiii si, El a promis c
nu va mai fi niciodat un Potop. ntr-un legmnt cu Avraam,
Dumnezeu a prezis viitorul su ca tat al unei multitudini de
naiuni; dar a prezis c ar putea veni o vreme cnd urmaii
si ar putea fi nrobii pe un pmnt strin - o experien
amar care ar putea dura 400 de ani (cum s-a ntmplat cu
pribegia evreilor n Egipt). i cu referire la sterila Sara,

Dumnezeu a prezis c ea ar putea avea un fiu i din ea ar

putea proveni naiuni i regi.
Cuprinznd povestea umanitii de la Adam i Eva,
trecnd prin distrugerea Primului Templu din Ierusalim i
reconstruirea sa prin ntoarcerea din exil n secolul 6 .Chr.,
Vechiul Testament arat, de asemenea, indirect i aproape
imperceptibil, schimbarea profeiei de la comunicarea direct
de la Dumnezeu prin unul din ngeri (textual: emisari) i apoi
prin Profei. Dei Moise a fost numit un Profet al lui
Dumnezeu, extinderea fenomenului este artat prin
relatarea din povestea biblic a lui Bile'am sau Balaam. El a
fost un clarvztor din vremea Exodului i a fost oprit de
regele moabit s blesteme avansul israeliilor; dar de fiecare
dat cnd era pregtit un loc pentru blestem i ritualuri,
Yahve i aprea poporului su ales, israel, i l avertiza s nu
cad prad blestemului. Dup cteva ncercri, el a fost
convins de ctre regele moabit s mai ncerce o dat; dar
atunci, ntr-o viziune divin, el a putut auzi spusele lui
Dumnezeu i distinge cunoaterea Celui Prea nalt.,J3ei nu
este aproape, l pot vedea, a spus Bala'am despre Steaua lui
Iacov; dei nu este acum, merge mai departe. i aceasta
spune mesajul divin, a spus el: fiii lui israel se vor apra i
vor cuceri naiunile aflate n calea lor. n mod incredibil,
listele acelor naiuni sortite a inclus Asiria - o naiune care
nu exista n Canaan la vremea Exodului i ai crei regi au
asaltat abia Peste mai multe secole regatele israelite care nu
se formaser nc.
Un caz de profeie bazat pe profeiile trecutului a fost
viitoarea mare btlie ntre Gog i Magog care a fost revelat
Profetului Ezechiel (capitolul 38 i 39) - o btlie care n
literatura apocaliptic a vremii ia asumat rolul confruntrii
finale din ultimul mileniu, Armaghedonul din Noul
Testament. Dei n ultimele scrieri Gog i Magog erau

considerai ca dou persoane sau naiuni diferite, Ezechiel

vorbete despre Gog ca fiind un conductor al teritoriului lui
Magog i prezice c finalul dominaiei sale va veni atunci
cnd el va ataca pmntul Ierusalimului, centrul
Pmntului. Prezicnd c va avea loc la timpul i va fi
totodat un semn al Sfritul Zilelor, Yahve a spus prin
Ezechiel: Dei vei veni numai la sfritul zilelor, Gog-Tu eti
Cruia iam vorbit n zilele vechi
Prin Profeii lui Israel
Care au profeit n acele zile.
n acele vremuri finale, Yahve a anunat prin Ezechiel, vor
fi un mare cutremur, mari distrugeri, boli i vrsri de snge,
puhoaie de ap, foc i pucioas din ceruri.
Un alt Profet care amintete prevestirile vechi - Primii
Profei - a fost Zaharia (1:4, 7:7,7:12) care a vzut, de
asemenea, viitorul n termenii trecutului, aazisele Primele
Zile. Aceasta a fost conform tuturor profeiilor biblice: n
prezicerea viitorului, Profeii au precizat c Sfritul a fost
ancorat n nceput. Vznd naiunile lumii strnse laolalt s
afle ce le ateapt, profetul Isaia i le-a imaginat ntrebnduse una pe alta Cine dintre noi poate spune viitorul auzind
Primele Lucruri?. Ridiculiznd naiunile care voiau s tie
despre trecut i viitor nu prin Dumnezeu, ci una de la alta,
Isaia a spus c numai Yahve, Domnul Savaot, are acea
cunotin (Isaia, capitolul 43)-Aceasta este relatat mai pe
larg n Isaia capitolul 48, unde Yahve spunea:
Eu sunt cel care a spus primele lucruri, Din gura mea au
fost ele rostite. i le voi spune ndat;
i cercetarea trecutului ascuns pentru a ghici viitorul
divin, a aprut nu doar n crile Profeilor, ci i n crile
biblice ale Psalmilor, Proverbelor i Iov. Deschide urechile,
popor al meu, la nvturile mele, deschide urechile tale la

cuvintele din gura mea; Voi vorbi cu parabole i voi rosti

ghicitori din vremurile vechi, spune psalmistul (78:2-3)
despre amintirile motenite din generaie n generaie.
Susinnd c el a fost calificat s spun acele ghicitori, a
explicat: Pentru c eu am calculat zilele din vechime i ani
din vremurile antice (77:6).
Aceast abordare: Hai s vedem ce s-a ntmplat n trecut
ca s putem ti ce urmeaz s vin s-a bazat pe experiena
omenirii pe parcursul unor milenii de amintiri ale umanitii
- mituri pentru cei mai muli, amintiri ale evenimentelor
reale pentru noi. Pentru orice cunosctor al povetilor antice
- nu doar de acum, ci i din vremurile biblice - este evident
faptul c orice cotitur i transformare a Omenirii a depins
de planurile i capriciile creatorilor si, Elohim.
La nceput, noi cei de astzi i oamenii (i cu siguran
Profeii) de acum cteva milenii am fost informai c am luat
fiin ca rezultat al discuiei din consiliul zeilor, reunit s
rezolve revolta din minele de aur. Crearea noastr genetic a
fost decis de doi Anunnaki - Enki i Ninmah - care au lucrat
deopotriv cu seriozitate i superficialitate. Consiliul Marilor
Zei a fost locul unde s-a votat s se pun capt unui
experiment al creaiei i s se lase Omenirea s dispar la
Potop. i tot n ntlnirea din consiliu, zeii Anunnaki au decis
ca dup Potop s dea Omenirii Regalitatea n cele trei
regiuni - civilizaia mesopotamian, cea din Valea Nilului i
cea din Valea Indusului.
Curios cu privire la nscrisurile nceputurilor, la istoria
uman de la Creaie pe parcursul Potopului i ridicarea
naiunilor, poporul din ultimul mileniu .Chr. - vremea
Profeilor biblici - se ntreba de asemenea cu privire la Vechile
Zile, evenimentele din mileniul sau cele dou milenii
anterioare - vremea cnd Biblia s-a ntors ctre oraul Ur al
caldeenilor din Sumer, Avraam, Rzboiul Regilor i

prbuirea Sodomei i Gomorei. Spune-ne despre acele Vechi

Zile astfel ca noi s putem ti la ce s ne ateptm, au cerut
oamenii celor ce deineau cunotine i puterea de a face
Biblia menioneaz cteva astfel de nregistrri - cri care ar fi putut avea rspunsuri, dar care au disprut
complet. Una este Cartea lui Jashar, Cartea Justeii, dac se
traduce textual, dar probabil nelesul este cel de Lucruri
Drepte. Cealalt, i probabil cea mai important, a fost
Cartea Rzboaielor lui Yahwe, care, dup titlul enigmatic, se
refer la conflictele i rzboaiele din neamul Elohim.
Astfel de conflicte mici care se transformau uneori n
rzboi deschis au fost nregistrate n scrierile sumeriene; i
astfel de scrieri din trecut erau cu adevrat Cuvinte Divine,
pentru c textele erau deopotriv notate de ctre Scribii
Divini sau dictate de ctre zei scribilor umani. Au fost
nregistrate n original de ctre nii zeii, evenimentele de pe
Nibiru ce implicau confiscarea tronului de acolo de ctre Anu
i continuarea btliei de succesiune pe alt planet, pe
Pmnt; povestea lui Zu; disputa dintre Horus i Seth (care a
condus la prima menionare a Omenirii ntr-un rzboi ntre
zei). n acea categorie, a scrierilor ce aparineau zeilor nii,
intr un Text Profetic care ne-a ajuns n versiunea
akkadian i nu este altceva dect o autobiografie a lui
Marduk. n cealalt categorie, cea a crilor dictate direct de
ctre zei, a fost un text cunoscut ca Erra Epos, o nregistrare
a evenimentelor aa cum au fost spuse de ctre Nergal.
Amndou acele texte reprezentau ncercri ale zeilor de a
explica Omenirii cum cele dou milenii de civilizaie - Vechile
Zile - se ndreptau brusc ctre un sfrit.
Este mai mult dect o ironie faptul c evenimentele care
declanaser sfritul marii civilizaii sumeriene au coincis
cu epoca sa cea mai glorioas. O carte veche - un text

sumerian - a lsat nsemnri cu privire la Consiliul Marilor

Zei, n cadrul cruia s-a decis acordarea Regalitii
(civilizaiei) Omenirii:
Marii Anunnaki care decid Soartele
Stau i dezbat cu privire la pmnt.
Cei care au creat cele patru regiuni,
Cei care au stabilit aezmintele,
Cei care controleaz pmntul.
Erau prea semei pentru Omenire.
i astfel ei au decis c trebuia creat instituia Regalitii,
deopotriv ca un tampon i ca o legtur ntre Cei Semei i
masa umanitii. Imediat dup aceea, Pmntenilor li s-a
permis s triasc lng zonele sacre din oraele zeilor; dup
aceea, ei au nceput s-i creeze propriile orae, conduse de
ctre LU. GAL, Oameni Mari -regi - care erau considerai
lociitori ai conductorilor divini.
Cnd Anunnaki s-au ntors n Edin, cmpia aflat ntre
Tigru i Eufrat dup ce aceasta se uscase suficient de bine
dup Potop, ei au restabilit Oraele Zeilor dup planul exact
de dinainte de Potop. Primul care a fost reconstruit a fost
Eridu, oraul lui Enki; i atunci, credem noi, a fost
momentul n care s-a decis s se dea Omenirii civilizaia;
dovezile arheologice arat c era cca. anul 3800 .Chr.
Dar, n conformitate cu decizia zeilor, Domnia Oamenilor
trebuia s nceap n Oraul Oamenilor, i acesta a fost un
nou aezmnt numit Kish. Data a fost marcat prin
primirea calendarului de ctre Omenire, un calendar creat n
centrul de cult al lui Enlil, Nippur. Acesta a nceput s
funcioneze ncepnd cu anul 3760 .Chr.
Lista Regelui Sumerian a nregistrat transferul repetat al
oraului care era capitala pmntului de la un Ora al
Oamenilor ctre altul din Sumer. Astfel de schimbri erau
legate de noroc i de schimbarea echilibrului de putere ntre

zeii nii sau chiar de rivalitile dintre ei - deopotriv n

Prima Regiune (Mesopotamia i teritoriile vecine), a Doua
Regiune (Valea Nilului) i a Treia Regiune (Valea Indusului)
(civilizaii care s-au succedat ntre 3100 .Chr. i 2900 .Chr.).
Ieea la suprafa din cnd n cnd conflictul violent dintre
Marduk i Ninurta - motenitorii direci ai lui Enki i
respectiv Enlil, care au preluat rivalitatea de odinioar a

prinilor lor.
ntradevr, nu a fost Pace pe Pmnt de cnd Marduk provocnd moartea lui Dumuzi - a primit sentina de a fi
ngropat de viu n interiorul Marii Piramide i apoi aceasta a
fost comutat n pedeapsa cu exilul. A fost aceeai pedeaps exilul pe un pmnt ndeprtat - pe care Marduk a impus-o
fratelui su vitreg Ningishzidda/Thoth, care fusese alungat
peste oceane pentru a deveni zeul arpe cu Pene
(Quetzalcoatl) n America Central.
A existat o perioad de relativ stabilitate ce a nceput cu
mileniul III .Chr. cnd civilizaia sumerian s-a extins pe
teritoriile vecine i a nflorit sub marii regi, cum a fost
Ghilgame. Pe parcursul ctorva secole, expansiunea n nord

a inclus triburile semitice; n cca. anul 2400 .Chr., s-a

format cel mai mare dominion sub regele drept (Sharru - kin)
- Sargon I - cu o capital n noul ora Agade. Era cunoscut
atunci ca regatul unit al Sumerului i Akkadului.
Numeroase texte - fragmentate n mare parte - au
nregistrat cursul evenimentelor - aventurile zeilor i ale
oamenilor - n secolele care au urmat. Centrul imperiului a
continuat s se schimbe. n final, n anul 2113 .Chr., a
nceput capitolul cel mai glorios din istoria Sumerului i
Akkadului. Istoricii se refer la aceast er ca perioada Ur III,
deoarece era a treia oar cnd Ur devenise capitala
imperiului. Era centrul de cult a lui Nannar/Sin, care
locuia n zona sa sacr (Fig. 65) cu soia sa, Ningal. Domnia
lor a fost una binevoitoare i luminat. Regele care a fost
desemnat s nceap noua dinastie, Ur-Nammu (Bucuria lui
Ur) a fost nelept, drept i stpnul comerului internaional
prin care Sumerul schimba grne i produse din ln pentru
metale i cherestea; hainele lor colorate erau apreciate,
potrivit Bibliei, chiar i n ndeprtatul Ierihon. Comercianii
din Ur erau recunoscui internaional i respectai; prin ei,
civilizaia sumerian, cu toate aspectele sale, s-a rspndit
pn departe. n cutare de mai mult ln, sumerienii au
exploatat cmpiile de punat spre regiunile din nord unde
au stabilit un avanpost comercial important la grania ctre
Asia Mic, pmnturile hitiilor. Acesta a fost numit Harran Caravana.
Urmnd s fie folosit ca un Ur n miniatur, un Ur-departede-Ur, Harran a concurat Ur n ceea ce privete aspectul i
templele sale.
n tot acest timp, din exilul su, Marduk urmrea aceste
evoluii cu un sentiment de frustrare i furie. n autobiografia
sa (o copie a acesteia a fost descoperit n biblioteca lui
Asurbanipal), Marduk i amintete cum, dup ce a pribegit

pe multe pmnturi de unde rsare soarele pn unde

apune, el a sosit pe Pmntul Hatti (al hitiilor). 24 de ani
n mijlocul lui m-am aezat, a scris el. i n toi aceti ani el
a continuat s ntrebe consiliul zeilor: Pn cnd?
n lipsa unui rspuns clar i satisfctor, Marduk privea
ctre ceruri. Soarta, am spus deja, are 12 staii; Soarta staie (casa zodiacal) a lui Marduk era constelaia
Berbecului (Aries); i deoarece precesiunea continua s
mping prima zi de primvar tot mai departe de constelaia
Taurului (Taurus) - casa zodiacal a lui Enlil - ea s-a apropiat
de intrarea Soartei - Staiei Berbecului lui Marduk. Sigur
ca a venit timpul ca Destinul su s se mplineasc, Marduk
se vedea pe sine nsui ntorcndu-se n Babilon cu mare
alai, numind un rege merituos, supraveghind naiunile n
pace i prosperitate - o viziune profetic ce urma s se
petreac n Zilele din Urm, cnd Babilonul urma s se ridice
la nivelul numelui su: Babili, Poarta Zeilor.Celelalte texte
din acea vreme, pe care cercettorii le consider ca parte din
colecia Profeiilor Akkadiene, nregistreaz relatri ale
astronomilor care cutau pe cer semne planetare conectate
cu constelaia Berbecului. Semnele, oricum, erau n mare
parte despre rzboi, sclavie, jafuri, distrugere; acele profeii,
mai degrab dect cele favorabile lui Marduk, care urmau s
se petreac. Ceilali zei, condui de ctre Ninurta i propriul
frate al lui Marduk, Nergal, folosind instrumente tiinifice
din Zilele Vechi, artefacte ale Cerului i Pmntului,
pretindeau c trecerea la Era Berbecului nu trebuia s se
ntmple nc. Nerbdtor, Marduk l-a trimis pe fiul su,
Nabu, s ridice o armat a oamenilor dintre supuii lor n
Pmnturile din Vest - teritoriile de la vestul fluviului Eufrat.
n anul 2024 .Chr., Nabu a lansat cu succes o invazie n
Mesopotamia i a deschis porile Babilonului pentru tatl
su, Marduk.

Erra Epos relateaz acele evenimente memorabile din

punctul de vedere al lui Nergal (numit Erra, Distrugtorul) i
al lui Ninurta (numit Ishum, Asprul). Sunt povestite detaliat
negocierile frenetice n vederea rezolvrii panice a disputei,
solicitarea ctre Marduk s aib rbdare; discuii nesfrite
la Consiliul lui Anunnaki care la sfrit s-a ntrunit ntr-o
edin continu; ngrijorare cu privire la adevratele intenii
ale lui Nabu i a armatei sale de oameni; i la final,
suspiciunile c n vreme ce Marduk vorbea de Babilon ca
Poart a Zeilor, fiul su - cu discipolii n zonele de grani ale
aeroportului spaial din Sinai - dorea de fapt s cucereasc
portul spaial i astfel s controleze legtura cu planetamam, Nibiru.
Vznd c nu exist cale de a-i opri pe Marduk i pe Nabu,
Consiliul Marilor Zei i-a autorizat pe Nergal i Ninurta s
deschid cele apte Arme Teribile, care fuseser ascunse cu
lact i sigiliu n Abzu (locuina lui Enki n sud-estul Africii).
A fost declanat un holocaust nuclear; acesta a distrus portul
spaial, lsnd o tietur uria pe suprafaa peninsulei i o
vast zon nnegrit n jurul ei. Oraele pctoase care au
fost de partea lui Nabu, situate n ceea ce era atunci valea
fertil din sudul Mrii Moarte, au fost de asemenea distruse o prbuire pe care Avraam a putut-o vedea din locuina sa
din sudul Canaanului.
Dar dup cum a decis Soarta, norul morii nuclear
purtat de vntul mediteranean a plutit n deriv spre est,
ctre Mesopotamia; n drumul su, tot ce era n via oameni, animale, plante - au avut o moarte groaznic. Cnd
norul mortal s-a apropiat de Sumer, zeii Anunnaki i-au
abandonat oraele. Dar Nannar/Sin nu a putut accepta
prbuirea oraului su splendid, Ur. Apelul su ctre Anu i
Enlil s gseasc o cale s salveze oraul Ur nu a fost de
niciun folos; i n vreme ce el sttea neajutorat, Enlil i-a spus

direct, Ur a primit domnia - nu a fost dat o domnie

venic... Domnia sa, regalitatea sa a ncetat - nu a fost
venic NAM.TAR a sa, un Destin ce poate fi ntrerupt i
nfrnt, Soarta.
Dar dup cum i-a fost soarta, vnturile, dup ce au ajuns
n Mesopotamia, i-au schimbat cursul ctre sud-est. i n
vreme ce Sumerul i marile sale orae vechi zceau distruse
i pustiite, oraul Babilon la nord a fost cruat complet.
Pn atunci Marduk privise ctre ceruri la soarta sa
divin. Cruarea miraculoas a Babilonului de la moarte
nuclear i pustiire l-a fcut s se ntrebe dac nu cumva
drumul su liber ctre supremaie era mai mult dect Soarta
- dac nu era cumva Destinul su.
Marduk nu era o zeitate, unii ar putea spune c ceea ce a
urmat a fost zeificarea sa. n aceste condiii, s-i spunem
celestializarea sa. Calea pentru aceasta a fost o alterare
(termenul falsificare poate fi folosit) a textului sfnt Enuma
elish: s numeasc planeta Nibiru Marduk i apoi s fac
unul i acelai zeul suprem planetar cu zeul suprem de pe
Pmnt. Dup ce Marduk a fost suprapus peste Nibiru n
povestea Btliei Cereti, cuvintele cruciale i-au fost aplicate
lui: obinnd Tblia Destinelor de la Kingu, eful otirii
Tblia Destinelor a luat-o pentru el,
A sigilat-o cu un sigiliu,
Pe propriul (su) piept a fixat-o.
Avea acum un Destin. i zeii, n Adunarea lor, acordau
atenie la aceast rostire. Ei s-au plecat i au strigat:
Marduk este rege!. Acceptnd inevitabilul, Anu i Enlil (n
cuvintele dintr-o inscripie a regelui babilonian Hammurabi),
Hotrte de Marduk, primul nscut al lui Enki,
Sarcinile lui Enlil peste toat omenirea,
L-a fcut pe el mare printre zeii care privesc i vd,

