Sunteți pe pagina 1din 912

VERONICA DINU Profesor dr.

EUGEN TRUXIA Profesor dr.


ELENA POPA-CRISTEA
Profesor dr.
AURORA POPESCU Profesor dr. doc.
BIOCHIMIE
MEDICALA
mic tratat
m
EDITURA MEDICALA
Bucure$ti, 199$
Coperta de: ADRIAN CONSTANTINESCU
Toate drepturile editoriale aparfin in exclusivtiate Editurii Medicate,
Publicaiia este tnarca inregistraia a Editurii Medicate, fiind protejatd integral
de - legislated interna i international^ Orice valorificare a continutului tn
afara limitelor acestor legi i a permisiumi edUorilor este interzim i pasibitd
de pedeapstt. Acest lucrti este valabil pentru orice reproducere integrala
sau partiala, indiferent de mijloace (multiplicari, traduceri, micmfil- mariy
tramcrieri pe dischete etc.)
Tchnoretfactarc computcrizata; TOP GAL SRL ISBN 973-39-0299-3
Prefafa
tn domeniul piinfalor biologice progresele tehnologiei moderne au permis
extinderea p aprofundarea studiilor referitoare la diverp constituent celulari
sau subcelulari. Totodatd, utilizarea metodelor moderne de investigate
tiinpficd in domeniu au evidenpaf p noi roluri sau mecanisme de acpune ~
mai mult sau mat pupn complexe - ale unor asemenea constituent. Datoritd
acestor fapte, insup obiectul de studiu al biochimiei - in general - p al
biochimiei medicate - in particular - p-au largit sau i-au aprofundat
conpnutul propria. De asemenea, in ceea ce privete obiectul biochimiei
medicate, investigapile moderne de cercetare au relevat noi i multiple
implicapi - din ce in ce mai strdnse ~ pe care le are aceastd disciplind cu
diverse alte discipline medicate (genetica, fiziologia, fiziopatologia,
farmacologia, medicina internd etc.). Se mfetege cd in asemenea condipi se
impunea intocmirea unui nou tratat pentru studiul biochimiei medicate care
sd cuprindd intr-un tot util atdt unele cunoti.n$e clasice cdt p nolle achizipi
ale cercetdrilor modernet precum i evidenperea relapilor existente intre
procesele biochimice i funcpile fiziologice - normale sau patologice studiate de alte discipline, considerate strict - medicate. In mod deosebit
apdrea necesar sd fie relevate mecanismele moleculare care stau la baza
declandrii unor boli.
In vederea realizdrii tuturor acestor deziderate s~a elaborat lucrarea de
faid care cuprinde: studiul proteinelor, studiul enzimelor, transferal de
infomape, hormonii p mecanismele de reglare metabolicd, energetica
biochimicd, marile metabolisme, echilibrul acido-bazic, matrices
extracelulard p nopuni de biochimia nutripei.
Pe Idngd caracterul didactic care face ca lucrarea sd poatd fi utilizatd de
studenp pentru insuprea inv&t&m&ntului de biochimie, adresabilitatea
acestei biochimii medicate este mai largd, considerdnd-o folositoare atdt
medicilor cdt p biologilor; in special, celor care-p desfdoard activitatea

profesionald in laboratoare clinice.


In dorinja realizdrii unui text uor de urmdrit p repnut, lucrarea este
insoptd de material ilustrativ bogat cuprinzdnd numeroase scheme, tabele p
tablouri sinoptice.
Referitor la bibliografia care a stat la baza elabordrii ei trebuie subliniat
faptul cd dep ea a fast vastd, s~au menponat aid publicapile mai recente p
mai importante, prezentdndu-se deci o bibliografie selectivd.
Autorii
Cuprins
Cap. L Proteinele. Structure general#. (Prof. Dr. Elena Popa-Cristea) .
.............................................................................. .......... 13
1.1.........................................................................Aminoacizii
14
1.2..........Peptidele.................................................................
29
I. 3. Proteinele ....... ........................................................... .30
1.3.1 Stmctura primara a proteinelor. . ............................ 32
1.3.2 Organizarea spapala a moleculelor proteice.... ........
33
Stmctura secundara a proteinelor. i ...................................35
Struclura terpara a proteinelor. ..........................................40
Structure
cuaternara.......................................................a
proteinelor
45
f.3.3 Proprietap generate ale proteinelor......... ............. . 47
1.3.4 Clasificarea proteinelor......................................
49
1.3.5 Proteinele plasmalice........................................... 51
Semmalbumina................................................................. 52
Inmnoglobulinele............................................................... 53
Faetori
aicoagulant....................................(fibrinogenui)
57
1.3.6 Hemoproleinele...................................................... .62
1.3.7 Fibronectincle......................,....................................I . 65
Cap, II. Eitzimcle. (Prof. Dr. E. Impa).................................... .
.67
II. 1.........................................................................Introduces
67
IL2 Scaderea de catre enzime a energiei dc activare a reacpilor. Capacitatea
cauditica a enzimeior. . ,....................................................68
II.3 Specificitatea enzimeior ..... .......................................... 70
0.3.1 Specificitaie do reac|ie...... . .....................................
70
0.3.2 Specificitaie de substrat. . .. . .......................................
. 71
11.3.3 vSpecificitate stereochimidl................................. 72
0.4 Stmctura enzimeior..................................................... 73
0.4.1 Aspect generale................................................
73
0.4,2 Enzime cu stmctura proteidi......................................74
0.4.3 .Enzime cu stmctura heleroproleicS . .........................75
11.5.............................. Sistenie (complex) multienzimalice
.77
11.6..........Izoenzime. ............................................................
77
11.7
Central activ.......................................................i
mecanismul
de ac|iune a enzimeior...................... 78
0.8 Cinetica enzimntica................................................... 83
11.8,1 Exprimarea vttezei teacpilor euzimalice. Activitatea enzimeior 83
0.8.2 Viteza inijiaUa reacjiilor enzimatice............................84
11.8.3 Influenja pH-ului i icmpcraturii asupra activit5jii enzimeior
85
11.8.4 Influenpi concentrapei enzimei...............................86

11.8.5 Influenza concenirajiei substratului. Ecuajia Miclwelis-Menten


88
0.8.6 Delermmarea experimental# a K.M, Semnificajia aceslei constante.
Constanta eataliUea, K<M. . . 90
11.8.7 Ecuajja Lineweaver-Burk ...........................................
, 92
11.8.8 Inhibipa aclivinipi enzimeior................................... 92
0.9 Reglarea biosintezci i aclivilapi enzimelor....................,95
11.9.1 Aspecte. generate ...................................................95
11.9.2 Reglarea cantitafii enzimelor...... ........... . .................
. 96
11.9.3 Reglarea alosterica a activit-^ii enzimelor...............
97
11.9.4 Reglarea alosterica a func[iei hemoglobinei.............102
IL9.5 Reglarea covalenta a activit3|ii enzimelor.................. .
107
0.10 Localizarea intraeclulara a enzimelor..........................109
11.11.....................Enzimcle i patologia. .................... .
HO
11.12....................................Clasificarea i denumirea enzimelor
.................................... 112
Cap. 111. Vitaminc $i cocnzime. (Prof. Dr. doc. Aurora Popeseu).
................................................................................114
III. 1 Generalilap . ............................................................. 114
111.2.......................Cla.sificarea vilaminelor .....................
114
111.3...................................................................................Vitaminele
hidrosolubile $i rolunte lor coenzimatice. . ,c....................... 115
111.3.1 Complexul B ............................... ....'.................... 115
Vitamina B; (tiamina) i coenzima tiaminpirofosfat. ...........115
Vitamina B2 (riboflavina) i coenzimele flavinice.... . ...........117
Vitamina PP (niacina) i coenzimele nicotinamidice......... 118
Vitamina B6 (pindoxina) $i coenzimele derivate..... . ........... 120
Acidul panlotenic i coenztma A..........................................
122
Biotina i rolul ei coeuzimalic................,............................123
Vitamina B12 (ciancobalamina) gi rolul ei eoenzimalic.........124
Acidul folic gi coenzimele derivate...................................... 126
01.3.2 Vitamina C (acidul ascorbic)....................................128
OI.4 Vitaminele liposolubile............................................ 130
01.4.1 Vitamina....................................................................A
(retinolul)
130
111.4.2 Vitamina....................................................................D
133
10.4.3 Vitamina E....................................... .-.................... 135
m.4.4 Vitamina.......................................................................K
136
Cap. IV. AdzH nucleici. (Prof. Dr. Veronica Dinu)
...
1V.1 Introducere.'..................................
IV.2 Stmctura chimica a acizilor nuclcici
IV.2.1 Bazele azotate din structure acizilor nucleici
IV.2.2 Nucleozide si nucleotide din stmctura acizilor nucleici. . .
IV.2.3 Nucleotide naturale libere...........
IV.2.4 Analog! structural! ai bazelor azotate gi nucleozidelor. . .
IV.2.5 Structure covalenta a acizilor nucleici
IV.2.6 Caracteristiri fizieo-chimicc ate acizilor nucleici
Denaturarca si rcnaturarca ADN...........
Hidroliza acizilor nucleici.......................
IV-3'Acizii dezoxiribonucleiei.................

IV.3.1 Stmctura covalenta a ADN..........


IV.3.2 Conformajia molecule! de ADN; tipuri de cunfomia$ii. . .
IV.3.3 Organszarea vnatevialului genetic la procariote i eucariote.
1V.3.4 Arbitectura genomulul eucariot.
IV.3.5 BiodiUeza ADN (replicarea). .......
Replicarea la procariote.......................
Replicarea la eucariote, ......................
Sinteza de ADN pe matrila de ARN. ..... .
IV.4 Acizii ribonucleic!.........................
...
IV.4.I Tipuri de ARN. . ............................
ARN mesagcr (ARNJ..............................
ARN de transfer (ARNJ...........................
ARN ribozonial (ARNJ. ..........................
ARN nuclear de niici dimenshmi...........
IV.4.2 Biosinteza ARN pe matron de A.DN (transcrierea)
Transcriereu la procariote.....................
Transcrierea la eucariote.......................
Inhibitor! ai transeiierii..........................
1V.4.3 Pre.lttcrari co- i posllranscriere ale raoleculelor de ARN.
Excizia imronilor din transcriplek- primare
M.odificari posuranscriere adijionale.....
IV,4.4 Biosinteza ARN pc matripi tie ARN.
. 139
. 139 . 140 . 140 . 142 . 145 . 146 . 148 . 150 . 150 . 152 . 153 , 154 . 154 .
158 . 160 . 162 . 165 . 172 . 174, . 175 . 175 . 1.77 . 178 . 180 . -181 . 181 .
182 . 187 . 188 . 188 . 190 . 197 . 201
6
Cap, V. Biosinteza proteinelor (traducerea mesajului genetic). (Prof. Dr.
Veronica Dinu)....................................................................203
V.l Codul genetic........................................................*......203
V.2 Biosinteza proteinelor.................................................. 206
V.3 Preluerari posttraducere ale moleculelor proteice . ......216
V.4 Reglarea biosinlezei proteinelor ..................................... . 219
V.5 Leziuni ale moleculelor de ADN i repararea acestora. Mutajii .
225
V.5,1 Repararea prin excizie-resinteza..............................227
V.5.2 Repararea prin reversarea leziunilor........................230
V.5.3 Mutapi........... ......... ...............................................230
V.6 Exprimarea fenotipica a mutajiilor. . ,...........................231
V. 7 Clonarea genelor........... ..................... .......................232
V.7.1 Clonarea genelor in vivo (Tehnologia ADN recombinant)
. 232
V.7.1.1. Scenariul clonarii genelor; objinerea ADN recombinat 233
V.7.1.2. Exprimarea fenotipica a informajiei cuprinsa in ADN recombinant. .
...........................................................................................242
V.7.2 Clonarea genelor in vitro (Reacpa polimerazica in lan|)
246
V.
7.3 Aplicafii ale clonarii genelor................................
248
(Determinarea secvenjei nucleotidelor in oligonucleotide)
248
Acizi nucleici antisens...................................................... 253
Tehnica de transfer Southern............................................253
Cap. VI. Energetics biochimica. (Prof. Dr: E.Tru|va)............
259

VI. l A specie gene-rale...................................................259


VI.2 Sisteme termodinamice. Funcfii de stare. Principiile termodinamicii 260
VI.3 Sistemele vii sunt caracterizate cel mai bine prin energia liberS
262
VI.4 Variajia energiei li be re in reacjiile chimice i biochimice 262
VI.
4.1 Vanajia energiei libere i constants de echilibru. Energia libera de
reacjie standard. ...... 263
VI.4.2 Variafia energiei libere in reacpile de oxido-reducere.
Potenjialul redox i legatura lui cu energia libera...............265
VI.5 Cuplarea reacjiilor endergonice cu cele exergonice. Intermediaml
energetic comun................................................................266
VI.6 Legaturi macroergice. Sistemul ATP/ADP, principals intermedia!energetic
comun (Compus macroergic).............................................268
VI.7 Alp compel macroergici. Potenjialul de transfer al gruparii fosfat
271
VI. 8 Cade de sintezS a ATP in vivo......................................,
273
VI.8.1 Fosforilarea la nivel de substrat...............................274
VI.8.2 Lanjul respirator i fosforilarea oxidativS.................275
VI.
8.3 Teorii privind mecanismul cuplarii lanj respirator-fosforilare
oxidativ#............................................................................284
Vl.8.4 Sisteme de transport a echivalenplor de reducere...286
VI.8.5 Afecjiuni datorate unor defecte eredit&re la nivelul enzimelor lanjului
respirator
i fosforiiSrii oxidative.................................................
288
Vl.8.6 Controitil respirator............................................... 288
VI.8.7 Decuplanji ai fosforilarii oxidative de lanjul respirator
289
'VI.8.8 Alte lanjuri respiratorii............................................289
VI.
8.9 Specii incomplet redu.se ale oxigenului............. 290
Cap. VII. Metabolismul glucidelor. (Prof. Dr, Veronica Dinu).
294
VII. l Chimia glucidelor.................................................... 294
VII.
1.1 Monozaharidele............................................... 295
vStereoizomeria monozaharidelor.................................. 295
Structurile ciclice ale monozaharidelor.............................298
Aminozaharuri..............................................................
303
Dezoxlzaharuri..................................................................304
Proprietaple fizice i chimice ale monozaharidelor...........305
VII.
1.2 Oligozaharidele.................................................308
VII.l.3 Polizaharidele........................................................ 310
VII.2 Digestia $i absorbfia glucidelor..................................312
VII.2.1 Deficits enzimatice in digestia i absorb|ia glucidelor
..................................................................- 315
VI1.3 Caile de nieiabolizare a glucozei. ............................. 316
VII.3.1 Glicpliza (Secvenja Embden-Meyerhof-Pamas).......318
Bilanjul energetic al glicolizei...................................... . .....* 328
VII.3.2 Decarboxilarea oxidativfi a piruvatului...................329
VII.3,3 Ciclul acizilor tricarboxilici (Ciclul Krebs)............ 333
Ciclul Krebs - cale amfibolica........................................... 339
Bilanjul energetic al arderii glucozei. . ................................ .
341
7
VI1.4 Alte cai de metabolizare a glucozei.............342

VII.4.1 Calea pentozo-fosfa|ilor (Suntul pentozo-fosfat)...... ,


............................................................. 342
Deficient ale unor enzinie implicate in calea peiitozelor. . .
351
VU.4.2 Calea acidului glucuronic..................................... 351
VI1.5 Gluconeogeneza...................................................... 353
VU.5,1 Reglarea alosterica a gluconeogenezei................... 362
Vll.5.2 Reglarea homionala a gluconeogenezei..................
363
VII.6 Metabolismul glicogenului............. ........................... 364
VII.6.1 Degradarea glicogenului (Glicogenoliza). ....................
366
Reglarea glicogenolizei.................................................. 368
V1I.6.2 Biosinteza glicogenului (Glicogenogeneza)...........371
Reglarea glicogenogenezei............................................... 373
VII.6.3 AlterSri enzimatice in metabolismul glicogenului...376
VII.7 Metabolismul galactozei............................................377
VII.8 Metabolismul fmctozei............................ .................
379
VI1.9 Glicoproteinele. ........... .. ...... ................................. 382
VI1.9.1 Biosinteza glicoproteinelor. ........................................
384
VII.
9.2 Semnifica|ia biologica a glicoproteinelor...........
387
VII. 10 Proteoglicanii......................................................... * 388
Cap. VIII. Metabolismul lipidelor. (Prof. Dr. Elena Popa-Cristea)
394
VIII. l Chimia lipidelor.......................................................394
VIII.
U Acizii gragi ........................................................
394
VIil.1.2 Acilglicerolii (Gliceridele sau grasimile neutre).... . .397
VIII.l.3 Fosfoglicerideie {Glicerofosfolipidele, fosfatidele) 399
Acizii fosfatidici ............................................................... 399
Fosfatidilcolinele (lecitine)............................................... 400
Fosfatidiletanolamineie ..........................................................
402
Fosfatidilserinele (serin-cefaline)..................................... 402
Fosfatidilinozitolii (inozitol fosfatide, fosfoinozitlde) . . ......... .
402
Plasmaiogenele ............................................................ 404
Fosfatidilglicerolii ....................................................................
404
VIII.l.4 Sfingolipidele. ...............................................................
404
Sfingomielinele................................................................ 405
Glicosfingolipidele.............................................................405
VIII.l.5 Cerarile...................................................................407
VIII.
1.6 Lipide nesaponifiabiie.................................... 407
Terpenele. . . . ...................................................... ............. . 407
Carotenoizii.......................................... . ..................-.......409
Steroizii................................................. . .............. . .......... * 410
V1II.2 Digestia i absorbpa lipidelor. ........................ 415
VIII.3 Metabolismul acizilor grai...................................... 417
Vfll.3.1 Degradarea oxidativa a acizilor gra$i............. . 417
P - Oxidarea acizilor gra$i (Ciclul sail spiraia lui Lynen).....418
P - Oxidarea acizilor grai nesaturali. .....................................
421
Oxidarea acizilor grai in peroxizomi............................. 422
VII1.3.2 Cetogeneza...................................................... 424
VII1.3.3 Biosinteza acizilor gragi..................................... 427
Biosinteza acidului palmitic............................................. 427
Elongarea acizilor graji............................................................
432

Biosinteza acizilor grai nesaturali. ........................................


433
VIII.4 Metabolismul glicerolului........ ................................... 434
VII1.5 Metabolismul triacilglicerolilor. ....... .......... . ..........
.......................................435
VIO.5.1 Hidroliza tmcilgliceroiilor................................... 436
VIO.5.2 Biosinteza triacilglicerolilor. ... ............................... .

437
VIII.6 Metabolismul glicerol'osi'oliptdelor. ...............................
441
VIII.7 Metabolismul sfingolipidelor.................................... 445
"VIII.8 Metabolismul colesterolului................................. 448
VIII.8.1 Digestia i absorbpa colestcrolului........................450
VU3.8.2 Biosinteza colesterolului. ................... ........ . ........
450
VHI.8.3 Catabolismul colesterolului. ...................
............ 455
VIII.9 Lipidele plasmatice............................................... 457
VI11.9.3 Analiza lipidelor plasmatice............................... 458
VII1.9.2 ChiJomicixmii....................................................... 461
8
VIIL9.4 Lipoproteinele cu densitate midi (LDL, (3-lipoproteine)
464
VIIL9.5 Lipoproteinele cu densitate mare (HDL, cx-lipoproteine)
466
VIII.9.6 Acizii grai liberi (AGL, acizi grai neesterificaji), . .
467,
VIH.9.7 Dislipidemiiie. ............................ ........................467
VIII. IO Eicosanoizii. ....... ..................................................
471
VIIU0.1 Biosinleza eicosanoizilor.............................. ........473
VIII.10.2 Catabolismul prostaglandinelor........ ................... . .
476
VIII.
10.3 Actiunile bioiogice ale eicosanoizilor............... . . 476
Cap. IX. Metabolisms^ proteineior 1 aS anriuoadzilor. (Prof. Dr. E.Trupa)
............................................................................................. 479
IX.
1 introduces.............................................................
479
1X.2 Starea dinamicS a proteineior. Bilanjuri azotate ....... 479
IX.3 Digestia proteineior alimentare i absorbpa aminoacizilor. Hidroliza
proteineior endogene. .... 481
IX.4 Fondul de aminoacizi. Aminoacizi] esenpali...............485
1X.5 Catabolismul aminoacizilor: dezamtnarea oxidativa i ciclul ureogenetic
............................................................................................ . . 486
IX.
5.1 Aspecte generale.................................. . ......486
1X.5.2 Dezaminarea oxidativa a aminoacizilor $i Iranspoitul amoniacului
rezultat..............................................................................486
IX.5.3 Biosinteza ureei. ........ . ...................... .................... 490
IX.5.4 Relalii intre ciclul ureogenetic i ciclul acizilor tricarboxilici
493
IX.5.5 Boli cauzate de defecie in metabolizarea amoniacului
493
1X.6 Catabolismul aminoacizilor; utilizarea schelelelor de carbon
494
IX.6.1 Aspecte generale.................................................... 494
1X.6.2 Alanina, treonina, glicina, serina, cisteina (i cistina) se degradeaza la
acid piruvic. ...... 495
IX.6.3 Arginina, prolina, histidina, glutamina i acidul glutamic se degradeaza
la acid ct-cetoglutaric. . .................................................... 497
IX.6.4 Aspargina $d acidul aspartic se degradeaza la oxaloacetat 499
IX.6.5 Izoleucina, valuta i meliomna se degradeaza la succinil-CoA
499
IX.6.6 Leucina i lizina se degradeaza la acid acetoacetie sau acetoacetil-CoA

...........................................................................................502
1X.6.7 Triplofanul se degradeaza la acctil-CoA alanina......503
IX.6.8 Fenilalanina $i lirozina se degradeaza la acid fumaric gi acid
acetoacetie........................................................................503
IX.6.9 Boli cauzate de defecte in utilizarea .scheletului de carbon ai
aminoacizilor......................................................................506
IX.7 Biosinteza aminoacizilor neesen|sali......................... 508
IX.7.1 Aspecte generale................................................... 508
IX.7.2 C5i particular de biosinteza....................................
510
IX. 8 Formarea din aminoacizi a unor compugi cu func^ii specializate 513
IX.8.1 Compugii rezulta|i prin decarboxilarea aminoacizilor 513
1X.8.2 Biosinleza glutationului, . .............................................
515
IX.8.3 Sinteza creatinei. Relajia creating - creatinfosfaL Creatinina 516
IX.
8.4 Conpugi de conjugare a aminoacizilor...........
517
Cap. X. Metabolism!]! hemoproteinelor. (Prof.Dr. E.Tru|ia).
................................................................. 519
X. l Aspecte cliimice....................................................... 519
X.2 Biosinteza hemukii..................................................... 521
X.
2.1 Etapele biosintezei........................................... 521
X.2.2 Reglarea biosintezei hemului................ ................ .
525
X.2.3 Porfiriilc...................................................................... . . 526
X.3 Catabolismul hemukii.................................................. 529
X.3.1 Etapele initiate. ............................................. ...... 529
X.3.2 Bilirubina: fomtare, patmndere in ficat, caracLeristici, conjugare,
excrepe biliara.................................................................... 530
X.3.3 Etapele finale. . .................................. . .............. . 533
X. 3.4 Hiperbilirubinemiile........................... ...................... .
534
Cap. XI. MetaboUsmul nudeotidelor purinice si piritmdinicc. (Prof. Dr. Elena
Popa-Cristea).....................................................................538
XL1 Metabolismul nudeotidelor purinice........................... 538
XI.
1.1 Biosinteza de novo a nudeotidelor purinice......_ 540
Biosinteza IMP. . .......................... . ................ ........ 540
Biosinteza AMP gi GMP. .. . .................................................. 542
Biosinteza nudeotidelor cu legaturi fosfat ntacroergice...... . . 544
Biosinteza dezoxiribonucleotidelor....................................544
Reglarea biosintezei de novo a purinelor...........................544
XI.
1.2 Interconversiunile i reutilizarca purinelor......... 546
XI.1.3 Catabolismul purinelor ...... .................................... 551
XI.
1.4 Palologia metabob'smului purinelor.........................
553
9
XI.2 Metabolismul nudeotidelor pirimidinice
XI.2,1 Biosinteza de novo a nudeotidelor pirimidinice. . . .
XI.2.2 Reutilizarea, catabolismul nudeotidelor pirimidinice.
XI.2.3 Patologia metabolismului pirimidinelor
Cap. XII. HormotiU. (Prof. Dr. Elena Popa-Cristea).....562
. XII. 1 Introducers..............................................................362
XII.2 Receptorii hormonal! .......................................... 564
XII.3 Mecanismele de ac|iune a honnonilor, .. ................... 571
XII.3.1 Mecanismul de acjiune a honnonilor steroidici 1 tiroidieni

......................................................................... 571
XII.3.2 Mecanismul de acjiune a honnonilor peptidici $i a catecolaminelor
...................................................................................... . .. .572
Proteinele G......*......................... ................................. ...573
AMPC> adenilat cidaza i AMPC fosfodiesteraza.....,............576
Protein kinaze i fosfoproteinfosfataze............................... 577
AMPC mediator al expresiei genice ....................................
580
GMPC, guanilat ciclaza i GMPC fosfodiesteraza .....................
581
Fosfolipaza C i mesagerii intracelulari. Diacilglicerol i inozitoltrisfosfat 583
Ca2* mesager intracelular al semnalelor exteme..............585
Mecanismul de acjiune a unor honnoni care regleazS creterea i proliferarea
celulara. ...... 586
XII.4 Honnonii tiroidieni. ...............................................
592
X1I.5 Hormonii care rcgleaza calcemia (honnonii calciotropi). . .
............................................................................. . 593
XII.5.1 Homionul paratiroidian...........................................594
X1I.5.2 Calcitonina........................................................... 595
XII.5.3 1,25-Dihidroxicolecaldferol (Calcitriol)................. 598
XII.6 Honnonii pancreatici, .......................... -....................598
XII.6.1 Insulina....................................................................603
XII.6.2 Glucagonul........................................................
604
XII.6.3 Somatostatina........................................................... , 606
XII.6.4 Polipeplidul pancreatic. ............................. .........
..................................... 607
XII.7 Honnonii gastrointestinal! .......................................... 608
XII.8 Honnonii raeduiosuprarenalieni ............ . ................. 612
XII.9 Honnonii corticosuprarenalieni................................ 618
X11.10 Honnonii sexuali.................................................. 618
XII. 10.1 Androgenii.......................................................... 622
XII. 10.2 Honnonii ovarieni. . ............................................. 624
XII. 11 Hormonii hipofizari $i hipoUilamici.........................624
XILU.l Hormonii adenohipofizari....................................... 626
Peptide'derivate din pro-opiomelanocoitina (POMC)....... 628
Giupui honnonilor somatomainotropi......... ,..................... 629
Honnonii hipofizari glicoproteici. ............................................
630
XU.I 1.2 Hormonii neurohiporizari.........,. . ........................ 631
XII. .12 Epifiza (glanda pinealS)....................................
633
XII.13 Endorfine..................................................................' 634
XII. 14 Factorii de cregtere. ..............................................., . 635
XII. 14.1 Familia EOF (Epidennal growth factor)............... .635
XII.14.2 Familia FGF (Fibroblast growth factor).....; . . .......
636
XII. 14.3 Familia PDGF (Platelet derived growth factor)......636
XII.14.4 Familia TGF p (Transforming growth factor p).........
..................................................................... . 637
XU.14.5 Factorii de cregtere insulin-like (IGF, somatomedine)
...................................................................... 638
XII, 14.6 NGF (Nerve growth factor)................................... .
........................................... . 638
XII,14.7 Familia CSF (Colony-stimulating factor).............. 639

XII.14.8 EritropoietinS (Erythropoesis stimulating factor), .


............................................................640
XII.14.9 Interleukinele (IL). .... . . .................................... 641
XII.14.10 Interferonii (INF)................................................ 643
XII.
14.11 Oncogeneie gi controlul createrii celulare........
Cap. XIII. Apa. Proccsele hidroclcctrolitice i cdiilibrul acido-bazic. (Prof.
doc. Aurora Popescu)643
XIII. 1 Introducere.... ........... .................. ...................
643
XIII.2 Conjinutul i reparlijia apei m organism. .................. 643
XI1I.3 EchiSibrul apei m organism.................. . ........647
X1IL3.1 Necesarul zilnic de apa. . . . .................................. 648
XIII.
3.2 Pierderile de apa..............................................649
XIII.3,3 Excesul de apa.......................................................649
XIII.4 ProprietSjile fizico-chimicc a)c apei....................... . .
649
XIII.4.1 Structura i polaritatca moleculei de apa..............649
XI1I.4.2 Legatura de hidrogen i asocierile mol.eculare ....
651
10
X1II.4.3 Calciura specifics i cSldura de vaporizare...........
653
XI1I.4.4 Caldura de topire, punctul de topire i punctul de Berbers654
XIII.4.5 Apa ea dizolvant. ................................................. 655
XIII.5 Procesele hidroelectrolitice............................ ..........658
X1II.5.1 lonizarea apei gi produsul ionic al apei. . ............. 658
XIII.5.2 Reacjia solujiilor si pH-ul. ................... ................. 659
XIII.5.3 Specii dc acizi i baze; l&ria lor..............................661
XIII. 6 Echilibral acido-bazic................ .............................. 664
XIII.6.1 Sistemul tampon acid carbonie-bicarbonai............665
XIII.6.2 Sistemul tampon al fosfajilor. ...................
..................................................... 668
XIII.
6.3 Sistemul tampon al proteinelor ............ ..........
668
XIII .6.4 Sistemul tampon al hemoglobineL . . . ........... .
669
XIIL6.5 Cooperates plaraan-rioichi.................................. ; 669
Cap, XIV, Matr&cea extracelulari (Prof. dr. doc. Aurora Popescu)
.......................................................................671
XIV. 1 Constituent chimici ai matricei extracelulare......... 671
XIV. 1.1 Proteinele.............................................................671
Colagenul............................................................................ . 672
Elastina...............*.............................................................680
XIV.1.2 Glicozaminoglicanii i proteoglicanii............... 682
Glicozaminoglicanii............................................................682
Proteoglicanii......'.............................. . ........................... 687
Funcjiile biologice ale proteoglicanilor i glicozaminoglicanilor
*
Biosinteza i degradarea proteoglicanilor..........................
695
XIV.2 Rolul matricei extracelulare Tn eursul morfogenezei
698
XIV. 3 Modificariie constituenjilor matricei extracelulare...
.................................................. 699
XIV.3.1 ModificSri m funcfie de varsta................................. 699
XIV.3.2 Colagenozele.........................................*................ 700

643
Dr.

-.

694

XIV.3.3 Unele modificari calitative dobandite................. . . 700


XIV.
3.4 Mucopolizabaridozele. . ........................................
701
Cap. XV. Nofiuni dc nutrifie (Prof. Dr. doc. Aurora Popescu)
703
XV. 1 Introducere. ................................... . ......... . 703
XV.2 Necesaml nutritiv...................................................... 703
XV.
2.1 Cheltuiala de energie.....................................704
Metabolismul bazal.....................................................-.....704
Efectele lemiogenetice.................................................. 705
Cheltuiala energetics determinant de activitatea fizica depusS
705
Necesaml energetic......................................................... 706
XV.2.2 Compozipa i energia rafioi alimentare. ....................
707
XV.3. Principals nutritive, ........................................................
709
XV .3.1 Glncidele.................................................... ........... 709
XV,3.2 Lipidele.................................................................... . 710
XV.3.3 Proteinele..............,................................................711
XV.3.4 Vilaminele .......................................................... 713
XV.3.5 Mineralele. . ......................................................... 716
XV.3.6 Substanj.ele alimentare bioactive........................ 719
XV.3.7 Fibrele alimentare................................................ 720
XV,3.8 Apa. ........ ...................................... . ...................* 722
XV.4 Principalele produse alimentare. . . .............................. 723
XV,4.1 Produsele alimentare de origine animala............. 724
Camea.............................................................................. 726
Petele............................................................................. 727
XV.4.2 Produsele alimentare de origine vegeiala............ .
728
Cerealele....................................................................... 728
Legumele.....................................................................
729
Fructele..............................................................................729
XV.4.3 Alte produse alimentare.................................. -...732
Bauturile........................................................................ 733
Condimentele.................................................................... 733
XV.4.4 Aliments bogate in nminoucizi esen|iali. _................ . 733
XV.4.5 Repartizarea unor principii nutritive in cele mai importanle produse
alimentare, ........ 734
XV.5 Contribupa nulrijiei la pastrarea sanatapi................736
11
Cap. I. PROTEINELE. STRUCTURA GENERALA
Protcinele sunt constituent chimici ai organismelor vii cu cel mai malt grad
de complexitate, de varietate molecular# i care prezint# specificitate de
specie, de organ. Denumirea lor deriv# de la euvantul grecesc proteios
care Inseamn# de prim rang, cel dintai,
Proteinele^sunt substante macromoleeiilaE^^ La construct
proteinelor participl 20 de aminoacizi fundamentals aceiasi la Joate
vieftiitoarele. de la cea mai simple bacterie j3n# la^om. Prin legare In lanjuri
polipeptidice variate ca lungime i succesiune a uniBpto? se' poate objine un
numdr nesfarit de combinajii. Cu toalii multiplicitatea posibilitSjilor de
combinare a aminoacizilor In lanjuri polipeptidice, la un anumit organism nu
se reabzeazS dec^t, aniimite. secven|e> acelea care sunt
specificate de
materialul
Proteinele sunt

macromolecule
informajionale, cu sravenje specifice de aniino.acizi, sunt expresia
epigenetic# a
genomului celular, '
Proteinele Indeplinesc funcjii fundamental, specifice organismelor vii
(Tabelul LI):
Label LL
Exemple de proteine i funcjii fndepiinite de accstea
Proteina
Funclia
Principala proteina a Jesuturilor
Colagenul
conjunctive
Histona
Proteina nucleara asociata cu ADN
Proteina eritrocitar# cu rol in mentinerea
Spectrina
fonnei celuiare
Amilaza
Enzima, participa la digestia amidonului
Pepsina
EnzimS, participa la digestia proteinelor
Glicogen
sintaza
Enzima, participa la sinteza glicogenului
Lactat
Enzima, catalizeaza oxidarea lactatului
dehidrogenaza
la piruvat
Actina
Proteina contractile din muchi
Miozina
Proteina contractila din muchi
Insulina
Hormon pancreatic hipoglicemiant
Hormonul de
cretere
Mormon hipofizar
Serumal
Proteina plasmatica, transporta ioni,
burnina
vitamine, hormoni
Transporta oxigenul in sistemul
Hemoglobina
circulator
Transferina
Transporta ioni de fier in plasma
Feridna
Forma de depozitare a Feral ui
Citocromii
Transporta electroni
Imunoglobulinel Andcorpi care fixeaza i imobilizeaza
e
agenjii bacterieni
ProteinS. plasmadcS cu rol in coagularea
Fibrinogenul
sangeiui
- Proteinele au un rol structural, major, ele constituie materialul din care
sunt construite to ate structurile celuiare, membrane, organite celuiare ca i
materialul intercelular al {esuturilor i organelor. Proteinele exist# Intr-o
varietate molecular# -foarte mare i ele
asigur# diversitatea $i specificitatea de form# a tuturor fiin|elor jiL
1-3
- Protemele exergita.^ acjiuni catalitice. determinand varietatea nesfSrita
de reacfii biochimice i specified transformerilor chimice din organismele vii.
- Proteinele contractile sunt instrumentele cu ajutorul c^rora organismele
vii indeplinesc activitatea contractile i locomotoare.
e ele pot aoc&gLiiaosin^
:,,SMEa5LChimM
ca ioni metalici, vitamine, oxigen, dioxid de carbon.

- Proteinele au sarcina de a apSra organismul xmpotriva unor corpi strSini,


macromolecule, virusuri, bacterii. Reacjiile imunologice sunt mediate de o
close de proteine specializate - imunoglobulinele.
LI. AMINOACIZII
Unitejile constituente ale proteinelor sunt aminoacizii, care prin legetura
peptidicS intre gruparea aminicS a unei molecule si gruparea carboxil a altei
molecule dau nagtere
la macrorholeculele profeice, Exists 20 aminoacizi proteinogeni specificafi
prm co3ul genetic, prezenji in toate organismele vii, de la cele mai simple
pane la om (Tabelul 1:2). Aieturi de aceti 20 aminoacizi fundamental!, in
proteine se mai intalnesc alji cSjiva, care rezuM, de fapt, prin modificeri
chimice ale acestora dupe incorporare in lanjiirile polipeptidice (de ex.
hidroxiprolina, hidroxilizina etc.). Totodate, se mai intalnesc i unii aminoacizi
cu alls funcjii, ca omitina, citrulina (Tabelul 13).
Aminoacizii naturali au formula generaie:
R CH COOH
NH2
ei sunt a-aminoacizi. Face exeepjie unul din cei 20 de aminoacizi,gidina, care
are o functie aminice secundare.
Diversitatea aminoacizilor naturali este date de natura lui R care poate fi
o catene hidrocarbonate alifatice sau aromatice, un heterociclu sau R poate
se cuprinde o funcjie adifionaie.
Aminoacizii alifatici (f&rS gruperi funcjionale in R).
COOH
N-H2
CH3 CH CH COOH
Glicocolul sau
CH2
gliicina;

Alanina:

1
NHj
CH3-

Valina:

CH3-

Leucina:

CH3-

Izoleucina:
CH3CH,
NH,
CH CH2 CH COOH
CH,
NH,
ii
CH,
CH COOH
I

NH,
14
Tahelul 12
Siructurile si demimirile aminoacizilor proteinogeni
Formula structurald
Denumirea Denumirea rationale
uzuala

3
Acid aminoacetic

NHa

2
glicocoi
(glicina)

Prescu
rtarea
de irei
litere
,4
Gly

CH3 CH COOH 1

alanina

Acid a-aminopropionic

Ala

j)A

valina

Acid a-aminoizovalerianic

Val

. V

leucina

Acid a-aminoizocaproic

Lea

izoleucina

Acid a-amino-Pmetiivaleriaiiic

He

4U

Phe

1
CH2COOH

Simb
ol de
o
litera
5
(}

NH2

CH, CH CH COOH 1 1
CH3 NH;
CH3 CH C-H2 CH
COOH
ii
CH3 NH2

CH3 CH2 CH CH COOH


1I
CH3 NH2 .
^ CH2 CH COOH NH2

fenilaianin
a

Tabelul 1.2 (continuare)


1
V
H
N
C
H

V/

2
prolina

3
Acid pirolidin-a-carboxilic

4
Pro

5
\P
1 i \l
i

Hisddina

Acid a-amino-pimidazoiilpropionic

His

.pH
tj

Triptofan

Acid a-aminopindoiilpropionic

Trp

p)w

Senna.

Acid a-amino-phidroxipropionic

Ser

f) s

Treonina

Acid a-amino-phidroxibutiric

Thr

COOH
- CH2 CH COOH
I
' NH2
-CH2CH COOH
V^
H

CH? CH COOH 1 1 OH NH2


CH3 CH CH COOH
I1
OH NH2

Tirozina

p-hidroxifenilalanina

Tyr

CH? CH COOH
II
SH NH2
Tabelul 1.2 (continuare)

Cisteina

Acid a-amino-ptiopropionic

Cys

1
CH3 S CH2
COOH

2
Metionina

3
Acid a-airrino-S-nietUtiobutiiic

4
Met

Acid aminosuccinic

Asp

NH2

Acid
aspartic

H,NOC CH, CH COOH


i

Asparagin
a

Acid a-amino-Pamidosuccinic

Asn

Acid
glutamic

Acid a-aminoglutaric

GIu

Glutamina

Acid a-amino-yamidoglutaiic

Gin

1Q

Lizina

Acid a,e-diaminocaproic

Lys

Arginina

Acid a-amino- 5guadininovalerianic

Arg

,AR
Sj

HO CH2 CH COOH
NH2

CH2

CH

.C
-}
5
ti) M

NH2

HOOC CH, CH COOH 1

i/j

NH2

HOOC CH2 CH2 CH


COOH 1
NH2

H2NOC CH2 CH2 CH


COOH
NH2

CH2 CH2 CH2 CH2 CH


COOH
I 1 NH2 NH2
CH, CH, CH, CH
COOH 1 1 NH NH,
1
C = NH
I
NH2

Tabelul 13
Amlnoaclzii neproteinogeni
Formula structurald

Denumire uzuald Denumire tiinlificd

H2N CH2 CH2 COOH

P - Alanina

Acid Paminopropionic

Component
al coenzimei
A

H2N CH2 CH2 CH2


COOH

Acid yaminobutixic,
GABA

Neuromodula
tor

H2N CH2 CO CH2 CH2


COOH

Acid 8aminolevulinie

H2N CO NH (CH2)3
CH(NH2) COOH

Citnilina

Acid a-amino- 5amidinovalerianic

Funcpe

Intermedia!
in biosinteza
hemuiui
Intermediar
al ciclului
ureogenetic

H2N (CH2}3 CH(NH2)


COOH

Ornitina

Acid a, 5-diamino
valerianic

HS CH2 CH2 CH{NH2)


COOH

Homocisteina

Acid a-armno-yticbu tiiic

HO CH2 ~ CH2 CH(NHJ


COOH

Homoserina

Acid a-amino-yhidroxibutixic

H2N C6H4 OH

Acid paminobenzoic

Intermediar
al dclului
ureogenetic
Intermediar
m metaholismtil
aminoacizilor
Intermediar
in metabolismtil
aminoacizilor
Factor de
cregtere
persfni
bacterii,
compo-'
i*ent a!
aciduiui
folic *

Aminoacizii aromatici (Sr& grap&ri funcjionale in R). Fenilalanina:


/\
CHp CH COOH
I
NHp
Aminoacizii heierociclici. Histidina cuprinde heterociclul pentagonal cu doi
atom! de azot, irnidazol.
N
N
r~ CH2 CH COOH
NHo
N
H
N
H
Irnidazol
Histidina
Triptofanul cuprinde nucleul heterociclic a! indoiului:
Indol

Prolina cuprinde o grupare aminic5 secondary situate intr-un ciclu derivat din
pirol:
COOH
'1ST
H
N
H

pirol
prolinS
Aminoacizii cu grupdri hidroxilice. Serina i treonina-curpind in R funcfii
alcool:
CH3 CH CH COOH OH NH2
Serina
Treonina
Tirozina posedft o funcjie adifionalS fenol:
CH2 CH COOH
OH NH,
HO \
7 CH2 CH COOH
NH '
19
Aminoacizii cu sulf (tioarninoacizii). Ci-steina cuprinde foncfia liol (R =
SH) i metionina o funcfie doeter (R = S R);
CH2 CH COOH
CH3 S CH2 CH2 CH COOH
SH NH2
NH2

Cisteina
Metionina
Aminoacizi dicarboxilicL Acidul aspartic i acidul glutamic sunt acizi
monoaminodicar boxilici, iar asparagina i glutamina sunt amideie lor:
HOOC CH2 CH COOH
HOOC CH2 CH2 CH COOH
m2
NH2
Acidul aspartic
Acidul glutamic
H>NOC CH2 CH COOH
|
NH,
H2NQC CH2 CH2 CH COOH NH2
Glutamina
Asparagina
Aminoacizii diamlnici. Lizina are ca funcfie adiJionalS o grupare aminidl
primary
\ CH2 Ci
NH2

NH
H2N CH2 CH2 CH* CH, CH COOH
Arginina cuprinde o grupare guanidil, NH C
derivatft din guanidine, H2N C NH2 :
NH
m?
H2N C NH CH2 CH2 CH2 NH
CHCOOH
NH2
Arginina
Propriet&tile fizice ale aminoacizilor. Toji aminoacizii sunt substanje solide,
cu pun'cte de topire ridicate, mai mari de 200 i se descornpun inainte de a
se topi. Aminoacizii se dizolv&, intr-o mSsuriS mai mare sau mai mica, in

ap&, dar sunt greu solubili in solvenfii nepolari ca: eter, cloroform, benzen.
Sunt uor solubili in soiufii diluate de acizi i baze.
Izomeria optica a aminoacizilor, Tofi aminoacizii, cu excepjia glicocolului,
posedS un centru chiralic (un carton asimetric) care este Ca:
R
CH COOH NH2
20
Izoleucina i treonina au on carbon asimetric adijional, atomul Cp.
Formuleie de configurajie ale enantiomerilor unui aminoacid oareeare,
reprezentate in sistemul D-L, m care substanja de referinjS este aldehida
gliceric# dexlrogirS sunt:
COOH
COOK
H c m2
H2N C H
R
R
D aminoacid
L aminoacid
In structura proteinelor nu se intalnesc decSt L-aminoacizi. Aminoacizii din
seria D apar numai ocazional, in special la unele microorganisme i
totdeauna au roluri specifice.
Proprieta$ile acidobazice ale aminoacizilor. Aminoacizii cuprind o grupare
- NH2 bazic# i una COOH acid# i intre aceste dou# funcjii poate avea
loc transferal de protoni:
COOH
R CH '
R OH
COO
NH2
NH3*
ion bipolar (amfion)
Datorit# interacfiunilor electronice posibile intre cele dou# funcfii
invecinate, echilibrul reacfiei este deplasat aproape in totalitate spre
dreapta, practic aminoacizii (monoaminomonocarboxilici), In cristale ca i in
solujie, exists numai sub form# de amfioni (ioni bipolari). Structura bipolar#
a aminoacizilor este susjinut# de numeroase fapte. Prin m#sur#tori de
distance interatomice s-a g#sit c# in gruparea carboxil, distanfele C-0 sunt
egale (1,26 A), eie corespund ionului carboxilat, unde are loc conjugarea n-p:
1

De asemenea, moleculele aminoacizilor, neutre in ansamblu, au momente


de dipoi foarte mari, cuprind sarcini electrice mari i de semn contrar in
regiuni diferite ale moleculei.
Ionii bipolari ai aminoacizilor r#man in continuare amfoliji, ei au at&t
caracter acid, cat $i caracter bazic. Funcpa acid# actual# a unui aminoacid
(monoaminomonocarboxilic) este gruparea aminic# protonal#, NH3\ acidul
conjugal al grupdiii aminice, NH2:

H*
NH3*
NH2
4- H +
acid
baza
21
Funcjia bazic& a unui aminoacid este ionul carboxiiat COO" , baza
conjugate a grup&rii carboxil:
+ H+
COO'- COON
H*
baza
acid
Unii aminoacizi ca: lizina, acidul glutamic, acidul aspartic, cuprind In
radicalul de la Ca grupSri acide sau bazice adijionaie, Pentru inceput In exam
in area comport&rii aminoacizilor ca acizi i baze se iau in considerate numai
aminoacizii monoaminomono- carboxilici (aminoacizi neutri):
, 000
R CHNH3*
Pentru caracterizarea aciditdjii i bazicitSfii aminoacizilor se folosesc
exponenjii de aciditate,
pK, (pKa = log KJ. Funcfia carboxil este caracterizati prin pKa-coOH iar
funcjia aminicft printr-un pKoe-NH3+, .La unii aminoacizi se adaugd o a fcreia
mSrime pK, corespunz&toare funcjiei acide adijionale.
In Tabelul L4 se dau valorile pK ale color 20 de aminoacizi naturali.
Din examinarea datelor din Tabelul 1.4 se remarcil, in piimul rand, faptul
c& fimcjia . COOH este tin acid mai puternic (pK * 2) decat gruparea
similar^ a acizilor carboxilici oarecari (pK pentru acidul acetic este 4,76).
Aciditatea grup&rii NH3+ este redusS (pK = 9-10), dar intrece totup
bazicitatea COO. Din aceastd eauz&, in ap& purd, gruparea NH3+
doneazS mai mulfi protoni decdt accepts ionul COO. Solujiile apoase ale
aminoacizilor sunt slab acide.
label L4
Valorile pK i pi ale aminoacizilor
Aminoacid
pf<a~NH3 pKfi
Pi
pKa-CQOH
+
(25)
1. Glicocol
2,34
9,60
5,97
2. Alanina
2,35
9,69
6,02
3. Valina
2.32
9,62
5,97
4. Leueina
2,36
9,60
5,98
5. Izoleucina
2,36
9,68
6,02
5,98
6. Fenilalanina
1,83
9,13

7. ProlinS,
1,99
10,60
6,10
8. Triptofan
2,38
9,38
5,88
9. Seiina '
2,21
' 9,15
5,68
10. Treonina
2V63
10,43
. 6,53
11. Tirozina
2,20
9,11
10,07 5,65
12. Cisteina
1,71
10,78
8,33
.5,02

13. Metionina
2,28 '
'9,21
5,75
14. Asparagina
2,02
8,8
5,41
15. Glutamina
2,37
9,13
. 5v65
16. Acid
aspartic
2,09
9,82
3,86
2,97
17. Acid
glutamic
2,19
9,67
4,25
3,22
18. Histidina
1,82
9,17
6,00
7,58
19. Lizina
2,18
8,95
10,53 9,74
20. Arginina
2,17
9,04
12,48 10,76
22
Un aminoac'id prin func[iile acid& i bazicS pejsare le cuprincle, poaie
reacfiona cu baze eedand protoni i cu acizi, accept&nd protoni. IncSrcarea
electrics a unui aminoacid depihde de pH~ul solujiei. DacS un aminoacid se
alia intr-o solujie puternic acid# (pH ~ 0-1) grup&rile aceeptoare de protoni
sunt protonate in totalitate. La titrarea acestuia cu o bazil tare (HG) proton.il
sunt eliberaji In ordinea descrescfitoare a aciditfijii funcjiilor acide. Au loc
reacfiile:
<jXH COOH NH/
R
R
i
H+ I
<j)H
-----^ (jjf-j ___
COO"
COO'
NH3*
m2
In fig. 1.1 este prezentat& curha de titrare'a aianinei, a-neutralize
funcjiilor COOH i
NH3+ CU o solufie de'NaOH.

Fig. 1.1. Curba de titrare a alaninei.


Din ecuajia Henderson-Hasselbalch:
pH = pKa a log
[BazS]

[Acid]
23
rezuita c3 La un pH egal cu pKa-cooH (2,35) exists egalitatea:
H3N CH(CH3) COOH - H.N CH(CH3) COO
iar ia pH = pKa-NH3+ (9,69) egalitatea:
H3N CH(CH3) COO * H2N ~~ CH(CH3) COO
La un pH egal cu semisuma valorilor pK, sarcina nets a aminoacidului este
practjc nul&, In solujie existand numai ionii bipolari. Acst pH este denumit
izoelectric (pi), in Tabelul 1.4, coloana 5, sunt date valorile pi ale
aminoacizilor proteinogeni. Pentru aminoactzii neutri, punctele izoelectrice
sunt, situate la valori de aproximativ 6, pH pujin inferior pH-ului fiziologic. La
pH = pi solubilitatea aminoacizilor este minimi.
Comportarea aminoacizilor cu grupdri acide i bazice adifionale. Un
num&r de 5 aminoacizi din cei 20 cuprind in radicalul R de la Ca grup&ri
acide sau bazice: acidul aspartic, acidul glutamic, lizina, arginina p histidina.
Funcfia fenol din tirozinU p cea tioalcool din cisteinft sunt acizi foarte slabi
care la pH-ul fiziologic se ionizeazft intro m&suril neglijabilft. La acegti
aminoacizi se adaugS o constants pK suplimentarS (Tabelul
1.4). Pentru acidul aspartic p glutamic aciditatea acestei funcjii este mai
micS decat; a grupului carboxilic de ia Ca, are o tSrie comparabilii cu a
acizilor monocarboxilici aiifatici (pK = 3,86 la acid aspartic p 4,25 la acid
glutamic), nu se mai simte influenja grup&rii am inice vecine.
Formele aciduiui aspartic, in raport cu pH-ul solujiei in care se aflft, pot fi
deduse, ca p in cazul aminoacizilor neutri, prin protonare maximal^ p apoi
adftugare treptat& de baz&; funcfiile acide vor ceda protoni in ordinea
descresc&toare a tiiriei lor:
(jXDOH t^OOH
<j;oo
f^OO
H
9 2
QH2
9H2
9H2
- H+ 1
- H+ 1
- H+ 1
1
pH . . MH +
CH MH +
w. PWNH
CjJH NH/
.1
COOH
COO
COO
COO
(+)
(0)
(-)
(2-)
pH-ul izoelectric al acestor aminoacizi este dat de semisuma valorilor pK ale
funcjiilor care genereazd ionul f&rS sarcinS netd. Pentru acidul aspartic p
acidul glutamic, punctele lor izoelectrice sunt situate la valori net acide (2,97
p, respectiv 3,2).
Lizina este un aminoacid bazic cu o funcpe aminicS in R. Formele lizinei In
raport; cu variable de pH ale mediului sunt:
(j)H2 NH3*
<j:H2-NH3*
(J;H2 Nhy
^H2~
(^HJ,
(^H2)3
(^H253
<JH ----- 1
NH3*
^ <pH NH3+
^ CpH NH2
COOH
COO
COO
COO
(-2)
(+)
(0)
(-)
pH-ul izoelectric al lizinei este situat la valorarea 10.
24
Arginina are un caracter bazic net prin gruparea guanidinicft;

NH
NH/
II
+ H*
II
R NH C NH2
R NH C NH2
H+
ion guanidinium
lonul guanidinium, datorita conjugSrii rc p poate fi serfs:
R NH - C
+ 1 NH2 ^
NH
+ 1 *2
Histidina prezinta caracter bazic prin nucieul heterociciic al iniidazolului:

N
HN i
i
||
-rH* '
|t
11
w
11

Bazicitatea acestei grup8ri este mai redusd (pK = 6,00) i pi este situat la
valori apropiate de pH-ul fiziologic (7,58).
Din cele expuse mai inainte rezuM c& ionizarea aminoacizilor, sarcina
electric!! pe care o poartS fiecare dintre ei, depinde de pH-ul solujiei in care
sunt cupringi. DacS jinem seama eft in organismele vii aminoacizii sunt
cuprini in lanfurile poiipeptidice ale proteineior este important de examinat
comportarea ca acizi sau baze a resturilor aminoacide -NH CH(R) CO
sarcina electric^ pe care o poartft aceste resturi la pH-ul fiziologic. Resturile
aspartil i glutamil au in aceste condijii o sarcinft netft (-) pe cand resturile
lizii, arginil i histidil au sarcina (+):
cjxxr
cjxxr
(fH*)*
NH,
NHCHCO; NHOHCO;
-HNCHCO;
(CpU
-HN CHCONH2

NH2
Restul histidil este redat prin douft stmcluri tautomere:

HN

H
CH2 CH
/
NH
\ CO

HN
HH CH2 CH {
\co
y

H
25
Clasificarea aminoacizilor dupd naiura radicaiului de la Ca.
In proteine, aminoacizii sunt. angaja{i in legiltur^l peptidicfl prin gruparca
aminic&-i cea
carboxil:
R
NH CH CO
rest ammoacidic
Ceea ce diferen|iazd resturile celor 20 de aminoacizi este natura
radicaiului de la Ca. Natura interacjiuniJor ce se pot stabili intre resturile
aminoacidice depinde de incftrcarca electrics. a acestor resluri, de caracterul
lor polar sau hidrofob. Jinandu-se scama de aceste insuiri ale resturilor R de
la Ctt aminoacizii sunt imparjiji in patru grupe.
a. aminoacizi cu R hidrofob, nepolar; alanina, vnlina, Ieucina, izoleucina,
prolina, fenilalanina, triptofanul, metionina;
b. aminoacizi cu. R polar, dar fdrM sarcina electric*!: serina, treonina,
lirozina, cisteina, asparagina, glutainina $i glicocolul (R = H);
c. aminoacizi cu R mc&rcat (-) (la pH-ul fiziologic): acidul aspartic, acidul
glutamic;
cl, aminoaocizi cu R mefircai (+) (la pH-ul fiziologic): lizina, arginina,
histidina.'
Reacf.iile chimice ale aminoacizilor, Aminoacizii prezinttl diverse reacjii
chimice la care participii atat funcjiiie amino 1 carboxil comune tuluror
aminoacizilor, cat. i grupilriie prezente in radicalii de la Cw.
ReacpJ ale grupdrii -COOH. Aminoacizii formeazS. derivaji normali ai
acestei funcjii:
esten, amide, anhidride, nitrilL Prin decarboxilare, aminoacizii formeaxfr
amine, multe dintre ele substanje cu proprietaji fiziologice i farmacologice
remarcabile (amine biogene):
R CH COOH ---------------> R CH2 NHa + C02
NH2
Unelc amine, produi.ai reacjiei de decarboxilare a aminoacizilor, sunt
ar&taji mai jos:
N
CH2 CH2 NH2
HOOC (CH2)3 NH2
Nx
hi,stamina
H
(din histidinft)
ad d y-am inobuti ric (din acid glutamic)
(jlH2 CH2 NH2 OH

H2N (CH2)5 NH2


Cj)H2 CH^ NH2
SH
etanolamina (din serina)
cadaverina (din lizina)
cisteamina (din cisteina)
Reacl'ii ale grupdrii ~NH2. Prin aceasta funcjie aminoacizii dau numeroase
reacfii: - condensate cu compui carbonilici:
R CH NHL
f
COOH
(R')H
A
C=0
HoO
R CjH * N = C
COOH
\
baza Schiff (aldimina, cetimina)
H(R')
26
alchilare iota 111;
agent
metilant
+
R CH MH2 ---------------------R CH N(CH3)3
COOH
COO"
betaina
acilare;
agent
aC) j
R _ CH NH- - -----------------R CH -- NH CO R'
I-
I
COOH
COOH
N-aci3-cierivat
Cu acidul carbonic, aminoacizii formeazS derivaji carbaminoacizi:
OH
/
o=c
o
OH
R CH NHo
I
COOH
R CH NH C OH
COOH
- oxidare:
R CH COOH
R CH COOH
+ H2O
R.r C COOH

-0

X
z:
1

2H
NHL
NH2
NH
Inloeuirea grupSrii NH2 cu OH:
+ HOH
R CH COOH----------------O
cx-cetoacid (a-oxoacid)
NH,
NH,
R CH COOH
I
OH
a-hidroxbacid
Reacpi ale funcfiitor prezente in radicalul de la Ca.
Penlru funcfia tioalcool din cisteind sunt caracteristice reacfiile: - oxidare
bland! si reversibilS la disulfura:
CH? CH2 S S SH
CH2
i
- 2H I
1
CH NH2
CH

1
+ 2H I
I
COOH COOH
CO
OH
cistina
27
- formare de s&ruri cu metale grele, marcaptide:
R SH + AgN03 ---------------------R SAg 4- HNOs
- oxidare energies la acid cisteic:
CH2S
CH2 S03H
H
1
oxidare I
CH ------ CH
NH2
NHo
12
COOH COOH
acid cisteic
Serina, treonina i tirozina prin func|ia hidroxi formeazS esteri, cu acidul
fosforic, rezuMnd;
CH2 O POSH2
0 FOSH2
s2
1
CH

P0
H
rS
3
CH NH 1
P

COOH

CH NH2 |

acid
serinfosforic

COOH

V
CH2 CH
2
l
I
NH2

acid
ireomnfosforic
acid tirozinfosforic
Gruparea NH2 de la Ce al lizinei confers acestui aminoacid sau restuiui

lizil, posibilit&fi multiple de a inferaefiona cu alfi compui. Condensarea cu


funefii carbonil este una dintre proprietS{ile cele mai importante ale acestui
rest aminoacidic. De asemenea, prin oxidarea grupSrii C NH2 din lizinS
se ohfine alizina:
oxidare
H2N CH2 (CH2)3 CH COOH
0 - HC (CH2)3 CH
COOH
NH2
NHZ
Hzina
alizinS
Gruparea carbonil ndu formats poate participa mai departe ia alte reaefii.
28
12 PEPTIDELE
Peptidele sunt combinafii de tip amidic rezultate prin condensarea a doua
sau rnai multe molecule de aminoacizi:
R
R
R
R
H2N OH COOH 4- H2N CH COOH - H2N
H2O
CH CO NH CH COOH dlpeptid
Peptidele pot rezulta din doua, trei, n molecule de aminoacizi. Ceea ce
rfcsane dinfcr-un aminoacid dupa angajarea sa in legStura peptidicd poartS
denumirea de rest (reziduu) aminoacidic.
Peptidele cuprinzand mai pujine resturi aminoacide sunt denumite
oligopeptide, iar acelea cu un numSr mai mare de resturi aminoacidice sunt
poiipeptide:
HZH CH CO NH CH CO - - - - NH CH COOH
polipeptid
Capetele moleculei unui peptid sunt diferite, unul are grupare aminicd
libera, cap3t N- terminal, iar ceMalt are gruparea carboxil neangajata, este
capatul C-terminal. Resturile de aminoacizi de la capetele moleculei sunt
denumite rested N-terminale i, respectiv, C~terminale. Inceputui unui
peptid este capatul N-terminal.
Denumirile peptidelor se construiesc socotindu-le derivaji acila{i ai
restului aminoacidic C-terminal, Se citesc succesiv radicalii aminoacizilor
Incepand cu capatul N- terminal panH la restul C-terminal. De exemplu,
tetrapeptidul:
CH(CH3)2
H2N CH CO NH CHg
CHoOH
CH3
I
I
CO NH CH - CO NH CH COOH
Se citete valil-glicil-seril-alanin&. De asemenea, pentru redarea structurii
unui peptid, mai mic sau mai mare, se folosesc prescurt&rile de trei litere sau
de o singurS liters pentru aminoacizi. In acest sistem, tetrapeptidul de mai
sus este redat:

Val-Gly-Ser-Ala sau VCSA. Cu ajutorul acestor prescurtM intr-un spa{iu


restrans pot fi redate structurile unor poiipeptide foarte mari,
Datorita posibilitajii de legare a acelorai aminoacizi in secvenje diferite,
peptidele pot prezenta fenomenul de izomerie de structura, de pozifie. Doi
aminoacizi diferiji pot da natere la doua dipeptide izomere dupa cum unui
sau altul ocupa pozifia N- sau C- terminaia. De exemplu, dipeptidele izomere
leucil-metionina sau metionil-leucina. Posibilitajile de izomerie cresc foarte
repede odata cu cregterea numarului de aminoacizi. Trei aminoacizi distlncji
A, B, C pot da nagtere la 6 tripeptide izomere (peptidul cuprinde cate un rest
din fiecare aminoacid), Din patru aminoacizi 24 tetrapeptide, din cinci 120.
Un eicosapeptid (cu 20 resturi) In care fiecare din cei 20 de aminoacizi este
cuprins o singura data poate exista sub forma a 2 x I018 izomeri. Posibilitatea
legarii aminoacizilor In secvenje nesfarit de numeroase sta la baza
multiplicitajii i varietajii moleculare a proteinelor.
29
In organismele vii se infalnese numeroase peptide (oligopeptide sau
peptide mai marl) cu funcfii particulare. Unele din aceste peptide au legftturi
peptidice atipice, cuprinzand. resturi aminoacidice modificate, au strueturi
ciclice, cuprind D-aminoacizi (Tabelul 1.5),
Oligopeptide cu funcjii biologsce
Tabelul 1.5.
Denu
Structura
Funcfia
mirea
Agent
Glutati
redox
yGiu Cys Giya
on
intracel
ular
Agent
Bradiki Arg Pro Pro Gly Phe Ser
hipoten
nina
Pro PheArg
siv
Agent
hiperfensiv,
Angiot
regleaAsp Arg Va! Tyr lie His Pro
ensina
za
Phe
11
secrefi
a de
aldoste
ron
Mormo
TSH
n
Piro Glu His Pro amidab
RH
hipotat
amic
Oxltoci Cys Tyr lie Gin Asn Cys
Mormo
c
na
Pro Leu GSy amida S
:
n
----------------S
neurohi
pofizar

Vasopr
esina

Cys TyrPhe Gin Asn Cys


Mormo
Pro Leu(Arg} Giy amida
n
i1
neurohi
S-----------------------S
pofizar
a)
Restul Gly N-terminal este angajat in legatura
pepttdica prin gruparea y-CQOH.
b)
Restu! Giy N-terminai formeaza amida interna; restul
Pro C-terminal formeazS amida,
c)
Resturiie 1Cys i 6Cys formeaza. punte disulfurica;
restul Gly C-terminal formeaz& amida.
1.3 PROTEINELE
Proteinele au o structura polipeptidicd. Granija dintre polipeptidele
propriu-zise i
proteine este arbitrary. La un anumit grad de complexitate a ianfurilor
polipeptidice apar nivele superioaxe de organizare i caiitfifi noi neintilnite la
polipeptidele mai mici.
Proteinele, alitiuri de acizii nucleic!, sunt macromolecule ce exists fntr-o
varietate foarte mare. Fiecare tip de celuHl, fiecare individ, fiecare specie
posedd un set distinct de proteine. Se estimeazti dl num&rul de tipuri de
proteine din intreaga iume vie este de 10K) 1012 i potenfialul de diversi'tate
nu este epuizat Chiar proteinele care indeplinesc funcfii similare la specii
diferite sunt entitaji distincte, cu mase i proprietfifi diferite.
Chimia proteinelor este deosebit de complex^, ea presupune, mai intii,
infelegerea principiilor generale de construcfie a moleculelor proteice, a
modului in care dintr-un nurmlr limitat de unittifi structural se pot forma
infinit de multe proteine gi a factorilor care inlervin in realizarea organizarii
lor spafiale. In al doilea rind, studiul proteinelor
30
necesitS abordarea fiecSrui tip de proteins In parte, stabiiirea pentru fiecare
specie molecularS a const! tufiei chiinice, a. arhitecturii gi a funcfiei (sau
funcjiiior) pe care !e exerciti
Structura poiipeplidicS este aptS sS asigure proteinelor cele douS
caractere, diversitate molecularS, pe de o. parte, gi specif icitale de forms,
pe de alts parte. Un polipeptidr
R
H
O
R
i
1
.11
I
CH
N
C
CH
\N/ \c/ \c/ \c/
ii
H
0
R
H
O
cuprinde o catenS principals cu o structurS monotonS in care se repetS
grupul de atomi - NH CH CO Varietatea lanfurilor este asiguralS de
radicaiii R legafi la Ca. Cu ajutorul celor 20 radical! diferiji se pot objine
combinafii multiple, deosebite prin -numSrul gi secvenfa resturilor
aminoacide. Lanfurile polipeptidice, unidimensionale gi flexibile, se
convertesc spontan m edificii cu trei dimensiuni, cu forme caracteristice
pentru o anumitS secvenfS de aminoacizi.
Organizarea spaJialS a lan|urilor polipeptidice are loc prin interacfiuni
necovalente iegSturi de hidrogen, atracfii polare i ionice, interacfiuni
c

hidrofobe la care participS atit grupSrile C = O gi ^2^ NH din catena


polipeptidicS, ctt gi diversele grupSri
cuprinse In catenele laterale ale lanfului.
Complexitatea proteinelor a fdcut necesarS. introducerea mai multor
fcrepfce de organizare structural denumite ftstructurS primarS, secundarS,
terfiarS.. gi structurS uaternarS. /Structura primarSjprecizeazS tmmSruLgi
secyenfa resturilor aminoacidice din molecplS. ea. reds totalitatea leiSturilor
covalente din moIeculS gi mai este denumitS gi |
Structura primarS
corespunde formulelor slructurale uzuale ale unui
compus organic. La moleculele simple astfel de formule definesc In acelagi
timp gi relajitle spafiale dintre atomi. La proteine cu lanfuri lungi gi un numSr
foarte mare de atomi sunt posibile numeroase conformafii (aranjamente
spafiale rezultate prin rotafia iiberS a atomilor sau grupurilor de atomi in jurul
legSturilor simple) gi este necesarS icrarhizarea nivelelor de organizare
spaJialS.
Structurile secundare rezultate din interacfiunile grupelor C = O gi' NH
din grupSiile peptidice, sunt structuri ordonate, periodice, elemental
structural care ie genereazS prezintS el Insugi regularitale. Structura terfiarS
a unui tanf. polipeptidic InglobeazS nivelul de organizare secundar la care se
adaugS rnodul de pliere, impachetare a lanfului polipeptidic determinat de
interacfiunile posibile Intre radicaiii R de la Ca, interacfiuni ce depind atat de
natura acestor radical! cSt gi de relafiile de vecinState dintre ei. Descrierea
organizSrii spafiale a unui lanf polipeptidic prin structurS secundarS gi
terfiarS este arbitrarS, cele douS niveie slructurale se intrepStrund, ImpreunS
ele definesc conformafia specifics a lanfului.
Proteinele alcStuite din mai multe lanfuri polipeptidice (proteine
oligomere) cuprind un nive! cuaternar de organizare. Structura cuatemarS a
unei proteine oligomere descrie modal In care lanfurile polipeptidice
individuate, se asociazS, se asambleazS pentfu a realiza structura proteine!
date, structura sa funcfionalS.
31
1.3.1
STRUCTURA PRIMARA A PROTEINELOR
Prima protein^ a cSrei structure primarS a fost stability este insulins
(Sanger, 1953), proteinS micS cu 51 resturi aminoacidice (Fig. 1.2). DupS
aceasta a urmat ribonucleaza
(Fig. 1.3) cu 124 aminoacizi. Numeral proteinelor a cSror structure primarS
este cunoscutt. dep&gegte astSzi cateva zeci de mii.
Cunoagterea structurilor primare are o important deosebitS pentru
infelegerea rolurilor proteinelor, ea a deschis orizonturi noi in toate gtiinjele
biologice:
a. Prin studii de secvenjializare s-a stabilit definitv cS o^qmtaM.da!i...are
o. structure unicS. nu este o colecjie de specii moleculare diferite (cum este
cazul polimerilor de sintezH);
b.
proteinelor constituie baza intlegerii la nivel molecular
a activit&ffi lor biologice;
c. Prin compararea structurilor primare a proteinelor care indeplinesc
funcjii omoloage la organisme diferite se poate stabili gradul de varietate
structural^ compatibilS cup anumitS funcjie gi aceste comparand permit
urmSrirea istoriei evolutive a proteinei. DouS sau mai multe proteine

omoloage pot varia la nivelul structurilor lor primare. Adesea aceste


deosebiri rezultS prin inlocuirea unui aminoacid dintr-o grupS cu un altul
aparjinand aceleiagi grupe (de ex. Val cu Leu sau Arg cu Lys). Astfel de
substitufii sunt denumite conservative. Inlocuirea unui aminoacid dintr-o
anume pozijie cu altul aparjinand altei grupe (substitute nonconservativS)
poate altera intr-o mare m&sur& funcjia proteinei;
d. Secvenfa aminoacizilor intro protein^ este veriga intre mesajul
genetic inserts in ADN gi expresia acestui mesaj;
e. Studiile de secvenjializare au dus la descoperirea unor specii de
proteine anormale (proteine mutante) ca expresie a unor modific&ri la nivelul
genomului; aceste proteine anormale se pot manifests sub forma unor boll
(boll moleculare).
f. Secvenfiaiizarea unui num&r din ce in ce mai mare de proteine a scos
in evident fenomenul de polimorfism molecular. O protein^ cu o anumitS
func{ie, la o aceiagi specie, poate exists sub forme moleculare diferite.
Gly-Iie-Vat-Giu-GIn-Cys-Cys-Ala-Sef'Val-Cys-Ser-teu-Tyr-GIn-LeU'Glu-Asn-TyrCys-Asn 5 |
10
15
1 21
s
s
Phe-Val-Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-GIUAta'Leu-Tyr-Leu-Val-CysGly-G!u-Arg-Gly-Phe-Phe-Tyr-Thr'Pro-Lys-Aia
5
10
15
20
25
30
Fig. !.2 Structura primary a insulinei
32

Fig. 1.3 Structua primara a ribonucleazei


L3.2. ORGANIZAREA SPATIALA A MOLECULELOR PROTEICE
Fiecare protein! fiecare lan{ polipeptidic are o structure tridimensional^
specific^ care este reprodusft cu fidelitate de milioane i milioane de ori in
cursul viejii organismului i de-a lungul generafiilor. Forma specific^ a unei
molecule proteice este determinate de structura sa primar! unice pentru
fiecare tip de protein! Aranjamentul spa|ial unic pe care un lanf polipeptidic il

adopts intr-o solujie este impus de constrangeri termodina- mice, este


rezultanta tuturor interac{iunilor necovalente care se pot stabili in cuprinsul
moleculei astfel ca nivelul s&u energetic s& fie minim. Aceste interacjiuni
necovalente de encrgie joasS (1-7 kcal/mol sau 4-29 kJ/mol), au energii de
activare mici, se stabilesc cu viteze foarte mari i nu necesitit intervenjia
unor catalizatori. Ele devin eficiente numai prin insumarea efectelor unui
numSr foarte mare de leg^turi.
Leg&urile necovalente care se manifesto in cadrul moleculelor proteice,
ca i la alte categorii de biomolecule, sunt legSturile de hidrogen, leg^turile
polare i interacjiunile hidrofobe.
33
Legatura de hidrogen se manifest# ca o valenf# auxiliary a hidrogenului
cand acesta este legat covalent la un atom puternic electronegativ (0 sau N):
8
S+
8 ~~~
X ------------------------------------ H ---------- Y-------------donor de hidrogen
acceptor de hidrogen
Atomul de hidrogen, polarizat pozitiv este atras de atomul electronegativ
al altei molecule. Astfel, legdtura de hidrogen se manifest#, in principal, ca o
forf# electrostatic#.
Punfile de hidrogen se stabilesc dup# direc|ii privilegiate. Direcfia cea mai
favorabil#, cea care duce la interacfiunea cea mai puternic#, corespunde
coiinearit#Jii celor trei atomi: X, H i Y. Totugi, earn! aceast# dispozifie no se
poate realiza sunt posibile i aranjamente nelineare ale atomilor.
In afar# de ap#, unde fiecare molecul# este angajat# simultan in patru
leg#turi de hidrogen, la dou# particip# ca donor i la dou# ca acceptor de
hidrogen, asociafiile intermoleculare prin punfi de hidrogen se intalnesc la
mulfi alji compugi, in stare pur# sau in solufii apoase. Leg#turile. de
hidrogen intra- sau intermoleculare intalnite la proteine i alte biomolecule
sunt:

Interacfiunile electrostatice, polare, se stabilesc intre grupSri cu sarcini


elec trice opuse. Aceste interacfiuni pot fi:
- asociafii intre perechi de ioni, leg#turi saline (de ex. intre un rest Arg i
unul Glu);
- interacfiunea dintre o grupare cu sarcin# + sau cu o grupare polar#
f#r# sarcin#;
- interacfiuni intre grupfrri polare f#r# sai*cin#.
Proteinele cuprind- un num#r mare de aminoacizi cu R polar, f#r#
sarcin#, i interacfiunile dintre acegtia sunt un factor important pentru
stabiiizarea structuriior de ordin superior ale proteinelor. Totodat#, in
interiorul moleculei proteice, unde accesul apei este interzis, se realizeaz#
un mediu dielectric, care favorizeaz# interacfiunile polare.
Interacfiunile hidrofobe sunt acele forfe care fac ca moleculele sau
grupSrile nepolare s# se asocieze in agregarte gi s# reduc# la minimum
contactul lor cu apa. Acest fenomen este datorat, in primul rand,, factorilor
entropici; entropia apei scade cand o molecul# nepolar# vine in contact cu

apa gi, respectiv, entropia apei create dac# aceast# molecul# este excius#
din ap#.
34
Interne jiimile hidrofobe sunt factorii cei mai important care determine
conformafia unei molecule proteice prin insumarea unui foarte mare num&r
de contacte nepolare. Dintre cei 20 aminoacizi proteinogeni, apte posed# R
cu caracter hidrofob.
Punjile disulfurice S S care se pot stabili intre dou# resturi Cys,
dei sunt leg#turi covalente, au un rol determinant pentru conformajia
proteinei. Realizarea unei punfi S S necesit# aducerea a douS resturi
Cys in pozijii potrivite care se realizeaza prin forje necovalente.
Fiecare specie proteic# este un unicat in ceea ce privete structura
primary i conformafia. Din studiul conformafiilor unui numir de proteine se
pot formula principiile generate care guverneaz# organizarea spafial# a
tuturor moleculelor proteice. Cele douS elemente structuraie ale unei
proteine, axul catenei polipeptidice i cele 20 de tipuri de radicaii legafi la Ca
care se pot g&si intr-o multitudine de relafii reciproce contribuie la realizarea
structurii secundare i terfiare a proteinelor:
R.
R?
R3
l
l
i
NH CH CO NH CH CO NH CH CO Structura
secundard a proteinelor
Pauling i colab. incepand din anui 1930 au intreprins studii sistematice,
pin cristalografie cu raze X, de m&surare a distanfelor interatomice, a
unghiurilor de ieg#tur& din aminoacizi, din peptide. S-a stabilit c#in
gruparea peptidicS are ioc o conjugare n-p, legStura NH CO capM un
caracter partial de leg&tur# dubl#, rotafia liberal in juml acestei legSturi
fiind astfel impiedicat#. Atomii Ca vor adopta pozifii rigide faf# de planul
legHturii duble. In peptidele naturale se intalnete numai configurafia trans,
mai stabile decat aceea cis (Fig. 1.4).

Fig. 1.4 Configurafia trans a unei legaturi peptidice


35
Lanjul peptidic i$i pesfreaze flexibilitatea prin rotajia liberU in jurul
legftturilor:
R'i
O R2

GH ~ NH
i
C CH
0 alts inspire a grup3rii peptidice este capacitatea grupei NH de a forma o
leg&turli d.e hidrogen cu un grup C = O aparjlnand altei grupftri peptidice:
^ N H -- O * C
Conjugarea n pa gruparii peptidice accentueazd aceaste fnsuire.
Un lanj polipeptidic, in solujie, ar putea adopta o infinitate de conformafii
prin rotafii in jurul legiUurilor CH(Rj) NC^ i CH(R2) CO . Unele
din aceste
conform ajii vor fi mai stabile dace permit realizarea de punji de hidrogen
intre grupSrile peptidice. Plecand de la principiul c& aranjamentul cel mai
stabil este acela in care se realizeazS cel mai mare numSr de punji de
hidrogen, Pauling i Corey (1951) au postulat dou& structuri secundare
pentru lanjurile polipeptidice a - elicea i structura [3. O. structure elicoidalft,
distinct^ de cea descris# de Pauling, este intSlnite la colagen, proteina
major2 a matricei extracelulare, care are o compozijie aminoacidice
particular^.
Structura de elice alfa. Lanful polipeptidic se rsucete (la nivelul
leg&turilor simple) pentru ca grupdrile O = C i ^:NH s3 devinft adiacente
stereochimic pentru a
forma punfi de hidrogen. Se objine astfel o structure repetitive eiicoidala in
care ioate unitSjile se aflii in raporturi spajiale identice cu unitSile vecine. O
grupare NH
formeaz# punte de hidrogen cu gruparea CO aparfin&nd celui de-al patrulea
rest
aminoacidic din secvenja linear&. In acest fel, toate grupele CO i NH
sunt unite prin punfi de hidrogen (Fig. 1.5).
Stereochimia grupSrii peptidice, unghiurile de legSturi, distanjele
interatomice, colinearitatea punfilor de hidrogen, apartenenja aminoacizilor
la aceeai serie optics (seria L) determine o anumite geometrie a a-eLicei;
- cu fiecare rest aminoacidic se avanseaze pe verticaie, cu 1,47 A;
~ pasul elicei, distanfa intre done puncte echivalente pe verticaie este de
5,21 A i cuprinde 3,6 resturi aminoacidice;
- diametrul elicei, diametrul suprafejei cilindrice In care se afle atomii
Ctt, este de 10,1 A;
- sensul nlsucirii lanpdui polipeptidic este de la stanga la dreapta (elice
dreaptd);
36

Fig. 1.5 Structura seconders. de a-elice a unui lanf polipeptidic (dupa


Linus Pauling)
radicalii R ai tuturor aminoacizilor sunt orientafi spre exteriorul eiicei,
configurafia atomilor Ca este aceeai penlru tofi aminoacizii;
toate grup&rile NH i C = O formeazS punfi de hidrogen.
Un lanf polipeptidic sub forma de a-elice are forma unui bastona cu
diametrul de 10,1 A. Pentru 300 restun aminoacidice lungimea acestui
bastona este de 450 A.
3?
Struclura a-elicoidalS a lanjurilor polipeptidice postulate de Pauling i
Corey a fost gSsitS, in proporjie mai mare sau mai micS, la diverse proteine
(Tabelul 1.6).
Tabetui i. 6
Con{inutul in efice-alfa al unor proteine (evaluat prin metoda dispersiei
activit&jii optics)
Proteins
% elice
alfa
Mioglobina
70
tnsulina
38
Ovalbumsna
31
Serumalbumma
(bovina)
46
Pepsina
31
Ribonucleaza
16

Chimotripsina
15
Lungimea i repart izarea segmentelor de a-elice in cuprinsul moleculei
este diferitS de la o proteins la alia, in funcfie de distribujia factorilor
stabilizator! i destabilizatori ai elicei in structura primarS. Resturile prolil,
prin geometria lor particulars, impiedicS rSsucirea elicoidalS a lanjmilor
polipeptidice. La nivelul unui rest Pro, lanjul se indoaie cu un unghi de 130.
Resturile glicil, lipsite de catena laterals, confers lanjurilor polipeptidice
flexibilitate i adesea la nivelul resturilor Gly structura secundarS a este
imreruptS, ianful schimbandu- i uor direejia.
Resturile de valinS, izoleucinS, treoninS, prin radicaiii voluminoi de la Cp
determinS o stanjenire stericS daca aceste R ajung adiacente in elice. Serina,
prin capacitatea de a forma punji de hidrogen prin gruparea alcoolicS
desiabilizeazfi elicea.
Resturile de cisteinS cfmd formeazS punji disulfurice leagS covalent, rigid,
porjiuni ale lanjului polipeptidic i in vecinStatea acestor regiuni rSsucirea
elicoidalS nu mai poate avea loc.
Structura secundarS a se intalnet:e in diverse proporjii atat la proteine
fibrilare cat i la proteine globulare. O proteins fibrilarS cu slructurS
secundarS a in proporjie de aproape 100% este keratina, proteins abundentS
in par, piele, unghii. Este alcStuitS din lanjuri polipeptidice lungi, cu slructurS
de a-elice, asociate cate douS i- superincolScite. Prin asocierea acestor
dimeri se realizeazS fibrile i fibre rezistente. In aceste fibrile, grupSrile R pot
inieracjiona prin valenje secondare in cele mai bune condijiuni. In plus,
structura superelicoidalS este stabilizatS i prin punji disulfurice
intercatenare, keratina avand un conjinut ridicat in cisteinS.
Mioglobina i hemoglobina au un procent mare (70%) de slructurS
secundarS a. In aceste cazuri, segmentele de a-elice sunt scurte, ele sunt
intrerupte de porjiuni
38
neelicoidale. La nivelul acestora din urma, lanjul polipeptidic ii schimbSL
direcjia sub diverse unghiuri, permijand realizarea unei structuri compacle.
Un ait motiv structural intalnit ia proteins cu un procent mare de structure
secundard a const# in asocierea paralel# a unui numflx de segments de aelice. Acest motiv structural putandu~se repeta de mai multe ori in cuprinsul
molecule! proteice.
Stmctura p. O alt# structure secundar# a lanfurilor polipeptidice in care
se realizeaz# potenfialul maxim de legare prin punji de hidrogen a grupdrilor
^:C = O i ^:NH este structura (J sau structurain foaie plisat#. In acest caz
punjiie de hidrogen sunt intercatenare, lanjurile polipeptidice se aeaz# in
foi. Cea mai stabil# interac{iune se obfine dac# lanfurile evolueaz# unul de
la capdtui N-terminal spre cel C-terminal i cel#lalt in sens in vers (structura
(3 cu lanjuri antiparalele, Fig. 1.6).

39
DatoritS rigidit^ljii legdturii peptidice i coplanarit&jii grupului
i
i
CH NH CO CH se realizeazS structuri asem&n&toare unei foi
plisate. Radicalii R sunt oriental, alternativ, de o parte i de alta.
Structura secundarS p In foaie plisatS este intalnitS in propor{ie de
aproape 100 % in proteina din m&tase, fibroina. Lanfurile polipeptidice
antiparalele sunt intinse i asociate prin leg&turi de hidrogen, d&nd nagtere
unei foi plisate. Aceste foi se aeaz& in straturi, intre straturi se stabilesc
numeroase legSturi intre grup&rile R, care proemineazS de o parte i de alta
a fiec&rei foi. DatorM unei structuri primare speciale, cu multe resturi Gly i
Ala alternante, distanjele dintre foi sunt mici (3,5 A i 5,7 A alternativ).
AceastS structura confers fibroinei rezistenjS la intindere i flexibilitate.
Structurile p sunt motive structurale intalnite frecvent in proteine
globulare. Cel mai simple element, de structure P const# dintr-un
lan{ poiipeptidic indoit asupra iui insugicare realizeaz# douS segmente
antiparalele, denumit p-turn:

II I
o
H
II / N | o R H H
De asemenea, mai multe catene polipeptidice, de regulS 6 dar i mai
multe, pot adopta structure p cu foi plisate. Domeniile structurale ale
imunoglobulinelor i ale proteinelor din aceeagi superfamilie cuprind un

motiv structural majoritar p.


Structura terfiara a proteinelor
Acest nivel de organizare inglobeazS structura secundarS i definegte
raporturile dintre segmentele de a-elice i structura p, modul de impachetare
a lanjului poiipeptidic. Factorii determinanti ai structurii tertlare ai unei
proteine sunt interac|iunile necovalente intre. radicalii R de laCr fie cS
acegtia se aflilin regiuni cu structure secundarS a sau ft. fie c#
sunleupria$i4n.,segmenlej>eorganizate. La nivelul de organizare terjiar
molecula proteicS dobandegte forma sa specifics.
40
.Intre divergii radical! ai aminoacizilor sc pot stabili urmtltoarele tipuri tie
leg&turi
necovalente:
- punji de hidrogen intre radicalii cu
(din resl-ur* seril, treonil),
[fST6Tice](din resturi tirozil)jjynidiciJ.(din resturi glutaminil i asparaginii):
N
NH
H
H
j
|
|
i
i
1
-0
C
CH CH2
CH2
H
0H-i
i
[
1
C
CO
O
i
1
1
s
e
1
ri
seril
l
- Jeg^turi ionicejsalinef intre radicalii cu sarcM negative (din resturi lizil,
arginil, histidii) sair interactiuni polare intre radicalii polari, iMt sai;cini:
NH
NH
CH CH2 cocr
co
I
asparti!
Ha*N - (CH2)4 - CH
i
CO
I
iizii
- ipteracfiuni hidrofobe intre resturile aminoacizilor nepoiari ca valinft,
leucina, izoleucinii, fenilalaninil, alanin&
NH
I
CH CH3

I
CO
I
a!anil
H,C
CH
NH
I
CH
I
CO
I
valil
Resturile cisteinil din multe proteine formeazd legftturi disulfurice care
IeagS covalent regiuni mai depdrtate ale lanjurilor polipeptidice. Pozijiile
acestor legSturi depind i de totalitatea factorilor care asigurft conformafia
nativii a proteinei. Ribonucleaza (104 resturi
aminoacidice) cuprinde patru punji disulfurice intre resturile Cys2&~Cys84,
Cys40-Cys95, Cys5B-Cysno i Cys65-Cys72. Din multitudinea de combinajli posibile,
intre cele 8 resturi cisteinil, in proteina native se realizeazit una singurii
(Fig.1.3).
41
Un lan| polipeptidic adopt#, in m&sura in care ti permite structura sa
primal'#, configurajii de a-elice i de structur# P i prin pliere, impachetarea
lanjului caut# s# satisfac# i afinitaple radicalilor R. Rezultanta tuturor
acestor interacpuni determin# conformapa moleculei proteice. Aceast#
conformape este de fapt un cornpromis nu se pot realiza toate legSturile
de hidrogen posibile, nu toate porpunile nepolare ajung s# fie inconjurate de
un mediu pur hidrofob, nu orice grupare () ajunge ia vecin#tatea uneia
(+) dar este compromisui cel mai favorabil din punct de vedere energetic,
cel mai stabil. Factorul ultim care detenu in# conformapa unei proteine este
structura sa primarS. Informapa genetic# tradus# in secvenje de aminoacizi,
prin jocul forjelor fizico-chimice, se transform# spontan in edificii
tridimensionale specifice.
Prima protein# a c#rei structui# tridimensional# a fost stabilit# in cele
mai mici detalii, precizandu~se pozipa in spapu a tuturor atomilor
componenp este mioglobina (Kendrew i colab., 1957). fMioglobinaJeste
oprotein# abundent#in mugchi, in special la mamiferele
cufund#toare (balen#, cagalot) avand rolul de rezervor tisular de oxigen.
Este o protein# cuprinznd aproximativ 150 aminoacizi (mioglobina din
muyhiul de caalot 153) i o grupare neproteic# denumit# hem. In Fig. 1,7.
se arat# schematic conformapa moleculei de mioglobin#.

Fig. 1.7 Structura ter|iar# a mioglobinei


42

Fig. 1.8 Structura terfiara a lanjului p al hemoglobinei


in mioglobinS 75% din lanjul polipeptidic formeazS a-elice. Cuprinde
J_Sgmente eiicoidale (denumite A, B, ... H) cuprinzand intre 7 (segmentul D)
24 resturi arninoacidice (segmentnlJi). Regiunile eiicoidale sunt separate de
segmente neelicoidale la nivelul cSrora lanjul polipeptidic i^i schimhS
jireffiia. In patru puncte de terminare a elicelor se aflS Cprplmaf In celelalte
regiuni intreruperea fSsucirii eiicoidale' este determinate de al{i factor!. Prin
aceste schimbSri ale directieij.ant.ului polipeptidic, molecula devine extrem
de compacts (45 x 35 x 25 A).flnterionil moleculmj cuprinde numai
jaminoacizi cu R nepolaij cu excepjia a douS rejun^jstidil angaiate in legarea
grupSrii hem..Resturile treonil i tirozil au grupSrile hidroxilice orientate
superficial, pe cand porjiunile nepolare ale acestor aminoacizi sunt ingropate
in interior. Suprafaja externS a moleculei cuprinde toate resturile polare i cu
sarcinS electrics, presSrate printre radical! nepolari.
Conformatia lanjurilor polipeptidice din hemoglobins este asemSnStoare
cu cea a mioglobinei (Perutz, 1959) (Fig.1.8).
43
In prezent, sunt cunoscute structurile terfiare ale multor proteine.

Proteinele solubile, citoplasmatice sau aceiea prezente In plasma sau in


lichidele interstifiale sunt proteine globulare care- au etalate pe suprafafd
grupdrile polare i pe aceiea care pooartd sarcini elec trice. Radical ii
nepolari sunt orientaji in interiorul moleculei. Forma sfericd sau elipsoidald a
moleculei depinde de raportul dintre numeral resturilor aminoacidice cu R
incdrcat i numdrul resturilor cu R hidrofob. O valoare mai mare a raportului
(0,9-1,4) favorizeazd adoptarea unei forme mai alungite. O proteind cu un
raport numdr R incdrcal/numdr R hidrofob mic (0,3-0,6) adopts o formd
sferoidald, resturile nepolare, hiclrofobe se acomodeazd mai uor in central
unei structuri globulare decat al uneia cilindrice.
La proteinele membranare tnglobate In stratul dublu lipidic, repartizarea
resturilor aminoacidice polare i nepolare este inversd. Partea exterioard a
moleculei, in contact cu lipidele membranare, cuprinde radicalii hidrofobi. La
unele proteine, in interiorul moleculei se delimiteazS canale cdptuite cu
resturi aminoacidice polare i incdrcate electric (canale ionice).
Organizarea pe dom.enii a proteinelor. In anii din urmd a fost descris un
alt nivel intermediar de organizare structural^ a proteinelor, organizare
domeniald sau suprastruc- turd secundard. Acest nivel de organizare este
inlalnit mai ales la proteinele mai mari. Un domeniu al unei proteine
multidomeniale corespunde unei porjiuni continue in structura primary a
lanjului polipeptidic care este impachetat intr-o entitate funejionald i are o
organizare proprie secundard i terpard. Domeniile sunt separate intre ele
prin porfiuni de ianj mai pu|in organizat, flexibil, eeea ce asigurd posibilitatea
deplasdrii unui domeniu in raport cu altul (dinamica domeniilor). Relapile
dintre domenii sunt deosebit de variate, zonele de contact, de interacpune
pot fi mai reduse sau mai intinse. De asemenea, dimensiunile domeniilor
structural variazd intre limite largi, de la cateva zeci de resturi aminoacidice,
la sute (cel mult 400).
Organizarea domeniald a proteinelor se intalnete la multe proteine i
domeniile structurale s-au dovedit a fi unitdp fundamentale ale evolujiei i
diversificdrii proteinelor. Prin compararea unor proteine analoage (exercitd
funcfii similars) sau/i omoloage (derive dintr-un acelai strdmo) s-a gdsit cd
aceste proteine euprind unul sau mai multe domenii structurale aproape
identice. Acest fapt denote cd odatd ce prin procesul de evolujie s-a
inventat o proteind aptd sd indeplineascd optim o anumitd funcpe,
patternul structural al acesteia a fost conservat i repetat ori de cate ori a
fost necesar. Diversificarea i complexificarea proteinelor s-a fdcut prin
combindri ale acestor motive structurale.
In naturd exists numeroase enzime, diverse ca origine i activitate
cataliticd, care utilizeazd ca substrat un nucleotid (ca NAD, FAD, AMP). Toale
aceste enzime euprind un domeniu structural de aproximativ 70 resturi
aminoacidice cu o regiune specified de legare a nucleotidului.
44
Proteinele care regleazft transcrierea ADN i exprimarea informajiei
genetice au capacitatea de a se lega de ADN dubiu elicoidaJ. In structure
acesior proteine a fost recunoscutd existenja calorva motive structural e
(fermoar cu leucinS, deget cu zinc, motiv a|5a) care prin forma i
dimensiune- sunt complementare cu adancitnra mare din dubia dice de ADN
(Hkflk).

Imunoglobulinele sunt aicatuile din mai multe domenii structurale (12)


care prezintd o organizare spafiaM specifics (imunoglobulin fold). Acest
domeniu structure este intalnit i la receptorul celulelor T, la complexul major
de histocompatibilitate (EMC) clasa I i clasa II ' Un pas important m
explicarea i interpretarea organized domeniale a proteineior a fost fftcut
odatd cu descoperirea discontinuitSjii genelor, a alc&tuirii lor din exoni
(segmente de gene care se exprimfi ca proteine) i introni (segmente de
gene transcrip- iibile dar netraductibile, care nu se exprimd ca proteine). S-a
constaiat cS, in multe cazuri, un domeniu structural proteic este codificat de
un exon. Prezenja unui aceluiaji domeniu in proteine omoloagc indica
descenden|a acestor proteine dintr-un stramog comum De asemenea, unele
domenii sunt dispersate in diverse proteine ale aceleiai specii. Trecerea unui
domeniu de la o protein^ la alta este posibilS prin trecerea unui exon dintr-o
gen& in alta, prin rearanjari cromosomiaie.
Structura cmternara a proteineior
Multe proteine sunt alc&tuite din mai multe lanjuri polipeptidice, de regulS
un num&r mic i pereche (proteine oligomere) (Tabelul 1.7). Lanjurile
individuale sunt denumite protomeri sau subunitlifi. La aceste proteine pe
langft structurile primarS, secundarS si terjianl ale fiecdrui protomer, apare
un nivel superior de organizare - structura cuaternarfi. Aceasta definete
nature, numfirul i modul de asociere a protomerilor.
Proteine oligomere
Tabeiui 17
Masa
Masa
Nr.proto
Prteina
proteinei
protomerilor
meri
Kdaltoni
Kdaltoni
Miozina
468
2
212
Creatin kinaza 80
2
40
Fosfataza
40
alcaltna
80
2
Hemoglobins
64,5
4
16
Lactat
150
4
35
dehidrogenaza
Aldolaza
160
4
40
Glicogen
fosforilaza
270
4
92,5
Piruvat kinaza 237
4
57,2
Ceruloplasmin
151
8
18
s
Glutamin
592
48,5
12
sintetaza
Funcjia specific^ a unei proteine oligomere se manifesto numai la nivelul
structurii cuaternare, protomerii separaji sunt inactivi.
45
Asamblarea protomerilor, structura cuaternare, se realizeazS numai prin
for|e slabe necovalente i asocierea devine stabile, permanents, numai dacS
suprafefeie de contact sunt complementare i un num&r cat mai mare de
atom] se apropie pane la nivelul razelor lor van der Waals (raze de contact).
Complementarifatea suprafefelor de contact asigurS un grad foarte inalt de

precizie $i de specificitate a structurilor cuaternare. Protomerii unor proteine


omoloage de la specii diferite nu se asociazS.
Interacjiunile prin suprafeje complementare prezinte fenomenul de
cooperate, primele interacjiuni favorizeazS formarea celorlalte. La inceput
moleculele se juxtapun prin cateva puncte dupS care celelalle grupSri ii
gSsesc mai uor partenerii.
Capacitatea de interacjiune a moleculelor prin suprafeje complementare
explicit nu numai form area proteinelor oligomere, a unor structuri
supramoleculare, dar i modui in care proteinele cu structure cuaternare Ti
indeplinesc funcjiile caracteristice, de transport etc.
Structurile cuaternare permit funcjionarea unor mecanisme fine de reglare
a activitSjii proteinelor. O perturbajie care are loc la nivelul unui protomer (de
exemplu combinarea sa cu un compos oareeare), poate fi transmisS in restul
moieculei, fund resimjita la nivelul contactului dintve protomeri, structura
cuaternare este alteratd i totodatfi i funcjia proteinei. Acest mecanism de
reglare este denumit. regime alostericS, ce va fi dezvoltat in capitolul de
enzime.
Hemoglobina este o proteins oligomere. Hematiile normale cuprind mai
multe speeii moleculare de hemoglobin#. Componenta principal# din
sangele adultului este hemoglobina A, (Hb Aj) aieturi de care se afl# in
cantitate mice Hb A2. La embrion exist# o Hb E iar la f#t i nou-n&scut Hb F.
Toate speciile de hemoglobin# cuprind patru lanjuri polipeptidice de cate
dou# tipuri. Hemoglobina A, me structura a2 p2.
Celelalte specii de hemoglobins cuprind in locul Ianjurilor P, lanjuri y. 6. e :
Hb A, = a2 p2 Hb A2 = a2 52 Hb F" = a2 yl
>
Hb E = a2 e2
Fiecare protomer este legal de cate o grupare hem i activitatea de
transport a oxigenului se manifests numai la nivelul tetramerului.
Lanjul a cuprinde 141 resturi aminoacidice, iar-cel p, 146 resturi.
Structurile terjiare ale acestor lanjuri sunt similare cu ale mioglobinei, cu care
are similitudini i de compozijie aminoacidice. In Fig. 1.9 este arStat#
structura cuaternare a hemoglobinei. Un lan| a este asocial de ceie dou#
lanjuri p prin zone de contact diferite a} (Jj i |i2. Contactele inlre protomeri
idendci a i a sunt foarte reduse, Contactul a1 p2 este cel mai intins in spajiu,
sunt implicate 34 resturi aminoacidice i aduce in contact 110 atomi, Forja
principal# de legare sunt interacjiunile hidrofobe. A1 doilea contact, a; P3 mai
restrims aduce- in vecimitate 80 atomi aparjinand la 19 resturi aminoacidice.
Da tori t# acestui contact mai slab, hemoglobina se disociaz# in condijiuni
favorabile, mai intai in dimeri i apoi sunt eliberaji protomerii:
a2 p2 ^ 2 ap ^ 2a + 2P
46

1.3.3.
PROPRIETATI GENERALE ALE PRGTEINELOR
Solubilitatea. Proteineie fibrilare sunt insolubile in ap&, pe c&nd cele
globulare prezinttl grade diferite de soiubiiitate. AceastS. inspire este
datoratd repartizMi pe suprafaja moleculelor de resturi aminoacidice cu
sarcini electrice i a acelora care cuprind grupSri polare.
Solubilitatea in apS a proteinelor este puternic influenJatS. de pH-ul
mediului prin modificarea inc&rcSrii electrice a proteinei. De asemenea,
diverse s&ruri ale metalelor uoare NaCl, MgCl2, Na2S04, (NH4)2S04
influenjeaz& considerabil solubilitatea proteinelor. La concentrafii mici ele au
un efect favorabil. De exemplu, proteineie din clasa globulinelor sunt greu
soiubile in apd purS, ele se dizolv& uor numai imsolujii saline diluate. La
concentrafii foarte man, s&rurile amintite scad solubilitatea proteinelor panit
laprecipitarea lor din solujii (salifiere). Albuminele i globulinele se deosebesc
dupd uurinfa cu care sunt precipitate de cdtre sulfatul de amoniu.
Globulinele precipitS cand soiufiile care le cuprind sunt aproximativ semi
saturate in (NH4)2S04, pe cand albuminele precipita la concentrafii mai mari
de 75% saturate. Precipitarea fracJionat& a proteinelor din solujie prin
adSugarea treptatd de (NH4)2S04 este o metodd cu largi utilizSri pentru
separarea proteinelor din medii biologice complexe.
Proprietaiile electrochimice. Proteineie sunt amfoliji macromoleculari,
cuprind un num&r mai mare sau mai mic de grupSri acide gi bazice.
Contribufia cea mai important# o au resturile glutamil, aspartil, lizil, arginil i
histidil. Resturile aminoacidice C-terminal i N-terminal au o contribute
redus&, cu atat mai redus# cu cSt lanful polipeptidic este mai lung. La pH-ul
fiziologic toate aceste funcjii acide sau bazice sunt ionizate complet (restul
histidil este ionizat aproximativ 50%), proteina apare ca un poliamfolit.
47
ProprietStile electrochimice ale protdnelor sunt concretizate prin pH-ul
izoelectric (pi), pH-ul solufiei in care proteina apare cu o sarcinS electric#
nulS, numSrul grup&rilor (+) este egal cu acela al grupSrilor ().
Valoarea pi a unei proteine depinde de compozifia sa arninoacidicS, de
predominenja res- turilor acide, a acelora bazice. 0 proteins cu pi > 7
cuprinde un exces de lizinS i/sau argininS; o proteinS cu pi < 7 cuprinde o
proporfie mare de aminoacizi dicarboxilici (Tabelul 1.8),
La pH-ul izoelectric solubilitatea, mobilitatea proteinei in campuri elec
trice este minimS. La pH-uri depSrtate de pi o proteins are o incSrcSturS nets

(+) sau ():.


P
NH3+

+ H*
^------------ P
COOH
NH8*
+ HO"
------------- P
- H20
GOO"
NH2
GOO"
proteina la
proteina la
proteina la
pH < pi
pH = pi
pH > pi
Sub forms de anioni sau cationi, proteinele migreazS in campuri electrics,
proprietate care stS la baza metodelor elect roforetice de separare a
proteinelor din amestecuri.
Tabelul 1.8.
pH-urile izoelectrice (p!) ale unor proteine
Proteina
pi
Sal mini
12,10
Histona
10,80
Serumafbumina 4,90
Miozina
5,20
Fibrinogen
5,50
Tireoglobulina
4,58
Lizozlm
11,00
MioglobinS
6,99
Hemoglobin^
7,07
Citocrom c
9,80
Insulina
5,35
PepsinS
- 1,00
Denaturarea proteinelor. Conformajiile native ale proteinelor globulare,
rezultate prin impachetarea specifics a lanjurilor polipeptidice i asocierea
subunitSjilor in proteinele oligomere sunt extrem de fragile, ele sunt uor
perturbate sub ac{iunea unei multitudini de agenji care afecteazS
interacjiunile necovalente din cuprinsul moleculei, Modificarea conformafiei
native a unei proteine poartS denumirea de denaturare i agenfii care o
provoacS sunt agenji denaturanji. Slructurile de ordin superior ale unei
proteine secundarS, terJiarS, cuaternarS sunt asigurate de legSturi
necovalente de energie joasS i agenjii denaturanji pun in joc forje de
intensitate micS care nu afecteazS legSturile
48
covaiente. In cursul denaturSrii unei proteine nu sunt rupte iegdturile
peptidice, nu se elibereaz! aminoacizi.
Denaturarea proteinelor este provocate de agenji foarte diferiji:
- temperatura de 50-60 denaiureaz! cele mai multe proteine globulare;
pujine proteine, de ex, ribonucleaza, suport! pentru scurt limp temperaturi

de 100 f!r! a sc denatura;


- radiajliie cu frecven{! mare, ultraviolets, X, y;
~ pH-urile extreme, acide sau bazice denaiureaz! majoritatea proteinelor;
-ureea i guanidina, In concentra{ii marl denaiureaz!, reversibil,
majoritatea proteinelor solubile;
- agenjii tensioactivi (surfactan(ii);
- solvenjii organici.
Acjiunea denaturant! a ureei i guanidinei, compui cu o capacitate foarte
mare de a conlracta legdturi de hidrogen, demonstreaz! rolul acestor
interacjiuni la stabilizarea conformafiei unei proteine. Acjiunea acestor agenfi
este uor reversibil!; dup! indepdrtarea ureei sau a guanidinei, leg&turile de
hidrogen se reconstituie in cuprinsul molecule!. proteice in acelagi num!r i
in aceleagi pozijii ca in proteins nativ!. Denaturarea proteinelor sub acjiunea
agenjilor tensioactivi sau a solvenjilor organic! demonstreaz! rolul
interacfiunilor hidrofobe in realizarea conformajiei native a unei proteine,
Acizii i bazele modifies inc!rcarea electrical a unor gup!ri, schimb!
raporturile de vecindtate intre sarcinile + i - de pe suprafaja moleculei.
1.3.4.
CLASIFICAREA PROTEINELOR
Sistematizarea proteinelor, compugi de o varietate molecular*! i
functional! extraordinar de mare, este deosebit de grea, orice incercare este
arbitrar! bazfmdu-se pe uneie tr!saturi ale proteinelor gi ignorandu-le pe
allele.
O prim! imparjire foarte general! a proteinelor este aceea in
proteine^obularc, ugor solubile i in genere proteine intracelulare i
proteinef fibrilarej insolubile, de regul! proteine extracelulare, cu roiuri de
sus|inere.
Un alt criteriu de clasificare a proteinelor este prezenja sau absenja in
molecul! a unei grupSri chimice distinct^, de lanjul polipeptidic, denp.mit!
igrupare prostetic!: Pe aceast! baz!, proteinele sunt clasificate im proteine
simple* alc!tuite numai din aminoacizi i proteine conjugate (heteroproteine),
alc!tuite dintr-o protein! (apoprotein!) i o grupare prostetic!. Dup! natura
grup!rii prostetice se deosebesc urm!toareIe clase de proteine:
Fosfoprotemc* grugarea prostetic! este constiruit! din?restul fosforil
(rEQ^H*). legat estenc la grup!ri hidroxilice aie resturilorlseril, treonil sau
tirozili
.//tuT
Uneie proteine cuprind permanent resturi fosforil (de ex. cazeina), pe
cand altele // oscileaz! intre forme fosforilate i defosforilate (proteine
interconvertibile). Schimbarea gradului de fosforilare a unei proteine, face
parte dinlr-un mecanism general de re glare a func{iilor proteinelor (vezi
capitolele enzime, hormoni).
49
' '
* ^Ghcoproteinejptottmt ce cuprind unitdji^ mpiiozaharidice sau
qjigozaharidice ataate de laniul polipeptidic.sProteinele din membrana
plasmatic^ cele care cSptugesc diverse cavitriji sunt bogate in resturi
giucidice. Un numSr redus de glucide este prezent insS in mai toate
proteinele.
Lipopi ofemek sunt asocjalii^intre proteine (apoiipoproteine) i un a sau
mai make grupe de lipide amfipatice. Asocierile predominant necovalente

sunt totui suficient de


stabile i specifics, lipoproteinele existand ca entity strucxuxate^de sine
st&t&toare. In |fiasmS fexist.il mai multe grupe de lipoproteine (chilomicroni,
a i P lipoprotexne)r.QromoproteinelemuX proteine colorate din cauza grupSrii prostetice pe
care o cuprind. Subclasa lhenioproteinei6i| proteine a cSror grupare
prosteticS este rfjqra.pl,) cuprinde \ blkCC hemoglobina i mioglobina,
proteine transportoare de^oxigen, citocrqmii, proteine) iransportoare de
electroni. 0 aitS subclass de cromoproteine suntlflavoproteinelet proteine^'Jl
*',J\ colorate tn galben. Cuprind drept giupare prosteticS o structure derivatS
de la. fvitomina^ EU) (nboGavina). Flavoprotemele funcfioneazS ca
tnmsportori de^hidrogen.
|i,
. ______________ ,, ...
bWeig]pproieinele\ proteine care cuprind ioni metalici sau combinapi.
sjmpl^.al.ei metalejor asociate direct cu agoproteina, Feritina, proteina de
depozitare a fierului este.' ^ alcStuitfidin apoferitinS i ioni de tier;
ceruloplasminaeste o proteina ce cuprinde ioni de cupru.;^X(b.?ix
cS) Nucleoproteinele sunt alcStuite din aeizii nucleici i proteine, in genere
proteine bazice, asociate primleg&turi salines
' O aceeagi proteins poate cuprinde mai multe tipuri de grupSri prostetice,
insumSnd caracterele mai multor clase de proteine conjugate, fosfo- gi
glicoproteine, glico- i metaloproteine etc.
Un alt mod de a sistematiza studiul proteinelor este acela dopa funcfiile
pe care le indeplinesc, proteine enzimatice, proteine contractile, proteine
hormonale, proteine de transport etc., sau dupil origine in proteine
plasmatice, proteine eritrocitare, proteine hepatice etc.
In toate capitolele urmStoare ale acestei alrfi, proteinele apar ca figuri
centrale prin varietatea lor structural^ i multitudinea de funcjii pe care le
indeplinesc, catalizatori, hormoni, anticorpi, proteine structural, contractile
etc.
Metabolismul proteinelor, sintezS i degradare, este tratatin Cap. V unde se
prezintft mecanismele moleculare de legate a aminoacizilor in succesiuni
dictate de informajia
50
genetics cuprinsft in ADN i in Cap. IX care cuprinde cSile de biosintezS i de
catabolizare a aminoacizilor.
In subcapitolul urmator sunt prezentate cateva grupe de proteine, care
evidenjiazli
relafiile structur<i-func{ie.
1.3.5.
PROTEINELE PLASMATICE
Plasma cuprinde o cantitate mare de proteine (77,5 g/dl) i de o mare
diversitate (Tabelul 1.9)'.
Prim a fraclionare a proteinelor serice s-a fScut prin salifiere (salting-out)
cu sulfat de amoniu i a dus la objinerea fracfiunii globulineior care precipitd
la concentrajii saline mai joase (in jurul valorilor de semisaturajie) i a
albuminelor (precipitd la saturarea solupei in sare), Folosindu-se rnetode cu
putere de rezolufie din ce in ce mai mare, bazate pe diversele insujiri ale
proteinelor, s-a putut individualiza in plasn.nl un num&r foarte mare de
proteine ( > 300).

Metoda curentd pentru separarea proteinelor plasmatice (sau serice)


utilizat# in laboratoarele de biochimie medicals este electroforeza. Se
utilizeaza suporturi solide (hartie, gel de agarozd, gel de acetal de celulozd)
i pH-ul de lucru este 8,6. La acest pH toate component.de proteice sunt
incarcate negativ i migreaz3 spre anod. Pe electrofo- regramS, dupS
colorare, proteinele apar ca benzi colorate. Prin mflsurarea densitd|ii optice a
electroforegramei, fiecare bands d3 un maxim de absorbjie (Fig. 1.10).
Prin electroforeza serului, in condijiile aminlite mai sus, se objin cinci
fracfiuni: serumalbumina, ar, a2~, [3 - i 7-globuline.

Fig, 1.10 Electroforegrama seruiui uman (pH 8,6). Se separa cinci


fracfunni; albumins, a,-, a2-, (}- i f globulins

Serumalbumina are mobilitatea electroforeticS cea mai mare,


Serumalbumina constituie
o fracpune omogenS, pe cand fracfiunile globulinice, cuprinde fiecare mai
multe componente individuate (Tabelul 1.9).
Tabelui L3
Protein piasmatice (label seSectiv)
Proteina
Conc.mg kD
pi
/dl
PrealbuminS
20-40
54,4
4,7
12 h
AlbuminS
350069
4-5,8
15-19 z .
4000
Fracjiunea ap
arAntiproteaz
a
78-200
55
4,8
4z
(antitripsina)
a^Glicoprotei
na
50-150
40
2,7-4
5z
(orosomucoid
)
:
Apolipoprotei
na A
170-325 200
.
arFetoprotein
0,003
69
a
Fracjiunea a2:
Haptoglobina 30-215
85
4,1
2z
ocrMacrogiob 125-410
5,4
5z
uiina
800

Ceruloplasmi 20-50
4,4
4,5 z
160
ns
Fracjiunea p:
Transferina
200-350 77
5,7
7z
Apolipoprotei
60-155
3000
na B
C4
10-40
206
7
Fibrinogen
200-400 340
5,5 .
2,5 z
C3
70-150
180
.
,
p2Mtcroglobulin 0,1-0,2
11,8
a
Fracjiunea y ; 525IgG
1650
160
6-7,3
24 z
IgA
40-390
170
6z
IgM
25-310
900
5z
Proteina
0,8
120
6,2
reactiva C
Serumalbumina. Este cea mai abundentS proteins plasmaticS (3,5 5,5
g/dl) reprezentand jumState din proteinemia totals. 0 cantitate aproximativ
egalS cu cea din plasmS se aflS in spajiile extracelulare.
Serumalbumina are masa molecularS de 69 kD i este alcStuitS dintr-un
lan{ polipeptidic cu 585 resturi aminoacidice. Este o proteins
multidomenialS. Forma generals a moleculei este elipsoidalS. Are pi ~ 5, la
pH = 7,4, poartS un numSr mare de sarcini negative. Este sintetizatS in ficat
(12 g/zi) i in plasmS, are un timp de injumStSjire de 15-19 zile.
52
Prin concentrajia sa moleculard mare, serumalbumina este componentul
care r&spunde cle 75-80% din presiunea osmoticd a plasmei, avand rolul de
a menfine apa in compartimentul intravascular.
Serumalbumina are proprietatea de a lega, mai mult sau mai pufin
specific, divergi component piasmatici, indepiinind funcjia de transporter al
acestora. Serumalbumina leagd compugi hidrofobi, insoiubili in apd, ca
bilirubina, acizi gragi liberi, vitamine liposolubile. Serumalbumina este
transporter plasmatic pentru unii hormoni steroizi, pentru hormoni tiroidieni.
Serumalbumina leagd cationi, Ca2+, Cu2+. De asemenea, serumalbumina este
un vehicul pentru multe medicamente: aspirina, sulfonamide, peniciiind etc.
Imunoglobulinele-. Imunoglobulinele (anticorpii) sunt proteine cu roiuri de
apdrare impotriva microorganismelor bacterii, virusuri, parazi|i care
invadeazd organisrpul. Sunt proteine solubile, se afld major! tar in plasm & gi
reprezintd elementele de recunoag- tere ale sistemului imun umoral.
Imunoglobulinele sunt sintetizate ca un rdspuns specific la pdtrunderea in
organism a unui microorganism sau a unui compus macromolecular
(protein^, polizaharid) strain (nonself). Agenjii strain! capabili sd dedangeze
sinteza de anticorpi sunt denumifi antigene (imunogeni). Un anticorp se
combind cu antigenul specific form and un complex antigen-anticorp
(complex imun) care blocheazd antigenul gi totodatd ini{iazdprocese care
distrug agentul patogen, fagocitoza, activarea complemen- tului (rdspuns
imun).

Antigenele, microorganisrne sau macromolecule, cuprind pe suprafafa lor


un mozaic de grupdri chimice, fiecare dintre acestea putand declanga
sinteza unui anticorp specific. O grupare chimicd sau un ansamblu de grupdri
care poate declanga sinteza unui anticorp se numegte determinant
antigenic. La o proteind, un determinant antigenic este realizat de cateva
resturi aminoacidice. Mioglobina, o proteind cu aproximativ 150 resturi
aininoacidice posedd cinci determinant antigenici. Numeral determinanj.ilor
antigenici pe o celuld bacteriand este foarte mare.
Organismul uman este capabil sd recunoascd orice fel de determinant
antigenic gi sd sintetizeze anticorpi specific!. Se estimeazd cd un adult
sintetizeazd in jur de un milion de specii moleculare de imunoglobuline.
Imunoglobulinele sunt sintetizate de plasmocite, celule care provin prin
diferenfiCrea gi proliferarea limfocitelor.
Fiecare celuld gi dona celulard respectivd sintetizeazd un singur tip de
imunoglobuline, capabile sd recunoascd un singur determinant antigenic. O
celuld bacteriand sau o macromoleculd proteied cuprinzdnd numerogi
determinant antigenici stimuleazd diverse celule limfoide B ceea.ce duce la
sinteza unei popula{iL heterogene de imunoglobuline,
53
anticorpi policlonali. Prin tehnici de laborator se pot obfine clone celulare
care sS product fiecare molecule identice de imunoglobuline (anticorpi
monoclonal!).
Exists mai multe clase de imunoglobuline (Ig) cu funcfii i distribujii
diferite: IgA, IgD, IgE, IgG, IgM. Clasa IgG cuprinde mai multe subtipuri:
(lgG] ... IgG4).
Imunoglobulinele M (IgM) se gSsesc in principal in plasmS, in concentrajii
mici, sunt sintetizate ca rSspuns la primal contact al organismului cu
antigenul. Sunt deosebit.de eficiente in activarea celulelor fagocitante i in
activarea complementului.
Imunoglobulinele G (IgG) constituie fracfiunea majors a imunoglobulinelor
plasmatice (70-80%). Se gSsesc, de asemenea, i in lichidele interstijiale.
Sunt sintetizate in cantitate mare la al doilea contact cu antigenul. ActiveazS.
eomplementul i celulele fagocitare. Pot traversa placenta.
Imunoglobulinele A (IgA) se gSsesc in concentrajii mici in plasmS i in
secrejiile mucoase din intestin, plSman, lacrimi, salivS, colostra. IgA
constituie prima linie de apSrare impotriva invaziilor cu agenji patogeni. Nu
activeazS eomplementul.
Imunoglobulinele E (IgE) sunt recunoscute ca fiind responsabile de unele
manifestSri ale rSspunsurilor alergice. Se aflS fixate pe leucocite bazofile
plasmatice i pe mastocitele din perejii vaselor i dupS interaejia cu
antigenele celulare activate mediazS rSspuns urile alergice (secrejii de
histaminS, uneori serotoninS).
Imunoglobulinele D (IgD) sunt prezente in plasmS in cele mai mici
concentra{ii; nu se cunoate exact ce funejie specifics au.
Structura imunoglobulinelor. Diversitatea molecularS a Ig (aproximativ 106
specii moleculare) se realizeazS in cadrui unei scheme structurale unice (Fig.
1.11). Sunt tetrameri cu formula molecularS H2L2. Lan {urile H (de la heavy,
greu) cuprind aproximativ 440 resturi aminoacidice (446 pentru ian{urile H
din IgG) i au mase de 53- 75 kD. Lanjurile L (de la light, uor) cuprind

aproximativ 220 resturi aminoacidice (214 la IgG) i au mase de 23 kD.


Lanjurile H sunt diferite de la o clasS la alta, lanjuri y la IgG, p la IgM, a la
IgA, e la IgE i 8 la IgD. Lanjurile L, la toate clasele sunt fie lanfuri X, fie k.
Unele imunoglobuline apar sub formS de oiigomeri ai structurii de bazS,
dimeri (IgA) sau pentameri (IgM) (Fig.1.12).
Structura generals a unei molecule de imunoglobulinS este arStatS
schematic in Fig.I.ll. Molecula are forma literei Y. Lanfurile L i H se
asociazSincepand cu capetele lor N-terminale i formeazS brajele literei Y.
Cele douS jumStS|i C-terminale ale lanjurilor H alcStuiesc coada moleculei.
Imunoglobulinele cuprind componente oligozaharidice legate N-glicozidic.
Intre lan{uri i interlanf exists numeroase punfi disuifurice.
54

Fig. 1.11 Structura generals a unei imunoglobuiine (Ig)


Fig. 1.12 - Structura pentameric& a imunogiobuiinelor M (IgM)

Funcfiile imunogiobuiinelor. Func|ia principal^ a unei imunoglobuiine sau


anticorp (Ac) este aceea de a recunoate i de a se combina cu antigenul sau
determinantul antigenic (Ag), formand complexul Ag-Ac:
Ag + Ac ** Ag * Ac
0 molecule tetramericS de Ig este bivalents, cuprinde douS. situsuri de
legare, cu aceeai specificitate, alc&tuite din capetele N-term inale ale
lanjurilor H i L.
Interaejiunile dintre Ac i Ag sunt necovalente, interacjiuni hidrofobe,
polare, punfi de hidrogen i se bazeaz& pe complementaritatea chimicS i
stench dintre determinantul antigenic i situsul de legare al Ig. Acest gen de
interacfiune are un grad foarte inalt de specificitate, afinititjile antigenelor
pentru anticorpii specifici sunt foarte mari (kd pentru complexele Ag-Ac au
valori de 10 -10'10 M) factorii determinanji ai acestor interacjiuni sunt vitezele
de difuziune, fiecare intalnire dintre Ag i Ac este eficace.

Fixarea Ag la Ac i formarea complexelor Ag-Ac este urmatS de


evenimente care vor duce la omorarea microorganismului invadator, la
distrugerea antigenului. Aceste funcjii
55
efectoare sunt comune pentru o clasd de imunoglobuline. Complexele Ag*Ac
formate de cStre IgM. i IgG sunt apte s& interacfioneze cu receptori de pe
macrofage i neutrcfile, inijiind chemotactism, fagocitozd, eliberare de
mediator!, citotoxicitate. De asemenea, complexele AgAc inifiaz^
evenimente care activeazd sistemul complementuiui, culminand cu formarea
unui complex litic (sau MAC, membrane attack complex) care formeazS pori
In membrana celuiei fintd i determine liza celulei. Aceste funcfii efectoare
sunt locaiizate in segmentele N-terminale ale lanfurilor H.
Organizarea multidomeniald a imunoglobulinelor. Cercetarea
imunoglobulinelor cu metode din ce in ce mai perfecfionate a dus la
stabilirea de -analog!! structurale intre diversele porfiuni ale lanjurilor L i H.
Segmente cu lungimi de aproximativ 110 resturi aminoacidice, doud in
lanpiri L i 4 in lanfuri H, prezintd analog!! la nivelul structurilor primare i al
organized lor secundare i terfiare, alc&tuind domenii structurale. Un astfel
de domeniu este alciltuit din dou& foi plisate cu lanjuri antiparaiele cu
structure p. Intre foi, radicalii nepolari determine interacjiuni hidrofobe
putemice i o punte disulfuricS, realizeazd o legytury covalentS interstrat.
Impachetarea specific^ a unui astfel de domeniu bistrat cu foi antiparaiele,
este intalnitd i la alte proteine (immunoglobulin fold) receptorul celuielor T,
complexele majore de histocompatibilitate (MHC clasa I i clasa II), ceea ce
pledeazd pentru originea lor genetic^ comund (Fig.L13).
O molecule de Ig este alcStuitS din 12 astfel de domenii, Un domeniu
dintr-un lanf este asociat cu un domeniu din alt lanf, astfel incat intreaga
molecule apare ca fiind alcStuitS din ase module globulare (Fig.1.14).
Studiile de seevenfializare ale 1 an junior L i H din poptilafii omogene,
individuals de Ig au ardtat c& segmentele 1-108 pentru lanjurile L i 1-125
pentru lanjurile H difer$ de la o molecule la alia, sunt domenii variabiie VL i
VH. Celelalte segmente au structuri primare aproape identice pentru fiecare
ciasd de Ig, sunt regiuni constante CL i CH. Regiunea constants, a lanfurilor L
corespunde unui singur domeniu CL. Regiunea CH cuprinde trei domenii
constante CH1, CH2, CH3 (la IgG).
In structura Quaternary a unei Ig, domeniile VL i VH formeazS situsurile de
legare a antigenului, ceea ce permite, in raport cu structura primary a VL i
VH, realizarea de centre de legare cu specificity diferite. Variabilitatea acestor
domenii nu este insy aceeai pe toatS lungimea lanfului. Lanjurile L cuprind
trei zone i lanjurile H patru zone cu un grad de variabilitate mai mare, zone
hipervariabile. Resturile aminoacidice coiespunzytoare acestor zone
ct1ptuesc nia nepoIarM unde este fixat determinantul antigenic.
Regiunea CH cuprinde situsurile efectoare care mediazy funejiile comune
intregii clase de imunoglobuline. Funcfia de activare a complementuiui este
domeniul CH2, receptorii pentru macrofage i neutrofile sunt localizaji pe CH3.
Organizarea structuraiy a imunoglobulinelor aratd modul in care pe o
schemd structuraiy comund sunt constitute milioane de molecule, diferite
prin situsurile de legare a anti gender.
56

Fig. 1.13 Protein fnrudite structural i genetic cu imunoglobinele:


1.
Complex major de histocompatibilitate clasa i (MHC I)
2.
Complex major de histocompatibilitate clasa ll (MHC II)
3.
Receptorul ceiuielor T
4.
Ig M (ancorata in membrana ceiulara)

Fig. 1.14 Structura multidomeniaia a unei imunoglobuline


Factori ai coaguldrii (fibrinogenul)% Coaguiarea sangelui reprezmt# un
mecanism de ap&rare pentru a impiedica hemoragiile. Este o components a
hemostazei care mai implied i alte fenomene: vasoconstricpe, activarea i
aderarea trombocitelor la locul leziunii vasculare. Formarea chiaguiul
(trombus) are loc prin transform area fibrinogenului, proteins plasmatic#
solubilS, In fibrinS, insolubil#, care formeazS o rejea in care sunt inglobate
trombocite i hematii. Coaguiarea este un proces care se autoregleazS,
menjinandu-se un echilibru foarte fin intre hemoragie gi trombozS.
5T
La coagulare parlicipfl foarte muffi component plasmatici sau tisulari. Unii
ciintre acet.i factori ai coaguklrii sunt desemnaji cu cifre romane, de la Ha
XIII (factorul VI nu exista), Acefi factor! exists, intr-o forma activS i una
inactive (II i IIJ. Unii factori (XII, XI, IX, VII, X, II) in forma lor inactive sunt
zimogeni (proenzime) iar in cea activS sunt enzime proteolitice de inaltS
specificitate. Ionii Ca2+ indispensabiii coaguISrii sunt factorul IV. Factori! V i
VIII nu sunt enzime, ei participS ca factori auxiliari (cofactori) in procesul de
activare a unor component ai coaguklrii. Factorul I este fibrinogenul i
factorul la, fibrina. Factorul XlIIa este o enzimft cu aclivitate transamidazicS.
Factorul III, trombomodulinS sau factorul tisular este prod us de endoteliul
vascular (Tabelul 1.10).
Tabelul 110

Factorii coagularii
Facto Denumire
r
uzuala
I
Fibrinogen
la
Fibrina
Protrombin
ii
a
II.
Trombina
in

IV
V
Va
VII
VII.
vm

Factorul
tisular,
trombomod
ulina.
Ca2*
Proacceleri
na
Prooonverti
na
Factor
antihemofili
c

VIII.
IX
IX.
X

Factor
Christmas
Factor

Xa
XI
XI.

XIII.

Proteins plasmatlca solubila.


Formeaza agregate tibritare.
Activate de un complex format din:
Xa, Va, Ca2+.
Transforma fibrinogenul in fibrina,
activeaza: XIII, VII, VIII.
Factor auxiliar la activarea factorilor
X,V.

Activat de trombina.
Cofactor la activareaa H de catre Xa.
Activat de lla + Ca2+.
Impreuna cu Hi activeaza X la Xa.
Activat de lla.
Cofactor af activarii X de catre IXa.

StuartPrower

XII
XII.
XIII

FUNCJIE

Factor
Hageman
Factor
stabilizator
al fibrinei

Activat de Xla i Ca2+.


Activeaza X la Xa (impreuna cu Vllla i
Ca2+).
Activat pe suprafaja plachetelor de
catre complexul Ca2*
+ Viila -v IXa (calea intrinseca) sau de
catre VSIa asistat de factorul tisular
(calea extrinseca).
Activeaza protrombina.
Activat de Xlla.
Activeaza, impreuna cu Ca2+, IX la IXa.
Activat de kaiikreina.
Se leaga de peretele vasului lezat.
Activat de trombina.
Stabilizeaza fibrina prin iegaturi
Tncruciate.

58
Protrombina, factorii VII, IX i X sunt proteine care cuprind in
segmentele ,N~ terminate resturi de acid Y-carboxiglutamic (Gla). Aceste
resturi aminoacidice se formeaz intr-un proces post-traducjional la care
participS ca intermediar, vitamina K:

COO
OOC
COO
CH2
?CH2
co2
-----Vit. K
CH
i
CH2
HN CH CO
HN CH CO
rest Glu
rest Gla
Proteinele cu resturi Gla au o mare capacitate de a lega ionii Ca2+.
Inifierea procesului de coaguiare este urmat& de activarea in cascade a
factorilor de coagulare, semnalul initial fiind puternic amplificat. Exists dou&
c&i de inifiere a acestei cascade, calea intrinseca (aparent cu participare de
factori exclusiv sanguini) i calea extrinsec#, la care particip& i factori de
engine tisulara. Ambele c&i conduc la activarea protrombinei in trombinS,
aceasta din urma transform^ fibrinogenul in fibrina. Agregatele de trombinS
sub aejiunea factorului XIIIa (activat de trombinS) sunt legate incruciat i
devin insolubile (Fig.1.15).
Calea mtrmseca Calea extrinseca

Fibrinogen
(solubifa)
Xf
Ha
2+
Ca
T
XIil a

Fibrins

(insolubila)
Fig. 1.15 Etapa finals a coagularii sangelui
59
in cele ce urrneazS sunt descrise unele aspecte biochimice, moleculare,
ale coagulSrii, Fibrinogenul are un rol central in coagulare. Este o proteins
plasmaticS cu rriasa molecularS de 340 kD. Concentrajia sa plasmaticS este
de 200-400 mg/dl (2-3% din proteinemia totals). Este un hexamer alcStuit
din trei tipuri de lan$uri: Aa (610 aminoacizi), Bp (461 aminoacizi) i y (411
aminoacizi).
Formula sa molecular! este (Aa BP y)2. Molecula este alungilS (460 A),
prezentand trei zone globulare, douS periferice i una centrals (Fig.1.16).
Lanjnrile Bp i y cuprind oligozaliaii.de legate N-glicozidic. Fibrinogenul
cuprinde multe (17) pun{i disulfurice.
Segmentele N-terminale A i B din lanjurile Aa i Bp, fibrinopeptide,
cuprind multe resturi Glu i Asp, segmentul B mai cuprinde i resturi de
tirozinS sulfatatS:
I
NH
CH
CO

Aceast! compozijie aminoacidicS confers fibrinopeptidelor sarcini ().


Trimerul Aa Bp y se formeazS prin asocierea paralelS a celor trei lanjuri i
doi trimeri se asociazS prin capetele lor N-terminale, fibrinopeptidele
apSrSnd ca proeminenje ale nodului central. Nodulul central are o sarcinS
nets negativS (-8) ca i nodulii periferici. Repulsiile electrostatice intre
moleculele de fibrinogen previn agregarea lor i proteina este menJinutS in
solufie.
Inijierea coagulSrii determinS aclivarea in cascadS a factoriior coagulSrii
care culmi- neazS cu activarea protrombinei la trombinS. Protrombina
(factory] II) este sintetizatS in ficat. Cuprinde un lan{: polipeptidic cu 582
aminoacizi. In segmentul N-terminal cuprinde resturi Gla, formate intr-un
proces dependent de prezenja vitaminei K.
Fibrinogen
Trombina
Fibrinopepbc/e
A si 3

230 A
Ftbr/ncr
Fig. 1.16 Schema structural! a fibrinogenului i a fibrinei.
A i. B: fibrinopeptidele A i B; a \ b: situsurile de interacjiune dintre
moleculele de fibrin!60

Sub acfiunea factorului X3, o proteazS, sunt scindate c&teva legaturi


peptidice i protrombina este transformata in trombina. In aceasta
transformare se pierde segmental N-terminal care cuprinde resturile Gia.
Trombina este alc5tuit& din doua lanfuri polipepddice, A(49 aminoacizi) i
B(259 aminoacizi), reunite printr-o punte disulfuricl Trombina are activitate
proteoliticd, sub acfiunea ei asupra fibrinogenului sunt indep&tafce
fibrinopeptidele A i B, fibrina rezultatS avand formula moieculara (a P y)2,
Prin indepMarea fibrinopeptidelor, nodulul central capatS o sarcina +5.
Totodata sunt demascate centre de legare pentru regiuni ale nodulilor
periferici. Moleculele de fibrina se asociaza longitudinal i lateral formand
fibre cu o periodicitate de 230 A, jumittate din lungimea unei molecule de
fibrind (Fig.1.16)
Agregatele de fibrina formate numai prin interacfiuni necovalente sunt
fragile (chiag moale), Asupra acestora acfioneazM factorul XIIIa, factor
stabilizator al fibrinei, enzimS eu activitate transamidazica, leagS incruciat
resturi lizil glutaminil:
CH (CH2)4 NH2 + H2NCO (CH 2) 2 CO
NH
I Xilla CH
>
I NH3 CO
NH
NH
i
i
CH (CH2)4 NH CO {CH2)2 CH
CO
CO
Aceste legaturi interlanfuri fac ca poiimerii de fibrinS s3 devinS insolubili i
rezistenfi. In rcjeaua de fibrina se incorpoieazd trombocite i hematii dand
natcre chiagului.
Coagularea este un proces rapid care trebuie sit ram ami localizat la local
leziunii vasculare i chiagul urmeazl sa fie distrus, dizolvat cat mai rapid
(fibrinolizl). Pe langl diluarea in torentul circulator a factorilor activi ai
coagul&rii, captarea selective i catabolizarea lor hepatic^, plasma cuprinde
component care intervin prompt pentru a stopa procesul. Acfiunea trombinei
este intreruptl prin intermediul unei proteine plasmatice (prezentfi in
fracfiunea electroforetica a*), denumitS antitrombinl, care se combinft
stoichiometric cu trombina i ii anulcazS activitatea proteoliticl De
asemenea, a2-macroglobulina are o acfiune similar^.
Un alt mecanism de intrerupere a cascadei coagularii cuprinde proteina
plasmatic!, Proteina C, care intervine prin inhibarea factorilor IX a i Xa,
Proteina C este activate de trombina in asociafie cu o glicoproteina din
endoteliul vascular, trombomoduiina.
61
Fibrinoliza, Plasma cuprinde i componenjii necesari dezagreg&rii i
dizolvSrii chiagului. Acedia r3man inacfivi pan& cand so impune intiai'ea lor
in acfiune. Etapa finals a fibrinolizei este catalizatS de plasminS, enzimi
proteoliticS, care transforms fibrina in fragmente solubile. Plasmina provine
dintr-un precursor plasmatic inactiv, plasminogen, care este incorporat in
rejeaua de fibrinS. El este activat de o proteazS eliberatS de endoteliul
vascular, factorul tisular activator al plasminogenului.

1.3,6.
HEMOPROTEINELE
Acest grup de proleine conjugate cuprinde mioglobina i hernoglobina,
transportori de oxigen, citocromii, transportori de electroni, membri ai
lanjului respirator mitocondrial i ai aceluia situat in reticulul endoplasmic
hepatic, diverse oxidaze i peroxidaze.
Gruparea prosteticd a acestor proleine este hemul. Yarietatea
hemoproteinelor rezuM prin uncle diferenfe In structura hemului sau pentru
aceiai grupare hem pot rezulta enfMji distinct in raport cu natura
apoproteinei i a modului de asociere cu hemul.
Hernoglobina (Hb) i mioglobina (Mb) cuprind aceeai grupare hem,
alcatuitii din protoporfirind i Fe2*. Porfirinele sunt compui cu o structure
macrociclicS, tetrapirolicd. In procesul de biosintezS a hemului apar ca
intermediaii naturali uroporfirina, coproporfi- rina i protoporfirina. Piecare
din aceste porfirine derivd dintr-un precursor porfirinogenic. Nucleele
fundamentale macrociclice ale porfirinogenilor i ale porfirinelor sunt:
porfinogenul i porfina.
N
X N/
>N/
H
H
=
\
/= Xz \=
H
/Nv
Z
y
H
/Ns
./W\.
Z
X
Porlinogen
Poriina
Porfirinogenii i porfirinele poart& in pozijiile 1-8 urm&torii substituenfi:
uroporfirinogenui i uroporfirina:
1,3,5, 8
-grupari CH2COOH
2, 4, 6, 7

CH2 CH2 COOH


coproporfirinogenul i coproporfirina:
1,3, 5, 8
-grupari CH3
2, 4, 6, 7,

CH2 CH2 COOH


62
protoporfirinogenul i protoporfirina:
1,
3r 5, 8 - grupari CH3 (M)
2,
4
,,
CH - CH2 (vinil, V)
8,7

CH2 COOH (P)


Formula protoporfirinei este:

Porfirinele cuprind o structure macrociclic<1 foarte stabdft cu caracter


aromatic. Delocalizarea electronilor determine aezarea tuturor atomiior intrun singur plan. Atomii de hidrogen din macrociclu sunt eliberaji ca protoni,
sarciniie sunt delocalizate.
Protoporfirina (spre deosebire de uroporfirina i de coproporfirind) are
proprietatea de a lega coordinativ un ion de Fe2+ formand hemul. Ionul de fer
are capacitates de a coordina 6 ligand (are cifre de coordinajie 6). Asocierea
Fe2+ la protoporfirina se face prin cei patru alomi de azot ai porfirinei i alji
doi liganzi externi, de regulS furnizaji de grupftri din protein;!:
X
N/
N'

Mioglobina este o hemoproteinS care funcJioneazS ca transporter tisular


de 02, prin legarea reversibild, a dioxigenului:
Partea proteic#, globina, este alc#tuit# dintr-un singur lanf polipeptidic
(cu 153 resturi aminoacidice) impachetat intr-o global# compacts. Cuprinde
o grupare hem fixat# intr-un buzunar, c#ptuit cu resturi aminoacidice
hidrofobe. Legarea hemului la
globing este diferit# dup# starea sa oxigenat# sau deoxigenat#. in forma
deoxigena- t&, iigandul extern X este reprezentat de un rest His din lanful
polipeptidic (His proximal) i pozijia Y de coordinate a Fe2+ este vacant#. In
forma oxigenat#, pozifia. Y este ocnipat# de dioxigen, care la randul lui
contracteaz# o a doua leg#tur# coordinativ# slab# cu un alt: rest His (His
distal):
/i/'s//mm/

o=o

/Y/s d/sfd/

Acest gen de asociere dintre hem i protein# face posibil# oxigenarea


reversibil# a mioglobinei, f#r# modificarea valenfei ferului.
Hemoglobins este o protein# tetrameric#, forma principal# din sangele
adultului are
formula molecular# 9^, Fiecare lanj a i' p este asociat cu cate o grupare
hem* Locurile de legare a hemului feunt situate la nivelul contactelor a / p.
Asocierea dintre hem. i fiecare lanf protomeric se face in mod similar cu
asocierea hemului la mioglobin#. Resturile His proximal sunt 87 a i 93 P iar
restui'ile His distal sunt 58 a i 63 p.
Oxigenarea reversibil# a hemoglobinei este descris# printr-un ir de
reacjii:
0 2 Oz
o2
o2
Hb ^ Hb02 ^ Hb(Og)2 ^ Hb(02)3 ^ Hb(02)4
Oxigenarea maximal# a hemoglobinei coiespunde fix#rii a patru molecule
de dioxigen. Cinetica oxigen#rii hemoglobinei este diferit# de cea a
mioglobinei, structura cuatemar# permite funcjionarea unor mecanisme
foarte eficiente de reglare (vezi Cap.H). Totodat#, hemoglobina, pe iang#
transportul de oxigen are i funcjia de transporter de protoni i de dioxid de
carbon,
Citocromii sunt hemoproteine care transport# electron!, prin schimbarea
reversibil# a valenfei ferului:
+e
cit Fe3+ ^ cit Fe2*
-e
64
H3C~
-oocCH?CH,CH?CH?-S"-'CH
CH3 ^M2HC~
-CH
\1
/
AT
A

-CH,
r!
i\
i!
n;a!
-CH,CH7SCH?
COOFig. 1.17 Hemui citocromului c
Citocromii mitocoridriali (a, a3, b, c, Cj) acjioneazS secvenjial, electronii

tree de la un component la altul, in final fiind acceptaji de dioxigen:


4 cit Fe2* + 02 _______________.____4 cit Fe3+ + 202"
202 + 4H+_________________________2H20
Citocromul c, cel mai bine studiat, cuprinde un lan{ polipeptidic cu 104
resturi arninoacidice i o grupare hem. Asocierea dintre hem i protein# este
diferit# de cea intalnit# la hemoglobin# sau mioglobin#. Ligandul X este
reprezentat de un rest His (18) i pozifia Y este permanent ocupat# cu un
rest Met (80). GrupSrile vinil sunt legate covalent la resturile Cys (Fig. 1.17).
. 1.3.7. F1ERONECTINELE
Fibronectinele alc&tuiesc o familie de proteine extracelulare adezive. Ele
au roluri majore in interacjiunile dintre celule i membrane bazale sau dintre
divergi component ai matricei extracelulare i celule. Aceste procese sunt
cruciale pentru determinarea caracterului migrator sau stafionar al celulelor.
Fibronectinele au roluri importante in embriogenez#, in menfinerea
integritdpi |:esuturilor, in hemostaz#, determine migrarea celulelor
canceroase.
Fibronectinele sunt proteine dimerice, protomerii A i B au mase de
aproximaliv 250 kD i prezint# o maM omologie structural#. In dimer
capetele C-erminale ale lanfurilor A i B sunt reunite prin dou# pun|i
disulfurice (Fig.1,18), Dimerul este o molecule alungit# (600 A/25 A),
Protomerii A i B sunt. organizafi in mai multe domenii structurale, fiecare
domeniu fiind caracterizat prin capacitatea sa distinct# de a se lega la alji
componenji.
65

Fig.L18 - Structure muttidomeniala a flbronectlnei plasmatic


Pentru fibroncctin! au fosl: descrise mai multe izoforme (12), specificate
genetic, Una dinlre acestea este fibronectina din plasm!, Aceasta esle
sintetizat! in ficat, f.esul: In care rat se mai exprimS nici o alt! genii a
fibronectinei. Alte izoforme ale fibronec- linei sunt sinletizate de diverse aJle
tipuri celulare. Cea produs! de fibroblast! este printre cea. mai mult sludiat!
mai bine cunoscutft fibronectin!. Fibronectineie dup! sintez! intracelular! sunt
secrciale in matrices extrace] uiar! local! unde funcfionea- z!. Toate
Jesuturile cuprind fibronectin!.
Fibronectineie a.u capacitatea de a. stabiii' legaturi cu alte proteine, astfel
se realizeaz! o retea de interaefixmi care conecteaz! proteine extracelulare
(colagen., laminin;!, vitronectin!) i mucopolizaharide (proteoglicani) cu
receptor! membranari (integrine) i cu proteine intracelulare care alc!tuiesc
citoscheletul (acting, a-actinin!, vinculin!).
O molecul! de fibronectin! posed! oral multe domenii structumle prin
intermediul. c!rora interacjioneaz! cu componen{ii enumerafi mai sus. Au
fost: identificate domeniile de legare ia colagen, heparin!, fibrin;!, acting ca
gi domeniul de. interacjiune cu o celul!.
interac|Iunea dinlre fibronectin! (fibronectina plasmatic!) i celule are loc

prin intermediul unui domeniu de aproximativ 75 kD situat in jumStatea Cterrninal! a ianjurilor A i B. Situsul de legare specific cuprinde secvenja Arg
Gly Asp Ser (RGDS). Peptide niici de sihlez! care cuprind acesl
segment sunt aple s! adere pe suprafaja celulelor.
Reeeptorul celular pentru fibronectina, care recunoagte secvenja RODS, a
fost identificat in toate tipurile de celule. Acest receptor face parte dintr-o
familie de receptor! care recunosc i interac(ioneaz! cu diverse proteine
adezive, familia integrinelor. Integrina specific! pentru fibronectin! este o
glicoprotein!, un heterodimer a (1
Integrina din plachete (glicoproteina IIb IIIa) este distinct! de cea a alter
celule. Integrina plachetelor, pe king! fibronectin!, interaefioneaz! i cu
fibrinogen, fibrin!, cu factorul von Willebrand.
Fibronectina plasmatic! are un rol deosebit In form area cheagului, prin
legare de fibrin!, fibronectina este incorporat! in cheag, Prin
multifuncfionalitatea sa fibronectina asigur! ancorarea cheagului ia celule i
pe mairicea structural! a perefilor vaselor.
66
Cap. IL ENZIMELE
ILL IMTRODUCERE
Numftrul reacpilor cunosciite care au loc in organismele vii este de ordinul
niiilor; cu rare exeeppi, acestc reacpi sunt catalizate.
in anui 1877 .cgMizMoriJor recpilor din organismde vii ,U s-a atribuil
numele de ^enzirne^4 (in drojdie); aceast! denumire, ahlturi de aceea de
.,biocatalizatori, se utilizeaza. i in prezent. Denumirca mai veche a, fost
aceea de JfermenlR (legate i ea de procesele fermentative); pentru enzime
individuate s-au utilizat denumiri specifice, ca
de exemplo, diastazav' (In prezent. a - amilaza),
Locul de, acpune al eelor mai multe enzime este in imeriorul cehilelor;
uncle acponeaza ins! i in afara acestora (de exemplu, o serie de enzime din
plasma sanguinfl intre care si ceie care asiguni coagularea)...Toate enzimeie
specifice unui tip de celule sunt sintetizate chiar de acele celule; enzimeie
care acponeaz! in afara ceiulelor sunt sint.cUz.ate dear de anumile tipuri de
celule .(hepatice, rennie etc.)*
Enzimeie au toate insujirile catalizatorilor utilizap In reaepile chi mice din.
lumea nevie, Ele sunt ins! superioare acestor.catalizatori in mai multe
privinje:
a) Asiguril reacpilor chimice pe care le catalizeaz! viteze cu cateva ordine
de m2 rime in plus;
h) Reac|i.ile pe care le cafaiixeazfi au loc in condipi biande: iemperatur!
sub 50C, presiune atmosfericL pH in jurul lui 7; exist.;!, evident, i unele
exeeppi, Comparativ, eatalizatorii chimici acponeaz! la temperaturi ridicate,
presiuni mari i vaiori. extreme de pH;
c) Au specificitave foaue mare ceea ce asigura ca in reaepile pe care le
catalizcazS s! mi se formeze produi secundari.
Multe enzime au insuiri neintainite la.' catalizatori chimici. Foarie
importanie sunt;
a) Capaeitaiea de regime a producer!! lor in celule i/sa.u de reglare a
activit&pi;
b) Fosibilitatea caializftrii unor reaepi endergonice prin cuplarea acestora

cu reaepi exergonice (vezi capitolul n,Energelica biochirniciL).


Istoria enzimologiei se intinde pe douil sute de ani. Marile descoperiri
realizate pan! la mijlocul secolului nostru au fost rodul gandirii i
experienfelor individuate ale unor chimi$li organicieni, fiziologi, microbiologi,
captivap de acest domeniu: Gay-Lussac, Liebig, Berzelius, Kuhne, Emil
Fischer, Pasteur i alpi. Totui, ca i in multe alte domenii ale biochimiei, abia
in ultima jum!tate a secolului nostru, prin cercetftri efectupte de grupuri
ultraspeciaiizate p cu mijloace tehnice din ce in ce mai perfeeponate,
67
s-a putut ajunge la o injelegere profunda a naturii i funcfionSrii enzimelor.
Cuno^tinjele de enzimologie sunt extrem de utile in prezent pentru
interpretarea multor fenomene din biologia celular#, genetic# i alte tiinfe
biologice.Ingineria genetic# se bazeaz# aproape exclusiv pe acjiunile
specifice ale unor enzime.
Din punct de vedere medical, enzimologia contribuie ast#zi in m#sur#
hotdratoare la cunoagterea cauzelor a numeroase boli, diagnostical i
urmdrirea evolujiei acestora, elaborarea pe baze tinjifice a medicamentelor
i multe allele.
IL2.
SCADEREA DE CATRE ENZIME A ENERGIEI DE ACTTVARE A REACJIILOR.
CAPACITATEA CATALITICA A ENZIMELOR
Toate reacjiile chimice sunt fnsojite de variajii ale energiei. In reacfiile care
au loc In lumea nevie, variajiile de energie se urm#resc in mod curent prin
variafia cSldurii (entalpiei); dup# cum ele elibereazS sau absorb c#ldura
sunt exoterme4< respectiv endoterme. Dac# reacjiile au loc in condifii de
temperature i presiune constant#, parametrul termodinamic urm#rit este
altul, respectiv variafia energiei libere, notat# AG. In cazul reacjiilor care au
loc in organismele vii superioare, la care cei doi parametri sunt constanfi, se
urm#rete, de asemenea, variafia energiei interne. Dac# AG in cursul
reacjiei este negativ# (ceea ce corespunde eliber#rii de energie), reacjia
este exergoni- c#; invers, reacjia este endergonic#A
In cazul reacjiilor exergonice, care constitute obiectui discufiei ce urmez#,
energia medie a moleculelor reactanjilor este mai mare decat energia medie
a produilor de reacjie. Deoarece produii de reacfie sunt mai stabili decat
reactanfii, s-ar putea crede c# reacjiile in care se eiibereaz# energie sunt i
spontane. Totui, cu foarte rare excepjii, desf#urarea acestor reacjii este
condifionat# de fumizarea unei anumite cantit#Ji de energie; abia dup# ce
au fost amorsate ele devin eiiberatoare de energie. De exemplu, oxidarea
glucozei cu 02 este o reacjie in care se eiibereaz# energie; tot.ui glucoza
rezist# contactului permanent cu acest element luni de zile, chiar i ani,
dac# reacjia nu este declanat# prin fumizarea unei cantit#fi de energie.
Energia fumizat# reacjiei are rolul de a ni#ri num#rul de ciocniri intre
reactanji, inclusiv a celor efica.ce; este vorba de ciocniri din care rezult#
complexe de tranzifie44 st#ri prin intermediul c#rora au loc transform#rile
substratelor in produ^i de reacjie. Aceast# energie este cunoscut# sub
numele de energie de activare44 \ este definite ca energia necesar#
pentru ca toate moleculele dintr-un mol de reactant s# ating# starea de
tranzijie44. Ea se exprim#, evident, in Kj/mol sau Kcal/mol i este specific#
fiec#rei reacjii.

68
In laborator sau industrie, energia de aciivare necesara reacflilor este
furnizatd sub formd de cdldurd. Imposibilitatca ca reacjiile chimice din
organismele vii sd fie influenfate de cdldurd este compensatd de cStre
enzime, care, asemdnator tuturor catalizatorilor, scad energia de activare.
Cu cat un catalizator scade mai mult energia de activare a reac^iei pe care o
catalizeazd cu atat ei este mai eficace adicd asigurd o vitezd mai mare acelei
reacfii.
Enzimele scad foarte mult energia de activare in raport cu catalizatorii
chimici. Reacfia de descompunere a apei oxigenate poate servi ca exemplu
in acest sens:
2H2Q2
-----2H20 -f 02
in absenja catalizatorilor energia de activare are valoarea de 18 Kcal/moi;
ea este de 11,7 Kcal/mol in prezenja catalizatoruiui de platind coloidald i de
numai 2 Kcal/mol in prezenja-catalazei, enzima cu specificitate absolute
pentru aceastd reacjie (Fig. ILL). Aa se explicit capacilatea cataliticd
deosebit de mare a catalazei: o singurd moleculd din aceastd enzimd
descompune 5 x 106 molecule de apd oxigenatd intr-un minut, in condijii
optime. Existd i enzime care asigurd viteze de reacfie de ordinul 10 10 - 1012
in raport cu reacfiile corespunzdtoare necatalizate.
Scdderea de cdtre cataiizatori a energiei de activare este consecinfa
cursului diferit pe care acedia il imprimd reacfiei. Se tie cd orice reacfie
catalizatd decurge i in absenja catalizatorului' dar cu vitezd foarte micd. In
acest caz substratul (S) se transforms. direct in produs de reacfie (P).

Desfc?Si/r&red redcfre/'
Fig. ILL Energia de activare pentru descompunerea apei oxigenate: a) fara
catalizator; b) in prezenfa Pt coloidaie; c) in prezenja cataizei.
69
Cfmd este prezenl catalizatorul, In cazul reacjiiior din lumea vie enziina
(E), nitre aceasta i substrat se formeazd un complex ES din care apoi
rezultd'P se reface E:
E+S
ES-----E + P
In conformitale eu cele afirmate mai Inainte, energia tie activare pentru
transform area lui S din ES in P este mult mai micd decal la transform area
directs a lui S in P.
In Fig. II. i. este reprezentat i faptul cd intr-o reaejie exergonicd
deelangata prim fumszarea energiei cle activare, se elibereazd o cantilate de
energie case este suma energiei tie activare + variajia energiei iibere
specifice (diferenja intre energia niedie a reacianjilor i a producer),

Desigur cd In organismele vii, alafuri de reaejiile exergonice, au loc


numeroase reaejii endergonice. Hie sunt posibile -prin faptul cd exists
enzime specializate, care, pe langd sedderea energiei de activare, asigurft
transfeml energiei Iibere necesare de la reaejii exergonice. DesBigurarea
acestor reaejii este prezentatd. in capitolul Energetica biochimic&A
11.3. SPECIFICITATEA ENZIMELOR
Inalta specificitate este ima dintre caracteristicile fundamentaie ale
enzimelor, Consecinje ale acestei specificitaji deosebite sunt a till evilarea
formSrii de product secundari in reaejii, cat i, pe un plan mai general,
exist.en.ja insdi a editor rnetabolice (in sensui cd succesiunea reaejiilor, de
exemplu intr-un compartiment. celular, este impusd de enzimeie existente).
ModalitdJ'ile de manifestare ale specilicitajii sunt diverse. Se pot
considera. totugi trei variante de baza: specificitatea de reaejie,
specificitatea de substrat i specicificitatea stereochimicd.
II.3.1
SPECIFICITATE DE REACJIE
Specificitatea de reaejie constd in aceea cd fiecare enzimd catalizeazS.
numai un
singur tip particular cle reaejie (excepjiile sunt foarte rare). Tipul particular
seincadreazd in unul din cele ase tipuri fundamentaie de reaejii care au loc
in lumen vie; oxidoreduce- re, hidrolizS. formare (scindare) de legdturi
covalente, izomerizarc, form.are de leg&turi covalente utiiizXmd energia
eliberafd prin scindarea unor legdturi macroergice. Se va vedea mai depnrte
in acest capitoi cd in sistemul actual de clasificare sunt. ase clase de
enzime, corespunzdtor color ase tipuri fundamentaie de reaejii.
Ca exemplu de tipuri particulare de reaejii pot fi considerate:
-hidroliza proteinelor in prezenja proteazelor;
- fosforildri ale unor compuji diverji cu acid fosforic provenil din ATP, in
prezenja kinazelor;
70
- schimburi de grup&ri amino contra grupSri carbon!! mire aminoacizi i
cetoacizi, catalizate de Iransaminaze.
O consecin{& a specifid$p de substrat este aceea cd un anumit compus
care poate ft traasformat in mai mul$ produ^i de- rescue, necesitft pentm
fiecare feansforniam o enzim& specified se exemplifies prin. reacjiile pe care
le suferS HI organism glncozob-fosfatul (G-6-P):
glucozo-6-fosfat glucozo-6-fosfat gIucozo-6-fosfat giucozo-6-fosfat + H 2o
giucozo-6-fosfatizomeraza
=5=======^^
fructozo-6-fosfat
fosfoglucomutaza
glUGOZO~1 -fOSfat
glucozo-6-fosfatdehidrogenaza
------^acid-Bdosfo.gluconic
glucozo-6-fosfataza
_--------------
glucoza + acid fo$tone
113.2 SPECIFICITATE DE SUBSTRAT
Aceasta. constS in aria mai restrSnsS sau mai largS de aejiune a Secarci
enzime cu o anumM specificitate de reaepe. Ea poate fi:
- absolute, dacS enzima catalizeazS un anumit tip de reaepe la un singur

substrat;
- de grup, dacS enzima catalizeazS acelai lip de reaefie la douS sau la un
numSr restrains de substrate;
- specificitate largS, dacS enzima catalizeazS acelai tip de reaefie la un
numSr foarte mare de substrate.
DoaS dinire enzimele cu specificitate absolute sunt anhidraza carbonic^ i
ureaza:
anhidraza carbonica
CO, 4- H20
HaCOs
y
H2N - CO - NH2 + H20----------------2NH3 + co2
Alcooldehidrogeneza este un exemplu de enzima cu specificitate de grup;
ea catalizeazS transform area prin dehidrogenare a aicoolilor monohidroxilici
inferiori (i chiar a unor alcooli dihidroxilici) in aldehidele corespunzStoare:
alcoofdehidroq aneza
R - CH2 - OH + NAD+ --------------^ R - OHO + NADH + H*
Substratul preferat pentru alcool - DH este alcoolul etilic, acfiunea
cataliticS fiind mult; mai redusS in cazul alcoolului metiJic, propilic,
etilenglicolului etc.
In reaefia de mai sus NAD* i NADH + H+ sunt formele oxidata, respectiv
redusd, ale coenzimei alcooldehidrogenezei (despre coenzime vezi in
coniinuarea acestui capitol gi in capitolul Vitamine i coenzime).
71
Spec if i c i ta tea largfi este intalnit! la mai multe enzime, dar cel mai
frecvent la hidrolaze. Intre ncestea sunt si proteazele digestive; pepsina,
tripsina. i chimotripsina. Specificitatea largS a fiecSreia dintre ele const;! In
capacitatea de a cataliza scindarea hidroliticS a oric^rei proteine din
alimente. Dar acfiunea hidrolitic! a fiecireia In parte chiar ac(iunea simultan!
a lor nu asigurS hidroliza totals (pdn5 la aminoacizii component!) a vreuneia
dintre proteinele din alimente.
FaptuI se explic! prin existenja unei specificit&{.i de legatunT care const!
in aceea c! fiecare dintre cele trei enzime asigur! hidroliza in oricare protein!
numai a anumitor legdturi peptidice. Asti'el chimotripsina eatalizeaz!
hidroliza legdturilor peptidice a cdror grupare CO provine de la aminoacizii
Phe, Tyr, Trp, in timp ce tripsina asigurS hidroliza legdturilor peptidice a cdror
grupare CO derivd de la aminoacizii bazici (lizina, arginina); la fel de specific
acjioneaz! i pepsina:

R
|
NH
CH"

CH2 NH2
(CH2)3 i
i

-CO NHCH
CO-j-NHHO H
i
i
legatura scindata
in prezenja tripsinei

R
C
H
-

CH2

R
|

i
-CONHCH
CO-l-NH- 1
HO H

-CH
CO

iegatura scindat& In
prezenja chimotripsinei

Pepsina, tripsina i chimotripsina sunt endopeptidaze (acfioneaz! pe


legdturi peptidice din interiorul proteinelor). Exists categoria de enzime
proteolitice numite exopeptidaze (aefioneaz! pe legaturi pepditice ale
aminoacizilor N - terminali sau C - terminal!); i in cazul aceslora exists
limitari impuse de specificMjile menjionate.
ri.3.3 SPECIFICITATE STEREOCHIM1CA
Majoritatea substratelor, chiar dintre cele mai simple, au atomi de carbon
asimetrici i deci se pot prezenta, raportat la glicerinaldehidil, in configurafii
absolute de tip D sau L (vezi proprietd}iie glucidelor sau aminoacizilor).
Stereospecificilatea const! in aceea eft, dupil caz, enzima asigurd
transformarea lie numai a substratului cu configurate D, fie numai a
substratului cu configurate L. De exemplu, lactat dehidrogeneza (LDH)
calalizeaz! numai oxidarea acidului L lactic la acid piruvic:
COOH
COOH
HO C H + NAD* -ABtL c=0 + NADH + H+
I
I
CH3
CH3
acid L-!actic
acid piruvic
72
Enzimele proleoiitice prezentate mai inainte, dar i enzimele ce
catalizeazS alte transform Sri ale proteineior, sunt stereospecifice in sensul
cS acJioneazS strict pe compugii polipeptidici. ce confin L - amincacizi aa
cum sunt proteinele naturale. DimpotrivS, majoritatea enzimelor ce
catalizeazS reacfii in cSile metabolice ale glucidelor ii manifests acjiunea
numai dacS acestea au configurate D.
Stereospecificitate au i enzimele care catalizeazS IransformSri in care
substrata] sau produsul de reacfie prezintS izomeri geometric!. De exemplu,
in reacjia de dehiclrogenare a aciduiui succinic (una dintre reacjiile ciclului
Krebs), catalizatS de succinct dehidroge- nazS, se obfine strict acid fumaric
(nici m&car urrne de acid maleic);
COOH
HOOC
1
\
CH 4- FAD
CH
2
I
^ 11 -r FADH2
CH
CH2
\
X
COOH
COOH
acid succinic
acid fumaric
In aceastS reacjie FAD FADH2 sunt forma oxidatS, respectiv redusS a unei
alte coenzime.
StereospecificitSjile descrise, ca i allele, sunt consecinje ale interacjiei
substratelor cu enzimele corespunzStoare la nivelul centrelor active de
acestora, aa cum se va arSta in continuare.
II,4 STRUCTURA ENZIMELOR
' 11,4.1. ASPECTE GENERALE
Din studiul naturii chimice a eatorva mil de enzime cunoscute rezultS cS
ele sunt, cu foarte rare exceppi, proteine sau heteroproteine. Excepjiile,
descoperite in ultimii zece ani, sunt enzime cu struclurS. de acizi ribonucleici,
iar ribonucleaza P este un complex proteinS-acid ribonucleic; activitatea

enzimaticS a acesteia din urmft este datoratS aciduiui ribonucleic i nu


proteinei. Una dintre teoriile formulate in legatura cu existenfa acestor
enzime are in vedere urmStoarele; pe scara evolutivS, acizii nucleici au
precedat proteinele i alSturi de alte funcfii ei au indeplinit-o i pe aceea de
enzime; cand s-au sintetizat proteinele, acizii nucleici i le-au ataat pe
acestea dobandind stabilitate i unele activit&Ji crescute, Treptat insS, din
motivele ce vor fi specificate, proteinele au preiuat funcfia ca.talit.icS, ARN-ul
fiind abandonat. De aceea enzimele cu slructurS de ARN, sau complexe ARN
- proteine, sunt considerate drept fosile biochimiceA
Structura proteicS i heteroproteicS a enzimelor este avantajoasS din mai
multe motive: resturile de aminoacizi din proteine dispun de o mare varietate
de grupSri funcfionale care participS ia legarea substratului cat i la
desfSurarea catalizei; nici-o altS clasS de compui din lumea p/ie nu are
varietatea de monomeri i de grupSri functional pe care o au proteinele. in
plus, enzimele sunt proteine globuiare, ele au deci structure secundarS,
terjiarS i deseori structure cuaternarS, Structurile secundarS i mai ales cea
terJiarS asigurS posibilitSji multiple de constituire a centrelor active, zonele
73
J'ierbinfr ale enzimelor, unde se desf$oar8 reacjiile. Deosebit de import
aritft este existenja la aprox. 10-20% dintre enzime a structurii cuaternare,
Activitatea aeestor
enzime poate fi reglatd (erescutd, scdzuUi) prin dileriji compel din mediti
care produc mid modificclri ale structurii cuaternare.
IL4.2. ENZIME CU STRUCTURA PROTEICA
Enximele cu structure strict profeic2 sunt relativ purine,'Dintre cede 6
clase man de enzime mai ales hidrolazele sunt proteine pure; exemple sunt
ribonucleaza, chimotripsina i lizozimul. In cazul acestor enzime atat legarea
substratuiui cat i cataliza !n sine se realizeazS de catre grupMic funcfionale
ale resturilor de arninoacizi.
Un exernplu 11 constituie acfiunea cataliticd a lizozimului, o enzimil ailatfi
in mucusul nazal i in laerimi. In prczcnja lizozimului are loc seindarea
hidrolitic& a unor compugi heterozidici care alcdtuiesc perejii multor cellule
bacteriene; odatd distrui ace^ti perefL, celulele bacteriene inor. Fleming,
care a descoperit acfiunea hidroliticli a Iizozozimului (in anul 1922), a avut un
timp convingerea eel acesfa este un ,,antibiotic (compui de a cftror existen$
era sigur). Ceva mai tfirziu, in anul 1929, Fleming a descoperit un adevSrat
antibiotic, penicilina.
Heterozidcle din perejii celulelor bacteriene sunt aJcSLuite din resturi de
acid-N-acetil muramic (.NAM) i resturi de N-acedlglucozaminft (NAG);
hidroliza lor, catalizatS de iizozim, este urmftloarea:

74
11.4.3. ENZIME CU STRUCTURA HETEROPROTEICA
Cele mai muite enzime au structure heteroproteicd; ele sunt alc&luite din
apoenzi~ miC (component# proteicd) i cofactorfct (components
neproteica). Fiind molecule organice, cationi i anioni (mai rar) ai
elementelor, stabilitatea cofactorilor la acfiunea lempleraturii este mai mare
decat. a apoenzimelor.
De regulS, o enzimd are un singur cofactor; exists lotugi i enzime cu doi
cofactori, clifeiiji structural i funcJionaL
In privinfa terminologiei cofactorilor s-au blent recent urmdloarele
recomandSri (ele urmdresc s& elimine cpnfuziile, destul de freevente):
- termenul cofactor se.va utiliza penlru total!tatea compui!or neproteici
din structura heteroenzimelor;
- termenul coenzim3 se va utiliza numai penlru componenteie
neproteice de naturd organic^ care se leagd prin legdturi foarte slabe de
apoenzime (legdturi de hidrogen, ionice, hidrofobe etc.);
- termenul ,,grupare prosletlcd^'se va utiliza lot penlru cofactori de
naturS organic# dai* care se leaga de apoenzime prin legdturi putemice,
inclusiv covalente.
Numarul cofactorilor cimoseufi este foarte mic in comparajie cu numSrul
enzimelor cu structura heteroproleic#. "Faptul se explicit prin aceea c# un
anumit cofactor este capabil s# se asocieze cu diferite. apoenzime rezul&nd
astfel mai multe heteroenzime.- Mai ales o parte dimre eoenzime i ioni au
aceast# capacitate. Exist#, de exernplu, cateva sute de enzime cu rol de
hidrogenaze-dehidrogenaze a edror coenzim# este nicotinandd-adenindinudeotidul, notat NAD* (in forma oxidat#). Ele pot acjiona simullan -inlr-un
eompartiment celular dal care are o -canlitate limitat# de NADA ca urmare a
faptului c# NAD+'trece cu ujurinj# de pe o apoenzim# pe alia in funefie de

necesitdjile de moment. De exernplu, alcool-dehidrogenaza i


laefatdehidrogenaza, ambele enzime cilosoliee (reaejiile calalizate au lost
prezentatc mai inainte) uti.Iize.az3. NAD+ din fondul citosolic comun. Pe de
alt# parte, in timp ce in cursul reaefiilor de dehidrogenare de lip ul celor
catalizate de alcool dehidrogenaz#, NAD* trece in NADH 4- H+ (forma red
us# a coenzimei), in comparlimentul celular dat (citosol.) au loc simullan
reaefii de hidrogenare a unor substrate in prezenja unor enzime care
utilizeaz# forum redusa. a coenzimei NADH 4- HA In condijiile unui echilibru
intre reaejiile care genereazS i ceie ce utilizeaz# NAD*, se amplified
posibililatea de funejionare cu o canlilate limitat# a aceslei. eoenzime a unui
num#r foarte mare de hidrogenaze- dehidrogenaze. Situajia este
asem#n#toare penlru enzimele cu eoenzime NADP*, FMN i FAD.
Date ample privitoare la eoenzime, care sunt derivaji ai vitam in el or
hidrosolubile, se afl# in capitolul Vitamine i eoenzime". Alte dale privind
funepa lor se a lid in subcapitoiul Cenl:rul activ i mecanismul de aejiune al
enzimelorA
Dintre gruparile prosteice, hemul este intdlnit eel mai freevent in diverse
enzime din organism ul uman. Date despre structura. i funcfiiie acestora se
afl# in capitolele ,,Hemoproleine" i Energetica biochimica" (lanful
respirator).
O reguld generalfi re-ieit# din studiul unui mare numdr de heteroenzime
cu cofactori organic! este ca specifidtalea lor este determinate in totalitate
de apoenzime in timp ce coenzimele sunt grupSrile responsabile in cea mai
mare parte de transformarea chimicd propriuzis#.
Cum s-a mai' ardtat, cofactorii multor enzime sunt ioni metalici
(metaloenzime). Legdturile dintre componenteie proteice i ionii metalici
sunt de tip electrostatic. Stabilitatea complexelor este in funefie de numdrul
i intensitalea acestor interaejiuni; din studiul acestor complexe a mai reiegit
cd resturile aminoacizilor care elibereazd
75
protoni (de exemplu, Giu, Asp, Ser) sau care au atomi de azot cu electroni
neparticipanfi (inciusiv atomi de azot, din leg&turi peptidice) constituie
liganzii pentru ionii metaiici.
DacS ionii metaiici sunt disociafi de apoenzimS, enzima ti pierde complet
sau tgi diminuS activitatea; de reguhl disocierile sunt reversibile in sensul c&
ionul metalic poate fi reintegrat in components proteicd.
In reacfiiie cataiizate de metaloenzime, ionii metaiici indepiinesc, de la
caz la caz, roluri variate:
-stabilizeazd structura enzimei;
-paiticipS la legarea substratului;
-indue unele modificSri in conformajia enzimei, cu elect asupra vitezei de
reaefie;
participS nemijlocit la catalizJt.de exemplu in cazul multor reaefii de
oxido-reducere.
In legiiturS cu structura enzimelor in general, a metaloenzimelor in
particular, este de remarcat gi existenfa enzimelor omoloage (care
catalizeazQ aceeagi reaefie in fesuturi sau celule diferite, uneori chiar in
compartimente diferite ale aceleiagi celule). Asemenea siluafii s-au remarcat
la enzime cum sunt aldolaza, piruvatcarboxilaza gi allele. In cazul

metaloenzimelor diferenja intre enzimele omoloage poate fi la nivelul


apoenzimei sau/gi a ionilor metaiici; de exemplu, enzima superoxiddismutazS extrasft din mitocondrii confine Mg2+ iar cea extras^ din citosol
confine Cu2+ gi Zn2+.
Sunt gi enzime care necesitd pentru activitatea lor simpla prezenfd in
mediu a anumitor ioni, cationi sau anioni; exemple sunt prezenfa Ca2+ pentru
activitatea lipazelor gi grezenfa Cl pentru activitatea amilazei salivate.
in tabelul II. 1 se dau gi alte enzime care au in structure, sau necesitS
pentru activitate, diferiti ioni.
Tabelul 1U
En/Jme care confin sau necesita prezenja unor ioni
Enzime
Ionul
Citocromi
Fe2+ sau Fe3*
Peroxidaze
Calalaze
Aleooldehidrogenaza Zn2+
Anhidraza carbonic^
Carhoxipep! idaza
Fosfohidrolaza
Mg2+
Fosfolransferaze
Arginaza
Mn2+'
Tirozinaza Citocrom
Cu2+ sau Cu+
oxidazTt
Piruvaikinaza
IC 5i Mgto
AlP-aza menibranara Na+
Amilaza salivara
cr
76
IL5. SISTEME (COMPLEXE) MULTIENZIMATICE
E4
CercetSrile din ultimele decenii au evidential cS in cazul unor cSi
metabolice toate enzimele care catalizeazS reacfii individuale (sau numai o
parte din ele) sunt asociate in formS de complexe multienzimatice". In
aceste complexe enzimele sunt fixate prin legSturi slabe, intr-o ordine
corespun- zStoare intrSrii lor in acfiune, pe o proteins, centralS care poate
fi chiar una dintre enzime (Fig. H.2.). Protein a centrals dispune de un braf
al cSrui rol este urmStorul: fixeazS substratul Ss i il duce la enzima E{ care il
transforms in P5; cum Pt este in acest caz S2, brajul i preia i il duce la E2 care
il transforms in P2. La mvelul fiecSrei enzime braful indeplinete rol similar
asigurSnd formarea produsului unic al tuturor enzirnelor com- plexului.
Avantajul este cS braful duce de fiecare datS S la E conespunzStoare potrivindu-I cu mare exact!tate pe centrul activ, ceea ce asigurS pe ansamblu o
vitezS mai mare decSt cea corespunzStoare acfiunii enzirnelor neasociate.
Complexe multienzimatice bine cu- noscute sunt acid gras sintetaza"
(vezi biosinteza acizilor grai) i complexul piruvat dehidrogenaza (vezi
degradarea oxidativS a glucozei).