Numit Babilon ce urmeaz s fie nlat,

l-a fcut suprem n lume;
i a stabilit pentru Marduk, n mijlocul su,
Domnia venic.
ncoronarea - pentru a folosi un termen inteligibil - a lui
Marduk ca rege al zeilor a avut loc printr-o ceremonie
solemn, ntr-o adunare a celor 50 de Mari Zei i cei 7 Zei ai
Destinului i n prezena a sute de ranguri i iruri de
Anunnaki. n mod simbolic, Enlil a ntins naintea lui
Marduk arma sa divin, Arcul (care n ceruri avea ca omolog
steaua - Arc). Apoi transferul puterilor lui Enlil ctre Marduk
a fost celebrat mai mult prin transferul ctre Marduk a
rangului numeric secret al lui 50. Aceasta s-a fcut prin
recitarea, unul cte unul, a celor 50 de nume. Ei au
nceput cu numele adevrat al lui Marduk, susinnd c
nsui Anu era cel care l-a numit aa pe Marduk atunci cnd
s-a nscut, continund cu restul numelor-epitet, i sfrind
cu Nibiru - transformarea zeului de pe Pmnt ntr-un zeu
suprem planetar.
Cele 50 de nume erau formate din cuvinte sumeriene sau
combinaii de silabe - epitetele oricui posed cele 50 de nume
naintea Poemului Creaiei au fost modificate pentru a le
adapta la Marduk: i dei creatorii babilonieni ai textului
(scris n limba akkadian) au ncercat s explice
contemporanilor lor silabele sumeriene enigmatice, era clar
c nici ei nu au putut nelege pe deplin mesajul secret pe
care l transmitea fiecare nume. Substratul nelesurilor
secrete sau codate ale celor 50 de nume a fost recunoscut de
ctre renumitul asirolog i cercettor biblic E. A. Speiser;
interpretnd Enuma elish n englez pentru Ancient Near
Eastern Texts Relating to the Old Testament, el a observat c
textul stabilete etimologia numelor ntr-o manier familiar
Bibliei; etimologiile care nsoesc efectiv fiecare nume de pe

lista lung par s aib un sens mai degrab simbolic i

cabalistic dect unul strict lingvistic.
Dar exist o natur cabalistic mai profund n cele 50
de Nume dect ne arat observaia de mai sus. Primele nou
nume sunt trecute la finalul celei de-a asea tblie a lui
Enuma elish i sunt nsoite de mai multe versete acolad.
Aa cum a notat Franz M. Th. Boln n cartea sa Die fnfzig
Namen des Marduk, rostirea acelor prime nou nume a fost
atribuit primilor prini nu doar ai lui Marduk, ci i ai lui
Anu nsui; trei dintre ele conin fiecare un triplu neles; i
ntr-un astfel de neles n cadrul altui neles, singura
capacitate (altfel nerelatat) de a renvia zeii mori a fost
atribuit lui Marduk. Aceea, a sugerat Franz Bohl, ar putea fi
o referire la moartea i nvierea lui Osiris (a tiinei egiptene),
pentru c urmtoarele trei nume (numerele 10, 11, 12) sunt
variante ale numelui-epitet ASAR (Asaru n akkadian) i,
potrivit lui Bohl, sunt trei epitete care imit cele trei epitete
ale zeului egiptean.
Cu acele trei nume-epitet, Enuma elish trece la tblia a
aptea - nu fr implicaii legate de cele apte zile ale Creaiei
din Genez (dintre care primele ase erau destinate aciunii,
iar a aptea zi era pentru odihn i divin contemplare); i
apte era, ne vom aminti, numrul planetar desemnat pentru
Pmnt i al lui Enlil, n calitate de comandant al
Cele trei epitete ASAR, dup care numele - epitet devin
variate i diverse, aduc totalul numelor la 12. Ele sunt
explicate n plus n patru versete dnd patru nelesuri celor
trei nume ASAR, sugernd din nou o ncercare de a include
cifra 12 n text. Recitarea celor 50 de nume include aadar,
rangul numeric divin al lui Enlil i numrul su planetar,
numrul membrilor din sistemul solar i al constelaiilor.
Toate instruciunile mele sunt incluse n cele 50 de

nume, a afirmat Enki la finalul ceremoniei. n acele nume,

toate riturile au fost combinate. Cu propria sa mn el a
notat asta, a pstrat pentru viitor i a cerut ca scrierea s fie
depus n templul Esagil pe care zeii l vor construi pentru
Marduk n Babilon. Acolo cunotinele secrete vor fi pstrate
n siguran de ctre generaiile preoilor iniiai, trecute din
tat n fiu: S fie pstrate (acolo), s le explice btrnii; tatl
nelept i cunosctor s mprteasc fiului.
Ce sensuri profunde, ce cunotine secrete poart cele 50
de nume care, potrivit lui Enki, combin n ele tot ceea ce
urmeaz s tim?
Probabil c ntr-o zi vom ti, atunci cnd o nou
descoperire ne va da capacitatea de a decoda criptrile
numerice ale regilor asirieni i babilonieni.
Cu 24 de ani naintea catastrofei nucleare, dou trasee sau intersectat, i nu ntmpltor. Unul era al unui zeu care
era sigur c Soarta sa devenise un Destin; cellalt era al unui
brbat al crui Destin devenise Soarta sa. Zeul era Marduk;
brbatul era Avraam; locul n care cile lor s-au intersectat
era Harran.
Consecina acestui fapt urma s dureze pn n vremile
noastre, cnd Babilonul (acum Irak) a trimis rachete mortale
pe pmntul Ierusalimului (acum Israel).
Faptul c Avraam a cltorit n Harran este cunoscut din
Biblie. Faptul c Marduk a cutreierat pe teritorii ndeprtate
i c s-a oprit pe pmnturile hitiilor l tim din
autobiografia sa. Faptul c locul special n care i-a petrecut
24 de ani era Harran l-am presupus din chiar nceputul
autobiografiei lui Marduk: El i-a nceput ntrebarea Pn

cnd? prin adresarea ctre ilu Haranim, zeii lui Harran

(Fig- 66) ca zeii prezeni atunci i abia apoi ctre ndeprtaii
Mari Zei Care Judec.
ntradevr, s se afle n Harran era o alegere logic pentru
c era un centru urban i religios important - aezat la
intersecia rutelor comerciale - i un punct central de
comunicare, la grania Sumerului i Akkadului, dar nu chiar
n interiorul Sumerului. Harran era un centru perfect pentru
zeu, al crui fiu pregtea o invazie armat.
O cltorie de 24 de ani de dinaintea invaziei i a
catastrofei nucleare care a avut loc n 2024 .Chr., aceasta
nseamn c Marduk sosit la Harran n anul 2048 .Chr.
Aceasta dup calculele noastre bazate pe o atent
sincronizare a datelor biblice, mesopotamiene i egiptene) era
chiar pe urmele lui Abram/Avraam. El s-a nscut, dup
calculele noastre, n 2123 .Chr. Fiecare mutare a lui Terah i
a familiei sale, am artat n Rzboaiele zeilor cu oamenii, era
legat de desfurarea rapid a evenimentelor din Ur i
imperiul sumerian. Biblia ne informeaz c Abram/Avraam a
prsit Harran, la instruciunile lui Dumnezeu, la vrsta de
75 de ani. Era atunci anul 2048 .Chr. - chiar anul n care
Marduk sosise n Harran! i era atunci cnd Yahve - nu doar
Stpnul Dumnezeu - i-a spus lui Abram: Mergi afar din
ara ta, afar din locul tu de natere i n locuina tatlui
tu, spre locul pe care i-l voi arta. Era o tripl plecare din ara lui Abram (Sumer), din locul n care se nscuse
(Nippur) i din locul n care locuia tatl su (Harran); spre o
destinaie nou i necunoscut pe care Yahve urma s i-o
Lundu-i pe soia sa, Sarai i pe nepotul su, Lot, cu el,
Abram a plecat ctre pmntul Canaanului. Sosind din
nord (traversnd probabil pe unde nepotul su Iacov ar fi
fcut-o mai trziu), el s-a ndreptat repede spre sud,

ajungnd ntr-un loc numit Alon-Moreh - un nume care

textual nseamn stejarul care arat, un indicator bine
cunoscut pe care un cltor nu-l putea trece cu vederea.
Pentru a fi sigur c se afl pe drumul cel bun, Abram a
ateptat mai multe instruciuni i Yahve i-a aprut lui
Abram acolo, confirmndu-i c se afl pe drumul corect.
Continund s mearg, Abram a ajuns la Beth-El (Lcaul
Domnului) i din nou strignd numele lui Yahve, a
continuat fr oprire spre Negev (Uscciunea), partea cea
mai sudic a Canaanului, la grania cu peninsula Sinai.
El nu a stat mult acolo. Nu se gsea de mncare acolo.
Astfel c Abram a plecat spre Egipt. Abram era descris n
mod obinuit ca un ef de trib beduin nomad, petrecndu-i
zilele ndrumnd turmele i odihnindu-se n cortul su. n
fapt, el trebuie s fi fcut mai mult dect att, altfel de ce ar
fi fost ales de ctre Yahve s fie trimis cu o misiune divin? El
descindea dintr-o linie de preoi; numele su i al soiilor
fratelui su, Sarai (prinesa) i Milcah (regina) indic o
legtur cu linia regeasc sumerian. Curnd dup ce Abram
a ajuns la grania egiptean, el a instruit-o pe soia sa cum
s se comporte dac vor fi primii la curtea faraonului (i mai
trziu, n Canaan el vorbea cu regii si ca un egal al lor).
Dup o cltorie de cinci ani n Egipt, cnd lui Abraim i s-a
poruncit s se ntoarc n Negev, el a primit de la faraon un
mare numr de femei i brbai n serviciul su, turme de oi
i cirezi de boi, mgari i asini - precum i o turm de cmile
foarte scumpe. Oferirea cmilelor este semnificativ, pentru
c ele aveau un scop militar n condiii de deert.
Faptul c se pregtea un conflict militar l aflm din
capitolul urmtor din Geneza (capitolul 4) referitor la invazia
n sudul Canaanului a unei coaliii a regilor din est - din
Sumer i protectoratele sale (cum ar fi Elamul n Munii
Zagros, care era renumit pentru rzboinicii si). Cucerind

ora dup ora, ei au urmat Drumul Regelui, au nconjurat

Marea Moart i se ndreptau direct ctre Peninsula Sinai
(vezi harta de la p. 26). Dar acolo Abram i armata sa au

Dezamgii, invadatorii s-au mulumits jefuiasc cele

cinci orae (inclusiv Sodoma i Gomora) din cmpia fertil la
sudul Mrii Moarte; printre prizonieri, ei l-au luat i pe Lot,
nepotul lui Abram.
Cnd a auzit vestea c nepotul su a fost luat captiv,
Abram i-a urmrit pe invadatori cu 318 brbai alei, tot
drumul ctre Damasc. Deoarece a trecut ceva timp pn
cnd un refugiat din Sodoma i-a spus lui Abram despre
capturarea nepotului su, i-a luat destul timp lui Abram s-i
ajung pe invadatori care ajunseser deja la Dan, n nordul
Canaanului. Sugestia noastr este c brbaii tineri
instruii aa cum i numete Geneza, era cavaleria cu cmile
(Fig. 67) din sculptura mesopotamian.
A fost dup acele evenimente, spune Biblia (Geneza 15),
cnd Yahve i-a vorbit lui Abram ntr-o viziune, spunndu-i:
Nu-i fie team Abram; Eu sunt scutul; rsplata ta va fi
Este timpul s revedem povestea lui Abram pn la acest
punct i s punem cteva ntrebri. De ce i s-a spus lui
Abram s prseasc totul i s mearg ntr-un loc complet
strin? De ce era aa de special Canaanul? De unde graba de
a prsi Negev spre grania cu peninsula Sinai? De ce
primirea regeasc n Egipt i rentoarcerea cu o armat i o
cavalerie de cmile? Care era inta invadatorilor din est? De
ce a fost lsat aprarea n minile lui Abram n schimbul
unei mari rsplate din partea lui Dumnezeu?
Departe de descrierea obinuit a lui Abram ca un pstor
nomad, el s-a transformat ntr-un lider militar i un actor
important pe scena internaional. Toate se explic, sugerm
noi, doar dac acceeptm realitatea prezenei lui Anunnaki i
lum n considerare celelalte evenimente majore care s-au
petrecut n acelai timp. Singura rsplat important ntr-un
rzboi internaional - chiar n vremea n care Nabu organiza

lupttorii pe teritoriile de la vest de Eufrat - era portul spaial

din Sinai.
A fost locul unde Abram - aliat cu hitiii i instruit de ctre
ei n arta rzboiului - a fost trimis n grab pentru a-l proteja.
n acelai scop i-a dat faraonul din Memphis - el nsui
confruntndu-se cu invazia adepilor lui Ra/Marduk aezai
n Teba n sud - cavaleria de cmile i un numr mare de
oameni care s-l serveasc. De aceea Abram a aprat cu
succes poarta ctre portul spaial, primind asigurri din
partea lui Yahve c va primi o mare rsplat - precum i
promisiunea c va fi aprat de o viitoare rzbunare a celui
Rzboiul Regilor a avut loc, dup calculele noastre, n 2041
.Chr. La un an dup aceasta, prinii din sud au cucerit
Memphisul din Egipt i l-au detronat pe aliatul lui Abram,
declarnd supunere lui Amon/Ra, cel ascuns sau
nevzut, Ra/Amon, care era atunci n exil. (Dup ctigarea
supremaiei de ctre Marduk, noii conductori ai Egiptului
au nceput construirea n Karnak, o suburbie a capitalei
Teba, a celui mai mare templu n onoarea lui Amon-Ra; ei au
construit drumul maiestuos care ducea la templu cu sfinci
cu cap de berbec - Fig. 68 - onorndul pe zeul a crui er
sosise, Era berbecului).

Lucrurile nu erau mai puin agitate n Sumer i n

imperiul su. Semne cereti, inclusiv o eclips total de lun

n 2031 .Chr., preziceau venirea sfritului. Sub presiunea
rzboinicilor lui Nabu, ultimii regi ai Sumerului i-au retras
forele i avanposturile de protecie mai aproape de capitala
Ur. Nu mai exista confort nici n apelurile la zei, pentru c ei
nii erau antrenai ntr-o acut confruntare cu Marduk. Zei
i oameni priveau ctre cer n ateptarea semnelor. Un om,
chiar pregtit sau ales ca Abram, nu mai putea proteja portul
spaial al lui Anunnaki. i astfel, n 2024 .Chr., cu
ncuviinarea Consiliului Marilor Zei, Nergal i Ninurta au
folosit armele nucleare pentru a rpi trofeul de la Marduk.
Totul este descris n detaliu i foarte viu n Erra Epos; este
relatat ca un spectacol prbuirea oraelor pctoase care
includ i Sodoma i Gomora.
Avraam a fost prevenit cu privire la ce urma s se
ntmple; la cererea sa, doi ngeri ai Domnului au venit la
Sodoma n ziua de dinaintea distrugerii cu arma nuclear a
portului spaial i a oraelor, pentru a-l salva pe Lot i familia
sa. Cernd timp pentru a-i strnge familia, Lot a ncercat s
conving cele dou fiine divine s amne distrugerea pn
cnd el i familia sa puteau ajunge n siguran n muni.
Aadar, evenimentul nu a fost o calamitate natural - el
putea fi previzibil i amnat.
i dimineaa Avraam s-a trezit devreme i a mers ctre
locul unde a stat naintea lui Yahve cu o zi nainte; i a
privit ctre Sodoma i Gomora i ctre toat cmpia; i iat,
a vzut fum ridicndu-se din pmnt, ca un abur de fum de
la un cuptor.
La poruncile Domnului, Avraam a prsit locul, mergnd
aproape de rmurile mrii. n munii din sud-estul
Iordanului, Lot i fiicele sale s-au ghemuit de fric; mama lor
a fost vaporizat de explozia nuclear deoarece a zbovit n
urma lor cnd fugeau din Sodoma. (Traducerea obinuit a

cuvintelor, aceea c ea s-a transformat ntr-un stlp de sare,

provine dintr-o nelegere greit a cuvntului sumerian care
ar putea nsemna deopotriv sare i vapor). Convinse c
tocmai au fost martorele sfritului lumii, cele dou fiice ale
lui Lot au decis c singura cale de a perpetua rasa uman
era s se culce cu propriul lor tat. Fiecare dintre ele a avut
astfel un fiu; ei au fost, potrivit Bibliei, precursorii celor dou
triburi de la estul rului Iordan: moabiii i amoniii.
Ca i pentru Avraam: Domnul i-a amintit de Sara aa
cum a promis (cnd le-a aprut cu cei doi ngeri cu un an
nainte), i Sara a conceput i i-a nscut un fiu lui Avraam
la vrsta sa naintat, i ei l-au numit pe fiu Isaac. Avraam
avea atunci 100 de ani; Sara avea 90.
Odat cu dispariia portului spaial, s-a terminat i
misiunea lui Avraam. Acum depindea de Dumnezeu s-i
ndeplineasc promisiunea. El a fcut un legmnt cu
Avraam s-i dea lui i descendenilor si ca o motenire
venic, pmnturile dintre prul Egiptului i fluviul Eufrat.
i acum, prin Isaac, promisiunea trebuia s fie inut.
Exista, de asemenea, ntrebarea cu privire la ce se
ntmpla cu celelalte faciliti spaiale.
Existau dou astfel de faciliti, n plus fa de portul
spaial. Una era Locul Aterizrii, ctre care i stabilise
traseul Ghilgame. Cealalt era Centrul de Control al
Misiunii - nefolosit, dar nc intact; un Centru al
Pmntului postdiluviu, servind aceleiai funcii ca Centrul
Pmntului din perioada prediluviu, care fusese Nippur.

Pentru a nelege funciile asemntoare i, prin urmare,

aspectele similare, ar trebui s comparm schiele facilitilor
spaiale din perioada pre i post diluviu. naintea Potopului
(Fig. 69), Nippur - desemnat Centrul Pmntului, deoarece
era n centrul cercurilor concentrice delimitnd Coridorul
Aterizrii - a servit drept Centru de Control al Misiunii.
Oraele Zeilor ale cror nume nsemnau Vznd Lumina
Roie (Larsa), Vznd Aureola la ase (Lagash) i Vznd
Aureola Luminoas (Laraak) au marcat deopotriv spaiul
echidistant i calea de aterizare ctre Sipparl (Oraul
Psrii), locul portului spaial.

Calea de aterizare, n interiorul unui Coridor de Aterizare

ntins, avea punctele pe vrfurile gemene ale Muntelui Ararat
- cel mai proeminent n topografia Orientului Apropiat. Portul
spaial a fost construit acolo unde acea linie intersecta cu
precizie linia nordic. Astfel, Calea Aterizrii forma cu
precizie un unghi de 45 de grade cu paralela geografic.
Dup Potop, cnd omenirea a primit cele trei Regiuni,
Anunnaki au reinut pentru ei a patra Regiune - peninsula
Sinai. Acolo, n cmpia central, pmntul era deopotriv
plat i greu (o zon perfect pentru tanc, cum au artat
armatele moderne), spre deosebire de terenul mltinos i
postdiluvian. Alegnd din nou vrfurile gemene ale munilor

Ararat ca punct de ancorare, Anunnaki au trasat o cale de

aterizare la acelai unghi de 45 de grade cu paralela
geografic - paralela 30 nord (Fig. 70).
Acolo, n cmpia central din peninsula Sinai, unde linia
diagonal intersecta paralela 30, urma s fie portul spaial.
Pentru a completa instalaia spaial, mai era nevoie de dou
componente: stabilirea unui nou Centru de Control al
Misiunii i delimitarea (i ancorarea) Coridorului de
Credem c trasarea Coridorului de Aterizare a precedat
alegerea locului pentru Centrul de Control al Misiunii.
Motivul? Existena Locului Aterizrii, n Munii Cedru din
Folclorul i legendele legate de acest loc repet aceeai
afirmaie, c locul a existat de dinainte de Potop. Imediat ce
Anunnaki au aterizat din nou pe Pmnt dup Potop, pe
vrfurile Ararat, ei au avut la dispoziie un Loc al Aterizrii
real i funcional - nu un port spaial n puterea cuvntului,
dar un teren pe care s aterizeze.
Toate textele sumeriene care se refer la primirea de ctre
Omenire a plantelor i animalelor domesticite (schimbate
genetic), descriu un laborator genetic n Munii Cedru, cu
Enlil i Enki lucrnd mpreun acum pentru a readuce viaa
pe Pmnt. Toate dovezile tiinifice moderne arat c din
aceast zon special au venit grul, orzul i primele animale
domesticite. (Iat din nou cum studii avansate n genetic vin
s confirme: un studiu publicat n revista Science n
noiembrie 1997 indic precis locul n care grul slbatic a
fost tratat genetic pentru a crea Cultura fondatoare a opt
cereale diferite: undeva acum 11.000 de ani n acel col
special din Orientul Apropiat!)
Au existat toate motivele s includ acest loc - o vast
platform din piatr a construciei masive - n noua facilitate

spaial. Acesta n schimb, a decis prin cercurile concentrice

echidistante locaia Centrului de Control al Misiunii.
Pentru a completa facilitile spaiale, era nevoie s se lege
Coridorul Aterizrii. n captul su sud-estic, cele dou
vrfuri apropiate - unul dintre ele venerat pn n zilele
noastre sub numele de Muntele Moise - erau la ndemn. n
marginea echidistant nord-vestic nu existau vrfuri, doar
un platou. Anunnaki - nu muritorul faraon - a construit
acolo doi muni artificiali, cele dou piramide de la Gizeh (cea
mai mic dintre ele, a treia piramid, am artat n The
Stairway to Heaven, a fost construit prima ca un test).
Peisajul a fost completat cu un animal mitologic spat n
piatr natural - sfinxul. El se uit cu precizie de-a lungul
paralelei 30, n direcia est, ctre portul spaial din Sinai.
Acestea au fost componentele portului spaial
postdiluviu al lui Anunnaki din peninsula Sinai, care a
fost construit de ei n cca. anul 10.500 .Chr. Cnd locul
de aterizare i de decolare din cmpia central a
Sinaiului a fost aruncat n aer, componentele auxiliare ale
portului spaial au rmas: piramidele de la Gizeh i
Sfinxul, Locul Aterizrii din Munii Cedru i Centrul de
Control al Misiunii.
Locul Aterizrii, dup cum tim din aventurile lui
Ghilgame, era acolo n cca. 2900 .Chr. Ghilgame a fost
martor acolo, cu o noapte nainte de a ncerca s intre, la
ridicarea unei rachete. Locul s-a meninut dup Potop - o
moned fenician a descris n culori foarte vii ceea ce sttea
n vrful platformei din piatr (Fig. 71). Vasta platform din
piatra nc exist. Locul se numete Baalbeck - pentru c era
Locul Secret al Nordului al zeului canaanit Ba'al. Biblia
cunotea locul ca Beth-Semesh, Casa/Locuina lui
Shamash (Zeul Soarelui) i era n interiorul domeniilor

regelui Solomon. Grecii de dup Alexandru au numit locul

Heliopolis, ce nsemna Oraul lui Helios, zeul Soarelui, i
au construit acolo temple pentru Zeus, sora sa, Afrodita i
fiul su, Hermes.
Dup aceea, romanii au ridicat temple pentru Jupiter,
Venus i Mercur. Templul lui Jupiter a fost cel mai mare
construit de romani vreodat oriunde n imperiu, pentru c
ei credeau c pe acel loc se afla cel mai important oracol din
lume, unul care putea prezice soarta Romei i a imperiului

Rmiele templelor romane nc se afl pe culmea vastei

platforme din piatr; la fel i platforma nsi, n ciuda
trecerii timpului, a ravagiilor naturii i oamenilor. Partea
plat a acesteia st strat pe strat (cursuri) din blocuri mari
din piatr, unele cntrind sute de tone. Recunoscut din
antichitate este Trilithon - un grup din trei blocuri imense din
piatr, stnd unul lng altul i formnd un rnd mijlociu
unde platforma era susinut acolo unde greutatea sa cea
mai mare (Fig. 72, cu un om care trece, pentru comparaia
mrimilor). Fiecare dintre acei uriai megalii cntrete
aprox 1.100 de tone; este o greutate pe care niciun
echipament modern nu ar putea s o ridice i s o mite.
Dar cine ar fi fcut asta n antichitate? Legenda local
spune c Uriaii. Ei nu doar au aezat acele blocuri din

piatr, ci le-au i exploatat, tiat i purtat pe o distan de

cteva mile; aceasta e sigur deoarece cariera de piatr a fost
gsit. Acolo, unul dintre blocurile uriae din piatr iese din
partea de munte pe jumtate exploatat (Fig-73); un om stnd
pe el arat ca o musc pe un bloc de ghea.
Jos, ctre captul estic al Coridorului Aterizrii, piramidele
din Gizeh nc stau acolo, sfidnd explicaiile tradiionale,
provocndu-i pe egiptologi s accepte c ele au fost construite
cu milenii nainte de faraoni i nu de ctre unul dintre ei.
Sfinxul nc privete cu precizie spre est, de-a lungul
paralelei 30, pstrnd pentru el secretele sale - probabil chiar
secretele Crii lui Thoth.
Dar Centrul de Control al Misiunii?
Acesta exist, de asemenea; este un loc numit Ierusalim.
i acolo, de asemenea, o platform mare i sacr se afl
peste blocuri uriae din piatr pe care niciun om sau
main antic nu ar fi putut-o muta, ridica sau amplasa.

nregistrarea biblic a sosirilor i plecrilor lui Avraam din

Canaan include dou momente de aparent inutil deviere; n
ambele momente locul spre care s-a deviat a fost locul
viitorului Ierusalim.
Prima dat devierea este amintit ca un epilog la povestea
despre Rzboiul Regilor. Luptnd i nfrngnd invadatorii de-

a lungul drumului ctre nord lng Damasc, Avraam s-a

ntors n Canaan cu captivi i prad;
i regele Sodomei s-a ndreptat ctre el Dup ce s-a ntors de la nfrntul Khedorlaomer
i regii care erau cu el Ctre Valea lui Shaveh care este valea regelui.
i Melhisedec regele lui Shalem i el era un preot al Dumnezeului Cel Prea nalt A adus pine i vin,
i l-a binecuvntat, spunnd:
Binecuvntat fi, Abram, de Dumnezeu Cel Prea nalt,
Creator al Cerului i Pmntului;
i binecuvntat fie Dumnezeu Cel Prea nalt,
Care a dat dumanii pe minile tale".
Melhisedec (al crui nume nsemna n ebraic exact ce
nsemna n akkadian Sharrukin, Regele Drept) i-a oferit
lui Abram s pstreze o zecime din toat prada pe care o
dobndise. Regele Sodomei a fost mai generos: Pstreaz
toat avuia, a spus el, d-mi doar prizonierii. Dar Abram nu
a vrut nimic din acestea; jurnd pe Yahve, Dumnezeu Prea
nalt, Creator al Cerului i Pmntului, el a spus c nu
poate lua nici mcar un iret de pantof (Geneza, capitolul
(Cercettorii au dezbtut ndelung i nc mai continu s
discute dac Avram a jurat pe Dumnezeu Prea nalt al lui
Melhisedec sau a vrut s spun: Nu, Yahve este Dumnezeul
Prea nalt, cruia i-am jurat).
Aceasta este prima referire din Biblie la Ierusalim, numit
aici Shalem. Faptul c aceasta este o referire la ceea ce mai
trziu a fost cunoscut ca Ierusalim se bazeaz nu doar pe
tradiiile ndelungate, dar i pe identificarea clar din Psalm
76:3. Este n general acceptat faptul c numele ntreg, YeruShalem n ebraic nseamn Oraul lui Shalem, Shalem

fiind numele unei zeiti. Unii sugereaz, totui, c numele ar

putea nsemna de asemenea, Fondat de Shalem. i se poate
argumenta, de asemenea, c Shalem nu a fost un nume sau
chiar un substantiv, ci un adjectiv, ce nsemna complet,
fr defect. Aceasta ar presupune c numele locului
nseamn Locul Perfect. Sau, dac Shalem este numele
unei zeiti, ar putea nsemna locul Celui care este perfect.
Fie c onora un zeu, c fusese ntemeiat de un zeu, sau c
nseamn Locul Perfect, Shalem/Ierusalim a fost aezat n cel
mai neobinuit loc, n ceea ce privete Oraele Omului. A fost
amplasat n zona arid montan, nici la intersecia
drumurilor comerciale sau militare, nici lng surse de
hran sau ap. ntradevr, era un loc lipsit complet aproape
de ap, furnizarea apei de but fiind n mod constant
problema principal i vulnerabilitatea Ierusalimului.
Shalem/Ierusalim nu a aprut nici n cltoriile lui Avraam,
nici pe ruta de invazii din est, nici n urmrirea invadatorilor
de ctre Avraam. De ce atunci un ocol pentru o srbtorire a
victoriei - un ocol, unii nclin s spun, ctre un loc pustiu
- poate fi explicat doar dac locul nu era cu adevrat un loc
prsit de Dumnezeu. Era un loc - singurul din Canaan unde a fost localizat un preot care servea lui Dumnezeu Prea
nalt. i ntrebarea este, de ce acolo? Ce era aa de special cu
acel loc?
A doua digresiune aparent inutil trebuie s fi avut
legtur cu testarea devotamentului lui Avraam de ctre
Dumnezeu. Abram mplinise deja misiunea sa n Canaan.
Dumnezeu i promisese c rsplata sa va fi mare, i anume
c nsui Dumnezeu l va proteja. Miracolul fiului su i
Motenitor Legal la o vrst naintat se ntmplase; Numele
lui Abram a fost schimbat n Avraam, Tatl unei mulimi de
naiuni. Pmntul fusese promis lui i descendenilor si;
promisiunea a fost inclus ntr-un legmnt care implica i

un ritual magic. Sodoma i Gomora fuseser distruse i toate

erau gata pentru a fi date lui Avraam i fiului su, s se
bucure de pace i linite la care ei erau cu siguran
Atunci, pe neateptate, era dup toate acele lucruri,
Biblia spune (Geneze, capitolul 22) c Dumnezeu l-a testat
pe Avraam spunndu-i s mearg ntr-un anumit loc i acolo
s-l sacrifice pe propriul su fiu:
Ia-l cu tine pe fiul tu Isaac,
Singurul pe care l iubeti cel mai mult,
i du-te la Pmntul lui Moria;
i ofer-l acolo ca sacrificiu,
Pe unul dintre muni
Pe care i-l voi arta ie.
De ce a hotrt Dumnezeu s-l testeze pe Avraam n acest
mod chinuitor, nu explic Biblia. Avraam, gata s
ndeplineasc porunca divin, a aflat n ultimul moment c
era doar un test al devotamentului su. Un nger al
Domnului i-a artat un berbec prins n tufiuri i i-a spus c
acela urma s fie sacrificat, nu Isaac. Dar de ce testul, dac
era nevoie de el, nu a fost fcut acolo unde locuiau Avraam i
Isaac, lng Beersheba? De unde nevoia de a face o cltorie
de trei zile? De ce au mers spre o parte a Canaanului pe care
Dumnezeu a identificat-o ca fiind Pmntul lui Moria i acolo
ntr-un loc special, pe munte - pe care nsui Dumnezeu l-a
artat - pentru a face acolo testul?
n primul moment, acolo trebuie s fi fost ceva special n
legtur cu locul ales. Citim (Geneza 22:4) c n a treia zi,
Avraam a ridicat ochii i a vzut locul de la distan. Zona
era bogat, n orice caz, cu muni sterpi; din apropiere i
sigur de la distan, toate artau la fel. Totui, Avraam a
recunoscut muntele special de la distan. Trebuie s fi fost
ceva special care l distingea de toi ceilali muni. Att de

mult nct atunci cnd chinul s-a terminat, el a dat un nume

de neuitat: Muntele Unde Yahve a fost Vzut. Muntele Moria
a fost vrful din Ierusalim pe care s-a construit n cele din
urm Templul.
Chiar din vremea n care Ierusalimul a devenit un ora, el
a cuprins trei muni. Enumerai de la nord est la sud vest ei
au fost Muntele Zophim (Muntele Observatorilor, numit
acum Muntele Scopus n englez), Muntele Moria (Muntele
Ghid, Indicator) n centru i Muntele Zion (Muntele
Semnal); acestea sunt precizri ale funciilor care ne
amintesc de numele-funcii ale Oraelor Cluz ale lui
Anunnaki marcnd Nippurul i Calea Aterizrii atunci cnd
portul spaial fusese n Mesopotamia.
Legendele ebraice spun c Avraam a recunoscut Muntele
Moria de la distan deoarece el a vzut deasupra un stlp
de foc ce ajungea de la Pmnt la Cer i un nor ceresc n care
se vedea Gloria lui Dumnezeu. Acest limbaj este aproape
identic cu descrierea biblic a prezenei Domnului peste
Muntele Sinai n timpul Exodului. Dar punnd astfel de
cunotine alturi, credem c ceea ce a vzut Avraam i l-a
fcut s identifice muntele ca fiind diferit de ceilali muni de
acolo, a fost marea platform de pe el.
O platform care, dei mai mic dect Locul Aterizrii de la
Baalbek, fcea de asemenea parte din facilitile spaiale ale
lui Anunnaki. Pentru c Ierusalimul (nainte de a se chema
Ierusalim), sugerm noi, a fost Centrul de Control al Misiunii
din perioada postdiluviu.
i, la fel ca cea de la Baalbek, acea platform, de
asemenea, exist nc.
Motivul (pentru prima) i scopul (pentru a doua)
digresiunilor sunt aadar n centrul ateniei. ndeplinirea
misiunii sale a fost marcat printr-o srbtorire formal,
inclusiv o binecuvntare preoeasc a lui Avraam cu pine

ceremonial i vin, la locul - singurul loc n Canaan conectat n mod direct la prezena lui Elohim. A doua
digresiune a fost legat de testul de calificare a lui Avraam
pentru un statut de ales dup distrugerea portului spaial i
dezmembrarea echipamentelor Centrului de Control al
Misiunii; i pentru a rennoi acolo legmntul n prezena
succesorului lui Avraam, Isaac. O astfel de rennoire a
legmntului divin a urmat imediat dup test:
i ngerul lui Yahve l-a chemat pe Avraam pentru a doua
oar din cer, spunnd, acesta este cuvntul lui Yahve:
Acesta este jurmntul meu:
Pentru c tu ai fcut acest lucru,
i nu ai refuzat pe fiul tu, unicul.
Te voi binecuvnta pe tine
i i voi nmuli smna...
i n smna ta naiunile Pmntului
Vor fi binecuvntate. "
Prin rennoirea jurmntului n acest loc special, nsui
locul - pmnt sfinit de atunci - a devenit parte din
motenirea lui Avraam evreul i a descendenilor si.
Promisiunea Divin ctre Avraam, spus de ctre Dumnezeu,
urma s se adevereasc numai dup trecerea timpului i
dup sclavia pe un pmnt strin pentru 400 de ani. Se
spune c 1000 de ani mai trziu descendenii lui Avraam au
luat n posesie muntele sacru, Muntele Moria. Cnd israeliii
au sosit n Canaan dup Exod, ei au aflat c un trib al
Jebusiilor se stabilise n partea de sud a muntelui sacru i iau lsat, pentru c nu sosise timpul s dein cel mai sfnt
pmnt. Singura rsplat a primit-o regele David care n cca.
anul 1000 .Chr, la 1000 de ani dup testarea lui Avraam, a
capturat aezarea iebusit i a mutat capitala din Hebron n
locul pe care Biblia l-a numit Oraul lui David.
Este important s nelegem c aezarea iebusit pe care a

cucerit-o David i noua sa capital nu a fost Ierusalim cum

se crede acum, nici chiar Vechiul Ora fortificat. Zona
cucerit de David i cunoscut apoi ca Oraul lui David a fost
pe Muntele Zion, nu Muntele Moria. Chiar i cnd succesorul
lui David, Solomon, a extins oraul ctre nord spre o seciune
numit Ophel (Fig. 74) a fost oprit s depeasc limitele
zonei unice la nord. Aceasta arat, sugerm noi, c platforma
sacr care se extindea ctre nord spre Muntele Moria exista
deja n vremea lui David i a lui Solomon.
Aezarea iebusit nu a fost aadar pe Muntele Moria i
platforma sa, ci n sudul su. (Locuinele umane de lng - i
nu din interiorul - zona sacr erau asemntoate centrelor
de cult din Mesopotamia, cum era Ur (vezi Fig. 65) sau chiar
oraul lui Enlil, Nippur, aa cum arat o hart actual a lui
Nippur descoperit schiat pe tbliele din lut, Fig. 75).
Una dintre primele aciuni ale lui David a fost s transfere
Chivotul Legmntului din ultima sa locaie temporar n
capital, pentru a pregti aezarea lui ntr-o Cas a lui Yahve
potrivit, pe care David avea n plan s o ridice. Dar aceast
onoare, i-a spus Profetul Nathan, nu era de partea lui
datorit sngelui de pe minile sale, pe care l-a vrsat n
timpul rzboaielor naionale i al conflictelor personale;
onoarea, i-a spus el, ar putea reveni fiului su, Solomon.
Ceea ce i se permitea s fac n acest timp era s ridice un
altar; locul exact pentru aceasta i-a fost artat lui David de
ctre un nger al lui Yahve, stnd ntre Cer i Pmnt. I s-a
artat, de asemenea, un Tavnit - un model - al viitorului
templu i i s-au dat instruciuni arhitecturale detaliate, pe
care, la timpul potrivit, el le-a dat lui Solomon, ntr-o
ceremonie public, spunnd:
Toate acestea, n scris prin mna Sa,
Mi le-a fcut Yahve
nelege -

Toate lucrrile Tavnit.

(Amploarea acelor indicaii detaliate pentru templu i
seciunile sale diverse i instrumentele rituale pot fi evaluate
n Cronici 28:11-19).

n al patrulea an al domniei sale - 480 de ani dup

nceperea Exodului, Biblia spune - Solomon a nceput
construirea Templului, pe Muntele Moria, cum i-a fost artat
tatlui su. n timp ce cheresteaua a fost tiat din Pdurea
de Stejar din Liban, cel mai pur aur de Ophir a fost adus, iar
cuprul pentru bazine speciale a fost exploatat i topit n
celebrele mine ale lui Solomon, nsi structura sa a trebuit
s fie ridicat cu pietre cioplite i tiate, pietre mari i
Piatra cioplit trebuia pregtit i tiat n alt parte la
dimensiunea i forma necesare, deoarece la construirea
Templului existau interdicii cu privire la folosirea

instrumentelor din metal. Blocurile din piatr au trebuit

transportate i aduse la locul construciei doar pentru
asamblare. Casa, cnd a fost n construcie, a fost ridicat
din piatr nainte s fie adus acolo; astfel c acolo nu a fost
auzit niciun ciocan, topor sau orice alt instrument din metal
ct s-a lucrat la Cas (Regii 6:7).
A fost nevoie de apte ani pentru a termina construcia
Templului i pentru a-l dota cu instrumente ritualice. Atunci,
la srbtorirea urmtorului An Nou (n a aptea lun),
regele i preoii i tot poporul au asistat la transferarea
Chivotului Legmntului n locul su permanent, n Sfnta
Sfintelor a Templului. Nu exista nimic n Chivot cu excepia
celor dou tblie din piatr pe care Moise le-a pus acolo la
Muntele Sinai. Nu mult dup ce Chivotul a fost pus sub
Heruvimul naripat, un nor a umplut Casa lui Yahve,
facndu-i pe preoi s nvleasc afar.

Atunci, Solomon, stnd la altarul care era n curte, s-a

rugat la Domnul care locuiete n ceruri s vin i s se
aeze n Casa Sa. Noaptea, trziu, Yahve i-a aprut lui
Solomon n vis i i-a promis prezena sa divin: Ochii mei i
inima mea vor fi n ea pentru totdeauna.
Templul a fost mprit n trei pri; se intra printr-o poart
mare flancat de doi stlpi speciali (Fig. 76). Partea din fa a
fost numit Ulam (Hol); partea cea mai mare din mijloc era
Ekhal, un termen ebraic provenind din sumerianul E.GAL
(Marele lca). Aceasta proteja partea interioar, Sfnta
Sfintelor. Se numea textual Dvir. - Oratoriul - pentru c n el
se afla Chivotul Legmntului mpreun cu doi Heruvimi pe
el (Fig. 77) de la care Dumnezeu vorbise lui Moise n timpul
Exodului. Marele altar i chiuvetele erau n curte, nu n
interiorul Templului.
Informaiile biblice i referinele, vechile tradiii i dovezile
arheologice spun fr dubii c Templul construit de Solomon
(Primul Templu) se afla peste marea platform din piatr care
domin nc Muntele Moria (cunoscut de asemenea ca
Muntele Sfnt, Muntele Domnului sau Muntele Templului).

Date fiind dimensiunile Templului i mrimea platformei,

exist un consens general cu privire la locul Templului (Fig.
78) i la faptul c Chivotul Legmntului din interiorul
Sfintei Sfintelor a fost amplasat pe o stnc deschis, o
Stnc sfnt care, potrivit tradiiilor, a fost cea pe care
Avraam se pregtea s-l sacrifice pe Isaac. Stnca a fost
numit n scripturile ebraice Even Sheti'yah - Piatra
Fundaiei - pentru c era acea stnc de unde ntreaga
lume a fost micat. Profetul Ezechiel (38:12) a identificat-o
ca fiind Centrul Pmntului. Tradiia a fost att de
nrdcinat nct artitii cretini din Evul Mediu au descris
locul ca Centru al Pmntului (Fig. 79a) i au continuat s
fac asta chiar i dup descoperirea Americii (Fig. 79b).
Templul pe care l-a construit (Primul Templu) a fost distrus
de regele babilonian Nubocodonosor n anul 576 .Chr. i a
fost reconstruit dup ntoarcerea evreilor din Exil din
Babilon, 70 de ani mai trziu. Acel Templu reconstruit,
cunoscut ca al Doilea Templu, a fost ulterior extins i
consolidat de ctre regele iudeu Irod, n timpul domniei sale,
ntre anii 36 i 4 .Chr. Dar al Doilea Templu, n toate fazele
sale, a respectat aspectul original, locaia i plasarea Sfintei
Sfintelor pe Stnca Sacr.

Atunci cnd arabii au cucerit Ierusalimul, n secolul 7

d.Chr., ei au pretins c de pe Stnca Sacr a urcat Mohamed
ctre cer pentru o vizit nocturn; ei au consacrat locul prin
construirea Cupolei Stncii (Fig. 80) care s-l adposteasc i
s-l mreasc.
Geologic, stnca este o revrsare a rocii naturale de
dedesubt, proeminent peste nivelul platformei din piatr de
cinci sau ase picioare. Dar este cea mai neobinuit
revrsare n mai multe feluri. Faa sa vizibil a fost tiat i
mprit, cu un unghi de o precizie impresionant (Fig. 81a)
pentru a forma recipiente i nie dreptunghiulare, alungite,
verticale i orizontale de mrimi i adncimi diferite. Aceste
recipiente i nie trebuie s fi avut un scop de cel care fcuse
inciziile n piatr.

Ceea ce a fost bnuit de mult vreme (ex: Hugo

Gressmann, Altorientalische Bilder zum Alten Testament) a
fost confirmat de ctre cercettorii receni (cum ar fi Leen
Ritmeyer, Locating the Original Temple Mount): Chivotul
Legmntului i pereii de la Sfnta Sfintelor fuseser
amplasate acolo unde se aflau o tietur dreapt i celelalte
nie de pe suprafaa stncii.
Implicaia acestor constatri este c tieturile i niele de
pe suprafaa stncii dateaz cel puin din vremea Primului
Templu. Nu exist, oricum, nicio meniune n pasajele
relevante din Biblie cu privire la tieturi fcute de ctre
Solomon; ntradevr, ar putea fi imposibil - din cauza
interdiciilor stricte mpotriva folosiriitopoarelor din metal sau
a celelalte instrumente pe Munte!