Fig. 11.2 - Reprezentare intuitiva a structurii i modului de funcfionare a unui


complex multien- zimatic cu ase enzime
IL6. IZOENZIME
O parte dintre enzimele care au i structurS cuaternarS se prezintS sub
mai multe forme moieculai'e. Pentru o enzimS datS, formele moleculare sub
care ea apare se numesc izoenzime. Toate izoenzimele unei enzime
catalizeazS aceeai reacfie; diferS doax viteza pe care fiecare o imprimS
reacjiei unice.
Structural, izoenzimele unei enzime diferS prin raportul in care sunt
asociate ianfurile polipeptidice^ de bazS (subunitSfiie, monomerii), care, in
acest caz sunt de cel pufin douS tipuri. In cazul lactatdehidrogenazei (LDH)
cele douS lanfuri de bazS sunt H (de la heart=inimS) i M (de la
muscle==muchi). Cele cinci izoenzime ale LDH sunt tetrameri cu
urmStoarele asocieri:
H4
HSM
H2M2
HM3
M4
(LDH5) (LDH)
(LDH3) (LDH4) (LDH5)
17
Imre lanjurile H i M exist# foarte mid diferenje din punctul de vedere al
structurii primare in limp ee structurile secundar# i tcrjiar# sunt atat de
apropiate incat asocieriJe in oricare din variamele de mai sus se fac cu
aceiagi u^urin|ii (evident, aceste asocieri se daloreaz# formttrii de legfUun
ionice, hidrofobe, de hidrogen etc.).
Cea mai mare parte a proprietiljilor fizico-chimice ale izoenzimelor unei
enzirne date sunt foarte apropiate. Diferenje semnificative apar cand unul.
din lanjurile de bazd dileril d.e celSIalt priMr-un aminoacid dicarboxilic
suplimentar sau aminoacid diaminic suplimentar, Se exemplified tot prin LDH
ale erirei izoenzime se diferenjiaz# prin sarcina electric# ca urmare a unei
asemenea diferenje tic struciura primary a celor dou# lanjuri de bazfi.
Aceasf# insugire a stat la baza separSrii electroforetice a izoenzimelor LDH;
in prezent dozarea pe aceastd cale a izoenzimelor LDH series se practic#
curent in scop diagnostic (se va vedea in continuarea acestui capitol).
Lanjurile polipeptidice de tip H i M ale izoenzimelor LDH, pe plan mai
general lanjurile polipeptidice de bazS din izoenzime, sunt codificate de gene
diferile; in condijiile asocierii lor cu egald ugurinj# in oricare din cele cinci
forme izoenzimatice, intr-o specie celuiar# proporjia relafiva a izoenzimelor
este determinate numai de intensitatea biosintezei celor doud lanjuri. La
randul ei, intensitatea biosintezei lanjuriior H i M este specified fieedrui tip
de celule. Se reamintegtc in acest. sens efi izoenzimele LDH catalizeazd.

reaejia:
CH C COOH 4- MADH + H+
CH3 CH GOOH + NAD*
II
I
O
OH
In sensul de la stanga la dreapta aceastS reaejie incheie glieollza in
condifii anaerobe (vezi s,Glicoliza in capitolul Metaholismui glucidelor% De
aceea izoenzimele LDH cu capacitate ridicabl de Ira as form are a piruvatului
in lactat sunt necesare, d.e exempli? in mugchi (care in eforl catabolizcaz#
glucoza anaerob). Aceste izoenzime sunt M.4 i MIL Mugchii si.n?.ctizeaza
deci mai intens lanjurile M decaf: cele Hi Inima, Jesul cu catabolism aerob al
glucozci, sintetizeaz# intens lanj.ul H, izoenzimele H4 i H3M avand o
capacitate foarte redus# de transformare a piruvatului in lactat.
Creatinfosibkinaza sau creatinkinaza (notalft CPK sau CK) are trei
izoenzime. Lanjurile de baxfi care se asocia/A in accst caz sunt M (tot de la
muscle) i B (de la bruin=creier); lieearc izoenzim# este un dimer, respectiv
M.2, MB ji B2. i aceste izoenzime se afl# in ser i pot ft separate prin
eiectroforez#. .
In jesuturi, izoenzimele Tndeplincsc importance roiuri reglaiorii fiind sigur
implicate gi in morfogenez# i di.ferenji.erea eelular#.
117 CENTRUL ACTIV 1 MECANJSMUL DE ACpUNE AL ENZIMELOR
S-a arista! la inceputul acestui capitol end in orice reaejie ealalizatd
enzimatic form area intermediary a complexului enzimd-substrat este
obligatorie:
E+S
ES-----v E H- P
In prezent, exist# numeroase dovezi experi.nicnta.le, direefe sau
indirecte, privitoare la fonnarea complexului ES. Infr-un num#r redus de
cazuri enzima este legate de sabstrat prin legaturi putemice (covalente);
aslfel de complexe ES stabile au fost izolate i analizate prin difraejia razelor
X i alfe metixle. Complexele in care leg#turile dintre E i S sunt slabe s~au
studiat pe c#i indirecte: satunlnd enzima cu substratul s-au objinut modified
in spectrul de absorhfie, solubililate, stahiiifate termic# etc, Mai non,
formarea complexeior ES este studiat#
78
prin metoda marcajului chimic; ea consul in tratarea enzimelor izolafe cu
coinpui chimici care reactionenzft in mod specific cu anumite grupftri
(aparfinand unor resturi aminoacide) la care se aiageazft prin legftluri
puienii.ee (care nu se scindeazft la hidroliza enzimei). Baal enzima marcatft
nu mai fixeazft S inseamnft eft aminoacidul la care s-a a(aat compusul
chimic este implicat In formarea cornplexului ES. Acest aminoacid poate fi
recunoscut dadl se hidrolizeazft enzima* in hidroiizai apMnd i compexul
aminoacid - compusul chimic, .
O ohservajie important in legftturft cu form area cornplexului enzimft
substrat este eft la anumite enzime indepftrtarea prin proteolizft a unor
porfiuni din macrornoleculele lor nu afecteazft (sau afecteazft in mieft
mftsurft) acti vita tea.
Aceste date experimental corelate cu aceea eft, de regulft, substratul este
foarte mic in ra~ port cu enzima, au permis formularea concluziei eft numai
o zonft resfransft din enzimft. par- ticipft la fixarea i -transformarea chimicft
a lui S; aceastft zona se numete centrul aclhd al enzimei. Tot din studii

experirnentale a rezultat ca o enzima dispune de on singur centra activ.


In centrele active ale enzimelor s-au evidential grupftri chimice de tip
carboxil, amino, hidroxil i tio; acesfea aparfin unor resturi de aminoacizi cu
caracter acid sau bazic (glutamic, aspartic, scrina, firozina, cisteiria etc.), dar
i hetrociclii, in special al histidine!, Gruparile sau resturile heterocicfice
apxtrfin tie regulft unor aminoacizi indepftrtaji in seevenfa (structura
priniarft) a proteinei - enzimft. De exemplu, in centru! activ al chimotripsi- nei
s~att ideptifical gruparea OH a serine) in pozijia 195, gruparea carboxil a
acidului'aspartic in pozijia 102 i nucleul imidazolic al histidinei in pozijia 57.
Grupftrile acestea sunt foarte apropiate in spajiu ca urrnare a conformajiei
speciti.ce a chimotripsinei (Fig. IL3).
Sunt ineft polemici in legftturft cu centru! activ al enzimelor rezultate dingenerali- zarea unor cazuri particulare; unii considers eft acesfa este alcfttuit
dintr-un centru de legareu L separat, dintr-un centru cataliticA Alj.ii susfin
eft este mai cored: sft se eon.sid.ere eft in cent ml activ unele grupftri sunt
implicate in legarea substratului, allele asigurit cataliza propriu-zisft, ele fiind
intercalate. In cazul enzimelor heteroproteice, eofaetorii reprezentaji de
grupftri prostetice fac parte din cenlrul activ: coenzimele i ionii metalici au o
pozijionare care le asigurft conlucrarca cu central activ.

Fig. 11.3. Structura terjiara a chimotripsinei; se evidenjiaza resturile Ser-195


i His-57 care smpreuna cu. Asp-102 (dispus In apropiere) se alia In centru!
activ.
79
In iegSture cu organizarea spapalS a centrului activ al enzimelor
(raportatfi la structura substratului) s-au elaborat douS modele:
- Modelul clasic (Emil Fischer) consider^ c& potrivirea substratului cu
centrul activ al enzimei este analoage cu potrivirea lacjt-cheie. Acest
model presupune o rigiditate a structurii enzimei in zona centrului activ (Fig,
II.4).
- Modelul Koshland, numit centrul activ indusA presupune o flexibilitate
a zonei in care aceasta se afll In enzima libera, central activ este preformat
ceea ce inseamn3 cS el are o configurape spapaie uor diferite de cea
necesM fix8rii substratului. Substratul induce o modificare conformaJionaM a
zonei centrului activ realizandu-se configurapa optime fixMi, In Fig. II.5. se

re una dinfre reprezentMe simplificate ale modelului Koshland.


In cazul unor enzime, formarea complexului ES in varianta Koshland a lost
demonstrate experimental. Pe de aM parte, din punct de vedere
termodinamic aezarea cea mai potrivite a substratului in raport cu enzima
reduce la minimum gradele de libertate in ceea ce privegte translapa i
rotapa substratului, element ce favorizeaze atingerea uoar3 a sterii de
tranzipe; aceasta este inteipretarea date scederii energiei de activare in
reacpile catalizate de enzime. Specificitatea stereochimice i mai ales
inhibipa competitive a enzimelor pot fi explicate cu ugurinje pe baza
modelului Koshland
Desigur c& fiecare enzime prezinte o structure specifice a centrului activ
(cu sterile preforrnate i indusS.). Aceasta nu exclude existenja unor
analogii in structurile centrelor active, cel pupn pentru enzime cu funcpe
apropiatS. Astfel o serie de enzime proteolitice au in centrul activ un rest de
serine; mai mult, in vecinetatea restului de serine variapa resturilor
aminoacide este foarte redusS (Fig. II.6).
Fig. 11.4. Modelul lacat-cheie de interacjiune a enzimei cu substratul.

m
.0
enzimS substrat enzimS - substrat
Fig. 11.5. Modelul I(centru! activ Indus** de interact!e enzima-substrat

substrat enzima - substrat


Tripsina
Chimotripsina
Trombina
: - Gin -Asp - Gly -j Seri - G!y : - Met - Gfy - Asp -fSerl - Gly : - Gfu - Gly - Asp
-1 Ser 1 - Gly
Gly
Gly
Gly
Pro - Pro - Pro Fig. 11.6. Secvenja aminoaciziior In zona centrului activ ai unor enzime
proteolitice este apropiatd
80
1

Fig. II.7. Mecanismul propus pentru scindarea hldroiitica catallzata de


chimotrpsina a legaturiior peptsdice (details ?n text).
Existenja acestor omologii pledeaz& pentru faptul c3, cel pujin in linii
mari, scindftrile proteolitice sunt asem&nStoare ca mecanism; situafia este
de a$teptat sli se MalneaseS. 1 pentru alte tipuri de reacjii catalizate.
O aim constatare rezultata din studiui centrulfii aetiv al multor enzime
este c3 acesta se afM in cavit&|i sau anjuri (crevase); polaritatea redusd
sau chiar lipsa polaritSjii din aceste zone favorizeaz3 fixarea substratelor.
Cunoagterea gruparilor funcjionale i a altor detail! structural ale
centrului^activ a! unor enzime a oferit i posibilitatea formuLlrii unor
mecanisme de reac{ie. In cazul chimotripsinei (Fig. II.7), se presupune cA In
lipsa substratului imidazolul restului His-57 interacJioneazS prin leg^turi de H
cu unul dintre atomii de oxigen ai grup&rii COOH
81
a Asp-102 i cu H al grup&rii OH a Ser-193. Cand substratul este fixat In
cavltatea in care se afiy central activ (i a cdrai pozifionare este realizaty prin
diverse interaejii) hidrogenul de la gruparea OH a serinei este transferal ca
proton pe axotui restului itnidazol; el formeazS acum o leg8tur& de hidrogen
cu azotul grupSrii peptidice a substratului in limp ce 0 a restului de seriny
atacS nucleofil atomul de C al gruptlrii peptidice a substratului. Prin aceste
rearanjM se induce scindarea heteroliticd a legilturii peptidice; intr-o fazS

intermediary, gruparea carbonil a acestei legSturi (cu restul proteic de care


este atagaty) se leagy covalent cu serina, in timp ce gruparea NH2 (de
asemenea cu restul sdu proteic de care este ataata) formeazii legStura de
hidrogen cu atomii de azot ai imidazolului. In final, restul proteic de la
gruparea OH a serinei este deplasat de apy, restul proteic de la imidazol se
desprinde i el; chimiotripsina ii reia structura inifiaiy.
Un mecanism detaliat s-a formulat pentru reacjia catalizaty de lizozim.
Central activ al lizozimului se prezintd sub forma unei despicyturi (an{)
cuprinzand mai multe grupSri de legare i catalitice (Fig. IL8). NumSrul
resturilor de NAM i NAG cuprinse in central activ este ase. La legate
participS. resturile de Trp-63, Trp-62, Asp-102, Ala- 107, Arg-114; gruparile
carboxil din resturile Glu-35 i Asp-52 participii la catalizy. Esenjial in
mecanismul propus este faptui cM in timp ce restul Glu-35 este intr-o zonS.
hidrofobS a lizozimului, el nefiind ionizat la pH-ul optim de aefiune (pH=5),
restul Asp- 52 este intr-o zonS hidrofiiy i deci este ionizat.
Din cele cinci legSluri glicozidice (1-4) aflate in central activ singura care
se scindeazS este cea cuprinsS intre resturile Glu-35 i Asp-52. Gruparea
COOH a Glu-35 cedeazS protonul oxigenului care formeazy legStura
glicozidicy (1-4) simultan cu scindarea heteroliticS. a legyturii oxigen - C, a
NAM. Restul NAG formeazy astfel gruparea OH la C4 in timp ce C{ a restului
NAM devine carbocation (fiind stabilizat de interacjia cu gruparea COO a
restului Asp-52). Uimeazy atacul nucleofil a (OH)*'" din apy cu formarea
grupyrii hidroxil la Ct a restului NAM; simultan ionul H+ din apS formeazy cu
gruparea COO a Glu-35 gruparea carboxil neionizaty (Fig. 1L9).
Reac|iile catalizate de enzimele heteroproteice sunt gi mai complexe
deoarece apoenzima i cofactorul participy simultan la formarea complexului
ES i la catalizd.

Fig. ii.8. Reprezentarea intuitiva a centrului activ a! lizozimului (comentariu in


text).
82

^C-Asp

(sF)

~o \JL
OP'
G/
u
^
3 '"o' ae
5

A
s
p

- ->

G/
u35

' "'O -// M


0'K^
l/VAAf
Fig. 11.9. Mecanismu! scindarii hidrolitice a legaturilor (1-4) glicozidice din
heteropotizaharide, catalizata da lizozim.
II.8. CINETICA ENZIMATICA
Cinelica enzimaticS studiazd viteza reacjiilor catalizate de enzime in
fimc{ie de variafia raportului concenirajiilor enzimei i substratului ([E], [S])
i a mfluenfeior unor factori fizico-chimici cum sunt: temperatura, pH-ul,
inhibitorii etc.
Concepfia unanim admisS in enzimologie cd formarea din substrat a
produsului de reaepe implied obligatoriu existenfa complexului enzimSsubstrat (ES) redatd. prin ecuajia:
E + S^=^ ES------------------------------- E + P
a fast statuata in primul rand in legdtunl cu cinelica reaejiilor catalizate de
enzime; de aceea, in interpretarea fieedruia dinlre aspectele cuprinse in
acest. subcapitol punctui de plecare il reprezintd chiar aceastd ecuafie,
11.8.1.
EXPRIMAREA VITEZEI REACJIILOR ENZIMATICE.
ACTIVITATEA ENZIMELOR
Utilizarea curentdin cinetica enzimaticS a acestor termeni lace necesarS
defmirea lor.
Viteza de reaejie se exprimS prin cantitatea de substrat transformatS in
produs de leacjtie (exprimatd in miligrame, mai mr in grame) intr-o imitate
de limp (secundS, minut).
83
Pentru enzimele purificate, cSrora li se cunoate masa molecular^ se
poate 'slabili num&rul de molecule de substrat transformate de c&tre o
molecule de enzimS intr-o seconds, valoare ce reprezinta activitatea
molecular^44 a enzimei. Aceasta mSrime, sinonimS cu eficienfa cataliticft,
este important^ pentru cd permite atat comparajii intre diversele enzime cat
i a enzimeior in raport cu catalizatorii chimici. Pe de alts parte, pentru
enzimele a cftror activitate molecularS este stability pe baza mSsurarii
canfitSfii de substrat transformat, de exemplu de c&tre un omogenat tisular,

se poate calcuia concentrajia enzimei (numSrui de molecule) din aeei


omogenat.
in practica biochimicft curentS, inclusiv in cadrul determinMlor enzimatice
In scop de diagnostic (in special in ser), infiereseaza mai pupn activitatea
absolute, fiind insS. importante variable de activitate; in acest caz este
suficient sa existe o anumitS unitate arbitrarS de activitate care s3 serveascS
drept referin$L Se utilizeaza urmS-toarele unitSji:
- unitatea internafionald, UI; o imitate internafional& reprezintS
cantitatea de enzimS care asigurd conversia unui prnol de substrat/min in
condipi standardizate de p.H, temperature, prezenfa cofactorilor (care sunt
stabiliji pentru fiecare enzima),
- Katalul (Kat); un Kat reprezinta acea cantitate de enzima care asigura
transfer- marea unui mol de substraf/sec (cu multiplu kilokat i submullipli
mkat i pleat).
Pentru unele enzime se ufilizeazl i alte unitafi. Astfel pentru
oxidoreductazele cu coenzime MAD" (NADH -f H+) sau (NADPH -f H*)
activitatea se exprimS prin cregterea sau sc^derea extinefiei la 340 nm
formele reduse ale enzimeior absorbind aceastl radiate, if. timp ce formele
oxidate no o absorb; o unitate enzimatice pentru aceste hidrogenazedehidrogenaze reprezinta creterea sau scMerea cu 0,001 a exlincjjiei la 340
nm intr-un minut (cuva de 1 cm).
Pentru fosfatazele din ser se utilizeaza unitatea. Bodansky care reprezinta
cantitatea de enzima ce formeaz3, prin hidroliza esterilor fosforici, un mg de
fosfat anorganic (in condifii standardizate de pH, temperature).
II.8.2.
VITEZA INIJiALA A REACpiLGR ENZIMATICE

Fig. II.10. Determinarea vitezei inijiale (v0) a unei reacfii enzimatice.


Dacd unui substrat aflat in solujie i se adauga o cantitate de enzima care
catalizeazS transformarea acelui substrat se constate c8 form area in timp a
produsului P are loo dupd o curb# ca cea din Fig. ILK). Ea are o porjiune
rectilinie (cu panta constants), apoi se incline i in final se aplatizeazd. Este
necesar ca in mSsitrStorile de cineticS sa se la valoarea notatd v0, numitd
viteza inijiaia i care reprezinta viteza. reaefiei pe porjiunea rectilinie.
DatoritS concentra- Jiei mart a substratului corespunzStoare acestei porjiuni,
ES se transforms numai in E + P (nu i in E + S). in practice se determine
viteza reaefiei in primele secun- de (sau minute pentru reaejii lente) i
aceasta se considers v0.
84
0.8.3. INFLUENTA PH-ULUI 1 TEMPERATURE ASUPRA ACTlVITA'p! ENZIMELOR
Enzimelc produse de cclule pentru cataliza reacjiilor care au ioe in

inleriorul lor sau in afara-dcaxul enzirnelor piasmaticc, digestive) sunt


adupiate condifiilor' dc pH, temperature alter factor! caracteristiei locului de
aejiune.
Daea in organismui uman temperatura la care se desfli^oanl loate
reacjiile enzimatice este in mod curent constants (37C), aland cand se fac
sludii de cinelka in vitro, temperatura poaie 1.1 variola in limile destul de
largi.
Activitatea orciirel enzime variazJl .cu temperatura duplt o curb;! ea cea
din Fig. 11,11. Credere a vitezei reacjici catalizate odatfi cu cregtcrca
tempexaiurii este interpretaffi prin prisma cnergiei de activarc7 a$a cum sa prezentat anterior. Pentru Occam enzinia se poate stahili (in condiljile
menjineiii constante a celorlaiji paramefri) an coefieient lerrnic al reaepei^
noiat Q10 a.uo reprezintsl cre^terea vitezei reaejiei' pentru o credere cu 10C
a te.mpera!:urii.
Valoare.a cocfieientului formic pentru reacfiile enzimatice tone oupnasil
obinuit intre .1 i 2 Find rnarmicfi decar pentru reacjiile chimice necatalizate
(Q10 intre 2 i 4). Reiajia este vaiabila numai pfln3 la o anumM temperature
nurnilS temperatura optima, pentru -care viteza atinge valoarea maxima,
Paste lopt viteza reaejiei scade brusc daforifll denalurarii termice a apoenzimei
(conslSnd mai ales in ruperea legaturilor de hidrogen), fiind afcctat i cenirui
activ. T t pentru enzimcle din organismui uman este intre 40-50C. Existd
enzime, in alle sisteme vii, a diror topE este mai. ridicatiS (la plante 50-60nC,
chiar 80-100C la enzime din microorganisme care fraiesc in ape termale).
Cand sc detenmna aetivitSfile unor enzime in scop diagnostic (de exempio
activitatea enzirnelor plasmatice), este obligatoriu oa aceasta s& se fact! la o
temperature fix&, in cazul color mai multe dintre eie 37C.
Infiuenfa temperatuiii asupra activitajii enzirnelor esie foarte important^
in criobiologic; un caz II constitute conservarea la temperatuiri sdSzute a orga.nel.ar in
vederea transplantului.

100
Fig. if.11. Variajia activitatii enzirnelor tn funeji de temperatura.
~20 ~40 SO t*C
85

Fig. If.12. Varia]ia activit&jH urtor enzime In funcjie de pH.


Viteza reacjiilor enziinatice este influen{at&, de asemenea, de pH. Pentru
enzimele din organismul urnan pH-ul optim de acjiune este ehiar pH-ul
normal al mediului in care ele ii indeplinesc funcjia calaliticS (cazul pepsinei
i tripsinei din Fig. IT. 12.).
Cum in majoritatea jesuturilor din organism pH-ul este in jur de 7 i enzimele
au acjiune optima in apropierea acestei valori.
Diminuarea vitezei reacjiei enzimatice la valori de pH mai miei sau mai
mari decat cel optim se realizeazdin mod specific pentru fiecare enzimft. In
ire multiplele acjiuni ale ionilor H+ OH asupra enzimelor se menjioneaza in
primul rand efectul ior denaturant; spre deosehire de efectul denaturant al
temperalurii, in acest caz se rup mai ales legSturile de tip electrovalent. La
enzimele in al eSror centru activ se afkl grup&ri ionizabile, acide sau bazice,
acesla interacjioneaza direct cu ionii H+ i OH~\ rezultalul fiind creterea sau
sc&derea gradului lor de disociere; ionii i OH acjioneazd in acest caz ca
adevtiraji inhibitori (vezi mai depaite inhibijia activibljii enzimelor).
Un exemplu de acjiune a pH-ului asupra enzimei il constituie inactivarea la
nivelul stomacului (pH 1-2) a amilazei salivare (pH optim 6,6-6,8) care este
antrenata cu aiimentele din cavitatea bucalS.
IL8.4. INFLUENZA CONCENTRAJIEI ENZIMEI
Eficienja cataliticS deosebitti a enzimelor este responsabil& de faptul c&
in reacjiile enzimatice ce au loc in vivo, concentrajia substratului este mult
superioarS concentrajiei enzimei; exists totui unele situajii cSnd regula nu
se respects, concentrajia enzimei putand fi chiar mai mare decat cea a
substratului. In vitro este foarte uor s& se fac& un asemenea experiment,
Iuand mai multe eprubete care confin aceeai cantitate de substrat dar
cantiklji din ce in ce mai marl de enzimS. DacS se determine vD pentru
fiecare probfi i apoi se reprezintd grafic vc in funcjie de fE] se objine o
dreapttl ca cea din Fig. 11.13.
86
Fig. 11.13. Yarialia vitezei unei reacjii enzimatice In funcjie de concentrajia
enzimei.

Matematic, aceastft linearitate se exprimS prin reiafia:


v0 = K * fE]
. '
unde K esle o constants caracteristicS pentru fiecare sistem enzimS-substrat.
Creierea lineanl a vitezei se explicS prin form area complexului ES in
dependent dear de [E], m acesle condijii complexul transfonrsandu-se
integral in produs de reaefie.
in aceastS reprezentare, la o concentrajie a enzimei egnLl cu zero, vG = 0,
sugerand cS reactia nu se desfSoarS deloc in lipsa enzimei. Totui
reprezentarea este corectd pentru c in praetiea enzimatica curentS v0 in
lipsa E se scade din v in prezenja ei (se face on aa numit blanc
reprezentSnd tocmai valoarea lui v0 in iipsa lui E care se scade din vaioarea
v0 a fiecitrei probe).
Proporjionalifatea inlre viteza vD i [Ej are importante aplicajii practice; de
exempt u, este posibil sS se esiimeze concentrajia relative a unei enzime in
omogenate ceiulare fM a fi necesar sil se efectueze o purificare prealabilS a
acesteia. Pe de o parte, vc = K . [E], iar pe de alia parte vD = [P]/t (unde [P] =
concentrajia produsului reaejiei, t = limpid de desiilsurare al reaejiei); deci:
K . [E] - [P]/t sau [EJ - [PJ/K * t
Dacd timpul pentru studierea reaejiei este mereu acelagi (deci constant)
i produsul K *t *= constant (notat K,); in aceste condijii, concentrajia in
enzimM este direct proporjio- nalft cu cantitatea de produs format [E] =
[PJ/K,.
Asemenea m&surittori de concentrajii relative a enzimelor se efectueazii
sistematic in laboratoarele de analize medicate (mai ales asupra sftngelui)
deoarece variajiile sunt corelate cu diferite sUlri patologice, (vezi subcapitolul
Enzimele in diagnosticul clinic")
11.8.5. 1NFLL1ENJA CONCENTRATE! SUBSTRATULUL ECUATIA MICHAELiSMENTEN
Concentrajia majoritniii enzirnelor cel ul are este constants! in limp; fac
excepfie en/.imelc numise Jnduetibiie" (vczi Regiarca aclfvinijii cnzirncior")
precum si enzimde piasoraliee neftrnejionale a cftror concemrafie create sau
seade in anumile st&ri palologice (vczi Rcia[ia ertzime - patologie"), la
schimb, concenirajia subsiratelor color mai rmiRe cnzime variazd clcstul cie
mult dupa starea metabolic;! a jesul.iiJui i numerous aJU fac tori. De acoca
dependent vitexei do reacdo de concealrafia substratului consliiuie aspectui
cel mai important al cinelicii enzimaiice. In accst caz, reprezentarea graded a
lui vcI.n funefie de [S] ((EJ, temperalura $i pH-ul fiind constranlc) conduce la o

curbft cu aspect de hiperboN (Fig. IT 14), Exisfa p exceppi, enzime peniru


care in Ioc de hiperbolil se obfine o curb*1 sigmoidall ACA Enzime!e
alosteriec")*
Din analiza curbei rciese cM vD create proportional cu crcgterea [Sj numai
peniru valori mici ale aceslda; apoi cregterea se face lol mai lent pentru ca
dineolo de punctul IT orient de mult or creole [S], viteza reaejiei r&nane
constant*!; valoarea constants a vitexei este i valoarea maxima, notatft
V1llax.
Explicajia alurei curbei precum i o ecuajie in care vc se expound In funejie
de |S), VIIWX i o constants! KM, se datoreazft lui Michaebs $i Men ten,
In deduecrea ecuapei se plead! de ia;
T
K-3
EvS
ES -. ..E + P
(1)
Ka
In compietare la ceie menponate anterior in legating cu acc&sfS ecuajie
geoerald se
precixeaxA cS transformarea ES
ErF este de reguld ireversibild din
douil mo
tive: pe de o parte, este etapa mai iemUl, pe de aim parte, P devine, in
cadrui edii metaboiice speeifice,. substrat pem.ru reaefia unnatoarc p docs,
se consume rapid (exists louigi reaejii erizimatice in care re form area lui ES
din E p P nu poate fi neglijatS),

88
0
Fig, 11,14. Variajia vitezei reaejiei enzimatice in funcjle de concentrajia
substratuiui.
Deoareee viteza reacjJei caializaul cnzimatic se expand prin canritatea cle
P formal inlr-u imitate de limp, iar [P] este proporjionald cu [ES], sc poate
scric
vo - K3 [ES).
(2)
Cantilatea de ES disponibilil pentru transform are a in E $i P este insa
dependent;!, pe de o parte, de viteza cu care sc orrneax;1, iar, pe de alia
parte, de viteza de disociere in E i S; aceste viteze sunt redate prin:
-
- viteza de formare a lui ES = K, [E]*[S]
(3)
node [El reprezintS concenlrajia enzimci libere (ciisponibila in momenn.il da.t
pentm
form area ES);

-.viteza de disociere a lui ES = k2 [ES]


(4)
Dacf reaejia face parte dinir-o eale metabolic:! fES] r&mane practic
constant;! ('"steady state'", stare staponara) i variaz;! numai [S] i [P].
Condifia matenialicfi pentru aceasta este e.a viteza de formare a iui ES stpfie
ega!2 cu suma vifezelorde transformare in E i P $i refaeere a lui E + S, deci:
K,-[E]-[S] *= (K2 -f- Ks) [ES]
sau: K2 -r K3 .. [E] * [3]
~ *[E^"
RaportuJ conslantelor este tot o constant.fr nolat& KM, deci:
[E] [S]
K,
[ES]
(5)
(S)
(7)
care poate fi serisa gi sub forma:
[ES]
[E]-[S]
(8)
Deci pentru calculul pe baza ecuafiei (7) a lui KM, care are o deosebild
important in enzimologie, este necesarfi m&surarea directs, a lui [E] i [ES],
Aceste determimlri sunt de-seori dificiie; de aeeea se urmSregte objinerea
unei ecuafii in care KM sa fie corelat. cu parametri mai uor mSsurabili. in
acest scop |E] se exprirrul prin:
ra - [Et] - [ES]
unde [ET] este concentrajia lotah! a. enzirnei in mediu. Substituind pe [E] din
(9) in (8) se objine:
[ES]
([Et] - [ES]) -[S]
KM
care- prin rezolvare conduce la;
[ES]
[ET3 [S] __
(9)
(10)
(11)
89
Subslituind aceasta valoare a lui ES in (2), se ob|ine:
(12)
v
0
KM + [S]
Cum s-a ardtat, cand eoncentrafia substralului este mare (caz frecvent in
vivo), vileza reacfiei este Vimx ceea ce presupune participarea in totalitate a
enzimei la reacfie, deci;
vmax - K3 (Et]
(13)
Subslituind in (12), se obfine:
Vm [S]
Vn- ..
(14)
KM + [S]
Aceasta este ecuafia Michaelis-Menten sau ecuafia de vitezS a reacfiilor

enzimatice cu un singur substrat. Ea redd deci variafia lui v0 in funcfie de


variafia lui [S]; in ecuafie mai apar constanta KM i VnM (care exprimS indirect
eoncentrafia. enzimei).
Coneordanfa ecuajiei cu alura corbel din Fig. 11.14 este excepfionald;
pentru verificare se dau doud situafii:
a. Cand S are eoncentrafia foarte midi (corespunzdtor porjiunii O - A pe
curba), valoarea lui la numitor poate fi neglijald i ecuafia (14) devine:
V0 = 22L2LK [S]
(15)
.KM
adicd v0 este direct proporfionald cu [S];
b. Cand S are eoncentrafia foarte mare in raport cu KM (corespunzator
punctului B pe corbel), valoarea acesteia din urmS poate fi neglijatd, deci;
adicd vc atinge valoarea maxima.
V,ax [S]
[S]
(16)
11.8,6,
DETERMINAREA EXPERIMENTAL^ A KM;
SEMNIFICAJIA ACESTEI CONSTANTE.
CONSTANTA CATALITICA, Kcat
Fiecare enzimd se caracterizeazd printr-o valoare particular^ a KM;
aceasta valoare se determine in principiu astfel: se prepare o serie de 6-10
probe (iritr-o solufie tampon potrivitS) introducandu-se in toate aceeai
cantitate de enzimd dar realizandu-se un gradient crescdtor al substratului.
Reacfia, declanatd in momentul amesteedrii enzimei cu substratul, este
idsatd sd se desfdoare un anumit timp (secunde, minute, dupa caz) apoi
este intreruptd prin adaosul unui inhibitor potrivit. Se masoara in fiecare
proba cantitatea de produs format; cu aceste date se calculeazd valorile v0
care se reprezinta grafic in funcfie de [S] crescator. Se obfine curba
hiperbolica caracteristicd (Fig. 1,1.14). Porfiunea dreapta paraleia cu abscisa
(corespunzatoare saturdrii E cu S) se prelungete pand la interseefia cu
ordonata; interseefia reprezinta V^. Se ia valoarea V^/2, se duce o dreapta
paraleia cu abscisa pand la interseefia cu curba i de aici se duce o dreaptd
paraleld cu ordonata pdnd la interseefia cu abscisa, care este chiar KM.
90
Dac& in ecuafia Michaelis-Menten se substituie v0 cu Vmax/2 se objine
succesiv:
vmax fS]

2[S] ~ Ku+ [S] KM - [S](17)


2 K + [S]
Se trage concltizia: KM reprezintS acea concentrate a substratului pentru
care viteza reacfiei este jumState din Vnax; in consecinjS valorile lui KM se dau
in moli/litru.
Semnificajia iui KM reiese dac se apeleazS la formula (6): KM = (K2 +
K3)/K,; considerand K3 K, se objine KM = &A i dec! KM red capacitates de
disociere- a lei ES in E + S"; in alfi termeni, ea red5 tSria leg&lurii intre E i S
in complexul ES. Valorile lui KM pentru diverse enzime sunt cuprinse intre 10'1
- 10*6 moli/litru.
Se conchide:
- valorile mici ale KM corespund unei leg&turi slabe intre E i S;

- valorile mari ale KM corespund. unei legftturi putemice intre E i S.


In cinetica enzimatica se utilizeazS i o altts constant#, notat# care se
definete prin raportul:
Ea red# numeral de transformed substrat ~> produs pe care fiecare
centra activ le catalizeaz# lntr-o unitate de limp (turnover). Cunoscand
valorile i semnificafiile lui KM i Kcat se poate calcula Kcat/KM care red#
eficienfa catalitic# a enzimei (Tabelul II.2).
Tabelul 11.2
Valorile K*,, Kcat i Kcat/K ale catorva enzime Tn raport cu substratele
Enzima
Substratul KU(M)
Keatfs1) KJKM
Acetilcolinester Acetilcolin 9,5x1
1,4x10 1,5x10
5
aza
a
O
Anhidraza
1,2x1
carbonica
C02
O'2
1,0x106 8,3x107
Anhidraza
2,6x1
carbonica
HCO
O'2
4,0x105 1,5x107
2,5x1
Catalaza
H2O2
O'2
1,0x1o7 4,0x10s
Chimotripsina
Esterul
4,4x10' 5,1x10'2 1,2x10'
etilic ai Nacetilglicinei
5,0x1
Fumaraza
Fumarat
O'6
8,0x102 1,6x10
Ureaza
Uree
2,5x1
1,0x10 4,0x10s
2
O'
91
118,7. ECUAJIA LINEWEAVER-BURK
Maiemalic, ecuajia Michaelis-Mcnten poale fi transformatfi in moduli
variate. O .variants, datorata Iui Lineweaver i Burk, este forma reeiprocii:
A=
.
(19)
+J
r
V "v Tsi
Variabilele fiind [S] i v0, ecuajia este de forma general# y = a.x + h;
reprezenland grafic 1/v0 in funcjie cic 1/{S] se obfine o dreapta (Fig. 11.15).
Iniersecjia dreptei cu ordonata corespundc valorii 1/Vmax, iar pania dreptei
este data de KM/Vmax Dac# se prclungegie dreapta pan# la iniersecjia cu*
abscisa, se objine valoarea -1/KM. D i n
punctul do vedere al determinant experimentalc a Iui KM i VIIWJl reprezentarea
Iui l/v0 in funcfie de i/[S] este avanlajoasfi, mimanil de probe necesare penlru
objinerea dreptei (,>i d.ect a !ui Vmax JCM) fiind mult mai mic In comparajie cu
numftrul de probe necesare objincrii hipcrboiei. Pe de alt# parte, ecuajia Iui
Lineweaver i Burk este extrem de utiId in studii de .inhibijle a aclivit&Jii
enzimelor prin compui chimici.
/A'

<CJLKn&x
T

'"'Fanta z-;
A:
M
max
Fig. 11.15. Reprezentarea grafica a ecuatiei Ltneweaver-Burk.
IL8,8. INHIBIJIA ACTTVITAJII ENZIMELOR
Activilatea multor enzime este inhihat# de compugi chimici divergi; In
sistemele vii asemenea compugi pot fi de origine endogen# (de exemplu
diferiji metaboliji) sau de origine exogen# (cum sunt agenjii toxici sau unele
medicamente).
Inhibifia enzimelor poate fi reversibil# i ireversibi.13, aceasta din urm#
numindu~se i inactivare. In ambele cazuri inhibitorul se leaga de enzirml,
dar in timp ce in inhibijia ireversibil# leg&tura enzim#~inhibitor este
putemicft (covalent#), in inhibijia reversibil# legStura este siabft.
92
Un exemplu de inhibijie ireversibite este oferit de acfiunea iodacetarnidei
asupra enzimelor care au in central activ o grupare - 5H; are ioc reacjia:
Enz CH2 SH+
CH2 -- COMH2 Enz CH2 S CH2 CONHa
+ HI
Complexul Enz CH2 S GH2 CONH2 este complet inactiv (nu poate
fixa substratul).
Tot grupSrile SH din centrele active pot fi blocate i cu acidtii
paraclormercuribenzoic in timp ce grupSrile hidroxil din centrele active (cum
este cazul tripsinei) sunt blocate de inhibitorul di-izopropilfluorofosfat
Se cunosc douS variance majore d:e inhibipe- reversibilil;
a) Inhibifia competitive, prod usd de irihibitori care se leag& tot la nivelul
centrului activ al enzimei, dar prin legdturi slabe. in cazul prezenfei
simultane in medio (sau In celule) a substratului i inhibitorului, intre acedia
are loc o compefijie pentru fixarea pe enzirrte. La o capacitate egate de
legate la nivelul centrului activ a substratului i inhibitorului, enzima va fixa
acegti competitors. in raport cu concentrapile lor. Inhibitorii competitivi 'sunt
compugi cu structure apropiate de cea a substratului. Evenimentele care au
loc pot fi reprezentate simplificat:

In acest tip de inhibipe, partea din enzima aflatd sub forma complexului El
poate fi recuperate daat in mediu apare un execs de substrat (datorite
reversibilit&fii E + I ** El).
Precizarea cd un anumit compos este inhibitor competitiv pentru o
enzim# data se face in mod simplu; se traseazS dreapta l/v0 in funefie de 1/
[S] pentru prezenjain mediu a lui E i S i apoi aceeai dreapte pentru
prezenja in. media a E, S i I. In ultimul caz se remared o pante crescute a
dreptei, interseejia cu ordonata nefiind modificate. Valorile interseejiei
prelungirii dreptei cu abscisa. i panta. dreptei sunt modificate cu
coeficientul 1 + [Ij/Kj, unde are semnificafie asemdnhtoare lui KM dar pentru
icacfia lui E cu I (Fig, 11.16).
Fig, !L16. Reprezentarea grafic^ a ecuatiei Lineweaver-Burk Tn cazul
inhibijiei competitive.

93
Printre numeroasele inhibijii competitive cunoscute sunt i urmStoarele:
Succinat dehidrogenaza, enzima ce catalizeaz# transformarea acidului
succinic in ac-id
fumaric, este inhibat# de acizii dicarboxilici malonic, malic i chiar oxalic.
COOH
.1
CH2
1
CH2

COOH
1
CH2

1
COOH

COOH
1
CH OH
i

COOH
1
COOH

GH2

COOH

COOH

acid
oxaiic
Un num&r de medicamente larg utilizate ii datoreaz# efectele faptului
c# sunt inhibitor! competitive De exemplu, sulfaniiamida, cea mai simple
sulfamidL este asem&n&toare structural cu acidul paraaminobenzoic pe care
il poate inlocui in cursul sintezei acidului folic de cfttre bacterii (vezi vitamine
i coenzime); cum acidul folic este indispensabil bacteriilor, acestea mor (la
om nu se intampl# acest lucru deoarece el ia din hran# acidul folic).
acid succinic

acid malonic

H2N

COOH

H2N

acid mafic

SO2MH2

Aacid para-aminobenzoic
Suifanilamida
In chimioterapia cancerului se utilizeazl analogi structurali ai bazelor
purinice 1 pirimidinice; ei Inhibit sinteza de acizi nucleici impiedicand
diviziunea celular# care este mult mai rapid# la tumori.
b) Inhibijia necompetitiv#; in acest caz inhibitorul, a c#rui structure poate
$& difere destul de mult de structura substratului, se leag# prin legSturi
slabein alt loc decat centrul activ a! enzimei. Afinitatea pentru substrat a
enzimei pare a nu fi modificatL Exist# ins# posibilitatea ca o parte din ES cat
i EI s# formeze complex ESI; transformarea lui S din acest complex in P este
sc&zut# in raport cu transformarea lui S din ES, deci atat v0 .cat i sunt mai
mici. Inhibifia necompetitiv# depinde numai de concentrafia inhibitorului (i
de afinitatea. enzimei pentru el) deoarece substratul in exces nu il poate
deplasa pe acesta.
t
ES
E
ESI
>- El + P (pujin)
El
Dac# se studiaz# cinetica unei asemenea reacjii, reprezentarea l/v 0 in
funcfie de 1/[S] conduce le o dreaptS a cdrei prelungire intersecteaz^
abscisa in acelagi punct cu dreapta objinut# fM inhibitor (deci valoarea KM nu
este modificat#); in schimb, sunt modificate intersecfia cu ordonata \ panta
(Fig. 11.17).
94
Fig. IL17. Ftorazentarea grafted a' ecuajiel Uneweaver- Burk Tn cazuJ
inhibljiel necompatitive.

Exomple sunt unele enzime care confin grupM SH iibere in alte pozijii
decat centrul activ, Aceste grupftri pot fixa prin leghturi slabe ioni ai unor
metale grele cum sunt Ag+ i Hg+ care dirninuft sau chiar anuleazh
capacitatea enzimelor de a transforma substratele in produi. Aa se explicit
efectul otrSvitor til multor metale grele.
119 REGLAREA BIOSINTEZEI 1
ACTWITA11I ENZIMELOR
II.9.L ASPECTS GENERALE
insulin cum sunt capacitatea cataliticS deosebiti, specificiiatea, inhibarea
prin diverji compui etc., se shidiazh in detaliu urm&rind comportarea

enzimelor cxtrase, puiificate i dizolvate In mediu apos; in aceste condijii,


atunci cand se studiazS acjiunea unui anumit factor, de exemplu a unui
inhibitor, ceilalti parametrii cum sunt temperatura, pH-ul, concentrajia
enzimei i substratului, prezenjain limitele necesare a cofactorilor etc., se
men Jin la valorile dorite (de regulh cele optime).
i pentru enzimele care ii desfa^oarh activitatea in organismele vii, o
parte dintre factorii mentionaji se menjin la valori constante sau variaziX in
limite resttose. Apar totui relativ frecvenl 51 situajii deosebite; intre acestea
variajiiie man in top ale concentrajiei substratului (de exemplu a glucidelor,
lipidelor i proteinelor in tractul digestiv) i acumularea pesfce Limite a
producer final! a c&lor metabolice sunt cele mai freevente.
Se menjine in astfel de situajii in celule, organs sau organismul intreg o
concentrate stajionarh i o activitate constants a tuturor enzimelor?
R&spunsul la aceasth intrebare a venit mai intai din studiul unor process
metabolice la organismele simple (bacterii) la care s-au rcmarcat, funejie de
condijiile create in mediu, crejteri i scftderi in limite foarte marl ale cantitajii
unor enzime, sau, in alte eazuri, variatii insemnate ale activit&jii enzimelor.
Aceste variajii cantitative sau
95
caliiative. consliluie de fapi modaliftji de reglare care sunt alribulul
biocatalizatorilor. Prin intermediul reacfiilor cataiizate de asifel de enzime
(dar gi prin prezema sau absenfa cofact.oii.lor, .a inhibitorilor etc.) bacteriile
igi menfin homeostazia in raport cu. medial extern. Pe baza cunogtinjelor
actuate, se poate afirma ca gi In organismele superioare toate procesele
care au o bazfi molecular#. sunt reflate prin enzime; la acesfe organisme,
datoritS specializilrii celulelor gi organelor, pe de o parte, gi a funcfiei
integrate, pe de altil parte, regiajul cantitaliv sau calitativ al enzirnelor la on
anuniit nivel poate avea ecou la nivelul organismului intreg, In afara
condifiilor nienjionate (exces sau lips# de substrat, exces de produs,etc.) se
menjioneaz# aid c# aefiunea hormonilor serealizeaz# final prin intermediul
unor enzime de reglaj specializafe (vezi capitolul ^HormonD).
In cele ee urmeazd sc prezintil reglarea cantiliSjii enzirnelor-(pe scurt) gi
cele do oil variante rnajore de reglare a a.ctivit#Jii enzirnelor: reglarea
alosteric# gi reglarea covalent#,
11.9.2
REGLAREA CANTITATH ENZIMELOR
Cantitatea oricfirei proteine din organism, deci gi a enzirnelor, rexulla din
dinamica proceselor de biosintez# i degradare. Vitezade schimb (tunioverul
proteinelor) exprimata prin timpul de injuiMLlfire, Tl/2, este foarte variat#
(vezi Metabolismul proteinelor gi ai aminoacizilor'*). Se gtie c# proteinele se
sintetizeaza din aminoacizi; pe- de alia parte, produgii de degradare ai
proteinelor sunt, de asemenea, aminoacizii. Se poate scric relajia:
K.
Aminoacizi
Proteine (enzime)
Kd
unde K3 este 0 constant# general# a procesului de sinfezS, iar K.d este 0
constant# general;! a procesului de degradare.
Dependent de vaioriie celor dou# constante generate se disting situajiile:
Ks > K(l concentrate absent# a enzimei;
'
Ka - K[t concentrate stajionanl a enzimei;

K;i < Kd concentrate sc#zut# a enzimei;


M.ajoritatea enzirnelor au K,f = Kd; eie se numesc enzime constitutive,
Enzimele la. care Ks> Kd se numesc inductibile, cele la care K.s < Kd se
numesc represibile. Se face pre- cizarea c# inducjia sau represia sintezei
enzirnelor nu au caracter permanent gi ca la o aceeagi enzim# inducjia
simezci altemeaz# cu represia acesteia in funejie de necesit#Jile de
moment.
Inducjia sintezei se restrange de regul# 1a. 0 singura enzimil dintr-o cale
metabolic;! (de ex. inducjia prin substrat a 5-aminolevulinatsintetazei, 8ALAS, 1n calea biosintezei hemului).
Exists situajii de induejie simultan# a mai multor enzime; de exempiu,
inducjia enzirnelor hepatice ilustrat# prin aceea c# la o diets bogaf# in
proteine, in decurs de 1-2 zile stmt sintelizate cantit#{i man de enzime din
c#ile metabolice de degradare ale aminoacizilor gi din gluconeogenez#.
Schimband dieta in una bogat# in glucide, sinteza enzirnelor nienjionate este
represai# gi este indus# sinteza enzirnelor din calea glicolitic# etc.
96
Represia sintezei enzimelor se face de reguIS. prin intermediul unor
compugi cu molecule mic&, numiji corepresoii; ei acJioneazS sub forma de
complexe cu proleine spccializate numite aporeprescri,
Mecanismeie inducjiei i represiei sintezei enzimelor, bine cunoscute In
prezent, nu pot fi Infelese decal in contextul mai larg ai mecanismului
biosintezei proteinelor
coordonai de acizii nucleic! Aceste aspecte sunt tratate in capitolul
Bk>sinteza proteinelorA
11.9,3, REGLAREA ALOSTERICA A ACTIVITAJ11 ENZIMELOR
In subcapitolul referitor la cinetica reacjillor catalizate de enzime s-a
menjionat c5 pentru unde dintte acestea curba variajiei lui v0 in func|ie de [S]
are un aspect, sigmoidal (Fig. 11.18).
Viteza micS a reacfiei. la in-ceput urmatS de crelerea marcata la.
concentrajii mai marl ale substratului, sunt rezultatul unor mecani-sme
particulare de aefiune a enzimelor ce cafalizeazS aceste reacfii.
Hot&ratoare pentru elucidarea acestor mecanisme au fost cercct&rile
efectuate de J. Monod, J.P. Changeux i F. Jacob, in a nil '60, asupra reghliii
acfiviliifii unor enzime bacteriene. S-a constatal: de exemplu cA In biosinteza
L-izoleucinei din L~treonin& (care constS din cinci reacjii catalizate de tot
atitea enzime), L-izoleueina in exces inhite intreaga cale melabolica. Nu sunt
Insd inhibate loale enzimele ci doar prima dintre ele, L-treonin-dehidi^ataza;
ea catalizeazS transformarea L-treoninei in a-cetobutirat + amoniac (Fig.
II19).
1.
enzima alosterica cu elect homotrop;
2.
enzima alosterica + modulator pozitiv;
3.
enzima alosterica + modulator negativ.
Fig. il.18. Reprezentarea grafica av0 = f([S]) pentru:

0
+ [S]
CHs
CHs
I
L treonfn - a - cetobutirat
CH2
HO-C-H
I
dehidrataza
+ NH3
HCCHs
H-C-NHi
I
COOH L - treonina
COOH L - izoleucina
(->
Fig. 11.19. Inhibarea activitSfii L-txeonin-dehidratazei de cStre L-izoleucina
aflatS in exces.
97
Pi
F2
P"$
+p
c__^ }__
t________________________ _ _ -;______________j
(a)
/

<y
D
'*A )
r-)~
- P7
/
> - P2

(b)
E1 E2
A-5t-+B-==-+ C--------------- ----- P
'A
(c)
(+)
Fi
F9
F-t
FA
A-RL^ e
C-> D-4- E-------> P
v
~ ~ W fV (d)
Fig. il.20, Moduiarea activitajii enzimelor aiosterice:
(a)
inhibi|ie Tntr-o cafe metaboiica lineara;
(b)
inhibifii In cale metaboiica cu ramificajii;
(c)
activare prin substrat; (d) feed-forward stimuiare.
Studiind i alte c&i de biosintezfl, Monod i colaboratorii au fost in m&sura
sS generalizeze c& produsul final, acumulat peste necesit&jile de moment,
devine inhibitor al enzimei care catalizeazd prima sau una din primele reacjii
ale girului celor implicate in biosin teza sa (Fig. II.20.a).
in cazul cfiiior metaboiice cu ramificajii, produgii finali sunt inhibitor! ai
enzimelor care cataiizeazd reacjiile de la nivelul ramificajiilor; deseed, fiecare
dinlre produgii finali inhibit gi activitatea primei enzime (Fig. II.20.b). Monod
gi colaboratorii au denumit acest tip de inhibijie, inhibifie prin produs final,
inhibijie feedback sau retroinhibijie; enzimeie inhibate s-au denumit enzime
aiosterice iar inhibitorii, inhibitor! alosterici sau modulatori (efectori)
negativi.
Au fost idenlificate i enzime aiosterice a c&ror activitate create in
prezenja unor compugi care au fost numiji activatori alosterici sau modulatori
pozitivi. Asemenea modulatori pot fi substratul (care acliveazd prima enzimS)
(Fig. II.20.c), unul dintre intermediari care activeaz& o enzimit aflatS in
continuarea c&ii metaboiice (feed-forward stimuiare) (Fig, II.20.d), diferiji alji
compugi. Al&turi de denumirile deja enumerate se utilizeazd gi aceea de
efectori alosterici in leg&tur& cu totalitatea compugilor cu rol activator sau
inhibitor.
98
Pentru cele mai multe enzime alosterice exists atat modulator! pozitivi cat
i negativi.
Modulatorii intensified sau scad activitatea enzimelor ca urmare a fixdrii
lor pe acestea. Locurile de fixare sunt distincte pentru modulatorii pozitivi i
cei negativi i altele decat centrul activ. De aid denumirile de enzime
alosterice, inhibitor! alosterici (alio = alt loc).
Existd in prezent mai multe argumente, bazate pe cercetdri
experimentale, privind locurile distincte de fixare pe enzime a activatorilor i
inhibitorilor de acest tip. Astfel, s-au realizat desensibilizdri ale unor
enzime alosterice prin aepuni fizice sau chimice: pH-uri extreme, enzime
proteolitice, ureea, temperaturi sedzute sau crescute, unele radiajii; s-au
realizat astfel de models experimentale inc&t sd fie afectate numai locurile
de legare ale modulatorilor nu i centrul activ. In alte experience s-a putut
proteja centra! activ de aejiunea unor agen|;i denaturaji prin intermediul
modulatorilor.
i alte insugiri ale enzimelor alosterice, a reacjiilor catalizate de ele,
precum i a condifiilor in care se desfdgoard aceste reaejii au importance

pentru cunoagterea fie a mecanismului de aejiune, fie a rolului de reglatori a


editor metabolice. Intie acestea se citeazd:
-din punct de vedere structural, aproape toate enzimele alosterice sunt
oligomeri, de reguld cu numdr par de monomeri: doi (mai rar), patru, ase
etc.;
- reacfiile catalizate de aceste enzime au AG0 negativ, sunt deci
exergonice i ireversibile; ele imprimd sensul unic a! editor metabolice din
care fac parte; situ area chiar la inceputul edii metabolice a acestor reaejii
asigurd nu numai un control ai intensitSjii edii, dar i imposibilitatea
parcurgerii ei in sens invers, ceea ce se traduce printr-o economicitate
maximd;
-compugii chimici cu rol reglator a enzimelor alosterice. (efectorii) sunt
prezenji permanent (rareori doar intermitent) la locul de aejiune al acestor
enzime; variazd doar concentra{ia lor.
Mecanismele (modele) propose pentru expiicarea, cu respectarea datelor
experimentale ardtate, a aejiunii enzimelor alosterice au fost numeroase.
Dintre acestea s-au impus doud: modelul concertat (simetric) imaginat de
Monod, Wyman i Changeux (modelul MWC) i modelul seevenfial propus de
Koshland, Nemethy i Filmer (modelul KNF).
Cele doud modele au cateva elemente comune:
a. fiecare monomer al oligomerului are centrul sdu activ;
b. monomerii coopereazd in fixarea substratului i deci in desfdgurarea
procesului catalitic. Prin cooperare se injelege cd la fixarea substratului
monomerii se influenjeazd. De exemplu un monomer care a fixat substratul
mdregte capacitatea de fixare a acestuia de cdtre ceilalfi monomeri
(cooperare pozitivd); fixarea substratului de cdtre un monomer poate avea
ca efect diminuarea capacitdfii de fixare a lui de cdtre ceilalfci monomeri
(cooperare negativd). Cooperdrile acestea se fac numai prin intermediul
centrelor active ale monomerilor (deci centre de acelagi tip); ele sunt de tip
homotrop, Dacd avein insd in vedere cele ardtate anterior i anume cd
enzimele alosterice sunt conti'olate i de modulatori (care se leagd in alte
pozifii decat substratul) interaejia se face i la nivelul locusuriior pe care se
leagd modulatorii; astfel de interaejii se numesc de tip heterotrop; cele mai
multe enzime alosterice sunt de tip mixt, homotrop-heterorop;
c. interacfiunile intre monomeri in oligomer, atat in cazul efectului
homotrop cat i a celui heterotrop, nu implied modifiedri profunde (formare
sau rupere de legdturi covalente) ci doar modifiedri conformajionale. De
aceea reglarea alosteried se face cu consum minim de energie.
99

Starea R
~ substrat
Fig, 11.21. Fixarea substratului i tranzifia T - R in cazul unei enzime
alosterice formata din doi monomeri.

Modelul simetric postuleazl suplimentan


- Oligomeral trebuie s3 mdeplineascS permanent condifia de simetrie,
respectiv centrele active ale monomerilor s& fie echivalente in interaefia cu
ceilalji monomeri; de fapt, oligomerul poate exista numai in doui$ stari:
conforma|:ia T (tensionat.&, constrSnsS.) in care enzima are afinitate micS.
faf:S de substrat i conformafia R (relaxatfi) cu afinitate mare pentru
substrat. Starea T are centrul activ preformat., starea R il are definitivat. Cele
douft st&ri se afl& in echilibru, constanta de echilibru fiind L (constants
alostericS). Termenii T i R se refers la flexibilitatea oligomerului, respectiv
felul i numSrul' interacfiunilor intre monomeri. In lipsa substratului starea
predominant# este starea T.
Dac# se consider!! numai interacfiunea de tip homotrop, fixarea
substratului la starea T se face cu atlU mai greu cu cat concentrafia lui este
mai mic# (Fig. IL18, porfiunea O- A pe curba 1). Intr-o enzim# alostericd
formats numai din doi monomeri fixarea substratului la unul dintre acetia
determine tranzifia T R; in virtutea postulatului simetriei, dar i al principiului
cooperMi, al doilea monomer dobandezpe automat conformafia R i el va fixa
mult mai uor substratul (Fig. 11.21, porfiunea A-B, pe curba din Fig. 11.18),
porjiunea B-C pe aceeagi curba, corespunde saturMi enzimei cu substrat.
La o enzim# alosteric# formats din patru sau mai mulfi monomeri efectul
cooperativ este mult: mai pronunjat deoarece fixarea substratului la un
singur monomer determine tranzifia T R la intreg oligomerul.
La enzimeie homotrop-heterotrope, efectul madulatorilor se suprapune
peste eel all substratului. Cei pozitivi (activatorii) stabilizeaz# conformafia R,
deci favorizeaz# deplasarea echilibrului T ** R spre dreapta; cei negativi
(inhibitorii) stabilizeazS
conformafia T (Fig. 11.22; curbele 2 i 3 pe Fig. 11.18).

T
S/area f
Starea S
Fig. 11.22. Stabiiizarea starii T a enzimeior alosterice de c&tre inhibitor! i a
starii R de catre activatori.
100
Diferenja esen{iala Inlre modelul secvenfial i modelul simetric const! in
aceea c5 primal abandoneaz! principiul simr.eriei. Legarea subslratului d.e
c&tre on monomer reclaim! i Tn acesl: eaz iranzijia T > R dar nu este
excJus! imeracpa sfiirii R a. acestuia. cu starile- T ale celorlaifi monomeri.
Cooperativilatea se resirange de asl! data la influenja monomerilor T si R
vecini. Legarea subslratului de cLSxe primal monomer se face i in acest caz
cu dificultate daiorit! stSrii T a iuturor monomerilor enziinei. Modific!ndu-i
conformajia prin legarea substratului, acesl monomer va induce modificarea
corespunz&toare doar la monomerul vecin care va fixa substralul cu mai
mult! uurinfa, Chiar dacft numSrul enzimelor cu cooperativitate negative
este foarte rnic (dintre acestea se citeaz! Urozil-ARNt-sintetaza), modelul

secvenfial s-a dovedit a ri mult mai potrivil d.ecat cel simetric in cazul
acestora.
Ulterior eiaborarii celor dou! modele, Eigen a demonstrat c! ele sunt
cazuri particular ale unei scheme mult mai complexe; dependent de
paidicularita|:i 1 e structurilor terfiara i cuuiernaizL uncle enzime alosierice
acfioneaz! dupa modelul simetric, allele dup! cel secvenfial, allele dupfi
modelul generalize (cel propus de Eigen),
Sub aspect cinetic, Kill a stabilil o ecuajie cu vaJabiliUUe atai pentru
enzimele Michaeliene cat i pentru cele alosierice;
log ~~------------------------- nH * iogfS] - iogK
V-v
max o
unde vG, i S au semnificajiile cunoscute, K este constants specific! pentru
interacjiunea enzimS-ligand; nH este coeficicntul Hill, o constants, empirical
care reflect;! atat numarul locusurilor de fixare a iiganzilor cat i intensitatea
interacfiunii acestora.
Reprezenland grafic log v0/Vnhlx - v0 in funcjie de log [S] (Fig. 11.23) se
obfine dreapta 1 (pornind din origine) pentru enzime lipsite dc
cooperativitate, dreapta 2 (intersecjie abscisa) pentru cele cu cooperativitate
pozitiv! i 3 (intersecjie ordonat!) pentru cele cu cooperativitate negaliva.
Panta. dreplelor 2 i 3 redd gradul de cooperativitate.
Fig. 11.23. Drepteie objinute la reprezentarea graficS a ecuajiei Hill pentru
enzime lipsite de cooperativitate (1), cu cooperativitate pozitiv! (2) i
cooperativitate negative (2).

101
In ultimii 15-20 ani s-au evidential la unele enzime alosterice structuri gi
mecanism e de acfiune mult mai complexe. Un exemplu este aspartattranscarbamilaza, enzimM cu rol de reglare in calea de biosint.ez3 a
nucleotidelor pirimidinice (vezi gi capitolul MetaboIismul nucleotidelor
purinice gi pirimidinice^)* Enzima are 12 subunit&ji dintre care gase sunt
catalitice gi gase sunt reg!atorii. !n starea T, subunitajile catalitice sunt
grupate In doi trimeri iar subunitdjile reglatorii sunt grupate in trei dimeri,
intreg ansamblul avand o anumit& simetrie gi o maxima compactizare.
Tranzifia T > R const& in trecerea spre un aranjament cu o aM simetrie, in
care ansamblul subumtftjilor este mult mai deschis. Cele doufi substrate se
leagd numai la unitdjile catalitice: legarea gi transform area se realizeaz#
printr-un mecanism cooperativ sofisticat gi deosebit de eficient. Produsul
final al eSii metabolice, acidul citidintrifosforic (CTP) se leagS numai la

subunitdfile reglatorii producand o inhibijie feed-back.


11,9.4. RECTLAREA ALOSTERICA A FUNCTIEI HEMOGLOBINEI
Reglarea alosterictl nu se restrange numai la enzime. Funcjia
hemoglobinei este reglatd tot printr-un asemenea mecanism.
Hemoblobina (Hb) gi mioglobina (Mb) sunt hemoproteine care in organism
indeplinesc funcjii vitale: prima transports. 02 de la pttimani la celelalfe
Jesuturi gi C02 in sens in vers, cea de a doua depoziteazd gi disperseazd
oxigenui in mugchi. Structurilc componentelor proteice ale Mb gi Hb sunt
prezentate in alte capitole (ProteineA Metabolismul hemoproteineloF).
Cunoagterea acestora este necesard pentru injelegerea reglSrii alosterice a
funcjiei Hb.
Din punct de veclere functional, comun pentru Mb i Hb este fixarea 02 la
nivelul hemului: mai precis, 02 se dispune intre Fe2+ (legandu-se coordinativ
la acesta) gi histidina distalft (cu aceasta interacfioneazd electrostatic). Din
faptul insS cd Mb nu are structure cuaternaril gi deci fixeazS o singurS
moleculS de 02, in timp ce Hb are structure letrametric& gi fixeaza patru
molecule de 02, rezuM diferenje importante intre ele. Acestea se reflects in
aspectul hiperbolic al curbei de oxigenare a Mb faf& de cel sigmoidal in cazul
oxigenfirii Hb in conditiile fiziologice (Fig. 11.24). Valorile presiunii de
semisaturare calculate din curbele specifice sunt, de asemenea, net diferite:
1 mm Hg pentru Mb gi 26 mm Hg pentru Hb (presiunea de semisaturare,
notat P50, reprezintS presiunea parjiaia a 02 la care Mb gi Hb se oxigeneaza
in proporfie de 50%).
Efectul cooperativ, responsabil de curba sigmoidal!! a Hb (gi de P50
ridicatS) este complex, de tip homotrop-heterotrop.
Pentru simplificare, se prezintii mai intai aspectul homotrop al efectului. El
poate fi studiat pe Hb izolald din eritrocite, adusS in solute apoasS din care
02 este apoi indepartat; Hb complet lipsitH de 02 se numegte deoxigenata.
Dactl in aceastd solujie.se introduce 02 a cfSrui presiune cregte treptat de la
0 la 100 mm Hg gi se determine pe
102
20
40 60 80 100 120
------------------------------------ - Po2 (mm Hg)
Fig, il.24. Curbele de oxigenare ale mioglobinei (Mb) \ hemoglobinei (Hb).
parcurs cat# Hb a fixat 02, se obfine o curbs sigmoidalS apropiatS de cea din
Fig 11.19. (diferenja fapl de aceasta |ine de influenja in condifiile fiziologice a
factorilor care determine caracterul homotrop-heterotrop al efectului).
Interpretarea, bazatfi i pe alte nrulsur&tori experimentale directe, este cfi
Hb deoxigcnatS este in slarea T, cu afinitate foarie redusS pentru 02.
Structural, aceastS stare se caracterizeazS printr-un numSr maxim de interne
jiuni atat intracatenare cat i intercatenare; intereseazS mai ales un numSr
de opt legSturi ionice stahilite intre grupSri carboxil i amino (Fig. 11.25).

Asp
His
COO +
146
94
NH;
p.
Fig. IL25. Legaturi ionice intre subunitafile Hb In starea T; acestea se
scindeaza cand Hb se oxigeneaza.
Important deosebM are i faptul ca in starea T Fe2+ din fiecare subunitale
este situai in afara planului protoporfirinei IX (la. o distant tie 0,6 A) ca
urmare a leg&rii lui dc-r histidina proximalS (Fig.11.26.)
NeinsemnatS la inceput, acceptarea 02 de c&tre Hb se face simjitd pe
mSsurS ce se for$eaz& prin cregterea presiunii. Fixarea 02 la o prim
subunitate (sau, dupS Perutz, deodatS la cele douh subunMfi a), este corelatii
cu modil'ictlri structural relativ insernnate nu numai la nivelul acesteia
(acesiora) ci, in concordanfd cu modelul simetric (considerat polrivit pentru
Hb), la nivelul tuiuror subunitSjilor, Semnalul este dat de revenirea in planul
protoporfirinei IX a Fe2* ca urmare a iegSturii ce se stabilegte intre acesta gi
02 care se plaseazft intre planul hemului i histidina distalS. Cum leg&tura
Fe2+ cu histidina proximaM nu se scindeazS in urma fix&rii 02 (Fe2+ trece doar
din starea pentacoordinatS in starea hexacoordinatS), sunt, antrenate prin
acest rest aminoa.dd.ic modificSri in structurile secundarS gi terJiarS ale
fiecSrei subunit^Ji. Se scindeaz&totodatft gi ceie opt leg&turi ionice Find
angajate modificSri semnificative in structura cuaternarl S-a stabilit de altfel,
in urma unor analize prin difracfia razelor X, efi un dimer |3 se rotegte in
raport cu cei&Ialt, considerat fix, cu 15. Aceste niodifidiri (influence 1
factorii de care se face deocamdatS abstacjie) constituie de fapt {ranzijia T
> R a Hb. Afinitatea mare pentru C)2 a stMi R se traduce prinir-o rapid#
Fixare a acestuia de chtre subunit&file 2, 3 gi 4 (sau 3 gi 4). Doar in
apropierea presiunii de 100 mrn Hg, capacilatea de fixare diminu# ca urmare
a saturSrii.
Planul hemului

+ o2

-o2

Fig. ii.26. Pozifia Fe2* faja de pianul hemului In Hb neoxigenata \ oxigenati.


104

HC0P0 ~~
2, 3 - bisfosfogliceratul (DPG)
H-C-H 0~
I
0
!
o=p-o~
1
o~
Fig. 11.27. Structure 2,3-DPG i intercalarea acestuia in cavitatea centrala a
Hb neoxigenate.
O variate alat de mare a presiunii parjiale a 02 pentru ca acesta s se
fixeze pe Hb ar constitui, in vivo, un dezavantaj. In pldmani ms;l presiunea
parfiaLI a 02 nu variazft Intre 0 i 100 mm Eg ca in condifiilc experimenlale
descrise ci ea este constant la nivelul valorii maxime. Accasta inseamnS e&
doar ultima porfiune a curbci din Fig. 11.24 este valabilS pentru condi(iile
Fiziologice, ceea ce i explicit oxigenarea extrem de uoar& a Hb.
Pe de altS parte, cedarea 02 la nivelul (esuturilor esle favorizatS i chiar
determinate de condifiile fixarii redate in Fig. 11.24. Evident, disocierea 02 de
Hb se face dupd nceeai curbs dar parcursS in sens in vers; presiunea
parfialfi a 02, care este in fesuturi de cca 30 mm Hg, favorizeaza procesul
cedarii sale de caire Hb dar il i intrerupe in rnomentul cand Hb este indl
oxigenat# in proporjie de 50-60%. Deci, Hb va prelua in pklmani doar restul
de 40-50% 02 ceea ce favorizeazS suplimentar oxigenarea. Condi-tiile
descrise ale oxigenSrii i deoxigendrii Hb asigunl gi alte avantaje funcjionale:

a) in mujchi, 02 cedat de Hb este deosebit de uor preluat de Mb (a se


compara curbele de oxigenare din Fig. 11.24);
h) tot cu ugurinpl este cedat 02 in iimpul sarcinii, de la Hb marnei (HbA2) la
Hb embrionului (HbE = a2e2) $i Hb f&tului (HbF = a272) ale c&ror curbe de
oxigenare sunt, de asemenea, sigmoidale, dar deplasate la stanga in raport
eu cea a HbA2.