Secretul Stncii Sacre i a ceea ce st n vrful ei este

amplificat de misterul a ceea ce s-ar putea afla sub ea.
Pentru c stnca nu este o simpl revrsare de roc. Este o
n fapt, avnd acordul, se poate cobor pe scri construite
de autoritile arabe i se ajunge ntr-o cavern ca o peter
al crei acoperi din roc este partea proeminent de
deasupra Stncii Sacre. Aceast cavern - nu se tie dac
este natural sau nu - are, de asemenea, nie i containere
deopotriv n pereii din roc, dar i n podea (dup cum s-a
putut vedea nainte, podeaua era acoperit cu covorae de
rugciune). La prima vedere se ghicete o deschidere ntr-un
tunel ntunecat; dar ce este i unde duce el este un secret
bine pstrat de ctre arabi.
Cltorii secolului al XIX-lea au precizat c aceast
cavern nu este ultima cavitate legat de Stnca Sacr; ei au
spus c exist o alta, o cavitate interioar sub ea (Fig. 81b).

Cercettorii israelieni, alungai din zon, au descoperit cu

ajutorul unui radar n sol i a tehnologiei sonarului c
ntradevr exist acolo o ncpere mai mare sub Stnca
Aceste ncperi misterioase au dat natere la speculaii nu
doar cu privire la posibile comori ale Templului sau nscrisuri
ale Templului care ar fi putut fi ascunse acolo atunci cnd
Primul Templu, apoi al Doilea Templu erau pe cale s fie
cucerite i distruse.

Legmntului, pe care Biblia a ncetat s l menioneze dup
ce faraonul egiptean Sheshak a jefuit (dar nu a distrus)
Templul n cca. 950 .Chr., ar fi putut fi ascuns acolo.

Aceasta deocamdat trebuie s rmn doar o speculaie.

Este sigur totui faptul c Profeii biblici i Psalmitii se
refer la aceast Stnc Sacr cnd folosesc de obicei
termenul Stnca lui Israel ca un eufemism pentru Yahve.
i Profetul Isaia (30:29) vorbind de vremurile viitoare ale
mntuirii universale n Ziua Domnului, prevestete c
naiunile de pe Pmnt vor merge la Ierusalim s se roage
Domnului pe muntele lui Yahve, la stnca lui Israel.
Muntele Templului este acoperit de o platform orizontal
din piatr de form perfect dreptunghiular (datorit
contururilor terenului), a crui mrime este de 1.600 pe 900
picioare, astfel c zona total din piatr este de aproape
1.500.000 picioare ptrate. Dei se crede c platforma
actual include seciuni, la extremitatea sudic i posibil n
nord, care fuseser adugate ntre construirea Primului
Templu i distrugerea celui de-al Doilea Templu, este o
certitudine c cea mai mare parte a platformei este original;
acest lucru este sigur n ceea ce privete partea ridicat uor,
unde a fost aezat Stnca Sacr (i deci Cupola Stncii).
Aa cum arat prile vizibile ale pereilor de susinere a
platformei i aa cum au dezvluit spturile recente, temelia
natural a Muntelui Moria se nclin considerabil de la nord
spre sud. Dei nimeni nu poate spune cu certitudine ce
mrime avea platforma n vremea lui Solomon, nici s
estimeze precis adncimea nclinaiilor care au trebuit
umplute, o presupunere este c platforma msura doar
1.000.000 picioare ptrate i o medie a adncimii de 60
picioare (mult mai puin n nord, mai mult n sud), rezultnd
o suprafa ce necesita 60.000.000 metri cubi (fundaie,
cmp de piatr). Aceasta era o construcie semnificativ.
Totui nicieri n Biblie nu apare nicio meniune sau aluzie
la o astfel de iniiativ. Instruciunile pentru Primul Templu
acoper pagini ntregi n Biblie; este dat fiecare mic detaliu,

msurtorile sunt uimitor de precise, este indicat unde i ce

ustensil sau obiect trebuie folosit, este specificat ct de
lungi trebuie s fie stlpii care in Chivotul i aa mai
departe. Dar totul se refer la Casa lui Yahve. Niciun cuvnt
despre platforma pe care urma s stea; i aceasta poate
nsemna doar c platforma deja exista acolo; nu a fost nevoie
s fie construit.
Ieind n eviden contrastul complet cu acea lips a
menionrii sunt cele dou referine n Samuel II i Regi I la
Millo, literalmente umplerea - un proiect nceput de David
i extins de Solomon de a umple partea inclinaiilor pe colul
sud-estic al platformei sacre, astfel nct s fac posibil ca
Oraul lui David s se extind ctre nord, mai aproape de
platforma veche. n mod clar, cei doi regi au fost destul de
mndri de aceast realizare i s-au asigurat c a fost
nregistrat n cronicile regale. (Spturi recente n acea zon
indic oricum faptul c ceea ce s-a fcut a fost s se ridice
nivelul nclinat prin construirea unor serii de terase care
erau mai mici pe msur ce se urca; aceasta a fost mult mai
simplu dect mprejmuirea primei zone extinse cu perei
nali de susinere i umplerea golului cu material).
Aceast comparaie ntrete fr dubii concluzia c nici
David, nici Solomon nu au construit marea platform de pe
Muntele Moria cu ziduri imense de siguran i cu cantiti
imense de material de umplere. Toate aceste dovezi arat c
platforma exista deja cnd se urmrea construcia Templului.
Cine a construit aadar platforma, cu toate terasamentele
i lucrrile din piatr de care a fost nevoie? Rspunsul
nostru desigur este: aceiai maetri constructori care au
construit platforma de la Baalbeck (i de fapt, platforma
vast i precis poziionat pe care se afl Marea Piramid de
la Gizeh).
Marea platform care acoper Muntele Templului este

nconjurat de perei care servesc deopotriv ca ziduri de

rezisten i ca fortificaii. Biblia spune c Solomon a
construit astfel de ziduri, aa cum au fcut i regii iudei
dup el.

Prile vizibile ale zidurilor, n special pe prile din sud i

est, reproduc construcii din diferite perioade de mai trziu.
Invariabil, nivelurile inferioare (i deci mai vechi) sunt
construite din blocuri de piatr mai mari i mai bine tiate.
Din aceste ziduri, doar Zidul de Vest, prin tradiie i aa cum
a confirmat cercetarea arheologic, a rmas sfnt ca un
vestigiu din perioada Primului Templu - cel puin nivelurile
sale inferioare unde piatra cioplit (tiat perfect n blocurile
de piatr) este cea mai mare. De aproape dou milenii evreii
in la acest vestigiu, l venereaz, se roag la Domnul acolo,

caut ajutor introducnd bucele de hrtie cu rugmini

ctre Domnul printre pietre, plngnd distrugerea Templului
i mprtierea poporului evreiesc - astfel nct, n timp,
cruciaii i ali cuceritori ai Ierusalimului au poreclit Zidul
Vestic Zidul Plngerii.
Pn la reunificarea Israelului, n 1967, Zidul de Vest nu
era dect o bucat de zid de aproximativ 100 de picioare care
se strecura printre case. n fa a fost lsat un spaiu ngust
pentru cei care se roag i pe ambele pri avnd cas peste
cas, acesta se ntinde pe Muntele Sfnt. Atunci cnd casele
au fost mutate, s-a format o mare pia n faa Zidului Vestic
i a fost realizat o extindere a sa spre colul su sudic (Fig.
82). i pentru prima dat n aproape dou milenii, s-a
realizat c zidurile de susinere se extind n jos aproape la fel
de mult ca cele aflate deasupra a ceea ce s-a considerat
nivelul solului. Aa cum arat partea vizibil n zilele noastre
a Zidului Plngerii, nivelurile inferioare erau mai mari, mai
bine mprite i desigur mult mai vechi.
Partea extins ctre nord a Zidului de Vest este o provocare
i promite secrete vechi.
Acolo, cpitanul Charles Wilson a fcut cercetri n anii
1860 la o arcad (care nc i poart numele) care duce spre
nord la un pasaj ca un tunel, iar la vest ctre o serie de
camere cu arcade i bolte. Mutarea locuinelor din zon a
dezvluit faptul c actualul nivel al solului se ntinde peste
cteva niveluri inferioare, acum subterane, niveluri cu
structuri antice care includeau mai multe pasaje i arcade.
Ct de departe n jos i spre nord s-au extins toate acestea?
Acesta a fost un mister pe care arheologii israelieni au
nceput n sfrit s-l discute.
La final, ceea ce au descoperit era zguduitor.
Folosind informaii din Biblie, din Cartea Macabeilor i din
scrierile istoricului evreu roman Josephus (i lund n

considerare chiar legenda medieval potrivit creia regele

David cunotea un drum care urca pe Munte din vest),
arheologii israelieni au ajuns la concluzia c Arcada lui
Wilson era o cale de intrare spre ceea ce trebuie s fi fost n
vremurile vechi o alee exterioar care mergea de-a lungul
Zidului de Vest i c nsi Zidul s-a extins ctre nord cu
sute de metri.

Curarea amnunit a drmturilor, confirmnd acele

presupuneri, a dus la deschiderea n 1996 a Tunelului
arheologic (eveniment ce a inut paginile ziarelor pentru mai
multe motive).
Extinzndu-se cu aproximativ 1600 de picioare de la
nceputul su la Arcada lui Wilson ctre ieirea sa la Via
Dolorosa (unde Iisus a mers purtnd crucea), Tunelul Zidului
Vestic descoper i expune rmie de strzi, tuneluri de
ap, bazine, arcade, structuri i piee din vremurile
bizantin, roman, irodian, hasmonean i biblic. Emoia
i experiena misterioas a trecerii prin tunel n adncimea
nivelului solului sunt asemntoare unei cltorii cu maina
timpului - napoi n trecut cu fiecare pas.
Peste tot vizitatorul poate vedea - i atinge - pri din

rmiele zidului vestic din cele mai vechi timpuri. Niveluri

care au fost ascunse de milenii sunt expuse acum. n cea mai
nordic parte a tunelului se poate vedea roca natural de
baz care se nclin n sus. Dar cea mai mare surpriz
pentru vizitator, dar i pentru arheologi, se afl n cea mai
sudic seciune a zidului descoperit:
Acolo - la nivelul vechi al strzii, dar nu i cel mai de jos
nivel - au fost amplasate blocuri masive din piatr, iar
deasupra lor, patru blocuri imense, fiecare cntrind sute de
n acea parte a Zidului Vestic, o seciune de 120 de picoare
este fcut din blocuri de piatr care au nlimea uluitoare
de 11 picioare, aproape dublu dect mrimea i aa
neobinuit a blocurilor care formeaz nivelul de dedesubt.
Doar patru blocuri din piatr formeaz aceast seciune:
unul dintre el are 42 de picioare lungime (Fig. 83); altul are
40 de picioare lungime i al treilea peste 25 de picioare
lungime. Radarul subteran i celelalte instrumente au artat
c aceste pietre se afl la o adncime de 14 picioare. Cea mai
mare dintre cele trei este aadar o mas din piatr de
aproximativ 6500 picioare cub, cntrind 1200.000 pounds1,
adic aproape 600 de tone! O alta ceva mai mic are aproape
570 de tone, iar a treia aproape 355 tone.
Acestea sunt mrimi i greuti peste orice etalon de
msurare; blocurile folosite la construirea Marii Piramide
de la Gizeh aveau 2,5 tone fiecare, cea mai mare
comparaie care ne vine n minte se refer la cele trei
construcii Trilithon de la marea platform din Baalbeck,
care de asemenea formeaz un nivel deasupra mai mic,
dar de asemenea cu blocuri colosale din piatr (Fig. 72).

1 pounds = livre, 1.200.000 livre = 600.000g= 600 kg (

Cine ar fi putut amplasa astfel de blocuri colosale din

piatr i pentru ce?
Deoarece blocurile de piatr sunt ndreptate spre marginile
lor, arheologii cred c sunt din perioada celui de-al Doilea
Templu (sau mai exact din perioada irodian, primul secol
d.Chr). Dar chiar cei care consider c platforma original
din piatr a fost mai mic dect cea actual, sunt de acord
cu faptul c partea central care cuprinde Stnca Sacr, i
creia i aparine zidul masiv, a existat din vremea Primului
Templu. La acea vreme, interzicerea folosirii instrumentelor
din fier (aceasta era din vremea lui Iosua) era respectat cu
strictee. Toate blocurile din piatr folosite de Solomon, fr
excepie, erau exploatate, tiate, mprite i pregtite n alt
parte, pentru a fi aduse apoi la locul respectiv pentru
asamblare. Faptul c aa s-a ntmplat cu privire la uriaele
blocuri din piatr despre care vorbim este confirmat n plus
prin faptul c ele nu fac parte din piatra local; aceasta se
afl dedesubtul ei i are o nuan diferit, (n fapt, ultimele
descoperiri din Ierusalimul de vest arat c ele ar fi putut
veni dintr-o carier de acolo). Cum au fost ele transportate i
ridicate la nivelul cerut, apoi mpinse pe amplasamentul
necesar rmn ntrebri la care arheologii nu pot da
Oricum, s-a oferit un rspuns la ntrebarea pentru ce.
Arheologul ef al antierului, Dan Bahat, scriind n Biblical
Archaeology Review, spunea: Credem c pe cealalt parte
(estic) a zidului vestic la acest punct, sub Muntele
Templului, este o sal imens; teoria noastr este c Nivelul
Superior (cum s-a numit aceast parte) a fost instalat
pentru susinere i servete ca o contra pondere la bolta
Seciunea cu blocurile imense din piatr se afl doar la
sud de locul Stncii Sacre. Pentru a arta, cum facem noi, c

acea seciune masiv era necesar pentru impactul greu

legat de funcionarea locului ca un Centru de Control al
Misiunii cu echipamentele sale instalate pe ea i n interiorul
Stncii Sacre. n cele din urm, aceasta pare s fie singura
explicaie plauzibil.

A fost amnarea nceputului construciei Templului
Ierusalimului datorat unui motiv anume - vrsare de snge
pe care a fcut-o David printre dumani n rzboaie i certuri
- sau a fost acesta doar o scuz, ascunznd un alt motiv mai
Unii consider c este ciudat c, n urma amnrii,
intervalul de timp care a trecut de la rennoirea legmntului
cu Avraam (i cu Isaac, de asemenea, cu aceeai ocazie) pe
Muntele Moria pn la nceputul construirii Templului a fost
de exact 1000 de ani. Este ciudat, deoarece exilul lui Marduk
a durat de asemenea 1000 de ani; i asta pare s fie mai
mult dect o simpl coinciden.
Biblia arat clar c sincronizarea construirii Templului a
fost decis de nsui Dumnezeu; dei detaliile arhitecturale i
chiar un model erau gata, El a fost cel care a zis, prin
Profetul Nathan: Nu nc, nu David, ci urmtorul rege,
Solomon. De asemenea, este evident c nu Marduk nsui a
fost cel care a stabilit timpul pentru sfritul exilului su.
ntradevr, el a strigat aproape cu disperare: Pn cnd? i
aceasta trebuie s fi nsemnat c sfritul zilelor sale de exil
era necunoscut pentru el; acesta a fost decis de ceea ce
trebuie s se fi numit Soarta - sau, n mod deliberat, de o
mn nevzut a Domnului Domnilor, Dumnezeul pe care

evreii l-au numit Yahve.

Concepia c un mileniu - 1000 de ani - semnific mai
mult dect un eveniment calendaristic, prevestind
evenimente apocaliptice, este de obicei considerat ca
provenind din relatarea vizionar a Apocalipsei, capitolul 20,
n care se prezicea c Dragonul, acel arpe btrn, care este
Rul i Satan, va fi legat pentru 1000 de ani, aruncat ntr-o
groap i nchis acolo pentru 1000 de ani, incapabil s nele
naiunile, pn se vor mplini cei 1000 de ani. Atunci urma
vremea n care Gog i Magog vor fi implicai ntr-un rzboi
mondial; se va petrece Prima nviere a morilor i Vremurile
Mesianice vor veni.
Acele cuvinte vizionare, introducnd n cretinism
conceptul (i ateptarea) unei apocalipse milenare, au fost
scrise n primul secol d.Chr. Aadar, dei cartea numete
Babilonul ca imperiu al rului, oamenii de tiin i teologii
cred c acela a fost numele de cod pentru Roma.
Dar chiar i aa, este semnificativ faptul c datele din
Apocalipsa le amintesc pe cele ale Profetului Ezechiel (secolul
6 .Chr), care a avut o viziune a nvierii morilor n Ziua
Domnului (capitolul 37) i rzboiul mondial al lui Gog i
Magog (capitolele 38, 39); va avea loc, a spus Ezechiel, la
Sfritul Anilor. Totul a fost prezis, a spus el, de Profetul lui
Yahve n Zilele Vechi, care a profeit atunci despre Ani.
Anii care urmeaz s se mplineasc, numrtoare pn
la Sfritul Anilor. Au fost ntradevr multe secole naintea
vremii lui Ezechiel, cnd Biblia a dat un indiciu:
O mie de ani,
n ochii ti.
Sunt dar ca o zi care a trecut.
Afirmaia, n Psalmul 90:4, este atribuit n Biblie lui
Moise nsui; aplicarea a 1000 de ani la msurtoarea
timpului divin ne duce napoi, cel puin la vremea Exodului.

ntradevr, Deuteromul (7:9) atribuie ca durat a

Legmntului lui Dumnezeu cu Israel o perioad de 1000 de
generaii, iar n Psalmul lui David compus atunci cnd
Chivotul Legmntului a fost adus n Oraul lui David,
durata de 1000 de generaii a fost amintit nc o dat
(Cronici 16:15). Ceilali Psalmi folosesc n mod repetat
numrul o mie pentru Yahve i minunile sale; Psalmul
68:18 d chiar cifra de 1000 de ani ca durat a Carului lui
Cuvntul ebraic pentru o mie, Eleph, este scris cu trei
litere Aleph (A), Lamed (L) i Peh (P" sau Ph), care poate fi
citit ca Aleph, nsemnnd prima liter din alfabet, iar
numeric 1". Adunnd mpreun cele trei litere, avem
valoarea numeric 111 (1+30+80), care poate fi luat ca o
tripl afirmaie a Unicitii lui Yahve i a monoteismului,
Unul fiind un cuvnt cod pentru Dumnezeu. Nu
ntmpltor, aceleai trei litere rearanjate (P-L-A) dau Peleh o minune a minunilor, un epitet pentru munca lui Dumnezeu
i misterele Cerului i Pmntului care sunt dincolo de
nelegerea uman. Acele minuni ale minunilor se refer n
principal la lucrurile create i prezise n trecutul ndeprtat:
ele sunt, de asemenea, subiect al cercetrii lui Daniel atunci
cnd cuta s afle divinul Sfrit al Zilelor (12:6).
Acele versete privind perioada milenar par, aadar, s fie
roi n interiorul roilor. nelesuri n nelesuri, coduri n
coduri: nu doar calculul numeric continuu al trecerii
timpului, dar i durata ncorporat a Legmntului, o
afirmaie codat a monoteismului i o profeie cu privire la
mileniu i la Sfritul Zilelor.
i aa cum arat clar Biblia, cei 1000 de ani a cror
numrtoare a nceput prin construirea Templului coinciznd cu ceea ce este numit acum ultimul mileniu d.Chr
- a fost un timp al profeiei.

Pentru a nelege evenimentele i profeiile din ultimul

mileniu, trebuie s ntoarcem ceasul n urm la mileniul
precedent, la catastrofa nuclear i la presupusa supremaie
a lui Marduk.
Textele Plngerii, descriind ravagiile i distrugerea care au
npdit Sumerul i Akkadul ca un nor nuclear mortal
plutind ctre Mesopotamia, descriu foarte viu cum zeii
sumerieni i-au abandonat n grab centrele de cult pe
msur ce Vntul Ru se ndrepta ctre ei. Unii s-au ascuns
n muni, alii au fugit pe cmpii ndeprtate. Inanna
lsndu-i posesiunile n urm, a navigat ctre Africa ntr-un
vas submersibil: soia lui Enki, Ninki, zburnd ca o pasre
a plecat ctre Abzu, n Africa, unde a cutat s fie n
siguran spre nord; Enlil i Ninlil au plecat ctre destinaii
necunoscute, aa cum a fcut i celibatara Ninharsag. n
Lagash, zeia Bau a rmas singur pentru c Ninurta plecase
de la explozia nuclear; ea a vrsat lacrimi amare pentru
templul ei i a zbovit acolo; rezultatul a fost tragic, pentru
c n acea zi furtuna a prins-o, ca i cum era o muritoare,
furtuna a luat-o cu ea.
Lista zeilor fugari continu pn ajunge la Ur i la zeitile
sale. Acolo, aa cum am menionat deja, Nannar/Sin a
refuzat s cread c soarta oraului su a fost pecetluit.
ntr-o lamentaie pe care ea nsi a scris-o ulterior, soia sa,
Ningal, a descris cum n ciuda mirosului respingtor al
morilor ale cror cadavre umpleau oraul, ei au rmas i nu
au fugit. Nu au fugit nici n noaptea care a urmat acelei zile
ngrozitoare. Dar diminea, cei doi zei, retrai n camera
subteran a ziguratului, au neles c oraul era condamnat
i au plecat i ei.
Norul nuclear, schimbat ctre sud de vnturi, a ocolit
Babilonul; i asta a fost luat ca un semn susinnd primirea
de ctre Marduk a celor 50 de nume ca un indiciu al

supremaiei sale meritate. Primul su pas a fost s

ndeplineasc sugestia tatlui su c nii Anunnaki au
construit pentru el templul su/casa sa n Babilon, E. SAG
IL (Casa Conductorului Mre). Pentru asta a fost adugat
n zona sacr un alt templu pentru srbtorirea Anului Nou
i citirea poemului revizuit Enuma elish; numele su,
E.TEMEN.AN.KI (Casa Fundaiei Cer-Pmnt) dorea n mod
clar s arate c el a nlocuit DUR.AN.KI al lui Enlil (Legtura
Cer-Pmnt), care fusese n centrul Nippurului cnd era
Centrul de Control al Misiunii.
Cercettorii nu au dat suficient atenie chestiunii
matematicilor din Biblie, lsnd nediscutat ceea ce ar fi
trebuit s fie considerat un mister: De ce Biblia ebraic a
adoptat complet sistemul zecimal, dei Avraam era un Ibri un sumerian din Nippur - i toate povetile din Genez (cum
se reflect n Psalmi i oriunde) se bazeaz pe textele
sumeriene? De ce nu se regsete deloc sistemul sexgesimal
sumerian (baz 60) n numerologia biblic - o practic care
a culminat n conceptul mileniului?
Unii se ntreab dac Marduk tiuse despre aceast
El marcase supremaia sa prin proclamarea Anului Nou
(acela al Berbecului), prin revizuirea calendarului i
construirea unei noi Pori a Zeilor. n aceti pai se poate
distinge dovada unor noi matematici - o schimbare tacit de
la sistemul 60 la cel zecimal.
Punctul central al acelor schimbri era templul zigurat
ridicat n onoarea sa, pe care Enki l indicase s fie construit
de ctre nii Anunnaki. Descoperirile arheologice fcute la
rmiele sale (dup reconstruiri repetate), precum i
informaiile oferite de tblie cu date arhitecturale precise,
dezvluie faptul c ziguratul s-a ridicat n apte nivele, cel
mai nalt dintre el servind ca locuin actual a lui Marduk.

Planificat (dup cum a pretins nsui Marduk) dup scrierile

Cerurilor nalte, acesta avea o structur ptrat a crei baz
sau prim nivel msura 15 gar (aprox 110 picioare); deasupra
sa era al doilea nivel, mai mic i mai scurt; i tot aa, pn ce
ntregul templu ajungea la o nlime combinat de 300 de
picioare, la fel ca baza sa. Rezultatul a fost un cub a crui
circumferin era de 60 gar n fiecare dintre cele trei
dimensiuni, dnd structurii numrul cerestru 3600 cnd
nmulim (60x60) i 216.000 cnd triplm (60x60x60).
Dar n acel numr a fost ascuns o schimbare ctre
sistemul zecimal, pentru c el reprezint numrul zodiacal
2.160 nmulit cu 100.
Cele patru coluri ale ziguratului au fost orientate cu
precizie ctre cele patru puncte cardinale ale busolei. Aa
cum au artat studiile paleoastronomilor, nlimea
repartizat fiecruia dintre cele ase niveluri a fost calculat
cu precizie pentru a permite observaiile cereti pentru
fiecare locaie geografic special. Scopul ziguratului aadar
nu era doar de a depi construcia Ekur de odinioar a lui
Enlil, ci s preia funciile astronomice/calendaristice ale lui
Aceasta a fost pus n practic prin revizuirea calendarului
- o chestiune de prestigiu teologic, dar i de necesitate
deoarece schimbarea zodiacal (de la Taur la Berbec) - avea
nevoie de asemenea, de o ajustare a unei luni n calendar
dac Nissan (Purttorul Stindardului) urma s fie prima
lun i luna echinociului de primvar. Pentru a face asta,
Marduk a poruncit ca ultima lun din an, Addaru, urma s
fie dublat anul acela. (Procedeul dublrii lui Addar de apte
ori ntr-un ciclu de 19 ani a fost adoptat n calendarul ebraic
ca o metod de realiniere periodic a anilor lunari i solari).
Cum a fost n Mesopotamia, la fel a fost i cu calendarul
revizuit n Egipt. Conceput acolo de Thoth, al crui numr

secret era 52, acesta mprea anul n 52 de sptmni de 7

zile fiecare, rezultnd un an solar de doar 364 de zile (o
chestiune abordat n Cartea lui Enoh). Marduk (la fel ca Ra)
a instituit n schimb un an bazat pe mprirea n 10: el a
mprit anul n 36 decani de 10 zile fiecare; cele 360 de zile
care au rezultat au fost urmate atunci de cinci zile speciale,
pentru a completa pn la 365.
Noua Er inaugurat de Marduk nu a fost una a
monoteismului. Marduk nu s-a declarat pe sine nsui
singurul zeu; ntradevr, el avea nevoie de ceilali zei s fie
prezeni i s-l aclame ca suprem. n acest scop el a creat n
zona sacr a altarelor mici temple i reedine pentru toi
ceilali zei principali i i-a invitat s-i fac acolo propriile lor
case. Nu este nicio indicaie n niciun text referitoare la
acceptarea invitaiei de ctre ceilali zei. De fapt, n perioada
aproximativ n care se presupune c dinastia regal a lui
Marduk a fost instaurat n Babilon, n cca. anul 890 .Chr.,
zeii dezbinai au nceput s-i stabileasc propriile lor noi
domenii n Mesopotamia.
Printre ele, de remarcat a fost Elam n est, cu Susa (mai
trziu biblicul Shushan), capitala sa i Ninurta ca zeu
suprem. n vest, un regat a crei capital a fost numit Mari
(din termenul Amurru, Cel Vestic), a nflorit pe malul vestic al
fluviului Eufrat; palatele sale magnifice erau decorate cu
picturi murale artnd-o pe Ishtar nvestind regele (Fig. 84),
dovedind prezena acelei zeie acolo. Pe pmnturile
muntoase ale hitiilor, unde acetia l venerau deja pe cel mai
mic dintre fiii lui Enlil, Adad, cu numele su hitit Teshub
(Zeul Vntului/Furtunii), a nceput s se ridice un regat cu
putere i aspiraii imperiale. ntre domeniul hitiilor i
Babilonia s-a ridicat un nou regat - acela al Asiriei - cu un
panteon identic celui al Sumerului i Akkadului, cu excepia
zeului naional care se numea Ashur - Cel Care Vede. El

mbin puterile i identitile lui Enlil i Anu, iar descrierile

sale ca un zeu n interiorul unui obiect circular naripat (Fig.
85) domin monumentele asiriene.

Iar n ndeprtata Afric exista Egiptul, Regatul Nilului.

Dar acolo o perioad haotic, numit de cercettori A doua
Perioad Intermediar, a determinat ieirea rii de pe scena
internaional pn la aa-numitul Nou Regat, care a nceput
n cca. anul 1650 .Chr.
Cercettorii gsesc cu greu o explicaie la ntrebarea de ce
a devenit agitat vechiul Orient Apropiat n acea perioad.
Noua dinastie (a 17-a) care a preluat controlul n Egipt s-a
extins cu o fervoare imperial, intrnd n Nubia n sud, Libia
n vest i terenurile de-a lungul coastei Mediteranei n est. Pe
domeniile hitiilor, un nou rege a trimis armata de-a lungul
barierei Munilor Taurus i de-a lungul coastei Mediteranei;
succesorul su a invadat Mari. n Babilon, poporul casiilor,
aprut de niciunde (de fapt din regiunea montan nord estic
de la grania cu Marea Caspic) a atacat Babilonul i a adus
sfritul brusc al dinastiei care ncepuse cu Hammurabi.
Deoarece fiecare naiune pretindea c pornete rzboiul n
numele sau la poruncile zeului su naional, conflictele n
cretere ar fi putut fi interpretate ca o btlie ntre zei prin
intermediul oamenilor. Un indiciu care pare s confirme

aceasta este faptul c numele teoforice ale faraonilor din

dinastia 18 au renunat la prefixul sau sufixul Ra sau Amon
n favoarea lui Thoth.

Schimbarea care a nceput cu Turmes I (uneori spus

Tutmos) n 1525 .Chr., a marcat de asemenea i nceputul
represiunii israeliilor. Motivul invocat de faraon este
edificator: Lansnd expediiile militare ctre Naharin, pe
Eufratul Superior, el se temea c israeliii ar fi putut deveni o
coloan a cincea intern. Motivul? Naharin era foarte
aproape de zona unde era aezat Harran i unde poporul era
alctuit din descendenii rudelor Patriarhilor.
Pe ct de mult explic raiunile opresiunii israeliilor, pe
att face inexplicabil de ce i mai ales pentru ce au trimis
egiptenii - care l venerau acum pe Thoth - armate pentru a
cuceri Harran. Este un mister care ne rmne n memorie.
Expediiile militare, pe de o parte, i asuprirea israeliilor,
culminnd cu edictul care cerea uciderea tuturor nounscuilor israelii de sex masculin, a ajuns la un apogeu n
vremea lui Turmes III i l-a obligat pe Moise s fug dup ce
a ridicat poporul su. El s-a putut ntoarce n Egipt din
pustiul Sinaiului numai dup moartea lui Tutmes III, n 1450
.Chr. Dup 17 ani, dup solicitri repetate i o serie de
nenorociri aduse de ctre Yahve peste Egipt i zeii si,
israeliii au fost lsai s plece i a nceput Exodul.

Dou ntmplri menionate n Biblie i o schimbare

major n Egipt indic implicaiile teologice asupra celorlalte
popoare ca un rezultat al miracolelor i minunilor atribuite
lui Yahve n sprijinul poporului su ales.
i cnd Jethro, Preotul Midian, socrul lui Moise, a auzit
de tot ce a fcut Dumnezeu pentru Moise i pentru poporul
su, Israel citim n capitolul 18 din Exodul, el a venit n
tabra israeliilor i, dup ce a ascultat ntreaga poveste a lui
Moise, Jethro a spus: Acum tiu c Yahve este mai mare
dect toi zeii; i a oferit sacrificii lui Yahve. Urmtoarea
ntmplare (descris n Numeri, capitolele 22-24) a avut loc
atunci cnd regele moabit l-a reinut pe clarvztorul Bile'am
(tradus i cu numele Bala'am) s opreasc naintarea
israeliilor. Dar spiritul lui Dumnezeu a venit peste Bilam i
ntr-o viziune divin el a vzut cum Casa lui Iacov a fost
binecuvntat de Yahve i cum cuvntul Su nu putea fi
Recunoaterea de ctre un preot neevreu i clarvztor a
puterilor i supremaiei lui Yahve a avut un efect neateptat
asupra familiei regale egiptene. n 1379 .Chr. - chiar cnd
israeliii i fceau intrarea n Canaan - un nou faraon i-a
schimbat numele n Akenaten - Aten fiind reprezentat de
Discul naripat (Fig. 86), a mutat capitala ntr-un loc nou i a
nceput s venereze un singur zeu. A fost un experiment de
scurt durat, cruia preoii lui Amon-Ra i-au pus capt
rapid... De scurt durat a fost de asemenea conceptul de
pace universal carensoea credina ntr-un Dumnezeu

n 1296 .Chr., armata egiptean care a invadat regiunea

Harran a fost nfrnt decisiv de ctre hitii, n btlia de la
Kadesh (unde este acum Libanul).
Deoarece hitiii i egiptenii s-au epuizat reciproc, era
momentul acum pentru asirieni s se afirme ei nii. O serie
de incursiuni n toate direciile a culminat cu recucerirea
Babilonului de ctre regele asirian Tukulti - Ninurta I - un
nume teoforic ce indica loialitatea religioas - i stpnirea
zeului Babilonului, Marduk. Ceea ce a urmat este tipic
pentru politeismul timpului: Departe de a denigra zeul, el a
fost adus n capitala asirian i, cnd a venit vremea pentru
ceremoniile Anului Nou, Marduk, i nu Ashur, a fost acela
care a aprut n vechile ritualuri. Aceast unificare a
bisericilor, pentru a folosi o expresie, nu a reuit s
opreasc epuizarea printre regatele cndva imperiale; i
pentru urmtoarele cteva secole, cele dou puteri de
odinioar ale Mesopotamiei s-au alturat Egiptului i
Regatului hitit n procesul de micorare a zelului cuceritor.
Fr ndoial retragerea tentaculelor imperiale a fcut
posibil evoluia spre prosperitate a oraelor-state din vestul
Asiei, n mod special de-a lungul coastei Mediteranei, n Asia
Mic, chiar n Arabia. Ridicarea lor, oricum, a devenit o
atracie pentru migraii i invadri din toate direciile.
Invadatori care veneau n vapoare -Popoarele Mrii cum i-

au numit egiptenii - au ncercat s se stabileasc n Egipt i

au sfrit prin a cuceri coasta Canaanului. n Asia Mic,
grecii au trimis o mie de nave mpotriva Troiei. Popoare care
vorbeau limbi indoeuropene i-au fcut drum n Asia Mic,
apoi n jos ctre fluviul Eufrat. naintaii perilor au nvlit
n Elam. n Arabia triburile care au devenit nstrite prin
controlul rutelor de comer, au pus ochii pe pmnturile
fertile de la nordul ei.
n Canaan, obosii de btliile frecvente purtate ntre ei de
ctre regii oraelor i domni peste tot n jurul lor, israeliii au
cerut lui Yahve prin naltul Preot Samuel: F-ne o singur
naiune, d-ne un rege!
Primul dintre ei a fost Saul; dup el a venit David i s-a
fcut apoi transferul capitalei la Ierusalim.
Biblia prezint Oamenii Domnului n timpul acelei
perioade, numindu-i chiar profei n strictul sens al
cuvntului: purttori de cuvnt ai lui Dumnezeu. Ei au dus
mesajele divine, dar erau mai mult prin oracolele preoeti
cunoscute celor din antichitate.
Doar dup construirea Templului lui Yahve acea profeie prezicerea lucrurilor ce urmau s se ntmple - a nceput s
se rspndeasc. i nu era nimic asemntor profeiilor
ebraice din Biblie, care mbinau predicile referitoare la
dreptate i moralitate cu prezicerea lucrurilor ce urmau s
vin, sau oriunde n lumea veche.
Perioada care acum este numit retrospectiv primul
mileniu .Chr. era de fapt ultimul mileniu din povestea
omului de 4000 de ani care a nceput cu ridicarea civilizaiei
sumeriene. Centrul dramei umane a crei poveste am spus-o
n Cronicile Pmntului era holocausul nuclear, cderea
Sumerului i Akkadului i predarea tafetei lui Avraam i
urmailor si. Acela a fost momentul de cumpn dup
primii 2000 de ani. Acum, urmtoarea jumtate a povetii,

ultimele dou milenii cu ceea ce a nceput n Sumer i o

vizit pe Pmnt a lui Anu, n cca. anul 3760 .Chr., va duce
de asemenea, ctre un sfrit.
Acesta, ntradevr, este firul de legtur a marilor profeii
biblice din acea vreme: Ciclul urmeaz s se nchid, ceea ce
a fost prezis la nceputul Anilor urmeaz s se adevereasc la
Sfritul Anilor.
Omenirii i s-a dat ocazia s se ciasc, s se ntoarc la
dreptate i moralitate, s recunoasc faptul c exist un
singur Dumnezeu, chiar un Dumnezeu al lui Elohim nsi.
Cu fiecare lume, viziune, actul simbolic al Profeilor strig
mesajul: Timpul se scurge; mari evenimente urmeaz s se
ntmple. Yahve nu caut moartea celor care fac ru - El vrea
ntoarcerea lor ctre dreptate. Oamenii nu i pot controla
Destinul, dar pot controla Soarta; oameni, regi, naiuni pot
alege cursul pe care s l urmeze. Dar dac rul va
predomina, dac nedreptatea va conduce relaiile dintre
oameni, dac naiunile vor continua s ridice sabia mpotriva
altor naiuni, toate vor fi judecate i condamnate n Ziua
Aa cum nsi Biblia ne informeaz, nu a fost un mesaj
ctre o audien receptiv. nconjurai de popoare care
preau s tie pe cine venereaz, evreilor li s-a cerut s adere
la standarde stricte cerute de un Dumnezeu nevzut, unul a
crui imagine era pur i simplu necunoscut. Adevraii
profei ai lui Yahve au avut mn liber s se confrunte cu
falii profei care pretindeau de asemenea c spun cuvntul
Domnului. Sacrificiile i donaiile ctre Templu vor ispi
toate pcatele, spuneau ultimii; Yahve nu vrea sacrificiul
vostru ci s trii n dreptate, spunea Isaia; Nu, nu, vine
Pacea, spuneau falii profei.
Pentru a fi crezui, Profeii biblici au recurs la miracole aa cum Moise, nvat de Dumnezeu, a recurs la miracole

pentru a obine de la faraon eliberarea israeliilor, apoi

pentru a-i convinge pe israelii de atotputernicia lui Yahve.
Biblia descrie n detaliu greutile cu care s-a confruntat
profetul Ilie n timpul domniei (n nordul regatului, Israel) lui
Ahab i a soiei sale feniciene Izabela, care a adus cu ea
venerarea zeului Canaanit, Ba'al. Dup ce i-a creat
reputaia fcnd o femeie srman s aib pentru totdeauna
fin i ulei i dup ce nviase un biat care murise, cea mai
mare provocare a lui Ilie a fost o confruntare cu profeii lui
Ba'al pe Muntele Crmei. Cine era adevratul profet urma
s se hotrasc n faa unei mari mulimi de oameni n
fruntea creia se afla regele, prin realizarea unui miracol: a
fost pregtit un sacrificiu pe o grmad de lemne, dar nu a
fost aprins niciun foc - focul urma s vin din cer. Profeii lui
Ba'al s-au rugat n numele lui Ba'al de diminea pn la
prnz, dar nu a fost niciun sunet sau rspuns (Regi I,
capitolul 18). Batjocorindu-i, Ilie a spus: Probabil c zeul
vostru doarme - de ce nu l strigai mai tare? i ei aa au
fcut, dar nimic nu s-a ntmplat. Atunci Ilie a luat pietre i a
reconstruit un altar lui Yahve care fusese n ruine, a aranjat
lemnele i taurul de sacrificiu pe ele i a cerut oamenilor s
picure ap pe altar, pentru a se asigura c nu exista un foc
ascuns acolo. El a chemat numele lui Yahve, Dumnezeul lui
Avraam i Isaac i Iacov; i un foc al lui Yahve a cobort
peste sacrificiu i altarul a izbucnit n flcri. Convini de
supremaia lui Yahve, oamenii i-au prins pe profeii lui Ba'al
i i-au ucis.
Dup ce Ilie a fost luat sus n cer ntr-un car n flcri,
discipolul i succesorul su Elisei a realizat, de asemenea,
minuni pentru a arta autenticitatea sa ca profet al lui
Yahve. El a transformat ap n snge, a nviat mori, a
umplut vase goale cu cantiti de ulei ntr-un minut, a hrnit
100 de oameni cu puine resturi de mncare i a fcut o bar

din metal s pluteasc pe ap.

Ct de credibile au fost atunci astfel de miracole? tim din
Biblie - povetile din vremea lui losif i Exodului - precum i
din nsi textele egiptene, cum ar fi Povetile Magicienilor
pentru c atunci curtea regal avea funcia sa de magicieni i
ghicitori. Mesopotamienii aveau preoi prevestitori i preoi de
oracole, prooroci i clarvztori i interprei de vise. Totui,
cnd tiina numit Critica Bibliei s-a rspndit n secolul 19
d.Chr., astfel de poveti privind miracolele s-au adugat la
credina c orice poveste din Biblie trebuia susinut din
surse independente pentru a fi crezut. Din fericire, printre
cele mai timpurii descoperiri ale arheologilor n secolul 19 a
fost o stel inscripionat de regele moabit Mesha, n care el
nu doar confirma informaiile cu privire la Iudeea n vremea
lui Ilie, dar a fost i una dintre rarele menionri extrabiblice
ale lui Yahve cu numele Su ntreg (Fig. 87). Dei nu este o
confirmare a miracolelor nsei, aceast descoperire - ca i
altele mai trziu - au venit s autentifice evenimente i
personaliti din Biblie.
n vreme ce textele i vestigiile descoperite de arheologi
ofer confirmri, ele arunc lumin de asemenea asupra
diferenelor profunde dintre profeii biblici i acei ghicitori ai
celorlalte naiuni. Chiar de la nceput, termenul ebraic Nebi
'im - tradus ca profet, dar care nsemna textual purttor de
cuvnt al lui Dumnezeu - explic faptul c magia i
prezicerile nu erau ale lor, ci ale lui Dumnezeu. Miracolele
erau ale Lui, iar ceea ce se prezicea era doar ceea ce
Dumnezeu poruncise. Mai mult dect s se poarte ca nite
angajai de curte, ca un profet yes-men, ei deseori criticau
pe cei mari i puternici pentru greeli personale sau decizii
oficiale eronate. Chiar regele David a fost mustrat pentru c a
rvnit la soia lui Uriah hititul.
Printr-o ciudat coinciden - dac aa a fost - la vremea

cnd David a cucerit Ierusalimul i a fcut paii principali

pentru a stabili Casa lui Yahve pe Platforma Sacr, declinul
i decderea a ceea ce s-a numit Vechea Asirie s-a ndreptat
abrupt spre final i, sub o nou dinastie, a aprut ceea ce
istoricii au numit perioada Neoasirian.
Nu mult dup ce Templul lui Yahve a fost construit,
Ierusalimul a nceput s atrag atenia conductorilor aflai
la distan. Ca o consecin direct, profeii si i-au
schimbat opiniile cu privire la arena internaional i au
inclus profeii cu privire la lume n ansamblul su n cadrul
profeiilor cu privire la Iudeea, regatul nordic separat al
Israelului, regii lor i popoarele lor. Era un punct de vedere
asupra lumii uluitor n scopul i concepia sa - al profeilor
care nainte de a se supune lui Dumnezeu, erau n mare
parte simpli ceteni.
Astfel de cunotine cu privire la teritorii i naiuni
ndeprtate, numele regilor lor (ntr-un exemplu, chiar
porecla unui rege), rutele lor comerciale i de comer, armele
lor i pregtirea forelor de lupt, trebuie s-i fi uimit chiar pe
regii din Iudeea din acel timp. O dat, cel puin, s-a gsit o
explicaie. A fost Hanani profetul care (avertizndu-l pe regele
iudeu n legtur cu un tratat cu arameii) i-a explicat regelui:
Bazndu-se pe cuvntul lui Yahve, pentru c este ochiul lui
Yahve care strbate ntregul Pmnt.
n Egipt, de asemenea, o perioad de dezbinare s-a
finalizat cnd o nou dinastie, a 22-a, a reunificat ara i a
relansat-o n relaiile internaionale. Primul rege al noii
dinastii, faraonul Sheshonq, a mrit implicarea istoric a
Egiptului, fiind primul conductor strin dintre marile puteri
de atunci care a intrat n for n Ierusalim i i-a confiscat
comorile (fr a distruge sau devasta Templul). Evenimentul
petrecut n 928 .Chr. este povestit n Regi I 14 i n Cronici II
12; totul a fost prezis de ctre Yahve regelui iudeu i nobilimii

sale conductoare din acea vreme de ctre profetul Semaiah;

a fost de asemenea un alt moment n care relatarea biblic a
fost confirmat de o nregistrare independent, din afar - n
acest caz de ctre faraon nsi, pe zidurile sudice ale
templului lui Amon din Karnak.
Invaziile asiriene n regatele evreieti, nregistrate cu
acuratee n Biblie, au nceput cu regatul nordic, Israel. Aici
din nou nregistrrile biblice sunt confirmate din plin de
analele regilor asirieni; Salmaneser III (858-824) chiar descrie
regele israelian Jehu nclinndu-se n faa lui, ntr-o scen
dominat de Discul naripat, simbol al lui Nibiru (Fig. 88a).
Cteva decenii mai trziu, un alt rege israelian a evitat un
atac pltind tribut regelui asirian Tiglat-Pileser III (745-727
.Chr.). Dar aceasta doar pentru a ctiga timp: n 722 .Chr.,
regele asirian Salmaneser V a intrat n mar n regatul
nordic, cucerind capitala sa, Samaria (Shomron - Micul
Sumer - n ebraic), exilnd regele i nobilimea. Doi ani mai
trziu, urmtorul rege asirian, Sargon II (721-705 .Chr.) a
exilat i restul populaiei - dnd natere enigmei celor Zece
Triburi Pierdute ale lui Isaer - i punnd capt independenei
acelui stat.