105

Efectiil homotrop avut in vedere pand acum pentru fixarea 02 pe Hb (dar


i pentru diso- ciere), este completat de acfiunile compugilor 2,3bisfosfoglicerat i C02 precum i ale ionilor H+; de aceea, pe ansamblu,
efectul cooperativ este in acest caz de tip homotrop-heterotrop.
2,3-bisfosfogiiceratul (2,3-DPG), sintetizat in cursul glicolizei i prezent in
eritrocite Intr-o concentrate egal& cu aceea a Hb, intervine astfel: in starea T
se intercaleazS in chiar cavitatea central!! a Hb ca urmare a atracjiilor
eiectrostatice intre grup&rile sale ionizate negativ i grupSri ionizate pozitiv
(amino) ale lanjurilor de tip a i, mai ales, de tip P (Fig. 11.27). Prin aceasta
starea T a Hb este suplimentar consolidate, dificultatea fix3rii 02 crescand
(carba sigmoidalS se deplaseaz la dreapta). Dupft ce ins Hb a fixat 02 la o
subunitate (sail la dou3) modificarea conformational! a tuturor subunit!{ilor,
responsabil! de tranzijia T > R, face incompatibil! r!manerea 2,3-DPG in
cavitatea centrals (care se micoreaz!). Curba de oxigenare a Hb lipsit! de
2,3-DPG este nu numai deplasat! spre stanga dar ii pierde in bun! m!sur!
aspectul sigmoidal tinzand spre cel hiperbolic. Prin aceasta, 2,3-DPG
favorizeaz! cedarea 02 la fesuturi.
Christian Bohr (tntSl celebrului fizician Niels Bohr) a f!cut, in anul 1904,
observafia c! Hb cedeaz! mai uor 02 dac! pH-ul este mai scSzut decat cel
fiziologic i presiunea partial! a C02 este mare; in literatura de specialitate
aceste constatSri sunt cunoscute sub numele de efect BohrA
Expiicafia dat! efectului Bohr, despre care se tie in prezent c! este mult
mai complicat, se restrange aici la aspectele esenjiale. Astfel, in vivo,
concentrajii man ale C02 i ionilor de hidrogen sunt, la nivelul (esuturilor
unde rezult! prin procesele catabolice; ionii de hidrogen mai rezult!:
a.) la formarea intre Hb (dar i alte proteine din plasm!) a carbamajilor
sub forma, alrora cca. 15% din C02 este transportat la plamSni in vederea
eliminSrii; gruparile amino care reaqioneaz! cu C02 sunt ale unor aminoacizi
N-terminali din lanjurilc Hb
i celorlalte proteine:
R - NH2 + C02
R - NH - 000 + H+
ion carbamat
b) la transformarea marei major* i!|i a C02 (cc. 85%) in ionul bicarbonat,
compus
solubil, care este transportat de asemenea la plSmani:
anhidraza carbonic!
co2 + H20
' ~..... . .-
H2CO3
+
H2C03
H + HC03Valoarea mai mica decat 7,4 a pH-ului (cat este valoarea normals in
sange) i
presiunea partial! mare a C02 favorizeaz! cedarea 02, curba de oxigenare
fund deplasat! spre dreapta (Fig. 11.28).
In pldmani echilibrele reacjiilor de la punctele a i b sunt deplasate spre
stanga datorit! elimin3rii C02 prin respiraiie. Concentrafia ionilor H+
desciete, pH-ul depSete uor valoarea
de 7,4; curba de oxigenare se depiaseaz! la stSnga bind favorizat! fixarea 02
pe hemoglobin;!.
106

Fig, 11.28. Deplasarea curbei de oxigenare a Hb tn func|ie de vaioarea pHului. IL9.5. REGLAREA COVATENTA A ACTlVlTkfn ENZIMELOR
In prezent se cunosc multe enzime cu rol reglator a cSror conversie formS
inactive A
formS activa are loc prin modificSri chimice care implies formarea sau
ruperea unor legSturi covalente.
Cazul cel mai freevent este al enzimelor cam se activeazS prin fosforilare
(sau defosforiiare),
Fosforilarea se face de cStre ATP care transfers, de regulS, an singur rest de
acid fosforic; acesta esterificS grupM hidrox.il ale unor resturi de serinS, mai
rar tirozinS sau IreoninS, care nu fac
A
parte din central activ. Reacjiile de fosforilare sunt catalizate de kinaze
specifice, care, la randul
j.
lop pot exists in forme fosforilate numite fosfokinaze i defosforilate numite
defosfokinaze. Fiind
:
putemic exergonice, reacjiile de fosforilare sunt ireversibile. Transformarea
inversS, formS
;
defosforilatS - formS fosforilatS, se lace hidrolitic in piezenja unor fosfalaze
specifice; i aceste
|
reaefii sunt ireversibile (Fig. 11.29).
f
Enzimele interconvertibile prin fosforilare-defosforilare apar numai in
celulele organismelor superioare. Dupa caz, unele enzime interconvertibile
pe aceastS cale sunt active in forma fosforilatS (glicogenfosforilaza) sau
defosforilatS (glicogensintetaza).
t
Activarea unor enzime prin fosforilare (defosforiiare) este, de multe ori, etapa
ultimS intr-o
:
cascadS de evenimente declangatS odatS cu fixarea de catre celule a unor
hormoni sau alfi
j
compui chimici cu rol reglator. Aceste mecanisme sunt tratate in capilolul
Hormoni.
j
0 activare-inactivare 'printr-un mecanism covalent aparte este intalnitS la
enzima
A
glutaminsintetazS care catalizeazS reac{ia:
A
COOH
COOH
|
|

CH NH2
(CH2)a + NH3 +
ATP
COOH
107
;
ATP
ADP

CH NH,
|
- - -^
(CH2)2
CQNH2

Forma acdva a enzimei este iransformalS in form 15 inactive prin


adenililarev< (aiaarea printr-o leg&turii covalentfi a unui rest de AMP). Ca i
fosforilarea, adenililarea se face cir ATP dar la un rest de tirozinft; reacjia este
ireversibilS, Revenirea ia forma activft se face i in acest. caz prin hidrolizft
(Fig. 11.30),
Glutaminsintctaza este o enzirml a carei activitate este reglata atat
alosteric cat. i covalent. Reglarea covalentd este cea anltall Reglarea
alosterial prezintS douft aspects: este multiple in sensul c& exists noua
compui cu rol de modulatori negativi (Tntre care histidina, triptofanul,
carbamilfosfatul) i cafiva modulatori pozitivi; pe de alta parte, este
cumulative in sensul cd modulatori! pot acfiona simultan (in totalitate sau
nurnai unii) i atunci efectui lor se insumeazd.
Tot activ&ri de rip covalent sunt; i transformdrile proeazimelor de tipul
pepsinogenului, iripsinogenului, chimotripsinogenului, procarboxidazei etc. in
enzimele pepsinS, tripsinS, chimotripsinS, carlxmpeptidazfu Formele inactive
(zimogenii) sunt cele prod use la locul
ATP
PPf

Fig. 11.30. Reglarea activita|it glutamimsintetazei prin adeniniiaredeadeninilare.


108
de sintez! (mucoasa gastric! pentru pepsinogen, pancreasul pentru toate

celclalle); activSrile se produc la local de acjiune (stomac, intestinal subjire).


Acesle activftri au loc atfit sub acjiunea unor factori local! cal i autocatalitic,
dup! schema general!:
-7.
Factor local {pH, enzima. autocatalitic)

, _
Zimogen ;____________________________tnzima activa
Transform !rile acesiea sunt unidireejionale, nu exists posibiiitalea refacerii
zimogenului din enzimeie active. Modalit!|ile particulare de activare a
aeestor enzime se pot urmart in capitolul MetaboIismuI proieinelor i a!
aminoaeizilorT
ILK) LOCALIZAREA INTRACELULARA A ENZIMELOR
Pe masura ce cuno$tintele privind structure celulclor speeiaiizate din
fosuturile organismelor superioare s-au amplificat, imaginea distribujiei
haotice a enzimelor in interiorul acestora (celule sunt saci. cu enzime'*)
datand din secolul trecuh a fost inlocuil! cu una diametral opus!.
Separarea prin ultracentrifugare a orga.nit.elor celulare urmat! de
identi.fi,carea prin tehnici histochimice i biochimice a enzimelor in fiecare
clintre aceste organke a constituit metodologia care a permis elaborarea unui
adevfrat tablou al distributed intracelulare a enzimelor. Cftfeva elemente ale
acestui tablou se prezint.fi in continuare.
Este o regal! general c! orice celul! specializat! dispune numai de acele
enzime care cataiizeaz! efectiv reacjii in ceiula dat!. Uriele enzime (sau seturi
de enzime) se all! in loate tipurile de celule speeiaiizate. Este cazul enzimelor
implicate in c!i metabolice fundamentale cum sunt: biosint;eza proieinelor 1
acizilor nucleici, glicoliza, ciclul acizilor tricarboxilici etc. F!r! funefionarea
aeestor e!i, care asigur! multiplicarea si dezvoltarea, nici un tip de celule nu
poate exista.
Tot ca regula general;!, o aceai enzimft apare in forme uor diferite de la
un tip de celule la ailul. Diferenjcle acesiea apar alat la nivelul strueturii prim
axe i conformajiei (enzime homoloage) cat. i la nivelul strueturii cuaternare
(izoenzimele); aclivitatea lor diferenjiat!, alaturi cle concenlrajia variabil! sunt
in report direct cu necesithfile diferite ale tipurilor de celule.
Pe de alt! parte, fiecare tip de ceiula specializat! dispune de seturi de
enzime care cataiizeaz! reacjiile din c!ile metabolice particulare: enzimeie
implicate in biosinteza hormonilor tiroidieni se afl! numai in.tiroid!, cele care
particip! la biosinteza ureei se afl! numai in ficat, creatinkinaza se afl!
aproape in lotaUtato Tn rnuchi etc.
Un alt aspect privegte locul in care se afl! diverse enzime intr-o celul!
dat!; el coincide, evident, cu locul de desf!$urure a c!ii metabolice sau a unei
seevenje a c!ii metabolice din care face parte reaefia pe care o cataiizeaz!.
Astfel, glicoliza se desf!oar! numai in citoplasm!, cleci toate enzimeie
acestei c!i sunt in citoplasm!; biosinteza ureei (in hepatocite) se desf!oar!
partial in mitocondrii partial in citoplasm!, deci unele enzime ale acestei c!i
sunt: citoplasmatice, allele sunt mitocondriale. Enzimeie implicate in
biosinteza ARN-urilor sunt, localizate in nucleul celular care este sediul
sintezei, i enumerarea ar putea continua.
109
Unele enzime au localizare dubld: aspartat aminotransferaza (ASAT =
GOT) cat gi izocitratdehidrogenaza (ICDH) se afi& atat in citopiasmS cat gi In
mitocondri. ICDH citoplasmaticS are coenzima NADP+, cea din mitocondri are

NAD\ ICDH mitocondriald catalizeazS o reac[ie a ciclului acizilor tricarboxilici;


ICDH citopIasmaticS, in relafie cu cea mitocondriaifi, asigur# transferal
echivalenfilor de reducere prin membrana acestui organit. (vezi
Metabolismul energetic44).
Multe enzime sunt legate de membrana celulaili sau sunt chiar inclose in
aceastd membranS, cu localizare spre exterior sau spre citopiasmS. In cazul
mitocondriilor, enzimele pot fi legale de membrana extern#, de membrana
intern#, multe se ail# ia matrix (Tabelul IL3).
Tabeluf 11,3
Localizarea unor enzime In mitocondriiie celulelor hepatice
Monoaminooxidaza (MAO)
Acii-CoA sintetaza
Membrana externa
Fosfoiipaza A2
Nucleoziddifosfatkinaza
Spajiul Intre
Adeniiat Kinaza
membrane
Membrana interna NADH dehidrogenaza
Citocromi (b, c, c1f a, a3)
Succinat dehidrogenaza
Matrix
Citrat sintetaza
izocitratdehidrogenaza
(ICDH) Fumaraza
Giutamatdehidrogenaza
Enzimele de oxidare ale
aciziior grai
II. 11. ENZIMELE 1 P.ATOLOGIA
In plasm# se afl# un num#r foarte mare de enzime. Dependent de
existenja sau inexistenfa la acest nivel a substratelor corespunz#toare (in alji
termeni dup# cum enzimele catalizeaz# sau nu rea.c{ii in plasma.), ele se
impart in:
a) Enzime plasmatice funcjionale cum sunt: lipoproteinlipaza,
pseudocolinesteraza, lecitin-colesterol aciltransferaza (LCAT), cele implicate
in coagulare gi fibrinoliz# gi altele. In afecjiuni grave ale ficatului, acesta
este incapabil s# sintetizeze normal proteine, inclusiv enzime, astfel
activitSjiie lor scad in raport cu valorile normale.
b) Enzime plasmatice nefuncponale: teoretic, oricare enzim# celular#
trebuie s# fie prezentS gi in plasm#; numSrul celor identificate este intradev&r foarte mare. Prezenfa lor in plasm# se explic# prin destrucjia
celular# normal# dar gi prin permeabilizarea membranelor in cursul
efoiturilor fizice, scSderea resurselor pentru producerea de energie gi altele.
La persoanele s&n&toase nivelul acestor enzime este aproape constant, el
reprezentind o stare stafionar# intre rata elibenlrii din cel ale gi inactivare.
La cele mai multe dintre enzime acest nivel constant este foarte sc#zut; ele
au fost evidenfiate prin metode extrem de sensibile, posibile de efectuat cu
aparatur# costisitoare. Cateva zeci de
110
enzinie pot fi insS dozate in plasxiiS cu suficientS precizie utilized metode
relativ simple. Dintre acestea s-au seiecfionat un numar gi mai restrSns
pentru dozare in scop de diagnostic; sunt enzime a airor concentrate

(activitate) create foarte mult in cursul destrucpilor masive ale celulelor


producStoare gi proportional cu gravitatea leziunilor la nivelul {esuturilor din
care aceste enzime fac parte: inimS, ficat, mugchi scheletici gi allele. Un
element important pentru ca enzimeie plasmatice sii aib& valoare
diagnostics, dar gi de urmSrire a eficacitSfii tratamentu- lui, este timpul in
care activitatea lor devine semnificativ crescutS, respectiv scSzutS.
Se exemplifies cu enzimeie serice care se dozeazS in legSturS cu infarctul
de miocard gi afeejiunile hepatice. In primal caz se dozeazS creatinkinaza
(CK), glumatic-oxaloacetic- transaminaza (GOT) gi lactatdehidrogenaza
(LDH). La toate exists o cregfcere proporfio- nalS intre mSrimea zone!
infarctate gi cregterea activitSjii serice. Dozarea creatinkinazei este totugi
mai utilS pentru diagnostic deoarece chiar dupS 4-6 ore se remarcS o
cregtere a activMfii ei iar maximul este atins dupS 18 ore (la GOT gi LDH
peste 24 ore). Situajia este diametral opusS in ce privegte durata de revenire
a activitSfii acestor enzime serice la valorile bazale (normale), de aceea
evolufia bolii se urmSregte cel mai bine prin LDH.
Pentru diagnostics afeejiuniior hepatice se practice alSturi de alte
investigafii paradinice, dozarea uctiviktfii a peste zece enzime plasmatice
nefuncfionale. Unele reflects integritatea celularS, allele sunt in legSturS cu
diverse procese metaboiice, altele redau capacitatea de sintezS a proteinelor
gi aeizilor nucleici gi in sfargit capacitatea de excrefie. Este recomandatS
dozarea intr-o anumitS ordine (nivelele I, II, HI gi IV); in prima instan|S,
nivelul I, se recomandS dozarea GPT (glumatic-piruvic-transaminaza), G1DH,
(glutamatdehidrogenaza) gi 7GT (y-glutamiltranspeptidaza).
Deosebit de util pentru diagnostic ar fi sS existe pentru fiecare fesut 0
enzimS extrem de specifics in ser. Un caz este fosfataza acidS a cSrei
cregtere a activitdfii este in legSturS cu carcinomul de prostatS. Pentru
investigarea hepaticS ar fi utilS dozarea activitSfii sorbitoldehidrogenazei
(SDH) gi a ornitin-carbamil-lransferazei (OCT) care insS nil se practicS curent
din cauza unor dificultSji tehnice.
Dificultafi mari in investigarea paraclinicftprin intermediul activitSjii
enzimelor serice apar, in primul rand, din faptul cS cele mai multe enzime
plasmatice nefuncfionale a cSror activitate se poate determina, au
provenienjS multipIS: LDH gi GOT provin din inimS, mugchi gi ficat, CK din
inimS gi mugchii scheletici etc. O alts dificultate este legatS de inactivarea
rapidS in ,ser a unora dintre enzime,
Chiar gi in cazurile complicate, prin diverse strategii, medicul gi
laboratorul de biochimie pot obfine totugi rezultate foarte bune. Se
menJioneazS determinarea simultanS a mai multor enzime serice gi calculul
unor raporturi (de exemplu, raportul De Rittis intre GOT/GPT, care scade sub
1,3 in afeejiuni hepatice), dozarea activitSjii enzimelor pe fesuturi (recoitate
prin biopsie), mai rar practicatS. De mare valoare sunt determinSrile
activit&filor izoenzimelor utilizand in acest scop procedee de separare (pe
eoloanS, electroforetice) sau inhibarea cu anticorpi specifici a unora dintre
izoenzimele unei enzime date. Astfel predominanfa in ser a formelor LDHj gi
LD1L este un indiciu foarte bun pentru infarct de miocard, in timp ce
predominant formei LDH5 indicS afeefiuni hepatice. In cazul CK, cregterea in
ser nu numai a activitSfii totaie ci gi a activitSfii izoenzimei de tip MB este
indiciu sigur de infarct de miocard (foima MB fiind de provenienfS aproape

strict miocardicS).
Activitatea multor enzime plasmatice nefunefionale se determinS in
relafie cu bolile de metabolism (glucidic, Iipidic gi proteic). Cele mai
importante dintre acestea sunt prezentate in capitolele respective.
Ill
II12. CLA5IFICAREA SI DENUMIREA ENZIMELOR
Primelor enzime descoperile li s-au atribuit diverse denumiri; in cele mai
muile cazuri numele enzimei s-a formal din numele substralului prin
adilugarea sufixului -azfc ureazii pentru enzirna ee catalizeazd hidroliza ureei
la C02 i NH3, arginazS pentru eazima care catalizeazS hidroliza argininei la
orn.ii.iri3 uree etc. Alter enzime li s-au atribuit denumiri partieulare bird
legaiuni cu reaejia caializala: pepsin! tripsinft, chimotripsinS.
Cand irumarul enzimelor cunoscute a devenit foarte mare i s-au
acumulat date despre structure coenzime, mecanism de aojiime etc., s-a
impus atat introducerea unei clasificari rationale cat i a unor denumiri
bazate pe crilerii chimice care s3 evite confuziilc. Acestea au fost elaborate,
in arm! 1961, de o comisie de enzirn.oi.ogie a Uniunii Intemafionale de
Bioehimie i Biologie Molecular!! (IUBMB) Hind in vigoare i in prezent.
In sistemul de clasificare adoptat fiecare enzimfi este incadraUl intr-o
subclass i, eventual sub-subclas<1 care apartine unei clase, Clasele,
subclasele, sub-subclaseie \ cnzimele individuale se noteazS prin ci'fre
despite de punct.e. Sunt ase clase de enzime avand in ordine numerele i
cat.ali.zand reacfiile:
1. Oxidoreduciaze, catalizeaza reaej-ii de oxido-reducere;
2. Transferaze, catalizeazd transferuri de grupe ce conjin carbon, azot sau
fosfor;
3. Hidrolaze, catalizeazd scindari d.e legaturi covalente cu participarea
apei;
4. Liaze, cataiizeazd ruperi ale legfiturilor OC, C-S i ON;
5. Izomeraze, catalizeazh toate tipurile de izomerizari, inclusiv
racemizftri;
6. Ligaze, catalizeazd formarea de legaturi in be carbon i O, S, N, cupiate
cu hidroliza legdturilor macroerg ice.
Subclasele i sub-subclasele sunt stahilite dup3 tipul grupfuii sau leg&turii
care se modified In cursul reaejiei, dup3 natura coenzimei i alte particularity.
Sistemul acesta de clasificare este deschis, orice enzimft nou descoperiia
putand fi introdusd intr-o clasa, subclass i sub-subclasfn
Comisia a hotfufU c3 se pot utiliza doud modality de denumire pentru
enzime:
a) Numele recomandal: se p3streaz3 (sau se atribuie) denumiri cu
sufixul -az& (glucozidaza, zaharaza, ureaza) sau se d& denumirea dupS
aejiunea specified (lactatdehi- drogenazd, adenilateiclazd); pentru unele
enzime se utilizeazd denumirile specifice (tripsina, pepsina).
b) Numele sislematie: acesta este corelat cu numele ciasei, subclasei i
sub-subclasei; el cuprinde denumirea substratului (substratelor), tipul
reaejiei catalizate, coenzima, eventual alte caracteristici. Astfel fiecare
enzimd are on cod specific. Utilizarea numeiui sistematic este obligatorie
doar in situafiile care reclama evilarea oriedrei ambiguity (lipdrituri, congrese
etc.). Curent se utilizeazd denumirile recoman date.

112
Clasificarea i denumirile sistematice ale enzimelor sunt redate in Tabelul
II.4.
i
Tahelu! 11.4.
Fragment din tableau! vast al clasific&rii enzimelor i a denumirii
sistematice a acestora
1.
Oxsdoreductaze
1.1.
Care acjioneaza asupra gruparii CH OH
1.1.1.
Cu coenzirna NAD+ sau NADP+
1.1.1.1.
Alcooi: NAD+-oxidoreductaz
1.1.1,27. L-lactat: NAD-oxidoreduetaza
1.2.
Care acjioneaza asupra gruparii C = O 1.2.1'. Cu coenzirna NADr
i NADP+
1.2.1.12. D-gliceraidehid-3-fosfat: NAD-oxidoreductaza
1.2.3. Cu 02 ca acceptor
1.2.3.2.
Xantina: oxigen-oxidoreductaza
1.3.
Care acjioneaza asupra iegaturii CH CH
1.3.2.
Cu citocrom ca acceptor
1.4.
Care acjioneaza asupra leg aturii CH NH
2.
Transferaz
2.1. Care transfer^ fragment de un carbon
2,1.1.
MetH transferaze
2.1.1.10. S-adenoziimetionina; L-homocistein S-metiitransferaza
3.
Hidrolaze
3.1.
Care scindeaza iegaturi esterice
3.1.1.
Carboxiesterhidroiaze
3.1.1.3. Giiceroi-ester hidrolaza
4.
Uaze
4.1.
Uaze C C
5.
Izomeraze
5.1.
Racemaze t epimeraze S. Ligaze
6.1.
Care asigura formarea legaturllor C O
113
Cap. Ill VI.TAMINE 1 COEMZIME.
III.
1. GENERALITAJI
Vitaminele sunt o categoric de substanfe strict necesare animalelor
superioare i care nu pot fi sintetizate in organismul lor, De aeeea,
vitaminele trebuie s& fie procurate de rafia alimentary,
in organismele superioare vitaminele nu reprezintS materiale structural,
de felul principiilor mediate (proteine, glucide, lipide) i nu au valoare
energetic^ dar implinesc roluri func{ionale importante. Intr-adev3r,
rnajoritatea vitarninelor - sau derivafi ai lor imediafl - sunt constituent
coenzimatici, participand la multiple i vaiiate reacjii metabolice. Pentru
acest motiv, in capitolul de fafit se vor descrie 1 iiustra asemenea
intervenjii.
Dei pentru implinirea tuturor rolurilor funcjionale ale vitarninelor
organism ul omului are nevoie de cantit&fi foarte raid ( cateva miligrame sau

chiar micrograme pe zi), rajia alimentary trebuie s le procure regulat. Altfel,


ajung s se declaneze anumite stdri patologice specifice, numite
avitaminoze.
Este de remarcat cS exists i vitamine distincte din punct de vedere chimic
- dar * inrudite structural - care implinesc aceleaji funcfii i a cMror carenfS
determine aceeagi avitaminozS. Aces tea se numesc vitamer e. Spre
exemplu, diverse vitamine E (tocoferoli) sunt caracterizate, una in raport cu
alta, drept vitamere; astfel Incat in loc de vitaminele E se poate spune \
vitamerele E.
In studiul vitarninelor se intalnegte uneori i terme/ml de antivitamind
(sau anti vita- mine). Antivitaminele sunt substance cu acjiune antagonists
vitarninelor i care produc efectele avitaminozelor respective. In principiu,
fiecare vitamina poate avea una sau mai iruilte antivitamine.
HL2, CLASIFICAREA VITAMINELOR
Vitaminele au structuri chimice foarte variate. Din aceasiy cauzl, ele nu sau clasificat conform structurii ci s-a fixat diept criteriu de clasificare o
insuire fizic& i anume, solubilitatea.
Din punct de vedere al solubilitajii, vitaminele s-au grupat in doud
categorii: vitamine hidrosolubile (cele cu molecule polare, solubile in ap3)'i
vitamine liposolubile (CQle cu molecule apolare, solubile in gr3simi). Prima
categorie cuprinde vitaminele din complexul B (vitamina B1( vitamina B2,
vitamina B6, vitamina PP, vitamina B12, acidul folic, biotina, acidul pantotenic)
i vitamina C. A doua categorie, cea a vitarninelor liposolubile, cuprinde:
vitamina A, vitamina D, vitamina E i vitamina K.
114
IIL3. VITAMINELE HIDROSOLUBILE 1 ROLURILE LOR COENZIMATICE
III.
3.1. COMPLEXUL B
CompIexul B este un grup de cel pujin 8 vitamine hidrosolubile
(menjionate la ctasificare) si care se gftsesc impreund in natunl, fiind Intr-o
stransii inter-relajie funcfionalft.
Toate vitaminele din complexul B sunt cofactori in diverse reacpi
enzimatice; in special, ele joaeti rol de coenzime in cele mai importante
reacjii metaboliee. Acest rol este ilustrat - penlxu fie care vitamin^ - In cele
ce urmeazS.
Vitamina Bj, sau tiamina, cuprinde in molecula sa cloufi nuclee
heterociclice (pirimidinic i tiazolic). Ambele nuclee stmt substitute in
amimile pozifii i sunt unite printr-o punte metilenied:
In organism - la nivelul ficatului, rinichiului i inimii molecula vitaminei Bl
este
penlru a da nagtere la coenzime i enzime active, participante la
metaboiismul glucidelor. Inlr-adev&r, in celulele diverselor organe i jesuturi
tiamina se aM sub formd de ester pirofosforic, tiaminpirofosfat (TPP). El
rezuM din reaefia tiaminei cu ATP:
Aceaslii reaejie este catalizati de enzima tiarriin difosfotransferazS, aflatd
- In special - In creer i ficat.
TiaminpirofosfatuI este coenzimd In reaejii enzimatice de transfer ale unei
unitiifi de aldehidS activti. Asemenea transferuri au loc In reaejii de
decarboxilare oxidativd a a- ceto-acizilor (piruvat, a-cetoglutarat) si In reaejii
de transcetolare. Ambele tipuri de reaejii sunt intalnite in metaboiismul

glucidic. In aceste reaejii de transfer rolui propriuzis al coenzimei TPP este de


a servi la eliberarea din anumite molecule a unMjilor
Vitamina B* (tiamina) si coenzima tiaminpirofosfat.

Fig. 111.1. - Vitamina Bt (tiamina)


combinata cu resturi de acid fosforic i proteine specifice (in prezenja ionilor
Mnz+)
Tiamina + ATP
TPP + AMP
H3C

NH2

CHf"CHrQ~-P~Q~P-OH
OH OH
Fig. 111.2. - TiaminpirofosfatuI (TPP)
115
aklehidi.ce care urmeazfi s& fie transferate pe alte molecule. Se ilustreazS
aid mtervenfia. tiaminpirofosfatului in decarboxilarea acidului piruvic i
formarea de acetaldehid&(' in vitro).
DatoritS pozifiei sale in ciclul tiazolic din tiaminpirofosfat Cf este reactiv;
in unna ionizMi H legal de el devine H+ iar C2 carbanion. Acest carbanion
exercitd on atac nucieofil asupra C2 din molecula acidului piruvic. Ca urmare,
rezuM un compos de aditie al acidului piruvic la tiaminpirofosfat i care se
decarboxileazS, formandu-se hidroxietil tiaminpirofosfat. Ulterior, acesta
elibereaz& molecula de acetaldehidS (rezultatS din hidroxietilul format prin
decarboxilarea acidului piruvic) i regenereazS tiaminpirofosfatul.
+

CH-r CCOOH J 1! o
* H3C HOOC-C OH

4*

OH
CHCH=O

Fig. Hi.3. - Mecanismul decarboxiiarii acidului piruvic (in vitro)


In organism, aeeastS reacp-e - cheie de decarboxilare a acidului piruvic
este catalizatS de un complex multienzimatic, al piruvat dehidrogenazei, In
care - pe langS. tiaminpirofosfat - particip& incfi patru coenzime: acidul
lipoic, acetil-CoA, NAD+ i FAD. La studiul metabolismului glucidic se prezinta
mecanismiil intregii reacfii complexe, ilustrandu-se in totalitate transferal
acetaldehidei rezultate din decarboxilarea acidului piruvic.
Decarboxilarea oxidativft a a-cetoglutaratului, precum i a derivator a cetocarboxi- lici proveniji din aminoacizi cu catena ramificatft, se realizeazft
printr-un mecanism absolut similar celui de decarboxilare a acidului piruvic;
deci tot cu participarea tiaminpirofosfatului.
Jinand seama de rolul coenzimei tiaminpirofosfat in metabolismul glucidic,
se infelege dS in carenfa vitaminei B} este stanjenit - sau chiar intrempt acest proces alat de important din punct de vedere energetic. Acidul piruvic
(piruvatul) ajunge astfel sS se acumuleze - ca a tare - in organism, ceea ce
atrage o serie de manifest&ri patologice resimfite, in special, la nivelui
sistemului nervos.
Este' de remarcai; c& in deficienja de tiaminS, pe 12ng& acidul piruvic
ajung s& se acumuleze in organism i alte substanfe (a-cetoacizi sau
pentoze) care in mod normal participS la reacfii de decarboxilare sau
transcetolare prin intervenfia coenzimei tiaminpirofosfat. Concentrarea
acestor substanfe in cantitfifi mai mari decat cele normale antreneazS - de
asemenea - diverse tulbur&i metabolice.
116
Vitam ina B2 (riboflavina) i coenzimele flavin Ice
Vitamina B2 sc mai numete riboflavina, datoritft structurii sale cle Having
(pigment galben) cu radical ribil.il, provenit din ribitol (polialcoolul
corespunzStor ribozei). Acest radical este'subsliluil In pozijia 9 a
heterociclului izoaloxazinic din molecula riboflavinei. In pozijiile 6 1 7 ale
aceluia heterociclu sunt substituiji radical! metil:
OH OH OH I 1 i
CM-CH- CH CH-CFL-OH i
H3C

H3C
I!
o
Fig. Hi,4. - Vitamina B2 (riboflavina)
In organism riboflavina formeazii cu ATP-uI douft flavinnucleolide numite:
ttavinmo- nonucleotid (FMN) i flavinadenindinucieotid (FAD). Strucfurile lor
chimice sunt umultoarele:

OH OH OH 1 i i
C CH- CH- CH CHr O - POJH2 l

Fig) Hi.5. - Fiavinmononucieotidul (FMN)

Fig. 111.6. - Fiavinadenindinucieotidul (FAD)


117
Ambele flavinnucleodde (FMN i FAD) sent coenzime care fac parte din
sisteme enzimatice implicate in diverse procese de oxidoreducere din
organism. DatorifS stmcturii coenzimelor respective, aceste enzime se mai
numesc flavoenzime sau flavoproteine. In structura lor se remarcd o legSturS
strSnsa, dar necovalentil, iiitre coenzimS i partea protdcte. De asemenea,
majoritatea flavoproteinelor conjin metale (Mo, Fe) cu rol de cofactori
adifionall De^aceea, enzimele corespunzSloare sunt cunoscute 1 sub
numeie de metaloflavoproteine.
In reacjiile de oxidoreducere catalizate de flavoproteinele active,
participantele directe la procesele redox sunt tocmai coenzimele
constituente, FMN sau FAD, Intr-adevSr, ciclul lor izoaloxazinic poate suferi
reducer! reversibile prin fixarea temporary la atom!! de azot din pozijiile 1 i
10 a doi atomi de hidrogen preluap. de la substratele (SH2) cu care intrS. in
reacfie i care se oxideazS (Sox).
tLC
SM2 *

R
s
H
n
O
FMN sau FAD

Fig. ill.7. - Reducerea nucieului Izoaloxazinic in flavin-nucleotide


In acest mod FMN' sau FAD tree din formele lor oxidate in fcrmele reduse,
FMNH2 sau FABH2
Ca in- orice reaefie de oxidoreduejie (dehidrogenare - hidrogenare) i in
reaefia anterioarii participS dou3 sisteme redox: SK2/Sox i FMN/FMNH2. DupS.

cum se tie, fiecare sistem redox se caracterizeazS printr-un potential


electric standard. Valorile acestor potentate pentru sistemele FMN/FMNH2 i
FAD/FADH2 servesc la precizarea ioculoi lor de intervenpe in girul
transportorilor de hidrogen 1 electron!.
In studiul metabolismelor se vor intalni numeroase reaefii de
oxidoreducere (dehidrogenare - hidrogenare) catalizate de enzime care admit
drept coenzime FMN sau FAD, Printre aceste oxidoreductaze foarte eficiente
sunt: a aminoacid - oxidam participants la procesul de dezaminare a.
aminoacizilor, aldehid dehidrogenaza care catalizeaz& degradarea
aldehidelor, xantin oxidam implicate In degradarea purinelor, succinat
dehidrogenaza din ciclul acidului citric, flavoproteina transportoare de
electrons, participants la oxidarea acizilor grai, dihidrolipott dehidrogenaza
implicate in decarboxilarea oxidativS a piruvatului i a cetoglutaratului. Se
injelege, in aceste condijii, cat de important este in organism rolul metabolic
a! coenzimelor flavinice i implicit, al vitaminei B2 constituente,
Vitamina PP (niacina) i coenzimele nicotinamidice
Vitamina PP este vitamina antipelagroas& (pellagra preventiv factor).
Numeie de niacinSt corespunde constitujiei sale chimice. Intr-adev&r, din
punct de vedere chimic, vitamina PP este niacina sau acidul nicotinic (vezi
formula). Aceeai acfiune vitaminicS antipelagroas& o are i amida acidului
nicotinic, nicotinamida sau niacinamda (Fig. III.8). Prin urmare, ambele
substance (niacina i nicotinamida) sunt vitamerele vitaminei PP.
118
Fig, HL8. - Nlacina i niacinamlda

COOH

CONH2
^AT

Acid nicotinic (niacina)


'"AT
Nicotinamida
(niacinamida)
Principalul roi metabolic a.l vitaminei PP reiese din faptul cS ea in lift in
siruclura a doua coenzime nicolinctmldice care pailicipFt la procese de
.oxidoreducere. Aceste coenzime sunt: nicotinamidadenin dinucleotid (NAD)
i racotinamidadenin dinucleoridfosiat (NADP):
Ca $i coenzimele Havinice, coenzimele nicotinamidice fac parte din
constitujia onor enzime implicate in reaefii redox de hidrogenaredehidrogenare. Aceastft capacitate a nucleotidelor pridinice se datoreazS
insfti nucleului piridinic pe care-I conjin i la nivelul caruia are loc fixarea
hidrogenului de la substrat (Fig. III. 11).
i in cazul eoenzimelor nicotinamidice sistemele lor redox participante la
reacjiile de hidrogenare - dehidrogenare, NAD7NADH+H*
1NADP+/NADPH+H+, se caracterizeazS prin potenjiale electrice standard, cu
valori bine determinate, care servesc la precizarea locului ocupat de ele in
lanpil respirator.

Spre deosebire de coenzimele flavinice, la conezimele nicotinamidice


legSturile lor cu componentele proteice din enzimele respective sunt foarte
slabe. De aceea, aceste

OH OH
Fig. iil.9. - Nicotinamidadenin dinucleotid (NAD+)

NH2
OH OPQ3H2
Fig. iii.10. - Nicotinamidadenin dinucieotidfosfat (NADP+)
119

Fig. - Reducerea nucieului piridinic Tn coenzimele nicotinamidic


coenzime pot trece uor pe mai multe proteine enzirnati.ee (apoenzime),
Este de remarcat cS unele enzirne devin active numai eand funcponeazU cu
coenzima NAD+, altele numai cu coenzima NADP\ iar altele admit drept
coenzima atat NAD* cat i NADP+. In ge-nere, dehidrogenazele care admit
drept coenzima NAD+ calalizeazil reac|ii de oxidoreducere din cataboiismul
oxidativ; spre exe-mplu, unele reactii din ciclul acidului citric. Pe de aM parte,
dehidrogenazele i reductazele pendente de NADP* participS. la reacfiile din
calea pentozofosfaplor gi la cele care au loc in procesul de biosintezS a
aciziior gragi, Prin tumare, ca i coenzimele fia.vinice, coenzimele
mcolinamidice - impreunS cu vitamina PP constituent# - sunt compugi cu rol
metabolic important.
Vitamina B6 (piridoxina) i coenzimele derivate
Numele de piridoxina corespunde constitufiei chimice a vitaminei B6
deoarece ea este un alcool cu nucleu piridinic. Acest nucleu este subslituit in
patru pozi|ii astfel*. in 2 cu mctil, in 3 cu Mdroxil, iar in 4 i 5 cu cate un grup
hidroximetil (Fig. III.12.), Piridoxina - aflat# in prod use vegetale sau animate
- este insojit# de dou5 vitamere inrudite structural; piridoxalul si
piridoxamina, respectiv aldehida i amina (in pozifia 4) corespunzand
piridoxinei:

CHO

CHrOH

Fig. III.12. - Structuriie chimice ale celor trei conpui piridinici cu activitate de
vitamina B6
In citoplasm# aceste trei vitamere devin substrate fa|# de enzima
piridoxal kinaz# care catalizeazS reaefii de fosforilare cu ATP-uI pentru
fiecare. Ca urmare, ele tree in esterii fosforici corespunz#tori (la grupul de
alcool primar din pozijia 5). Dintre acegti esteri, piridoxalfosfatul i
piridoxaminfosfatul sunt coenzime participante la diverse reaejii metabolice;
in special, la transaminarea, decafboxilaiea i trans-sulfurarea a aminoacizilor.
In procesul transaminftrii, piridoxalfosfatul i piridoxaminfosfatul intervin
pentru transformarea - dup# caz - a unui aminoacid in cetoacid i invers:
120

R~CH~~COQH + Rs~C~~CQOM
i
Si
Nf%~
a.
Aminotransferaza (transaminaza)

RO
-OOH+ R-CH-COOH s
NH2
Fig. 1IL14. - Reac|ia general a de transaminare
Mecanismul (de ping-pong) reacfiei de transaminare poate fi urmSrit uor
dac& se iau in considerate notafiiie:
E CHO = aminotransferaza cu coenzimS piridoxalfosfat E CH2NH2 =
aminotransferaza cu coenzimS piridoxaminfosfat gi dacd. se {ine seam a de
int:erven|ia succesivd a celor doud coenzime in reacfii reversibile:
HoQ

R1~CH-NH2 * QHC-E
RiCHN = CHE
$-=-=-*
I
f
COOH
COOH
' Baza SchiffI
R/ CN.CH2-E
R-I-C-COOH + E~CH2~NH2
COOH
O
Baza Schifl
R2-C-COOH + E~CH2~NH2
R2~e~cooH
o
N-CH2~E
Baza SchiffHi
+ HoO '
R^CH-COQH^d** Rp-CH-COOH * E -CHO II
N-CHE
NH2
Baza SchifV
Fig. ill.15. - Mecanismul transaminarii
i
-H
;;=s.
121
In reacplle de decarboxilare a aminoacizilor, piridoxalfosfatul joac& rol de
coenzimft tot prin formare de baze Schiff intermediare.
Coenzima piridoxalfosfat paiticipg. gi ia procesul de trans-sulfurare; spre
exemplu, la reacjia metioninei (sub found de S-adenozil melionind) cu serina
din care rezultd ci stein a (vezi metabolismul acestor aminoacizi).
In sfargit, piridoxalfosfatul participd la mecanismul de acjiune al
fosforUazei implicate in scindarea glicogenului (vezi g!icogenoliza).
Acidul pantotenic gi coenzima A
Acidul pantotenic poartd acest nume (in grecegte, pan = tot, peste tot)
pentru' cd este foarte mult r&spandit in fesuturile vegetale gi animale.
Din punct de vedere structural, acidul pantotenic este produsul
condensarii acidului 2,4 - dihidroxi - 3,35 - dimetil ~ buliric (numit gi acid
pantoic) cu P - alanina:
CHj
HQ-CH3~C- CH - CO- NH- CHr CHr COON 2 \ \ .22
CH3 OH

Acid pantoic
* ft - alanina
Fig. ill.16. - Acidul pantotenic
In majoritatea organelor acidul pantotenic este fosforilat pe seama ATPului, sub acpunea unei kinaze specifice. Produsul rezultat este anirenat
ulterior intr-o serie de alte patru reacpi enzimatice, succesive, eonducand la
formarea coenzimei A:

CH7 \ 3 CH2
i2
NH
-CO
Coenzima A participd la numeroase procese biochimice fundamentale,
atat de biosintezd (spre exemplu, biosinteza acizilor gragi, a colesterolului),
cat i de degradare (in special la degradarea oxidativd a catenelor
hidrocarbonate din divergi cataboliji). Posibilitatea coenzimei A de a participa
la reacjii numeroase gi variate se datoreazd faptului cd gruparea SH din
molecula sapoate forma legdturi tiolesterice, macroergice. Spre exemplu,
activarea acizilor gragi (premergdtoare degraddrii oxidative sau biosintezei
lor) are loc conform reacfiei:
R COOH + CoA SH + ATP ^ R CO - SCoA + AMP +PP;
122
Se observe cH in reacfie s-a prescurtat slructura coenzimei A libere sub
forma' CoA - - SH pentru a se pune in evident grupul reactiv, respectiv - SH.
Acesta este modal obignuit de a se nota forma liberS a coenzimei A. De
asemenea, din reacfie se observe leg&tura macroergM, C ~ S (aflatft in
fiolesterul acidului gras) s-a format prin desfacerea and legSturi macroergice
din ATP (scindat in AMP i PPj).
Un compus macroergic important in const!tujia caruia intr3 coenzima A
este acetil CoA, CH3 CO ~ SCoA, intalnit mult in studiul metabolismelor;
mai ales, In cadrul mefaboiismului glucidic gi lipidic.
Biotina i rolul ei coenzimatic
Biotin a este vitamin!! pentru om i animalele super ioare iar pentru
drojdii, ciuperci i
bacterii este factor de cre'gtere.
In constitujia moleculei de biotinS intr& cidul hidrogenat al imidazolului
condensat cu ciclul hidrogenat al tiofenului. La acesta din urm&, in pozifia a
fa{3 de atomul de suif, se aflS atagat (prin sobstituire) radicalul acidului
valerianic:
O
'CN
HN
NH
HCCH
H2C
CH- {CH2)4 - COOH
Fig. Hi.18 - Biotina
S
In organism biotina unplinegte roluri importante, pariicipand in mod

constant la metabolismul lipidelor - formarea gi degradarea oxidative a


acizilor gragi - precum gi la metabolismul glucidelor carboxikrea acidalui
pimvic pentru formarea acidului oxalacetic (pnszent in ciclul acidului citric).
De asemenea, biotina intwine gi m alte reacfii importante care necesit&
fixarea dioxidului de carbon pe unii metabolifi. In toate aceste reacfii biotina
funcfioneazSt cu rol de coen.zi.md.
In calitatea sa de coenzima a carboxilazelor, biotina ia parte la reacfii de
carboxilare care aparfin unor cSi metabolice bine precizate:
Tabelul III. I
Enzime care func$ioneaz3 cu coenzima biotina
Enzima
Rolul metabolic
Piruvat carboxilaza
Prima reacfie pe calea care
conduce la transformarea
precursorilor - rezultaji din unitaji
cu 3 atomi de carbon - in glucoza
(gluconeogeneza).
Procura oxalacetat pentru ciclul
acidului citric.
Procura unitaji cu doi atomi. de
Acetil. - CoA carbon - de acetat - in sinteza
carboxilaza
acizilor gragi pentru formare de
malonil - CoA.
Transforma propionatul in
Propionil - CoA succinat care rntra apoi in ciclul
carboxilaza
acidului. citric
P - Metil - crotonil - CoA Intervine in catabolismul leucinei
- carboxilaza
gi al unor compugi isoprenoidici
123Se ilustreazii aici rolul coenzimatic al biotinei In carboxilarea acidului
piruvic. Reaefia general^ este:
CH3 CO COOH + CCX, - -HOOC CH2 CO COOH
acid piruvic
acid oxalacetic
Trebtiie subli.ni.al faptul eft la ieacfie dioxidul de carbon participft numai sub
formft activatft, adicft unit cu biotina. In aceastii etapft a reacfiei iau parte:
HC03\ ATP, Mg2+ \ acetil - CoA. (cu ro! de efector alosteric). Ulterior, grupul
carboxil activat. este transferal: la acidul piruvic.
R
i
?
C OH
[
NHx
COOH CH _ CH _
yCH CM

S|
CO + CO
> CO

+s
CO
''CH,
N/,
1 ''CH, CH
NH/
CH
'coo- CH3
CH2
\
COOH
Carboxibi
otinAcid
Acid
Biotin

enzima

piruvic

R
I
XCH CH

oxalacet
ic

enzima
R
I
yCH CH m\

--s j CO * HCO3 +ATP


S | CO + AOP + Pj
/
'''CH. CH NH
'''CH, CH N y
cooCarboxibiotina
Fig. Hi.19. - Mecanismul carboxiiarii acidului piruvic
Vitamina Bu (cianocobaiamina) i rolul ei coenzimatic*
Vitamina Bi2 Implinegfe rol de vitamina anfipernleioasft. pentru om i este
factor de credere pentru mieroorganisme. Poarta indicele 12 fiind
considerate al 12-lea produs izoiaf din complcxul B. Nurnele de
cianocobalaminft este datorat constitujiei sale chimice deoarcce confine in
molecuift o grupare dan i un ion de cobalt (Fig. Ilf.20).
Exists i alte substanfe cu acfiune de vitamins B12 (vi tarn ere) care a.u
structuri asemnftnftfoare cianoeobalaminei. Ele se deosebesc de aeeasta
prin faptul eft in locul grupftrii CN cuprind. o uitit. grupare funcfionalft
electronegative (nitro, hidroxil), radjcalul melil sau chiai' un rest de
deoxiadenozinft.
In float, la omul sftnfttos, se gftscse obinuit trei coinpui cobalarninici;
metil-, hidroxi- deoxiadenozil - cobalamina. Aceti compui - sau vitamina Bn
ca^atare - iau parte, cu rol de coenzime, in procese metabolice esenjiale din
organism, in special, ele sunt coenzime pentru unele transmetilaze.i
anumite izomeraze (mutaze).
124

Fig. 111.20. Vitamina B12 (ciancobalamina)


R variaza dand diverse vitamere ale vitaminei B12 ;
R = CN Tn ciancobalamina, R = OH in hidroxicobalamina,

R = 5 deoxiadenozil Tn 5 deoxiadenozilcobalamina i R - CH3, Tn


metilcobafamina.
Se exemplified aici, Tn primal rand, participarea metflcobalaminei, in
calitate de coenzimft a unei (ransferaze, la reaefia de transformare a
homocisteinei Tn metionM. In al doilea rand, se pane in evident inecanismul
de intervene al rnutazelor i se ilusireazd participarea
deoxiadenozilcobalaminei - cu rol de eoenzirrul - in neaejia de transfoimare
a. L melil maloniJ CoA Tn succinil CoA:.
SH
CH3
1
s..1
CH2

CH2

CH2

CH2

HC NH2
COOH

HC
NH2
COOH

Me - H4 fotat
{-J
Homocistein
metiitransferaz
a
Homoci
steina
Me t/loobalamina
Fig. HI.21. - Rolui coenzimatic

\
a
A

Met
ion in
a
al metiicobalaminei

125
; ;
' ! . :j.|
ifdU.
Ai"Y
1 iv,
wv' ii I ;
-!

' : i . V ih -

ii
rL!::
CO
CO
\U\

1) Metilarea homocisteinei pentru transform area acesteia in metioninS


are loc in cifoplasmd utilizandu-se N5 metiltetrahidrofolatul (MeH4folat)
ca donor de metil. Enzima catalizani# este homocistein metiltransferaza
care admite drept coenzimd specified metilcobalamina.
In aceasld reacjie metilcobalamina igi insugegte temporar un grup metil
de la donorul MeI-I4folat i-l transfer# homocisteinei, gcnemndo-se astfel
metionina. Semnificafia metabolic# a acestei reacfii este dubla: se
economisegte metionina iar tetrahidrofolatul devine disponibil pentru a
putea participa la sinteza de purine, pirimidine gi acizi ouclcici.
2) Izomeijzarea catalizatd de mutaze are loc conform reacfiei:
A1 \f
If if
Fig. Ili.22. - Mecanismu! intervenjiei mutazeior
XH
HX
In cazul L metil malonil CoA izomerizarea la succinil CoA decurge
conform
reacfiei:
CH3
H2G- COON
HC-GOOH
HCH
1
1
C-SCoA
C-SCoA
II
II
0
Deoxiadeno- O
zi/cobafamina
L~
Metiimalonii - - - -,-------------^ Succinil
CoA - CoA
Mutaza
Fig. III.23. - Rolut coenzimatic a! deoxiadenozilcobaiaminei
fiind catalizalil de enzima L metilmalonil CoA mutaza care funcfioneazd
cu coenzima sa specified, deoxiadenozilcobalamina.
Este de remarcat cd deficienfa de vitamin# Bu se poate resimfi pan# la
nivelul acestor reacfii. Astfel, in primul caz, homocistcina rdmane nemetilatd

i ajunge sd se elimine prin urind (homocistinurie) iar in al doilea'caz, pentru


acelag motiv, acidul L metil malonic se elimind tot prin urind (acidurie
metilmalonicd).
Existd gi patru lulburdri metabolice ereditaie caracterizate prin
incapacitatea organismuiui de a folosi vitamina B{2 cu rol de coenzimdin
reacfii de felul celor ilustrate mai inainte. In dou# din aceste maladii
ereditare este afectatd numai formarea (sinteza) deoxiadenozilcobaiaminei
iar in celelalte dou# s-a pus in evidenfd incapacitatea de constituire fie a
deoxiadenozilcobaiaminei, fie a metilcobalaminef
Acidul folic i coenzimele derivate
Numele de acid folic este generic; el corespunde mai multor vitamere ale
sale. Ca gi aite vitamine din complexul B, acidul folic este vitamin# pentru
organismele superioare gi factor de cregtere pentru microorganisme.
Denumirea acid folic se datoreazd faptului ca prima substanj# descoperitd
din acest grup de vitamine a fost izolatd din frunze (in latinegte folia) de
spanac gi s-a dovedit cd are caracter acid.
In structura -molecular# a acizilor folici se afid condensate trei sunstanfe:
un derivat trisubstituit al heterociclului numitpteridina, acidul p
aminobenzoic gi acidul glutamic:
126
OH

2 - amino - 4 hidroxi, 6 - me til -pteridina


acid p- amino - benzoic acid glutamic Fig. 111.24, - Acidul folic
(pteroilmonoglutamat)
Numele de ,pteroilmonoglutarna.t este in legSturd cu structura chirnicd
a acidului folic, deoarece compusul rezultat din condensarea 2 ^ amino
4 hidroxi 6 metil pteridinei cu acidul p anunobenzoic se numete
acid pteroic i acesta este condensat -la rSndul sdu - cu on singur rest de
acid glutamic. Se cunosc ins& al{i doi acizi folici: pteroiipentaglutamatul (cu
cinci resturi de acid glutamic) aflat in ficatul animalelor
pteroilheptaglutamatul (su apte resturi de acid glutamic) extras din plante.
In acegli acizi folici resturile de acid glutamic sunt condensate Intre ele ifttrun'mod special (neobiniiit). Intr-adevSr, la fiecare condensare ia parte
grupaxea carboxil din pozifia y a unui rest i gruparea amino a altui rest
(erm&forii!) de acid glutamic.
. Cel mai important rol pe cared implinegte in organism acidul folic este
acela de transporter a! unor entitdji cuprinzand cate un atom de carbon i
care sunt folosite in multiple biosinfeze. InsS, pentru a putea indeplini
aceastS. funepe, acidul folic este In prealabil hidrogenat in compusul H4
Mat, sub aepunea. folat reductazelor caie utilizeazft ca donor de

hidrogen NADPH-flT'. Reducerea are loc la nivelul dublelor legfiluii 5-6 i 7-8
din nucieui pteridinic al acidului folic propriu-zis (ptoroilmonoglutamat):

9
10
CHrNHCOOH:
/
-CO-NH-CH
(CH2)Z
}
COOH
Fig. ill.25. - Acidul tetrahidrofolic (FH4 sau THFA)
, In calitatea sa de coenzimil in procese enzimatice de transfer, acidul
tetrahidrofolic participd la trecerea grup&rilor cu un carbon: metil (CH 3),
metilen ( >012), formil (-r-CHO), formimino (CH = NIT), de la un metabolit
la altui. Spre exemplu, transferul grupului cu un carbon de pe serind pe
homocisteinii cu formate de rnetionind are loc conform reaepilor din fig.
IIL26.
127
CHrOH
CH--NH, + I
C-OOH
Senna
N
H
CHrNH~~
CH-NHS
COOH
/ CH, N
^rCHrNN
H
)
FH4
Glicina N5, N 1 ~ me Wen FH4
NSs N 10 metlien - FH4 + NADH * H N $ - metil - FH 4 + NAD*
N^, - metil - FH4 + homocisteina > FH 4 + metionina
Fig.!!!.26. - Particlparea acidului tetrahidrofoISc, cu rol coenzimatic, la
formarea metioninei
Dupd cam s-a arStat la vitamina Bri, ultima reacfie din Fig. 1IL26 tire loc cu
participarea coenzimatic^ a cobalaminei, pentru.lransferul grupului CH3
(Fig, XII.21).
N5, N10 metilen H4F, participant la reacfie are rol coenzimatic i in
cedarea unui OTP metil deoxiuridilatului pentru a-1 transforma in
deoxitimidilat
HN

x
o
2 '-Dezox iuridilat (dUMP)
xiz1
H _____
WA^CHJ
Stntaza
* \X4
N5tN10 -metilen-FH4
A
OH H
XX
\
H
Dih/drofolat
2'-Dezoxitimidilat
(dTMP)
Fig. III.27. Rolul coenzimatic al acidului tetrahidrofolic la formarea
deoxltimldilatuluj
Reacfia. aceasta prezintfl un interes deosebit cad deoxilimidilatul, astfel
format, este precursor implicat in sinteza ADN-ului.
Formiminoglutamalul, un catabolit al histidine!, transfer^, grupul sM imino
la li4
foiat i rezulta N5 formimino H4 folatuL
III,
3.2. VITAMINA C (ACIDUL ASCORBIC)
Vitamina C poart& i numele de acid ascorbic (a - fMrd, scorbic =
r&d&eina cuvantului scorbut) deoarece este 0 substanfii acida (acid organic)
i vindecS boala numild scorbut.
Structural rnoleculei de acid ascorbic este inruditd cu cea a hexozelor. De
fapt, el poate fi considerat drept y - iactona unui add hexuronic, numit acid L
- gulonic. In molecule mai sunt cuprinse i patru grupari - OH: doud alcoolice
(la C5 i C6) gi douS enolice (la C2 i C3). Atomul de carbon C5 are configurate
stSng8,'
128
Prin indepSrtarea atomilor'de hidrogen din cele douS grup&ri. enoiice se
ob{ine acidul dehidroascorbic. Ambeie forme (acid ascorbic, acid
dehidroascorbic) devin interconvertible prin bidrogenare - dehidrogenare i
sunt fiziologic active. Structurile ior chimice sunt prezentate In Fig. XH28.
O
O
1C--------1
I
2C-0H il o
3
OH
4
I
HC--------J
5
i

HO-CH
6
I
CH2~~OH
- 2H *2H
JS*.
c
c~o
l
c~a
HC-----I
HQCH
O
CH2-OH
Acid L - ascorbic
Add L - dehidroascorbic
Fig. Hi.28. - Acidul L-ascorbic i acidul L-dehidroascorbic
Ca atare sau sub forms oxidatd, vitamina C participd la reacfii multiple
pe'care le suferd In organism diverse eategorii de compugi important - din
pu.nct de vedere biochimic: aminoacizi, nucleotide, hormoni, vitamine,
coenzime, ioni metalici.
Majoritatea reacjiilor care au loc cu participarea acidului ascorbic (forma
redusd) sunt hidroxildri In care este implicat i oxigen molecular:
R H + Ac. ascorbic + 02 - -^ R OH + Ac. dehidroascorbic + HzO
Se cunosc Insd i hidroxildri care se fac pe seama acidului
dehidroascorbic. In aceste cazuri, odatd cu hidroxilarea altei substanje are
loc i reducerea fonnei oxidate a acidului ascorbic. Alte oil, reacjiile la care
participd acidul ascorbic (forma redusd) constau numai In reduced. In labelul
1112. se menjineazd cateva reac|ii metabolice in care intervine acidul
ascorbic (forma redusd sau oxidatd), precizandu-se tototdatd l tipul de
reacfie corespunzdton
Tabefui III.2
Unele reacjii metabolice la care partlcipi acidul ascorbic
________Reacfia metabolica
Tipul de reacfie chimica
z
1/2 Q2>O * *
Citocrom a(c) Fe3+ >
Citrocrom a(c) Fe2+
Methemoglobina >Hemogiobina Acid folic > acid tetrahidrofofic
*Frolina -> hidroxiprolina
* Lizina >hidroxiiizina Triptofan >5 - hidroxitriptofan
* Reacjii importante in biosinteza coiagenutui
Reducere
Reducere
Reducere i Cu participarea acidului ascorbic (forma redusd)
Reducere
Hidroxiiare
Oxidare cu participarea acidului dehidroascorbic
129
Pe langft reacfiile menjionate in tabelul precedent, acidul ascorbic
intervine i in diverse alte reacjii de oxidoreducere in care funcjioneaz#

cuplai cu glutationul sau coenzirnele nicotinamidice i flavinice. Un rol


important il are acidul ascorbic in degradarea oxidativ# a aminoaciduiui
tirozin# precum i in formarea (tot din tirozin#) a liormonului
medulosuprarenalian, adrenalina. In ambele procese vitamina C intervine ca
un cofactor activator al anumitor enzime (vezi catabolismul tirozinei i
biosinteza adrenalinei). De asemenea, acidul ascorbic este implicat in sinteza
acizilor biliari precum i In absorbjia ferului. In sfSrgit, funcfionand ca
antioxidant hidrosolubil, acidul ascorbic poate inhiba dezvoltarea
nitrozaminelor in cursul digestion
III. 4. VITAMINELE LIPOSGLUBILE
Spre deosebire de vitamineie hidrosolubile, ceie liposoiubile au molecule
apolarc, hidrofobe^ Din panel de vedere structural, toate vitamineie
liposoiubile sunt derivafi izoprenici. In organism, vitamineie liposoiubile,
provenite din alimentele ingerate, se comport# la fel cu gnlsimile rajiei i
utilizarea lor depinde - in mare m#sur# - de meta- holismul lipidelor. Astfel,
pentru a li absorbite din intestin vitamineie liposoiubile necesit# absorb}ia
normaia a grasimilor din hraml Dupa absorbjie, vitamineie liposoiubile sunt
transportateL- prin chilomicroni - la ficat gi apoi depozitate; in ficat;
vitamineie ISX (B^K^iar in jesutui adipos
Este de remarcat db spre deosebire de vitamineie hidrosolubile, ceie
liposoiubile sunt vehiculate prin sange de cdtre anumite lipoproteine (unite
cu ele).
In organism vitamineie liposoiubile implinesc funejii importante foarte
diferite. Astfel, vitamina A este necesar# - mai ales - in precesul vederii,
vitamina D este direct implicate in metabolismul calciului i fosforului,
vitamina E joac#rol de antioxidant iar vitamina K-este strict necesar# in
coagularea sangelui. Trebuie subliniat faptul c#, potrivit noilor concepfii
biochimice, actualmente vitamina D (colecalciferolul) mi se mai considers
vitamin# propriuzis# ci pro-hormon.
III.
4.1. VITAMINA A ( RETINOLUL)
Numele de vitamin;!-A este generic, valabil pentru mai multe vitamere ale
sale, avand activitatea biologic# a primului prod us izolat c#ruia i se mai
spune retinol. Acest nume se datoreaz# faptului c# este un alcool inrudit.
imediat cu retinalul care intr# in constitufia bastonagelor din retin# (vezi,
mai departs, rolul retinalului in menjinerea vederii). Actualmente exist#
tendin{a de introduces a termenului de retinoi.de pentru cuprinderea intr-un
singur grup atat a vitaminelor A naturale cSt gi a substanjelor sintetice,
analoge retinolului.
Din punct de vedere chimic, vitamina A este un derivat poliizoprenoidic
care confine gi nucleul ciclohexenului:
130
Fig. Hi.29. - Vita min a A (retinolul)
CH3 CH3 CM?

CH, OH
CH,
Vitamina A are mai multe provitamine. Aces tea sunt substanfe care se

transform^ - in organism - in vitamina. Provitaminele A sunt carotenii: a, (3 i


y. Ei sunt pigmenji tie euloare galbeny - roz, aflaji in anumite vegetal e care
fac parte din hrana obinuitH a omului. Carotenii sunt $i ei compui
poliizoprenoidici i cu nucleu ciciohexenic.

P - carotenul posed;! o marcante activitate antioxidants fajS de radicaiii


iiberi peroxidici. Deoarece activitatea sa antioxidants interfere adesea cu cea
a vitaminei E, potenj&ndu-se reciproc, se presupune c3 aceti compugi
liposolubili (provitamina A i vitamina E) ar putea avea, impreunS, ivo
eficientS acfiune anticanceroasS.
Activitatea biologies a vitaminei'A propmTz^^
in parte, i
de alte douS substance inrudite structural: retinalul i acidul retinoic (Fig.
III.31).
Retinalul (aldehidS) este un component al pigmentului vizual rodopsina
din bastonagele retinei. Intr-adevSr, rodopsina este constitute dintr-o
proteins simply, opsina i 11-cis- retinal (Fig. III.32.).
Senzajia vizuaie, mediate de bastonage, ia natere in urma ahsorhfiei
fotonilor.de luminS de cStre rodopsind. Insd absorhfia luminoasS determine
descompunerea rodopsinei in opsinft i retinal cu structure trans* All-trans
retinalul, general, de rodopsinS, trece din nou in 11-cis-retinal prin
izomerizare iar acesta din urm& reface rodopsina (Fig. III.32). Izomerizarea
catalizatfi de o enzime specific^, retinal izomeraza, este ins# incomplete. Se
injelege, in aceste condifii, c& pentru asigurarea desfyjurMi normale a
procesului descris este absolut necesar un aport constant i permanent in
rafia alimentary de all-tras-retinal; respectiv, de vilamiml A (all-trans-retinol).
Acidul retinoic participS la sinteza giicoproteinelor. De fapt, sub forme de
retinil fosfat, acidul retinoic are rolul de a transporta, prin dublul strat lipidic
celular, oligozaharidele care urmeazft s3 fie incorporate in glicoproteine. In
acest proces acidul retinoic sufer! i el izomerizare enzimatic5 cis-trans,
analogy celei intalnite in ciclul rodopsinei.
131'
i ; i
nW.
f I: v
CH<, CH* CM,

yOH
CH3
CH3

Retinol (vitamins A)
Acid retinoic
Fig. ill.31. - Trecerea p-carotenului in retinol i formarea derivator Tnrudiji
i!:
in: '
if.-.

Retinal
izomeraza
IT' ^

Opsins
Rodopsina

Fig. IIL32 - Ciclui rodopsinei


132
Unele date relativ recente susjih eg. retinoidele ar afecta i expresia genetidi.
implical.il alat in proliferarea cat: i in diferenjierea mai multor tipiiri de
celuie normaie^Tmaligne. De altfel, s-a constatat c3 administrarea de
retinoide scade totdeauna efectele unor compui caranogenici.
III.
4.2, VITAMINA D.
Ca i vitamina A, vitamina D are mai multe vitamere i mai multe
provitamine D. Dintre ele, cele mai importante - din punct de vedere al
acjiunii biologice i ai rolurilor metabolice pe care le Implinesc - sunt
vitaminele D2 i I)v Ele corespund respectiv, provitaminelor ergosterol i 7dehidrocolesteroL Tocmai pentru a se sublinia aceastS provenienja, vitaminei
D2 i se mai spune ergocalciferol iar vitamina D3 se mai numete colecalciferol
(Fig. HL33). Ambele vitamine au activitale antirahiticS (egalS). Deoarece
aceastfl. acjiune biologic# este caracteristicd vitaminei D (name generic) ei i
se mai spune vitamina antirahiticd. Totodate, asa cum s-a mai men|ionat,
vitamina D este considerate astSzi ca un prohormon de tip sterolic.
I'ntr*adev8r, prin hidroxilM suplimentare, ea de natere in organism
hormonului calcitriol care joacft roi important in metabolismu! calciului i fosforului (vezi capitolul ,JHormoni).
Din punct de vedere structural, provitaminele D sunt: steroli care diferS
intra ei prin catena lateraie fixate in pozifia 21 iar vitaminele
corespunz#toare pestreaze structura provitaminelor dar au nucleul B
deschis.

Ergosterol (plante)
Ergocalciferol (vitamina D2)

7 - dehldrocofesterol
Colecalciferol {vitamina D3)
(animaie)
Fig. til.33. - Structurile ergosterolului, 7-dehidrocolesterolului i ale
vitaminelor D2 i Da

rezultate prin fotoliza


Vitamin a D din alimenteie ingerate este supus#, ca 1 gr#simile, acjiunii
emuisifiante a bilei, apoi este absorb## prin regiunea proximal# a
intestinului subfile, De la acest nivel, transportul prin sange al vitaminei D
implicit unirea sa cu o polipeptid# (sintetizat# de ficat) i care are mobilitate
a - globulinic#. In acest fel, vitamina b2 (sau D3) ajunge in ficat. Tot la ficat
ajunge prin sange i vitamina D3 formats din 7 - dehidrocolesterol - in piele sub acfiunea radiafiilor ultraviolete din lumina solar#.
In ficat vitamina D3 safer# hidroxilare la pozifia 25 sub acfiunea unei
enzime specifice (vitamina D3-25-hidroxilaza). Produsul 25 - hidroxi colecalciferolul (25 - hidroxi - vitamina D3) reprezint# forma cea mai
abundent# de compuji din aceast# categoric de vitamine D, aflat# in
circulafia sangvin# i in depozitul hepatic. 0 fracfiune apreciabil# din ea
sufer# circuit enterohepatic ceea ce explica, deficienfa de. vitamin# D
resimfit# in tulbur#rile acestui proces. Ulterior, 25 - hidroxi - colecalciferolul
din sSnge safer# o noe# hidroxilare, la pozifia 1, sub acfiunea unei alte
enzime specifice, 25 - hidroxi - vitamina D3 - la - hidroxilaza, aflat# in tubulii
renali, oase i placent#. Sub acfiunea unei alte enzime specifice aflat# in
tubulii renali, cartilagii i placent# 25 - hidroxicolecalciferolul poate fi
hidroxilat i in pozifia 24. Nivelul acestui 24, 25 - dihidroxicolecalciferol in ser
se afl# in relafie reciproc# cu cel al 1,25 - dihidroxicolecalciferolului.
Concentrafiile lor in sange sunt egale cand concentrafia calciului seric este
normal#. De fapt, regiarea nivelului lor in sange se face direct de c#tre
hoimonul paratiroidian i indirect de concentrafia calciului seric.
Este de remarcat c# nivelul 1,25 - dihidroxicolecalciferolului depinde - in
mare m#sur# - i de concentrafia fosforului plasmatic.

Fig. 111.34. - Coiecalciferolu! i produii lui d hidroxilare formafi in


organism
134
III.4.3. VITAM1NA E
Vitamina E se mai nurnegte gi tocoferol. Acest nume este in legilturii cu
principals ei funcjie bioiogicl de a favoriza fertilitatea (in grecegte tokos =
nagtere gi pherein = a purta, a suporta).
Vitamina E ai*c 4 vitamere (tocoferoli) care se gdsesc in nature, sunt
semnificativi din panel de vedere dietar gi au constitujii chimice

asemnSnftoare (Fig, IIL35, Tabel.III.3.). Forma cea mai biologic - activ<1 este
a tocoferolul.
Tocoferolii au in moieculele lor, ca structure de bazfi, tocolul. La randul
situ, acesta conjine un nacieu cromanic substituit in pozijia 6 cu un hidroxil
iar in pozijia 2 cu un metil gi un radical saturat conjinand 16 atom! de
carbon, Din toco! derive, prin median in diverse pozijii (5,7 sau 8) , cei palru
tocoferoli naturali:

Fig, 111.35. - a-tocoferolu!


Constitujia chmiica a tocoferolilor natural!
Tabelul Ilf.3.
Tocoferol
a (alpha)

Pozijii substitute i nume


5,7,8 - Lrimetiltocol

p (beta)

5,8 - dimetiltocol.

y (gamma)
7,8 - dimetiltocol
A (delta)
8 - metil locol
Deoarece vitamina E este cuprinsil in Ijoidclc aiMeMeto^dupd ingerarea
acestora ea se ebbereaza gi se absorbe la nivelul intestinului sublire in cursul
digestiei iipidelor. Ulterior, vitamina E este transportatS de sSnge la ficat gi
alte organe. Se consider^ cl transportul vitaminei se face prin inglobare in
chilomicroni iardupS eliberarea din ei este preluaU1.de iipoproteine. Date
relativ recente tind s&arate eft fosfolipidele din mitocondrii, reticulul
endoplasmatic gi membranele plasmatice posedft afinitftji deosebite
(specifice) peniru a - tocoferol, ceea ce duce la concluzia cl vitamina E se
concenlreazft in aceste formapuni. De asemenea, dupft cum s-a mai
menjionat, depozilarea tocoferolilor se face in {esutul adipos.

135
in organismul urnan vitamina E joac& un rol important, funcfionanci ca
antioxidant , In aceasta calitate, ea protejeazd hematiiie fa0 de divergi toxici
oxidanji (radicali liberi- ai oxigenului), previne oxidarea unor hormoni
hipofizari 1 suprarenalieni precum oxidarea altor substanje ce sunt, utile ca
atare; spre exemplu, vitamina A i acizii gm$i esenjiali
Mecanismul interven{iei tocoferolilor in procesul antioxidativ se explied in
fclul urm&tor: tocoferolii pot intrerupe irul reac{iilor (inlSnJuite) ale
radicalilor liberi datoritS capacitajii lor de a transfera un hidrogen fenolic
propriu la un radical liber peroxi di.o.rr- un peroxid de acid gras polinesaturat:
Toe OH + ROD' -----------------------^ Toe 0 + ROOH
Ulterior, radicalul liber fenoxi format din tocoferol reaefioneazd cu un alt
peroxi! liber: Toe O 4- ROG' ROOH + produs de oxidare fara radical
liber Acest produs fM radical liber are struclura din Fig. III.36.

oc~o
\
CHrCH3
Fig, HI.36. - Produsul de oxidare ai a-tocoferoiufui
DupS conjugarea sa cu acidul glucuronic, produsul de oxidare a!
tocoferolului este excreta! prin bil& - intestin.
Acfiunea antioxidants a tocoferolilor este apreciabilS. i eficientS la
concentxatii ridicate ale oxigenului. DatoritS acestui fapt, tocoferolii au
tendinfa sS se concentreze in acele structuri lipidice care - in genere - sunt
expose h presiuni ridicate de oxigen; spre exemplu, in rnembrana eritrocitarS
i in mernbranele arborelui respirator.
Up alt fapt demn de semnalat In legdturd cu acfiunea. antioxidants, a
tocoferolului esie conlucrarea sa cu seleniul in acelag scop, intr-adevdr, in
calitate de component: ai sistemului glutation peroxidazei - seleniu
dependents, seleniul participS p el la prevenirea aejiunii distructive a
peroxizilor, alftturi de vitamina E.
Pe de aldi parte, aa cum sa specificat la vitamina A, tocoferolul poate fi
intovMit. in activitatea sa antioxidantd de p - caroten, cu acfitme sinergicS
de acela tip.
IH.4.4. VITAMINA K
Vitamina K poartS acest: indicator deoarece este necesarfl coagulSrii
(Koagulations Vitamin). Pentru acest motiv i se mai spune i vitamina
antihemoragicS. Intr~adevSr, earenfa vitaminei K determine predispozifii la
hemoragii datorate prelungirii timpului de coagulare a sangelui.
136
o
o

Menadione (vitamina K?) Menachinona (vitamina K2; n-6f 7, sau 9)


/ON

N
FIlochinona (vitamina KJ

CWa,
Menadio! ~ difosfatuf de sodiu
'Fig, Hf.37. - Struoturile vitaminefor K naturale i de sinteza
Ca i celelalle viiamine liposolubiie, vitamina K am mai muite vifamere cu
structuri chimice asemSnfltoare (Fig. 37). In primal r3nd, exists cioiul
viiamine K naturale important; vitamina K), izolatii din vegetale i vitamina
K2, izolatii din jesuturi animate i baeterii iniestinale (care au capacitafea de

a o sintetiza), De ascmvnoaJitiocoIuL constituent at membranelor lipidice din


bacilul Koch, are i el activitale de vitamM K. Alfsturi de acestea, exisUl mai
mulji produi de sintezS foiosiji in terapeuticil i care au conslitufxi chimice
asemftn&toare iar activity de vitamina K cel pujin egale cu cele ale produilor
nalurali. In aceasta categoric infrd menodiona i unii derivaji funcfionali ai sfii
(Fig.37).
In constitujia lor molecular#, vitaminele K naturale cuprind nucleul p naftochinonei substituit in pozijia 2 cu un radical rneUf iar in pozijia 3 cu un
radical poliizoprcnoidic. Produii de sintezd nu conjin in moleculele lor
radical! poliizoprenoidici.
Vitamina K din aiimenleie ingerate este absorbitS la nivelul jejunului i
acest proces depinde de absorhjia norm alii a lipidelor. Intr-adev3r, cea mai
frecvcnt& deficienfa de vitamin# K se daloreaziS malabsorbjiei grdsirmlor
care - la randul ei - este asocial# cu disfunejia pancreatic#, obstruct!! biliare,
atrofierea mucoasei iniestinale sau alter diverse cauzc de steatoree. Dup#
absorbjie, sub acf'iunea bilei, vitaminele K naturale - Impreunil cu lipidele tree pemale limfaticS In sange care le duce la float* Vitaminele K de sintez#
tree direct in torentul sangvin (fiind hidrosolubiJe). Ficatul este principalul
organ de depozilare temporal# a vitaminelor K naturale. VitamineleK de
sintezS nu-se acumuleazif in ficaf; excesul lor se elimin# prin urin#, sub
form# de glucurono-conjugaji.
Cea mai important# funejie a vitaminei K in organism este impiicarea ei in
proeesul coagularii. Dup# cum se tie, la form area fibrinei particip#
protrombina iar la biosinteza protrombinei intervine vitamina K. CercetSri
relativ recente au demonstrat cS aceast# vitamin# nu este implicate nurnai
in biosinteza protrombinei (faciorul II) dar i in cea a altor factori de
coagulare (VII, IX, X). Top aceti factori ai coaguhlrii sunt biosin tetiza{i
137
alter factor! de coagulare (VII, IX, X). Toji aceti factor! ai coagulSrii sunt
biosin tetizaji in ficat, sub forma unor precursori inactivi care devin biologic activi prin intervenes vitaminei K. De fapt, ulterior procesului de traducere a
mesajului ARNm In seevenfa aminoacizilor din proteinele specifice - care
constitute factorii de coagulare - intervine vitarnina K. Ea ajutS la modificarea
resturilor de acid glutamic in resturi de acid j - carboxiglutamic, Modificarea
constS intr-o carboxilare ce se face pe seam a dioxidului de carbon, in
microsomii ficalului, sub aejiunea cataliticS a carboxilazei - in prezenja
oxigenului - cu vitarnina K (forma hidrochinonicS) drept cofactor al enzimei.

Fig. IN. 38. - Carboxilarea resturilor de acid glutamic la resturi de acid ycarboxiglutamic, pentru constituirea factorilor de coagulare, prin intervenjia
vitaminei K
Resturile de acid y - carboxiglutamic (protrombina conjine 10 asemenea
resturi) pot chela ionul calciu:
Ca2+
O Om -Q O %/
cc

\/
CH
!
CH2
CCHNFig. ili.39. - Chelarea ionuiui de calciu de catre acidui f-carboxtgiutamic
Acest proces de fixate a calciului este esee|ial pentni rolul biologic al
factorilor de coagulare.
S-a constatat cS pe langS factorii de coagulare exists i alte proteine care
conjin resturi de acid y - carboxiglutamic, formate tot prin intervenjia
vitaminei K. Aceste proteine au fost identificate in diverse organe: piSmanL
spliriS, rinichi, placentS, case (osteocalcina).
138
CapJV. ACIZH NUCLEICI
IV. 1. INTRODUCERS
Acizii nucleici sunt, din punct de vedere chimic, produji de policondensare
a unor uni- tiifi denumite nucleotide.
Se cunosc dou& clase de acizi nucleici; acizi dezoxiribonucleici (ADN) i
acizi ribonucieici (ARN), Atat ADN cat i ARN sunt macromolecule
informaponale care permit stocarea, transmitereai i exprimarea informapei
genetice.
Molecula de ADN repezintd baza chimicd a eieditip, ea confinand
informajia genetic^ cu privire la biosinteza proteinelor. Conpmitul
informational al ADN, inserts in secvenja nucleotidelcr ce constituie
macromolecula, permite specificarea structurii fiecSiei proteine, determine
deci, prin definirea caracterelor morfofuncponale ale unui organism,
individualitatea acestuia.
Transmiterea informapei genetice de-a lungul generapilor, cu o fidelitate
ireprogabiM, este rezultatul capacMpi de autoreplicare a moleculei ADN in
virtutea cSreia molecula de ADN parental este copiatS astfel incat s&
formeze doud molecule - fiice avand o secvenp nucleotidic^, deci un conpnut
informational, identic^ cu ADN parental.
Exprimarea informatiei genetice cuprinsd in molecula de ADN in secven{e
specifice de aminoacizi, deci in proteine, se realizeaz& pe parcursul a doud
procese:
- transcrierea - constdnd in rescrierea unor pftrp din mesajul genetic sub
forma unui ARN denumit mesager. Acesta. preia din nucleu mesajul genetic
cu privire la biosinteza unei anumite proteine 1-1 aduce in citoplasmS, locul
de biosinteza a proteinelor;
- traducerea - in cursul c&reia mesajul genetic, care se afl& inseris intr-o
succesiune de triplete (grup de trei nucleotide) din ARNm este exprimat in
secvenjS de aminoacizi. Fiec&ruia dintre cei 20 de aminoacizi ii corespunde o
succesiune de trei nucleotide, desemnat# drept codon. Amplasarea
aminoacizilor intr-o secvenpi caracteristic^ unei proteine (codificatd de un
anumit fragment ADN i transcrisd intr-un anumit ARNm) este asiguratS de
molecule de ARN de transfer44, purlfttoare ale unor triplete complementare
cu divergi codoni din structura ARNm denumi{i anticodoni. Acest ARN de
transfer adapteazS un anumit aminoacid, cel pe care-1 transports, in faja
codonului de pe ARNm ce specified aminoacidul dat, gra{ie recunoagterii

codon-anticodon, in felul acesta, fiecare aminoacid !i gSsegte locul


consacrat in polipeptidul in curs de sintezi.
Fluxul de informape in lumea vie este exprimat prin dogma central& a
geneticii moleculare, care redS relapa celor trei procese fundamental
(replicare, transcriere, traducere) grape cSrora se asigura continuitatea
genetic^ a organismelor:
Descoperiri relativ recente completeazS substantial imaginea oferitd de
dogma central^44, pnandu-se seama de capacitatea de autoreplicare a unor
tipuri de ARN ca i de cea de transcriere a informapei din ARN in ADN.
Transcriere
Traducere
PROTEINE.
139
IV.2, STRUCTURA CHIMICA A ACIZILOR NUCLEIC!
Kidroliza add# a acizilor nucleici d# natere la baze azotate, pentoze iji
acid fosforic, Pentoza din structura acizilor ribonucleici s-a dovedit a fi Driboza, in limp ce aceea din structura ADN este D-dezoxiriboza. In structura
acizilor nucleici pentozele se g#sesc sub form# cidici P-furanozic#.
CHO
CHO
|
|
H
C OH |
H
C ' OH
|
H

HCH|
H _ c OH 1

H c OH
i
1
CH2OH
CH2OH
D-riboza
D-2-dezoxiriboza
IY.2.1. BAZELE AZOTATE DIN STRUCTURA ACIZILOR NUCLEICI.
Razele azotate care intr# in structura acizilor nucleici deriv# din dou#
structuri heterocidice: purina i pirimidina.
6*
C OH |
1

Piiimidlny
Razele purinice din structura acizilor nucleici sunt adenina (6amino~purina) i guanina (2-amino-6-hidroxipurina).
Ca baze pirimidinice s-au identificat 3 baze majore:
- uracilul (2,4-dihidimi-pirimidina);
- timina (2,4-dihidr6xi-5-metil-pirimidina);
- citozina (2-hidroxi-4-aminOpirimidina).
Razele purinice i pirimidinice prezint# fenomenul de tautomerie. Se
considers structuri tautomere doua structuri care difer# una cle cealalt# prin
pozijia unui atom de hidrogen i a unei dubie legSturi. Bazele azotate
prezinta tautomeric lactim-lactam datorit#
OH
O
grupei C = N care exist# in echilibm cu forma C NH ~
O
OH
G NH
C=N
forma lactam
forma lactim
140
In structura acizilor nucleici se g^sesc formele lactam, mai stabile.
NH 2
0

- Adenma
(6-aminopurina)
lac fjft)

Guanina

Lactirn
Lactam
Uracil
(2,^-dfhjdroW'p/rim/dina)
OH
PH3
CH,
HO
HN"
v/
N
Laclim
H
Lactam
Timina
(5'mel/i-u'adf)

tactim
Lactam
Citozina
(2-hidfO-4-arnino*fMfjmiaina)
Derivajii aminaji care nu confin grup&ri -OH prezintS i ei tautomeric iminoamino,
dar echilibrul este net deplasat in favoarea formei amino;
NH2

141
Ca atare, adenina se va prezenta sub forma amino.
De menfionat cd uracilul este baza pirimidinicd specified AR.N, In limp ce
trmina este baza pirimidinicd'specified ADN.
Atat ADN cat i ARN (in special ARNt) confin i baze minore ce
reprezintd forme mediate, tiolate sau glicozilate ale bazelor majore. Ra|iunea
prezenfei lor in acizii nucleici va fi discuta td ulterior.
Bazele azotate sunt molecule plane, relativ insolubile in apd. Prezinfd on
maxim de absorhfie in ultraviolet intre 252-271 nm, in funefie de natura
bazei azotate i de pH, ceea ce permite determinarea cantitdfii de acizi
nucleici intr-o probd.
IV.2.2, NUCLEQZIDE 1 NUCLEOTIDE DIN STRUCTURA ACIZILOR NUCLEICI
Nucleozidele sunt compui ce rezultd prin stabilirea unei legdturi Nglicozidice intie hidroxilul semiacetalic (de la C ) al pentozei i atomul de
azot din pozifia 9 a unei baze purinice sau din pozifia 1 a unei baze
pirimidinice.
Ribonucleozidele confin ca pentozd p-D-ribofuranoza, in limp ce
dezoxiribonucleo- zidele confin P-2 -dezoxi-D-ribofuranoza,
NH 2
O

OH
142
Citidinn
DeioxiUmiclinn
Dezoxiribonucleozidele se citesc adSugand prefixul dezoxi la numele
ribonucleozidului corespunzStor. In unde nucleozide pirimidinice, denumite
pseudonucleozide, leg&tura intre pentozS i baza azotatS se realizeaz-S prin
intermediul C5 i N,.
Nudeotidele sunt esteri fosforici ai nucleozidelor la gruparea alcool de la
C5>, sau C3> al pentozei. In structura acizilor nucleid intrS nucleozid-5fosfa{i.