Regii asirieni ncepeau fiecare nregistrare a numeroaselor

lorcampanii militare cu cuvintele: n numele zeului meu
Ashur, dnd cuceririlor lor aura unor rzboaie religioase.
Cucerirea i asuprirea lui Israel au fost att de importante
nct Sargon, nregistrnd victoriile sale pe zidurile palatului
su, a nceput inscripia identificndu-se pe sine nsui ca
Sargon, cuceritorul Samariei i a ntregului inut al

Israelului. Cu acea realizate, vorbind peste tot despre

cuceririle sale, el a scris, Am extins teritoriul aparinnd lui
Ashur, regele zeilor.
n vreme ce acele catastrofe, potrivit Bibliei, s-au abtut
asupra nordului statului Israel deoarece conductorii i
poporul nu au luat n considerare avertismentele profeilor,
regii Iudeei din sud au fost mai ateni i pentru o vreme s-au
bucurat de o perioad de relativ pace. Dar asirienii au pus
ochii pe Ierusalim i templele sale; i din motive pe care
analele lor nu le explic, multe dintre expediiile lor militare
au nceput n zona Harran i s-au extins apoi ctre vest ctre
coasta Mediteranei. n mod semnificativ, analele regilor
asirieni, descriind cuceririle lor i teritoriile din zona Harran,
identific dup nume un ora numit Nahor i un ora numit
Laban - orae ce purtau numele fratelui i pe al cumnatului
lui Avraam.
Rndul Iudeei i n mod special al Ierusalimului s cad
prad atacurilor asirienilor nu s-a lsat ateptat. Sarcina
extinderii teritoriale i a comandei zeului Ashur peste Casa
lui Yahve a revenit lui Senacherib, fiul lui Sargon II i
succesorul su n 704 .Chr. Dorind s consolideze cuceririle
tatlui su i s pun capt rzvrtirilor repetate din
provinciile asiriene, el a dedicat cea de-a treia sa campanie
(701 .Chr) cuceririi Iudeii i a Ierusalimului.
Evenimentele i circumstanele acelei ncercri sunt
relatate pe larg deopotriv n analele asiriene, dar i n Biblie,
fcnd din aceasta unul dintre cele bine documentate
exemple ale veridicitii biblice. A fost, de asemenea, o alt
ntmplare care a artat veridicitatea profeiei biblice,
valoarea sa de ghid de preziceri, i scopul su de nelegere

Mai mult, exist aici dovezi fizice - pn chiar n zilele
noastre - confirmnd i ilustrnd un aspect important al
acelor evenimente; astfel c se poate vedea clar ct de
reale i adevrate sunt toate.
Cum am nceput s povestim acele evenimente, cu
cuvintele lui nsui Senacherib, s observm c aici
campania a nceput din nou mpotriva ndeprtatului
Ierusalim cu un ocol ctre pmntul hitiilor, zona Harran
i abia apoi s-a ntors ctre vest, spre coasta Mediteranei,
unde primul ora atacat a fost Sidon:
n a treia mea campanie am mers mpotriva hitiilor,
Luli, regele Sidonului, care inspir teroare
Strlucirea domnului meu i-a copleit
i-a spulberat peste mri i au disprut.
Splendoarea nimicitoare a Armei lui Ashur,
Domnul meu, a nimicit puternicele orae ale
Toi regii din Sidon pn la Arvad, Byblos, Ashdod,
Beth-Ammon, Moab i Adorn au adus
Daruri somptuoase;
Regele Ashkelon I a fost trimis n Asiria...
Inscripia (88b) continu:
Ct despre Ezechia Iudeul
Care nu s-a supus jugului meu
46 dintre oraele zidite puternice
Precum i oraele mici din vecintate
Care erau fr numr...
Le-am asaltat i luat i
200.150 de oameni btrni i tineri, femei i brbai
Cai, catri, cmile, mgari, bovine i oi
Le-am luat de la ei.

n ciuda acestor pierderi, Ezechia a rmas inflexibil deoarece profetul Isaia a profeit: Nu te teme de atacator,
pentru c Yahve i va impune spiritul Su, el va auzi o veste
i se va ntoarce pe teritoriul su i acolo va fi rpus de
sabie... Astfel a grit Yahve: regele Asiriei nu va intra n
acest ora! Pe drumul pe care a venit se va ntoarce, pentru
c eu protejez acest ora pentru Mine i de dragul lui David,
slujitorul meu (Regi II, capitolul 19).
Sfidat de Ezechia, Senacherib a continuat s scrie astfel n
analele sale:
n Ierusalim, l-am fcut pe Ezechia
Prizonier n palatul su regal,
Ca o pasre n colivie, nconjurndu-l
Cu anuri, pedepsind pe cei care
Ieeau prin porile oraului.
Am prsit atunci inuturile regatului lui Ezechia i le-am
cedat regilor oraelor-state Ashod i Ekron i Gaza - orae
filistene - i am crescut tributul pentru Ezechia, scria
Senacherib; i apoi a nscris ca tributul acelui Ezechia s-mi
fie trimis la Ninive.
Aadar, aproape imperceptibil, analele nu menioneaz nici
cucerirea Ierusalimului, nici prinderea regilor si - doar
impunerea unui tribut greu: aur, argint, pietre preioase,
stibiu, pietre roii tiate, mobilier ncrustat cu filde, coli de
elefant i toate felurile de comori valoroase.
Laudele omit s spun ce s-a ntmplat cu adevrat la
Ierusalim: sursa pentru povestea complet rmne Biblia.
Aceasta consemneaz n Regi II, capitolul 20 i, la fel, n
cartea profetului Isaia i n Cronici c n a 14-lea an al lui
Ezechia, Senacherib, regele Asiriei a venit peste oraele
fortificate ale Iudeei, i le-a cucerit. Atunci Ezechia, regele
Iudeei, i-a trimis veste regelui Asiriei, care era n Lachish,
spunndu-i: Am greit; ntoarce-te i orice mi vei impune voi

suporta. Astfel regele Asiriei i-a impus lui Ezechia, regele

Iudeei, 300 de lingouri din argint i 30 din aur; Ezechia le-a
pltit, inclusiv un plus ce consta n bronz ncrustat de la
templu i uile palatului, pe care i le-a dat lui Senacherib.

Dar regele Asiriei nu a respectat acordul. n loc s se

retrag n Asiria, el a trimis o mare armat mpotriva
capitalei Iudeei; i cum era tactica de asediu a asirienilor,
primul lucru pe care l-au fcut atacatorii a fost s distrug
rezervoarele cu ap ale oraului. Tactica mergea oriunde, dar
nu n Ierusalim. Pentru c, asirienii nu tiau, Ezechia avea
un tunel pentru ap spat sub zidurile oraului, deviind
apele mbelugate ale Izvorului Gihon ctre bazinul Silo 'am
n interiorul oraului. Acest tunel de ap subteran secret a
furnizat ap proaspt oraului asediat, zdrnicind
planurile asirienilor.
Furioi pentru c asediul nu a reuit s supun oraul,
comandantul asirian a decis s declaneze un rzboi
psihologic. Vorbind ebraica, astfel ca aprtorii s poat
nelege, el a artat inutilitatea rezistenei. Niciunul dintre

zeii celorlalte naiuni nu-i putea salva; cine este acest Yahve
i de ce ar fi el mai bun pentru Ierusalim? El a fost un zeu
imperfect la fel ca ceilali...
Auzind toate acestea, Ezechia i-a pus hainele de jale i a
mers la Templul lui Yahve i s-a rugat la Yahve, Dumnezeul
Israelului care domnea peste heruvimi, singurul Dumnezeu
peste toate naiunile, Cel care a fcut Cerul i Pmntul.
Asigurndu-l c ruga sa a fost auzit, profetul a rennoit
promisiunea divin: regele asirian nu va intra n ora; el se
va ntoarce nfrnt i acolo va fi asasinat.
n acea noapte s-a ntmplat un miracol i prima parte a
profeiei s-a ndeplinit:
i a venit s treac n acea noapte,
C ngerul lui Yahve a naintat
i a distrus tabra asirienilor 185 de mii.
i la rsrit ia te uit: Toi erau mori.
Astfel c Senacherib, regele Asiriei, a plecat
i a cltorit napoi i a trit n Ninive.
Regi II 19:35-36
ntr-un postscriptum Biblia a consemnat c a doua parte a
profeiei s-a adeverit de asemenea, adugnd: i Senacherib
a plecat i a cltorit napoi la Ninive. i atunci cnd se
nchina n templu la zeul su Nisrokh, Adramelekh i
Sharezzer l-au lovit cu o sabie; i ei au fugit pe pmntul lui
Ararat. Fiul su, Esarhaddon, a devenit rege n locul su.
Postscriptumul biblic cu privire la modul n care a murit
Senacherib i-a nedumerit pe cercettori pentru c analele
regale asiriene au fcut din moartea regelui un mister. Doar
recent, cercettorii, cu ajutorul descoperirilor fcute de
arheologi, au confirmat relatarea biblic: Senacherib a fost
ntr-adevr asasinat (n anul 681 .Chr.) de ctre doi dintre fiii
si, iar motenitorul tronului a devenit un altul, fiul numit

Noi putem, de asemenea, s adugm un comentariu

pentru a confirma o dat n plus veridicitatea Bibliei.
La nceputul secolului 19, arheologii care cercetau
Ierusalimul au descoperit c Tunelul lui Ezechia nu era de
fapt un mit: c ntr-adevr tunelul subteran a servit ca o
conduct pentru furnizarea secret a apei n Ierusalim,
tiat prin stnca original a oraului sub zidurile de
aprare, din vremea regilor iudei!
n 1838, exploratorul Edward Robinson a fost prima
persoan din vremurile moderne care l-a traversat n toat
lungimea sa, 1 750 picioare1.
n urmtoarele decenii, ali exploratori renumii ai
Ierusalimului antic (Charles Warren, Charles Wilson, Claude
Conder, Conrad Schick) au examinat tunelul i coloanele sale
variate. El fcea ntr-adevr legtura ntre sursa de ap de la
Izvorul Gihon (n afara zidurilor de aprare) la bazinul
Silo'am n interiorul oraului (Fig. 89). Atunci, n 1880, nite
biei care se jucau au descoperit aproape de mijlocul
tunelului o inscripie care fusese fcut pe zid. Autoritile
turce ale timpului au cerut ca segmentul inscripionat pe zid
s fie scos i adus la Istanbul (capitala Turciei).

1750 picioare = 534 metri

S-a constatat atunci c inscripia (Fig. 90), ntr-o frumoas

scriere ebraic veche depe vremea regilor iudei comemora
finalizarea tunelului, atunci cnd lucrtorii lui Ezechia tind
prin piatr de la ambele capete s-au ntlnit chiar n acel loc
unde a fost gsit inscripia.
Inscripia (pe o bucat de piatr tiat din peretele
tunelului) care este expus la Muzeul Arheologic din
Istanbul, red urmtoarea poveste:
...tunelul. i aceasta este povestea breei. Cnd (lucrtorii
la tunel au ridicat) toporul fiecare spre tovarul su, i cnd
mai erau trei coi1 de spat (prin), s-a auzit o voce de om
chemnd pe tovarul su, pentru c era o sprtur n piatr
pe partea dreapt... i n ziua breei, sptorii au lovit fiecare
ctre tovarul su, topor ctre topor. i apa a nceput s
curg din sursa sa ctre bazin, 1200 de coi; i nlimea
stncii de deasupra capetelor sptorilor era 100 de coi.
Acurateea i veridicitatea relatrii biblice a evenimentelor
din Ierusalim se aplic evenimentelor de departe din Ninive,
cu privire la succesiunea la tronul Asiriei. A fost ntr-adevr o

1 cot = 0,664 m

poveste sngeroas care i-a asmuit pe fiii lui Senacherib s

se ridice mpotriva lui i care s-a terminat cu venirea la tron
a fiului cel mai tnr, Esarhaddon (pronunat i
Asarhaddon). Evenimentele sngeroase sunt descrise n
Analele lui Esarhaddon (pe vestigii cunoscute ca Prisma B) n
care el descrie norocul su de a conduce naintea frailor si
mai n vrst, ca rezultat al unei profeii fcute lui
Senacherib de ctre zeii Shamash i Adad - un noroc
acceptat de ctre marii zei ai Asiriei i Babilonului i de
ctre toi ceilali zei aflai n cer i pe Pmnt.
Sfritul sngeros al lui Senacherib a fost doar un act n
drama legat de rolul i poziia zeului Marduk. ncercarea
asirienilor de a-i ngenunchia pe babilonieni i n realitate de
a anexa Babilonul prin aducerea lui Marduk n capitala
asirian nu a funcionat i, peste decenii, Marduk s-a ntors
la poziia sa de onoare n Babilon. Textele sugereaz c un
aspect crucial al restauraiei zeului a fost nevoia de a celebra
festivalul Akitu al Noului An, n care Enuma elish era citit
public iar Renaterea lui Marduk era jucat ntr-o pies
privind patimile zeului n Babilon, i nu n alt parte. Pn la
vremea lui Tiglat-Pileser III, legitimitatea regelui presupunea
supunerea dinaintea lui Marduk nsui pn Marduk mi ia
amndou minile n ale sale (cuvintele regelui).
Pentru a asigura ansa lui Esarhaddon ca succesor al su,
Senacherib l-a numit vicerege al Babilonului (i s-a numit pe
sine nsui Rege al Sumerului i Akkadului). Cnd a
preluat tronul Esarhaddon a jurat solemn n prezena zeilor
Asiriei: Ashur, Sin, Shamash, Nebo i Marduk (Ishtar, dei
nu a fost prezent, a fost invocat n analele de mai trziu).
Dar toate acele eforturi, inclusiv religioase, au euat n
ncercarea de a aduce pace sau stabilitate. Deoarece
ncepnd cu secolul VII .Chr., inaugurnd a doua jumtate a
ceea ce a fost Ultimul Mileniu, numrnd de la nceputul

sumerian, tulburrile au cuprins marile capitale i s-au

extins n lumea veche.
Profeii biblici au prevzut toate acestea; era nceputul
Sfritului, anunau ei n numele lui Yahve.
n prevestirea scenariului evenimentelor ce urmau s vin,
Ierusalimul i Platforma Sacr urmau s fie locul central al
purificrii. Furia divin urma s se manifeste n primul rnd
mpotriva oraului i a populaiei sale pentru c l-au
abandonat pe Yahve i poruncile sale. Regii marilor naiuni
urmau s fie instrumente ale mniei lui Yahve. Dar apoi
fiecare dintre ei, la rndul lor, vor fi judecai n Ziua Judecii
Va fi o judecat peste toat umanitatea, pentru c Yahve are
o nemulumire fa de toate naiunile, a anunat profetul
Asiria, spunea profetul Isaia citndu-l pe Yahve, a fost
nuiaua pedepsei; el a prevzut trecerea asirienilor peste
multe naiuni, chiar invadarea Egiptului (o profeie care a fost
adevrat); atunci Asiria va fi judecat pentru pcatele sale;
Urma Babilonul, a spus profetul Ieremia; regele su va veni
peste Ierusalim, dar 70 de ani mai trziu (cum a i fost)
nsi Babilonul va fi ngenuncheat. Pcatele naiunilor mari
i mici, de la Egipt i Nubia pn la ndeprtata Chin (!)
urmau s fie judecate n Ziua lui Yahve.
Una cte una profeiile s-au ndeplinit. Pentru Egipt,
profetul Isaia a prevzut ocuparea sa de ctre forele asiriene
dup trei ani de rzboi. Profeia s-a adeverit n vremea lui
Esarhaddon, succesorul lui Senacherib. Ceea ce este
remarcabil, n afara ndeplinirii profeiei, este faptul c
nainte s duc armata sa spre vest, apoi spre sud ctre
Egipt, regele asirian a fcut un ocol prin Harran!
Aceasta se ntmpla n 675 .Chr. n acelai secol, nsi
soarta Asiriei era pecetluit. Un Babilon renscut sub regele
Nabopolassar a cucerit capitala asirian, Ninive, sprgnd

digurile rului pentru a inunda oraul - la fel cum a prezis

profetul Naum (1:8). Era anul 612 .Chr.
Rmiele armatei asiriene s-au retras - din toate locurile
- ctre Harran; dar acolo instrumentul mai important al
judecaii finale i-a fcut apariia. Va fi, i-a spus Yahve lui
Ieremia (Ieremia 5:15-16), o naiune ndeprtat... o naiune
a crei limb nu o cunoti deloc:
Un popor a venit dintr-o ar din nord,
O mare naiune se va ridica
Din deprtarea Pmntului.
Ei mnuiesc arcuri i spade,
Ei sunt cruzi, nu au mil.
Sunetul lor este ca urletul mrii.
Ei clresc cai
Aezai ca oteni.
Consemnrile mesopotamiene ale timpului vorbesc despre
apariia brusc, din nord, a neamului Umman - Manda probabil naintaii sciilor din Asia central, sau naintaii
mezilor din pmnturile muntoase pe care acum se afl
Iranul, sau o combinaie a ambelor neamuri. n 610 .Chr. ei
au cucerit Harran, unde se ascunseser rmiele armatei
asiriene i au preluat controlul asupra rutelor importante. n
605 .Chr. o armat egiptean condus de faraonul Necho a
invadat din nou - la fel cum a ncercat Tutmes III naintea
Exodului - i a reuit s cucereasc Naharin, pe Eufratul
Superior. Dar o armat aliat a babilonienilor i UmmanManda a dat imperiului egiptean o ultim lovitur, ntr-o
btlie crucial la Carcemish, lng Harran. Era aa cum a
profeit Ieremia cu privire la trufia Egiptului i a regelui su,
Ca un ru care izvorte i ca rspndirea valurilor
A fost Egiptul (zical)

Voi crete, voi acoperi Pmntul,

Voi lovi oraele tot ce locuiete acolo...
Dar n acea zi,
Ziua lui Yahve,
Domnul Savaot, va veni,
O zi a rsplatei.
Din pmntul din nord, pe fluviul Eufrat...
Aa a spus Yahve, Domnul lui Israel:
Am dat porunci lui Amon al Tebei,
i faraonului i peste Egipt i zeii si
i regii si - pe faraon i toi care se ncred n el:
n minile celor care caut s-i omoare,
n minile regelui Nabucodonosor al Babilonului
i n minile supuilor lui i voi da.
Ieremia, capitolul 46
Asiria a fost nfrnt - nvingtorul a devenit o victim.
Egiptul a fost nfrnt, iar zeii si au czut n dizgraie. Nu mai
exista nicio putere s stea n calea Babilonului - nici pentru
Babilon s joace rolul de nuia a mniei lui Yahve mpotriva
Iudeei i apoi s-i ntlneasc propria soart.
La conducerea Babilonului se afla acum un rege cu ambiii
de cezar. El a primit tronul ca o recunoatere pentru victoria
de la Carcemish i nume regesc de Nabucodonosor (al doilea),
un nume teoforic ce ngloba numele lui Nabu, fiul i
mesagerul lui Marduk. El nu a pierdut timpul i a lansat
campanii militare prin puterea stpnilor mei Naabu i
Marduk. n 597 .Chr., el i-a trimis forele militare n
Ierusalim, ostentativ, doar pentru a-l detrona pe regele
proegiptean, Jeho'iakim i pentru al nlocui cu fiul su,
Jeho'iachin, un tnr doar. S-a dovedit c a fost doar un test;
pentru c, ntr-un fel sau altul, el era destinat s joace un rol
pe care Yahve i l-a atribuit, de a pedepsi Ierusalimul pentru
pcatele poporului su; dar la final, Babilonul nsui va fi i

el judecat:
Acesta este cuvntul lui Yahve privind Babilonul Spus printre naiuni,
Ridic un stindard i proclam.
Nu neag nimic, anun:
Cucerit este Babilonul,
Domnul su este umilit, Marduk este ngrozit;
Idolii si sunt spulberai, fetiurile sale sunt umilite.
Pentru c o naiune din nord a venit peste el
Din nord;
i i vor pustii pmntul, lsndul fr locuitori.
Ieremia 50: l-3
Va fi o purificare a ntregului Pmnt, n care nu doar
naiunile, ci i zeii lor vor fi chemai s dea socoteal, a
artat Yahve, Domnul Savaot. Dar la finalul purificrii,
dup sosirea Zilei Domnului, Sionul va fi reconstruit i toate
naiunile lumii se vor strnge pentru a-l venera pe Yahve la
Cnd toate au fost spuse i fcute, a spus Isaia,
Ierusalimul i Templul su reconstruit vor fi singura Lumin
peste naiuni. Ierusalimul i va nfrunta Soarta, dar se va
ridica s-i ndeplineasc Destinul su:
i va veni s treac
La Sfritul Zilelor:
Muntele Templului lui Yahve
Va fi stabilit n faa tuturor munilor
i va fi slvit peste toate dealurile;
i toate naiunile se vor duce spre el.
i muli oameni vor veni i vor spune:
Venii, s ne suim la Muntele lui Yahve,
La Templul Dumnezeului lui Iacov, astfel
El ne va nva despre cile sale
i astfel vom urma calea Lui;

pentru c nvtura va veni din afara Sionului

i cuvntul Domnului de la Ierusalim.
Isaia 2:2-3
n desfurarea acelor evenimente i profeii cu privire la
marile puteri, la Ierusalim i Templul su i la ce urma s se
ntmple n Ultimele Zile, profeii de la Pmntul Sfnt s-au
alturat profetului Ezechiel, cruia i s-au artat Viziunile
Divine pe malurile rului Khabur, n ndeprtatul Harran.
Pentru c acolo, n Harran, drama uman i divin ce a
nceput odat cu intersectarea cilor lui Marduk i a lui
Avraam, urma s se apropie de final - chiar la vremea n care
Ierusalimul i Templul su urmau s nfrunte Soarta.
A fost intersectarea cilor lui Marduk i a lui Avraam n
Haran doar o simpl coinciden sau a fost ales Harran de
ctre o mn nevzut a Soartei?
Este o ntrebare scitoare, cutnd un rspuns divin,
pentru c locul pe care l-a ales Yahve pentru misiunea
ndrznea a lui Avraam i acolo unde a reparut Marduk
dup o absen de 1000 de ani, a fost mai trziu i locul
unde au nceput s se deruleze evenimente incredibile evenimente miraculoase, am putea spune. Acestea erau
ntmplri cu scop divin, influennd deopotriv cursul
destinului uman i al celui divin.
Evenimentele cheie, consemnate pentru posteritate de
martori oculari, au nceput i s-au finalizat cu ndeplinirea
profeiilor biblice referitoare la Egipt, Asiria i Babilon; ele au
inclus plecarea zeului din templul i din oraul su, urcarea
sa ctre cer i ntoarcerea sa din cer, jumtate de secol mai

i, pentru un motiv probabil mai degrab metafizic dect

geografic sau geopolitic, att de multe dintre evenimentele
cruciale ale ultimelor dou milenii - a numrtorii care a
nceput cnd zeii, ntrunii n consiliu, au decis s acorde
Omenirii civilizaia - au avut loc n Harran sau n preajma
Am menionat deja n trecere ocolul fcut de Esarhaddon
n Harran. Detaliile acelui pelerinaj au fost consemnate ntr-o
tbli care fcea parte din corespondena regal a lui
Asurbanipal, fiul i succesorul lui Esarhaddon. Atunci s-a
ntmplat c Esarhaddon, plnuind un atac asupra
Egiptului, s-a ndreptat ctre nord n loc de vest i a cutat
templul din pdurea de stejar, n Harran. Acolo el a vzut
pe zeul Sin sprijinit de slujitori, cu dou coroane pe capul
su. Zeul Nusku sttea naintea lui. Tatl majestii mele
regele a intrat n templu. Zeul a pus o coroan peste capul
su, spunnd: Vei merge ctre ri, acolo vei fi cuceritor! El
a plecat i a cucerit Egiptul (Nusku, tim din Lista Zeului
Sumerian, a fost un membru al grupului lui Sin).
Invadarea Egiptului de ctre Esarhaddon este un fapt
istoric, confirmnd pe deplin profeia lui Isaia. Detaliile
ocolului ctre Harran au venit s confirme n plus prezena
zeului Sin acolo. n 675 .Chr.; pentru c cteva decenii Sin
s-a nfuriat pe ora i poporul su i a plecat spre cer.
n zilele noastre Harran nc se afl acolo unde era pe
vremea lui Avraam i a familiei sale. n afara zidurilor
prbuite ale oraului (ziduri din vremea cuceririi islamice)
izvorul unde Iacov a ntlnit-o pe Rebecca, nc mai curge,
iar pe cmpiile nconjurtoare oile nc pasc aa cum fceau
acum patru milenii. n secolele trecute, Harran a fost un
centru de educaie i literatur, unde grecii de dup
Alexandru au obinut accesul la cunotiinele acumulate ale
caldeenilor (scrierile lui Berossus erau unul dintre ele), iar

mult mai trziu musulmanii i cretinii au fcut schimb de

culturi. Dar mndria acelui loc (Fig. 91) era templul dedicat
zeului Sin, n ale crui ruine se gseau mrturii scrise cu
privire la evenimentele referitoare la Nannar/Sin i care au
supravieuit mileniului.
Mrturiile nu erau vorbe n vnt; ele constau n
consemnri ale martorilor oculari. Nu erau martori anonimi,
ci o femeie numit Adda-Guppi i fiul ei, Nabuna'id. Ei nu
erau, cum se ntmpl n zilele noastre, un erif cu mama sa
care raporteaz apariia unui fenomen OZN ntr-o zon
nelocuit. Ea era nalta Preoteas a marelui templu al lui Sin,
un altar sacru i respectat de milenii naintea sa: fiul ei a fost
ultimul rege al celui mai puternic imperiu de pe Pmnt n
acele vremuri, Babilonul.
nalta Preoteas i fiul su, regele, au consemnat
evenimentele pe columne din piatr - stele inscripionate n
scriere cuneiform, nsoit de descrieri pictografice.
Patru dintre ele au fost descoperite n acest secol de ctre
arheologi i se crede c stele au fost puse de ctre rege i
mama sa n fiecare col al templului refcut pentru zeul Lunii
n Harran, E.HUL.HUL (Templul dublei bucurii). O pereche
de stele poart mrturia mamei, cealalt pereche cuprinde
cuvintele regelui. Stela preotesei Adda-Guppi, nalta
Preoteas a Templului, este cea care consemneaz plecarea i
ascensiunea la cer a zeului Sin; n inscripiile regelui
Nabuna'id apare ntoarcerea miraculoas a zeului. Cu un
evident sim al istoriei i cu experiena unui funcionar n
templu, Adda-Guppi furnizeaz n stela sa informaii precise
despre uimitoarele evenimente; datele, legate de cum era
atunci obiceiul anilor de domnie a regilor cunoscui, au putut
fi - i au fost - verificate de ctre cercettorii moderni.
n cea mai bine pstrat stel, nregistrat ca HIB, AddaGuppi ncepe mrturia sa scris (n limba Akkadian) astfel:

Eu sunt doamna Adda - Guppi,

Mama lui Nabuna 'id, regele Babilonului,
Devotat zeilor Sin, Ningal, Nusku
i Sadarnunna, zeitile mele.
Crora evlavia mea le nchin nc din copilria mea.
Ea s-a nscut, scria Adda-Guppi, n al 20-lea an al lui
Asurbanipal, regele Asiriei, la mijlocul secolului 7 .Chr. Dei
n inscripiile sale Adda-Guppi nu i consemneaz
genealogia, alte surse sugereaz c ea provine dintr-o
descenden distins. Ea a trit, potrivit inscripiilor sale, n
perioadele de domnie ale mai multor regi asirieni i
babilonieni, ajungnd la vrsta matur de 95 de ani cnd
avuseser loc evenimentele miraculoase. Cercettorii au gsit
listele sale regale care confirmau analele asiriene i

Iat aadar consemnarea primei ntmplri remarcabile,

cu propriile cuvinte ale preotesei Adda-Guppi:
Era n al 16-a an al lui Nabupolasar,

Rege al Babilonului, cnd Sin, stpnul zeilor,

s-a nfuriat pe oraul i pe templul su
i a plecat spre cer;
i oraul i poporul din el au czut n ruine.
Anul permite observaia c evenimentele - cunoscute din
celelalte surse - avuseser loc la acea vreme, confirmnd ceea
ce nregistrase Adda-Guppi. Pentru c anul respectiv era 610
.Chr. - cnd armata asirian nfrnt s-a retras la Harran
pentru o ultim oprire.
Exist destule chestiuni care necesit clarificri datorit
acestei afirmaii: A fost Sin furios pe ora i pe oamenii si
pentru c acetia i-au lsat pe asirieni s ptrund
nuntru? A decis el s plece din cauza asirienilor sau a
apropierii hoardelor neamului Umman-Manda? Cum, pe ce
cale a plecat el n cer i unde s-a dus? Spre alt loc pe Pmnt
sau departe de Pmnt, un loc ceresc? Scrierile Addei-Guppi
speculeaz asupra acestor chestiuni i pentru moment vom
lsa aceste ntrebri n ateptare.
Ceea ce spune nalta Preoteas este c, dup plecarea lui
Sin, oraul i poporul din el au czut n ruine. Unii
cercettori prefer s traduc cuvntul din inscripie ca
prsire pentru a descrie mai bine ceea ce s-a ntmplat
metropolei cndva nfloritoare, un ora pe care profetul
Ezechiel (27:23) l-a enumerat printre marile centre
comerciale internaionale ale vremii, specializate n tot felul
de lucruri, haine albastre i materiale de broderie, dulapuri
pentru veminte bogate, legate cu nururi i fcute din
stejar. ntr-adevr, pustiirea din oraul abandonat Harran ne
amintete cuvintele introductive biblice din Cartea Plngerii
despre Ierusalimul prsit i desacralizat: Ct de singuratic
este oraul, cndva plin de oameni! Cndva mare printre
naiuni, acum a devenit prbuit; odat regin printre
provincii, acum a devenit o amintire.

n timp ce ceilali au fugit, Adda-Guppi a rmas. n fiecare

zi, fr ncetare, zi i noapte, pentru luni, pentru ani, ea
mergea la altarele abandonate. n doliu, ea a renunat la
rochiile din ln fin, la bijuteriile ei, nu mai purta nici
argint, nici aur, renunnd la parfumuri sau uleiuri dulci
mirositoare. Ca o fantom cutreiernd printre altarele goale,
n haine zdrenuite eram mbrcat, veneam i plecam n
linite, scria ea.
Atunci, n zona sacr abandonat, ea a descoperit o mantie
care aparinuse cndva lui Sin. Trebuie s fi fost o mantie
splendid, una dintre acele variate mantii pe care le purtau
zeitile, aa cum sunt ele descrise pe monumentele din
Mesopotamia (Fig. 28). Marii Preotese dezndjduite,
descoperirea acelei mantii i-a prut a fi un semn de la zeu;
era ca i cum el i-ar fi dat deodat un semn al prezenei lui
fizice. Ea nu-i putea lua ochii de la vemntul sacru,
nendrznind s-l ating dect inndu-i tivul su. Ca i
cum nsui zeul ar fi fost acolo, ea s-a nchinat i n
rugciune i umilin a rostit urmtorul jurmnt:
Dac te vei ntoarce n oraul tu.
Tot poporul cu capul negru
Va venera divinitatea ta!
Poporul cu capul negru era termenul folosit de sumerieni
pentru a se descrie pe ei nii; i folosirea termenului de
ctre nalta Preoteas n Harran era foarte neobinuit.
Sumerul, ca o entitate politico-religioas, ncetase s existe
de aproape 1500 de ani naintea perioadei preotesei AddaGuppi, cnd teritoriul i capitala sa, oraul Ur, au czut
victim a norului nuclear n 2024 .Chr. Sumer, pn la
vremea lui Adda-Guppi, era doar o amintire sfnt, iar
capitala sa de odinioar, Ur, un loc al ruinelor, iar poporul
su (oamenii cu capul negru) erau mprtiai pe multe
teritorii. Cum putea atunci o nalt Preoteas din Harran s

promit zeului su Sin s restaureze domnia sa n

ndeprtatul Ur i s-l fac zeu al tuturor sumerienilor dac
ei erau dispersai?
Era o adevrat viziune a Rentoarcerii Exilului i o
Restaurare a unui zeu n vechiul su centru de cult, ce se
aseamn profeiilor biblice. Pentru a realiza asta, AddaGuppi a propus zeului un trg: Dac el s-ar putea ntoarce i
i-ar folosi autoritatea i puterile divine s-l fac pe fiul ei,
Nabuna'id urmtorul rege imperial, domnind n Babilon peste
teritoriile babiloniene i asiriene - Nabuna'id ar putea reface
templul lui Sin n Ur i va reinstaura venerarea lui Sin n
toate inuturile unde locuiete poporul cu capul negru!
Zeului Lunii i-a plcut ideea. Sin, stpnul zeilor Cerului
i Pmntului, pentru faptele mele bune, a privit peste mine
cu un zmbet; el a auzit rugciunile mele i a acceptat
jurmntul meu. Mnia din inima sa s-a linitit; cu Ehulhul,
templul lui Sin din Harran, reedina divin n care inima sa
s-a bucurat, el s-a mpcat; el a avut o schimbare n inima
Zeul zmbitor, a notat Adda-Guppi n inscripia sa, a
acceptat trgul:
Sin, stpnul zeilor,
A privit cu plcere la cuvintele mele.
Pe Nabuna 'id, unicul meu fiu,
Rodul pntecului meu,
La domnie l-a chemat Regatul Sumerului i Akkadului.
Toate inuturile de la grania Egiptului,
De la Marea Superioar ctre Marea de Jos,
n minile lui le-a ncredinat.
Copleit i recunosctoare, Adda-Guppi a ridicat minile
sale i respectuos, cu imploraie a mulumit zeului pentru
rostirea numelui lui Nabuna'id, chemarea lui la domnie.

Apoi ea l-a rugat pe zeu s asigure succesul lui Nabuna'id s-i conving pe ceilali mari zei s fie de partea lui
Nabuna'id n btliile lui cu inamicii, s-i dea putere pentru
mplinirea jurmntului, pentru a reconstrui templul
Ehulhul i s restaureze Harran n mreia sa.
ntr-un postscriptum adugat la inscripie cnd AddaGuppi avea 104 ani, era pe patul de moarte (sau cuvintele
sale au fost consemnate imediat dup moartea sa), textul
spunea c ambele pri i-au inut nelegerea: Eu nsmi
am vzut c s-a mplinit; Sin i-a onorat cuvntul pe care mi
l-a dat, pentru c Nabuna'id a devenit rege ntr-un nou
Sumer i Akkad (n 555 .Chr.); i Nabuna'id i-a inut
jurmntul de a restaura templul Ehulhul n Harran,
desvrindu-i structura. El a rennoit culmi lui Sin i al
soiei lui, Ningal - toate ritualurile uitate el le-a adus din
nou. Cuplul divin, nsoit de trimisul divin, Nusku i soia sa
(?) Sadarnunna s-a ntors n templul Ehulhul ntr-o
procesiune solemn i ceremonial.
Copia inscripiei de pe stel cuprinde 19 linii n plus
adugate, fr dubii, de fiul preotesei Adda-Guppi. n al 9-lea
an al lui Nabuna'id - n 546 .Chr. - Soarta a luat-o cu ea.
Nabuna'id, regele Babilonului, fiul ei, progenitura ei, a
ngropat corpul ei, nvelit n mantii (regale) i pnz alb
pur. El i-a mpodobit corpul cu ornamente frumoase din aur
cu pietre preioase minunate. Cu uleiuri dulci i-a uns corpul;
i a aezat-o s se odihneasc ntr-un loc secret.
Doliul pentru mama regelui a fost general. Oamenii din
Babilon i Borsippa, locuitori din regiuni ndeprtate, regi,
prini i guvernatori au venit de la grania Egiptului pe Marea
Superioar peste Marea de Jos - de la Mediteran pn la
Golful Persic. Doliul, care a inclus purtarea cenuii peste
cap, plngerea i tieturile autoprovocate, au durat apte zile.
nainte s ne ntoarcem la inscripiile lui Nabuna'id i la

povetile sale pline de miracole, trebuie s ne ntrebm cum dac ceea ce a consemnat Adda-Guppi este adevrat - a
reuit ea s comunice cu o zeitate care, potrivit afirmaiei
preotesei, nu mai era de mult n templu sau n ora, ci era de
fapt plecat sau urcat n cer.
Prima parte, aceea n care Adda-Guppi s-a adresat zeului
ei, este simpl: rugciunea, adresnd rugile ei zeului.
Rugciunea ca o cale de a aduce naintea zeitii, temerile i
grijile, cernd sntate i noroc sau via lung, chiar
cutnd ndrumare pentru alegerea corect ntre alternative,
este nc folosit. Chiar din perioada cnd a aprut scrierea
n Sumer, au fost consemnate rugciunile i apelurile la zei.
ntr-adevr, rugciunea ca mijloc de comunicare cu zeitatea
cuiva a precedat probabil cuvntul scris i, potrivit Bibliei, a
nceput cnd umanitatea a devenit Homo Sapiens; Era atunci
cnd s-a nscut Enosh (Omul Homo Sapiens), nepotul lui
Adam i al Evei, cnd a nceput s cheme numele lui
Dumnezeu (Geneza 4:26).
Atingnd tivul mantiei zeului, nchinndu-se ea nsi cu
mare umilin, Adda - Guppi s-a rugat la Sin. Ea a fcut asta
n fiecare zi pn el i-a auzit rugciunile i a rspuns.
Acum ajungem la partea cea mai delicat - cum a rspuns
Sin, cum au putut cuvintele sau mesajul su s ajung la
Marea Preoteas?
nsi inscripia ne ofer rspunsul: rspunsul zeului i-a
venit ei n vis. Cnd ea i-a pierdut cunotina ntr-un somn
ca o trans, zeul i-a aprut ntr-un vis:
n vis
Sin, stpnul zeilor,
i-a ntins cele dou mini spre mine.
El mi-a vorbit, astfel:
Pentru tine
Zeii se vor ntoarce s locuiasc n Harran.

Voi ncredina fiului tu Nabuna 'id

Reedina divin din Harran.
El va reconstrui Ehulhul,
Va desvri structura sa;
El va reface Harran i o va face
Mai bun dect a fost nainte.
O astfel de cale de comunicare, de la o zeitate ctre un om,
nu este deloc neobinuit; ntr-adevr, era una dintre cele
mai folosite. Peste tot, regii din lumea antic, preoii,
patriarhii i profeii primeau cuvntul divin prin intermediul
viselor. Ei puteau fi oracoli de vise sau semne, uneori doar
prin cuvinte, alteori cuprinznd viziuni. De fapt, nsi Biblia
l citeaz pe Yahve spunnd fratelui i surorii lui Moise n
timpul Exodului: Dac este un profet printre voi, Eu,
Domnul, m voi face cunoscut lui ntr-o viziune i i voi vorbi
ntr-un vis.
De asemenea, Nabuna'id a consemnat comunicarea prin
intermediul viselor. Dar inscripiile sale spun mai mult: un
eveniment unic i o teofanie neobinuit. Cele dou stele ale
sale (nregistrate de cercettori ca H2A i H2B) au fost
mpodobite la vrf cu o descriere a regelui innd n mini un
lucru neobinuit i avnd n fa trei corpuri cereti, zeii
planetari pe care el i venera (Fig. 92). Inscripia lung de
dedesubt ncepe chiar cu marele miracol i unicitatea sa
Acesta este marele miracol al lui Sin
Fcut de zei i zeie
Nu s-a mai ntmplat pe pmnt
Din zilele vechiului necunoscut;
C oamenii de pe Pmnt
Nu au vzut i nu au gsit scris
Pe tblie din zilele vechi:
C divinul Sin,
Stpnul zeilor i zeielor,

A cobort din ceruri n vederea deplin a lui Nabuna 'id,

Regele Babilonului.