Nudeotidele din structura ADN se citesc adSugand prefixul dezoxi la


numele nucleotidului con{inSnd riboza (dezoxiadenozin-S-monofosfat sau
5- dezoxiadenilat); In limp ce ADN ti este propriu 5- dezoxi timidilatul, in
A.RN de transfer exists ca nucleotid minor 5MimidiIatuI.
o

Dezoxi guanozin- 5-monofosfai (dGMP) (S-Dezoxiguanilal)


O

Guanozin-S'-monofosfai (GMPj (S'-Guaniial)


NH 2

Adenozin-5'-monofosfat (AMP) (S'-Adeo/la!)


143
NH

i!-M
Ac
V

;C^V

;
,i in\ i
N

OezoxiciMin S'-monotostat (dCMP) 5'-de-joxidliciilai


CiliUin-5-monofoafal (CMP) (S'-cHirislaV)
O

Uridif^-5 -monofostat (UMP)


Dezoxilimidin
{ b -undilat)
t%-nwiobsiat (dTMP)
(5-dezoxilimidilat}
Dac& un nucleozid sau un dezoxinucleozid este di~ sau trifosforilat se objin
nucleozid sau dezoxinucleozid di- gi trifosfaji. De exemplu, in cazul adenine!
se objin adenozin- difosfatul (ADP) i adenozin-trifosfatul (ATP),

144
De menjionat exisfcenfa a douS conforma|ii posibiie- pentru nucleozide gi
nucleotide derivand din suprimarea/ofafiei libere in jure 1 legSturii J$-Nglicozidice: conformafiu anti gi conformafia syn. In conformerii anti,
dezoxiriboza gi baza sunt situate de pSr{i opuse fatS de legStura glicozidicS,
ceea ce reduce repulsia stericS intre acestea. UzuaJ, conformerii anti sunt
prezenji in dubla helice Watson-Crick (ADN-forma B) in timp ce conformed!
syn sunt prezenji in ADN-forma Z (vezi structura ADN)-

IV.2.3. NUCLEOTIDE NATURALE LIBERE


in afara nucleotidelor descrise ca fund elemente de construcjie a acizilor
nucieici,. exists o serie de nucleotide care indeplinesc roluri dintre cele mai
important gi variate in Jesuturi.
Adenozin~3 ,5 -monofosfatul (AMP ciclic, AMPC) mediazS acjiunea a
numerogi hormoni (mesageri primi) care nu traverseazS membrana celularS.
Prin interacjiunea primului mesager
(hormonal) cu enzima membranarS adenilat cielaza pe care o activeazS, ia
nagtere din ATP
NH 2

0"
Struclura 3',5' AMP(AMPc)
O

0"
Slrucluf 3',5 GMP (GMPc)
145
adenozin monofosfatul ciciic (rnesagerul secund). AMPC este interprets
acfiunii hormonilor respectivi in celulS, el realizand, prin intermediul unor
kinaze, fosforilarca reversibiD a unor enzime, aciivarea sau inactivarea
acestora (vezi hormoni). Suprimarea acfiunii hormonului se traduce prin
hidroliza AMPC sub acfiunea fosfodiesterazei.

'Ca AMPC, i GMPC se comports ca un important semnal intracelular al unor


mesaje extracelulare.
Activarea prealatiD a unor molecule, in vederea efectudrii unor reacjii de
transfer, se realizeazS. adesea prin cuplarea acestora cu un nucleotid;
metionina este activate ca S-adenozil-metionina, glucoza, ca uridindifosfatglucoza etc. (vezi metaboiisme),
Alte nucleotide joacft un rol important in reglarea replic&rii i transcrierii
la tmele organisme. Astfel, guanoziri - 5 - di fos fa t-3 - difosfa lu 1
(guanozin tetrafosfatul) i guanozin- 5-trifosfat-3-difosfatul sunt implicate in
transcrierea unor gene bacteriene.
Diadenozin tetrafosfatul este un dinucleotid important in activarea
aminoacizilor i replicarea ADN. Concentrafiile mici de diadenozin tetrafosfat
(Ap4A) in fazele de go! sintetic (G{ i G2) ale ciclului celular, cre-sc
spectaculos in faza S a ciclului. Se considers cd Ap4A ar acjiona ca semnal
pozitiv al creterii.
1Y.2,4; 'ANALOG! STRUCTURAL! Al BAZELOR AZOTATE 1 NUCLEOZIDELOR
Analogii structurali ai bazelor purinice i pirimidinice sau ai nucleozidelor
se comportil ca antimetabolifi, ei putSnd sft acfioneze fie prin incorporare in
acizii nucleici, fie prin inhibarea unor enzime implicate in biosinteza ADN.
Printre compuii avand acjiune antivirals sau antimitoticS se numSrS. 5fluoroura- cilul, 4-aza-uracilul ca i unele nucleozide confinand ca zaMr
arabinoza (arabinozil citozina).
i derivajii purinici, cum ar fi 6-tioadenina, 6-tioguanina, 6mercaptopurina, 8~ azaguanina, se utilizeazS in afecjiuni tumorale, dar mai
ales in leucemia acuta.
Utilizarea lor in clinicile de oncologie se bazeazft pe tumoverul crescut ai
nucleoti- delor in jesuturile canceroase.
Allopurinolul, inhibitor al sintezei de novo a purinelor este utilizat in
tratamentul hiperuricemiei i a! gutei.
Azatioprinul (imuranul) este utilizat in prevenirea respingerii irnunologice
in cursul transplantelor de organe.
*.
Azidotimidina (zidovudina), derival al timidinei, este un antiviral redutabil
pe care il folosegte, ca nucleozid trifosfat, exclusiv ADN polimeraza virali (nu
i cea uman&). Alfituri de alfi analogi structurali, azidotimidina se utilizeazS
in infecfiile cu HIV (virusul imunodeficienfei umane).
146
o
o
0
If
II
I!
5
O P- O- P- 0~ P 0 H 2 C
iff
,
1f(
o
O" 0 0"
A"
4
C.y
0OH

o
A.
7)
A7
HO
HO OH 6- Aza-uridina
HOH2C
kQ?
A/, OW Zidovudina (AZT)
SH

6 - Marcapt^punna

MM ^ H 6 - Tioadenina
IV.5.2. STRUCTURA COVALENXA A ACIZILOR NUCLEICI
Acizii nucleici sunt poiinucleotide realizate prin stabilirea de legatori
covalente Intre nucleotidele ce se succed in ianp
Gruparea 5-hidroxi a unui nucleotid este legatd la gruparea S-bidroxi a
nucieotiduiui urmdtor prin legdturd fosfat diestericd (Figura IV. L)
De remarcat cd orice catena polinucleotidicd are o direcjie (o polaritate)
specified, in sensul cd, toate legaturile internucleotidice au aceeagi orientare
de-a lungul lanfului. Fiecare catena polinucleotidicd va avea doud capete:
capdtui 5\ ia care gruparea -OH de la C5 este liberd, i capdtui 3, la care
gruparea -OH de la C3 nu este angajatd intr- o legdturd internucleotidicd.
Prin convenjie, structura unei catene polinucleotidice este scrisd
intotdeauna cu capdtui 5 in stanga i cel 3* in dreapta. De exemplu,
succesiunea ACGAC semnified faptuj cd adenina are grupa 5-OH neangajatd
in legdtura cu alt nucleotid in limp ce citozina are liberd gruparea 3-OH.
Doud lan{uri polinucleotidice sunt antiparalele atunci ednd unul evolueazdin
direejia 5 >3\ iar celdiait in direefia 3?~A5? (Figura IV.2).
148

Fig. IV.1 - Fragment din structura unui polinucieotid i reprezentarea sa


schematics

Fig. iV.2 - Catena polinucleotidice antiparaleie; reprezentare schematics


149
IY.2.6. CARACTER1STICI FIZIGO-CHIMICE ALE ACIZILOR NUCLEIC!
Denaturarea i renaturarea AON
La variajii man dc pH sau de tempera tur# are ioc ruperea Ieg#turilor de
hidrogen care solidarizeaz# calenele ADN dublu helicoidai acompaniat#,
inevitabil, de suprimarea interacjiunilor van der Waals.
Acest proces denaturarea ADN este insojit de o moclificare a
absarbjiei la 260 nm, maxim de absorbjie caracteiisiic bazelor azotate libere
i a ceior din structum ADN (la pH = 7).
Cantitatea de lurnin# absorbit# de ADN nativ, dublu helicoidai, este mai
mic# decat cea absorbit# de bazele purinice i pirimidinice izolate. Acest
efect hipocrom se datoreaz# masc#rii parfiale a bazelor stivuite
(stacked) care interacjioneaz# tore ele.
Denaturarea are ca efect previzibil hipercromicitatea, respectiv creterea
capaciMfii de absorbjie in ultraviolet la 260 nm, i poate fi monitorizat#

urmMrind modificarea absorbfiei in cursul procesului.


Repaezentand modificarea absorbfiei funcjie de temperatum la cam este
supus# o prob# de ADN' se objine o curb# de ioplrd cu Haiti sigmoidal#,
denot#nd interacjiuni cooperative intie baze. Suprimarea progresiv# a
acestor interacjiuni culmineaz# cu sepaxarea complet# a calendar.
Se definegte temperatora de topiie (melting temperature) a ADN ca
temperatura la cate modificarea absoibanjei xepre- zint# 50% din cea total#,
coies- punzStoare unei denatur#ri complete (Fig. IV,3).
Este uor de admis c# pro- centul de perechi G - C respectiv A = T dintr-o
molecul# de ADN' influenjeaz# temperatura de topire in sensul cresterii sau
descreterii acesteia. Comparand ,,profilur de topire a dou# molecule de
ADN' i cunoscand pioparfia de baze G +- C/A -r T pentm una dintie ele se
poate aproxima proporfia acestora din cealaM molecul#, cu com- pozijie
necunoscut#.
Denaturarea ADN este perfect reversibil#. Prin restabilirea valorilor de pH
i temperatura la valori fiziologice cateneie, fie i complet separate, pot
reforma dublul helix original* prin rena- turare (annealing).
Renaturarea (termic#) se produce la temperaturi sub temperatura de
topire (ideal, cu 20C mai mici ca aceasta), prin r#cire progresiv#.
Viteza cu care are ioc renaturarea este mult mai mic# in situajia in care
cele dou# catene sunt separate complet in comparafie cu cea in^care cele
dou# catene an rSmas legate printr-un num#r mic de leg#turi de hidrogen.
in primul caz, cele dou# catene trebuie mai intai s# se reg#seasc# i s#
tatoneze, prin coliziuni intamp!#toare, alinierea cored# pe o porfiune mic#
care apoi se va extinde. In cel de-al doilea caz exist# deja un reper care va
permite o renaturare spontan# (Fig. IV.4).

timus de vljel
150
ADN
dubiu
helicoidal

Fig. IV.4 - Stadiile denaturarii reVersibile a ADN i regenerarea sa


In afara utiliz&rii procesului de denaturare-renaturare In vederea
determinSrii proporjiilor de baze dintr-o molecuhl de ADN ca i a hSrfilor de
denaturare (localizarea regiunilor bogate in perechi A=T in condijiile unei
denatur&ri blandeu temperaturd

151
i concentrate de agenji' denaturanji relativ mici), exist! i alte aplicafii ale
acestui proces. Printre cele mai importante se numM hibridarea molecular^.
Tehnica hibridSrii moleculare permits renaturarea prin combinare a unor
monocatene de ADN sau a unor monocatene de ABN cu ARN, in condijiile
unui grad relativ crescut de. complementaiitate a acestora, cu formarea unui
heteroduplex.
Detec tarea regiunilor hibride aie unui heteroduplex se poate face
electrono-micrcscopic (contur mai ingroat). Vizualizarea electronomicroscopicd a heteroduplexurilor ADN- ARNra, formate in solujie, permits
determinarea pozifiei intronilor (vezi mai departe) in rnoleculele de ADN sau,
in cazul heteroduplexurilor ADN, evidenjierea delefiilor cromozomiale.
Detec tarea heteroduplexurilor ca i determinarea gradului de hibridare se
pot face i prin marcarea uneia dihtre monocatene cu 32P, urmat& de

/
0

0X
10
C
L
1

autoradiografiere. Identificarea unui anumit fragment de ADN dintr-un


amestec de fragments separate de exemplu, prin electroforezB in gel de
agarozSL, utilizeazS o sondS ADN sau ARN' radioactive. Tehnica Southern
permite transferal fragmentelor de ADN de pe gelul fragil pe o membraml
solid! de nitrocelulozS i identificarea ulterioarS a fragmentului de interes.
Hidroliza acizilor nucleici
Hidroliza acizilor nucleici poate decurge atat chirnic eat i enzimatic.
Hidroliza chirnic! decurge in mediu bazic sau acid.
Spre deosebire de ADN, care este rezistent la hidroliza bazicS, ARN este
hidi'olizat la un amestec de 2- I 3'- nucleotide.
Deprotonarea grupei TOH in mediu bazic favorizeaz! atacul nucieofil al
acesteia asupra leg&turii 3, 5- fosfat diesterice cu formarea intermediary a
unui nucleotid ciclic 2\ 3, hidrolizabil la nucleozid- T sau 3s- fosfat (Figura
IV.5).
L. . ............;. .
A
/
//
*-r
O ------:or
0
/^
/<
/ 0"

H20
3'
7~
T
O-POg OH
A ~|~
T
HO
0~PQ'
Fig, IV.5 Hidroliza bazic& a ARN
152
Rezistenja la hidroliza bazicd a ADM este uor de injeles i poate fi
interpretatd ca o necesitate servind funcjiei de depozifare a informajiei
genefice.
Atat ADN cat i ARN pot id hidrolizafi enzimatic sub acjiunea unor enzime
denumite nucleaze. Se cunosc doud tipuri de nucleaze: endonucleaze, care
hidrolizeaz# legdturile fosfat diesterice din interiorul catenei polinucleotidice
i exonucleaze, care hidrolizeazd nucleotidele terminate de la capdtul 5 sau
3 ale until lanj polinucleotidic. Aceste enzime sunt distribuite ubicuitar.
Nucieazele secretate de pancreas particip# la procesul de degradare a
acizilor nucleici. Acjiunea nucleazicd, in special cea exonucleazicd, este
proprie i unor enzime implicate in biosinteza ADN, cum ar fi ADN polimeraza
III.
O elasd important de endonucleaze specifice, denumite enzime de
restricjie sau restrictaze, a fost evidential# la bacterii. Rajiunea existenjei
acestor enzime este aceea de a distruge once ADN strain care a patruns
in.baclerie, prin calitatea de a recunoagte secvenje specifice de 4-6
nucleotide i a cliva, intr-un loc specific, cate o iegdturd. fosfat diestericd de

pe fiecare calemt Numdrul de enzime de restricjie izolate i purificate este


impresionant.
De remareat faptul cd bacteriile ii crujd propriul ADN, marcandud
chimic, in general, prin metilarea specified a unora dintre reziduurile de
adeninS i citozind cuprinse in seevenjele recunoscute de enzimele de
restricjie. Metilarea are loc sub acjiunea unor ,,metilaze de modificare fie la
gruparea amino a. adeninei fie la C5 al citozinei. Cel mai adesea acjiunea
endonucieazicd ca i cea metilazicS aparjine aceleiai proteine. Restrictaza
Hind II, izoiatd din Haemophilus Influenzae, taie specific seevenja:
5' C-T-Pirimidina -------------------Purina A-C 3'
3J G-A-Purina Pirimidina-T-G 5
din orice ADN, cu excepjia celui care este metilat la nucleotidele adeninei din
aceste secvenje, adied a propriuiui ADN.
In cursul sintezei de ADN fiecare dintre catenele parentale servete ca
mairija a cate unei noi catene complementare; catenele non sintetizate sunt
imperativ modificate prin metilare specified inaintea unui nou ciclu de
repiicare (inodificare postreplicare).
Acest sistem de restricjie-modificare, propriu bacteriilor, defensiv,
ingenios si eficace pulverizeazd agresorul (fragmentele rezultate prin
acjiunea enzimelor de restricjie sunt degradate apoi de exonucleazele
haeferiene), in general un virus (bacteriofag).
Enzimele de restricjie, adevdrate bisturie moleculare, permit, t&ierea
selectiv# a unor fmgmente de ADN in scopul utilizdiii lor in tebnicile de
clonare a ADN (vezi ingineria genetic#).
Dintre diversele tipuri de enzime de restricjie, tipul II are iegdturd direct#
cu tehnologia ADN recombinant, spre deosebire de cele de tip I i III care
sunt enzime bifunejionale manifestand atat activitate endonucieazicd cat i
activitate metilazicd.
IV.3. ACIZII DEZOXIRIBONUCLEICI
In 1868, Miescher a izolat, din celule spermatice de pegte, un compus
conjindnd fosfor pe care l-a numit nucleina, fiind izolat din nucleii celulelor
respective. Siructura covalent# a grupdrii prostetice, care a prim it numele
de acid dezoxiribonucleic (ADN), a fost stability in jurul anilor J 940.
Cu totul revolufionard a fost demonstrarea de catre Oswald Avery, Colin
MacLeod i Mciyn McCarty in 1943 a faptului ed ADN este molecula ereditdjii,
cd ea este purtdtoarea informajiei genefice. ADN extrem de pur, extras dinlrun pneumococ
153
virulent. provoacS transformarea geneticd a unci sue neviruiente de
pneumococ. Virulenfa caligalfi de aceasta din urm& este transmisd ereditar,
prin includerea ADN injectat in ADN al celulei gazdii.
Informafia geneiicd este tnscrisd in secvenfa variabilS a nucleotidelor,
elementele din care sunt constituifi acizii nucleici. ADN confine informafia
genetic# complete pentru a specifies structura proteinelor unui organism.
Definirea caracterelor morfologice i funcfionale ale unei celule, al c&ror
substrat este reprezentat de proteine, se realizeaz# dupd program ul inscris
in ADN.
IV.3.1. STRUCTURA COVALENTA A ADN
Acizii dezoxiribonucleici sunt polidezoxiribomicleotide cu mass,

molecular# mare in care gruparea 3-OH a unui dezoxiribonucleotid este


legal# la gruparea 5-OH a dezoxiribonucleotidului adiacent printr-o leg&tur#
fos-fat diestericl (Figura IV.6).

Fig. IV.6 - Structura covalenta a ADN


ADN confine patru baze azotate i aniime: adenina, guanina, timina i
citozina. In secvenfa nucleotidelor corespunzStoare din macromoleculele de
ADN este inscris# informafia genetic# pe care acestea o cuprind.
IV.3.2. CONFORMAT1A MOLECULE! DE ADN; TIFURI DE CONFORMATTII
In stabilirea structurii secondare a ADN decisive au fost cercetdrile
intreprinse de Chargaff, Rosalind Franklin 1 Wilkins, ale cSror concluzii le
vom sumariza in celece urmeaz#:
154
- analiza cromatograficS, efectuatS de cfttre Chargaff pe molecule deADN izolate din diverse specii, stabilete o anumitS. relatie cantitativS intre
cede 4 haze azotafe, In toate tipurile de ADN studiate numeral de reziduuri
de adenind este egal cu cel al reziduurilor
de timing, iar cel al reziduurilor de guanine cu cel de citozina; rmmdrul de
baze purinice este egal cu cel de baze pirimidinice (A+G=T+C);
- difracjia razelor X, efectuatS pe cristale de ADN de c&tre Rosalind
Franklin i Maurice Wilkins, a demonstrat existenfa a doufi perioade de
identitate de-a lungul axei lungi a moleculei: una mare, de 3,4 nm i una
mic&, de 0,34 nm.
Pornind de la aceste date, cat i de la necesitatea tie a oferi o interpretare
molecular^ capacity!! de reproducere a informajiei genetice conjinuta in
rnoiecula ADN, ca taMturli caracteristicS a acesteia, Watson, i Crick an
elaborat un model tridimensional al macromoleculei de ADN cu urmStoarele
caracteristici;
- tlouil lanfuri polidezoxiribonucleotidice antiparalele se riisucesc
helicoidal i in acelai sens in jurul unui ax comun, formand o dubia helice cu
orientare dreapta. Ineleie glucidice, legate prin resturi fosfat, constitute
scheletul extern al dublului helix, in limp ce bazele azotate, hidrofobe, sunt

orientate spre interior i perpendicular pe axa helixului. Toate grup&rile


fosfat la pH = 7 sunt ionizate i inc&rcate negativ;
- cilindrul ce incadreazft dublul helix are diametrul de 2 nm;
- distanja dintre planurile a dou3 baze adiacente este de 0,34 nm;
perioada de identitate este de 3,4 nm, deci structura se repetS dupil 10
perechi de baze azotate;
- stabilitatea dublului helix este asiguratfi atfit. de interacjiunile
hidrofobe dintre bazele azotate cat i de leg&turile de hidrogen ce se
srahilesc intre bazele azotate de pe o catena i cele complementare de pe
cealaltit catena.; multitudinea de legattiri van der Waals, stabilite intre
bazele azotate suprapuse, slivuite (stacked), prin. suprafejele lor de
contact, contribute major la stabilitatea moleculei.
Leg&turile de hidrogen se stahiiesc, invariabil, intre o baxS azotatS
purinicS de pe o catena i una pirimidinica de pe cealaltli calenti.
imperecherea a doua baze purinice

Timidin a

Dezoxiadenozina

Fig. 1V.7 - Baze complementare unite prin iegaturi de hidrogen


155
este excIusS intrucai s-ar depai spajiui oferit de dublul helix (diametrul
constant,-- de 2 nm, de-a lungul axului), iar fmperecherea a dou& haze
pirimidinice ar face imposibiia
stabilirea leg&turilor de hidrogen, bazele azotate fund situate prea departe
una de alta. Bazele pereehe sunt adenina-timina i guanina-citozina, intrucat
numai acestea pot stabiii num3rul. maxim de leg&turi de hidrogen,
asigurand astfel conformafia cu energia iibeift cea mai mic&, de-ci cea mat
stabilS, moleculei de ADR Adenina se leagS de timing prin dou& legiituri de
hidrogen, iar guanina de citoziM prin trei leg&turi (Fig. IV.7). Cele dou8
catene poiinucleotidice nu sunt identice ci complementare, in sensul c&,
adeninei dintr-o catena ii va corespunde intotdeauna timina de pe cealaM
catena, iar guaninei - citozina. Succesiunea bazelor azotate dintr-o catena
dicteazS succesiimea bazelor azotate din cea de-a doua catena.: o catena
este replica celeilalte.
Ins&gi dispozijia siruclurilor hidrofobe, respectiv hidrofile, in medial
convenabil lor, confera stmcturii ADR maximum de stabilitate necesarS;
tifcria leg&turilor care asigurd conformajia moieculelor de ADN trebuie sa fie

suficient de mare pentru a-i menfine integritatea pennifUnd totodata


flexibilitatea conforma|ionaia a acesteia.
Modelul Watson-Crick este reprezentat in Figura IV.8.

Fig. 1V.8 - Structura dublu


heiicoidaia a ADN
CAlZNit
PAW;NTAtC

Fig. IV.9 - Autorepiicarea ADN


156
. Ir.formafia genetic# cu privire 1a biosinteza de proteine rezid# in ins#i

secvenfa bazelor azotate din catenele de ADN. Multipiele posibiiifAji de


variable a acesteia explicit multitudinea de proteine ce pot fi sinteiizate
conform ,,instruc|iunilotu cuprinse in ADN.
Modelul Watson-Criek ofer# elementele pentru explicarea capacity ADN
fie a stoca i transmite informa|ia inserts# in secvenja bazelor azotate.
Fiecare dintre aceste catene va servi ca matrix (template) pentru sinteza
unei catene noi, complementary cu catena parental9, rezultSnd astfel dou#
molecule fiice identice cu ADN parental (Figura. IV.9).
Conforrnajia dublu heiicoidal# descris# de Watson-Crick corespun.de
formei predominante de ADN in celulii - forma B.
Exist# dovada c#, departe de a fi o molecul# static#, molecula de ADN
adopt# i alte conformajii.
Conformafia de tip A corespunde tot unei duble helice drepte d.ar este
mult inai compact#; pasul helicei este de 2,8 nm iar numdrul de baze per tur
este de 11. Ca. i in cazul ADN-B i in ADN-A predomin# conformerii anti.
Conformajia de tip Z (Z de la zig zag) corespunde la o helice sting# avand
12 perechi de baze per tur, pasul helicei Bind de 4,56 nm. Ea intrerupe
monotonia helicei drepte atiinci cand intilnegte structuri speciale (anumite
succesiuni de secven{e alternative de purine i pirimidine) fiind prezent# a
tit in condifii fiziologice cit i in condijii speciale (la concentrajii marl de
cation!). Intro succesiune GC dezoxinucleotidul guaninei adopt#

Fig. IV.10 - Confer- ma|ia 2 a ADN

Superrasuciri
pozltlve
157jib
A
A:j

f::
:
\
'
V;

conformafia syn iar cel a 1 citozinei pe cea anti, ceea ce face ca lanjul sft
evoiueze in zigzag intne cele douM conformafii (Fig. IV. 10).
MinoritarS fa|ii cle dubla helice Watson-Crick i avand o stabilitate mai
mic decat ea, prezenja acestei con.forma{ii are, probabil, o semnificafie
biological; se sugereazS cS ar reprezenta un semna.1 de recunoagtere sau ar

juca un rol important in variabilitatea geneti- c<1 a organismelor (aceste


regiuni sunt, in general, predispose la mutajii).
Se admits c& in timpul proceseior de replicare sau transcriere a ADN,
procese implicand ,<deschiderea moleculei, energia eliberat& ar fi utilizatft
pentru stabilizarea structurilor Z> natural instabile. Dacft este aa, rezuM c&
in cursul acestor procese au loc remanieri ale conformajiei ADN, variable in
cursul existenjei celuJei.
Dei prezenfa acestei conformajii in vivo nu este ferm dovedita, exists
argumente (in vitro) ca structura Z modifica interacjiunile ADN-proteine, prin
excelenjS importante in replicare, transcriere, repararea leziunilor ADN. Se
speculeazS ideea de limbaj conformational receptat ca rnesaj.
IV.3.3. ORGANIZAREA MATERIALULUI GENETIC LA FROCARIOTE 1 EIJCARIOTE
La procariote, o moleculii unicii de ADN, de mars dirnensiuni (confin&nd.
4.000.000 perechi de baze) i in general circulars (formats prin legarea
covalent# a capetelor 5, 3'), alc#tuiete un cromozom. Lungimea conturului
de ADN cromozomial este de -1,4 mm, deci cu mult mai mare decat
dimensiunile unei celule de Escherichia coli. Evident, molecuia ADN va trebui
s& adopte in celuLI o form# cat mai compacts, care s-o fac# compatibil# cu
spajiul oferit de ciitre aceasta. ADN circular formeaz# infr-adevdr
superhelixuri prin suprarfisuciri, superspiralizftri (supertwisting, supercoiling).
Suprar3sucirile spre dreapta (sensul dublei helice), determinate de
scMerea num&rului de perechi de baze per tur helice (faf# d.e 10,5 in ADNR), sunt considerate'pozitive (positive supercoling ).
SuprarSsucirile spre stanga, determinate de cregterea num&rului de
perechi de baze per tur helice, sunt considerate negative (negative
supercoiling) tot prin convenjie.
Structure superhelicoidald negative este proprie celulelor vii, ea relaxand
dubla helice.
Suprarilsucirea este o proprietate universal fi a ADN dublu helicoidal;
suprar&suciri apar nu numai atunci cand un ADN circular se r$sucete in
jurul propriei axe dar i in cazul ADN Liiuar-deci fi la eucarioie.
Formele superhelicoidale sunt In report cu forma helicoidala, ca i una faja
de cealaM, topoizomeri. Enzime specifics, denumite topoizomeraze,
catalizeaz# aceste modificdri topologice, interconvertind izomerii topologici
(tapoIogia-ramurS a matematicii, studiaz# deform&rile geometriei unor
structuri).
O topoizomeraz#, prezent# in procariote, este ADN giraza care are
abilitatea de a produce sau desfiinja suprar3suciri negative. Dou& dintre
subunitajile acestei enzime- tetramer (doiul perechi de subunit# {i A 1 B),
acelea care introduc superhelixuri negative, au fi activitafe ATP-azic#, spre
deosebire de subunitilfile specializate in desfiinjarea acestora.
158
Pe langd ADN reprezenlSnd materialal cromozomial, ce cuprinde setul
complet de gene penlru specificarea tuturor caracterel'or celulei, bacleriile
confin i mici cantitdfi de ADN circular, ex(racroinozoniial, care se gdsete in
citoplasmd. Aceste molecule de A.DN se numesc plasmide i confin o
cantitate redusd de informalie geneUea. Pe langd alte gene, ele confin i
gene care specifiers anumite proteine ce le confera rezisfenfa la antibiotice.
Plasmidele pot migra de la o celuld cu rezistenjd la un antibiotic la alia

.celuld, cu sensibilitate la antibiolicul respectiv, fdcand-o i pe aceasta


rezistentd, Rezistenfa la antibiotice, transferable nu nurnai in cadrul aceleiai
specii bacteriene ci i de la o specie la alia,.pone probleme serioase
antibioterapiei.
Plasmidele s-au dovedit. a fi instrumente ideale de manipulare a genelor.
Manifest&nd adesea autonomic fatd de ADN cromozomial, plasmidele se
autoreplicM extrem de rapid. Posibilitatea incorporarii unui fragment de ADN
strain intr-un plasmid, prin tehnicile ingineriei genetice, $i reintroducerea
plasmidului modificat intr-un organism gazdd permite ohfinerea. unor mari
cantildfi din gena str&ind sau din proteina specificate de aceasta.
In cazul eucariotelor, cea mai mare cantitate de ADN se gasete in nucieu
care, spre deosebire dc procariote, este delimitat de citoplasma printr-o
mernbrana.
In perioadele de repaos ale celulei, deei in afara perioadelor de diviziune,
materialul genetic se gasete sub formd de cromatind, un material amorf,
dispersal in nucieu, care confine ADN, proteine bazice denumite histone i
proteine nehistonice denumite -hertone.
In timpul mitozei i pufin inaintc de aceasta, cromatina se eondeiiseazd i
se subdivide in. cromozom i care sunt complexe ADN-proteine. Num&rul
acestora depindc de specie; astfel, celulele somatice umane confin 46 de
cromozomi grupafi in 23 de perechi, vulpea 34, puiul de gdind 78 etc. Fieeare
cromozom confine o singuril moleculd de ADN linear lungimea sa variind de
la un cromozom la altul.
Porjiunile ADN care confin informajia genetied cu privire la sinteza unei
proteine au fost denumite, inifial, gene. S-a mai tat: ulterior cfi proteinele
fonnate din mai multe subunitdfi polipeptidice sunt codificate de un grup de
gene, fiecttrei gene corespunzandu- i un lanf polipeptidic. Relafia dintre
materialul genetic (ADN) i expresia sa finald (proteinele) este cored
exprimala prin conceptul o gend - un lanf polipeptidic; tot gene sunt i
fragmentele de ADN care nu se oxprimd final in proteine, ci in acizi
ribonucleic! de transfer i . ribozomiali. Gena reprezintd deci fragment'd
cromozomial care confine informafia cu privire la sinteza unui singur lanf
polipeptidic sau a unei molecule de ARN.
Fieeare cromozom confine un set unic de gene. Totalitatea genelor
cuprinse in cromozomii unei celule constituie genomul acesteia. (Genomul
haploid uman constd din 3,5 x 109 perechi de baze).
In general, genele eucariotelor se intalnesc o singura datd in genom.
Unde gene sunt prezente, insd, in copii multiple, de exemplu genele care
corespund tuturor lipurilor dc ARN, genele care codified histonele, genele
care codified cheratina la pdsdri i cornute etc.
Moleculele de ADN eucariot prezintd, spre deosebire de ADN procariot, i
anumite segmente, relativ mici, noninformafionale, care se pot repeta de
milioane sau nurnai de mii de ori (ADN satelil). Aeeste seevenfe repetitive,
cuprinzand zeci sau sute de perechi de baze, sunt suspectate a indeplini
roluri in reglare, in arhitectura moleculei de ADN, d:u* dovezile in acest sens
sunt ined neeonvingdtoare.
159

I M -.1 :: z-

Surpriza cea mare privind organizarea genomului eucariot a oferit-o


descoperirea discontinui- t^Jii genelor, 0 genS conjin&nd inform afia privind
structura unui lanf polipeptidic- este intreruptS de secvenfe care nu sunt
fraduse via ARNm, care nu se vor exprima in structura poiipeptidului dat.

Secvenjele de ADN traductibile, dinlr-o anumitii gerul structural^, s-au


denurnit exoni (expressed regions), iarcelelaite introni (intervening
sequences). Cercetflrile din ultimii ani au dus la concluzia c&
discontinuitalea. genelor, departe de a fi o excepfie, reprezanUl o IrSsSturS
comiind a genomului organismelor superioare (excepfie ar face genele care
codifidi histonele i interferonul).
Afirmafia unor geneticieni dup8. care genomul eucariot est.e organixat pe
linia relaxSrii i extravaganfei nu pare, deocamdaU, extravagant#.
Celulele eucariote eonfin, pe laugh ADN nuclear, i ADN- localize! in
mitocondrii, diferit atat prin structura, cat i prin unele proprietyfi, de cel
nuclear. ADN mitocondrial se prezintii ca un duplex circular, cu raasa
molecular# relativ midi i o capacitate de renaturare surprinzStoare.
Prezenfa ADN mitocondrial confers acesteia o oarecare autonomie
genetic#, o parte dintre proteineie mitocondriale, mai ales cele implicate in
biogeneza sa, sintetizSndu-se pe tipar de ADN propria. Printre aceste
proteine semnalfim: NADH-ubichinono oxidoreductaza (inhibat# de
rotenon#), apocitocromul b, subunitSfi ale citocrom oxidazei, diferite
proteine structurale.
Majoritatea proteinelor mitocondriale sunt ins# specificate de gene
nucieare, sintetizate in citoplasm# apoi importate, grafie recunoa^terii lor
de c&tre receptorii specializafi de pe suprafaja rhitocondriei.
Este surprinzhtor faptul c# setul de gene ale ADN mitocondrial (care
specifics proteine mitocondriale) nu este identic la. diferite ovganisme,
proteine omoloage fiind codificate la unele de e#tre ADN mitocondrial, iar la
altele de c#tre ADN nuclear. Ideea unui transfer de gene intre nucieu i
mitocondrie pare plauzibila finand seama de faptul oil ADN nuclear poate
incoipora AON exogen phtruns in celuLl
Se pune firesc intreharea: de ce alte organite celulare las# pe seama ADN
nuclear intreaga responsabilitate a biogenezei lor iar mitocondria
cointereseaz# atat ADN nuclear cat'$i ADN propria? Indiscutabil, prezenfa
ADN mitocondrial nu poate fi un capriciu sau un accident al evolution
menfinerea unui sisfem genetic separat constituind o substantial^ investifie,
impusa probabil de o necesitate inc# neinfeleas#.
IV.3A ARHITECTURA GENOMULUI EUCARIOT
Cantitatea de ADN In celulele eucarioteloi* este semnificativ mai mare
decat la procariote. Lungimea conturului de ADN dintr-o singur# celul#
urnan# este de ~2 m. Pentru ca o rnolecul# de ADN s# incap# in spafiul
nuclear, stramt, materialul genetic se organizeaz# corespunziitor, un rol
important revenind histonelor, proteine bazice, cu
mas# molecular# micfi, asociate ADN. Se eunosc 5 clase de histone i
atiume H}, H^, H^, H3, H4. Histonele i H2K au un confinut foarte begat in
lizinh, in limp ce H3 i H4 sunt foarte bogate in arginin#. Intrucat la pH
fiziologic radicalii color doi aminoacizi sunt protonafi, histonele stabilesc
legftturi saline .cu anionii fosfat din molecula ADN, ceea ce permile formarea
de complexe ADN-histone.
160
Cantitatea mare de histone, existenja strict# a 5 tipuri de histone In
toate celuiele eucariote ca i constanja structurii lor pe scara evolupei au
reactualizat problema importan|ei acestora In organizarea cromozomiior:

unde se afM aceste proteine in cromozom, cum sunt dispose i ce rol au de


indeplinit? Este asocierea histonelor cu ADN r#spunz#toare de condensarea
materialului genetic, f&cand posibil# incadrarea in spajiul nuclear cu
diametral de 1/10 n.m a unor molecule care, extinse, ar mSsura 2 m?
CercetSrile ultimelor decade, utiliz&nd un intreg arsenal de tehnici de
performanj# (microscopie electronic#, difracjia neotrosiicS etc.), au dus la
concluzii ce par s& dezlege misterur histonelor.
Studiile de difracfie a razelor X (efectuate de Wilkins i Buzzati) au dus la
constatarea surprinz^toare c#, cromatina (cromozomii interfazici) prezint#
structuri repetahile la intervale de -10 nm.

Nucleozom miezw

Fig. IV,12
161
in sfudiile de microscopie electronic! cromatina are aspectul unor m!rgele
peaf!. M!rgelele reprezint! o suit! de particule sferice cu diametru de -10
nm, iar afaA porjiuni de ADN liber. Unitatea repetitive de 10 nm, evidential!

prin. studiile de microscopie electronic!, a fost denumit! nucleozom (Fig. IV.


12a). Fiecare unitate repetitiv!-nucleozom-cuprinde un octamer histonic
constituit din 2R7A, 2H^, 2H3, 2H4, ce formeaz! un fel de cilindru turtit cu
dimensiuniie 11 x 11 x 5,5 nm. Dubla helice a ADN infaoar! de aproximativ
dou! ori fiecare miez histonic al nucleozomului. ADN asociat octamerului este
constituit din -140 perechi de baze: (nucleozom miez). intre doi nucleozomi
miez adiacenji se g!sete ADN liber, 20-60 perechi de baze, la erne este
legal! histona Hj (Figura IV.12.b).
Studiile de difraejie neutronic! au demonstrat c! ADN impacheleaza
octamerul histonic i no invers, cum se credea, astfel incat polinucleozomii
pot fi mai degrab! asimiiaji cu o ajii inf!urat! pe m&rgele.
in cromatina eucariotelor polinucleozomii formeaz! un superhelix,
dispunandu-se dup! un solenoid cu un pas de 10 nm, cu diametral de 30 nm
i o distanj! intre spire de 10 nm (Figura IV.13). Fiecare tur de spir! are 6-10
nucleozomi. Solenoizii ar fi, ei inii, organizaji in fibre cu configurafu
heiicoidale de ordin superior.
Se pare c! ins!i cromatina activ!, subiect al replic&rii i transcrierii, este
asociat! cu histonele. Cromatina activ! ar con|ine, pe iang! histone, i
proteins nehistonice care modified, intr-o oarecare m!sur!, sti'uctura
nucleozomului ce se deschide\ permijand citirea mesajului genetic.
Structura condensat! trece intr-o stare mai destinsa, care permite replicaiea
i transcrierea.
Indiscutabil, imaginea pe care o avem despre cromatina, i mai ales
despre modifi- c!riie pe care aceasta le poate suferi, este incomplete i
perfectibil!.
IV.3.5. BIOSXNTEZA ADN (REPLICAREA)
Biosinteza ADN trebuie s! decurg! astfel incat. s! permits conservarea i
transmiterea informajiei genetice de la o generate la alta. In cursul diviziunii
celulare, fiecare celulfi genereaz! dou! celule fiice cu acelai patrimoniu
genetic, conpnand, deci, aceeai cantitate i calitate de ADN.
Modalitatea specific! de biosinteza a ADN este repiicarea, respectiv
desfacerea duplexului de ADN parental i construirea pe fiecare dintre cele
dou! catene a cate unei catene complementare - replica celor dintai. Ca
urmare a replicMi apar dou! molecule ADN fiice identice cu parentala, in
fiecare dintre moleculele nou formate conservandu-se o catena veche,
parental!. Sinteza ADN poarta, din acest motiv, numeie de replicare
semiconservativa (Fig. IV.9).
Intuit! de catre Watson.i Crick, repiicarea semiconservativa a fost
confirmat! de Meselson i Stahl. Cultivand o bacterie (Escherichia coli) tntrun media confinand ca unich sursa de azot NH4C1 marcat! cu i5N, se ob{ine
ADN bacterian integral marcat. Bacteriile sunt transferate apoi pe un mediu
conjinand. NH4C1 nemarcata. ADN extras dup! prima diviziune are o
densitate intermedia!*! intre aceea a ADN marcat cu i5N
162

Fig. IV.13 - Polinucleozomi - Fig. IV.14 - Replicarea semiconservativa;


cbnstituind un solenoid
experienja Meselson - Stahl
(greu) i aceea a ADN nemarcat (uor). DupS cea de a doua diviziune, pe
lang& ADN cu densitate intermediary (50% din ADN total), apare, in aceeai
proporjie, ADN uor (Fig. IV. 14). Desigur, in urmatoarele generajii bacteriene
procentul de ADN uor va create.
Experienja, devenM clasicS, a lui Meselson i Stahl a reprezentat dovada de
necontestat a mecanismului de replicare a ADN. Considerat mecanism
general de siniez& (in vivo) a ADN

163
atat la procariote cat i la eucariote, sinteza semiconservativd asigurd
transferal de informajie geneticd de la ADN parental la ADN fiu i deci
menjinerea stabilitiijii genetice a fiecdrui organism i a speciei.
Procesul de biosintezd a ADN este un proces de mare compiexitate care
necesitd, atat la procariote cat i la eucariote:
- prezenja ADN matrix (template);
- prezenja celor patru dezoxiribonucleozid-trifosfaji (dATP, dGTP, dCTP,
dTTP);
- prezenja ribonucleozid-trifosfajilor (ATP, GTP, UTP, CTP), sugerand
necesitatea sintezei de ARN in cursul sintezei ADN;
- prezenja ionilor de magneziu;
- un sistem enzimatic complex avand ca enzime constitutive: .
a) helicaza - enzimd care realizeazd desfacerea duplexului parental

(denaturarea) cu etalai'ea celor doud catene complementare, permijdnd


citirea secvenjei nucleotidelor de cdtre enzimele replicdrii. Desfacerea
duplexului parental se realizeazd treptat, pe porfiuni mici de ADN, pe mdsurd
ce replicarea avanseazd. Cele doud catene rdman separate ca urmare a
intervenjiei proteinelor de stabilizare a ADN monocatenar, care se leagd ferm
la acesta.
b) topoizomerazele, care rezolvd problemele topologice apdrute in cursul
desfacerii duplexului parental.
c) ADN primaza, enzimd care sintetizeazd mici fragmente de ARN (ARN
inijiator, primer), necesare inijierii sintezei de ADN.
d) ADN polimeraze ADN-dependente.
La procariote s-au descris mai multe ADN polimeraze (I, II, III) avand
funcjii specifice.
Rolul central in procesul de replicare in vivo revine ADN polimerazei III,
enzimd cu masS moleculard mare (aprox. 500000) constituitd din mai multe
subunitdji, fiecare avand un rol precis in legarea substratelor (ADN matrijd,
ARN primer, dNTP), acjiunea polimerazicd i cea exonucleazicd. li sunt proprii
urmdtoarele atribute;
- edified lanfuri polidezoxiribonucleotidice, preluand instruejiuni de la
ADN-matrijd care dicteazd seevenja nucleotidelor din catena nou sintetizatd;
- nudnijiazd catene ADN, necesitSnd un primer cu o grupare 3OH IiberS;
- sintetizeazd exclusiv catene cu direejia 5~3;
- prezintd activitate exonucleazicd (3*-5) excizand nucleotide de la
capital 3J al catene! in cretere.
Atributele enumerate permit ADN polimerazei III sit exercite, pe langd
activitate polimerazicd, i o important# activitate de control al replicdrii,
asigurand procesului o inaltd fidelitate.
Funcjia ADN polimerazei II este ined obscurd.
ADN polimerazei I ii revin sarcini speciale in evenimentele replicdrii i
repardrii leziunilor ADN, derivate dintr-un atribut pe care nu-1 impdrtdete
cu celelalte ADN polimeraze i anume activitatea 5-3 exonucleazicd.
In cazul eucariotelor existd o multitudine de ADN polimeraze avand
atribute specifice.
e) ADN ligaza enzim'd ce reunegte fragmentele ADN rezultate in cursul
repliedrii. ADN-ligaza catalizeazd formarea unei legSturi fosfat diesterice
intre extremitatea 3-OH a unui fragment de ADN i extremitatea 5
monofosfat a altuia. Enzima necesitd prezenja unui donor al unui rest de acid
adenilic (ATP la eucariote, NAD la procariote)
164
care se fixeazS la capital 5 monofosfat al unui fragment, generand o
structure de tipul -O-P-P-RibozS-AdeninS.
Capital 3-OH terminal al celaila.lt fragment atacS iegStura -P-P i,
eliberand AMP, stabilegte o !eg3turS fosfatdiestericS care reunete cede
douS fragmente de ADN (Fig. IV. 15).
Complexul de factori care participS la replicarea ADN poartS numele de
replizom sau sistemul ADN replicazS.
5'
3*
5'
( >B5f
AMP
/ OH 3'
o[PC! P

^OH

(X'
.....N ....."*
EE
IP-R-AI
P
AMP
R
s

rA
Fig. IV.15 - Mecanismul de ac|iune a ADN ligazei
Replicarea ADN la procariote
DesfSurarea procesului de biosintezS a ADN la procariote implicit
urm&txwea. succesiune de evenimente: inifiere, elongare, terminare a
replicarii.
1. Inijierea replicarii se produce in puncte bine determinate, avand
caracteristici distinctive u^or de recunoscut de cStre enzimele mifierii
(helicaze, topoizomeraze, ADN primaze), denumite regiuni-origine (ori). La
Escherichia coli ar exista o singurS regiune ori. Aceste regiuni conjin
secvenje ,,consens foarte bine conservate de-a lungul evolufiei, bogate in
perechi A=T, rccunoscute de proteina dna A responsabilS de corectitudinea
ini|iem. Duplexul de ADN circular se replies simultan in ambele direejii;
cromozomul bacterian arc in timpul rcplicSrii forma literci theta. (Fig. IV. 16).
Regiunea activS in replicare la un moment dal care se deplaseazS de-a
lungul duplexului parental este desemnatS drept bifurca{ie de replicare*4.
Pe cromozomul bacterian evolueaza douS bifureajil de replicare, una in sens
orar, cealalta in sens antiorar, Replicarea bidirectional# s-a dovedit a fi
uzualS atat la bacterii cat i la virusuri,
Iniperea replicSrii parcurge douS etape:
a) desfacerea duplexului parental pe anumite porfiuni replicatori sub
acfiunea helicazelor (proteine dna B); procesul, presupunand ruperea
legSturilor de hidrogen dintre bazele complementarc, se produce cu un
substantial consum de energie (ATP). Desfacerea duplexului parental
(denaturarea acestuia), realizatS initial pe o por{iune micS de ADN (in
regiunea oriu), continu# de-a lungul moieculei pe mSsura inaintSrii
165
0

Fig. JV.16 - Replicarea bidirecjionaia a unui cromozom circular


bifurcafiilor de replicare, precedate de helicaze. Reunirea catenelor de ADN

formate (renaturarea) este prevenitd de cdtre proteinele de stabilizare a ADN


monocatenar care se leagd cooperativ la acesta. Desfacerea duplexului ADN
permite accesul replizomuiui la fiecare dintre catenele ADN parental, ce vor
constitui matrije pentru sinteza a cate unei catene fiice; ilustrarea procesului
se va raporta la una dintre bifurcajiile de replicare.
Intrucat duplexul circular se desface (se desrdsucete) in regiunea
bifurcajiei de replicare cu o vitezd de aproximativ 100 de revolujii/secundd,
apar, inevitabil, supertorsiuni, regiuni superhelicoidale, dincolo de limita
bifurcajiei de replicare. Intr-o moleculd circular^, avansarea bifurcajiei de
replicare genereazd supertorsiuni pozitive, care pot bloca replicarea. Am
vdzut cd ADN-giraza (topoizomeraza II) introduce in molecula ADN
supertorsiuni negative, astfel incat constrangerile impose de avansarea
bifurcajiei de replicare sunt in mare mdsurd contracarate 'i replicarea nu
este sfanjenitd. Altfel spus, ADN-giraza, introducand torsiuni negative ale
dublei helice, in sens contrar celor create de inaintarea bifurcajiei de
replicare, compenseazd, in avans, constrangerile impuse de derularea
catenelor ADN. Interesant de notat cd acidul nalidixic (Negram) i derivajii
sdi fluomraji (norfloxacin), superior! prin toxicitatea redusd i prin faptul cd
nu dezvolta rezistenjd plasmidicd transferabild, suprimd cregterea i
multiplicarea bacteriand prin inhibarea ADN-giruzei.
Torsiunile pozitive pot fi eliminate i prin acjiunea topoizomerazei de tip I.
ADN- topoizomeraza I acfioneazd ca o endonucleazd reversibild. Ea incizeazd
o legdturd fosfat diestericd de pe una dintre catenele ADN, permij&nd astfel
celor doud capete ale ADN sd se released unul fafd de celSlalt; starea
superhelicoidald este desfiinjatd. Acjiunea de suveic& a topoizomerazei I
duce la relaxarea termodinamic avantajoasd a ADN. Este necesard, desigur,
refacerea legdturii fosfat diesterice incizate. Intrucdt energia legdturii fosfat
diesterice originale a fost eonservatd intr-o legdturd fosfat esteried,
implicand tirozina din centrul activ al enzimei, reaejia este reversibild i nu
necesitd apart energetic (Fig. IV. 17). Conlucrarea ambelor categorii de
topoizomeraze reuete sd scadd stress-ul topologic produs de helicazd.
166
b)
Construirea unei molecule de ARN inijiator (primer) al polimerizSrii
dezoxiribonu- cleozid trifosfajilor in regiunea oriT Primerul este reprezentat
de un ARN de mici dimensiuni (5-10 ribonucleotide) i este realizat prin
acjiunea ADN-primazei, asistatd de alte protein-enzime (complexul
primozom). De menjionat cd etapa de inijiere a replicdrii controleazd intregul
proces, prin mecanisme incd neelucidate.
2.
Elongarea (alungirea) ARN initiator constd in addugarea succesivd
de dezoxiri- bonucleozid fosfaji la capdtul 3 al acestuia. Reacjia decurge prin
atacul nucleofil al grupei OH de la capdtul 3 al moleculei primer asupra unui
dezoxiribonucleozid trifosfat aliniat in ordinea dictatd de matrifd (ADN
monocatenar), cu care formeazd legdturi de hidrogen. Reacjia are loc sub
acjiunea ADN polimerazei III i duce la formarea unei legdturi fosfat
diesterice ce inifiazd propriu-zis catena ADN fiicd (Fig. IV.18).
Clivarea restului pirofosfat sub acjiunea pirofosfatazei, enzimd prezentd in
toate Jesuturile, asigurd ireversibilitatea reacjiei de polimerizare, devenitd
termodinamic avantajoasd. Nu trebuie ignorat faptul cd energia eliberatd in
cursul interacjiunilor slabe, dar numeroase, pe care le stabilete nucleotidul

introdus (legdturi de hidrogen, forje de stivuire), favorizeazd, de asemenea,


procesul. Reacjia se repetd pand la parcurgerea integrald a matrijei ADN
dintr-o anumitd unitate replicatoare. Bifurcajia de replicare avanseazd prin
desfacerea unei noi porjiuni din duplexul parental realizatd de helicazd,
asistatd de ADN girazd i de proteinele de stabilizare a monocatenelor.
Jinand searna de capacitatea ADN polimerazelor, din orice sursd, de a
cataliza numai sinteza unui lanj polinucleotidic cu direcjia 5*ar rezultd cd
numai catena cu direcjia 3>5 dintr-o bifurcajie de replicare poate fi
copiatd. Totui, sinteza catenei avand ca matrijd catena cu direcjia 5>3 se
face tot in direcjia 5>3, ea evoluand, formal, in direcjie opusd deplasdrii
bifurcajiei de replicare.
Replicarea catenei 5>3' i construirea unei replici cu direcjia 5-3
este, evident, discontinud. Odatd cu avansarea bifurcajiei de replicare
(dilatarea replicatorului), noi molecule de ARN primer vor fi sintetizate la
capdtul 3 al catenei parentale, molecule pe care se vor construi fragmente
mici de ADN, denumite fragmente Okazaki. Acestea au dimensiuni de 10002000 nucleotide la procariote i de numai 150-200 la eucariote.
Excluderea ARN primed din catenele nou-formate, nucleotid dupd
nucleotid, prin acjiunea exonucleazicd a ADN polimerazei I, presupune
obligativitatea de a umple golurile rdmase cu dezoxiribonucIeoti.de.
Operajia este efectuatd tot de ADN polimeraza I, in conformitate cu rolul sdu
poiimerazic. Fragmentele ADN rezultate vor fi sudate prin acjiunea ADN
ligazei, cu consum de ATP.
In Figura IV. 19 sunt redate etapele replicdrii pe una dintre bifurcajiile de
replicare. Evident, in timp ce sinteza uneia dintre eatene este continud,
sinteza celeilalte este discontinue; ele au fost desemnate drept catend in
avans (leading strand) respectiv catend ln intarziere (lagging strand).
Replicarea moleculei de ADN este semidiscontinud.
Cum replicarea este bidirecjionald, pe cealaltd bifurcajie de replicare
evenimentele decurg identic.
3.
Terminarea replicdrii are loc atunci can cl cele doud bifurcajii de
replicare se mtalnesc intr-o regiune opusd regiunii ori. Proteine specifice
semnalizeazd oprirea replicdrii prevenind acjiunea helicazelor.
Uti
m
:

-v

old
U-. 2
:;
:n
I s i /:\
167
HO-TiROZiNA ENZIMA
i

5' - T-0-A~<g) - T-0--C-0-G-- A--3


TIROZINA ENZIMA
OH
2)
3-0- A 4P> T -CP)- A-(R
M
i!
n
ui
II
H
it
HI
H
M
il
Hi
-5!
5'
T-~A-0- T-0- C--G<P)/ A--3
-cm\i
HI T It
3)
TIROZINA-ENZIMA
0OH
3--A-0-T-0-A^P) 6-0-C-0-T- -5'
m
m
Hi
H
II
H
5' T~ - A-- T-0- C-0-G-0- A--3'
4)
ENZ MA -TIROZINA-OH
3- -- A -P T - - A-0 -G-0-C -0-T-0 -5
i I!
m
HI
HI
m
HI
H
li
il
5' <P)-T-(P)-A 0 - T-0-C~(F>) -G-0- A-0-3
Fig. 1V.17 - Reactia catalizata de ADN topoizomeraza !
5
..
p
..
/
T

i
- / ?'
OH
/
r
A_____/
"'P J
s
/
7/
/
/
u, P-P-P

/
/

'VDH
&

/
/
p7
/

___ c -

P7
... I j _ /

p/
/
/
3
5'
P
/
R7
/
/
P7
/
P7
/
P

P7
_ .Z
-7

.
-^
OH

E
C
L

py

Z
c
c
<

z
/
p

j -pp
?
T
C
OH
T
P7
A

- - - -U
-

. Z ..
P/

v:: c /
/
" g:/.
P

J
w
C
D

____
G
V

/
A

--- - y

____
z__^

s
_
<
L
>

a
.
2
C
C
<

p7
p/
/_____
- ^
-c
vG
3
OH
p
l
Fig. IV. 18 - Eiongarea primerului ia capaiui 3OH
cn, .00
GiRAZA

SINTEZA UNUi NOU ARN PRIMER ( PRIMAZA)

EXCLUDEREA ARN PRIMER! Si COMPLETAREA QOLURILOR (ADN POLIMERAZA I


)
t

Fig. IV.19 - Etapeie biosintezei ADN


169

Despre mecanismul separftrii ceior douft molecule de ADN circular,

rezultate prin replicare, au se tie aproape nimic.


Relativ recent , s-a postulat un model de replicare a ADN care fine seama
de faptui eft aceasta se desfaoarft in vivo cu viteze egale pent.ru ambele
catene (Fig. IV.20), care admite eft:
L replizomul este ancorat la membrana nuclearft, deci relativ fix, iar
molecula de ADN il tranziteazftu;
2. formarea unei bucle (loop) de cfttre catena matritft cu direcfia 5->3
permite catenei Jagging1 sa fie sintetizatft simullan i in aceeai direcfie cu
catena JeadingA cea a bifurcafiei de replicare.
3. sinteza ceior douft catene este concomitentft, fiecare dintre ele
devenind subslrat pentru subunitftfi diferite ale ADN polimerazei III care este
un dimer asimetric.
Subunitftfile cu aclivita|i polimerazice ale holoenzimei ar diferi prin aceea
eft subunitatea responsabilft de sinteza catenei pleading11 se asociazft ferm
cu o subunitate p, care-i create procesivitatea (abiliialea de a adftuga
nucleotide continuu, fftrft sft se disocieze de catena in credere - vezi mai
deparie). Pentru catena Jagging11 esenfialft este viteza reaefiei de
polimerizare i no procesivitatea.
Modelul propus, a eftrei esenfft este replicarea simultanft a ceior douft
catene in i pe direcfia bifurcafiei de replicare pare un model valid.
De remarcat un avantaj important al acestei modalitafi de replicare:
proximilatea situsurilor de terminare i incepere a douft fragmente Okazaki
ce se succed permite Iransferul concertat i rapid al dispozitivului de
replicare de la un primer la altul.
Fidelitatea procesului de replicare la procariote, Replicarea ADN, utilizand
un aparat enzimatic extxem de elaborate reuete sa asigure, prin inalta sa
fidelitate, menfinerea capitalului genetic al speciei.
170
Crearea unei catene noi, perfect complementary cu catena matrijy, se
realizeazS atat prin respectarea principiuiui complementaritSjii bazeior cat gi
prin activitatea de autocontrol a ADN polimerazei III. Aceasta, pe langd
activitate polimerazicSt, prezinE gi o important activitate de corectare a unor
erori, rezultat al atributelor enumerate anterior. De subliniat c& ADNpolimeraza III stabilegte o legSturS fosfat diesteriCcf intre capStul 3-OH al
catenei in cregtere gi nucleotidul unrEtor, numai dacd la capStul 3-OH se
giisegte un nucieotid corect imperecheat cu catena matnp. Enzima are
calitatea de a descoperi o eventual^ eroare de imperechere matrifSdezoxiribonucleotidul impropriu (incorporat la cap&tul 3-OH al catenei in
cregtere) gi de a selecta pe cel adecvat. O asemenea situajie poate sS
decurgS. din aparifia tranzitorie a unor forme tautomere rare ale bazeior
azotate (frecvenfa este de 104 - 105). Astfel, citozina in fornE imino, gi nu
amino, se imperecheazM cu adenina gi nu, firesc, cu guanina. Aceastd
imperechere gregiE este numai temporary citozina revine la forma amino,
uzuaE, care nu se poate imperechea cu adenina; situa|ia este sesizaE de
ADN polimerazll, care nu mai continue elongarea catenei av&nd la capHtul
3-OH un nucieotid neimperecheat. Prin activitate exonucleazicS 3x5\
enzima exclude citozina, reludnd elongarea catenei. In ipoteza unor erori
repetate, ea igi continua activitatea exonucleazicS pand cand g&segte
eap&tul 3-OH adecvat (imperecheat cu matrija). Aceasta activitate de

supercontrol a ADN polimerazei III eliminS erori ce s-ar fi comis dacS singurul
mecanism de control ar fi fost respectarea principiuiui complernentariEjii
bazeior. Intr-adevir, dacii ADN polimeraza III n-ar fi fost inzestraE cu activitate
de corector, perechea adenind-citozirE s-ar fi menjinut in ADN non sintetizat,
generand o mutafie.
Incapacitatea ADN polimerazei III de a ini Jia catene polinucleotidice,
respectiv necesitatea unui primer, nu este un handicap al enzimei ci o
necesitate impusd de exigenjele procesului de replicare; ADN polimeraza III
poate s& exclude un nucieotid impostor numai dacfi acesta se aM la capStul
3 al unui lanj polinucleotidic in cregtere, ceea ce ar permite o inijiere
defectuoasl
Solujia pare a fi intr-adevar o inijiere mai aproximativS, prin sinteza unui
ARN primer, sub acjiunea unei ARN poiimeraze lipsitS. de activitate de
corector, gi excluderea ulterioaE a acestuia, care va fi inlocuit. cu fragmentul
de ADN corespunz&tor.
InsSgi alegerea unui sens unic al replicSrii, i anume cel cu direcjia 5"
>3% contribuie la asigurarea acuratejii procesului, permijand ADN
polimerazei sil-gi exercite acfiunea de autocontrol si corectare a erori!or.
Dacd lan{ul sintetizat ar avea direcfia
gi la
cap&tul S ar apare o gregeaE de imperechere, excluderea
dezoxiribonucletidului impropriu ar face imposibiM continuarea replicSrii in
condifiile date, de unde necesitatea pSstrSrii lui, chiar cu preful
compromiterii fidelitStii, aproape absolute, a procesului.
Ca rezultat al funcpei de corector a ADN polimerazei gi al imperativului
complemen- taritS|ii bazeior, frecvenja erorilor in procesul de replicare a ADN
este de una la 106 - 107 pexechi de nucleotide. Totugi, frecvenja erorilor in
ADN al Escherichiei coii este de numai una la 109 perechi de nucleotide,
grape unui sistem enzimatic ce acfioneazS post-replicativ (vezi mai departe).
Pe langii activitatea de corector, ADN polimeraza III este o enzimS cu o
capacitate cataliticS excepJionaE; ea reugegte sS adauge in cursul elong&rii
aproximativ 60 000 de nucleotide pe minut. Viteza extrem de mare de
polimerizare o face demiE de rolul pe care gi-1 asumS in sinteza ADN.
171

".
v;i j

Un numSr mic de molecule de ADN polimerazS Ill prezente lntr-o celulS


bacterianS (aproximativ 1.0 molecule) reuete s& asigure o vitezS adecvatS
sintezei discontinue a catenei Jagging44, ceea ce presupune i reciclarea44 lor
rapids intre capStul unui fragment Okazaki i capStul 3 al primerului
anterior.
O a treia calitate a ADN polimerazei III, care o distinge, este
procesivitatea, respectiv abilitatea de a adSuga nucleotide la catena in curs
de sintezS fM sS coboare de pe matrijS. ADN polimeraza III catalizeazS
formarea a mii de legSturi fosfat diesterice fSrS sS se disocieze de matrijS,
ceea ce o consacrS ca enzimS cu procesivitate remarcabilS, calitate extern
de important^ pentru sinteza catenei leading. Viteza foarte mare a reacjiei
catalizate dec urge, in speJS, din atributul de procesivitate al enzimei.
Acuratejea, procesivitatea i eficienja cataliticS proprii ADN polimerazei III
sunt calitSji pe care le reclame rolul s&u in replicare.

In contrast, ADN polimeraza I are procesivitate redusS i capacitate


cataliticS micS, in acord cu atribujiile sale in replicare; excluderea primenlor
i umplerea golurilor rSmase.
Repiicarea la eucariote
In linii mari, repiicarea la eucariote se desfSoarS dupS modelul descris,
cu particularitSji derivand din organizai*ea genomului eucariot.
Ca i la procariote, s-au identificat mai multe tipuri de ADN polimeraze i
anume;
a, p, y, 8.
ADN polimeraza a este implicate in repiicarea ADN nuclear. Ea este
formats din patru subuni tSji, av&nd proprietSji i structuri similare in toate
celulele eucariote. Cum procesivitatea acestei enzime este relativ micS i
una dintre subunitSJi manifests acjiune primazicS, se suspecteazS cS ea este
responsabilS de sinteza catenei flagging44.
ADN polimeraza 5 este un dimer asocial cu o proteins - antigenul nuclear
din celulele proliferate; aceastS proteinS, prezentS in cantitSji mari in nucleul
acestor celule, stimuleazS ADN polimeraza 8, crescandu-i procesivitatea.
Se considers cS ADN polimeraza 8 rSspunde de sinteza catenei Jeading44.
Ea manifests acjiune 3->5 exonucleazicS.
ADN polimeraza P este implicatS numai in repararea ADN, nu i in
repiicarea acestuia; manifests acjiune 5-3 exonucleazicS.
ADN polimeraza y este implicatS in repiicarea ADN mitocondrial.
Polimerazele nu manifests, in general, acjiune 3-5 exonucleazicS, ceea
ce sugereazS existenja unor mecanisme de asigurare a fidelitSjii diferite fa{S
de cele ale procariotelor; se admite existenja unor exonucleaze ca entitSJi in
sine.
Existenja ADN ligazelor i izolarea fragmentelor Okazaki pledeazS pentru
discontinui- tatea replicSrii (ca i in cazul procariotelor).
DatoritS mSrimii moleculei ADN eucariot, cat i depiasSrii relativ lente a
bifurcajiei de replicare (aproximativ 3000 baze/minut, fatS de 16 000 la
procariote), rezultat al organizSrii superioare a genomului, pe o moleculS de
ADN exists mai multe origini de replicare, separate prin 3.104 - 3.105 perechi
de baze. In aceste origini multiple de replicare se organizeazS bifurcajii.de
replicare (aproximativ 100 pe fiecare cromozom) ce se deplaseazS
bidirecjional pe cromozomul eucariot in curs de replicare.
n; c IV
ilia
172
Fig, IV.21 - Fazele cidului ceiular

Mitoza

Fidelitatea lepiicSrii este la eucariote de ordinal 1CT9, rezultat, probabil, al


insdi naturii cromozomului eucariot i al acjiunii unor exonucleaze 3 -^5
care secondeazit ADN poHmeraza.
Biosinteza 'ADN are loc la mamifere in faza S, de sinfezd, a ciclului ceiular,
fazd separata de faza mitoticS prin perioadele de gol sintetic, G, i G2 (Fig.
IY.21). In cursul acestei faze, ADN nuclear este replicat in intregime i o
singurd data per ciclu ceiular. Respectarea acestui imperativ este posibilS.
grafie unor procese de metilare care marcheazS covalent molecula ce a
trecut prin experienfa replic&rii. Marcarea constS intr-o metilare, in general a
citozinei, la 5-metil-citozM, efectuatd de ADN metilaze care folosesc ca
donator de grupare metil SAM (S -adenozil metionina).
Gradul de metilare a citozinei este extern de variabil, de la 3-5% pentru
regnul animal, la 33 % pentru cel vegetal (virusurile animate se sustrag, in
general, metii&rii). La eucariote secvenfa recunoscuhl de c&tre metilaze
este:
5* - GG - 3*
3* - GC - 5'
metilarea decurgand pe ambele catene.
In eucariotele superioare un num&r restrains de celule se divid activ; cele
mai multe sunt refinute, dupft mitozd, in faza G0, de nondiviziune (resting
phase).
Decizia intr&rii din faza Gc in faza Gj i apoi in faza S, urmatS de mitozft, este
luatil de
proteine cu activitate kinazic& (variabile cu specia) activate prin
interacfiunea cu diverse cicline - proteine a c8ror concentrate create sau
scade dramatic In cursul ciclului ceiular.
Celuiele tumorale tiu s& evite faza G0 a ciclului ceiular.
Ritmul sintezei de histone este cel al sintezei ADN, grafie copiilor multiple
ale genelor ce specific^ histoneie (40 de seturi, fiecare confin&nd genele
corespunz&toare celor 5 tipuri de histone). In faza S cantitatea de ADN i
histone se dubleazH.
Durata fazei S variaz& cu specia; la mamifere este de aproximativ 8 ore.
Dac& ar exista o singurM bifurcafie de replicare care se deplaseaza cu o
vitezd de 50 nucleotide/secundd pe un cromozom confin&nd aproximativ 150
milioane de nucleotide, ar fi necesare aproximativ 800 de ore - de unde
necesitatea funcjionftrii sincrone a peste 100 de bifurcajii de replicare per
cromozom.
Diferite regiuni ale fiecdrui cromozom sunt replicate in momente diferite
ale fazei S, dar invariabil in aceeai secvenfd.
Controlul replicMi i diviziunii celulare ridicSt probleme numeroase, la care sa
rdspuns, cel mult, parfial.
Sinteza de ADN pe matrifa de ARN
Fluxul de informafie genetic# in lumea vie are, in general, seasul ADN >
ARN Proteine. In ultimii ani, s-a identificat in virusurile oncogene
conjinand ca material genetic ARN o enzim# a c&rei existenfS era greu de
pievSzut care a completat conceptul expiimat prin dogma central#" a
genelieii moleculare. Aceast# enzimd, revers transcripfaza, este o ADN
polimerazS ARN - dependents. Ea are'abilitatea ca, o dat# pdtruns# in celula

gazdd, sS sintetizeze un hibrid ADN-ARN, mai exact sS construiascS o eaten#


de ADN pe matrifS de ARN. ARN viral este degradat enzimatic iar catena
ADM rSmasd se autoreplic# dand natere la un duplex ADN ce confine
informafia prezent# in ARN viral (Fig. IV.22),

ADN
duhlu catenar
Inserfia ADN
Fig. IV.22 - Repibarea ADN pe ma- trifa de ARN sub acpunea ADN polimerazei
- ARN dependent# (revers transcriptaza)
Ambele procese sunt catalizate de c&tre revers transcriptaza in virtutea a
douS activity enzimatice adifionaie de care dispune:
1) activitate ribonucleazicS, ce-i permite s# hidrolizeze ARN din hibridui
ARN/ADN (de unde i desemnarea sa ca ribonucleaz# II);
174
2) activitate ADN polimerazidt ADN - dependents.
Primerul foiosit de revers IranscriplazS in activitaiea sa. polimerazicS este,
surpiinzS- tor, un ARNt inglobat in particula viralS (preluat in cursul unei
infecfii anterioare).
ADN rezultat prin revers transcriere se insert in genomul gazdS putanduse exprima in proteine, intr-o anumitS conjuncture.
Cum numeroase virusuri ARN sunt oncogene i genomul viral este
motenit, se considers eft fiecare subiect uman este purt&torul unei
oncogene neexprimate, ca rezultat ai pfttrunderii in organism a unor astfel
de virusuri ARN (retrovirusuri), intr-un moment al evolufiei. Dacft apare o
condifie care sft le favorizeze exprimarea, deci dacft vor fi transcrise i
traduse, celula se malignizeazft prin acfiunea unor proteine ce realizeazft
transformarea neoplazicS (adesea kinaze).
Revers transcriptaza comite gregeli, neavand activitate 3->59
exonucleazicft; acest fapt ar constitui una dintre explicable varietftfii mari de
tulpini virale producfttoare de boalft.
Un retrovirus, prin excelenfft versatil,virusul imunodeficienjei umane (HIV)
este rftspunzator de sindromul imunodeficienjei dobftndite (SIDA).

Acest virus are un design comparabil cu al celorlalte retrovirusuri,


confinand , obligatoriu genele pol, env i gag. Acestea specifics revers
transcriptaza i o enzixhft.de integrare in genomul gazda (pol) cftt i proteine
necesare asamblftrii particulei virale (gag, env) in cursul multiplicftrii:
Integrarea in genomul gazda presupune, pe langft o integrazft, secvenfe
nucleotidice specifice la ambele capete (Long Terminal Repeats),
Virusul imunodeficienfei dobandite dispone de multe alte gene care, prin
splicing altemativ, produc un numftr impresionant de proteine benefice lui.
Versatilitatea acestui virus derive, in spefft, din lipsa de acuratefe a revers
transcrip- tazei, avand ca rezultat un. numftr mare de mutafii, deci de
variante HIV, i o eficienfft redusft a tratamentelor.
Descoperirea revers transcriptazei, pe langii semnificafia ei teoreticft, are
i o important^ laturft practice rezultatft din faptpl eft, deji prefers propriul
ARN (viral), erizima poate utiliza ca matrifft orice ARN pe care construiete
un ADN complementar (ADNC). Apare astfel posibilitatea obfinerii unor gene
sintetice (ADNC), prin utilizarea unof ARN mesageri, relativ uor de izolat,
gene care, prin tehnicile ingineriei genetice, pot produce mari cantitftfi din
proteina codificatft.
IV.4, ACIZII RIBONUCLEICI
IV, 4.1. TIPURI DE ARN
Sunt produgi macromoleculari care iau na^tere prin condensarea.
rihnniidmtldelnr. Ribonucleotidele ce alcfttuiesc molecuia de ARN stabilesc
legftturi fosfat diesterice intre guparea OH din uozitia T a unui nucleotid i
gruparea OH din pozajiaA a nucleotidiilui succesiv (Fig. IV.23). Din punct de vedere al compozifiei in baze, ARN confine, ca i ADN,
guanina, citozina i adenina. dar, spre deosebire de acesta, cea de-a patra
bazft nu este timina, ci uracil ul. Pe langft aceste baze, ARN confine i baze
aa-zise mmore\ rezultate prin metilftri, tiolftri ale bazelor majore.
Componenta glucidicft din structura ARN este riboza i nu dezoxiriboza.
i.
i

175

if ;
yii-i;

il f >

Fig. IV.23 - Structura covalenta a ARN


5*
________________________________________________
UGGCGUUCGUACUUAAAUAUGGAAU \ Fi9- !V-24 ' Structura ARN mo|g|||||j|
j||
| | j| | |
3>j nocatenar conjinand porpuni cu
GCCUCAAGCAUCGCUUUCAACCUUA j, ')
Jiuni cu baze necomplementare
3s
Confinutul In adenind este diferit de cel in uracil i nici cel de guaninM nu
este egal
cu cel de citozinfi. Q_ structura dublu. catenary complementary este exclusS
pentru.
ARN. Moleculele de ARN sunt monocatene, dar, pe anumite porjiuni, acolo
unde o perrmte complementaritatea bazeior se organizeaz& in structuri
dublu helicoidale. Portiunile de baze necomplementare sunt expulzate ca
bucle in afara zonelor de dublu helix dand moleculei aspectu! de (Fig. IV.24).
Cantitatea de ARN, spre deosebiS <ie cea de ADN, variazS de la o celul& la
alta gi
chiaFin ca^l ace|eiai celule,
proteinelor la momentnl dab
PupFrolui ce le revine in procesul de biosintezd a proteinelor ARN pot fi:
ARN mesager (ARNm)
ARN de transfer sau solubil (ARNt)
ARN nboz^mal (ARNr)

ARN nuclear scurt Ide jrnjcjidimensiune)


176
ARN mesager (ARNm)
Jinand seama d.e faptul ca molecula de ADN se gtsete In nucleu, in timp
ce biosinteza proteinelor se desf&oar& in citoplasmS, Jacob i Monod au
postulat existenfa urrni intermediar care aduce mesajul genetic .din nucleu
in citoplasmjL Acest intermediar s-a dovedit a fi o molecula de ARN,
denumitS ulterior ARN mesager,
Moleculele de ARNm sunt molecule monocatenare liniare. de, lungime
variabilft.
ARN^ este sintetizat in.nucleu ^D^niatrigei^ ADN. O genS structural^
este
transcnsa* in sensul complementarit&tii bazelor (A corespunde la U, iar G la
C), objinandu-se o rnoleculd de ARNra a cftrei cornpozifie in baze reflects
compozifia in haze a genei transcrise.
ARNn nuclear iese in citoplasmS (la eucariote dupS .,preluerarea sa i
formarea unui A.RNni matur), unde va servi ca matrifft (template) pentru
sinteza unui pohpeptid cu
sec vents specifics de aminoacizi. Fiecare aminoacid este codihcat de cStre o
secvenfft de trei nucleotide, denumitS codon, CapStul 5 al ARN m confine o
secvenfa care no este tradusS in proteine, denumitS secvenfa ,deader" (la
procariote, include secvenfa Shine Dalgamo); capStul 3' confine $i el o
iegiune netradusS, cunoscutS ca secvenfa ,,trailer A
La procariote, o moleculS de ARNm poate sS confinS informafia pentru
sinteza unui singur polipeptid (ARNT monogenic sau monocistronic) sau a mai
multor polipeptide implicate in aceeai cale metabolicS (ARN^ poligenic. sau
policistronic). Cistronii sunt separafi prin regiuni intercistronice sau
,,spafiatoriA
La procariote, intre gena transcrisS, ARNm i proteina specificate de genS
exists o relafie de colinearitate, succesiunea tripletelor nucleotidice intr~o
genS. corespunzand exact celei a aminoacizilor in proteina codificatS.
La eucariote, ARNin rezultat al transcrierii este monogenic i, cel mai
adesea, cu mult mai lung decat ARNm citoplasmatic. i la eucariote, ca i la
procariote, la capetele 5 i
3 se gSsesc regiuni netraductibile. Genele
care codificS proteine, sunt,
in general,
intrerupte de sccvenfe de ADN necpdifipatoare,. iolronj (intervening
sequences). Secvenfele codificatoare, separate prin introni, poartS numele
de exoni (expressed regions). Dogma coiinearitSfii genS-proteinS, valabilS la
procariote, este incSlcatS la eucariote, la care continuitatea infonnafiei
genetice este desfiinfatS. Gena nu mai este corespondentul structural al
ARNm, subject al traducerii, fiind cu mult mai lungS decal ar fi necesar pentru
codificarea unui anumit polipeplid. ARNm rezultafi prin transcriere, respeciiv
ARN,n iranscripte grimaie sau ARNrn precursor!, sunt supui unor prelucrari
diverse avand ca rezultat obfinerea unor ARNm de dimensiuni diferite, funefie
de stadiul de prelucrare la care se g&sete fiecare exemplar, reunifi sub
numele de ARN nuclear heterogen; un ARNm produs final al procesului de
prelucrare este un ARNm matur.
Prelucrarea ARN... nuclear genereazft unui sau, uneori, mai mulfi ARN,

maturi, care vor servi ca matrite pentru sjnteza -unuia sau a mai
mul1or.-..nolipeptideJgcygnte specif ice, de aminoadzL^
Timpul de supraviejuire a ARNm in celuia este variabil. ARNm bacterian are
o..........................................................................................viajh
foarte scurth (2-3 minute); dupd ce servete la sinteza catorva zeci...de
.exemplare din proteina pe care ^itccifica' egej^rMaLdb^micIeaze.
La eucariote, ARN, are o viafh de ordinal orelor; aceasta diferenfd este
uor de infeles finand seama de fluctuafiile mari de mediu la care o bacterie
se obstineazir sh se adapteze continuu.
177
AKN tie transfer (ARNt)
Moleculde de ARN, sunt molecule mici (70-90 nucleotide), monocatenarg,
In care procentul de baze complementare este deosebit de mare fajd. de
celeialte specii de ARM* 'Raportul A+G/U+C din ARNt este apropiat de 1.
ARNt nuclear, nu gi cel mitocondrial, prezintS o conformajie in .dome de
trifoiA avand 4 zone deperechi complementare gi 3 necomplementare.
expulzatecu bucle (Fig. IV.25).
5*
-<?QbHU (iif^dmahtd^rui
H2

/
o DHU
Vt
-o~o.
95&
1
o9i
3'
9
c
9
Brat
aminoacid
9t
O
\
O-O-O-O-O
.o-q
Bra( 9
rwcP
O-O-O-O-fXj^P
b'O~0h

u'Q9
0
1
p
p
'0-0 Braf adlponal
~o-oy
O-c
! I 1 Bra} anticodon
Fig. IV.25 - Structura tridimensionala a ARNt
La capStul 5 terminal, cei mai mulji ARNt au restul acid guanilic, iar la
cap&tul 3\ top. au secvenfa nudeotidicS CCA. La cap&tui buclei inferioare se
g&segte aga-numita portiune anticodon, care variazS cu natura ARN t. i alte
secvenje nucieotidice sunt important in procesele de recunoagtere; de
exemplu, in brau]JDHU exists o secventS. nucleotidicS care recunoaste. gi
se leagS la aminoacil-ARNr"Sintetaza, enzimS care... JncarcSRAELLxn un
aminoacid specific, activat. In braful PRC, o anumitS secvenja nucleotidicS
asjgurS legarea la ribozom a complexului. aipinoacil - ARN
178
o
Toate tipurile de ARNf au on procent neobisnuit de mare de baze rninore;
A.
HN NH

OH OH
Pseudouridina (^V)

OH OH 4-Tiouridina
O

OH OH
Dihidrouridina (DHU)

CH3
HOH,
k
f3C \
O'

OH OH
Ribotimfdina (T)

OH OH 3 - MetifcitidinS

N
J
HOHfC |
C?
OH OH Inozina
In procesul de biosintezS a onitemeier, ARNt are de Indeplinit dooa func(ii:
1. Transports aminoacizilor activati in faza solubilS, la ribozomi, sub formS
de complcxe aminoacii - ARM. FiecSraia dintre cei 20 deaminoacizi care intrS
in stnictura profeliefof il corespunde cel pujin un ARNt specific. Exists, cel
pujin 20 de lipuri de ARNt. In general, exists mai mul{i ARNt specific! pentru
un aminoacid - ARNt izoacceptori - fapt explicabil prin caracterul degenerat al
codului genetic (un aminoacid poate fi specificat de mai mulfi codoni).
Legarea aminoaeidului se face la reziduul adenilic din secvenja CCA i
constS in stabilirea unei legaturi macroergice intre -OH din 35 al adeninei i
restul acil al aminoaeidului (vezi sinteza profceineior).
2. Adaptarea gninoaciduiui transportat In dreptul codpnului de pe
ARNL.care-1 specifics. AceastS racordare a. aminoaci3uiui este posibilS prln
recunoagterea codon-anticodon. Porjiunea anticodon din ARNt este
complementers. succesiunii de nucleotide din ARNm ce codified aminoacidul
transportat de ARNt respectiv gi ca atare cele douS regiuni pot stabili legSturi
de hidrogen (Fig. IV.26). ARN, este relativ slabil la.procariote gi mai putin
stabil ia eucariote.
Fig. IV.26 - Recunoag- terea codon - anticodon
3'
A ~ aaf
C
C
A ~ BB2
C
C

iM
m
m.
m
m
m
'Id
t
in
M :: i

179
ARN ribozomal (ARNr)
Moleculele de ARN, sunt rnacrornolecule flexibife. si deformafaiM, care
contin. zone dubiu catenare Mrerupte de zone monocatenare,
Extrem de heterogen ca forrnS i inMrime, ARNt se fmparte, in funcjie de
constanta de sedimentare (S), care depinde de mSrimea i forma particulei,
in;
ARNr 23 S, 16 S i 5Ji la procariote i
ARNr 28 S, IB S, 5,8 S i 5 S la eucariote.
ARNr reprezinta tipul de ARN cel mai abundent (aproximaliv 75% din
totalpl .de ARN.. celular) i cel mai stabil metabolic..
ARNr se agregd cu prot:eine,"3Iverseiaii lipide, constituind particule
ribonucleoproteice denumite rihozomi (desccperiji de George Palade). Dupd
valoarea constantei de sedimentare, acetia pot fi 70 S la bacterii i 80 S la
eucariote.
Ribozomii pot disocia reversibil in dou& subunit5|i; 50 S si 3Q..JLpentru

procariote 1 60 S, Te^ectiyjjli^
La procariote, subunitalea mare. 50 S, contine ARM 23 S. ARN, 5 S si 34
tipuri de
3^ (dup& apartenenja la subunitatea mic& - small) (Fig. IV.27). Proteinele
ribozomale au roluri bine stabilite, nu in intregime descifrate, decurgand fie
din capacitatea cataliticS (peptidil transferaze, GTP-aze), fie din abi-litatea de
a construi arhitecturi stereospe- cifice, esentiale in recunoasterea si
lesarea diverselor tipuri de ARN implicate, in biosinteza proteinelor (ARN m,
aminoacil-ARN,).
70S
80S

50 S
SOS
ii
60S
40 S
ARNr 5 S ARNr 16 S
ARNr 5 S
ARNr 18 S
ARNr 23 S 21 poiipeptide
ARNrS,8 S
+
+
~ 33 poiipeptide
34 poiipeptide
ARNr 28 S
+
~ 46 poiipeptide
Fig. IV.27 - Ribozomii ia procariote i eucariote
180
Ribozomii. constituie sediul hiogntezei ^roteirjel^L^Aceste unit&fi
mecano-chimice permit conlucrarea ARNm, ARNt i ARJ^lnTetLrea desfdgurdrii
procesului de sintezd a proteinelor.
Pe suprafaja fiecdrui ribozom exists doud situsuri i anume: situsul
aminoacid, care leagd ARN. portS.tor ai unui ...aminoacid, si situsul peptid,
care ieagd ARN, purtStor al unui jant polipeptidic.
Subunitatea micd a ribozomului (30 S sau 40 S) ieagd ARNL.intr-un loc
specific^ astfel incat ribozomul sd se afle cu locusul peptid in fafa codonului
care specifics aminoacidul initiator i cu locusul aminoacid in fata codonului

ce specified, aminoacidul 2.
Legarea subunitdfii man de complexul ARNm - subunitate micd determine
formarea ribozomului functional. ARNm i ribozomii se pot deplasa unui in
raport cu celSlalt, ribozomul giisand pe ARNm. Aceastd deplasare reciprocd
permite trecerea tripletelor de pe ARNm, care specified aminoacizi suceesivi
in lanful polipeptidic, prin fafa locusului aminoacid, indicand
acestuiacomplexul aminoacil-ARNt ce trebuie legal. Aminoacizii vor fi
incorporafi in molecula proteied In curs de edificare. Dupd sinteza unei
molecule proteice, ribozomii disoeiazd, permifdnd reluarea sintezei unei noi
molecule proteice.
Cercetari recente sugereazd participarea cataliticd a ARN. in sinteza
legdturii peptidice. ,
~
~
ARN nuclear de mkl diinensiuni
O a patra categoric de ARN intalnitd la eucariote, despre care no se tiu
ined multe lucruri certe, este reprezentatd de ARN de mici dimensiuni - scurt
(small nuclear RNA).
Acest tip de ARN este constituit din aproximativ 100 de nucleotide i
confine un procent mare de uridind. Existd sub forma mai multor specii
moleculare notate U1? U2 etc.
Se gdsete cu preeddere in nucleu, asocial cu proteine, generand
ribonucleoproteine desemnate dupd tipul de ARN scurt: snRNPUj, snRNPU 2
etc. (small nuclear ribonucleo- proteins = snurps).
snRNP(U!, U2, U4, U5 i U6) intervin in' excizia infronilor din ARNm transcript
primal*, snRNPU3 sunt implicate in prelucrarea ARNt transcript primar iar
snRNPU7 pare responsabild de formarea capdtului 5 al ARNm precursor
pentru histone.
TV.4.2. BIOSINTEZA ARN PE MATRIJA DE ADN Transcrierea
Modalitatea majord, specified, de sintezd a tuturor specifier de ARN, atfit
la procariote cat i la eucaiiote, este transcrierea, respectiv sinteza ARN pe
matrijd de ADN.
In vivo, transcrierea este asimetried in sensul cd, intr-o anumitd regiune a
genomului, se copiazd o singurd catend a ADN desemnatd drept catend
matritd (template) sau necodificatoare, cealaltd catend a ADN, purtdtoare a
informatiei cu privire la sinteza unui lan{ polipeptidic, in spejd, este catena
codificatoare. Succesiunea bazelor in ARN nou sintetizat (ARN transcript
primar) este aceeai cu succesiunea bazelor azotate din catena codificatoare
(cu excepfia inlocuirii timinei cu uracilul).
Reia|ia catend template - catend codificatoare se schimbd funejie de gena
transcrisd, sensul sintezei ARN rdmdnand obligatoriu 5->3 (Fig. IV.28).
181
Gena A Gena B Gena C
Gena B

*__________-.... ^. ....................t
Catena matrifa (template)
Fig. IV.28. Transcrierea asimetrica a ADN
Biosinteza ARN, spre deosebire de replicaxe, proces care angajeazd
sirnuitan Intregul cromozom, vizeazd numai anumite porfiuni de ADN, acelea

care codified proteineie de care celula are nevoie la un moment dat i


implicit ARNt i ARNr necesari.
Biosin teza ARN, moment crucial In transferal de informajie de la ADN la
proteine, presupune, in esenfd, prezenja ADN dublu helicoidal, a celor patru
ribonucleozid- Irifosfaji (ATP, GTP, CTP, UTP) i a ARN polimerazei ADNdependentd. Enzima construiete o catend de ARN, complementary co
catena ADN malrijd pentru o anumitd gena, avand polaritate
Ca. i ADN
polimeraza, ARN polimeraza confine
zinc i necesitd prezenja in media a ionilor de magneziu sau mangan (Mn2*).
Transcrierea la procariote
Spre deosebire de eucariote, care folosesc ARN polimeraze diferite in
funefie de tipul de ARN sintelizat, la procariote existd o singurd ARN
polimerazd pentru toate tipurile de ARN. Ea este constituitd din patru
subunildfi: doud de tip a, ana de tip (i i una de tip |P (a2P[i) ba aceastd
enzimd-miez\ importaritd In procesul de elongare, se asociazd, tranziloriu,
subunitatea sigma A-a, important in inifierea transcrierii. Pentamenil a2|i(Pa
constituie holoenzima. In absenfa subunitdfii a ARN polimeraza se leagd
nespecifie la ADN.
Din punct de vedere ehimic, reaefia globald catalizatd de ARN polimerazd
poaie fi reprezentatd:
(ARN)n + NIP ^ (ARN)n+l + PP
Ca i in cazui acfiunii ADN polimerazei, reaefia de formate a legdturii
fosfat. diesterice constd In afacui nucleofil al grupdrii 3 hidroxi libere din
poliribonucleolidul
in cretere asupra grupdrii a-fosfat din ribonucleozid trifosfatul urmdtor
impus de matripl.
Reaefia devine termodinamic favorabi.ld prin acfiunea pirofosfatazei (PP
>2Pa).
Spre deosebire de ADN polimeraza III, ARN polimerazele sunt apte sd
inificze sinteza catenelor poliribonucleolidice, fapt corelat, eu lipsa calitdfii de
corector, tolerat'd, de insdi funefia ARN.
Sinteza ARN, atat la procariote cat i la eucariote, decurge dupd un model
similar implicand ca etape: L inifierea transcrierii, II. elongarea catenei
poliribonucleolidice III. terminarea transcrierii.
;
In procesul transcrierii esenfiald este recunoaterea pe molecula de ADN a
unor semnale de inifiere i de terminare a transcrierii care sd indice inceputul
i sfaritul fragmentelor de ADN ce vor fi transcrise (unitdfi de transcriere).
Aceastd sarcind, de extremd importanfd, i-o asumd ARN polimerazele.
I, Ini{ierea transerieni
Situsul de inijiere a transcrierii este semnalat de catre o secvenja
specified de nucleotide din molecula ADN, responsabild de acuratejea
procesului, care poarta numeie de promoter (P) i care este recunoscut de
ARN polimerazS holoenzima (a2p(5a). Subunitaji a diferile orienteazd
holoenzima cdtre promotori diferiji asigurand specificitatea.
Secvenja nucleotidelor in regiunea promotor, conservatd in evolume, a
fost stability pentru un numdr mare de gene bacteriene, fapt care a permis
desemnarea unor seevenje consens, ca medie a sfructurii diferifilor
promotori,
Fajd de punctul de start al transcrierii, notat cu +1, care va dicta capdtul

5 al Iranscriptului primar ARN, promotorii sunt situaji in amonte i notaji cu


'minus (seevenjele in aval faj& de +1 sunt notate cu plus, tot prin convenjie).
Toji promotorii bacterieni au dou seevenje consens situate pe catena
codificatoare ; caseta - 10 (Pribnow): 5 TATA AT 3* i caseta 35: 5TTG ACA
3a '
Se admits cfl variabilitatea seevenjelor promotor este eoreiahl cu eficienja
cu care ARN polimeraza se leagd la ace'stea, respectiv cu amploarea exprim
drii genei.
Momentele imperii pot fi sumarizate astfel:
1. subunitalea 0 a holoenzimei recunoate promotoml specific, in
regiunea - 35, i se leagd la acesfa'prinir-o legdturd laxd; are loc foimarea
aa-zisului ^complex inchis de inijiere;
2, Holoenzima alunecd de-a lungdl ADN i, in jurul pozijiei - 10, bogatd
in acid iimidilic i adenilic, deschide (topete) dublul helix pe o porjiune de
aproximativ 10 perechi de haze in virtutea activitdjii sale de helieazd; are loc
foimarea complexului deschiT de inijiere;

po/memze/
Fig. IV.29 - ARN polimeraza se afla cu situsul catalitic in dreptul semnalului de
inijiere a transcrierii
3. ARN polimeraza, prezentd cu situsul activ in dreptul semnalului de
inijiere a transcrierii (Fig. IV.29), catalizeazd formarea primei legdturi fosfat
diesterice in Ire nucleotidul +1, aproape invariabil until purinic, i nucieotidul
+2.
Enzima, care conjine pe subunitalea P un situs de legare a nucleotidului
nou introd'us i altul de legate a moieculei de ARN in curs de edificare, se
deplaseazdfn pozijia +3 pe template -i continud sinteza, Subunitalea a, care
se disociazd din complexul ARN polimeraza -ADN- ARN dupd fonnaiea
primelor legdturi fosfat diesterice, se asqciazd unei alte molecule de ARN
polimeraza miez i incepe o noua runda de transcriere (Fig. IV.30).
0 ; Id:
,::.V V ;
is-

183
t:\

m'.uh
sir. u; :
f

ARN polimeraza^se ieaga la


ARM Polimeraza

ADN si migreaza spre promotor

Fig. IV.30 - Momente In inijierea transcrierii


:a
If )r\\
184
D
3
Situs x promoter

f-e-c-c'
urp
CTP
ARN-po/meraza avansaazA (disoc/erea facforv/uiG)
M-U-C-G-G-C

$*
t.
ARN-oo/imeraza (OJ Catena, rSUDiimtoteeCr t&J template

AUCGG-C-U hr/ATP era erp ^S/Ws


AsocterpaARR% fer/n/Cart

+
A UCtrGCUUA CG +> +
Fig. IV.31 - llustrarea procesului de transcriere cu sublinierea rolului ARN
polimerazei i a factorilor o ip
IL Elongarea lantului polinucleotidic
La^ capStul 3 terminal al ARN in cretere se adaugS ribonucleotidele
dictate de matri^S. Toate evenimentele transcrierii decurg in bucla de
transcriere care cuprinde 1247 perechi de baze ADN-ARN. Pe mSsurS ce
molecula de ARN transcript primar se sintetizeazS, are loc disocierea sa din
duplexul hibrid cu catena template, permijandu-se refacerea ADN duplex,
asistatS, ca i desrSsucirea, de topoizomeraze, parte integrants a
complexului de transcriere.
Viteza de elongare nu este constants, ea depinzand de secvenfele de ADN
citite de ARN polimerazS.
III. Terminarea transcrierii
Exists cel pujin douS modalitSfi de terminate a transcrierii: rho (p)
dependents i rho independents, rho fiind un factor proteic reglator (Fig.
IV.31).
185
Terminarea p independents este impost de faptul eft transcrierea unor
secvenje de ADN specifice devine neconvenabilft, din punct de vedere
terniodinamic, complexuiui de elongate. De exemplu: o secvenjft bogatft in

perechi guaninft-cilozmft este parciirsft dificil intrucSt bucla de transeriere se


formeazft greu gi duplexul hibrid ADN-ARN se denatureazft greu. DificuMji
maxime creeazft secvenjele palindromice bogafedn acid guanilic i citidilic
care preced o serie de A consecutive i care dau prin transeriere 'structuri
in ,,ac de pftrc< terminate cu numeroase nucleotide uridilice (Fig. IV.32).
Stabilitatea acului de pftru terminator bogat In GC i imperecherea mai
samara a cozii sale poli-U cu catena ADN mauija sunt favorabiJe UmimMi
Uanserierii.
Terminarea p dependents este impusft de recunoaterea de efttre acesta
a unor secvenje de pe ADN template ce semnalizeazft sfaritul procesului de
transeriere.
Rho depisfeazft, astfel, ARN polimeraza opritft temporar la situsul
terminator (relativ greu de parcurs) i, folosindu-se de activit&jile sale
catalitice .de helicazft ARN-ADN (desfa.ee duplexul hibrid) i ATP-azft, ca i
de afinitatea mare pentru ARN monocatenar, elsberaazft tnmscriptul prinruir
ARN.
Mecanismcle intime ale procesului de transeriere nu sunt cunoscute ci, cel
mult aproximate.
Transcriptele ARN, rezultate dupft prelucrarea posttranscriere a
transcriptelor primare, sunt fie produi finals ai expresiei unor gene (ARNr,
ARNt), fie molecule purtftioare a informajiei privind sinteza unor proteine
(ARNni),
catena codificatoarer
catena
rnainfa
uuuuu
C 0 transcript ARM
CGCG
GC
Fig. IV.02 - Structural in "ac de par" favorabila termin&rii transcrlerli

direepa de transeriere
AGCCCGC\ TCGGGCGL
GCGGGCT
CGCCCGA
TTTTTTTT- AAAAAAA ADM
AAAAAAA
ADN1
De remarcat eh. transcriptul primar ARNm procariot este mai lung decat
insfti gena de transcris. ARN polimeraza transcrie nu numai gena

corespunzfttoare unui anumit


AR.Nm ci \ douft secvenje suplimentare care o flaneheazft. ARNin transcript
primar va. a.vea, ca urrnare, la cap&tul 5 o secvenjft denumitft- ieader iar
la capfttul 3" o secvenjft trailer care nu se exprimft in proteinft:
+1
gena
ADN
..
....................... -i---1------ - - --- - - -""-1- - i--- ------- i
iii
l ___________________i
_____i
)
S'
fe
A
seevenfa leader
seeven^a trailer
h ---------------------------------- ----H
transcript primar ARNm
186
Transcrierea la eucariote
In cazul eucariotelcr, procesul decurge similar transcrierii la procariote,
comportand
insil un grad de complexitate net superior.
Spre deosebire de procariote, eucariotele folosesc ARN polimeraze
diferite, in funcpe de tipul de ARN sintetizat.
- ARN polimeraza I, localizaUl in nucleoli, sintetizeazd. A.RNr 45S;
- ARN polimeraza II, loealizata in nucieoplasmft, sintetizeaz&, cu precMere,
ARNm;
- ARN polimeraza III, cu aceeai locaiizare ca i ARN poLimeraza II,
sintetizeazS ARN{ -i ARNr 5S,
At&t ARN polimeraza II cat i ARN polimeraza III sintetizcaz i ARN
nuclear de mici dimension!.
O ARN polimemz.il mitocondrialS, localizata In matrixul mitocondrial,
sintetizeazS toate tipurile de ARN mitocondrial,
Fiecare dintre cde patru tipuri de ARN polimeraze utilizeazS promotori
dil'erifi intre ei.
In timp ce ARN polimeraza I utilizeaza promotori identic!, ARN polimeraza
II utilizeaza o diversitate de promotori, avSndxa seevenfe-consensi
- caseta'TATA, asemSn&toare secvenjei Pribnow, central# in jurul pozifiei
-32, in amonte de punctui de start al transcrierii; este considerate
responsabil# de acurafcejea .inifierii transcrierii, reprezenland semnalul
.unde (tncepe transcrierea), recunoscut de polimeraza;
-casetele CAAT i GC, situate de asemenea in amonte fata de 4-1, sent
considerate responsabile de frecvenja transcrierii, reprezenland semnalul
c&nd (incepe transcrierea).
Ca i in cazul secvenfei TATA, interacfiunea cu proteine specific (factor!
de inifiere a transcrierii) este necesar# in realizarea acestei funcfii.
Pozijia i orientarea celor douS casete TATA i CAAT sunt attribute
important, distanfa fix# fafil de punctui start: i orientarea 5>3* Iliad
obligatorie.
Fiind situate pe acelai cromozom ca' i gena de reglat, aceste secvenfe
se considers, elemente acJionSnd in cis, spre deosebire de proteinele cu
care interacfioneaz#, considerate a acjiona in trans.
O a treia cias# de secvenfe de 10-20 perechi de baze cresc sau scad
viteza de inifiere a transcrierii (etapa limitantS tie vitez&); motiv pentru care

au fost desemnate enhancer\ respectiv silenceri\ Spre deosebire de


sexvenfele descrise mai sus, care rftspund de expresia bazald a unor gene,
aceste secvenfe indeplinesc rolul de reglatori ai expresiei genelor (expresia
reglabil#). Ele sunt funcfionale fie in amonte, fie in aval fafii de punctui de
start. $i la distance uneori chiar foarte marl faf# de promotori (obiigatoriu
ins# in' cis). Orientarea relative faf# de gena a. cftrei transcriere o
controleaz# poate fi adit 5 >3 cat i 3*->5* (Fig. IV.33).
Express's reglabila
Expresie bazala
Elemente de rasp arts (la semnale)

i.Hh

7A
caveta
TATA
+1

gena structural^
Fig. IV.33 - Elemente implicate in transcriere la eucariote

.MA
187
Funcjia aces tor elemente de control se realizeazd ca urmare a
interacfiiinii cu factor! proteici, respecliv factori de transcriere, avand ca
efect modificdri conforrnajionale in molecula de ADN, modificdri ce pot fi
favorabile sau defavorabile transcrierii.
Secvenjele enhancer sunt asociate cu gene care se exprimS selectiv in
diverse Jesuturi, deci relajia lor cu diferenjierea celularS este de admis.
Tot din clasa secvenjelor interesate in expresia genelor fac parte i
anumite elemente care mediazd rdspunsul la diferite semnale - motiv pentru
care sunt numite elemente de r&spuns*' (responsive elements) foarte
asemdndtoare cu enhancerii.
Sunt identificate eleme-nte de rdspuns44 la hormonii glucocorticoizi,

tiroidieni i alji compuji cu caracter polemic hidrofob, care pot traversa cu


uurin$ membrana celulard, legandu-se, ulterior, la receptori specific!
intracelulari. Complexul hormon-receptor traverseazd membrana nucleard i
schimhd proteina receptor cu on factor de transcriere avand un domeniu de
recurioatere a elementuiui de rdspuns hormonal specific. Toate genele care
dispun de un element de rdspuns hormonal, in spejd, ii vor activa
transcrierea (vezi stiirmlarea transcrierii genelor ce specified enzimele-cheie
ale gluconeogenezei prin glucocorticoizi - hormoni hiperglicemianji).
Factori de (ranscriere specific!, interacponand cu elemente de rdspuns
la stresuri termice, chimice etc. activeazd transcrierea unui grup de gene
avand ca produgi proteine ce atenueazd stresul: proteine de oc termic,
proteine care cheleazd metalele grele (ca de exemplu metalotioneina,
proteind cu conjinut mare in grupdri tiol), proteine care se opun stres-ului
oxidativ at speciilor reactive de oxigen (superoxid dismutaza) etc.
O subliniere necesard la sfdrgitul odiseei transcrierii; toate elementele
bazale sau reglatorii au o caracteristicd comund: interacjiunea cu proteine
specifice.
Aejiunea ARN poiimerazelor I i III prezintd similitudini dar i diferenfe
majore fatd de acjiunea ARN polimerazei II, diferenje doar consemnate, fard
pdtrunderea rajiunii lor.
Inhibitor! ai transcrierii
Transcrierea ADN este suprimatd de cdtre unii compui exogeni, fie prin
modificarea structurii ADN astfel incat acesta sd nu mai poatd servi ca
matrifd in sinteza ARM, fie prin inhibarea ARN poiimerazelor procariote sau
eucariote.
Antibioticui actinomicina D, ca i colorantul acridind, prin porjiunea lor
pland, se insinueazd intre perechile de baze GsC; aceastd intercalare are ca
rezultat distorsiunea moleculei de ADN, care nu mai poate servi ca malrifd
pentru ARN polimeraze.
Dependenja unui proces celular de sinteza ARN se diagnosticheaz& in
vitro prin inhibijia acestuia de cdtre actinomicina.
Rifampicina, un antibiotic extern de activ in tratarea tuberculozei, se
leagd la subunitatea (J a ARN polimerazei-holoenzimd din procariote,
prevenind inijierea lranscrierii. Ea nu inhibit ARN polimerazele eucariotelor.
Un inhibitor de temut ai ARN poiimerazelor din celulele animate este
produsul one! frumoase ciuperci, Amanita phalloides. Acest produs,
amanitina, inhibit, cu precMere, la concentrajii mici, ARN polimeraza II.
IV.4.3. PRELUCRARJ CO- 1 POSTTRANSCR1ERE ALE MOLECULELOR DE ARN
Procesui se referd la modificdrile pe care le suferd diferitele tipuri de ARN
inainte de implicarea lor In biosinteza proteinelor. Aceste modific&ri decurg
atat in nucleo cat i in citoplasmfi $i presupun:
- eliminarea din moleculd a unor fragmente polinucleotidice;
- addugarea unor fragmente polinucleotidice;
- modificdri covalente ale bazelor azotate.
188
Modificarea majors pe care o sufer# transcriptele primare la eucariote
const# in scurtarea acestora.
CercetSrile ultimilor ani au ar#tat c# moleculele de ARN (ARNm, ARNt,
ARNr, ARN nuclear scurt), rezultate prin transcrierea unor gene structural^,

pot s# ajung# la locul de sintez# a proteinelor cu mult mai scurte decat


porfiunea din genom ce corespunde proteinei respective sau ARN t, ARNr.
Constatarea a avut ca punct de plecare observafia c# fragmentul de ADN
corespunzStor ARNm ce confine informafia privitoare la sinteza ovalbuminei
este intrerupt de secvenfe de ADN ce nu se reg&sesc in ARNm citoplasmatic.
Rezult# ca secvenfele de baze care codific# ovalbumina sunt plasate
discontinuu in genom.
Secvenfele nucleotidice din cuprinsul genei corespunz#toare ovalbuminei
care nu se regSsesc in molecula de ARNffi citoplasmatic s~au denumit
introni, iar secvenfele nucleotidice transcriptibile i traductibile, delimitate
de introni, s-au denumit exoni.
Lungimea total# a genei de ovalbumin# corespunde la 7700 perechi de
baze, in timp ce aceea a ARNm citoplasmatic, la numai 1872. Dintre acestea
1158 perechi de baze codific# cei 386 aminoacizi ai proteinei, iar 64 de
nucleotide de la capStul 5 i 650 de la cap#tul 3' al ARNm nu sunt traduse.
Gena ovalbuminei 7700 perechi baze
1 2 3 4
5 6
7
M
Intron
\
xon
Transcriere
L12
3 4
5 6
Transcriptul * I A primar
I
i
ARN matur pentru ovalbumina

/1872 nucleotide \
3'
Fig. IV.34 - Transcrierea genei de ovalbumina, cu obfinerea transcriptuiui
primar, urmat# de excizia introniior; ARNm matur rezultat va servi ca matrifa
pentru sinteza ovalbuminei
Constatarea c# ARNm nuclear este mai lung decat a.celai ARNm ajuns in
citoplasm# a dus la concluzia c# ARN polimeraza realizeaz# o copie primar#
identic# cu intreaga gen#, apoi intronii sunt excizafi i exonii se leag#
formSnd ARNm matur, traduclibil (Fig. IV.34).
Departe de a fi un fenomen izolat, discontinuitatea genelor s-a dovedit a fi
un fenomen cvasi-general. Cel mai adesea, secvenfele intron au dimensiuni
cu mult mai mari dec#t ce-le exon (de peste 100 de ori), ceea ce ar constiui
o explicafie parfial# a faptului c# numai 5-10% dm genomul eucariot
repiezint# secvenfe codificatoare pentru proteine i ARN.
Dac# secvenfele de nucleotide dintr-un ADN codificand o protein# nu
sunt adiacente, ci secvenfele codificatoare sunt intrerupte de secvenfe
necodificatoare, este evident c# la eucariote nu se mai poate vorbi de
colinearitatea gen#~protein#, ci numai de o colinearitate exon-fragment din

proteina specificat# (corespunzand, probabil, unui domeniu funcfional al


proteinei).

189
Excizia intronilor din transcriptele primare
Excizia intronilor din ARN precursor, biologic inactiv, se realizeazd pentru
toate tipurile de ARN' in nucleu, sub acpunea unor enzime specializate, care
trebuie sS recunoasci' secvenjele de baze la jonc|iunea intron-exon, sS
asigure juxtapunerea corectif a substratelor i sit efectueze actul catalitic.
In general, intronii au la cap&tul 5 secvenfa GU iar la cel 3' secvenja AG
incadrate adesea in secvente consens mai lungi. Exists o categoric de introni
in care, in amonte fap. de capStul 3 a! intronului (50 nucleotide), este
prezentS o secven{S consens, parte a unui situs de ramificare, confinand
invariabil adenozina; in drojdxi, secvenja consens, diferitS de cea a
vertebratelor, este: 5-TACTAAC-3\
Mutajii in vecinStatea unei jonc{iuni intron-exon, cu precSdere in

dinucleotidul de la capetele intronului, interfere excizia intronilor putand


genera un ARN inactiv, conjinand un intron rezidual. In uncle {kihalasemii
sinteza sc&zutd a ianfurilor fl-glohinS s-at datora unui defect de excludere a
intronilor, avand (kept consecin|S incapacitatea ARN nuclear de a iei in
citoplasmS pentru a fi citit.
Cech i Zaug au evidential o modalitate cu totul surprinzStoare de excizie
a intronilor dintr-un ARN ribozomal al unui protozoar cilia! Tetrahymena
termophila. Incubarea in vitro a ARNr precursor (transcript primar) cu
nucleozid trifosfaji i extract nuclear, ca sursS de enzimd catlizand procesul
de excizie, a dus la conciuzia c& adaosul de extract nuclear era inutil. Se
contura ideea intervenjiei autocatalitice a ARNr in procesul de exciziecoasere* idee greu de acceptat, care extindea la acizii ribonucleici un atribut
aparjina nd exclusiv proteineior.
Excizia intronilor din ARNr.
1.
ARN precursor
2
Exon stang
5*
AGGC
V.
CUi

3*

intron
Adaos
guanozina
2.
4
5*----

intron liniar
~ cucucuuExoni reunip

Fig. IV.35.a - Excizia autocatalitica a intronilor din ARNr la Tetrahymena


termophila
190

tntron excizat
Exons reunifi
Fig. 35.b - Mecanismul transesterificarii Tn reacjia de excizie
Lucrandu-se in medii in care contaminarea cu protein^ era excius& (ARNr
obfinut prin tehniciie ingineriei genetice i mi prin extraejie din nucleu),
concluzia indubitabilS a fost aceea c& ARM' catalizeazii excizia intronilor i
coaserea propriilor exoni (Fig. IV.35a i b). Acestui tip de ARNr, izolat din
Tefcrahymena termophila, i s-a dat numele de ribozim pentru a cpnsfinji
activitatea sa cataliticl Spre deosebire de enzimele clasice, aceast& enzimft
avand activitate autocataliticS nu se regsete neschirnbatii dugii actul
catalitic.
In l&murirea mecanismului de acfiune a ribozimului decisive a fost
constatarea ca la unul dintre capeteie intronului excizat se gSsete on rest
de guanozinS care nu exista in ADN. GIF sau guanozina nu erau folosile in
scopuri energetice, ci ca agent nucleofil apt sS desfacSt leg&tura fosfat
diestericft de la unul dintre capeteie intronului.
Legarea guanozinei la un loc specific din porjiunea intron o orienteazS.
astfel incat o gnipare -OH a acesteia s& poafi ataca legHtura fosfat diestericfi
de la joncjiunea exon- cap&tul 5 al intronului. La capital 5s a! exonului exists
o secvenp. de 6 nucleotide pirimidinice CUCUCU care se imperecheazS cu o
porjiune din intron GGGAGG. Agezatft convenabil steric, guanozina atacft
joncfiunea exon-intron la capital 5\ Aceasfl reacpe de transesterificare are ca
rezultat legarea guanozinei (G) la adenM (A) i eliberarea capital ui 3 al
exonului I. Uracilui (U), devenit capital 3-OH liber al exonului I, efectueazii o a
doua transesterificare cu uracilui de la capital 5' al exonului II, realizandu-se,
oda$ cu excluderea intronului, coaserea celor doi exoni (pieces de splicing)
(Fig. IV35).
De remarcat C& activitatea catalitic^ a ARNf este conditional# de
integritatea conformajiei sale, intrucat, intocmai ca o enzimii, el trebuie sa
asigure juxtapunerea
corecta a substratelor. Excizia intronilor i coaserea exonilor sunt accelerate,
grape efectului autocatalitic al ribozimului, printr-un factor de ordinul a zece

bxlioane. .Un argument in plus pentru calitatea de catalizator a. ARNr este


saturabilitatea reacfiei ARNr (intron) cu GTP sau guanozina (KM 30 M) i
inhibifia acesteia piin 3 -dezoxi-guanozina.
Intronii din categoria descrisd, avand capacitate autocatalitic^ (seif-splicing)
i utilizand GTP (sau guanozina) adijional, ca agent nucleofil, aparfin grupului
1 de introni.

192
Excizia intronilor die ARNn
Excizia intronilor din ARNm eucariot se desf#oar# similar exciziei
intronilor din ARHr, presupunand, de asemenea, succesiunea a dou# reacjii
de transesterificare (Fig, IV36). Deosebiriie fa{# de excizia intronilor din AKNr
constau in faptul c# agentul nucleofil care opereaz# prima reacjie de
transesterificare nu mai este GTP (sau guanozina) liber, ci un nucleolid in
cadrul infronului, iar excizia intronilor nu este autocatalitic# (gnipul 03 de
intjnoni).
Intr-o prima etap#, gruparea 2-hidroxi a unei unitSji de adenozin# atac#
nucleofil iegdtura fosfat diesteric# ce unegte exonul I (5) cu intronul,
eliberand exonuL LegStura noufi 2\5-fosfatdiesteric# stability da structurii

rezultate forma unui lasou.


In cea de-a doua etap#, gruparea 3-hidroxi terminal# a exonului I atac#
nucleofil legfttura fosfaldiesteric# dintre intron i exonul II (3)- Intronul este
eliminat, urm&nd a se degrada, iar eei doi exoni se. reunesc.
Indep#rtarea intronilor este calalizat#, in cazul intronilor din grupul III, de
un complex ribonucleoproteic constituit din ARN nuclear scurt (small nuclear
RNA = sn RNA), proteine i ARNm, subiect til prelucrfirii, care poart# nurnele
de splicozonT (spliceosome), prin analogic cu ribozomul. Se consider# c#
dimensiunea mare a splicozom-ului impiedic# ARNU1 precursor s#
p#r#seasc# nucleul inainte de prelucrarea sa complete la ARNSI1 matur.
ARN scurt, nuclear (60-300 nucleotide), bogat in uracil, particip# sub
forma a cinci specii diferite: Uj, U2, U4, Uj/U* desemnand i tipul de
ribonucleoproteine rezultate prin asociere cu proteine: snRNPU,, snRNPU2,....
(small nuclear ribonucleoprotein - colocvial citite snurp).
Recunoaterea joncliunii intron-exon ca i a situsului de ramificare este
asigurat# de e#tre snRNPU. Se admite c# snRNPU, recunoate din
ansamblul de transcript ARN prezente in nucleu numai pe cele con{in#nd
introni. snRNPU5 se imperecheaz# cu cei doi exoni ce flancheaz# intronul,
ceea ce permit discriminarea intre secvenjele GU i AG la limita intron-exon
i alte secvenfe de acest fel. RNPU2 se ieag# la secvenfa consens din intron
fiind implicate in selecjia punctelor de ramificare (Fig. IV.37). Interacfia intre
ARNnt precursor (premesager) i celelalte tipuri de snRNPU nu este
clarificat#.
Asocierea ARNm transcript primar cu snRNPU, presupunand o multitudine
de interacfiuni (proteinfi-proteind, ARN-protein#, ARM-ARN) i o riguroas#
intrare in seen# a componenjtilor, asigur# inalta fidelitate a procesului de
excizie-coasere a intronilor, realizat catalitic de components ARN a snRNPU.
. Trecerea prin furcile caudine ale splicozomului face din ARN pre-mesager
urt ARNm pe deplin matur, apt s# ajung# in citosol pentru a fi citit i tradus.
193
ifi
j
fi

Fig. IV. 37 - Rolui SNURP in eliminarea introniior


194
Excizia intronilor din ARNt
Unele molecule de ARN eucariot confin in vecinStatea regiunii anticodon
succesiuni de nucleotide (20-40) ce corespund unor introni.
Spre deosebire de intronii din grupul I i HI, aceti introni se exclud prin
paiticiparea unor protein-enzime organizate intr-un sistem multienzimatic
avand printi*e multiplele sale activitSJi i pe cele de endonucleazS i ligazS
(Fig. IV.38).
Din demonstrarea capacitSjii catalitice a ARM rezuM o idee fundamentals
din punct de vedere teoretic: dualitateafuncJionalS a moleculei de ARM care,
pe langS calitatea de a fi o moleculS informaJionalS, o are i pe aceea de a
funcjiona drept catalizator. DupS aprecierea. lui Cech, diviziunea muncii in
celulS nu pare sS fie chiar atat de strictS.
Problems discontinuitSjii genelor la eueafiote este o temS fascinantS de
biologie, care pane o serie de intrebSri al cSror rSspuns, cel pufin
deocamdatS, este departe de a fi satisfScStor. In ce moment al evoiujiei, cum
i in ce scop au ap&rut intronii? Procariotele actuale sunt identice ca genom
cu cele din care au provenit eucarioteie? DacS nu, este posibil ca i

procariotele sS fi dispus de gene discontinue i ca variajia posibilitSjilor de


excizie a intronilor sS fi servit evoiujiei, imbogSjind repertoriur* de proteine
al acestora. Cu timpul, este probabil ca procariotele sS fi renunjat la ADN
necodificator, astfel incat sS-i mSreascS viteza de cregtere prin scSderea
cantitSJii de ADN ce trebuia replicatS in fiecare generate.
Este prezenja intronilor avantajoasS eucariotelor sau pur i simplu s~au
pastrat prin lipsa unui aparat de excludere a intronilor? S-ar pSrea cS
prezenja lor este avantajoasS.
Se conlureazS ipoteza intervenjiei intronilor in procesul de diferenjiere
celularS. Mai mult, transportul ARM din nucleu in citopiasmS pare s& depindS
de prezenja intronilor. Intr-adevSr, unii ARM objinuji prin transcrierea ADN
complementari unor ARN m atari (sub acjiunea revers transcripfazei) nu
pSrSsesc nucleul; probabil, unii introni codifies porjiuni dintr-o enzimS,
maturaza, implicatS in insui transportul ARN.
CercetSri recente au demonstrat o mare flexibiiitate a aparatului de
excizie-sudurS a diverselor regiuni din ARNns ia eucariote intrucat, dintr-un
singur transcript primar pot rezulta numerogi ARNm maturi i deci proteine
diferite (splicing alternativ). Chiar dacS dintr-un singur transcript primar se
objin proteine diferite, caraeterul monocistronic al ARNra eucariot se
pSstreazS, intrucat un singur tip de ARNm matur i un singur polipeptid
rezultS intr-un anumit tip de celulS, la un moment dat, prin procesSri diferite.
Un exemplu de splicing alternativ il oferS transcriptul primar pentru
tropomiozinS proteins a aparatului contractil ce prezintS diferenje
structurale in diverse Jesuturi. O genS unicS genereazS un transcript primar
unic in toate Jesuturile caxe conjin tropomiozinS. Prin tfatarea diferenjiatS a
exonilor in unele Jesuturi acedia sunt trataji ca introni se objin tipuri
diferite de ARNm matur i deci tropomiozine diferite funcjie de Jesut (Fig.
IV.39). .
Exonii exprimaji in toate Jesuturile sunt desemnaji ca fiind constitutivi.
V C
"N

m
m
i
AH

1
M:
: i;:
195
Intron

ADN
Transcript
pwlmmr
ARNt

4
Excizia intrciiyMi
H
0

Fig. IV.38 - Prelucrari posttranscriere aie ARNt 196


JM
= introni
STR
aa (N) STR
165IBS- 214- 235258- STR 2585' UT1-38 39-80 39-8081-125 126-164 188 213 234 257
284 3' UT 284'
3 UT
3 U11-38 3W-80 3S-8U 81-1 25 126-184 1 88 213 234 257
284 3 U I
|:

ARNm transcris
Mu$chi striatl (STR) '

(N)
Muschi striatl '(STR)'
Creier
Fig. IV.39 - Organizarea ganei a-tropomiozinei ia obo!an; alternativeie de
transcriere
Pe lang# excluderea intronilor prezenfi in ARN eucariot (i in foarte pufine
procariote - mai ales din dasa bacteriilor arhaice), numeroase prelucrSri
adifionale, diferind cu tipul de ARN, des#var;esc trecerea de la ARN
transcript primar ia ARN matur, functional, succesiunea ior temporal^ fiind
stability cu aproximafie.
Spre deosebire de ARNm procariot care este tradus in timp ce este
sintetizat, deci se nate matur, la eucariote ARNm devine functional numai
dupft modificarea capetelor 5' i 3\ Cap&tul 5' al ARNm este modificat
covalent intr-un proces considerat a fi cotran- scripjional, intrucat se
realizeazS chiar inainte ca deplasarea ARN polimerazei II din situsul de
inifiere a transcrierii s# fi avut loc. Modificarea const# in adSugarea unui rest
de 7-mefiI guanozind legal prin leg&turd 5-5 tdfosfat de transcriptul primar
(Fig. IV.40).
La unele specii modificarea la capdtul 5 include i metilarea grupMrii T
hidroxi din nucleotidul ultim, uneori i penultim, din fostul transcript primar.
Marcarea cap&tului 5 al ARNm este necesardintrucat;
- protejeaz# molecula de acjiunea 5-3* exonucleazelor;
determine specificitatea celulara
Modificari posttranscriere adifionale
Modificari adifionale ale ARN raesager eucariot
197

0
1
-O-P = O
I
0
1
-o-p = o
I
0
1
CH.
Baza

Q~~CH?
~op=o
I
0
1
CH2

Baza
O CH?
~QP = Q
Fig. IV.40 - Marcarea oapatului 5 ai ARNm
- favorizeazh ina^erea, fiind recunoscutd de cStre ribozom ca semnal de
inijiere a sintezei proteinelor;
- reprezintd un semnal de recunoatere pentxu enzirnele care-l vor folosi
ca substrat in cursul prelucrMlor ulterioare.
Capital 3 al ARNm este adesea modificat covalent prin poiiadenilare
formarea cozii poli A (200-300 nucleotide).
Poliadenilarea se produce in aval fapl de o secvenf& de semnalizare" a
clivdrii i poliadenildrii i este rezultatul acjiunii concertate a douS enzime: o
endonucleazft care taie molecula de ARNm in vecinStatea secVenJei de
semnalizare: i o poli-A-polimerazS care, fM $& necesite un template,
cataiizeazS polimerizarea resturilor adenilat.
Semnificafia poliadeniklrii la capStul 3 al ARNm este obscurS; jinand
seama c& in cursul existenjei sale in citoplasmS coada poli A a ARN m sufeifi o
scurtare progresi- v5, ca urmare a acjiunii unor 3,~~>5 exonucleaze, se
poate admite c& scopul cozii este acela de protecjie a regiunilor
codificatoare. i totui, ARNm pentru histone i interferon, cel pujin, nu sunt
poiiadenilaji.
In vitro, prezenfa cozii poli A s-a dovedit extrem de utild. Ea servegte ca,
djiator in sinteza ADN pe matrifh de ARN, dec! la objinerea \DNC (C pentru
complementar), utilizat in tehnicile de clonare ca i la izolarea i purificarea
ARNm din totalul de ARN celular din care el reprezint o mich parte.
Prelucrarea ARNm eucariot se incheie cu excizia intronilor (vezi anterior).
Modificari adijionale ale ARN de transfer
La procariote, ca i la eucariote, transcriptul primar confine mai mulfi ARNt
precursor!
(multimeric). ARNt precursor! monomerici, avand extensii 5i 3' relativ
scurte, se obfin prin acfiunea unui mare num&r de ribonucleaze (Fig. IV.38)
In ob|inerea capdtului 3 al ARNt matur este implicate o ribonucleazd cu
activitate endonucleazictt i anume Ribonucleaza P (RNA-aza P), constituM
dintr-o subunitate ARN de c&teva sute de nucleotide i o protein^ cu
caracter bazic, cu masft molecular# de aproximativ 14 kD.
198
In vitro, in prezenja unor concenlrajii maxi de s3ruri, proteina s-a dovedit
a nu fi necesara actului catalitic, Activitatea enzimei in vivo impune prezenfa
ambelor subunit&Ji, actul catalitic fiind instl realizat, aga cum a demonstrat
S. Altman, de c8lre subunitatea ARM, erne poate fi considerate un ribozim.
Prezenja proteinei bazice reduce, ia concentrajii fizioiogice de siiruri, repulsia

dintre dou& molecule ineftreate negativ: dintre ribozim un ARN polianionic


- gi substratul sflu - ARNt.
Acjiunea RNA-azei P se soldeaza cu formarea unor ARN, precursori cu
capete. 5 mature,
De remarcat obiigativitatea prezenjei Mg2* sau Mn2+ pentru activitatea
enzimei.
La eucariote s-a demonstrat activitate de tip ribonucieazfi P in nucleu gi
mitocondrii.
Spre deosebire de alte enzime ARN, RNA-aza P este o enzimft ce se
conformeaz8 accepjiei ciasice a enzimei, sub aspectul recuper&rii sale in
unna actului catalitic.
Descoperirea ribozimilor - enzime in care componenta ARN dejine
activitatea catalitic;! - a propulsat aceastft moleculd, dintotdeauna
informajionalS, pe un teren pand nu demult rezervat proteinelor, a desfixhjat
dihotomia genotip-fenotip gi a consolidat punctul de vedereal lui L. Johnson
privind soarta adevftrurilor: orice adevftr incepe ca erezie gi se terming ca
dogmSA
Se speculeazS c8 ARN ar fi' molecula primordial^, urmat2 de ADN gi
proteine, catalizatorul originar, gi c& ingigi rihozomli,constituifi dintr-un
procent foarte mare de ARNr (aproximativ 50%), ar juca in celulS gi un rol
catalitic, Argumentul pare a fi servit de dUre Noller gi eoiaboralorii care au
demonstrat ca ARNr necontaminat de proteine, este apt sa catalizeze sinteza
legftturii peptidice.
Objinerea cnp&tului 3 matur al ARNt, din transcriptele primare
multimerice, presupune o activitate exonucleazici soldat&v in cazul
procariotelor, cu revelarea capStului CCA (toate genele pentru ARNt codificS
seevenja CCA terminus). In cazul eucariotelor, seevenfa CCA este aditugatii
ulterior de cStre o nucleotidil-lransferazS avfmd ca substrate ATP gi CTP.
O modificare covalentS pe care o sufer! atat ARNt procariot cat gi cel
eucariot const# in modificarca unor baze sau a ozei. Aceste modific&ri
enzimatic-catalizate constau in alchiifui, tioklri, hidrogenSri, gi decurg, in
spejfi, in regiuni de ARN, in care nu exists baze eomplementare (vezi IV 4.L).
IVfodificari adi$Ionale ale ARN ribozomal
Prelucrarea ARNr ciecurge similar la procariote gi eucariote gi presupune
clivai*ea unor transcripte prim are de mari dimensiuni la transcripte de
dimensiuni mai mici: 30S pentru eucariote gi 45S pentru procariote. Aeestea
vor genera molecule de ARNr, matur: 23S, 16S, 5S ARN,. pentru procariote gi
28S, I8S gi 5,8S ARNr pentru eucariote, dup# indepftitarea fragmentelor
spajiatoare gi, in cazul procariotelor, a ARN, objinut prin transcrierea unor
gene ARNt intruse (Fig. IV.41).
De menjionat c! ARNr 45S rezuM prin transcrierea, operate in nucleol, de
ditre ARN polimeraza I, a sule de gene ARNr separate. ARNr 5S rezultd dintr-o
molecul# precursoare diferitd obfinukl prin transcrierea unei gene, 5S, de
cfltre ARN polimeraza III.
Objinerea ARNr matur implicit, atat la procariote cat gi la eucariote,
modificarca prin metilare a unor baze.
199
16 S
1TS

ARN r 16 S
precursor 30 S
23 S
ARNt (4S)
metiSare +
hidroliza enzimatica
25 S
ARNt
ARNt
ARN r 23 $
SS
hidroliza
enzimatica
5S
ARN r
Fig. IV.41 - Modificari post transcriere ale moiecuielor
de ARN,
precursor 45 S
18 S
5,8 S
28 S
median
hidroliza
enzimatica
H ..
grupari
metrl
ARN r
ARN r
ARN r
18 S
5,8 S
28 S
Modificari adiflon&le ale ARN miciear de imict dimensitmi
Sintetizat de c3tre ARN polimeraza II, acest tip de ARN transcript primar
va primi la cap&tul s3.u 5 un rest de 7-metil-guanozin& (ca i ARN,*) in
cursul unui proces contranscripfional.
Dup3 ce ARN scurt ajunge in citosol, o metilaz& locals il hipermetileazS
dand un capSt 5 ce confine 2,2,7 trimetil guanozinS (m3G); metilarea se
realizeazd numai dupS asocierea ARN nuclear scurt cu proteine specifice
sintetizate in citosol.
Ribonucleoproteinele rezultate sunt importate de nucleu, dei proteina nu
are semnalele caracteristice proteinelor de import.
S-a demonstrat c3 introducerea m3G este necesarS transportului in
nucleu, mediat receptorial, ca i legarea prealabilft la proteine.
200
Din necesitatea ca particuia s# aM ambele semnaie pentru a fi importat#
s~ar putea deduce c# numai particuiele corect asamblate au acces in
nucleu, unde au de indepiinit funcfii specifice.
IV.4.4. BIOSINTEZA ARN PE MATRIjA DE ARN
Unele virusuri con fin ca material cromozomial ARN, Replicarea acestui
ARN in celula gazd# are Ioc sub acfiunea unei replicaze, o ARN polimeraz#
ARN-dependent#, analoag#, ca mecanism dt acfiune, ARN polimerazei ADNdependenll.

Replicazele se sintetizeaz# in organismul gazd# ca rfispuns la infecfia


viral#. Ele manifest# o specificitate surprinz#toare, folosind ca matrif#
exclusiv ARN omolog (al virusului cu care a fost infectat# celula). In felui
acesta, in celula gazd# are loc replicarea ARN viral, nu i a ARN al celulei
gazd#. ARN sintetizat pe matrif# de ARN omolog nu este complementary ci
identic cu acesta, Dupa infecfie se sintetizeaz# pe matrifa ARN (+) o replica
complementary (-), luand natere o dubl# elice constituit# dintr-o eaten#
ARN (+) i una ARN (-). Catena ARN (-) va servi apoi ca matrifa pentru
sinteza a numeroase catene complementare (+) (Fig. IV.42).
+
(+) M * + + + *

omoloage ARN viral


Fig. IV.42 - Sinteza de ARN pe matrifa de ARN
Fig. IV.43 - Completarea dogmei centrale a geneticil moleculare prin prisma
descoperirii ADN polimerazei ARN-dependenta i ARN polimerazei ARNdependenta.

201

ARN viral va funcjiona ca ARNm perifru sinteza proteinelor virale (spre


deosebire de ARN al retrovirusurilor).

Tinand seama atat de existen{a ADN polimerazei - ARN-dependentS


(revers trams- criptaza), cat i de a ARN replicazelor, dogma centrals a
geneticii moleculare treb.uie
reconsiderata in sensul indicat in Fig, IV,43,
t?
Cap. V, BIGSINTEZA PROTEINELOR (Traducerea mesajului genetic)
V.l. CODUL GENETIC
Aa cum s~a arStat anterior, informafia genetics - mesajul genetic - cu
privire la biosinteza proteinelor este confinut in secvenfa de nucleotide din
ADN. Acest mesaj este transmis codificat in citoplasmS, local de biosintezS a
proteinelor, prin sintezS de ARNm*
Secvenja de nucleotide dinir-un anumit ARNm trebuie tradusS intr-o
succesiune specific^ de aminoacizi, corespunzand unui lan{ polipeptidic. In
citoplasmS trebuie sS aibS loc decodificarea ARNm, respectiv traducerea
limbajului nucleotidie in care este scris acesta, in iimbaj aminpacidic. Este de
presupus cS unui anumit aminoacid ii corespunde on cuvant cod format
dintr-o anumitS succesiune de nucleotide. Identificarea cuvantuiui cod pentru
fxecare dintre cei 20 de aminoacizi ce intrS in structura proteinelor a
constituit un eveniment remarcabil i se datoreazS lucrSrilor lui Nierenberg,
Ochoa, Khorana i Matthaei.
Descifrarea codului genetic, a relafiei dintre secvenja de nucleotide din
acizii nucleici (materialul informafional genetic) i secvenja de aminoacizi
dintr-un lanj polipeptidic, care reprezintS forma de exprimare a acestui
mesaj, a ridicat numeroase probleme;
- aprecierea mSrimii unitSjii codificatoare, respectiv a numSrului de
nucleotide ce
codificS un aminoacid;
- stabilirea naturii unitSjii codificatoare, a nucleotidelor ce formeazS
unitatea;
- determinarea seevenjei nucleotidelor in unitatea codificatoare.
Evident, intruc.it exists 20 de aminoacizi i numai 4 nucleotide, este
exclus ca un aminoacid sS fie specificat de un singur nucleotid. Specificarea
unui aminoacid prin douS nucleotide este, de asemenea, insuficientSintrucat
se pot obfine numai 16 cuvinte cod. In schimb, construirea unui cuvant cod
dintr-o succesiune de 3 nucleotide oferS 64 de posibilitSji, respectiv 64 de
cuvinte cod pentru cei 20 de aminoacizi. Faptul cS toate cuvinteie cod sunt
triplete, denumite codoni, a fost verificat prin experience simple i expresive
cum ar fi;
- un ARNni viral monogenic constituit din 1200 de nucleotide codified o
proteinS
continand 400 de aminoacizi;
- delelia (excluderea) sau inserjia unui triplet intr-un anumit ARNm
determinS sinteza unei proteine cu un aminoacid mai pufin, respectiv cu unui
in plus.
In ceea ce privete stabilirea naturii nucleotidelor ce constituie tripletul i
a sucxesiunii lor in acesta, decisive an fost experienjele efectuate pe
polinucleotide de sintezS, constituite din acelai nucleotid sau din nucleotide
diferite, care au servit ca ARNm pentru
203

sinteza unor proteine in sisteme acelulare. De pildft, dac5 se utilizeazU ca


ARNm un polinucleotid adenilic se ob|ine o proteinS consfituM exclusiv din
lizinSL RezuM c& lizinei ii corespunde triple!ui AAA. Analog, un polinucleotid
uridilic d& natere unui lan| polifenilalaninic, unul policitidilic edified o
poliprolind; rezultd cuvintele cod peritru feniialanind (UIJU) t pentru prolind
(CCC). JSensur ceiorlalfi codoni s-a stabilit prin utilizarea unox
heteropolinucleotide cu seevenjd cunoscutd, Jinandu-se seama de faptul ca
direejia de traducere a moleculei de ARNm este 5~3\
Secvenfa bazeior intr-un codon s-a precizat ca urmare a unei experience
ingenioase imaginate de Nirenberg care a pus in contact un triplet
nucleotidic sintetizat in laborator (avand o succesiune de baze cunoscuta) cu
ribozomi 1 20 de complexe aminoa- cil~ARNt, dintre care unul singur era
marcat 14C aminoacil-ARNO i apoi a filtrat amestecul pe nitroceluioziL Pe
filtrul de ceiulozft este refinut numai aeel UC amiiioa- cil~ARNt care s-a
Tinperec!icat prin porjiunea anticodon cu tripletul utilizat, legat specific la
ribozomi. S-a demonstrat astfel, de exemplu, cS tripletul UGU codified
cisteina, UUG, leucina, iar GUU, vaiina.
In tabelul V.l. este redat codul genetic.

Tabelul V. 1.
Codul genetic
//
/
U
C
UUU
UCU
Phe
u
UUC
UCC
Ser
UUA
UCA

Leu
UUG
CUU

UCG

cue
Leu
CUA

CCC
Pro
CCA

CUG

CCG

GCU

A
UAU
Tyr
UAC
UAA
Codon
terminator
UAG
CAU
His
CAC
CAA
Gin
CAG

G
UGU
Cvs
UGC
Codon
UGA
terminator

///
U
C
A
G

UGG Trp
CGU

CGC
Arg
CGA

CGG

AUU
A

AUC
He
AUA

ACU

AAU
Asn

AGU
Ser

ACC Thr
ACA
ACG

AAC

AGC

C
A

AAA
Lys
AAG

AGA
Arg
AGG

GAU
Asp
GAC

GGU

GGC
Gly
GGA

GGG

AUG
Met
GUU

GCU

GUC
Val
GUA

GCC
Ala
GCA

GUG

GCG

GAA
Glu
GAG

204
Caractehsticile codului genetic standard
~ intrucat nu exists semnale care sd indice inceputul i sfaritul fiecdrui
codon, citirea mesajului genetic se face neintrerupt, de la un codon start
pand la an codon terminator. Punctul de start in citire este reprezentat de un
semnal de inijiere incluzand, invariabil, codonul de inijiere AUG. Codul
genetic nu are deci, virgule, semne de punctuajie.
- Codul genetic este degenerat, mai exact, redundant.
Dintre cele 64 de triplete 61 codified aminoacizi particular! Cum nu
exist'd. decat 20 de aminoacizi ce trebuie specificaji, rezultd cd unui singur
aminoacid ii pot corespunde mai multe cuvinte cod, Intr-adevdr, aa cum se
vede din tabelul V.l. numai triptofanul i metionina sunt specificaji de cfUre
un singur codon, in timp ce ulji aminoacizi, cum ar fi de exemplu serina i
leucina, sunt codificafi de catre 6 codoni fiecare (codoni sinonimi).
Degenerarea codului, respectiv existenja mai multor cuvinte cod pentru
acelagi aminoacid, se manifesto in special la nivelul nucleotidului 3 din
codon. Intr-adevdr, este uor de observat cd, in general, primele doud baze
ale codonilor sinonimi sunt constante. Crick a conchis cd asocierea
nucleotidelor 1 i 2 din codon cu nucleotidele 3 i 2 din anticodon este fermd,
respectand principiul complementaritdjii A, U i C, G, in timp ce
imperecherea nucleotidului 3 din codon cu 1 din anticodon este, in general,
laxd, Aceasta s-ar datora particularildjii nucleotidului 1 (capdtul 5) din
anticodon de a se imperechea i cu alte nucleotide, tncdlcand regulile
Watson-Crick (A, U; C, G). De exemplu, in pozijia 1 a anticodonului, uracilul se
poate lega cu A dar i cu G (slab), iar guanina se poate lega cu C, dar i cu U
(slab), din pozijia 3 a codonului. Frecvent prezentd ca nucleotidul 1 in
anticodon, inozina se poate lega de citozind, ca i de uracil sau adenind, dar
legdturile sunt slabe. Cand insd in pozijia 1 a anticodonului se gdsete C sau
A, acestea se pot lega numai dupd regula Watson-Crick cu G, respectiv U din
pozijia 3 a codonului, stabilind legdturi ferme.
In pozijia 1 a anticodonului existd deci, in mulji ARNt, o baza ovdielnicd",
nedccisd\ oscilantd'\ dispusd sd incalce regulile de complementaritate

Watson-Crick (efectul wobble). Un ARNt conjinand un astfei de anticodon


poate recunoagte i se poate lega la mai mulji codoni care specified acelai
aminoacid (s-au identificat 51 de tipuri de ARNt); cel mai adesea legdturile
sunt slabe.
Rafiunea biologicd a complexiidjii interacjiunilor codon-anticodon ar
decurge din necesitatea de a asigura atat acuratcjea imperecherii cat i
promptitudinea disocierii complexului ARNt-ARNn), care nu trebuie sa devina
un factor limitant al vitezei procesului de biosintezd a proteinelor. Departe de
a fi un semn de imperfeejiune, degenerarea codului minimalizeazd efectele
mutajiilor, prin redundanja ibformajiei.
De remarcat cd trei codoni din cei 64 (UAA, UGA, UAG) nu specified nici un
aminoacid. Aceti codoni, denumiji non sens", reprezintd de fapt semnale de
intrerupere a traducerii ARNnl. Un lanj polipeptidic, sintetizat pe un anumit
ARNm, iji inceteazd creterea atunci cand citirea ARNn) a ajuns la un codon
non sens.

205
- Codul genetic nu este ambigou, niciodatS acelai triplet no semnific&
doi aminoacizi diferiji.
- Codul genetic este universal-toate viepiitoarele utilizeazS acelai cod
genetic pentru a traduce genele lor specifice in proteine specifice, O abatere
surprinzStoare de la universalitate ne releva codul genetic al mitocondriei.
Astfel, codonul AUA corespunde metioninei, i nu izoleucinei, codonul UGA
corespunde triptofanului, nefiind nn codon non sens, codonii AUA i AUU sunt
codoni de iniJiere i nu codonii ce specific^ izoleucina .a.m.d..
V.2. BIOSINTEZA PROTEINELOR
Edificarea unei macromolecule proteice este, probabil, cel mai complex

proces biosintetic ce decurge in lumea vie, implicand conlucrarea a peste


300 de macromolecule reprezentate de protein * cnzime, cu funcfii distincte
in acest proces, i de diverse tipuri de acizi ribonucleici.
Procesul de biosintez& a proteinelor presupune traducerea limbajului de
patra litere al acizilor nucleici (4 nucleotide) in limbajul de 20 de litere (20 de
aminoacizi) al proteinelor.
In cadrul transferului de informafie, in organismele pro- i eucariote, etapa
de biosinteza a proteinelor este desemnata drept etapa de traducere a
mesajului genetic inscris in ADN i transcris in ARNm. Aceastil etap& decurge
la nivelul ribozomilor i se deruleazS, in principiu, prin ad&ugarea succesivif
a cate unui reziduu aminoacidic la cap&tul carboxi terminal in cretere. Atat
in cazul procariotelor c3t i in cel al eucariotelor, biosinteza proteinelor
implicit 5 etape:
- activarea aminoacizilor
- inifierea lanfului polipeptidic
- elongarea lanfului polipeptidic
- terminarea edific&rii proteinei i eiiberarea sa
- prelucr&ri posttraducere ale proteinei sintetizate.
I. Activarea aminoacizilor
Participarea aminoacizilor la biosinteza legaturii peptidice, care este un
proces endergonic, impune activarea prealabil& a acestora, Activarea are loo
in urma reaefiei aminoacidului cu ATP. Se formeaz& complexul
aminoacil~AMP, care con|ine o legatura macroergicti de tip anhidridS mixt&
i pirofosfat. Hidroliza ulterioarS a
206
pirofosfatului, sub acfiunea pirofosfatazei, depiaseazS echilibrul spre dreapta,
f&cand reacfia ireversibiLl

Complexul aminoacil-adenilat cedeaz& restul aminoacid activat unei


molecule de. ARNt specified aminoacidului dat (al edrui anticodon corespunde
codonului ce specified aminoacidul respectiv), permijandud ARN r s&-i
exercite funefia de transport i adaptors a aminoacizilor. ARNt leagS
aminoacidul la capStul CCA i anume la gruparea -OH din pozifia. T sau 3 a
nucleotidului adenilic, cu formarea unei legSturi esterice, in mod exceptional,
macioergicS.
ROO
ARN{
ARNt

I 1! II

NH2
Aminoacil-ARNt
Reacfia global*! de activare a aminoacidului poate fi scrisd:
aminoacid + ARN, + ATP >- aminoacil ARNt + AMP + 2P
Pentru activarea fiecarui aminoacid se consumd doud legaturi
macroergice.
Atat reacfia 1 cat i reacfia 2 sunt catalizate de ligaze-aminoacil ARNt
sintetaze, care manifesto o extremd specificitate atat pentru aminoacid cat i
pentru ARNt, evitandu-se astfel eroarea legSrii la un anumit ARNt a altui
aminoacid decat cel al cfirui codon este complementar cu porfiunea
anticodon a ARNt dat. Pe langd local de legare a ARNt i a ATP, enzima este
inzestratd cu incd doud locusuri, unul pentru legarea aminoacidului, avand o
dimensiune adecvatd acestuia i altui, hidrolitic. Dacd un aminoacid ce diferd
minimal de aminoacidul consacrat se leagd la locusul de legare a
aminoacidului activat, enzima recunoate aminoacidul impostor i-I
exclude prin hidrolizd. De exemplu, dacd in loc de izoleucind se leagd valina,
care diferd doar printr-o grupare metilenicd de prima, enzima corecteazd
imediat aceastd eroare, expulzand valina din locusul hidrolitic, care are
dimensiuni potrivite pentru complexul AMP~valind, nu insd i pentru
AMP~izoleucind. Prin hidroliza complexului valil-AMP, valina este eliminatd i
enzima leagd corect izoleucina.
Fidelitatea procesului de traducere-respectiv adaptarea corectd a
aminoacidului pe matrices de ARNm i stabilirea secven|;ei de aminoacizi
caracteristicd proteinei de
sintetizat este, in mare mdsurd, asiguratd de capacitates de autocontrol a
ARNt sintetazelor.
IL Iniiierea laniului polipeptidic
Citirea de cdtre ribozom a ARNm se face in direcfia 5-3 a acestuia,
proteina edificandu-se de la capdtul amino-terminal spre cel carboxiterminal.
Inifierea presupune ca primd etapd legarea subunitdfii 30 S a ribozomului
la ARNm. Legarea este mediatd de unul dintre cei trei factori de inijiere i
anume de factorul de inifiere 3 (FIS), care are i rolul de a preveni
reasocierea prematurd a celor doud subunitdfi ribozomale. Etapa necesitd
prezenfa GTP. Legarea corectd a ribozomului in dreptul codonului de inifiere,
ce specified aminoacidul N-terminal, este esenjiald pentru citirea corectd a
mesajului genetic. La procariote, aminoacidul N-terminal este, invariaUl, Nformil-metionina. Acestui aminoacid ii corespunde pe molecula de ARNm
codonul AUG (uneori i GUG), cel care specified i metionina nefonnilatd din

cuprinsul lanfului polipeptidic. Subunitatea ribozom aid 30 S va trebui sd


discearnd intre AUG corespun- zand N-formil-metioninei, deci aminoacidului
initiator, i AUG corespunzand celorlalte reziduuri de metionind. Ghidarea
corectd a ribozomului la capdtul 5 al ARNm, in
208
dreptul codonului cle inijiere, este posibilS datorita prezenjei la capS- tul 5 ai
ARNm a unei secvenfe. poHnucieotidice (secvenja Shine Daigarno), adiacentd
codonului de inijiere, perfect complementary cu o succesiune de nucleotide
de la capStuI 3-OH al ARNr 16 S, conjinut in subu- nitatea 30 S. Semnalul de
inijiere a traducerii la procariote este, deci, re- prezentat de codonul AUG
precedat de secvenja nucleotidica descrisS. Afinitatea ribozomului pentru
semnalul de inijiere ar modula viteza traducerii, aa cum afinitatea ARN
polimerazei pentru promoter modu- leazfi viteza transcrierii.
Aa cum s-a menjionat anterior, la procariote, mulji ARNm sunt
poiicistronici, codificfind douS sau mai multe polipeptide. Pe un astfel de
ARNra exists multiple semnale de inijiere egale numeric cu .numS- rul de
lanfuri polipeptidice codifi- cate, Ribozomul, alunecand peste semnalul de
terminare a sintezei pri- mului polipeptid (codonul non sens), iniJiazS,
informal fiind de un nou semnal de inijiere, sinteza urmS- torului lanj
polipeptidic.
A doua etapS a procesului de inijiere constd in legitrea ia com- plexul
ARNm subunitate 30 S a N-formil-metioniJ~ARN,fmet i a GTP. La aceastS
legare colaboreazS factorii de inijiere 1 i 2 (FIl + FT2). N-formiI-metionilARN,fnwt rezultS prin formilarea metionil~ARNfmc{,

Fig. V.1 - Cele trei trepte in formarea complexului de inijiere.

209
format din ARNt11,Kt i metionind, sub acjiunea unei transformiiaze avand ca
donator de grupare formil N10-formi!tetrahidrofoiatul (N10-CHO-FH4):
metionina + ARNtfm9t + ATP * rnetionil~ARNthnet + AMP + PR metioni!
ARN/met + N10 - CHO ~ FH4 - formlbmetionil - ARN/' + FH4
De suhliniat faptul ca existd doufi specii diferite de ARNt purtdtoare ale
metioninei: ARN(niel i ARNtfme\ fiecare aptd sd lege metionina generand

metionil~ARNtnie\ respeetiv metionil~ARNtfnwt. Dintre aeestea numai metionilARN/1 este susceptibild la formiiare generand aminoacidul initiator care se
va lega la codonul de inijiere, i nu la oricare codon AUG de pe ARNm, in
dreptul locusului peptid de pe ribozom care-1 accepts (Fig. V.l).
In cea de-a treia etapd a inijierii, subunitatea ribozomald mare, 50 S, se
leagd la complexul anterior format, cu eliberarea simultand a factorilor de
inifiere i hidroliza GTP. Se formeazd, astfel, ribozomul functional desemnat
drept complex de inifiere.
Formil-metionil~ARN,fmct, legal pe principiul complementaritdfii bazelor la
codonul de inifiere, ocupd locusul peptid de pe ribozom (ocupat altfel numai
de lanful polipeptidic in cretere), Locusul aminoacid al ribozomului este
deocamdatd liber (Fig. V.l).
III. Ehmgarea ian^ului polipeptidic
Procesul const! in addugarea succesivd de aminoacizi pand la formarea
proteinei de sintetizat.
Addugarea fiecdrui aminoacid parcurge mai multe etape, ce se vor
exemplifica pentxu aminoacidul 2 din catena polipeptidicd.
a. Recunoaterea de cdtre ARNf purtdtor al aminoacidului doi a celui de-al
doilea codon de pe ARNni. Fixarea corecld a aminoacil~ARNt pe locusul
aminoacid de pe ribozom este asiguratd atat de interacjiunea codonanticodon cat i de interacfiunile ce se stabilesc intre o anumitd porfiune a
ARNt i locusul aminoacid (A). Aceastd etapd a eiongarii necesitd prezenfa
unui factor de elongate (Tu) legal la GTP, ca elector alosteric (Fig. V.2).
b. Formarea legdturii peptidice prin transferul restului formii-medonil pe
gruparea amino a aminoaciI~ARNt din locusu aminoacid. Reacfia este de
fapt o reacjie de acilare a grupei. amino din aminoacidul doi, catalizatd de o
peptid.il transferazd, factonii de elongate G, inclusd in subunitatea 50 S.
Locusul peptid este, in acest moment, ocupat de ARNtfnicL, iar locusul
aminoacid este ocupat, nefiresc, de un ARNt purtdtor al dipeptidului format
(Fig. V.2.)
Energia necesard fonnarii legdturii peptidice este furnizatd de energia
eliberatd la desfacerea legdturii aminoacid inifiator-ARN, corespunzdtor.
c. Glisarea ribozomului de-a lungul ARNm pe o distanjd de un codon spre
capatul 3 al ARNm. Simultan sire loc hidroliza ARNrfmet (fost purtdtor al
aminoacidului 1) cu eliberarea sa in citosol. In acest moment, locusul peptid,
ajuns in dreptul codonului 2, este ocupat de ARK, purtdtor al dipeptidului, iar
locusul aminoacid, ajuns in fafa codonului 3, este gala sa accepts ARNt
purtdtor al aminoacidului 3 (Fig. V.2). Aceastd
210

alunecare a ribozomului pe ARNm, cu toate evenimentele ce o inso{esc,


poartS numele de transiocare. Etapa de translocate este catalizat# de o
translocazS i presupune hidroliza unei molecule de GTP. Ca i in etapa
anterioard procesui este conditional de existenja unor factor! de elongare.
Procesui de elongare este un proces repetitiv, care se deruleaz& absolut
analog la formarea urmdtoarelor legdturi peptidice.
211

Pozitia P

Pozitia A

Pozitia P

Pozitia A

Fig. V. 2a - Etapa 2 a elong3rii.


212
PozitiaP ' Pozitia A hi
I
C=0
k'1-'

Fig. V.2b - Etapa 3 a elongMi.


IV. Terminarea sintezei lanftilui polipeptidic
Procesul de elongare se oprete cdnd ribozomul intalneste unul dintre
codonii non sens care semnalizeaza terminarea lanfului polipeptidic. Pe unii
ARNm existd doi codoni non sens succesivi sau separap prin 5 codoni,
probabil pentru a reduce riscul citirii in continuare a mesajului genetic in
cazul unei mutafii care schimbd un codon non sens cu unul sens.
La aceti codopi, ajuni in faja locusului aminoacid, nu se mai poate lega.nici
un ARNt, intrucat nici o secvenjd anticodon nu corespunde acestora. In acest
moment intervin divert factori de eliberare care efectueazd urmdtoarele
operafii:
-desfacerea hidroliticd a legdturii polipeptid-ARNt, cu elibexarea
polipeptidul ui, sub acfiunea peptidil trans ferazei ,,transformatdu de factorii
de eliberare (FE) in hidrolazd;
- eliberarea ARNt, purtdtor al ulti- mului aminoacid, din locusul peptid;
-disocierea ribozoinului in subunitdjile respective, apte sd inceapd sinteza

unui nou lanj polipeptidic;


-degradarea ARNm care a servit ca matrix pentru bio- sinteza unei
proteine, atunci cdnd sinteza acesteia nu mai este necesard (Fig. V.3.)
Biosinteza proteinelor este, aa cum s-a ardiat, un proces de mare
complexitate cai'e presu- pune i uiiA con sum energetic substantial Intradevdr, la for- mai'ea unei legdturi peptidice se consumd patru legdturi
macro- ergice, doud in etapa de activare a aminoacizilor (ca ATP) i doud in
etapa de elongare (ca GTP). Cele 29 kcal investite in fonnarea unei legdturi
peptidice care elibereazd la hidroliza numai 5 kcal, asigutd ireversibililatea
procesului i, desigur, fidelitatea sa.
Fig. V.3 - Terminarea lanjului
proteic.

214
Biosinteza proteinelor decurge cu o vitezd impresionantd (un lanj
polipepiidic de 100 de aminoacizi este edificat de cdtre un ribozom de
Escherichia coll in numai 5 secunde). Pentru a~i adecva fondul de proteine
necesit&Jilor extrem de variable, impose de fluctuafiile de media,
procariotele cupleazd procesu! de transcriere cu cel de traducere; pe m&surd

ce ARN polimeraza ADN-dependentd sintetizeazd ARNm ribozomii efectueazd


traducerea acestuia.
Biosinteza proteinelor la eucariote decurge printr-un mecanism similar cu
cel propriu procariotelor; aparatul de sintezd a proteinelor din Escherichia
coli poate sd utilizeze ARNia objinut de la organismele superioare i sd
sintetizeze proteine perfect funcjionale.
Exisfa i uneie particularity in desfdurarea biosintezei proteinelor la
eucariote, cum ar fi:
-aminoacidul initiator nu este N-formil metionina, ci metionina;
- pe molecula de ARNm- existd un singur semnal de inijiere a traducerii,
reprezentat, aa cum s-a mai ardtat, de 7-metil guanozind legatd printr-o
legdturd trifosfat de o succesiune de nucleotide mediate, urinate de ccxlonul
AUG (Fig. IV.40). Sinteza proteinelor la eucariote incepe cu citirea codonului
AUG situat in proximitatea capdtului 5 terminal, marcat. Nici unul dintre
ceilalji codoni AUG din ARNm nu vor servi drept codoni de inijiere, datoritd
exigenjelor de legare ale ribozomului. Ribozomul eucariot mai are un atribut:
el nu sareV pesle codonii terminatori (ca cel procariot). Ca urmare, pe un
ARNm eucario|v nu se poate sinleliza, intr-o circumstanfa datd, decat un
singur ianf polipepiidic, chiar cand transcriptul primar confine infonnajia cu
privire la sinteza mai multor lanfuri polipeptidice.
- viteza procesului de traducere este mai mare, in cazul eucariotelor.
Citirea ARNm de cdtre ribozom cu o vitezd de 40 codoni/sec ar fi total
insuficientd pentru eucariote care trebuie sd sintetizeze un intreg arsenal de
proteine, dintre care uneie cu masa moleculard foarte mare. Pentru
cregterea eficienfei traducerii, mai mulji ribozomi se angajeazd simultan in
citirea ARNU1, fiecare dintre ei incepand citirea de la capdtul 5 tenninal.
Evident, intr-un anumit moment, un ribozom va fi purtdtoml unui lanj;
polipeptidic mai lung sau mai scurt, funcjie de momentui in care a inceput
citirea. Ribozomii cei mai apropiafi de capdtul 5' al ARNm, spre deosebire de
cei care au ajuns aproape de capdtul 3' terminal, vor purta un lanf
polipeptidic mult mai scurt, avand incd de descifrat o mare porjiune de
ARNm. Asocierea mai multor ribozomi, ce Iraduc sincron aceeagi moleculd de
ARNm, constituie un poliribozom sau polizom (Fig. V.4.) Se pare cd i
procariotele recurg la formarea polizomilor.
tots

Fig. V.4 - liustrarea schematics a unui poliribozom.


215
V.3. PRELUCRARI POSTTRADUCERE ALE MOLECULELOR PROTEICE
Objinerea unei proteins native, funcfionale, presupune, cel mai adesea,
modificarea lanjxslui polipeptidic rezuitat prin traducere. Prelucr!riie
posttraducere constau in:

-indepftrtarea enzimatic! de ia cap&tul N-terminal a restului formil din


formil- metionin! (la procariote) sau a metioninei (la eucariote), ceea ce
explicit faptul c! nu toate proteinele incep cu aceti aminoacizi;
-modificarea unor aminoacizi in scopul obfinerii celor care nu dispun de
cuvinte cod. Hidroxiprolina, hidroxilizina din colagen se ob|in prin hidroxiiarea
enzimatic! a prolinei, respecliv lizinei. Cistina se formeaz! prin oxidarea
reziduurilor de cistern! y-carboxilarea reziduurilor de acid glutamic din unele
proteine, indeosebi a celor implicate in coagulate, genereaz! 7-carboxiglutamat, excelent chelator al calciului. Reacjia este dependent! de vifamina
K.
- iodurarea reziduurilor de tirozin! ale tireoglobulinei;
-atagarea la lanjul polipeptidic a unor grup&ri funcfionale, de exemplu
fosfat, pentru formarea fosfoproteineior (fosforilarea reziduurilor de serin! a
unor enzime reglatoare. sau a reziduurilor de serin!, treonin!, tirozin! din
cazein!), glicozil, pentru formarea glicoproteinelor, biotin!, pentru acetil-CoA
carboxiligaza etc,
-clivarea unor oligopeptide in cazul unor proteine sintetizate ca precursor!
De exemplu, insulina sintetizat! ca preprohormon este convertit! la hormon
numai dup! indep!rtarea succesiv! a unor fragmente polipeptidice (vezi
insulina).
-ADP-ribozilarea (mono- sau poli- ADP-ribozilarea) proteinelor, intalnit! la
eucariotele superioai*e, joac! on rol central in procesele de reparare,
diferenfiere celulanl, carcinogenez!.
Mono ADP-ribozilarea reprezint! 0 modaiitate de acjiune a unor toxine
bacteriene printre care toxina difteric! a holerei etc. care igi aleg, inspirat,
Jinta printre proteinele implicate in transducjia unor semnale celulare.
Sursa de ADP riboz! este NAD+
- S-farnezilarea.
O prelucrare posttraducere, recent relevat!, este S-farnezilarea
proteinelor. Proeesul se adreseaz!, in special, polipeptidelor sau proteinelor
avand la cap!tul carboxi-terminal secvenfa: cistein!-(aminoacid alifa.tic) 2aminoacid C-terminal i const! in S-farnezilarea restului cisteinil catalizat! de
0 S-farnezil transferaz! (fig. V.5).
Proteina-aa (N terminal)
1
Cys-aa-aa-aa ( C terminal)
I alifatici
SH
S - fameziltransferaza * Farnezil PP

Proteina - aa ( N terminal)
7
1
+ PP
Cys -aa-aa-aa ( C terminal)
I atifatici S - farnezil
Fig. V.5 - S - farnezilarea proteinelor
216
Glucoza
Giicoiiza
T
acetiJ CoA

i
i.
-4-^ mevinoiin
V
mevalonat .
i
!
CH3
t
I
izoperttenil pirofosfat (Cs) ( CHS = C-CH2 CH2 ~0(P)0 (P))
i
i
geranil pirofosfat ( CiB)
i
i
o0d
farnezil pirofosfat ( C15 )
YN/YN/Y^
/
/
/
/
/
&
\
\
\
\
\
\
X
coiesterol
farnezilarea proteineior
Fig. V.6 - Provenienja metabolica a farnezil pirofosfatului i utilizarea sa.
Donatorul radicalului farnezil este farnezil pirofosfatul, intermediar in
biosinteza colesterolului (Fig. V.6).
Frecvent, farnezilarea este acompaniat& de metil esterificarea grapSrii
carboxi-terminale.
Sunt susceptibile la S-famezilare polipeptide i proteine din clasa
proteineior G, GMPC fosfodiesterazele diverselor fesuturi (vezi hormoni) i alte
numeroase proteine corelate cu proceseie de transducjie a unor semnale
extracelulare sau implicate in diviziunea celularH
Hidrofobia radicalului farnezil ii justified prezenja in proteinele ancorate la
membrane iar depistarea lor in citosol sugereaz& c5 proteinele famezilate
servesc ca mesageri secunzi ai unor semnale extracelulare, mediate de
proteinele G.
217
O intreagS clasS. cie proteine farneziiate este reprezentatft de
oncoproleine; inhibitori ai farnezii transferazeJor sunl consiiierafi ca fiind
promij&tori in prevenirea maligniz&rii celulare.