Afirmaia c acesta a fost un miracol unic era justificat,

pentru c evenimentul a determinat deopotriv o ntoarcere a
unei zeiti i o teofanie - dou aspecte ale interaciunii
divine cu oamenii care, aa cum subliniaz cu atenie
inscripia, nu erau necunoscute n Vechile Zile.
Nu tim dac Nabuna'id (cruia unii cercettori i-au spus
primul arheolog datorit nclinaiei pentru descoperirile i
spturile fcute la ruinele locurilor antice) a fcut afirmaia
pentru a fi n siguran sau era de fapt familiarizat, prin
intermediul vechilor tblie, cu astfel de evenimente care
avuseser loc, ntr-adevr, departe i n urm cu mult timp;
dar, n fapt, astfel de evenimente s-au ntmplat.
Astfel, n vremurile agitate care s-au terminat cu cderea
imperiului sumerian n cca. 2000 .Chr., zeul Enlil, care era
departe, s-a grbit spre Sumer cnd a aflat c oraul su,

Nippur, era n pericol. Potrivit unei inscripii a regelui

sumerian Shu-Sin, Enlil s-a ntors zburnd de la un orizont
la altul; de la sud spre nord el a cltorit; prin ceruri, peste
Pmnt el s-a grbit.
Acea ntoarcere, oricum, a fost brusc, neprevzut i nu
era parte a unei teofanii.
n urm cu 500 de ani - aproape 1000 de ani naintea
ntoarcerii i teofaniei lui Sin - cea mai mare teofanie
nregistrat a avut loc n peninsula Sinai, n timpul Exodului
israeliilor din Egipt. Atenionai dinainte i anunai cum s
se pregteasc pentru eveniment, Copiii lui Israel - toi cei
600 000 - au fost martori la coborrea Domnului peste
Muntele Sinai. Biblia subliniaz c aceasta s-a fcut la
vederea deplin a tuturor oamenilor (Exodul 19:11). Dar
acea mare teofanie nu a fost o ntoarcere.
Astfel de sosiri i plecri divine, inclusiv urcarea i
coborrea lui Sin ctre i din cer, presupuneau faptul c
corespunztoare - i ntr-adevr aveau. Yahve a aterizat pe
Muntele Sinai ntr-un obiect pe care Biblia l-a numit Kabod,
care aprea ca un foc devorator (Exodul 24:11); profetul
Ezechiel a descris Kabod (tradus n mod obinuit ca glorie,
dar care nsemna literalmente lucrul greu) ca un vehicul
luminos i radiant echipat cu roi n interiorul roilor. El
poate s fi avut n minte ceva comparabil cu carul circular n
care era descris zeul asirian Ashur (Fig. 85). Ninurta deinea
Imdugud, Pasrea Neagr Divin; i Marduk avea un
adpost special construit n zona sa sacr dinBabilon pentru
Cltorul su Suprem; era probabil acelai vehicul pe care
egiptenii l-au numit Barca Cereasc a lui Ra.
Dar Sin cu sosirile i plecrile sale cereti?
Faptul c el deinea ntradevr astfel de aparat pentru zbor
- o cerin esenial pentru plecrile spre cer i ntoarceri

consemnate n inscripiile din Harran - este atestat n multe

imnuri adresate lui. Unul sumerian, descriind zborul lui Sin
peste ndrgitul su ora Ur, a fcut referire la Barca
Cereasc a zeului ca fiind gloria sa:
Tat Nannar,
Stpnul lui Ur
A crui glorie este Barca Cerului sacr...
Cnd n Barca Cerului cobori,
Tu eti glorios.
Enlil a mpodobit mna ta cu un sceptru,
Venic cnd peste Ur n Barca Sacr tu urci.
Dei nicio descriere a Brcii Cerului a zeului Lunii nu a
fost identificat pn acum, o posibil descriere nu exist.
Aezat peste ruta principal care leag Estul i Vestul peste
rul Iordanului, se afl Ierihonul, unul dintre cele mai vechi
orae cunoscute. Biblia (i celelalte texte vechi) se refer la el
ca la Oraul zeului Lunii - care este ceea ce nseamn
numele biblic Yeriho. Acolo profetului Ilie (secolul 9 .Chr.) i-a
spus Domnul biblic s traverseze rul Iordan pentru a fi luat
ctre cer ntr-un car n flcri. Nu era, cum a fost descris n
Regi II capitolul 2, o ntmplare, ci o ntlnire aranjat.
ncepnd cltoria sa final dintr-un loc numit Gilgal,
profetul a fost nsoit de ajutorul su Elisei i un grup de
discipoli. Cnd au ajuns n Ierihon, discipolii l-au ntrebat pe
Elisei: tii c Domnul l va lua pe nvtor astzi? i Elisei
ncuviinnd, le-a spus s fac linite.
Cnd au ajuns la Iordan, Ilie a insistat ca ceilali s
rmn n urma sa. 50 dintre discipolii si au avansat spre
marginea rului i s-au oprit; dar Elisei nu a plecat. Atunci
Ilie a luat mantia sa, a nfurat-o, a lovit apa i a mprit-o
la dreapta i la stnga i cele dou pri au fost desprite de
pmnt uscat. Atunci, pe cealalt parte a Iordanului,
Un car n flcri cu cai nflcrai

Au aprut deodat
i s-au desprit unul de cellalt;
i Ilie a urcat la cer ntr-un vrtej de vnt.
n anii 1920, o expediie arheologic trimis de Vatican a
nceput spturile la un loc n Iordania numit Tell Ghassul,
Muntele Mesagerului. Vechimea sa se ntinde n mileniile
din urm, aici descoperindu-se cteva dintre cele mai vechi
locuine din Orientul Apropiat antic. Pe cteva dintre zidurile
prbuite, arheologii au descoperit picturi murale frumoase
i neobinuite, n culori variate. Una dintre ele descrie o
stea care arat mai mult ca o busol ce indic principalele
puncte cardinale i subdiviziunile sale; alta arat o zeitate
aezat primind o procesiune ritual. Celelalte picturi murale
arat obiecte negre ca nite bulbi cu guri asemntoare
ochilor i picioare lungi (Fig. 93); cea din urm putea fi foarte
bine un fel de car n flcri care l-a purtat pe Ilie spre cer.
ntr-adevr, locul putea fi foarte bine chiar locul de unde a
urcat Ilie: stnd acolo, n vrful muntelui, se putea vedea
foarte bine rul Iordan i nu departe, sub el, licrind la
distan, oraul Ierihon.
Potrivit tradiiei evreieti, profetul Ilie se va ntoarce ntr-o
zi s anune Timpul Mesianic.
Faptul c Adda-Guppi i fiul ei, Nabuna'id, s-au gndit c
un astfel de timp a sosit ntr-adevr, semnalat i indicat prin
ntoarcerea zeului Lunii, este evident. Ei ateptau Timpul lor
Mesianic s vesteasc o er de pace i prosperitate, o nou
er care ar fi putut ncepe cu refacerea i reconsacrarea
Templului din Harran.

Faptul c viziunile profetice similare avuseser loc n

aproximativ acelai timp cu cele privind Dumnezeu i
Templul din Ierusalim este, pede o parte, greu de neles. Dar
acesta este de fapt subiectul profeiilor lui Ezechiel - care
ncep cnd cerurile s-au deschis i el a vzut un car ceresc
radiant venind ntr-un vrtej de vnt.
Cronologia furnizat de inscripiile din Harran, verificat
de cercettori prin analele asiriene i babiloniene, indic
faptul c Adda-Guppi s-a nscut n cca. anul 650 .Chr.; c
Sin a plecat din templul su din Harran n 610 .Chr. - i s-a
ntors n 556 .Chr. Aceasta a fost exact aceeai perioad n
care Ezechiel, care fusese un preot n Ierusalim, a fost
chemat s profeeasc atunci cnd era printre iudeii exilai n
nordul Mesopotamiei. Avem de la el exact aceeai dat: era n
a cincea zi din luna a patra n al 5-lea an al exilului regelui
iudeu Jeho'iachin, cnd eram printre exilai pe malurile
rului Khebar cnd cerurile s-au deschis i am avut viziuni
divine, scria Ezechiel chiar la nceputul profeiilor sale. Era
anul 592 .Chr.!
Rul Khebar (sau Khabur, cum este cunoscut acum) este
unul dintre afluenii marelui fluviu Eufrat care izvorte n
munii aflai n Turcia de astzi. Nu departe, la est de rul
Khabur, se afl un alt important afluent al Eufratului, rul
Balikh; i pe rmurile lui Balikh a fost situat de milenii
oraul Harran.

Ezechiel se afla el nsui att de departe de Ierusalim, pe

malurile unui ru din Mesopotamia Superioar, la marginea
teritoriului hitit (ara Hatti n scrierile cuneiforme) pentru
c el era unul dintre miile de nobili, preoi i conductori ai
Iudeei ce fuseser prini i trimii n exil de ctre
Nabucodonosor, regele babilonian care stpnea peste
Ierusalim n anul 597 .Chr.
Acele evenimente tragice sunt povestite detaliat n a doua
carte a Regilor, n principal n 24:8-12. n mod remarcabil, o
tbli babilonian (parte din seria cunoscut cu numele de
Cronicile Babiloniene) a consemnat chiar aceleai evenimente,
cu datele care se potrivesc.
De asemenea, este remarcabil faptul c aceast expediie
babilonian - la fel ca cea anterioar a lui Esarhaddon - a
fost lansat tot dintr-un loc de lng Harran!
Inscripiile babiloniene detaliaz cucerirea Ierusalimului,
prinderea regelui su, nlocuirea sa la tronul Iudeei cu un alt
rege, ales de Nabucodonosor, i exilarea - trimiterea ctre
Babilon - a regelui capturat i a conductorilor teritoriului.
Aa se explic faptul c preotul Ezechiel se gsea el nsui pe
malurile rului Khabur n provincia Harran.
Pentru un timp - teoretic pentru primii cinci ani - exilaii
au crezut c dezastrul care s-a abtut asupra lor i asupra
oraului i templului lor era o chestiune temporar. Dei
regele iudeu Ioachim era inut n captivitate, el era n via.
Dei comorile Templului au fost duse n Babilon ca prad de
rzboi, Templul era intact; i majoritatea poporului a rmas
pe teritoriul su. Exilaii, meninnd contactul cu
Ierusalimul prin mesageri, aveau mari sperane c ntr-o zi
Ioachim va fi reinstalat, iar Templul readus la gloria sa sacr.
Dar curnd dup ce Ezechiel a fost chemat s profeeasc,
n al 5-lea an de exil (592 .Chr.), Domnul Dumnezeu l-a
nvat s vesteasc poporului c exilul, prdarea

Ierusalimului i a Templului su nu erau sfritul chinului.

Erau doar un avertisment transmis poporului pentru a-i
ndrepta comportamentul - s se poarte drept unul fa de
cellalt i s-l venereze pe Yahve conform Poruncilor. Dar, i-a
spus Yahve lui Ezechiel, oamenii nu i-au ndreptat
comportamentul; ei mai degrab s-au ntors s se roage la
zei strini. n cazul acesta, a spus Domnul Dumnezeu,
Ierusalimul va fi din nou atacat i de aceast dat el va fi
distrus n ntregime, templul i toate celelalte.
Instrumentul mniei sale, a spus Yahve, va fi din nou
regele Babilonului. Este un fapt cunoscut i confirmat de
istorie c n 587 .Chr., Nabucodonosor, neavnd ncredere n
regele pe care el nsui l pusese la tronul Iudeei, a atacat din
nou Ierusalimul. De aceast dat, n 586 .Chr., oraul
cucerit a fost ars i lsat n ruine; aa a fost i Templul lui
Yahve pe care Solomon l construise cu jumtate de mileniu
Acest fapt este cunoscut. Dar ceea ce se cunoate mai
puin este motivul pentru care oamenii i conductorii
rmai ai Ierusalimului nu au luat n serios avertismentul.
Era convingerea lor c Yahve a prsit Pmntul!
Potrivit cu ceea ce ar fi considerat el viziunea
ndeprtat, Ezechiel a spus-o Btrnilor Ierusalimului n
spatele uilor nchise, apoi i-a luat ntr-un tur vizionar pe
strzile oraului. Se putea vorbi de o prbuire complet a
justiiei i a ceremoniilor religioase, deoarece cuvntul rostit
Yahve nu ne mai vede -Yahve a prsit Pmntul!
Era n 610 .Chr., potrivit inscripiilor din Harran, cnd
Sin, stpnul zeilor, s-a nfuriat pe oraul su i pe templu
i s-a dus n cer. Era n 597 .Chr. - doar un deceniu mai
trziu - cnd Yahve s-a suprat pe oraul su Ierusalim i pe
poporul su i l-a lsat pe regele necircumcis Nabucodonosor

- un rege prin bunvoina lui Marduk - s intre, s jefuiasc

i s distrug Templul lui Yahve.
Poporul a strigat: Domnul a prsit Pmntul!
Ei nu tiau cnd, i dac, se va ntoarce El.


Marile sperane ale mamei pentru fiul su, Nabuna'id, ca

reunificator al Sumerului i Akkaadului i restaurator al
Vechilor Zile nu l-au pregtit pe noul rege pentru tulburrile
cu care s-a confruntat. El s-a ateptat la provocrile militare;
dar nu a anticipat fervoarea religioas care a cuprins
domeniile sale.
Nu mult dup ce a preluat tronul din Babilon, n urma
nelegerii dintre mama sa i Sin, el a neles c Marduk odat mutat i revenit n Babilon - trebuia s fie linitit i s i
se dea ce i se cuvine. ntr-o serie de vise prevestitoare,
adevrate sau pretinse, Nabuna'id a anunat obinerea
binecuvntrii lui Marduk (i a lui Nabu), nu doar pentru
domnia sa, ci i asupra reconstruirii promise a templului lui
Sin n Harran.
Pentru a nu lsa nicio ndoial asupra importanei acelor
mesaje din vis, regele a spus c Marduk l-a ntrebat n mod
special dac vzuse Marea Stea, planeta lui Marduk - o
referin direct la Nibiru - i ce alte planete erau n
conjuncie cu ea. Cnd regele a spus c erau zeul 30 (Luna,
echivalentul astral al lui Sin) i zeul 15 (Ishtar i planeta
echivalent, Venus), i s-a spus: Nu sunt semne rele n
Dar nici poporul din Harran, nici cel din Babilon nu erau
fericii cu aceast domnie bicefal a zeilor, nici discipolii lui

Ishtar i ceilali zei. Sin, al crui templu n Harran a fost

restaurat, a cerut ca marele su templu din Ur s devin, de
asemenea, un centru de venerare. Ishtar s-a plns c templul
su de aur din Uruk (Erech) trebuia reconstruit i a cerut s
i se dea din nou un car tras de apte lei. i, aa cum se poate
citi printre rndurile inscripiei regelui, el se sturase de
acele solicitri ale mulimii de zei i preoi.
ntrun text numit de cercettori Nabuna'id i Clerul din
Babilon (pe o tbli aflat acum la Muzeul Britanic), preoii
lui Marduk au prezentat o list de nvinuiri i acuzaii
mpotriva lui Nabuna'id; ei au nceput cu problemele de ordin
civil (legea i ordinea nu au fost proclamate de el) apoi cu
neglijarea economiei (fermierii sunt corupi, rutele
comerciale sunt blocate) i rzboaiele fr succes (nobilii au
fost ucii n rzboi), pn la cele mai serioase acuzaii:
sacrilegiul - El a fcut imaginea unui zeu
Pe care nimeni nu l-a mai vzut nainte pe pmnt;
El l-a pus n templu, l-a ridicat pe un piedestal...
l-a mpodobit cu lapislazuli, ncoronat cu o diadem...
Era statuia unei zeiti ciudate - care nu a mai fost vzut
nainte, au accentuat preoii - cu prul ajungnd pn la
piedestal. Era att de neobinuit, nct nici chiar Enki i
Ninmah nu l-au putut concepe, att de ciudat nct nici
chiar nvatul Adapa nu-i tia numele. Pentru ca lucrurile
s mearg i mai ru, dou bestii neobinuite au fost
sculptate ca gardieni ai si: una reprezenta Demonul
Potopului, iar cealalt Taurul Slbatic. Pentru a aduga
sacrilegiului o nou insult, regele a pus acei montri n
templul Esagil al lui Marduk i a anunat c festivalul Akitu
(Anul Nou) prin care se echivala Marduk cu planeta Nibiru,
ar fi putut s nu mai fie srbtorit de aici ncolo.
Preoii au anunat pe toi care vroiau s aud c zeitatea
protectoare a lui Nabuna'id i-a devenit ostil, c fostul

favorit al zeilor a fost sortit acum nenorocirii. Astfel,

Nabuna'id a anunat c el urmeaz s plece din Babilon
ntr-o expediie ctre o religie ndeprtat. El l-a numit ca
regent pe fiul su, Belshar-uzur (Bel/Marduk protejeaz
regele - Belaar din Cartea lui Daniel).
Destinaia era Arabia, iar grupul care la nsoit includea,
dup cum atest diferitele inscripii, evrei ntre care se aflau
i iudei exilai. Principala sa baz a fost oraul numit Teima
(un nume existent n Biblie), el stabilind ase aezri pentru
discipolii si; cinci dintre ele au fost enumerate, o mie de ani
mai trziu, de surse islamice, ca orae evreieti. Unii
consider c Nabuna'id n izolarea deertului se gndea s
instaureze monoteismul; un fragment de text descoperit
printre manuscrisele de la Marea Moart n consemnrile din
Qumran, c Nabuna'id a fost lovit de o neplcut boal de
piele n Teima i a fost vindecat numai dup ce un evreu i-a
spus s-l onoreze pe Domnul cel Preanalt. Cea mai mare
parte a dovezilor sugereaz, oricum, c el era credincios lui
Sin, zeul Lunii, simbolizat prin semilun - un simbol preluat
n timp de credincioii arabi ai lui Allah.
Indiferent crei credine religioase i era devotat Nabuna'id,
el a fost proscris de ctre preoii din Babilon. i astfel, cnd
conductorii ahemenizi ai Persiei au preluat regatul mezilor
i s-au extins n Mesopotamia, regele Cyrus a fost binevenit
n Babilon, nu ca un cuceritor, ci ca un eliberator. nelept, el
a mers n templul Esagil imediat ce a intrat n ora i a luat
minile lui Marduk cu amndou minile sale.
Era n anul 539 .Chr.; el marca sfritul prevestit al
existenei independente a BabiIonului.
Unul dintre primele sale acte a fost s fac o proclamaie
ce permitea evreilor exilai s se ntoarc n Iudeea i
reconstruirea Templului din Ierusalim. Edictul, consemnat n
Cilindrul lui Cyrus care se afl acum la Muzeul Britanic,

confirm relatarea din Biblie, potrivit creia Cyrus a fost

nsrcinat s fac asta de ctre Yahve, Domnul Cerului.
Reconstruirea Templului sub conducerea lui Ezra i
Neemia, a fost finalizat n 516 .Chr. - 70 de ani dup
distrugerea sa, aa cum a prevestit Ieremia.
Povestea sfritului Babilonului este spus n Biblie, ntruna dintre cele mai enigmatice cri, Cartea lui Daniel.
Prezentndu-l pe Daniel ca unul dintre iudeii exilai, luai de
babiloni n captivitate, ea povestete cum a fost el ales,
mpreun cu ali trei prieteni, pentru a servi la curtea lui
Nabucodonosor i cum (ca Iosif n Egipt) a fost promovat nalt
funcionar dup interpretarea unor semne ale viselor regelui
cu privire la evenimente viitoare.
Cartea continu cu evenimente din vremea lui Belaar
cnd, n timpul unui mare banchet, o mn care plutea a
aprut i a scris pe perete MENE MENE TEKEL UPHARSIN.
Nimeni dintre vrjitorii i clarvztorii regelui nu a putut
descifra inscripia. n ultim instan, Daniel - retras acum a fost chemat. Daniel a explicat nelesul regelui babilonian:
Domnul a numrat zilele domniei tale; ai fost cntrit i
gsit necorespunztor; domnia ta se va sfri, mprit ntre
mezi i peri.
Dup aceasta, Daniel nsui a nceput s aib vise
prevestitoare i viziune despre viitor n care Strvechiul i
arhanghelii si jucau un rol cheie. Nedumerit n privina
viselor i viziunilor sale, Daniel a cerut explicaii ngerilor. De
fiecare dat, ele deveneau predicii ale evenimentelor viitoare
ce s-au ntmplat dup cderea Babilonului, chiar n urma
mplinirii profeiei de 70 de ani a reconstruirii Templului.
Ridicarea i cderea Imperiului persan a fost prezis, sosirea

grecilor sub conducerea lui Alexandru, mprirea teritoriilor

dup moartea sa i tot ce a urmat.
Dei muli cercettori moderni - nu i nelepii evrei sau
Prinii Bisericii cretine - au neles acele profeii (doar
parial precise) ca o prevestire ulterioar, ce indica un autor
mai trziu (sau chiar mai muli autori), punctul central al
viselor, viziunilor sau experienelor lui Daniel fiind
preocuparea pentru ntrebarea: Cnd? Cnd va fi sfritul
regatului, cel care va supravieui i va dura?
Va fi cel pe care doar discipolii Domnului Prea nalt, ai
Spiritului Unic vor tri s-l vad (chiar morii printre ei,
care se vor ridica). Dar din nou, Daniel a continuat s ntrebe
ngerii: Cnd?
La un moment dat, ngerul i-a rspuns c va fi n viitor,
ntr-o vreme cnd un rege pctos va ncerca s schimbe
timpurile i legile; va dura un timp, timpuri i jumtate de
timp i numai dup asta se vor da oamenilor regate sub cer,
acelea sfinte ale Celui Prea nalt.
Alt dat ngerul a dezvluit c 70 de sptmni din ani
au fost hotrte pentru poporul tu i oraul tu pn
msura pcatelor este plin i viziunea profetic ntrit.
O dat emisarul divin a fost ntrebat de ctre Daniel: Ct
mai este pn la sfritul acestor lucruri ngrozitoare?. El a
primit din nou un rspuns enigmatic: mplinirea tuturor
lucrurilor profetice va veni dup un timp, timpuri i
jumtate de timp.
Am auzit i nu am neles, a scris Daniel. Aadar, am
spus, Domnul meu, care va fi rezultatul acestor lucruri?
Vorbind tot codat, fiina divin a rspuns, Din vremea n
care ofrandele obinuite au fost interzise i se ridic o
ticloie ngrozitoare vor fi 1290 de zile. Fericit este cel care
ateapt i ajunge 1335 de zile.
Deoarece Daniel a rmas confuz, ngerul Domnului a

Tu, Daniel, te vei odihni i te vei ridica ctre destinul tu la
Sfritul Zilelor...
Dar ine secrete cuvintele,
i pecetluiete cartea pn la Sfritul Timpului.
La Sfritul Timpului, cnd naiunile Pmntului se vor
strnge la Ierusalim i toate vor vorbi ntr-o limb clar, a
spus profetul efania (al crui nume nsemna chiar Codificat
prin Yahve) - i nu va mai fi nevoie de limbi i litere
amestecate pentru a citi n urm codurile ascunse.
i, ca Daniel, nc ntrebm: Cnd?