S-a demOnstrat cd mevalonatul, intermediar in sinteza farnezii


pirofosfatului, este necesar replicSrii ADN in celulele animate. Inhibitori ai
sintezei de mevalonat, cum ar fi mevinolinul (utilizat i in tralamentul
hipercoiesterolemiei), inhiba cregterea blocand celulele in faza Gjt Reversarea
procesului prin adaos de mevalonat, i nu de colesterol, demonslreaza cd
intermediarul faniezil pirofosfiat, i nu colesterolul, este responsabil cle
cregterea celularSL Conslatarea nu este incompatibilft cu cregterea sintezei
de colesterol in celula canceroasS.
- acilarea proteinelor cu radical! acil ai acizilor gragi (miristQilare,
palmitoilare) este, de asemenea, o modificare posttraducere cu profunde
implicajii fiziologice.
Orice protein;!, cu o secvenpl anume de aminoacizi, isi dobandegte,
ulterior, conformajia nativa, cme ii asigura reaiizarea fuiicjionakl.
Inhibitori ai sintezei proteinelor
Numeroase antibiotice i toxine bacteriene se comports ca inhibitori ai
procesului de biosintezfl a proteinelor, Inhibarea sintezei proteinelor se poate
realiza in orice moment al transferului de informafie ADN-ARNm-proteina
(Tabel V.2).
Tabetul V.2.
inhibitori ai sintezei proteinelor
Compusul
I
Mecanism de acpune
Proce
su!
Mitomicina
!
tmpiedica fizic separarea
Replic cateneior compiementare de
are
ADN,
Repiic
Acidul nalidixic are
Inhiba ADN giraza
Rifampicina
Transc Leaga ARN poiimeraza.
riere
Actipomicina D Transc Se leaga term la ADN.
riere
Streptomicina
Tradu Interfera cu iegarea formilcere
metionii-ARN,**1 la locui de
inhere.
Cloramfenicolu Tradu inhiba peptidil-transferaza
l
cere
Tradu Inhiba iegarea amtnoacil-ARN, la
Tetraciclina
cere
ribozomi.
Tradu Inhiba transiocarea prin Segare la
Eritromicina
cere
subunitatea 50 S.
Puromicina
Tradu Blocheaza elongarea,
cere
substituindu-se unui amino- acilARNt in situsui A (este analog
structural al extre- mitajii 3 ai
tirozil-ARN,)
Neomicina,
Tradu Erori Tn citirea coduiui genetic
Kanamicina
cere
Toxina difterica Tradu Inhiba translocaza

cere
Degi acjiuriea compugilor men|iona|i se manifests, cu precMere, in
organismele procariote, unele sunt la fel de active i in cele eucariote
(puromicina, actinomicina D, a-amanitina).
218
VA REGLAREA BIOSINTEZEI PROTEINELOR
Mecanismele care regleazd viteza sintezei de proteine.au fost studiate in
special in cazul procariotelor. Activitatea acestora depinde foarte mult de
mediul in care trdiesc, de fluctuafiile in concentrafia substanfelor nutritive pe
care le utilizeazd. Procariotele au abilitatea de a-gi adecva echipamentul
enzimatic la natura surselor de azot sau carbon ce li se ofera; ele dispun de
doud tipuri de enzime:
a. enzime inductibile;
b. enzime represibile.
a Enzimele inductibile sunt acelea a cdror concentrate depinde de
prezenfa sau absenfa din mediu a unui compus denumit inductor. In general,
enzimele inductibile sunt implicate in cdi catabolice. In mod normal,
cantitatea de enzime inductibile in celule este foarte micd dar ea poate
create spectaculos atunci cand apare necesitatea utilizMi substratului
enzimei respective, substrat care se comportd ca inductor.
Un astfel de exemplu este JLgalaetozidaza, enzimd care catalizeazd
hidroliza lactozei gi care este prezenfcd iritr-un numdr minim de exemplare in
condijiile in care bacteria are la dispozifie altfe surse de carbon, de preferinfd
glucoza, dar care, in condi fiile in care lactoza devine sursa exclusive de
carbon, deci de energie, este sintetizatd in rnii de exemplare. Organizatd pe
principiul maximei economii, bacteria investegte aminoacizi gi energie
pentru sinteza enzimei numai atunci cand aceasta devine imperios necesanl
Transferarea bacteriei pe un mediu confinand glucozd determine sistarea
sintezei P-galactozidazei. Lactoza se comportd ca inductor al sintezei enzimei
ce o catabolizeazd. Utilizarea lactozei presupune participarea a incd doud
enzime i anume: o permeazd, care faciliteazd ti'ansportul (J-galactozidul'ui
in interiorul celulei gi o transacetilazd, a cdrei funcfie nu a fost incd
precizatd. Lactoza induce sinteza nu numai a galactozidazei ci gi a celorlalte
doud enzime. Inducfia prin lactozd este deci coordonatd, referindu-se la
toate enzimele implicate in utilizarea sa.
b. Enzimele represibile sunt acelea a cdror concentrafie depinde de
prezenfa sau absenfa din mediu a unui compus denumit corepresor. In
general, enzimele represibile sunt implicate in cdi anabolice.
O bacterie care cregte pe un mediu confinand surse de azot gi carbon
este aptd sd realizeze sinteza tuturor eeior 20 de aminoacizi. Dacd in mediu
se adaugd unui - oricare - dintre acegti aminoacizi, bacteria inceteazd sd
producd enzimele implicate in biosinteza aminoacidului respectiv.
Aminoacidul addugat produce represia sintezei tuturor enzimelor implicate in
biosinteza sa. Represia prin produsui final al unei cdi anabolice este deci o
represie coordonatd.
Explicarea in termeni molecular! a proceselor de inducfie gi represie
enzimaticd se datoreazd lucrdrilor lui Jacob gi Monod. In 1961, acegtia
elaboreazd modelul privind reglarea biosintezei proteineior la procariote,
reglare ce se efectueazd la nivelul trans- crierii, deci a sintezei ARNm.

Modelul Jacob-Monod de reglare a biosintezei proteineior poartd numele


de teoria operonului gi s-a bazat, in principiu, pe studiul regldrii
metabolismului lactozei in Escherichia coli. Ei au postulat cd genele
structural ce confin informafia cu privire la biosinteza ($-galactozidazei,
permeazei gi transacetilazei (desemnate z,y,x) sunt adiacente in genom gi
cd viteza sintezei celor trei enzime este guvernatd de un fragment de ADN
219
denumit gen# reglatoare. Pe aceast# gen# reglatoare se edific# un ARNm ce
conjine informajia pentru sinteza unei proteine denumit# represor. Acest
represor, o protein# alosteric#, se leag# la un fragment de ADN, desemnat
drept operator, care este adiacent la genele structurale a c#ror transcriere o
controleaz# i impreun# cu care formeaz# un dperon (operonul lac). Genele
structurale ale operonului pot fi transcrise atata tisnp cat operatorul este
liber. Legarea represorului la operator blocheaz# accesul ARN polimerazei la
locusul promotor avand ca rezultat suprimarea transcrierii genelor
structurale interesate in metabolizarea lactozei.
Ce se intampl# Tn prezenja lactozei care, aa cum am v#zut, se comports
ca inductor, declanand sinteza celor trei enzime ce o catabolizeaz#? Jacob
i Monod admit c# inductorul se leag# specific la represorul atagat la
operator i, inducand o Ixanzijie alosteric#, il converted la o conformajie cu
afinitate redus# pentru operator; ca urmare, are loc desprinderea acestuia
de pe operator. In aceast# situajie, ARN polimeraza se leag# nestanjenit# la
locusul promotor, inijiind transcrierea genelor structurale, respectiv sinteza
unui ARNm policistronic pe care se vor edifica cele trei enzime ce
catabolizeaz# lactoza (Fig. Y.7). Inductorul realizeaz# derepresia operonului
i permite declan area proceselor de transcriere i traducere subsecvente.
Moleculele de represor liberepot lega i ele molecule de inductor, ceea ce le
converted la forme inapte s# se lege la operator.
Abilitatea represorului de-a se lega reversibil i exclusiv la operator sau
inductor este responsahil# atat de represia sis tern ului p-galactozidaz# cat
i de derepresia (inducjia) sa.
O Tntrebare pare ineviiabil#: ce se intampl# dac# bacteria (E.coli)
dispune simultan de glucozft >i lactoz#? Se va comporta lactoza ca
inductor, impiedicand acjiunea represorului i deci permijand transcrierea
genelor lac i ulterioara lor traducere? Strategia bacteriei este alta; ea create
pe seama glucozei i numai alunci cand concentrajia acesteia atinge valori
minime incepe s# utilizeze lactoza. Metabolizarea simultan# a glucozei,
combustibil preferat al E.coli, x a lactozei sunt excluse; bacteria nu
consum# energie pentru sinteza enzimelor operonului lac atata timp cftt
dispune de glucoz# (represie prin catabolit). Cum simte bacteria prezenja
glucozei in mediu i cum se comut# activitatea ei pe utilizarea lactozei cand
concentrajia glucozei scade? R#spunsul s-a conturat ca urmare a
urm#toarelor constatSri:
- adenozin monofosfatul ciclic (AMPC), format din ATP sub acjiunea
adenilatciclazei i hidrolizat de fosfodiesteraz#, reprezint# semnalul de
foame al bacteriei (hunger signal"), de lips# a glucozei. AMPC se leag# la o
protein# receptoare specific# (proteina receptoare a AMPC = P.R.AMPJ,
formand complexul AMPC-PRAMPC, apt s# se lege pe un locus specific din
regiunea promotor. Prezenja complexului in acest locus favorizeaz# accesul

i legarea ARN polimerazei la promotor (locusul promoter se suprapune


partial peste locusul operator).
- in lipsa glucozei sau la concentrajii mici ale acesteia, concentrajia
AMPc este mare; formarea complexelor cu proteina receptoare i legarea
acesteia la promotor permite intrarea ARN-polimerazei la locusul promotor.
Dac# lactoza este prezent# in mediu, operatorul este liber i ARN
polimeraza efectueaz# transcrierea genelor lac. (p- galactozidaza,
permeaza, transacetilaza) i deci utilizarea lactozei (Fig. V. 8).
Alunci cand concentrajia glucozei este mare, concentrajia AMPc este
redus# i, prin absenja complexului AMPC-P.R.AMPC, ARN polimeraza nu se
leag# la promotor i genele lac nu sunt transcrise fie c# exist# lactoz#, fie
c# nu, deci indiferent dac# operatorul este ocupat de represor.
220
GemragZahtare
Gene structureie
1 URN J ,
|
ARNm}entrjj
{
.J
AON
GKK/\/ KA/MVVA^/W^ Afittm poiigenic Pibozmt j /ftibozomi
Proteina represorfc
(active)
+inductor J3-GdioctozidazS Pmna&zi ProteinSA Prote/ne
cnd/ficate
Comp/ex
/nductorrepresor
(inac/ix)
Fig. V.7 - ilustrarea mecanismului de reglare a biosintezei proteinelor prin
inducjie.
9MZ*ro Promoter Opere/or (te/tfiere
3
ff/a/Oof c______ A_
A
regie,
y
Prote/nS(~\ recepteare v_y
Repreaor
A RNpo/imeraza
b
/
ProteinS
recepteare
X
y
ARN AMPC po/imeraza
Comp/ex , ,
,
represor-inoucror
Fig. V.8 - Reglarea operonuiui lac la E.Coli intr-un medlu confinand giucoza (a)
sau lactoza (b).

<?
Proieine
cod/f/cnte
221
Complexul AMPC-P.R.AMPC, spre deosebire de represor, exercitd on efect
pozitiv m exprimarea operonului lac. Aceastft dubld modalitate de reglare
intalnitd la numeroase bacterii i vizancl diveri operoni, conferd acestora o
mare flexibilitate metabolic#, permi|andude $d-i rezolve problemele de
adaptare la mediul nutritional ce li se oferd ia un moment dat.
Teoria operonului oferd o explicate i fenomenului de represie prin produs
final a biosintezei en.zi.mdor. Genele implicate in biosinteza histidinei-de
exemplu-inceteazd sd se mai exprime trt sauafia in care sinteza histidine! in
celuld depdete utilizarea sa. i, ca urmare, aminoandul se acumuleazd in
mediu. In absen|a histidine!, represorul, sintetizat de cdtre gena reglatoare a
operonului His, este inapt sd se lege la operator. La concentra{ii mari de
histidind insS, aceasta se leagd la represor i induce o tranzitie
conformational^ ce favorizeazd legarea sa la operator. Histidina se
comport# ca un corepresor reuind sd sisteze transcrierea genelor ce
codified enzimele implicate in propria sa sintezd. Are loc astfel represia
coordonatd prin produs final (Fig. V.9). indepdrtarea histidine! din mediu,
respectiv utilizarea sa, produce derepresia transcrierii i dec! aparifia
enzimelor ce o sintetizeazd.
In termeni generali, modelul Jacob-Monod admite existenja unei gene
reglatoare care controleazd exprimarea anumitor gene structurale prin
inteimediul unei proteine, a edrei sintezd o specified, denumild represor.
Activarea represorului suprimd sinteza de ARNni, deci de proteine, in timp ce
inactivarea sa permite transcrierea genelor structurale controlate i sinteza
proteinelor respective.
(lepd
repMvdre
ffepresop in'acfiv ""
Operator s/foefora/a
~~ -------
l
I
AM:
m
/7Z//77<J
\
Frodos (corepresor)
,
<3
Complex represor- corepresor ac/yV
JU
0s
Gena s/roe/vra/anu es/t trooscr/sa
Fig. V.9. - iiustrarea mecanismuiui de reglare a biosintezei proteinelor prin
represie.
222

In cazul enzimeior inductibiie, tepresorul este activ in mod normal i


genele structurale sunt represate. Cand in media apai'e inductorul,
represorul este inaclivat de c&tre acesta, ceea ce duce la derepresia genelor,
deci la sinteza enzimei respective.
In cazul enzimeior represibile, represorul este inactiv in mod normal i
genele structurale se exprimil ducand la sinteza unui anumit component
celular. Cand in media se acumuleaz# produsul final al cSii anabolice
respective, care se comports drept corepresor, represorul este activat prin
formarea complexului represor-corepresor, producandu-se represia genelor
structurale i sistarea sintezei enzimeior implicate in sinteza metaboiitului
celular terminal.
Ipoteza Jacob-Monod i-a dovedit validitatea in cazul a nenum&rate
sisteme enzimatice. Ea a perm is interpretarea acfiunii unor compui endosau exogeni (medicamente, hormoni) prin mecanisme de inducjie i represie
enzimaticS, contribuind totodatii la descifrarea unor mecanisme patogene.
Pe langd tipul de reglare deserts, bacteriile dispun i de alte mecanisme
de control al biosintezei proteinelor, care ie asigurS supraviefiiirea.
La eucariote, reglarea sintezei proteinelor se realizeaza atat la nivelul
transcrierii cat i la nivelul traducerii. Mecanismele reglSrii la eucariote sunt
pujin cunoseute.
Reglarea la nivelul transcrierii se realizeazS prin aejiunea unor hormoni.
Se tie, de exemplu, c& sinteza unor enzime implicate in gluconeogeneza,
cum ar fi: piruvat carboxiligaza, fosfoenolpiruvat carboxikinaza, fructozo-l,6bisfosfataza, este indus& de cortizol. Estrogenii, androgenii, vitamina D ii
exercitS acfiunea asupra fesuturilor fintii declanand sinteza unor proteine
specifice.
Prin ce mecanism realizeazd hormonii steroizi induefia? Se considers cS
acedia au intrare liberS in celulS unde se leagfi la receptori specific!,
citoplasmatici, formand complexe hormon-receptor. Aceste complexe sunt
transferate in nucleu unde interaejio- neazS cu cromatina, declanand
sinteza anumitor tipuri ARNm care, prin traducere, genereazS proteine
specifice (vezi hormonii).
Anumite evenimente care au loc la nivelul genomului pot sa modifice
numftrul de exemplare dintr-o proteins datit sau chiar dinlr-un ARN de care
celula are nevoie express la un moment dat. Astfel, unele celule cresc
numarul de copii, per genom, a unei clase de gene, probabil printr-un proces
de inijiere repetatft decurgand in cursul sintezei ADN (ampiificare genicS). Pe
de altS parte, gradul de metilare a ADN 1-ar face mai susceptibil sau trial
pujin susceptibil la a fi transcris. in general, o genS mai pufin mediate are
anse mult mm man de a se exprima decat una mai mediate.
Dei potenfialul genetic este comun pentru diverse Jesuturi, compozifia in
proteine a acestora diferri atat cantiiativ cat i calitativ. in fiecare fesut
numai o fraejiune din informajia genetic este tradusft sub fortn de
proteine. Jinand seama de mSrimea genomului eucariot i de faptul c& nu
mai mult decat 10% din acesta este vreodatS
223
transcri's i apoi exprimat in proteine, se considers cS reglarea transcrierii la
eucariote
s-ar face mai degrabS prin proteine activatoare ale genelor i nu prin

proteine represoare.
Reglarea la nivelul traducerii poate fi exemplificatS in caznl biosintezei
hemoglobinei trpextracte de reticulocite. Adaosul de hem la acestea
declanjeazS biosinteza glob'inei; suprimarea aportului de hem sisteazS
sinteza. Controlul s-ar exercita asupra unuia dintre factorii de inifiere i
anume factorul de ini{iere-2 (FI-2). Acesta poate trece reversibil dintr-o
formS defosfo, activS, intr-o formS fosfo, inactive, AceastS modificare
covalentS a FI-2 este realizatS de o proteinkinazS AMPC dependents, enzimS
constituitS din dou& subunitSfi reglatoare i douS subunitSfi catalitice cu
activitate kinazicS (C2R2). Sub acjiunea AMPC, proteinkinaza (C2R2) se
disociazS cu eliberarea subunitSJilor catalitice active, care fosforileazS FI-2
trecandu-1 in forma fosfo- inactivS. Deosebit de important este faptul cS
protein kinaza AMPC dependents este inhibatS de hem. DacS hemul este
prezent in probS, proteinkinaza este inactivS i FI-2 rSrnane in forma defosfoactivS, permifand ini{ierea sintezei globinei. In absenfa hemului, inhibijia
proteinkinazei se suprimS 1 ca atare ea va fosforila FI-2 inactivandu-1 deci
oprind sinteza globinei. Conversia formelor fosfo- la defosfo- este realizatS de
cStre o fosfatazS (Fig. V. 10.)
Reglarea biosintezei proteinelor la eucariote presupune i alte mecanisme,
a cSror bazS molecularS este incS neclarificatS.
Hem

A MPc + Cg R2
2C + 2 R-AM Pc

ATP AFP
FI-2
-defosfo- (acff )
-fosfo- (indch'y)
RI-2
FosfdtdTS
Fig. V.10 - Reglarea biosintezei globinei prin fosforilare reversibila a Fl2.
224
V.5. LEZIUNI ALE MOLECULELGR DE ADN X REPARAREA ACESTGRA, MUTAJII
Stabilitatea informa{iei genetice inscrisS in molecuia de ADN este
.esenfialS pentru organisme in sine i pentru continuitatea lor in limp.
Cum medial in care trSiesc acestea poate fi advers, exists .riscul ca
integritatea informajiei genetice s3 fie ameninfatl
Vulnerabilitatea moleculei de ADN la factori chimici (agenji aJchilanfi,
agenp de intercalare, agenfi de nitrozare, analogi structural!, acizi, cum ar fi
acidul azotos, compui care prin metabolizare genereazS radical! liberi) i
fizici (radiajii ultraviolete, X) creeazft premiza aparifiei leziunilor ADN.
Leziuni ale ADN pot fi introduse i in cursul replicSrii, dacS acestea au
scSpat acjiunii de corector (proof reading) a ADN polimerazei III (mismatch

errors).
Leziunile pe care le suferS materialul genetic constau, in principal, din:
- schimbarea stMlor tautomere, cu posibilitatea fmperecherii eronate a
bazelor, fie in cursul replicSrii, fie prin substituirea unei baze proprii ADN cu
un analog structural; astfel, 5 brom-uracilul, analog al timinei, prefers forma
enolicS i nu pe cea cetonicS, pe cam o adopts timina; din acesf motiv 5
brom-uracilul se imperecheazS cu G 1 nu cu Ac
Br
o H - ---------- 0

H
Forma enolica a 5~Br - uracilului
Guanina
Consecinfa este inlocuirea perechii A = T cu G s C (tranzijie),
- depurinSri; aproximativ 5000 de baze purinice se pierd pe zi prin
hidroliza spontanS a legSturii glicozidice;
ruperea legaturilor fosfat diesterice;
cross-linking al bazelor de pe catene opuse;
- dezaminarea spontanS sau sub ac{iunea acidului azolos/cu formarea
unor compui care fie nu se imperecheazS cu bazele azotate, fie sunt
susceptibili la imperecheri eronate.

Pan dezaminare citozina conduce ia uracil, guanina la xantiml si adenina


la hipoxantina (Fig. V. 11); fiecare dintre ele, nefiind baze proprii ADN, vor fi
cu uurin{& recunoscute i exclusc de callre enzirnele de reparare (se admitc
c3 existenja timirid in loC de uracil In rnolecula ADN i-ar gdsi astfel
justificarea);
- dimerizarea timinei, cu formarea unor stmcfuri ciclobutanice in cadrul
aceleiaji calene (Fig. V.12);
- inserjia uneia sau a mai multor baze suplimentare; se produc inserjii la
tratarea unor culturi celulare cu acridinS, molecuid plan# care se poate
intercala intre douS baze din tr- un Ian]., fifnl sil se lege covalent. In timpul
replicMi, pe catena complementary se insert, corespunzdtor acridinei, o bazS
suplimentarS care se leaga covalent. La o replicare
ulterioaiti va exista o pereche de baze suplimentara;
- delejia uneia sau a mai multor baze; se produc delefii prin hidroiiza
unei baze din lang posibild la variajii de pH i temperature, sau prin acjiunea
unor agenji care modified o baza de aa nalura incat aceasta nu mai este
complementary cu nici o altil bazd, Prin replicare, golur apare pe ambele
catene.
Aceste leziuni pot fi corectate de mecanismele de reparare pe care le-a
imaginat nalura. Gama cxtrem de variatd a leziunilor, rezultand din greeii
apdrute in cursul replicftrii, ca i din agresiuni externe a supra moleculei,

implied o mare diversitate a mecanismelor de reparare.


H
A4/
nw
CVZoz/nd |
N // i
^
Dezdm/nare
O
Dezam/fjjre
---------" l A
Urati/ O
////
/Y
Jde/r/rra
0
Nib

VZ

Deza/rw&re
/V /V
GuavZnZr
J/
HZpoxmZini 0
11 l
H
Xanana
Fig. V.11 - Dezaminarea due ia baze "strain" ADN
226
Fig. V.12 - Dimeri de timlna.
H3C.
MC

H ff/boza
'dft/AQZtf
\
V.5.I. REPARAREA PRIN EXCIZIE-RESINTEZA
Moiecula de ADN este singura rnacrornolecida care poate' fi reparanl (cu
maxim<1 acurate|.e), atrihut. decurgand din redundanfa informajien
inlrinsecd slructurii dubiu heiicoidale; ori de cate ori o catenS este lezatS
cealaM va servi nu nu'mai la pdstraxea informajiei genelicc, dar i la
repararea catenei lezate. Esenfiale in procesu.1 de reparare sunt detectarea
leziunii gi corectarea acesteia. Numerous enzime (pcste 50) conlucreazS in
acestc procese de recunoagtere specified i reparare, supraveghind

continuu moleculeie de ADN.


Acpunea sistemului reparator constitute presupune, in esenjfi,
urmStoarele etape:
- excizia seevenjei alterate;
- sinteza unui fragment de ADN corespunzator porfiunii exeizate;
- sudarea fragmentelor rezultate.
Sislemul de extizie-refacere aejioneazft atat in mutageneza spotanS, cat i
in cea indusft de radiafii sau de agenfi chimici,
Vom ilustra aejiunea sistemului de reparare in situafia dezaminSrii uneia
dintre hazel azotate (Fig. V.13).
Elim inarea bazelor rezultate se realizeazS sub acfiunea unor glicozidaze
specific care recunosc legtttura glicozidicft purditoare a unei baze alterate.
Endonudeaze speciiice recunosc riboza neangajatS in iegStunl glicozidicd
i cliveaz& leg&turiie fosfat diesterice dintr-un fragment de ADN ce
delimiteazii go!ul l&sat prin elim inarea bazei.
ADN poiimeraza 1 efectueazd, folosind ca matrix catena de ADN bun, o
copie a fragmentului de ADN excizat.
ADN ligaza ligatureazS fragmented de ADN in prezenja ATP.
227
AJ CG G C T' cjAjr C C G AJ
.i
I II
:ni
fAGC C GAG A G G C GA Ci/durd
T AT
r CCGA r
CGGCrC N
____
L
rA GCCGAG
r/
V
AT C G G C
TO
T AGCC
GAGr A
~~c
_ 7
A r c ffff c r *
}
rAGCCG
AGr

fGGcrA
Adeni/ AON g/zcozidaze
r c c GA r
i
A GGCTA
Nac/eazS
CCGA r
..
AGGCTA
| ADN'flo/merez# /
AON-//g#zd

A rCG G c r
cA

rccGAr

rA G C C ff A G rA GGCrA
Fig. V.13 - Repararea unei catena ADN in care a avut ioc dezaminarea

adeninei la hipoxantina
Un alt exemplu de acjiune a sistemului constitutiv reparator il reprezintS.
excizia dimerilor de timing formaji prin acjiunea radiajiilor UV (Fig. V.14).
Defecte in activitatea enzimelor de reparare se traduc printr-o mare
sensibilitate la acjiunea radiafiilor UV i o frecvenjd. crescuta a cancerelor de
pieie.
imperecherea greita a bazelor in cursul replicSrii (mismatches), scftpata
vigilen|ei ADN polimerazei III, este rezolvatS de un sistem de reparare
specializat care sesizeaza distorsiunile introduse in dublul helix, discriminand
totodata intre catena nou sintetizata (inc& nemetilata specific) i catena
parental!
Pe langS sistemul constitutiv de reparare, organismele dispun de un
sistem inductibil de reparare, reprezentat de o serie de factori de naturd
proteica, a cror fidelitate in replicare este numai aproximativa care, din
acest motiv, a fost dermmit sistemul reparator predispus la erori. Cum el
condijioneaza supraviepiirea, f&c&nd posibiia replicarea ADN, chiar dac& prin
repar&ri oarecum aproximative, a fost denumit i sistem SOS.
228
Repararea este realizatft de sisteme enzimatice care pot preceda procesul de
replicare
sau, dimpotriv8, acfioneazd poslreplicativ.
Enzimele reparatorii ce preced replicarea sunt in general enzime
constitutive i pot fi surprinse de replicare in urmdtoarele situajii:
ieziunea este complet remediate i bifurcajia de replicare trece normal;
Ieziunea permite trecerea aparatului replicator dar catena in formare
rSmane incomplete
Ieziunea nereparatit, inc3, nu permite desfSjurarea replic&rii.
De menjionat c& sistemul inductibil de reparare este tranzitoriu,
incetandu-i activitatea cand acpunea inductorilor sSi a luat sfSrit.
JSrr"TTi
-s'
-3f
0 erdom/c/eazaspec/A/ca (^d~aqdoqucfecda)c//^dzd a /agarere
resfafd/esfer/cd

Dfmera/ de dm/na,, s/ /yac/eoddefe ad/acerre 3swf-exc/zefe c/e o e/?do - $


m/cfeeza
s

3'

s'3'
AON f/qaza re face
/eqa/dra fosfaf if/esfence

,_

s
J__L
Fig. V.14 - Excizia dimerilor de timina (structuri cidobutanice).
229
V.5.2. REPARAREA PRIN REVERSAREA LEZIUNTLOR
Pc langd mecanismele de reparare prin excizie-resinlezd existfi i
posibilitatea d.e reve.rsare a lezkmilor ADN. Astfeh dimerii de timind pot sd
reformeze ^nonomerC sub acjiunea luminii.
Revcrsarea acestui tip de lezitme se datoreazd aetivMi, sub acjiunea
luminii (300-600 nm), a unci fotoliaze (enzima fotomerizantd) care
recunoale regiunea ADN disiorsionatd de dimer, pe care il cliveazd.
Reversarea dircctd este demonstrate gi pent.ru 06-alchiI-guanine forma
enolied, rezultate prin acjiunea unor agenji alchilanji asupra guaninei.
Procesul este enzimalie i acceptorul final este lnsdi enzima-Ofi-alchilguanin-alchil transferaza care se autometiieazd la an reziduu cisteind.
Surprinzdtor, enzima, devenitd inactive, nu se regenereazd.
Exists dovada efi o activitate 06-aichii transferazied scdzutd este o
caracteristicd a ficatului cirolic. Menjinerea OMnetiNguaninei ar fi
responsabild de transformarea malignd a celulelor hepatice prin mu tape de
tip tranzipe (G-A) i activarea oncogene! celulare liras (mecanism admis de
activare a oncogendor).
Cum ciroza hepatied este o elapd In procesul de hepatocarcinogenezd,
teoria privind reiajia mutape-cancer are un argument in plus,
Leziunile care scapd sistemelor de reparare devin rnutapi (schimbarea
permanent^, a
seevenjei nucleotidelor intr-o gend reprezintd o mutafie).
Mutajiile pot interesa o singurd pereche de baze (mutapi punctiforme) sau un
grup de
baze, de pe una sau arnbele catene ale unei molecule de ADN,
Mutajiile punctiforme surd, rezultatui:
1, substitupei care poate dec urge prin:
a) tnmzijie - o pereche de baze este inlocuitd cu alia; o bazd purinied
dintr-o eatend
este inlocuitd lot cu una purinied, sau o bazd pirimidinied este inlocuitd tot
cu una. primidinied.
Acidul azotes dezamineazd adenina, a edrei pereche este timina, la
hipoxantind care se imperecheazd de preferinjd cu citozina:

V.5.3. MUTAJIT

N
citozina
hipoxantina
230
b) transversie - o perechede baze este inlocuitd cu alia; o baz& primidinicd
dintr-o catena este Inlocuitd eu una porinica, sail una purinicd eu una
pmmidinicd. In Fig.
V.15 sunt reprezentate diferile mutajii ce pot avea loc prin tranzijie 1
transversie in gena structural#. corespimzand ianjului P al hemoglobinei,
avand ea rezultat substituirea aminoacidului valind din pozijia 67 cu alji
arninoacizi i dec! aparifia unor hemoglo- bine anormale.
2.inserfiei.
3.delejiei.
Hemogiobina
Milwaukee
Glutamat
Hemogiobina . Bristol Aspartai
Hemogiobina A ( Normaia ) Valina
Hemogiobina
Sydney
Aianina
GAU -------------------------------------GUU------------&GCU
GAC<--------------------------------------GUC-------r---GAA 4----------------:--------- -----------QUA---------------------- GC4
GAG<------------------------------ ---: GUG -------------------+ GCG
Fig, V.15 - Hemoglobin anormale rezuitate prin substitute
V.6. EXPRIMAREA FENOTIPICA A MUTAjllLOR
Modificarea inform ajiei genetice din ADN prin mutajie se exprirnd,
datoritd fluxului informational ADN-ARN-proteind, in lnsdi secvenja
aminoacizilor din proteine. Aceste proteine sunt proteine mutante. Mutafiile
punctiforme care schimba o singurd bazft dintr- tin triplet prin transversie
sau tranzijie pot produce efecte diverse cand se traduc In proteine,
La nivelul ARNm mutafia se traduce prin substitujia unui codon cu altul.
Acegtia pot fi:
a. Cu acelai sens - dacfi mutafia a inlocuit un codon cu un codon sinonim
(degenerarea codului). Proteina rezultatd nu se deosebegte de cea de
engine, mutajia produsd este o mutajie mutii (silent mutation).
b. Cu ait sens - In cazul in care codonui nou format specified alt
aminoacid, O astfel de mutajie punctiforma poate avea un ecou mai mare
sau mai inic asupra expresiei fenotipice, funejie de numerogi factor!, cum ar
fi:

- calitatea intrinsecd a aminoacizilor schimbaji


- diferenja de polaritate intre aminoacidul original* i cel din proteina
mutants, ceea ce duce la modificarea stabilitdjii, respectiv solubilitdfii
proteinei;
-diferenfa de sarcind electried modified migrarea In efunpul electric i
solubilitatea proteinei respective. Exemplul cel mai eloevent este acela al
substitu{iei acidului glutamic din pozijia 6 a ianjului P din hemogiobina A cu
valina. Solubilitatea proteinei mutante este mai mied (2%) In stare
neoxigenatd, fajd de hemogiobina normaid. Schimbarea sarcinii de suprafatd
a proteinei schimbd interaejiunea dintre subunitdji i face ca ea sd

231
precipite, formand cristale in forma de secer# (sickle), ceea ce confer#
acestei proteine anormale denumirea de hemoglobin# S. Hemoliza avansat#
care se produce determine ischemic tisularil mai mult sau mai pufin severe.
Proteina safer# modific#ri mai mici sau mai mari in funcfie de situarea
aminoacidului substituit intr-un loc mai mult sau mai pufin vital pentru
structura, respectiv func{ia proteinei. De exemplu, dac# aminoacidul
schimbat este integral unei porfiuni de lanf proteic angajat in legarea
substratului, este probabil ca repercusiunile s# fie severe, mergand pan# la

abolirea capacit#fii catalitice a proteinei. Un exemplu este cel al


hemoglobinei M, in care histidina din pozijia 58 a lanfului alfa sau din pozijia
63 a lanfului beta este mlocuit# cu tirozina. Histidina din pozijiile respective
este implicate, aa cum se gtie, in insugi procesul de legate a 02 (substratul).
Ca urmare a substitute!, hemoglobina mutants va lega mai slab 02; mai mult,
in aceast# hemoglobin#, Fe2+ este vulnerabil oxid#rii la Fe3+.
Methemoglobina format# in timp agraveaz# lipsa oxigenului.
ModificSri severe pot suferi proteinele reglatoare prin schimbarea unor
aminoacizi din locusul aiosteric sau din regiuni interesate in relafiile
interprotomerice ce mediaz# tranzifia aiosteric#.
Schimbarea unui aminoacid cu altul intr-o protein# poate s# afecteze
legarea acesteia la receptorul s#u specific. In hiperlipoproteinemia familial#
tip III (dis-(3-lipoproteinemie vezi lipide) incapacitatea de legare a
apoproteinei E la receptorul ei hepatic este rezultatul substitufiei, in regiunea
de legare, a argininei cu cisteina. Cum apoproteina E este esenfial# in
introducerea in hepatocit a chilomicronilor i p-lipoproteinelor remanente, se
constat# acumularea acestora in sange, cu aparifia aterosclerozei.
Se poate intSmpla'ca un codon sens, ce codific# un aminoacid, s# fie
inlocuit cu un codon non sens, terminator. In acest caz, intrucat transcrierea
se termin# prematur, se obfin lanfuri proteice incomplete, nefuncjionale,
care sunt degradate.
Inserf iile i delefiile conduc la mutajii in coloaniT (frame shift mutation)
atunci cand num#rul de perechi de baze ad&ugate sau scoase dintr-o
secvenf# nucleotidic# nu este multiplu de 3. Citirea ARNm corespunz#tor
unei gene in care s-au produs astfel de mutafii genereaz# proteine
nefuncjionale.
Dac# inserfia sau delejia se refer# la un multiplu de trei perechi de baze,
proteinei rezuitate ii vor lipsi sau prisosi mai mulfi aminoacizi, ceea ce poate
fi grav, mai pufin grav sau foarte grav.
V/7. CLONAREA GENELOR
V.7.1. CLON/7REA GENELOR IN VIVO (Tehnologia ADN recombinant)
Recombinarea genetic# reprezint# un schimb de informafie genetic#
intre dou# genoame avand ca rezultat crearea de molecule de ADN
recombinat,
Schimburile genetice sunt posibile, natural, numai in cadrul aceleai
specii, posibililatea de recombinare constituind insui criteriul de definire a
unei specii.
Recombinarea genetic# Intre specii a ap#rut intotdeauna ca tentant# i
s-a anticipat ca avantajoas#.
232
Experience de inginerie genetic?! (tehnologia ADN recombinant) vizeazft
inserfia unor gene de provenienfii animals sau vegetal?! (ADN recombinant)
intr-un vector potrivit (o molecula de ADN) i introducerea intr-un media
celular care s2 ii permits replicarea autonomy i chiar exprimarea fenotipicS.
Tehnologia ADN recombinant face apel la letmicile de clonare (a ciona = a
face copii identice dintr-o singurS ceiula sau molecula parental?!; se obfine o
clonS celularS sau molecular?!).
Clonarea ADN presupune objinerea unui mare numilr de copii ale unui
anumil fragment de ADN (ideal o genS), prin introducerea acestuia In

complementul genetic al unui organism i replicare ulterioarli.Obfinerea unor


cantMji rnari din fragmentul de ADN izolat i purificat permite atingerea
scopurilor denarii ADN i anume:
1) studii fundamentale de genetic?! (seevenjializarea i locaiizarea genei
in genom, objinerea de sonde" pentru depistarea dintr-un amestec a unei
anumite seevenje micleotidice, terapie genic?! etc.)
2) studio! expresiei unei gene; proteina codificatS de gen5 nefdcand
parte, in general, din reportoriul de proteine al celulei gazdil este posibild
alterarea void a proprietdfilor organismului acceptor ca i objinerea unor
microorganisme apte s& sintetizeze gi' sS secrete proteine de uz practic.
Introducerea unei molecule de ADN ca atare xntr-o ceiula gazdh
comports riscul ineficienjei preluSrii sau degradSrii acesteia. Pentru evitarea
acestei eventuality^ se apeleazS la un vector de donate o molecula ADN,
in general, extracromozomial, care indeplinegte dou& proprietSji
fundamentale: este invulnerabil la aejiuni distructive i posed# o origine a
replicSrii.
V.7.1.1. Scenariul clonarii genelor; objinerea ADN recombinat
Scenariul pe care il presupune clonarea parcurge etapele:
I. includerea fragmentului de ADN conjinand gena de clonal (ADN
recombinant) intr- un vector de clonare, cu formarea unei molecule hibride
desemnat# ca moleculS de ADN recombinat;
II.introducerea moleculei de ADN recombinat. in ceiula gazdS, in care i se
permite s#
se replice, urmatS de selectarea celulelor transformate. Gazda cea mai
utilizatS este E. coli. Parcurgerea unui mare numSr de cicluri celulare
genereaz# o populate de celule conjinand copii multiple ale moleculei de
ADN recombinat (o cion#);
III.recuperarea ADN recombinat din extractele celulare i objinerea genei
donate.
I a) Clonarea unui anumit fragment de ADN presupune identificarea i
objinerea sa in stare purfi din genomui unei celule. AceastS operajie este
practicabil# numai pentru genoamele de mici dimensiuni.
ADN donor al genei de interes, ca i ADN vector, sunt clivaji astfel incat:
s# se poatS forma exiremitaji monocatenare omoloage, avand posibilitatea
de a realiza o sinapsii molecular#. Decisive In implinirea acestei necesit#Ji a
fost descoperirea enzimelor de restriejie. Aceste endonudeaze recunosc In
molecula de ADN o seevenfa anumit# de baze i cliveaz# cate o legatur#
fosfat diesteric# de pe ambele catene, intr-un loc particular ai seevenjei
recunoscute. Situsurile de recunoagtere pentru cele mai multe enzime de
restriejie sunt palindroame care prezint# dubl# simetrie rotational#. Un
palidrom este definit ca o porjiune de ADN in care seevenfa nudeotididl,
cititH pe ambele catene in direejia 5 3, este identic#.
233
Dinire diverse!e tipuri de enzime de resiricfie, tipul II are legitlur& directs cu
tehnica
ADN recombinant. A fost caracterizat on numSr ibarte mare de enzime de
restrief e tip II, avSnd specificitil{i diferite i provenind dintr-o varietate de
bacterii. O selecjie a ceior mai uzuale esle data in tabelul V.3. Uneie enzime
de resiricjie taie moieculele de ADN bicalenar decaiat, producand

segmente purtStoare de extremity monocatenare coezive (con{inand


nucleotide complementare) ce permit sinapsa fragmentelor aid'd
neomoloage. Aslfel, restiictaza Eco R-I, izolata din Escherichia coin
recimoasrc secvenja palidromicfi 5' GAATTC 3 i taie intre G i A. Secvenfa
de pe cealaltS catena 3 CTTAAG 5 va fi taiatd tot intre G i A. Evident,
rezultS. fragmente de ADN cu capete monocatenare eomplementare;
Situsurilede recunoatere i clivare ale unor enzime de restricfie
Tabelul V.3.
Secvenfa
Enzima de
recunoscuta G
Provenienja
restricpe
indica situsul de
metiiare)
Eco R i
S' GKA'TTCS'
Escherichia coil Ry13
Eco R il

^CC'^GG

Mae III
Hind II!

GGV C

Hpa II

cV'GG

Pst 1

CTGCA^G .

Taq i
Bam H 1

T*CGA'
G'kaATCC

A^AGCTT

Escherichia coll
Ry245
Haemophilus
aegyptius
Haemophilus
influenzae Rd
Haemophilus
parainfluenzas
Providencia stuartii
164
Thermus aquatieus
, Bacillus
amyloiiquefadens H

4
5 G A A T T C 3
5-_C TT A AG 5'
IT
j Eco Rl
1

G
A A T J C
CT T A A
G
Alte endonucleaze de restricjie taie ADN bicalenar, formand capete boante
(blunt ends), drepte, necoezive. Hpa I, obJinutS din bacteria Haemophilus
parainfluenzae, taie aslfel:
5 G
-T
- 3
'
AA C

T
3 C
-A
-

T G 5
AT~
-
i
Hpa
i
5 G
-T
A A C

3
T-

0I

3 C
-A
234
P/dSfi7f(f

() AU)
Fig. V.16, - Etapeie c\onaru unui fragment de ADN intr-un plasmid.
Dactl pe o molecule de ADN exists mai multe situsuri de.recunoatere
pentru o restrictazd, aceasta va genera mai multe fragmente de ADN. Cu cat
secvenfa recunoscut& de enzima de reslricjie este mai lungft cu atat
fragmentele de ADN obfinute sunt mai lungi. De exemplu, Eco R I, care
recunoate o secvenjfl de 6 nucleotide, taie fragmente de 10-20000
nucleotide, care pot sft corespundft la una sau mai multe gene,
Fragmentele objinufe prin acfiunea mai muhor enzime de restricfie,
adesea unigenice, pot fi separate prin diferite metode.
Dac<1 atat ADN donor al unei gene, cat i plasrnidul vector sunt clivafi de
aceeai restrictazS, de exemplu Eco R I, este posibiD inserpa genei in
plasmid prin imperecherea nucleotidelor de la nivelul capetelor coezive (Fig.
V.16). O ligazj stabilejte legifturi fosfat diesterice sudand plasrnidul devenit
recombinat.
235

fi :;i

Dacd doud molecule de ADN, ce provin de la specii diferite, nu conjin


capele coezive, se recurge la adflugarea de secvenje monocatenare
complementare la capetele celor doua molecule. Enxima dezoxinucleotidil
transferaza, denumitd i terminal transferaza., are abilitatea de a adduga la
capetele 3-OH ale celor dou& molecule ce trebuie sudate cozi
homopolimerice complementare, de exemplu polidezoxicitidina pe o
molecule i polidezoxiguanozina pe cealaldi:
5s
5

5l
3'
5s
3*
terminal transferaza.
GGGG CCCG3s 5f
3!
ADN iigaza
GGGG-JJYTT'
cccc~~
3(
De remarcat cd, terminal transferaza nu reclamd o catend ADN matrifd.
Alternativ la modalitatea prezentatd, se pot insera direct Tntr-un vector
adecval fie ADNC objinut prin revers transcriere, fie o gend sintetizatd chimic.
L b) Vectori de clonare. Ca vectori de cionare se utilizeazd: plasmidele,
i'agii, cosmidele.
Plasmidele sunt., aa cum s-a ardtat anterior, molecule circulare de ADN
dublu catenar, extracromozomial, care se replied independent de cromozom.
Ele sunt instrument ideale ale tehnologiei ADN recombinant, intrucat
insumeazd calitdji importante, cum ar fi:
- se izoieazd uor i rezistd la manipuldri;
- sunt'molecule rnici care tree uor prin membrana celulei gazdd;
- se replied autonom i rapid, independent de cromozom, ceea ce
permite amplificarea genei (fragrnentului ADN inclus);
- prezinta gene marker care, exprimate fenotipic, le conferd
caracteristici ce permit selecfionarea celulelor transformate (cel mai adesea
gene de rezistenjd la antibiotice).
Plasmidele uzual utilizate pentru cionare au fost modificate in laborator i
conjin in genele de rezistenjd la antibiotice situsuri recunoscute de uncle
enzime de restriejie, Un plasmid foarte popular, confecfionat in laborator,
pBR322, de aproximativ 4 kb, are doua gene care-i conferd rezistenjd la
antibiotice (la ampicilind i tetraciclind), ambele inciuzand situsuri
recunoscute de anumite enzime de restiicjie (Fig. V.17 a), Dacd atat
fragmental de clonal, cat i plasmidul s-au tdiat cu aceeai enzimd de
restriejie, de exemplu Pst I care tale seevenfa CTGCA4G (prezentd in gena
care-i conferd rezistenfa la ampicilind), capetele lor complementare se vor
lega, constituind plasmidul recombinat - o moleculd himerd (Fig. V7!7.b).
Introducerea plasmidelor recombinate in celule bacteriene-gazdd. se face
prin procesul numit transformare\ cu objinerea unor celule transformate"
genetic.
236
plasmid
p8R322
o,r6-
endonudeazS de restrictie (pst!)
strain
O

Fig. V.17 - Clonarea ADN in p.BR3.


i

237

Fagii se ulilizeaza ca vector! alternative intrucat ut.iliza.rea piasnricielor


este limitatd la secvenje ADN de lungimi moderate (~ 15 kb), eficienja
procesului de transformare scdzand cu cvegterea lungimii fragmentului ADN.
Bacteriofagii, virusuri bacteriene, pot clona fragmente de ADN de
dimensiuni mult, rnai mad decat plasmidele, generand un imens numdr de
copii per celukl Fagul A, cel mai utilizat, are o calitate cared distinge,

aproximativ o freime din genomul sdu nu este esenjiald pentru existenja sa


i, ca aiare, accepts cu ugurinjd ADN strain, de dimensiuni comparabiie, in
local fragmentului neesenjiak De menjionat eft fagul A, utilizat ca vector de
clonare (fagul Charon), es(e prelucrat astfei incat singurul situs recunoscut
de Eco R 1, cu care este, in general, tdiat sd se afle in regiunea neesenfiala.
Molecuiele de ADN recombinat objinute sunt introduse in cclule bacteriene
(E.coli} prin procesul numit transfeeJie/ (infeejie fagied).
Cosmidele sunt construcjii artificiale rezullate din asamblarea unor
piasmide de dimensiuni mari cu unele secvenje de ADN din bacteriofagul A.
Ele accepts fragmente de ADN foarte mari (>45 kb) i pot fi introduse in E.
coli drept cosmide recombinate.
Reamintim cd, in toate cazurile, ohjinerea ADN recombinat implied
sudarea. ceior douft specii de ADN (ADN de clonal: i ADN vector) sub
aejiunea unor ADN ligaze. Eficienja enzimei este maxima in situajia in care
fragmented objinute sub aejiunea unor enzime de restriejie au capete
coezive (tentajie naturald de a se uni).
II. Odatd create premized clonMi, confecjionarea modcudlor de ADN
recombinat, urmeazd introducerea acestora in celule gazdd care devin astfei
celule transformate genetic. Aceastd operajie se realizeazft prin
permeabilizarea membranelor celulare cu Ci2Ca. Numdrul de celule
bacteriene (in general E.coli) care preiau molecule himerft este rnic, ceea ce
obligfi la detectarea i sedetarea exclusiv a acestora.
In cazul utilizdrii pBR322 tdiat cu Pst I, existd posibilitatea ca, pe iangd
celulele bacteriene care au preluat modcula recombinatd (A), sd existe celule
care fie au preluat piasmidul recircularizat inainte de a insera fragmentul
ADN de cionat (B), fie n-au preluat nici unul dintre cele doud tipuri de
piasmide (C).
Se poate discrimina intre cele trei tipuri de celule i selecta exclusiv cele
care au incorporat piasmidul recombinat, Jinand seama de faptul cd acestea
i-au pierdut rezistenfa la arnpicilinri, prin inserarea ADN de cionat in insdgi
gena care i-o conferea, pdstrand-o pe cea la tetraciclinSL Dacd celulele sunt
crescute pe pldci de agar conjinand tetraeiclind, vor create atat cele din
categoria A, cat i cele din categoria B, care au preluat un plasmid
nemodificat (evident, cele din categoria C mor). Preluate ca replica (replica
plating), pe agar conjinand atat ampicilind cat i tetraeiclind vor create
numai cele din categoria B (Fig. V.17 b). Compararea ceior doud geluri:
agar+tetraciclind i agar+ampicilind+tetraciclind, precizeazd pozijia
coloniilor recombinate, patternul de distribute a coloniilor fiind identic.
Bacteriofagii recombinaji se recunosc prin capacitatea lor de a crea
plaje de lizd. intr-o culture bacteriand cultivat'd pe pldci de agar.
Plajele de lizd conjinand ADN recombinat de interes se identified printr-o
tehnied de hibridare in situ (in situ hibridization), ce va fi prezenlatd
ulterior.
III. ADN heterolog se scoate din piasmidul recombinat prin tdierea
acestuia cu aceeagi enzimd de restriejie care 1-a general.
238
Bibiioteci genomice
Clonarea unui anumit fragment de ADN obfinut in stare purd este prin
excelenfd dificild pentru genoamele de mari dimensiuni, cum ar fi cel uman.

Hidroliza, fie i limitatd, a unui astfel de genom, sub acfiunea enzimelor de


restricfie, duce la un numdr imens de fragmente.
Modaiitatea cea mai practice de separare a unei gene, in aceastd situafie,
este hidroliza intregului genom cu o enzimd de restricfie care recunoate i
cliveazS o secvenfd reiativ rard in ADN, urmatd de clonarea tuturor
fragmenteior obfinute. Aceastd tehnicd este cunoscutd ca Ushnica puti.i de
vdntoare (shot gun technique").
Colecfia de clone recombinate, confin&nd intreaga informafie geneticd a
unui organism constitute o bibliotecS genomicd.
Crescute in medii de cuitord adecvate, celuiele confindnd biblioteca
clonatd se pot replica i, adesea, exprima in celula gazda producand
proteine.
Selectarea (screeningui) unei clone confindnd o gend anume din
multitudinea de clone ce constituie biblioteca genomicd se realizeazd printrun proces ce poartd numele de hibridare in sitii. Coloniile bacteriene,
fiecare confinand un ADN recombinat diferit, sunt transferals din culture
originald pe un filtru de nitroceiulozd (sau nylon), care are afinitate mare
pentru ADN monoeatenar, Un numdr de celule din fiecare colonie aderd la
filtru, obfinandu-se o replied a culturii originale de pe geiul de agar. Filtru!
(sau nylonul) se trateazd cu NaOH, care lizeazd celuiele bacteriene.
denatured totodatd ADN confinut in acestea. ADN monoeatenar se ieagd
form la filtrul de nitroceiulozd (prin scheletul glucidofosforic, sub acfiunea
racliajiilor ultraviolets sau a temperaturii) in pozifia clonei din care provine.
Filtrul este tratat cu o sondd radioactivd monocatenard pentru gena de
interes, spdiat, pentru indepdrtarea sondei in exces, uscat i autoradiografiat
(Fig. V.18). Sonda, hibridizand exclusiv cu gena complementary, permite
vizualizarea coloniilor ce o confin. Localizarea pe filtru a sondei legate
corespunde localizdrii celulelor conjinand clona de interes din cuitura
originals, ceea ce permite recuperarea i amplificarea acesteia. Ca
alternative la sonda radioactive se poate utiliza o sonde asociate unei
activit&fi enzimatice,' cu condi fia ca actul catalitic sd se soldeze cu un
eveniment perceptibil.
Avantajul net al unei biblioteci genomice conste in faptul cd, odatd
constituitd, informajia inmagazinatd se pdstreazd, accesul la ea depinzand
exclusiv de disponibilitatea unei sonde specifics.
Natura unei sonde depinde de informajia pe care o avem despre gena de
interes. In situafia in care produsul de traducere a genei de interes nu este
caracterizat, se pot folosi ca sonde; ADNC anterior clonat, o gend omoloagd
clonatd provenitd din altd specie (pentru genele avand seevenje perfect
conservate in cursul evolufiei hibridizarea este mai mult deedt parfiald),
ARNm in situajia in care este abundent si uor de purificat dintr-o celuld.
Dacd insd gena cdutatd codified o proteind a carei seevenjd de aminoacizi
este cunoscutd, cel pufin partial, existd posibilitatea de a utiliza, ca sonde,
oligonucleotide de sintezd obfinute in conformilate cu codui genetic. Jinand
seama de o caracteristicd a acestuia codui genetic este degenerat
devine evident faptul cd ideale sunt proteinele foarte bogate in aminoacizi
specificafi de unui (metionind, triptofan) sau cat mai pufini codoni, pentru a
reduce ambiguitatea. Din setul.de oligonucleotide sintetizate, folosite
casondd mixtd,

239
unul va hibrida perfect cu gena cie interes. Posibilitatea ca un oligonucleotid
s& hibrideze, prin hazard, cu secvenfe din alte gene oblige la verificaiea cu
un nou set de oligonucleotide sintetizaf conform unei alte secvenje
aminoacidice din proteina de interes (Fig, V.19).
Biblioteci genomice provenind de la specii animate diferite, donate de
preferinfH in bacteriofagi, stau la dispozijia laboratoarelor de genetic*!.

Agar cu colonii bacteriene transformate

Replica coloniilor pe niirocelulozci


I NaOH + uscare

ADN transferal pe hartie nitroceiulozlca


Y'
W Asc 'w' radi
Asocierea cu proba radioactiva + uscare

Colonii detecta te
Film au-to- radiografic
Fig, V.18 - Identificarea unei clone conlinand segmentul de ADN dorit.
240
Secvenfe
+
cunoscute de aminoacizl
- Gly Codonipasibiti ($')
GGA
GGC GGU GGG
Leu ~ Pro - 7rp - GIu - 4sp ~ Met - 7?p - P/je
U CCA G G AUG
U UGG A A UGG

A
A C UUC
U ccc
G G UUU
U
A A
G
G U
G ecu
U
A
c
u
e CCG
c
u
u
G
U
G
Regfune de degenerare minima
Val - Arg - COO ~ Gf/U 4G4 p'J Gu'c 4GG GUlU CGA
GI/G CGC
1
GGU ? CGG \
!
Probe sintetice UGG GA* GAfi AUG UGG Uufi GU
Fig. V.19 - Detectarea genei unei proteine cu secvenja de aminoacizi
cunoscuta.
Biblioteci ADNC
Pentru genoamele de mari dimensiuni, utilizarea unei biblioteci genomice
comports probleme, identificarea unei gene anume fiind o operajiune dificilS.
Este motivul pentru care, cel pufin in situafia in care scopul cion&rii este
acela de a objine o anume proteins eucariotS, se recurge la o bibliotedl ADNC.
Pentru constituirea ei, ARNm matur se separS de celelalte tipuri de ARM
celular, mult mai abundente, prin cromatografie de afinitate pe oligodT
imobilizat pe coloanS. HibrideazS cu oligodT exclusiv ARNm care sunt
purtStorii unei cozi poliA; modiiicarea temperaturii 1 concentra}iei saline
per mite eluarea ARNm. Toate moleculele de ARNm dintr-o celula vor servi ca
template pentru sinteza unor ADNC monocatenari, sub acjiunea unor revers
transcriptaze virale (Pig. V.20). ADNC dublu catenari, formafi pe monocatenele
ADN sub acjiunea unei ADN polimeraze modificate, se insert! in vectors de
donate care-i vor introduce in celulele gazdd, constituindu-se o biblioteci
ADNC.
De remarcat cS, pentru un organism dat bibliotecile genomice au acela^i
conjinut, indiferent de Jesutu! utilizat ca sursS de ADN, in timp ee confinutul
unei biblioteci ADNC exprimS funcjiile specializate ale fiecdrui tip de celulS,
refleciate in expresia diferilS a unor gene particulare in diferite |esuturi.
Reprezentand toate genele exprimate la un moment dat intr-un |esut dat,
numftrul de clone cuprinse intr-o biblioteci ADNC complete este relativ mic in
comparajie cu numftrul de clone dintr-o biblioteci genomic# i deci
depistarea unei clone particulare va fi uguratS. O bibliotec# ADNC,
reprezentand molecule de ARNm foarte abundente sau mai pujin abundente,
este deci mai tentantS decat o biblioteci genomic#. Ea prezintS i

avantajul posibilitifii unei gene eucariote de a se exprima in gazde procariote


intrucat lipsa intronilor nu pune gazdei probiema existence! unui aparat de
excizie, ADNC pot, la randul lor, sS serveasc# ca sonde pentru a pescui intro banc# genomic# anumite gene.
241
ARNm
'i
\\i y

y; \
ARNm + oligonucleotid sintetic foiosit ca primer

Csnstruirea eatenei complementare de'ADNjpu ajutorufrevers transcriptazei


ARNm-ADN hibrid
3'
ARNm este degradai Tn mediu alcalin
i
3
TTTTTTTT

Fig. V.20 - Construirea unei biblioteci ADNC folosete ARNm sintetizat prin
revers transcriere.
V .7.1.2. Exprimarea fenotipicS a informa$iei ceprtnsa in ADN recombinat
Plasmidele hibride, ca i bacteriofagii hibrizi, reprezint& nu numai o sursS
abundent& de ADN heterolog, dar i o modalitate de a obfine in celula gazd&
mari cantit&Ji de proteine specificate de genele inserate. Clonarea operonului
triptofan din E. coli, de exemplu, a perm is sinteza celor cinci enzime ce-i
corespund, reprezent&nd 40% din proteinele celulare.
242
Utilizarea. unei gazde procariote pentru clonarea unei gene eucariote,
avand ca scop final objinerea proteinei corespunz&toare, poate fi ins3 un
egec dac nu se |ine seama de diferenfele notabile intre transcrierea,
traducerea gi controlul celor douS procese la eucariote fa(3 de procariote.
Vectorii care permit; transcrierea fragmentelor ADN inserate in bacterii

poartii numele de vector! de expresie gi sunt confecjionaji in vederea acestui


scop.
Prin tehnicile ingineriei genetice s-au objinut mari cantitSji de insulin^
uman& (humulina), somatostatin;!, hormoni de credere, la un grad de
puritate pe care tehnicile de izolare nu-I puteau atinge. Tot prin sintezS
bacterianS. s-au objinut, fapt remarcabil, interferoni gi vaccinuri fgrS
incovenientele celor clasice. Obfirserea activatorului piasminogenului, utilizat
in tratamentul infarctului de miocard, i a antitripsinei (inhibitor al elastazei),
utilizatS in tratarea enfizemului pulmonar, se num&rS printre succesele
tehnologiei ADN recombinant.
Tehnica clonSrii genelor a rezolvat probleme de terapie medicals,
stringent (tratamentul diabetului insulino-dependent, a nanismuiui
hipofizar etc.), a p&rmis modificarea geneticS a unor piante superioare
(transfer de gene avand ca rezultat cregterea eficienfei fotosintezei gi a
rezistenfei la diferite condijii de media), a produs bacterii specializate in
degradarea unor poluanji etc. Amplificarea genelor, prin clonare in bacterii, a
permis succese remarcabile in genetics (secvenjializarea genelor,
determinarea structurii cromozomilor la eucariote, mecanisme de control in
exprimarea genelor). Se anticipeazS utilizarea rezultatelor clonSrii genelor in
corectarea unor defecte metabolice innSscute, prin transformarea genetic!! a
unor celule somatice.
Este de sperat cS manipularea genetic# a microorganismelor va fi
practical# exclusiv in serviciul exislenfei, in spiritul celei mai inalte gi
inalterabile bioetici.
Incapacitatea bacteriei gazdS de a recunoagte elementele de control al
sintezei de ARM gi proteine, adSugatS la inexistenja aparatului de exciziecoasere a intronilor, ca gi a celui de prelucrare posttranscriere, proprii
eucariotelor, poate fi depSgitS prin utilizarea unor vectori de clonare apji s#
foloseasc# gazde eucariote (drojdii, celule animate in culturfi sau in vivo).
Printre vectorii de acest tip, cei mai utilizafi sunt vectorii retroviral!
modificafi.
Simplificand, procesul de clonare a unor vectori retrovirali in celulele
animate parcurge etapele:
1) sub acfiunea revers transcriptazei, ARN retroviral genereaz# un ADN
dublu catenar, conjinand informajia ARN;
2) o gen^l strain#, cea doriti, se insera in ADN, ob{inandu-se o molecul#
de ADN recombinat. Acesta este incapabil s# se replice gi s3 se transcrie,
intruc&t introducerea genei pasagere presupune ablajia anterioar# a genelor
responsabile de aceste procese (pentru a-i face loc genei str&ine);
3) ADN recombinat este introdus in celule in cultural, in prezen{a,
obligatorie, a unui virus helper4' ce permile transcrierea sa; ARN viral
recombinat rezultat se asambleaz# in particule virale;
H
H
A"
i/i

TA - - :
V!
:A
^!: i .
243
Genom retroviral
L
e
T *
n
R flag pa!
v
LTR I
ADN
LTR ga<
ADN retroviral deveni l recornbinat
iRevers transcriplaza
transforma genomul ARN 1h ADN dublu helicoidal
pol
i... ism
f Genele virale s&njlhiocuite
I' cu o gena straina
ADN recornbinat este introdus in celuie
Copii ARN viral recornbinat. produse in prezenta unui virus helper"

Revers Iranscriptaza' si integraza


Genom ARN / retroviral cu gene straine
Genomul retroviral cu gena straina este integral ?n cromozornul
celulei tinta r
Particuiele virusuiui recombine! infecieaz^ o celuia tin la

Fig. V.21 - Cionarea in celule animaie a unor vectors retroviraii


4) genomul retroviral, purtStor ail genei supine, este introdus in celuie
fintd, unde este reconvertit la ADN recombinat care se -integreazd in
genomul gazdd, unde se poate exprima (Fig. V.21).
Eficacitatea transferuiui genei trebuie sd fie vcrificata atat la nivelul
sintezei ARNra cat
i la cel al sintezei proteinei normals
Terapia genicci
Terapia genicd un deziderat care prinde contur uimdrete Inlocuirea
unei gene defectuoase, exprimate intr-un produs final defectuos, cu o genii
normals (terapie de substitute).
Un numSr important de lucrSri tiinJifice recente se refers la utilizarea
adenovirusurilor recombinate in tratamentul fibrozei chistice
(mucoviscidoza). Tentativa a devenit posibilS prin separarea i
secvenjializarea genei responsabile de producerea acestei maladii,
autosomal recesivd, afectand 1/2500 caucazieni, i care se adreseazS, in
principal, sistemului digestiv (in spe(S pancreasului exocrin) i respirator
(secrepe brongicd excesivS cu consecinfa infecfiilor repetate).
Este stabilif cS anomalia biologies fundamentals care stS la originea
mucoviscidozei este disfuncfia unui canal ionic pentru cloruri, prezent in
membrana celulelor epiteiiale, disfuncjie datorate, in majoritatea cazurilor,
delefiei unor reziduuri de fenilalanind. Introducerea in epiteliul respirator a
genei normale, folosind ca vector un adenovims recombinat caracterizat
printr-un tropism particular pentru epiteliul editor respiratorii, a eondus la
rezultate incurajaloare.
Pe langd vectorii virali, s-a incercaf utilizarea lipozomilor, ca i a unor
compui fiziologici avand afinitate crescutd pentru membrana unor celuie |
intd (imunoglobuline, transferina etc.)
Tehnici recente de terapie genicS ocolesc incovenientele introduse de
vectorii retrovirali, recurgand la microinjecjia de ADN (gena) in nucleul unei
celuie.
Microinjecjia de ADN intr-un ovul de joarece fecundat, care se introduce
intr-o fetneld, permite exprimarea genei straine in oriceii nou ndscuji
(animale transgenice). Prin aceastd tehnied, s-a reuit introducerea genei
specificand hormonul de cregtere urn an in ADN cromozomial at oarecelui,
sub controlul unui promotor inductibil. oarecii proveni{i din embrionii
injectaji capdtS dimensiuni fabuloase dacfi in hrana acestora se include
inductorul genei pentru hormonul de cretere.
Animalele transgenice permit evaluarea funcfici celulare a genelor i a
produilor specificafi de de in cursul diferenfierii, in diverse fesuturi.
Se sperd, in limitele unui optimism moderat, in tratarea bolilor genetice
umane, in mdsura in care defectul genetic este limitat la o singurd genii,
mecanismele biologice ce produc boala sunt injelese i gena normals este

donate. S-a experimentat terapia genied exclusiv pe boli genetice de mare


gravitate, cum ar fi o form! de imunodeficienfd severd determinate de
deficitul genei specificand adenozindezaminaza. Introducerea genei in
celulele maduvei osoase pare se aibe rezultatul scontat.
245

Intr-un viitor, nu tocmai apropiat, pare posibild gi abordarea terapiei


cancerului,
scontandu~se, inclusiv, pe cionarea genei ee specified factorul de necrozd
tumorald (INF).
De subliniat cd, in timp ce terapia genicd somaticd (introdueerea
materialului genetic in celuiele dipioide ale organelor bolnave) este permisd,
terapia genicd germinal d este interzisd prin lege sau prin consensul
comunitdjii gtiinjifice internajionale.
V.7.2. CLONAREA GENELOR IN VITRO (Reacjia polimerazied in lanj)
O aM modalitate de amplificare a unui fragment specific de ADN, de data
aceasta o amplificare in vitro, utilizeazd o reacjie enzimaticd. aceea de
polimerizare in lanj a dezoxiribonucleotidelor (polymerase chain reaction =
PCR).
Tehnica PCR, datoratd lui Kary Mullis (1984), necesitd:
1) molecule sau fragmente de ADN (provenind esenjial din lizate
celulare);
2) oligonucleotide primeri (amorse), formate din 20-30 de
dezoxiribonucleotide care hibrideazd perfect cu extremitdjile 3 ale
fragmentului de amplificat (in situajia in care secvenfa acestuia se cunoagte)
sau cu secvenje ce-1 flancheazd; acestea se pot objine fie prin adaugarea
unor fragmente sintetice la capetele fragmentului de analizat, fie prin
inserfia fragmentului de amplificat, de secvenjS necunoseutd, intr-un vector
de clonare de secvenfd cunoscutd;
3) o ADN polimerazd cataiizand elongarea celor doi primeri. Utilizarea
unei enzime termostabile Taq polimeraza - izolatd din Thermos aquaticus organism apt s& tr&iascd. activ la 75~85C, simplified metoda ce presupune
variajii de temperaturd. Enzima s-a dovedit a avea o foarte bund
procesivitate - calitate remarcabild pentru o enzimd care edified un
polinocleotid;
4) cei patru dezoxiribonucleozid trifosfajL
Tehnica in sine reprezinld un ciclu repetabil, constand in:
-separarca celor doud catene de ADN prin denaturare termied;
- cuplarea primerilor, addugaji in exces, cu seevenjele complementare
(annealing);
- polimerizarea, respectiv elongarea primerilor in direejia 5-3\
Operajiile se repetd pand la obfinerea unei cantitdji suficiente de produs.
In general, ciclul se reia de 25-30 de ori, seevenja de interes fiind dublatd la
fiecare ciclu, derulat pe parcursul catorva minute (Fig. V.22). Dupd cateva
ciciuri, produsul major este un fragment de ADN cu o iungime egald cu soma
lungimilor celor doi primeri plus segmentul ADN de interes.
Atributele evidente ale acestei tehnici sunt: selectivitatea, sensibilitatea,
rapiditatea. Fragmente de ADN virtual pure, din genoame complexe, pot fi
obfinute pe parcursul catorva ore, in contrast cu sdptdmanile pretinse de
cionarea tradijionald.1
Supremajia metodei rezultd i din cantitatea de material necesar o
singurd moleculd de ADN i nu milioane, necesare clondrii standard; mai
mult, tehnica nu presupune un ADN purificat. In plus, pentru amplificarea
unui fragment specific de ADN nu este obligatoriu sd se cunoascd seevenja
nucleotidicd a segmentului Jintd de ADN.

246
fragment de clonat
5 s3 '
3* *
5*
5p
P1

CATAGGACAGGO

3 s-----------GGACGTATCCTGTCCGATTGCCA
5'
3'
5
S* - *
ciciui 1
3e
3
*
- S
5' - *
J'
*
dcfuf 2
*
*
3'
*
S
Fig. V.22 - Clonarea geneior prin tehnica PCR (P(fP2 = primeri)
Specificitatea se asigurd, in spejd, prin alegerea unor primeri (care
flancheazd fragmentul de ADN jintd) suficient de lungi, astfel incat
secvenfa lor s& fie, virtual, unicd in genom. Intrucal interacfiunea prin
leg&turi de hidrogen a primerilor cu fragmentul |int& este dependents de
temperaturd i concentrafia salind, amplificafea specified este condijionatd
de stabilirea riguroasd a condifiilor de lucru.
247
j",
Utilizarea unei polimeraze termostabile permite alegerea unor
temperaturi de cuplare
!;
primer-ADN suficient de mari (92-96C) pentru.a exclude
interacfiuni primer-template
i.
de joas& specificitate.
j
Recent, s-a imaginat o strategic de lucru care Iimiteaz3

amplificarea strict la
:j
fragmental Alaturi de primerii consaeraff\ se utilizeazi an
primer intern. Dup&
I'
piima rund de amplificare, desf3urat3 in prezenfa ceior trei
primeri, se ajusteaz&
i
temperatura astfel incat sS fie favorizatS cuplarea primer intern
secvenfS finis
:
(select!vitate infailibild).
Tehnica PCR se practice in aparate automate, cu controlul strict al
timpului i
temperaturii, permifand amplificarea unui ADN, care nu trebuie s2 fie nici
purificat nici proaspSt, provenind chiar dintr-o singurS. pic&turS de sange,
spermti, saliva sau un singur fir de par.
Aplicajiile practice ale tehnicti de clonare in vitro sunt numeroase i uor
de imaginat; stabilirea diagnosticului prenatal intr-o largd arie de boli
genetice, detectarea polimorfis- mului alelic, detectarea infecfiilor virale
inainte de aparifia simptomelor sau a unui r&spuns imun manifest, tiierea
suspecjilor i identificarea celui vinovat in medicina legaM.
V.7.3. APLICAJII ALE CLONARE GENELOR (Determinarea secvenfei
nucleotidelor in oligonucleotide)
Clonarea genelor prin metodele descrise anterior-Tehnologia ADN
recombinant i Tehnica PCR permite objinerea, in cantitSfi suficiente, a
unor polinucleotide a cSror secvenfS trebuie determinate Metoda chimica
Stability de Maxarn i Gilbert, metoda, simple i riguroasii, are ca principiu
fragmentarea ADN i separarea electroforeticS a fragmentelor rezultate,
funcfie de m&rimea lor i independent de natura bazelor, urmata de
identificarea acestora. Simplificand, etapele s-ar succeda astfel:
1) se marcheaz& unui dintre capetele ADN clonat cu 32P.
2) se separd -cele doud catene i se izoleazS populafia omogend,
constituit& din aceeagi monocaten&;
3) se utilizeazif patru probe de ADN monocatenar marcat la capital 5 (de
exemplu) gi fiecare se supune unui agent chimic care distruge select!v una
dintre cele patru baze. S3 admitem c3 oiigonucleotidul marcat lacap&tul 5
este: -G*CTCGTCAA~i c3in proba 1 este degradat3 timina, in a 2-a citozina,
in a 3-a guanina gi in ultima adenina Prin distrugerea in proba 1 a timinei,
oiigonucleotidul este scindat in fragmente de diferite dimensiuni, care vor
avea sau nu capital 5 marcat. Prin indep&rtarea, tot la intamplare, a
citozinei, guaninei, adeninei din probele 2,3,4, se objin seturi de fragmente
de dimensiuni diferite (mono, di, tri, tetra-nucleotide).
4) se separ3 electroforetic fragmentele obfinute in fiecare dintre cele
patru probe, pe
gel de poliacrilamidil
Este necesar ca puterea de rezolufie a gelurilor s3 permits separarea,
neambigu3, a unor fragmente diferind printr-un singur nucleotid. Impunerea
acestui unic criteriu, al

248
lungimii fragmentelor, se realizeazS prin alegerea condifiilor de separare:
gelul confine uree (~8M), iar electroforeza se realizeazft ia ~55C, pentru a
elimina orice asociere prin leg&turi de hidrogen a bazelor.
5) se identifies autoradiografic, exclusiv, fragmentele dinspre capStul 5,
care a fost marcat i se indicS numSrui de nucleotide corespunzStor fiec&uia
pin comparaie cu an etalon.
Admifand (Fig. V.23) cS in proba 1, In care s-a excizat timina, s-au objinut
di- i pentanucleotide marcate (G*C i G*CTCG), este evident cS timina
reprezintS nucleotidul 3, respectiv 6 din oligonudeotidul analizat Similar,
dacS in proba 2, din cane s-a exclus citozina, se objin mono, tri,
hexanucleoiide marcate (G*- capStul 5\.G*CT, G*CTCGT) rezuM cS
nucleotidele 2, 4 i 7 din oligonudeotidul de analizat sunt reprezentate de
citozinS. RajionSnd similar pentru pattemul objinut in cazul probelor 2 i 4,
rezultS c& oligonu- cleotidul analizat este mononucleotidul GCTCGTCAA.
Se poate conchide cd seevenja nucleotidelor din orice ADN poate fi
stability direct pe gelul autoradiografiat, citindu-1 de jos in sus.
OPdonuc/eotid de ane/iratBaza exc/zeta:
G*CTCG TCAA
T
[A1,
G
A
GC
<3C,
ACT
G*crc GlCTCGTC
*CTC6T
G CTCGTCA

Start

Start

Start

Start

Start
nendocr
/eof/d.
GtrCuJ ocbiJ7W
'CA
c/eof/d\
GVrcG te0rc/Se
rc
odo1
GlAPPI
texemc/
L
eot/d
G*CTC
penfaMc
G
/eobb
G*crc
tetrenuc
/eotid
G*cr_
Mrwcfeo
t/d
od/ecpo
G*C
/id
. .G*_
mormuc
/ec/i{j\
1
Proba / ~Proba2 Probe J Probe 4 Probe de
eta/orare
Fig. V.23 - Determinarea seevenjei nucleotidelor dupa tehnica Maxam i
Gilbert
249
De menfionat c&> tn fapt, degradarea chimica afecteaz2 ambele baze
purinice (atat A, cat i G) ca i ambele baze pirimidinice (atat C, cat i T) in
m&surS diferM, funcfie de condifii. Problema se rezolva cu acurateje, folosind
probe cuplate; G i G+A, C i C+T. Modificand condijiile de lucru, de exempli]
in cadrul cupluiui G/G+A, Intr-o probS se distruge, prin excelenje, G, in timp
ce in cea de-a doua se distrug i se elibereazS. (prin ruperea legdturilor
fosfat diesterice), la viteze comparabile, atat G, cat i A. Reziduurile A se pot
identifica comparand pe electroforez& pozifiile G cu cele G+A; similar penirn
cuplul G/C+T (Fig. V.24).
Intrucat nucleolidul 5' terminal nu poate fi identificat (se distruge) i o
verificare a secvenjei catenei ADN in studiu este necesarft, se recurge la
secvenjializarea paralel&a catenei complementare, dupS marcarea acesteia
cu 32P.
Metoda enzimadcd
O modalitate alternative de determinare a secvenjei ADN clonat este
metoda Sanger. Spre deosebire de metoda Maxam i Gilbert, care este o
metoda ehimicS, aceaste tehnicft este o metoda enzimaticS; ea igi propune
s2 determine secvenja catenei complementare cu cea de analizat, avand ca
principiu intreruperea controlata a sintezei acesteia prin incoiporarea unor
analog! structural ai dezoxiribonucleozid trifosfajilor proprii structuiii ADN,
Sinteza in vitro a catenei ADN complementare presupune prezenja:
1) monocatenei ADN de secvenjializat, utilizate ca matrije (template) i
care provine, in general, dintr-un fragment de restricfie.
2) unui primer complement^' cu o mica por- Jiune de la capital 3 a!

catenei de replicat, care se marcheaza cu 32P Acesta se ohjine cu uurinje


finand seam a de faptul ca fragmentele de restricjie sunt flancate de
secvenje cunoscute.
3) ADN polimerazei 1 din care s-a exclus regiunea cu activitate 5-3
exonucleazic#, rezul- tand fragmentul KlenowA
4) celor palm T dezoxinucleozid trifosfaji: dATP, dCTP, dGTP, dTTP, dintre
care cel pujin unul este marcat (ca alternative la marcarea primerului).
5) mici cantiteji din cei patru T-V didezoxinu- cleozid trifosfaji: ddATP,
ddCTP, ddGTP, ddTTP, ca analog! structural] ai T dezoxinucleozid trifosfajilor.
Este uor de imaginat cd absenja grupei -OH din ddNTP face imposibilS
continuarea sintezei ADN in momenta] in care unul dintre acetia catige in
competijia cu dNTP dictat de matrije.
Sinteza ADN poate fi deci intrerupte, prematur i intampldtor, la oriaire dintre
reziduurile nucleotidice.
A+GG
C4

smi
................SBB3C G
..... p t^aSSBSS TT
****** T
- AG
.1

i ***'*&*&: t r
?> c ' A A 'X'fpfy l T
:
cA
AA

Fig. V.24 - Autoradiografie de control


250
Experiments se realizeazS in'patru probe distinct care diferd intre ele,
exclusiv, prin natura ddNTP utiiizat. Fiecare proM va confine fragmente de
ADN de dimensiuni diferite
avand la cap&tul 3 acel ddNTP, ap&rut prin hazard, ori de cate ori ADN
polimeraza 11-a incorporat in locul unui dNTP.
Cele patru seturi de fragmente objinute in fiecare 'dintre cele patru probe
se supun, dupd separarea fragmentelor nou sintetizate de catenele
template, electroforezei in gel de poliacrilamidd sau agarozd i se identified
prin autoradiografiere (Fig. V.25). Secvenfa se citete, ca i in tehnica Maxam
Gilbert, pe imaginea autoradiografied a gelului, de jos in sus, pe direefia 53.
Pentru a evita iradierea 1 a simplifica stocarea, marcarea cu 32P, care
permite vizualizarea fragmentelor ADN de diferite m&rimi, a fost inlocuM fie

cu legarea covaientd ia primerul nucleotidic a unui compus fluorescent,


diferit pentru fiecare dintre cele patru probe, fie cu ataarea la un anumit
ddNTP a unei molecule care prezintd fluorescent la o anumihi lungime de
unda. In cel de-al doilea caz, reunirea celor patru probe, dopd efectuarea
replicilrii, urmatd de electroforeza amestecului, duce la aparijia
Matrifa',
3'
Primer: 5
- CCGGTAGCAACT - GG 3

GGCCA
GGCCATCGTTGA
GGC
GGCC
GGCCATC
GGCCATCG
GGCCATCGTTG
dATP
dCTP
dGTP
dTTP + ddTTP
GGCCAT
GGCCATCGT
GGCCATCGTT

3 N
SecventS complementary > modelului ADN
Fig. V.25 - Secvenfializarea ADN prin metoda Sanger (seevenja nucieotidelor
se citete direct pe electroforegrama).

251
a numeroase benzi electroforetice, fiecare cu un spectru de fluorescent
caracteristic cap&tului s&u 3 terminal, a cror succesiune indicii
succesiunea nucleotidelor In catena ADN (Fig. V.26).
Sistemui de detecjie a fluorescenjei este automatizat i permite
secvenjializarea unor fragmente de ADN (de peste 500 de perechi de baze),
intr-un ritm de -10000 perechi de baze/zh Secvenfa complete a peste 1000
gene, printre care cele codific&nd insulin^, interferoni, citocromi,
hemoglobin^, interleukine, a fost stability.
Secvenfializarea complete a genomului E.coli este iminentS, iar cea a

genomului uman pare sa aparjM unui viilor apropiat, prin aportul decisiv al lui
Fred Sanger, dublu laureat Nobel (pentru secvenjializarea proteinelor in 1958
i pentru secvenjializarea acizilor nucleic! in 1980).
Utilizarea tehnicilor de amplificare a ADN permite stabilirea hazel
moleculare a boiilor genetice (peste 3000), objinerea de sonde necesare
diverselor tipuri de hibridizare, evaluarea producer unei gene (ARNm,
proteine).
Secvenjializarea ARN se face, cel mai adesea, dupS sinteza ADNC,
catalizatS de revers transcriptazd i recurge la ambele tehni.ci descrise
pentru ADN.

Lungimea oligonucleotidului
Fig. V.26. - Detecpa prin fluorescent a tragmenteior oiigonucleotidice objinute
prin metoda didezoxi
252
Acizi nucSeici antisens
Tehnicile de eionare permit, in cazul folosirii unor vector! de expresie,
sinteza unor ARN antisens, respectiv a ARN avand succesiunea nucleo tidic&
(T=U) a catenei necodificatoare. Acest ARN este, desigur, complementar cu
ARNm, a c&rei succesiune nucIeotidicS corespunde catenei codificatoare.
Un ARN antisens poate fi rezultatul clonarii unei gene care este introdusd
in vectorul de expresie in aval fata de promotor, intr-o orientare invetsS,
care-i schimte polaritatea.
Transfecfia vectorului de expresie recombinat in celula parental^ permite
sinteza unui ARN antisens, celula dispunand astfel de ambele categorii de
ARN (antisens i mesager).
Hibridand perfect cu ARNin, un ARN antisens va bloca traducerea ceiui
dintai, intrucat form area hibridului nu numai c& mascheazd situsul de legare
la ribozomi, f&cand mesajul inoperant, dar create i susceptibilitatea la
hidroliz# a ARNm.
Utilitatea producerii acizilor nucleici antisens este, in primul rand,
terapeuticd; posibiiitatea de biocare a sintezei unei proteine virale cu
eventual potential oncogen este dintre cele mai tentante,

in cele din urmft, tehnoiogia ARN antisens poate aduce contribufii


teoretice importante privind funcfia unei proteine specifice unei celule, care
a fost represatS selectiv in celula data.
Sinteza, in vitro, a ARN antisens a fost: inspirat& de descoperirea sintezei
in vivo a acestui tip de ARN, la procariote. Rolul acestuia in controlul
expresiei genelor este stabilit atat in ce privete transcrierea, cat i
traducerea sau modificSrile posttraducere.
S-au detectat ARN antisens care se adreseazfi ARNm specificand
dihidrofolat reductaz- timidilat sintaza, secvenje ARN complementar ARNm
pentru proteina P53, ca i ARN antisens pentru proteinele bazice din mielind.
Tehnica de transfer Southern
Identificarea unui fragment de ADN cu o anumM secvenjd se poate face
prin tehnica de transfer pus& la panel de c&lre Ed. Southern.
Etapele parcurse sunt:
1) separarea fragmentelor de dimensiuni variabile, rezultate prin aejiunea
enzimelor de restriefie asupra ADN genomic, prin electroforezft in gel de
agarozS (pentru fragmente de lungimi relativ mail ~20 Kb);
2) gelul, confinand fragmentele de ADN separate, este imersat intr-o
solufie de NaOH 0,5N, care produce denaturarea acestuia, i apoi neutralizat;
3) ADN monocatenar rezultat este transferal de pe gelul fragil pe un filtru
de nitrocelulozd sau nylon, care are calitatea de a fixa ferm monocatenele
ADN. Acest
253
transfer (the blot transfer technique sau Southern blot), se renlizeazd prin
eapila- ritate la forjd ionicft mare; gelul acoperit cu filtrul de nitrocelulozd,
peste care se adaugd un teancu de hartii absorbante, este plasat pe o
hfutie, de asemenea absorbante, imer- satd intr-o solujie salind concentrate.
Bar- tiile absorbante trag solujia din gel odatd cu ADN; pentru rapiditate, se
lucreazd sub vacuum. ADN eluat din gel se fixeazd pe nitrocelulozd, ca
replied exacts, a acestuia. Monocatenele ADN, legate la nitrocelulozd exact
in pozijia in care se aflau pe gel, sunt fixate prin iradiere in ultraviolet sau
prin cregterea temperaturii (~80C);
4)
se incubeazd replica nitrocelulozicd cu o sondd
32
radioactivd ( P), de asemenea, monocatenard, in condijii care favorizeazd
hibridizarea;
5)
se indepdrteazd, prin spdlare, excesul de sondd
radioactivd gi se realizeazd prin autoradiografiere, pozijia heteroduplexurilor. Revelarea unui fragment de interes se poate face gi utilizand o' enzimd a
edrei aejiune se soldeazd cu o modificare vizi- bild;
6)
se compard pattern ul de hibridizare cu gelul original gi
se definesc secvenfele ADN de interes (Fig. V.27).
. Aceastd tehnied ingenious^, permijand detectarea unui fragment de
ADN cu o anume seevenja, poate pune in evidenja numdrul de copii in care
se gdsegte o gend in ADN genomic al unui fesut, posibilele altenlri ale
materialului genetic, exprimate in polimorfismul lungimii fragmentelor de
restriejie.
Hibridizarea acizilor nucleici, imobilizaji pe membrane solide, se praetied
i in cazul
254

rrty> cJip**
v

^ Q

Fig. V.27 - Tehnica de transfer Southern.


deteciarii moleculelor de ADN recombinat. in coloniile bacteriene (sau plajele
de liza produse de bacteriofagi), duph transferul lor din mediul de culturil
Metoda de transfer a ADN de pe geluri pe membrane nitrocelulozice a fost
extinsh i la ARN, fiind denumitS, colocvial, drept tehnica de transfer
Northern, facandu-se astfel sugestia analogiei conceptuaJe cu tehnica
Southern. Practic, analogia nu este perfects intrucat ARN nu se leagS la filtrul
de nifroceluloza in condifiile in care o face ADN i, in plus, este susceptibil la
hidrolizS alcalina; imobilizarea pe filtru nitrocelulozic este posibilS numai
dacS electroforeza in gel de agarozS se efectueazft in condijii de denaturare
(incluzand in gelul de agarozh formaldehida, de exemplu) c*ire previne
adoptarea unor struciuri secundare.
Transferul unor proteine, separate electroforetic, de pe geluri de
poIiacrilamid& pe nitrocelulozfi, ii propune identificarea imunochimicS a
uneia dintre ele, in spe{S, prin utilizarea unor anticorpi specific!.
Tehnica de transfer a proteinelor a fost. denumitS, cu umor, tehnica
Western.
Utilizarea tehnicii de transfer Southern in depistarea polimorfismului

fragmentelor de restrictie
Cromozomii umani homoiogi, ca i segmente ADN homoloage de ia
indivizi diferiji, prezinth diferenfe (motenite) in secvenja nucleotidelor.
Acestea apar cu o frecvenjh de unu la cateva sute de perechi de baze (~ de
107 ori/genom) i constau in delefii, inserfii ample sau numai in mutaiii
punctiforme; modificfrile nu se traduc prin boaM in situajia in care sunt
prezente in regiuni necodificatoare sau se produc in regiuni ale unor gene
neesenjiale funcjiei acestora (variafii genetice).
O mutaiie in secvenjele nucleotidice cuprinzand situsuri specifice pentru
acjiunea unei anumite enzime de reslricfie poate* avea ca rezultat abolirea
unora dintre ele, fapt ce se reflects in dimensiunile diferite ale fragmentelor
de ADN rezuitate prin hidroiiza, Este uor de imaginat reciproca o mutajie
intr-o secvenja nucleotidica poate crea un situs suplimentar de recunoa$tere
pentru o anume enzinia de restricjie.
O diferenfa motenita in patternul de restriefie este desemnatS drept
polimorfismu3 fragmentelor de restricjie" (RFLP=restriction fragment length
polimorfism); ea s~a dovedit extrem de utilS diagnosticului, cand
polimorfismul este intragenic i deficitul functional intr-o boahl creditors nu
este cunoscut.
Separarea prin electroforeza, pe criteriul lungimii fragmentelor de
restricjie, urmatd de aplicarea tehnicii de transfer Southern, pennite
evidenfierea polimorfismului prin utilizarea unei sonde anume.
Detectand RFLP, tehnica Southern este deja o tehnica de rutind in
depistarea i screeningul bolilor genetice umane, utilizandu-se i in
diagnostical prenatal al acestora, alftiuri de alte tehnici, cum ar fi:
hibridizarea imperfecta, secvenfializarea genomica etc.
255
1,15Kb
t
Ii
B.
5'
1,35 Kb

heterozigot normal heterozigot


Fig. V.28 - Utilizarea polimorfismului fragmentelor de restric|ie in depistarea
prenatala a anemiei falciforme
256
Vom ilustra utilitatea acestei tehnici in cazul anemiei falciforme, datorat&,
aa com se tie, unei mutajii punctiforme (A substitute T in catena matrij) in
codonul specificand cel de-al gaselea aminoacid.de la capfttul aminoterminal
al globinei, soldafii co inlocuirea
glutamatului cu valina.
Enzima de reslricfie Mst II, care recunoagte i taie secvenja CCTGAGG din
catena codificatoare normals, nu mai recunoate secvenfa modificatS.
CCTGTGG, abolindu-se
astfel un situs de
restricjie
CCTGTGG
mutafie ~~
CCVGAGG
-----------J* GGACACC
GGACTjCC

in gena normals pentru [I globind (A), digestia cu Mst II produce


fragmente de 1150, respectiv 200 de perechi de baze, in timp ce in gena
anormalft (B) rezuM un singur
fragment de 1350 perechi de baze.
T&ierea cu Mst II i utilizarea unei sonde corespunzand genei pentru p
globing permite sS se distingii intre indivizii normali, homo i heterozigoji
Pentru stabilirea diagnosticului prenatal la un copil provenit din p2rin{i
heterozigoji, probe de ADN fetal (din lichidul amniotic) i parental, taiate cu
Mst H, sunt analizate prin tehnica de transfer Southern. Admijand c3 fetiisul
prezintd un pattern de restricjie din care lipsegte fragmentul de 1350 baze,
existent la arnbii pSrinJi, se poate conchide c& acesta nu a mojtenit boala de
la p3rinjii s3i heterozigoji i niei nu este purtittor al acesteia (Fig. V.28).
De remarcat c&, din numfunl mare de gene sau fragmente ADN
extragenic donate, un procent semnificativ (peste 40%) prezintS, cel pujin,
unul sau mai multe RFLP.
Este stabilit c3 num3rul de secvenje repetitive, in tandem, intre dou&
situsuri de recunoatere pentru o enzimh de restricjie, variaz& de la
cromozom la cromozom, de la individ la individ (cu o transmitere strict
mendelianS). Acest tip de polimorfism face ca cei mai mulp indivizi sft
genereze un numiSr diferit de fragmente, de mftrimi diferite, pentru fiecare
membru al unei perechi de cromozomi.
Utilizarea unei sonde (sau i mai bine a mai multora) care recunoagte

unele secvenje de ADN necodificatoare, intragenice, relevit pattemul diferit


al benzilor electroforetice.
Medicina legalS se serve^te de acest poliforfism in selectarea vinovatului
din totalul de suspecfi. Folosind ca enzim& de restricjie Hinf I pentru digestia
unui ADN provenit dintr-o pat& de sange gSsitii la locul crimei, c&t i a ADN
provenit, s& zicem, de la trei suspecji, se objin prin tehnica de transfer
Southern amprentele ADN diferite pentru fiecare dintre cei trei indivizi.
Dacd unul dinlre patternurile corespunzand suspecjilor se suprapune pe
pattemul de restricjie al ADN din pata de sange, identitatea vinovatului
prinde contur (Fig. V.29 a).
Poliforfismul fragmentelor de restricjie intergenice traneaz&, chiar, i in
disputele de paternitate (Fig. V.29 b).
257
N>
LA
00

CAP. VI. ENERGETICA BIQCHIMICA


VI. 1. ASPECTE GENERALE

Existenja organismelor vii este condi jionatS de on consum insemnat i


continuu de energie. Celula, unisatea de bazS a acestor organisme, este, din
punct de vedere termodinamic, un sistem foarte pufin stabil; numai un
consum permanent de energie ii permite sS-i menfinS ordinea complexS a
structur'd side fragile i sS-i indeplineascS funcjiile specializate.
Studiul aprofundat al desiSurSriI proceselor energetice in lumea vie, cu
contrubu|ia esenfialS a biochimiei, a condos la douS concluzii majore:
a) conceptele $i principiile termodinamicii clasice isi pSstreazS...ya].abi]i|
atea^icaz;
b) toatameeMe_.ac.estDr Diocese au o baza moleciilaril.^
Radiajia solarS constituie sursa primarS de energie pentru toate
organismele vii; dupS modal in care o recepjioneazS dar i in funcjie de
forma sub care preiau carbonul, principalul element din constitufia lor, se
disting:
-grjanisme^aiitofro^ cuprinzSnd lumea vegetala i o serie de
microorganisme; ele utilizeazS drept sursS de carbon CQ?, din care, sub
acjiunea radia|iei solare, prin procesul num.it fotosintezS, Igi construiesc
moleculele organice complexc prin intermedin! glucozei. Procesul este redat
prin ecuafia general^1:
hv
6C02 + 6H20 C6Hl206 P 602
In afarS de autotrofele fotosintetizatoare exists i .autotrofe ce utilizeazS
energia rezultatS din joxidarea anaerobS a unor subsfraturi anorganice (H2S,
NH3 etc.) pentru sintezS de compui organic!; ~~~
-organismele h^rofrofe, cuprinzand lumea animals, ii procurS prin hranS
compusji cqrnpl^gi (reprezentaji de glucide, lipide i proteine) sintetizafi de
autotrofe sau de alte heterotrofe. Degradarea acestor compu^i pieluafi din
exterior, dar i a celor proprii, constituifi ca rezerve, la compui simpli este
insoptS de elibemre masivS de energie. Aceste degradSarL reprezintS
catabolismul compusilor respective Majoritatea cSilor catabolice implies
particioarea oxigenului molecular iar produgii final! ai for sunt-C^igi
Hgb^iEnergia eliberatS in procesele catabolice este utilizatS. pentru sinteza
de compQi organici diveri, ceea ce reprezintS anabqbsmuL dar i pentm
sus{inerea a numeroase alte process consumatoare de energie cum sunt
ceje mgcanice (contracfia muscularS), electrice (potentate membranare) i
altele.
Intrucat organismele autotrofe utilizeazS in procesul de fotosintezS C02 i
H20, adicS exact compugii pe care heterotrofele ii elibereazS in cursul
degradSrii aerobe (oxigenul necesar acestor degradSri fiind objinut tot in
procesul folosintezei), cele douS tipuri de
i
Intrucat fotosinteza este proprie iumii vegetale gi unor microorganisme,
studiul acestui proces depSete cadrul unei cari de biochimie medicals.
Procesul este tratat m orice carte de biochimie general!
259

Fig. VL1 - Dependent organismelor vii de radiajia solara i interdependent


organism autotrofe-organisme heterotrof
organisme se..inten^diftqiieaz{i (sintrofia), in Fig. VI. I se reckl schematizal
acest aspect ca i dependent tuturor organismelor vii de radiafia solarS.
FSrd cunoagterea aspectelor esen{iale ale energeticii chimice 2 care sunt
prezentate in continuare, injelegerea aprofundatH a metabolismelor glucidic,
lipidic i proteic no este posibil&
VI,2. SISTEME TERMODINAMICE. FUNCJH DE STARE. PRINCIPIILE
TERMODINAMICIL
Termodinamica, in oricare domeniu se aplicS, studiazft procesele
energetice caracteris- tice.ale sistemelor: ea are in vedere numai sterile
energetice initial^ si final ft, decTnu ia in considerare niei drumul parcurs nici
timpul scurs la trecerea de la o stare la alta.
Sistemul este definit ca o parte a universului, separata real sau imaginar
de mediul inconjur&tor; acesta din urmft reprezintS restul universului.
Sistemul e-sfeiiicfaisdacaintre ei si mediul inconiunitor nu se schimbfl
materie (dar poate avea loc schimh de energie). Dac&sistej^
mediuljiici
materie nici energie, el se numeqte izoiat,.
2
Deseori, tn locul denumirii "energetics chimicS" se utilizeaza termenul
"bioenergeticS".
260
/
In lurnea vie sistemul poatej^reprezentat de un organism intreg, un
jesut^o culture de celuie, o^eiuM, o secventa de reacjii dintr-o cale
metabolied. etc. Sistemele ^oiogice sunt sisteme cfeschise. ele fund
traversate de flipcuo -de materif ..jr^nergre,
Ca oricare ait sistem, un sistem via se poate afia in mat multe stdri. O
anuniitd^stare a sisteryiu^i este caracterizatd prin y^^bine definite ale
unor rQ|rim^^i^iJgcuni sunt pmsiunea, iium^fl de mpli etc., cai*e se
numesc fiipfijiide^tare^
Cand sistemul trece de ia o stare la alta, o parte sau toate funcfiile de
stare care il caracterizeazd ii schimbd. valoarea; cum a mai fost menfionat,
drumul parcurs de sistem .intre cele douS stUri poate fi oricare, ceea ce
conteazd este ca funcfiile de stare sd ajungd ia nolle valori. Acest espect este
deosebit de important pentru energetica biochimicd i este ilustrat in
continuare printr-un exemplu: giucoza poate fi ti'ansformatd in CO^gi H^O,
in doud moduli:

prin oxidare energicd in bomba, calorimetricft


C6H5A + 602
6C02 + 6H20
^ in vivo, prin intermediul unei lungi seccesiuni de reacjii dintre care unde de
oxidare:
6CO? + 6H?0
unde I{, I3, I3 sunt intermediari.
Sjarea finalda sistemuiui este aceeagi indiferent cd^O^Jgi^Oobjinut prin
prima sau a doua transformare (dacd condi fiile in care se afld cei doi produji
sunt identice). In timp ce prima transformare nu are nici-o importanfd pentru
orgamsmele vii, cea de a doua este esenjiald aa cum va reiei in continuai'e
din acest. capitol i din capitolul de metabolism glucidic. Faptulinsd c;iin
^trej^azuri sepbtine.ac,eiasi..cao.tiMed.eenergies
Legile termodinamicii sunt relajiile, formulate adeseori matematic, intre
funcfiile de stare. La baza tuturor acestor legi stau doud principii, adevdruri
incontestable reieite din nenumdrate obsrvafii ale fenomenelor naturale,
precum i din experienje.
Principiul I este principiul conservdrii nerdei: formulat ia modal foarte
general el precizeazS ca
El prevede
posibililatea transformarii unei forme de energie in altele, fiind formulat i
astfel:

Principiul II, numit i principiul evolufiei, stabilfeste sensul in care au loc


transfor- m&ile tnsotite de schimbfri de enereiZHtatueaza cd
sau,
in alfi termeni c2 orice PmsfonniasJfe^^^^^ toare crejgtaikia^^^
hi
id-5'
ra
W
U
111
ill
' O;;
in'1
Ub
261
VI.3 SISTEMELE VII SUNT CARACTERIZATE CEL MAI BINE PRIN ENERGIA
LIBERA
Faptul ca principiile i conceptele termodinamicii ciasice au valabiiitate i
pentru procesele energetice din sistemele vii nu inseamnd i cd mdrimile
(parametri de stare) care au mare valoare pentru caracterizarea unor
sisteme din domeniul tehnic de exemplu (termodinamica dasicd s-a dezvoltat
in legdtura cu funcjionarea motoarelor termice), ii pdstreaza aceiai valoare
i pentru caracterizarea energeticd a diferitelor sldri ale sistemelor vii. Astfei,
in (imp ce trecerea intre doud stSri energetice care se realizeazd. in cursul
functionary unei masini termice este caracterizatd prin variatia entropiei (AS)
si ent^lp|gf.IAHjr la trecerea .de la o stare la...alJiLiLjjnui ststem vm variatia
lor (care, evment, are loc) este dificil sau chiarjrnposibil de determinate?
T7S3TS Vi\ in schimb, varia|ia energiei libjere/notatH AG) care matematic

reprezinfd diferenja intre variatia entalpieTi produsui variapa eTiTfopiei x T


(temperatura absolute)
(AG-AH T-AS)
s-a dpvediUniirim.ea ideald deoarece:
a)
reprez^p. conform definijiei termodinamice, acea
On, menjinerea ddnstantd a acestor parametrii caracterizeazd sistemele
vii, in special organismele superioare;
b)
in cmsu^evolupei reacjiilor^chjimcc(pot Ipobimutc e^mai pujind
^ihcultate deoarece sunt cordate eu,mdnmij;nuH mapujor dc determmat.
Se face menfmnea cd, pentru sistemele vii, in ecuafia prezentatii mai
fnainte AH este deseog inlocurf cujndumea AE deoaiece, dm motive caie {in
de specificul Iransfornvdrilor in aceste sisteme, AH AE; deer.
Din aceastd ultimft ecuajie rezultd cd
ter

ef p-ct
l
transformdri care are loc la
pe langd componenta capabila sa efectueze travaku
..............................................
(deci o micare ordonata), exista obligatoriu . o component#;(T. AS) care
reprezintd o formlTde
inferioard. In opozipe cip energia liberd, acestei
pdr{i din energia total'll i se spune energie jegatdA
VI.4 VARIATIA ENERGIEI LIBERE . iN REACTIILE CHIMICE 1 BIOCHIMICE
Aproape toate transformarile care au loc in organismele vii sunt, sau au la
hazd, reaejii chimice; de aceea in bioenergetied intereseazd in mod deosebit
AG a*acestor reaejii.
Respectdnd conventia de semne di.n termodinamidL reacjiile chimice pot
fi impdrfite dupftjvatoai&^^
Variapa de entropie se masoarS cu suficienta precizie doar m cazul
sistemelor reprezentate de elemente chimice i molecule mici.
262
gyjjj *#
^ASi4fereacfie
m

*^^5SsEtiaiaSEifioM;
dQsWguiarca dc la stiiiga.la dicapt^i, cncrgic __
A ..
c)
reacjia ejrieJas^Mfem. ea no evolueazS spontan in mci un sens.
Majoritatea reacfiilor chimice care au loc in organismele vii fac parte din ,,g;|
^ BfilitaMee*' care constau din secvenfe de reacfii; evident, fiecSreia dintre
acestea ii corespunde o variafie a energies Iibere:
AG,
-> B
AG9

G
AG
DAG,
E
Fiind o
ener|k U^gr|jge
AGtota, = AG, 4- AG2 4- AG3 4- AG4 ....
Dacfi AGtPtal < 6' calea melaboljcS elc exergonic# intr-o astfel de'cale
obUgatqritf ca fiec&re. reacpe individuals s$ ajbS AG<0? pentru unele reacjii
aceasta putted fi pozitivS. Condijia esle ca sum AG ppgative *4 fi$ mi decat
surra AG po/itive.
CSil^exergompQ sppt ccle dtgmdatiYP (catabqlice)^ c3i endefgonice;
evident, in cazul acestqra^suma AG Poziiivqreste1. maiJojacejuLSSme
absolute decat pma AJ3 negative.
In sintezS, modui in care organismele vii he.terotr.ofe ii asigurft energia.
este: moleculelg organise cqmplf xq (glupidq, Ijiplde1, ptptqne) preluate din
hranS sunt d(egpadate pe chi carc^ai|.AGtotai pegaijve; energy libuS este
utiljuatS pentru proqesde anabolice i pen tip npmqrgasepTtp jiioccse. Pnn
mtennediul moleculelor complexe din hranS (dar i a unor molecule simple)
organismele heterotrofe ii asigurd totodatd elementele i compuii chimici
pe care le vor utiliza pentru sinteza de compui specifici. Numai 0 parte din
energia totals a moleculelor organice complexe este utilizatS aa cum numai
0 parte din de sunt folosite pentru sinteze proprii, restul fiind retumat
mediului; in aceasta constS caracterul deschis ai acestor sisteme.
Transferal energiei iibere care se produce in cursul degradSrilor c&tre
procesele consumatoare se face in organismele vii intr-un mod cu total
aparte.
VI.4.1. YAR1AJIA ENERGIEI LIBERE 1 CONSTANTA DE ECHILIBRU; ENERGIA
LIBERA DE REACJIE STANDARD
Cunoaterea variapei energiei iibere in reacpile chimice este posibiia prin
faptul c3 aceasta estelegaffdeln^i'iml relativ usor misurabilefconstanta de
echilibru i - in cazul reacjiilor de pxido-reducere - potenpalul icdpx.
Dac& energia liberd exprim& tendinja reacpei de a atinge echilibrul (AG ~
0), se injelege ciS AG va fi cu atat mai mare cu cat, in starea inipald, reacfia
este mai departe
4
A se face distincjia intre reacjii ,,exergon^ce-endergonice,, 51 reacjii
"exoterme-endoterme". Reac|iile sunt exergonice sau endergonice dupa
valoarea lui AG i exotenne sau endoterme dupa valoarea lui AH (variapa
caldurii).
263
de echilibrul ei; dec! trebuie sS existe o relafie a AG cu concentrafia
reactanjilor i a
producer de reaefie. Pentru reaefia generals A + B ^ C + D aceastd relafie
este:

undej^^te cppstaina^g^aexal^a gazelor _(l,98^ca|rmo|;!K^),


T,~,temperalui;a absolute la care se desf3goar& reactia, [A]%

L4J^^ccygj^.u4ra|iile^^reactantilar i ale
produgilor iar AG o constants niuiuta Menergijib,ef$ dp reaefie standard'4.
Pentru a defini pe AG se consider^ [A] - [B] - [C] = [D] - lM;-atunci [C]
[D]/[A] [B] = 0 i AG = AG. Deci
Jinand seama c3 la echilibru AG = 0 i inlocuind pe [C] [D]/[A] [B] cu K^,
se obfine:
0 AG + RT in Kech AG = - RT in Kech
Deci se poate calcula vaioarea lui AG dacS se determine valoarea Kech. In
practice, plecand de la concentrafiile de 1 M a fiecSrui reactant i produs de
reaefie se las3 reaefia s3 se desf3oare panS la atingerea echilibrului (stare
stafionarS); atunci se determine nolle concentrafii ale lui A, B, C i D.
Valorile lui AG sunt:
0f

ML
Pentru a respecta in intregime condifiile in care se desf3oarft reaefiile in
organismele vii, in locul valorii AG care corespunde pH-ului imprimat de
reactivi i produ^i se utilizeazS valoarea corectat#5 pentru pH ~ 7 notatS
AG\ Pentru un numSr foarte mare de reaefii care au loc in lumea vie aceste
corecfii sunt cunoscute (se dau in tabele). Valorile AG pentru diverse tipuri
de reaefii sunt date in Tabelul VI. I.
Se impune injelegerea corectii a semnificafiilor iui AG0 i AG; AG0 |indicS
sppsuJLdgL, djesf3surare a reactiei in cpndi|.ii standard fingfogiv pH-ul = 7) i
este o constants, in limp
ce AG^esTte 'variatia energiei1mweTn condifiile speo^^ in cardan loc
reaefiile in organismul viu (concentrafii diferite de 1 M a reactanfilor i
produgilor de reaefie, pH diferit de 7, eventual T diferit de 298K). Ideal ar fi
ca pentru fiecare reaefie s& se poatfi calcula AG care red3 starea energetics
reals in sistemul biologic; acest Iucru este posibil in ultima vreme pentru
reaefii care au loc in aa numitele >.sisteme aceiulare44. Pentru celelalte este
utilize tS valoarea AG\ care, in majoritatea cazurilor, red& suficient de corect
tendinfa de evolufie a sistemului. .
5
Cu rare excepjii, pH-ul m |esuturi p'recum i al umorilor din organismul
uman este in jurul valorii de 7.
264
VL4.2. YARIAJIA ENERGIEI LIBERE IN REACJIILE DE OXIDG-REDUCERE.
POTENTIALUL REDOX I LEGATURA LUI CU ENERGIA LIBERA
Datele din Tabeiul VI. 1 evidenfiazft c& AG0' in reacfiile de oxidate a
gJucozei i a acizilor grai la C02 i H20 au valori negative foarte man. Aceste
valori au fost objinute pe glucozS i acid palmitic care s-au oxidat in bomba
calorimetric! Dar, aa cum s-a ar&tat mai inainte, aceleai valori ale AG
totale se obfin i prin oxidarea treptatft la C02 1 H20 a celor doi compui in
vivo. In faptul cd aceste valori negative ale AG0 sunt foarte ridicate rezidS
explicafia c oxidarea glucidelor i a lipidelor in organismele vii este
resDonsabM de producerea celei mai mari p&rfi a energiei.
Tabeiul VI.l
Valoriie AG0 pentru c&teva reacjii care au Soc fn organismele vis
AG01
Tipul reacfiei Reacfia
kealimol
Oxidare
Acid palmitic 4-2302 -> 16 C02 - 2 338,0

-f 16 H20
Oxidare
Glucoza -f 602 6C02 + 6H2G
- 686,0
Hidroliza
Zaharoza 4- H20 -> Glucoza + - 5,5
Fructoza
Hidroliza
ATP -f H20 ADP + P,
. - 7,3
Glucozo-6-P 4- H20 Glucoza +
Hidroliza
P*
- 3,3
Izomerizare
Glucozo-l-P -4 Glucoza-6-P
- 1,7
Eliminare
Acid malic Acid fumarie + H20 - 0,88
Condensare Acid glutamic + NH3
' ' ' -t-3,4 '
Condensare Glutamina + H20 Glicina +
- -i- 2,2
Glicina Glicilglicina 4- H20
In cazul reacjiilor de oxido-reducere AG se poate calcula din relajia care
Ieag& aceast! m&rime de variajia potenpalului redox standard coiectat
pentru pH = 7, notatft AE*
unde n este nuir
|r AG0' = - n * F AE; ^
it_cMaiLsm*acf
in reactie i
ecliiyaffifful
SSMWW... . . .
- --- t
Valoarea lui se obfine mftsurand pe Ec (Fig. VI.2) care este potenpalul
redox standard al sistemului de oxido-reducere la pH = 0 i adaug&nd -0,421
vol{i cat reprezintA potenjialul redox al unui eiectrod de hidrogen in care [H+]
= I O'7 ioni/iitru fa$ de electrodul normal de hidrogen.
Fig, VL2 - Determinarea potentiaiului redox standard (E0) ai unui sistem de
oxido- reducere. Electrodul normal de hidrogen consta dintr-o placa de
platina platinata cufundata mtr-o soluble de acid tare de concentrajie 1M in
care se sufla un- curent de H2 la presiune de 1atm. Reacts. de oxidoreducere care are loc este H2 ** 2H+ + 2e\ Potenjialui redox ai acestui
eiectrod este, prin canven|ie, zero. In celula de masurare concentrate formei
oxidate i a celei reduse sunt de tM.

Tub cu so buffi s&bi/robjo'e KCl


Ce/ubs cfe /ndsi/rsre

H2

cbecbrodub
flocwsb
cbebrbdruffe/7
265
Valorile pent.ru o serie de reacjii redox impoitante In biochimie se dau in
Tabelul VL2,
Tabelul VI.2
Valorise Ef0 ale unor slsteme redox (determinate la temperature fntre 25 30C
Reacfia de electrod
Ef0 voi-l'i
- 0,421

2H+ + 2e **H2
a -cetoglutarat + C02 + 2H+ + 2e' ** 2
Izocitrat
- 0,380
NAD+ + 2H+ + 2e' ** NADH + FP
- 0,320
+
+
NADP* + 2H + 2e ** NA.DPH + H
- 0,324
Piravat + 2H+ + 2e' ** Lactat
- 0,185
+
Oxaloacetat + 2H + 2e* ** malat
- 0,166
Fumarat + 2H+ + 2e* * snccinat
- 0,031
2 cit. c(ox) 2e* 2 cit. c(red)
+ 0,254
2 cit. a3(ox) 2e' - 2 cit. a3(red)
+ 0,385
+
1/2 03 + 2H + 2e- ** H,C>
+ 0,816
In afara posibilitdfilor ce le oferil pentru calcuiul lui AG\ valorile
potenfialelor redox standard sunt utile i in stabilirea sensului de curgere a
electronilor in sisteme conjinand mai multe cupluri de oxidoreducere (vezi
Lanjul respirator**); ca i in cazul lui AG\ valoarea informational^ a lui E
este limitata la condipile standard. Potenjialul redox al unui sistem care nu se
ail! in condijii standard se calculeazS cu ajutorul relajiei:
E
R-T in [Ox] TT TRidJ
unde R, T n i F sunt constantele intalnite \ anterior, [Ox] i (Reel)
reprezentand concentrajiile formei oxidate, respectiv reduse.
VI.5. CUPLAREA REACJIILOR ENDERGGNICE CU CELE EXERGONICE;
INTERMEDIARY ENERGETIC. COMUN
Organismele vii utilizeazS in permanents mari cantitati de energie atat
pentru sintea
^
eat i
pentru sustinerea unor nrocese_cum sunt contractia muscular:! excitatia,
transportul activ si altele. Toate aceste procese sunt sustinute defreactiile
exergoniceaEliberarea de energie
prin aceste reaejii se face chiar la locul desfdsurSrii processor consumatoare

i numai in limitele necesaruiui. Este evident c& transferul energiei libere


rezultatS din reaejiile exrgonice c&tre aceste procese, toate avand o bazS
molecular:!, trebuie sd se realizeze cu
266
mare eficienp. La ogcMHgmglejm^^
ca acest transfer
s
3J&22klS
daa4MM0Slflillfiatoa eper^ MwA
a uueia, cai^e^ggtM#.
este^^g.
Sunt cunoscute douS variante de cuplaj:
^atolgoaisi- Acest cuplaj nu este strict" specific lumii vii, el fiind fntalnit 1 in
chimia organic^ sau cea anorganic^. Un exemplu .din aceste domenii este
cuplareareacpei |de.p hidrolizd a anhidridei acetice cu sinteza acetatului de
et.il din^acicLacetic si alcool etilicr
CH3 c = o
\ o + H2O
CH3 c = o
->* 2CH3 COOH;
AG01 = -21,8 Kca^md
CH3 COOH + C2H5 OH
^ CH3 COOC2H5;
3 AG0 = + 4,7 Kcaf/rrd
CH3 C = O
\ O + C2H5 OH ----------CH3 COOC2H5 + CHa COOH; AG01 - -17,1
KcaVmd
CH,-~ C = 0
In acest caz, scMfpimljle energie lihedL se re'alizeazft prin iiip^riped^
a carui
asi ura
Isfaff
MMEusl&yuu^
In organismele vii opereazd numeroase reacpi cuplate in acest mod. Ele
sunt, de reguia,
exemplu xl oferS douS
JjLmusduL
reactii succesive care fac parte din calea
ilicim
glucozo-1-fosfat ---------------------------------------- glucozo-6-fosiat i glucozo6-fosfat ----->* fructozo-6-fosfat:
glucozo-1-fosfat
Fosfoglucomutaza
d
AG0 = -1,74 kcal/mol
glucozo-6-fosfat
Glucozofosfatizomeraza J,
AQo, = +0i40 kcal/mol
fructozo-6-fosfat
Pe ansambiu: AG01 = -1,74 + 0,40 = -1,34 kcal/mol
(izomerizarea glucozo-6-fosfat ** fructozo-64osfat).
267
b) cupiarea...r^ti^j endergon^^
prin
jQggggjjg'comun (Fig. VL3); inteimodiaxul mf.np este reprezentat de fapt de doi
comniisi dinfre care unul este neenemeiizat (D i al doilea enerrizat Ix). Cci
doi ccmpui sunt Iglgrgpnvextibili pnsi(jfbsoib[ie-ced^'a de.e,nergie libera,
MecamsmuLacestui cuplaj, care ;gjgij|hcre dc *a reacjiile exergonice ale cdilor
degradative ale
proteinelor cStre cele mai diverse reacpi consumatoare de energie, este

prezentat in continuare.
VI.6. LEGATURILE MACROERGICE.
SISTEMUL ATP/ADP, PRINCIPALLY INTERMEDIAR ENERGETIC COMUN (COMPUS
MACROERGIC)
Starile F i I ale intermediarului energetic comun nu au nici o legiUurS cu
stdrile excitatS, - neexcitatd ale atomiior i moleculelor, st8ri convertibile
prin absorbjie-emisie de cuante de energie. F reprezintd un compus care are
leg3turi macroergice66 in timp ce I este produsul reactiei de hidrolizfl a lui P;
dupfl caz, cl nu arc snu mai arc Tnc o leg&turd macroergicS.
Deoarece sistemul format din. ATP.(acidul adenozintrifosfpric),
corespunz&tor lui i APEwtoai degrabd ADP.+. P,), corespunzStor lul l,
constituie intennediarul energetic comun al majori&Jii cuplajelor, se prezintd
mecanismul funcjiondrii acestuia. ATP-ul ca i alfi compugi care au legaturi
maciocrgice sunt dcnumiji curent compui macrocrgieii? dei cored este sS
fie denumiji comp,uL(cu IcgSturi macrocrgiqe". In catena ATP, care
cuprinde trci resluri de acid fosforic* sunt doui legSturi macroergice, notate
NH.

OH OH
Cele doua legaturi macroergice din ATP
268
Fig. VI.3 Cuplarea reaci;ii!or endergorvice cu cele exergonice prin
intermediar cornun

Scindarea hidroIiUcA a ATP~(redat in forma ionizatA aa cum se aflA el in


solufie sau in mediul biologic), poate avea loc in douAmoduli: la
ADP^P^respecliv la AMP + PPi%
0
"t>-~ P - O- P~ 0- P- 0 Adenozina* H20
0 O"
I

0
o
o
OH l
O- P~ 0~ P~ O- Adenozina + o= P0
O'
0
O"
AG -7,3 Koal/moi
O
o
"0 P- 0- Adenozina* 0- P ~0 P0 i
I
I
0~ 0~ 0
AG0' = -7,3 Kcal/moi
In fiecare dintre cejp douA. seindari se rape o legAturA,, macroergicfl iar AG 0>
este de
-13 kcal/moi: aceastfi valoare s-a luat in bioenergeticS drept referintA in
sensul-cS legAtun macrocvgicc sunt considerate acelea care prin scindare
hidroliticA dibeareazA cel pujin a tala energie. ^ v ; ,

Teoretic, legAtura macroergicA rAmasAtn ADP s-ar puteasclmia hidroUiic


^iar,.elibera tot -7,3 kal/moL |R vavo, o ARCmenca jecpe nu r^rc loc dm bpsa
enzirpei corespuozAtoarc.
In schimb, legAturn macroergicA dm acidol piroiosfonc este scindatA
hidrolilic extrern de..rapid, In celuie existSnd
energia care se ellbereazA
este chiar
ceva mai mare decat -13 kcal/moi.
O
0
HO P O P OH + H20 - -2H3P04 ; AG01 - - 8 kcai/moi
ii.
OH OH
269
% % pioo*Q$*ttr
Cea de a
Pe de altd parte, in celule ^
nici nu existd enxinie care sd asigure aceastd scindMeuAG0 pentru aceastd
scindare a fost totui mdsuratd. ..ee.ctuindu-se in vitro hidroliza:tAMP*
AMP + H20 ---------->* Adenozina + H3P04 ; AG0 ~ -3,4 kca!/mol
Existd mai multe explicajii in legdtnrd cu valoarea negative ridicatd a AQ C'
in corsul hidrolizei legdtuniar,. P~0 din ATP ,i dm pirofostat;.,
- in pnmul mnd, Of9tmW& ATP, la^H-^are^miu^arcjninog^.tsitt
aciduj^ fosforjp;
- in al doilea rand, atat in ATP cat 1 in pirofoslat legdturile cu caracter
macroergjp sunt de ,tip,-anhidnda (unesc doud res tun acide). S^ihtatea
acizilor care rezultd prin hidrohza este mult, supenoard celei a anhidndelor,
acizu exTstand
mezojnere^
un al treilea aspect este legat de rolul ionilor defMg^;un celule, atat ATP
cat i ADP^
i P| sunt complexafi cu aceti ioni:
sejie&ping mai puternic decat cele trei dm AJDP, respectiv cele cloud dm
^mdndloare lippjfWa
000

0o
-0P-0--P-OP O Adenozina 0 P-0 P P Adenozin a
0 O" O
0~ 0~
Mg2+
MgATP2"
Mg2+
0
II
MgADP"
HO P 0
1 |
0--- Mg2*
MgHP04
a
Deoarece
&-8fl JW0i wa&J&SU&Q*_
=
2
4IJV 3.B.10 ), reagiaJ^jTu^droliza
In cele mai multe dintre cazurile cfmd ATPTumizeazd energie, el se
scindeazd la ADP i Pr Scindarea ATP_ la 4MP + PP^ urmatd de scmdarea
rapldd a acestuia din urmd la 2P; este intalmtd mai rar, ea este insd
avantajoasd dm punct de vedere energetic (AG0,lora] = -15,3 kcal/moi);
aceastd scindare a ATP se realizeazd cand reacfia endergonicd cuplatd
necesitd mai mult de 7,3 kcal/ipol. Cele doud variante se exemplified prin
feacjiile:
270
I. Activarea glucozei co'nstSnd in fosforilarea ei la glucozQ-6-fogfat6;
intruc&t reacfia necesi^maT^^n^S^Ts kcal/mol, este
CH2 OH
CH2 O P03H2

2. Activarea acizilor gi;agj, constfmd in trecerea. lor in derived acil-CoA,


necesitd mai mult cle 7,3 kcal/mol (pentru formarea ieg^turii macroergice
C~S); ATP se scindeazd in acest caz la AMP -f PPj? pirofosfatul scindandu-se
rapid ia 2P,:
O
tiokinaza
#
B COOB 4- ATP + CoA - 3H------>* R - C ~ SCoA + AMP + PPf
pirofcsfataza
pp, + H20
- - -->*
2 Ps
Consumul de ATP in organism este permanent; daei$ acesta este Inegal in
limp pen tip anumite procese
ula^>, pentru allele este practic constant,
(qctivitatea sistem^lpp
de aceea el trebuie s2t se resintetizeze tot timpul,
aspect ce va fi prezentat in continuare. Se tac acum dear precizarile: in timp
ce ADP..+ P, reformeazA ATP (in cotulipile care vor fi precizate), din AMP i PPJ
nu este posibilft o resintezd directs in muschi se poate realiza o sintezft
indirect# datoritd nrezenjej aici a enzimei adenilatkinaza:
adenitatkinaza
AMP + ATP
T:=r2ADP
Din 4eU^aISfe

YI.7. ALJI COMPUI MACROERGICI. POTENJIALUL DE TRANSFER


A GRUPARII FOSFAT
Celelaite nucleotide trifosforilate, cu ribozfl sau dezoxiribozd, servesc in
anumite siluajii drept compui macroergiciAstfebm^ este utilizat, in
met^bqlismulii^ glucidic. la sinteza UDP-glucozei care particip# la biosinteza
6
Reacfia aceasta, ca multc al(e fosforitSri, are loc in doi timpi: hidroliza ATP
la ADP + P{ i reacfia P; cu glucoza.

: . r * ;;
A '!
271
;V

CTP activeaz a
SUSMMisi
A unii compel
lipidici in timp ce la sinteza proteinelor parti cipS atat ATP. c&t i CUffi. In
procesele de biosin teziS ale acizilor nucleici nucletidele trifosforilate (ATP,
GTP, UTP i CTP pentru ARN i ATP, GTP, UTP, CTP, dATP, dGTP, dCTP, dTTP
pentru ADN) sunt, simultan, unitlijii monomerice i furnizori de energie,
Dac& la scindarea hidroliticS a leg&turiior macroergice din celelalte
nucleotide trifosforilate se elihereazft aceeai energie ca la scindarea ATP,
exists in organismele vii alji compui cu legSturi macroergice a c&ror AG in
reacfiile de hidrolizS. este mai mare decat -7,3 kcal/mol; majoritatea
acestora sunt tot compui fosforilafi (Tabelul VL3):
Tabelul VIJ
AG05 in reactiile de hidroUziS ale imor compusi macroergici (fosforilaji sau de
aSta natura) si ale imor conipui fosforilap care nu sunt macroergici
Compustd
AG0
kcallmol
kJimol
Acidul fosfoenolpiruvic
- 14,8
-61,9
Carbamilfosfatul
- 12,3
- 51,4
Acidul 1,3-bisfosfoglicerie
- 11,8
- 49,3
Creatinfosfatul
- 10,3
- 43,1

Acil - CoA
- 7,5
- 31,4
ATP ADP +P(
n^
- 30,5
Glucozo-1 -fosfatul
- 5,0
- 20,9
Fru ctozo-6 - fos fa t ill
- 3,8
- 15,9
G1 u cozo- 6-fosfatul
- 3,3
- 13,8
Glicerol-3-fosfatul
-9,2
- 2,2
Din dispunerea pe baza AG a ATP intr-o pozijie de mijloc in raport cu
ceilalfi compugi fosforila|i reiese $i mai bine rolul siiu de intermediar
energetic (moned& de schimb^). Orice compus macroergic fosforilat (dar i
nefosforilat) cu AG0' negativ mai mare de 7,3 kcal/mol poate transfera
teoretic restul de acid fosforic ADP-ului pentru a se forma ATP; acesta din
urmS este, la randul sftu, capabil sii Iransfere restul de acid fosforic pe
compugi cu AG0 negativ mai mic decat 7,3 kcal/mol. Se realizeazft astfel o
scanl de transfer a restul ui de acid fosforic numitS potenlial de transfer a
grup&rii fosfaf4 (sau potential de fosforilare) care are o mare important in
bionergeticS. Pentru ca aceste transferuri sfi se product in realitaie, este
obligatorie existenfa enzimelor specifice. Lipsa enzimelor specifice face
imposibile transferurile fosfatului intre compugii situaji deasupra ATP in
Tabelul VL3, sau intre acil-CoA i ATP; din acelagi motiv nu este posibilti nici
transfenirea fosfatului de la compusii de deasupra ATP c&tre cei dedesubtul
acestuia.
Fosforilai*ea ADP cu Pt furnizal de compugii macroergici ca
fosfoenolpiruvatul i aci- dul 1,3 bisfosfogliceric reprezinUl, aa cum va reiegi
in continuare, una din modalitSjile de sinteza a ATP in sistemele vii.
Deosebit de important^ este relatia dintre ATP si cieatinfosfat. Acesta din
urm3 se poate acnmula in anumite limite in muschi constituindu-se ca o
rezerviT de
272
^ ts
1 ,tf
,z

*1J0
'K.
f\~p
H
Oj 'b
8
S
4
2
O
fosfoe/rofft/nj^fPSf^f
u
ytorft/ ' , ~A
Creafy'/jfosfyf/
Gfucazo

' 8-far/*/
k
G/t'cero/
3-fosfyfFig. VI.4 - Transferal grup&rii fosfat de la compui macroergici cu AG01 negativ
mai mare decat -7,3 kca!/moS ia ATP i de la acesta la alji compui
Depozitarea se face in starea de repaos i in condifiile excesului de ATP.
Creatinfo- sfatul servete pentru furnizarea rapids de ATP in momentul
contracjiei, sinteza obinuit# de ATP necesitand un timp mai indelungat.
Sinteza i utilizarea creatinfosfatului In muchi se fac prin intermediul
re&cfiei reversibiie cataiizat# de cseatinksnaz#, numita i creatMosfoMnaz#
(CK, CPK):
HN = C'
NH,
CPK
+ ATP
HN = C'
NH ~ P03H2
+ ADP
N CKCOOH
N CHg COOH
CH3
CH3

creating
creatinfosfat
Potenfialul de transfer a grup&rii fosfat i relafia ATP-creatinfosfat sunt
reprezentate
in Fig. VIA.
Se face preeizarea dx acidul fosfoenolpiruvic, creatinfosfatui i acetil~CoA
(in genera! acil~CoA) au ieg&turi macroergice dei nu sunt anhidride. AG
negativ ridicat in leacjiile de hidroliz# a lor ii are explicajia in stabilizarea
prin rezonanf# a produgilor rezultafi.
VI.8 CAILE DE SINTEZA ALE ATP IN VIVO
S-a mai menjionat eft, din punct de vedere energetic, fiecare Jesut, chiat
fiecare celulS, acjioneaz# pe cont propriu, In alji termeni, nu exist#
posibilitatea transferului de energie liber# i nici de compui cu legHturi
macroergice de la o eelul# la alta.
273
Pentru producerea de ATP, celulele utilizeazd energia eliberatH in reacjiile
exergonice din caile de degradare a giucidelor, iipidelor i proieinelor. Cu
excepjia eritrocilelor i a altor cateva tipuri de celuie, toate ceielalte
degradeazd aerob compuii menfionafi ceea ce asigurS producerea unei
cantMfi insemnate de ATP raporat la un mol de compus degradat. In eforturi
intense, celulele musculare degradeaz giucoza i in condijii anaerobe.
Eritrocitele sunt celuie strict anaerobe in limp ce celulele musculare sunt
facultative.
Deoarece cuprind numai o parte din etapele c&ilor degradative aerobe,
cftile anaerobe produc pufina energie i dec! pufin ATP: fajS de 38 moli
ATP/mol de glucozft degradatS aerob, in etapa anaerobe se produc doar doi
moli ATP/mol de glucozd. Sinteza de ATP corelatd cu degradarea anaerobe se

realizeazft in intregime prin procesul numit fosforilare la nivel de substraf 1 in


timp ce sinteza de ATP corelatS cu degradarea aeroM se realizeazS numai in
micB mSsurS prin acest proees, in cea mai mare parte ea are loc prin
cuplarea proceselor numite ,,lanf respirator14 i fosfori!are oxidafiviT.
VI.8.1. FO S FOR IL ARE A LA NIVEL DE SUBSTRAT
Energia eliberatd Intr-o reacfie exergonicd poate fi utilizatS direct pentru
sinteza d e A T P d i n A D P i Pf, se spune, in acest caz, c& ATP s-a objinut
prin fosforilare la nivel de substrat".
Numai reacfiile exergonice care elibereazfl energie in valoare cel pufin
egald cu cea eliberatft la hidroliza ATP pot asigura sinteza acestuia prin
fosforilare la nivel de substrat.
Cuplarea ADP cu P; in urma c&reia se formeazS leg&tura macroergicfc
este catalizatS de kinaze, enzime cu specificitate absolute in raport cu
substratul. In organismul uman acfioneazli numai trei asemenea kinaze,
corespunzand la tot atatea variante de sinteza a ATP la nivel de substrat.
Doua dintre variante sunt in Iegfttur& directa cu degradarea glucozei la acid
piruvic fiind operafionale atat in condijii anaerobe cat i aerobe; cea de a
treia este corelatd cu catabolizarea acetil-CoA in ciclul aeizilor iricarbcxilici:
1. Sinteza de ATP cuplat# cu transformarca. acidului 1,3-bisfosfogliceric
in acid 3-fosfogliceric; este una dintre reacjiile glicolizei fiind catalizatS de
fosfogliceratkinazil:
O
C#
j XO~PO3H2
HC-~ OH
Fosfogliceratkinaza
+ ADP

1O

| N OH HC OH
+ ATP
H2C O P03H2
H2C 0 PO3H2
274
Din cele 11,8 kcai/mol ale legftturii macroergice din acidi.il 1,3bisfosfogIiceric doar 73 se conserve in legftturft macroergice din ATP, restul
de 4,5 se disipeazd in media.
2. Sinteza de ATP cupiafil cu tmnsformarea aciduiui fosfoenopiruvic in
acid piruvic este o alld reacjie glicoliticll; ea este catalizate dc pinivatkinnze:
0
<
c#
C#
Piruvat
\\r
j OH
kinaza V
C 0 P03H2 .
ii
1
CH2

O
OH

CH3

+ ATP
Ceie 14,8 kcal/moi cat se eiibereazd la hidroliza aciduiui fosfoenolpiruvic
ar fi suficiente pentru sinteza a doi moii de ATP; in realitate se formeaze
numai unul, 7,5 kcal/mol disipandu-se in mediu.
3. Sinteza de ATP cuplate cu transformarea succinil-CoA in acid succinic;
este ana dintre reacfiile ciclului acizilor tricarboxilici fiind catalizate de
succinii-CoA-tiokinazd:
CO
COOH
OH
j
j
1
Succinii- l
CH2
CoA
CH2
1
tiokinazi 1
GHp -f GDP 4- P;
- - ------CH2
1 ^0
1
C ~ SCoA
CO
OH
LegiStura macroergice din succinil-CoA eiibereazd prin hidrolize ~8
kcal/mol din care 7,3 se utilizeazS pentru form area legSturii macroergice din
GTP. Este singura reacjie in care se formeazfi un alt nucleotid decat ATP-ul;
GTP este utilizat ca atare sau este transformat prin reacfie de schimb in ATP;
GTP -f ADR
GDP + ATP
VI.8.2. LANJUL RESPIRATOR 1 FOSFORILAREA OXIDATIVA
Rolul catabolic al ciclului acizilor tricarboxilici este de a degrada restul
acetii din acetil-CoA care se objine prin degraderi specifice ale glucidelor,
lipidelor i unora dintre aminoacizi. In cursul acestei degraded, carbonii din
restul acetii sunt oxidafi la C02 iar hidrogenii sunt preluaji de coenzimele
NAD+ i FAD care se reduc la NADH + H\
4i
k:
A,
;i
'A :
A
j;i
A
275

FADH2

Fig. VI.5 - Schema de ansamblu a degradSrii aerobe a giucidelor,


lipidelor i proteinelor
respectiv FADH2 (vezi CicIul acizilor iricarboxilici) (Fig. VI.5). Coenzimele
reduse NADH + H+ i FADH2 se formeazS i in cursul degradarilor specifice
ale giucidelor (de exemplu in glicolizS), lipidelor (P-oxidarea acizilor grai) i
unor aminoacizi.
Lanful respirator, etapa ultima a degradarii aerobe, are drept scop
reoxidarea coenzimelor NADH + H+ i FADH2 prin trecerea hidrogenului pe
oxigen cu formarea apei.
276
Prin reoxidarea coenzimelor se asigurifc
a) posibilitatea continu&rii dehidrogenSrilor in entile degradative specifice
i in ciciul acizilor tricarboxilici;
b) eliberarea unei cantitdfi de energie care servete la sinteza celei mai
marl p&rfi din ATP-ul necesar organismului;
Sinteza propriu zisS de ATP se realizeazS prin procesui numit' Jfosforilare
oxidativiT, proces cupiat cu lanful respirator; ATP se objine din ADP i Fi a
c&ror condensare este posibiia numai pe seama energiei eliberatd in lanful
respirator.
Transferal echivalenfilor de reducere7 de pe coenzimele reduse pe
oxigen poate fi redat prin ecuafiile globale aie lanfului respirator:
NADH + H+ + 1/2 02 -------------------NAD" 4- H2G
FADH, 4-1/2 0, ---------------------- FAD + H20
Acest transfer se face ins& printr-un num3r mare de reaefii intermediare
(lanf) catalizate de enzime specifice care aefioneazd individual sau in
complexe; corespun- zdtor, energia totals a fieedreia din cele dou& reaefii se
elibereazd in trepte sau pachete cu valori ale AG0 sub sau uor peste -7,3
keal/mol, ultimele utilizabile pentru sinteza ATP din ADP i.Pj. . .
Lanful respirator i fosforiiarea oxidativd, se des'fSoar5 in membrana
internd a mitocondriilor, toate enzimele care catalizeazd cele uoud procese
fiind integrate in structura acestei membrane.
Multe enzime (componente) ale lanfului respirator au fost izolate i

structura lor a fost elucidate; altele au fost studiate numai pe edi indirecte.
Citocromii sunt compui heteroproteici ale edror grupdri prostetice sunt
hemuri, foarte uor diferite de hemul din hemoglobin^ i mioglobind (vezi
Metabolismul hemoproteineior). Cel mai bine studiat este citocromul c (Cit.
c) care este deosebit de stabil deoarece legdtura intre hem i componenta
proteied este covalentd (Fig, VI.6). O proprietate deosebit de important# a
citocromilor este absorfia selective a unor radiafii din domeniul vizibil al
spectruiui radiafiilor eleetromagnetice; clasificarea citocromilor in a, b, c etc.
(fiecare cu mai multe variante, notate prin indici 1, 2, 3 ...) s-a realizat dupd
acest criteria.
Mecanismui prin care fiecare dintre citocromi aefioneazd in lanful
respirator constii in acceptarea electronilor de la un partener cu potenfxal
redox standard mai negativ (sau pozitiv mai mic) decat al sdu 1 cedarea
apoi a acestor electroni cdtre un partener cu potenfial eiectronegativ mai mic
(sau electropozitiv mai mare) (Fig. VL7). In cursul funefiei lor, citocromii ii
schimbd deci alternativ valenfa fierului intre Fe3+ i Fe2+. Aceastd inspire este
total diferitd de a miogiobinei i hemoglobinei la care valenfa fierului nu se
modified odatd cu fixarea 02; aa se explicit nu numai prin diferenfa structurii
hemului din citocromi ci i prin componentele proteice diferite.
7
Dupa cum se va vedea in continuare, in un.ele- reaefii ale lanfului respirator
se transfers hidrogeni, m altele electroni. Termenul "echivalenfi de reducere"
este comun pentru cele doua transferuri.
277
CH3 CHS.
H,C
HOOC'
v_
/r
V
I
/VSe^-H
yCHs
HOOC
HeC
S'
\
Ctf,
-CHSI
CHj
/
$
V
Fig. VI.6 - Structure citocromului p (componenta neproteica). Legatura cu
proteina specified se face prin intermediul gruparilor -SH ale unor resturi de
cisteina

(Fe**)
Fig. VI.7 - Modul de funcjionare a citocromllor in lanjul respirator (detalii In
text)
Citocromii a i a3> unit&ji distincte dup& spectrele de absorbfie
inregistrate pe fragmente de memhranft intern^ mitocondrial^, no an putut
fi tot-ui separafi imul de altul, Impreunft ei alcdtuiesc citocrom-c-oxidaza,
singurul dintxe componentele lanjului respirator care este capabil s8 reduce
oxigenul.
Coenzirrm Q (CoQ), numit& i ubichinonS, seamSnS structural i functional
cu vitaminele K. Sunt cunoscute variante ale CoQ care difera prin lungimea
catenei izoprenoide; fiecare dintre acestea exists in forms redusli i in forms
oxidala;
funcfia lor in lanful respirator se' bazeaz# tocmai pe alternanja continue intre
cele douil forme:
O
OH
CH,
H C /
3 ^Y'/AS (CH2--CH = C- 0
CoQ, forma oxidata

CH,
(CH2~-CH = C CHZ~^H
CoQ, forma redusa
Flavoproteinele (FP) sunt componente ale lanfului respirator prin
intermediul cMrora se preiau hidrogenii de la coenzimele dehidrogenazelor
NADH + H+ 1 FADH2. Structurile diverselor flavoproteine au fost prezentate
in capitolul Vitamine i coenzimeA In Ian{ul respirator se intSInesc in
variantele;
-flavoproteina N, cu coenzimft FMN, notata FPN; are rolul de a prelua
hidrogenii de la coenzima NADH + H+;.
~ flavoproteina S, cu coenzima FAD, notatS FPS; preia direct, hidrogenul
de pe acidul succinic in ciclul acizilor tricarboxilici;
alte flavoproteine cu coenzima FAD, care preiau hidrogenul de la diverse
substrate; Proteine cu fier i sulf: atomii aces tor elemente sunt grupafi in
centre care se ieag&
de componentele proleice prin intermediul unor resturi de cisteind (Fig. VLB).

. .Aceste componente sunt dispose secvenjial in membrana interna


mitocondriand, in ordi- nea descre^terii potenjialului redox negativ i crejterii
celui pozitiv; cu excepfia CoQ i Cite,
CyS-S,
\.
Fe~
Fe
>
s

S-CyS
\
Fig. VLB - Structura unei proteine cu Fe i S
MATRIX
mm
am

mfrnra

mm
JfiHM

MM

SPAJ'fU SNTERMBMBRANAR
Rg. VI.9 - Locaiizarea m membrana interna mitocondriala a cotnplexeior
1...1V] ale !an|uiui respirator i ATP sintaza
care funcjioneazit individual, celelalte componente se gsrupeaz& in
complexe notate I, 13, m i IV (Fig. V1.9) fiecare complex catalizSnd o
anumitS reacjie de oxido-reducere.
Tot in membrana intemd mitocondriaLI, dupft complexul IV, este inclus
(partial) complexul responsabil de fosforilarea oxidativS numit ATP~sintaz&
dar i ATP-azS, deoarece, dac& este extras din membrane, el catalizeazU

hidroliza ATP; denumiri sinonime mai sunt H+ - ATP-azS i FoFrATP-az38.


Complexul are o subunifate, notatS F0, care strSbate In totalitate membrana
intern*!; ea const# din patru tipuri de proteine care formeaz# un sistem de
pori transmembranari prin care tree cu mare uurin$ protonii (canai
protonic4')- Subunitatea notate este aic&tuit# din cinci tipuri de proteine care
se afl& in raportul stoechiometric a3p378e; ea este cuplatft la subunitatea F0
i se afl# in intregime In matrixul mitocondrial sub forma unei mid sfere (Fig.
VI.10). La niveiul acestei subunitS{i are loc. reaejia de condensare a ADP cu
Pj, de aceea este denumit# i ^factor de cuplare I.
Funcjionarea celor patru complexe, a CoQ i Cit.c ale lanfului respirator,
cuplate cu funejionarea ATP-sintazei pot fi urmiSrite in Fig. VI.ll.
Complexul I, numit chimic NADH - CoQ reductaz#, transfer# ionii de H+ i
electronii de pe NADH -f H+ din matrix pe coenzima Q. CMerii de potential de
0,42 V, care reprezint# difeienfa Intre Ec' a NADH i E0' a CoQ, ii corespunde
o AG = -19,4 keal/mol, suficient# pentru sinteza a doi moll de ATP, in
procesul fosforii&ii oxidative se sintetizeaz# ins# un singur mol, restul de
energie se disipeaz# in mediu. Reacfia catalizat# de complexul I, cuplat# cu
fosforilarea oxidativ# se sumarizeaz# astfel:
NADH + HN CoQ
NADH-CoQ
reductaz#
> NAD* + CoQHz
ADP + Pi
ATP
*Uneori, ATP-sintaza este denamita $i complexul V.
280
MATRIX
MMMM

mm
Fig. VI.10 - Un model ai structurii ATP sintazei
ATP
ATP
ATP

Fig. VL11 - Funcjlonarea cuplat& a complexelor lanjului respirator f


fosforilarii oxidative
Subuni dtyiie complexului I sunt FPN (numit& i NADH dehidrogenaza) i
cateva proteine cu fier i sulf notate FeSl5 FeS2, FeS3 i FeS4, aceastS. ordine
corespunzand
deseregtcrii valorii negative a !ui E0; corespunz&or, curgerea echivaienfilor
de reducere m interiorul acestui complex este:
NADH + H
NAD+
FPN(FMN)
2 e
2 e
2 e"
2 e"
2 e
FeS,
FeS?
FeS,
-FeS4
FPN(FMNH2) 2H+
2H+
CoQ
COQH2
281
Se observe eft hidrogenul este disproporfionat la prelurea sa de cfttre
complex, in continuare fiind transferaji dectronii; transferul se asigurft prin
oxidftri-reduceri ale ionilor de fier i de sulf ai subunitftfilor. In final, protonii i
dectronii refac atomii de hidrogen i acejtia reduc coenzima Q.
Complexul I este inhibat de rotenonft (un insecticid de origine vegetalft),
amital (compus din clasa barbituricelor) i pericidinft (an antibiotic),
substance care hlocheazft transferal de electroni la acest nivel.
Complexul II, numit i succinat-CoQ reducteazft, realizeazft transferal
echivalenjilor de reducere de la succinat la CoQ conform schemed
Succinat
FPS (FAD) N . COQH2
Fumarat
FPS (FADH2) /
^ CoQ
Subunitatea principal;! a complexului II este succinatdehidrogenaza cu
coenzima FAD, care, fiind dispusft la marginea dinspre matrix a membrane!
interne mitocondriale, catalizeazft dehidrogenarea succinatului la fumarat in

ciclul acizilor tricarboxilici i, in acelai timp, introduce hidrogehii in ianful


respirator. Aiftturi de aceastft subunitate, in complex se mai aflft cel pufin
trei proteine cu fier i sulf; evident, exist# i in interiorul complexului II un
transfer din aproape in aproape a electronilor.
Variafia de potential la transferul electronilor de la succinat la CoQ este de
0,07 V corespunzand unei valori a AG = -3,2 kcal/mol; deci la nivelul
acestui complex no se elibereazft suficientft energie pentru ca prin cuplare
cu fosforilarea oxidativft sft se sintetizeze ATP.
Complexul II al lanfului respirator are i flavoproteine specializate pentru
introducerea hidrogenilor de pe alte substraturi: acil-CoA, glicerol-3-fosfat,
colinft, sarcozinft. In cazul acil-CoA, aceastft flavoproieinft a fost identificatft;
ea a fost numit# electron transporting flavoprotein (ETF).
Complexul III, numit CoQ-citocrom c reductazft, asigurft transferul
echivalenfilor.de
reducere, tot sub forma de electroni, de la CoQ la citocromul c:
CoQ-citocrom c redact aza
COQH2 + 2Cit.c (Fe3*)
------CoQ -!- 2Citc (Fe2*) + 2H+
Variafia de potential la acest transfer este de 0,18 V, cftreiaii corespunde
AG05 = -7,75 kcal/mol, ceea ce asigurft ca prin cuplarea cu fosforilarea
oxidativft sft se sintetizeze un mol de ATP.
Citocromii care participft la structura acestui complex sunt notafi bK, bx i
q; este prezentft i cel pufin o proteinft cu Fe i sulf.
Complexul III este inhibat specific de antibioticul antimicim! A.
282
Coinplexul IV, numit eitocromoxidaz!, calalizeaz! adijia a patru electron!
fumizaji de Cit.c (Fe2+), la oxigenul molecular cu formarea a 202"; acesta,
combinandu-se cu protonii, formeaz! ap!:
Citocromoxidaza
02
+ 4e* + 4H*
ADR + P}
ATP
Structural mecanismul de acjiurid al acestui complex nu sunt inc! pe
deplin cunoscute, Au fosl identificate cel pujin apt.e subunit!j.i proteice a
c&ror compozijie in aminoacizi este diferil!. Unele dinfcre acestea conjin i
ioni de cupru, Pe baza unor determinSri indirecte, se admite al in complexe
elecironii receptionap de la Cit.c de c!tre Cit.a, tree de la acesta pe proteina
cu cupru i de aici pe Cita3 care u transfer! apoi pe oxigen.
C!derea de potential la trecerea electronilor medial! de compiexul IV este
de 0,54 V c!reia ii corespunde o valoare AG0> = -24,8 keal/mol, deci energie
suficient! pentru sinteza a trei moli de ATP; nu se sintetizeazfi ins! decat un
singur mol.
Citocromoxidaza este puternic inhibat! de ionul CN~, de oxidul de carbon
i compuii denumiji azide ceea ce explic! toxicitatea mare a acestora.
Cu datele prezentate se poate face un bilanj; complect al energiei
eliberate la reoxidarea NADH + H+ i FADH2 in lanjul respirator i a utiliz!rii
acesteia pentru producerea de ATP prin procesul de fosforilare exidativ!.
Ecuajiile globale corespunz!toare sunt:
NADH + H* + 1/2 02 + 3 ADR + 3 P;
NAD* 4- 3 ATP + 4 H2G
FADH2 + 1/2 02 + 2 ADR + 2 P, - - -> FAD 4- 2 ATP + 3 H20
Variafia polenjialului redox standard pe tot lanjul respirator este AE0 =.

1,14 V pentru reoxidarea NADH + HL valoare rezultat! din insumarea c!


derilor de potenjial la nivelul celor trei complexe. ApiicSnd formula AG0 = mF*AE0? se ob{ine AG0' = - 52,6 kcai/mol. Intrucat se sintetizeazfi trei moli de
ATP pentru care se consum! 3x7,3 = 21,9 keal/mol, randamentul utiliz!rii
energiei libere pentru sinteza de ATP este: 21,9x 100/52,6 - 42%.
Intrarea echivalenfilor de reducere in lanjul respirator prin compiexul I
este numit! ramura lung!u a acestuia; ea asigur! deci formarea a trei moli de
ATP/atom gram de oxigen redus.
La intrarea echivalenjilor de reducere prin compiexul II se asigur!
formarea a numai doi moli de ATP/atom gram de oxigen redus. Este ramura
scurt! a lanjului respirator.
Raportul intre numfirul de moli de ATP produgi 1 oxigenul (in atomi gram)
consumat este numit cat de fosforilare44. El se simbolizeaz! P/O i este deci
3/1 pentru ramura lung! i 2/1 pentru ramura scuit!.
283
VI.8.3. TEORII PRIVIND MECANISMUL CUPLARII LANJ RESPIRATOR FOSFORILARE OXIDAHVA
Una dintre problemele fundamentale ale bioenergeticii o constituie
mecanismul prin care energia eliberatd in lanful respirator este cuplatd cu
formarea de ATP prin fosforilarea oxidativd. Cele trei teorii formulate in timp
au ca element comun existenja intermediary a unei stdri energetizateA
Aspecteie esenfiale ale eelor trei teorii sunt prezentate. in continuare.
a) Teona chimicd, numitd i a intermediarilor comuni (Slater, 1953): prin
analogic cu fosforilarea oxidativd la nivel de substrat, se admite cy variafia
energiei libere in cursul Irecerii electronilor de la un intermediar redus (AH2)
al lanpilui respirator la urmytorul oxidat (B) servete la cuplarea lui A cu un
compus C pentru a forma legytura macroergicy A~C. in reacjii de schimb
secvenfiale, legytura macroergicy este trecutyin compusul C~P; de aici in
ATP. in timpul acestor reacjii AH2 este oxidat la A, B este redus la BH2 i C
este refycut putandu-se inijia o nouy secvenld:
AH2 + B 4- C
^ A - C+ BH2
A C + P|
cP+A
C P + ADP
ATP + C
Celor trei cuplaje ale lanjului respirator cu fosforilarea oxidativy ar trebui
sd le * corespundy trei intermediari A~C; nici un asemenea compus no a fost
identificat. Abandonaty din acest motiv, teoria cuplajului chimic a fost
reluatd (Griffith, 1977) considerdndu-se cd acidul lipoic, care s-a constatat cd
este implicat in complexul ATP- azic, ar putea indeplini roiul lui C dar nu s-a
objinut nici un fel de date experimentaie care sd sprijine aceastd supozijie.
b) Teoria conformafionald: in forma initiate (Boyer, 1964), considerd cd
energia eliberatd in cursul transportului electronilor este conservatd prin
modificarea conformajionald la o stare energizatd a unuia sau mai multor
transported de electroni. Ulterior, s-a postulat modificarea conformafionald a
complexelor enzimatice la care se reaiizeazd cuplajul. in sprijinul acestei
teorii se aduc rezultate objinute prin microscopia electronicd care
evidenfiazd cd la trecerea mitocondriilor din starea de repaos metabolic la
starea activd (consum de 02 i sintezd de ATP), membrana intemd se pliazd,
volumul matriceal reducandu-se foarte mult. Viteza redusd a modificdrilor

conformafionale in raport cu rapiditatea cuplajului transport de electronisintezd de ATP este un serios impediment de impunerea acestei teorii.
c) Teoria chemiosmoticd (Mitchell, 1961) postuleazd cd starea
intennediard energetizatd care determind sinteza de ATP din ADP i P; este
reprezentatd de gradientul de protoni care se stabilegte intre fafa interioard
i cea exterioard a membrane! interne mitocondriale in timpul transportului
de electroni. in alji termeni, transportul direefionat al electronilor in lungul
membranei determind un transport direefionat (vectorial) al protonilor din
interioml mitocondriilor spre exterior (Fig. VI. 12). Gradientul protonilor
ejectafi in spajiul intermembranar are doud componente: una de pH, (ApH)
284
ADP * Pi
ATP

Fig. VI.12 - 0 iiustrare schematizata a teoriei chemiosmotice


una electric^ sau potential de membrane (A*F). Surma lor este numitft
for|& proton motrice, notatft Ap:
A p = A - 2,303 A pH
Numeroasc date experimentale vin in sprijinul acestei teorii. Astfel
existenja unui potential transmembranar, care constitute cheia ipotezei
chemiosmotice, are justificare prin faptul cil spajiul intermembranar al
mitocondriilor este mult mai acid in cursul funcjion&rii celor douh procese.
Prin studii de microscopic electronic^ i alte tehnici, s-a confirmat i faptul,
de asemenea obligatoriu pentru valabilitatea teoriei, cS membrana interns
mitocondrialfr este strSbStutS de la o fajd ia cealaltS de complexele I, III i IV
ale lanfului respirator (Fig. VI.9).
Teoria prevede in continuare cS protonii din spajiul intermembranar revin
in mitocondrie strict prin partea Fu a ATP sintetazei care este un conductor
pentru protoni (restul membranei fiind impermeabilS pentru acetia). Acest
flux de protoni este cel care determine, la nivelul subunit&jii Fj, sinteza de
ATP din ADP i P;.
in experienfe model s-a putut demonstra eft un flux artificial de protoni, in
absenja lanjului respirator, poate determina cuplarrea ADP cu P,;, ceea ce
constituie incft un argument series in favoarea teoriei chemiosmotice.
Unui dintre postulated teoriei chemiosmotice prevede eft apa rezultatft in
reaefia de form are a ATP din ADP i P- se ionizeazft spontan, ionii H+ fiind
dirijafi spre interiorul mitocondriei (ei urmfmd sft creeze gradientul protonic)
in limp ce ionii OH sunt dirijaji spre spajiul intermembranar;
ADP 4- Pj
'
ATP 4- H+jnterior 4- OH exterior
. Obligatoriu dupft Mitchell, acest postulat a constiluit obiectul principal al

unor inverunate critici la adresa teoriei chemiosmotice; totui, prin


argumentele experimentale deja menjionate ca $i prin allele aduse relativ
recent, aceastft teorie s-a impus net in raport cu teoria ehimieft i cu cea
conformajionalft.
285
VI.8.4. SISTEME DE TRANSPORT A ECHIVALENXILOR DE REDUCERE
Reacjii de dehidrogenare catalizate de enzime cu coenzima NAD+ au loc
atat in citoplasma cdt i in mitocondriile celulelor. NADH 4 H+ care se
produce in astfel de reacjii la nivelul mitocondriilor se reoxideazd prin
preluarea direct# a echivalenjilor de reducere de cdtre lanjul respirator
(mecanismul descris). Mai complicate! este reoxidarea NADH + H+ care se
produce in citoplasmd. Exceptand anumite cazuri, de exemplu reoxidarea
NADH 4 H+ produs in cursul oxiddrii gliceraldehid-3-fosfat ---4 acid-3fosfogliceric
in reacjia acid piruvic > acid laclic (vezi Glicoliza in condi|ii anaerobe) i
NADH 4 H+
produs in citoplasm^i se reoxideazd prin introducerea echivalenjilor de
reducere in lanjul respirator. Cum insa membrana mitocondriald nu este
permeabild pentru coenzimele nicotinamidice, procesul are loc pe cdi
indirecte numite navete (shuttle).
Naveta glicerolfosfat (Fig. VL13.A) opereaza astfel: NADH + H+ format in
diverse reacjii de reducere din citoplasmd se asociazd cu apoenzima
specified formand glicerol-fosfatdehidrogenaza, enziind ce catalizeazS reacjia
de hidrogenare a dihidroxi- acetofosfatului (DHAP, intermediar glicolitic.) la
glicerolfosfat; intrucat membrana extern^ mitocondriald este permeabild
pentru glicerolfosfat, acesta pdtrunde cu uurinjd in spafiul intermembranar.
Pe suprafaja externd a membranei interne mitocondriale este localizatd
glicerolfosfatdehidrogenaza mitocondriald care reoxideazd glicerol-fosfatul la
dihidroxiacetonfosfat, cei doi atomi de hidrogen fiind prelua|i de coenzima
acestei enzime, care este de tip FP (FAD); de aici echivalenjii de reducere
tree in lanjul respirator. Dihidroxiacetonfosfatul revine in citoplasmd i suita
de reacjii se reia.
Acjiunea navetei glicerol-fosfat este restransd la introducerea
echivalenjilor de reducere de pe NADH 4- H* citoplasmatic in lanful
respirator. Ea este deci unidireejio- nald i are ca scopuri menjinerea
concentrajiei necesare de NAD+ in citoplasma i furnizarea de echivalenji de
reducere lanjului respirator.
Prinlr-un mecanism mai compiieat opereazfi naveta malat-aspartat (Fig.
VI.13.B);
la transferul in sensul citoplasmd > mitocondrie sau mitocondrie

citoplasmd
(naveta este deci hidirecjionald) a echivalenjilor de reducere concur#
malatdehidroge- nazele (MDH) i glumaiic-oxalocetic-transminazele (GOT)
citoplasmalice i mitocondriale precum i transported specializaji pentru
transferul prin membrana intern# mitocondriald a malatului, glutamatului,
aspartatului i a-cetoglutaratului (notaji pe figurd, in ordine 1, 2, 3 i 4). Prin
acjiunea acestei navete se asigurd atat. reoxidarea NADH + H+ citoplasmatic,
cat gi, pe plan mai general, reglarea cuplurilor NADH - NAD+ extra i
intramitocondriale.

Alte navete sunt capabile sd realizeze schimb de echivalenji de reducere


cu participarea i a coenzimelor de tip NADP. Una dintre ele este responsabild
de form area in citoplasmd a unor man cantitdji de NADPH 4 H* necesar
pentru biosinteze, in special de lipide.
286
NAO N H ^ NAD ~h
\ O/Zcero/N-Omf v c/ksoZZct, y
OMAN
"v.
GZ/ceroZ-0
GZ/cemZ~3rfnzZs s^/ZocoxcZroM/
%N
(zmi/OrUh
cZZbM/tacofuZrZe
A
CZrOPLASZAA
D/sZdZp________________
AfA0+*r^/'ZZAZZZZ^P MM
ZZ/d/OAceZdZ
WD^DZo <- 'G0r\ ,
* Asp *o(- ce%pZxZdrd/- *#1 M/rOCONDN/E
0'
vV
Afd/dZ MON

NADt * NAOH
OXdZOACeZdZ G/cX71 x
----- -

Asp
*- A~ceN?p/xZdXdZ
B
Fig. VI.13 - A. Naveta unidirectional^ ..glicerol-fosfaf; B. Transferul
bidirectional malat-aspartat
287
I
\4:
V:

VI.8.5. AFECJIUNI DATORATE UNOR DEFECTE EREDITARE LA NIVELUL


ENZIMELOR LANJULUI RESPIRATOR 1 FOSFOKILAKII OXIDATIVE
In complexele lanjului respirator i fosforiidrii oxidative au fost identificate
cateva zeci de proteine. Cele rnai multe dintre ele sunt sintetizate in citosol
i transportate in mitocondrii; pentru un numdr dintre aceste proteine s-a
stabiiit cd sunt codificate de ADN mitocondrial.
Se gtie cd ADN mitocondrial are o ratd a mutafiilor de aproximativ zece ori
mai mare decat aceea a ADN nuclear. De aceea, mai ales in Jesuturile care
consume cantitdji mari de ATP, cum sunt ficatul, rinichii, mugchii scheletici,
mugchiul cardiac, s-au semnalat miopatii mitocondriale44 de care sunt
responsabile proteinele cu defecte a cdror sintezd a fost controlatd de ADN
mitocondrial. Se cunoagte i o neuropatie opticd ereditard caracterizatd prin
pierderea bilaterald a vederii cenlrale ca rezultat al degraddrii retinei.
VI.8,6. CONTROLUL RESPIRATOR
S-a afirmat chiar la inceputul acestui capitol cd organismeie vii produc

energie i deci sintetizeazd ATP in raport cu necesitdfiie de consum din


fiecare moment. Pentru a rdspunde prompt la aceste necesit&fi, fosforilarea
oxidative cuplatd cu lanjul respirator, principalele procese prin care se
produce ATP, sunt riguros controlate.
Cum insd cele doud procese constituie etapa finaid a degraddrii
glucidelor, lipidelor i proteinelor (Fig. VI.5), teoretic controlul respirator44 se
poate exercita atat prin compugi i factor! implicaji direct in lanful respirator
i fosforilarea oxidativd (coenzime reduse, 02, ATP, ADP, Pj, complexe
enzimatice etc.), cat i prin intermediari ai degraddrilor celor trei clase de
compugi. S-a constatat cd, dintre aeegtia, rolul principal it are ADP-ul; astfel,
un omogenat tisular consumd cantitatea cea mai marcde oxigen cand se
adaugd ADP. Deoarece ADP-ul se cupleazd cu P; pentru a forma ATP, controlul
respirator se mai numegte i ^control prin acceptor de fosfat44.
Raportul intre intensitatea respirafiei celulare in prezenja ADP fa{d de
lipsa acestuia se numegte rata controlului prin acceptor de fosfat; din
studii efectuate pe mitocondrii izolate a rezultat al aceasta poate varia in
limitele unui ordin de mdrime gi chiar mai mult.
Sunt mai multe fapte care justified rolul principal al ADP in controlul
respirator:
a) Factorul de cuplare 1 din ATP sintazd, prezent in cantit^tji limitate in
membrana intemd mitocondrinld, rdmane Jblocaf4 in forma energizatd in
lipsa ADP;
b) Intensitatea fluxului protonic prin componenta F0 a ATP sintazei este,
de asemenea, determinate de nivelul ADP;
c) ADP este modulator alosteric pentru mai multe enzime cu rol reglator
care catali- zeazd diversele etape ale degraddrii glucidelor, lipidelor gi
proteinelor.
288
VI.8.7. DECUPLANJI AI FOSFORILARII OXIDATIVE DE LANJUL RESPIRATOR
Se numesc decuplanji compugii chimici care blocheaz# utilizarea pen Ini
fosforiiarea ADP a energiei eliberaie in lanjul respirator.
Primul decuplant cunoscuf a fost 2,4-dinitrofenolul. Prezent intr-o
concentrate cie numai 10 uM, el determine! o diminuare a raportului P/G cu
50%; la concentrajii mai mari raportui devine zero. Alte substance
decuplatnte sunt unele hidrazone, izotiocianaji:

F
CN
2,4-dinitrofenol
carboniicianida-p-trifiuorometoxifenilhidrazona (FCCP)
In celule exist# far# indoial# decuplanji natural! ai fosforilSrii oxidative
de lanjul respirator. Ei asigur#, intre altele, stabilirea unui report optim intre
procesele consumatoare de ATP gi producerea de c#ldur# necesar#
menjinerii constants a temperaturii. De exemplu hormonal T4 (tiroxina), in
concentrajii peste limitele norm ale, are un elect decuplant. Energia care nu
se utilizeaz# in alte scopuri se disipeaz# sub form# de c#ldur#. Se admite
gi existenja unei proteine, termogenina (sau leptina), cu rol asem#n#tor.
In Jesuturile adipoase brune, a c#ror euloare este datorat# unui confinut
ridicat de mitocondrii (deci de citocromi), lanjul respirator funcjioneaz#

decuplat de fosforiiarea oxidativ#.' Asemenea Jesuturi au animalele care


hibemeaz#; de asemenea, la flit gi la nou n#scut se afl# un jesut brun
r#spandit in. jurul vaselor mari gi in regiunea omoplajilor.
Teoria chemiosmotic# ofer# o explicajie pentru acfiunea decuplanjilor.
Astfel 2,4- dinitrofenolul este un acid slab, care este solubil in mem bran# in
stare protonat# gi solubil in ap# sub form# de anion (2,4-dinitrofenoiat). El
este deci un transporter de protoni prin membran#, determinand prin
aceasta abolirea gradientului protonic gi provocand decuplafea (Fig. VI12).
VI.8.8. ALTE LANJURI RESPIRATORII
In celule exist# gi idle varianle de lanfuri respiratorii, care nu sunt ins#
cuplate cu fosforiiarea oxidativ#. Rolul lor este restrains' la reducerea 02 in
vederea incorpor#rii in anumiji compugi chimici. Cele mai freevente cazuri le
reprezint# procesele de hidroxilare. Astfel, reacfiile de hidroxilare catalizate
de monooxigenaze decurg dup# schema general#:
R-H. + 02 + XH2 ------------------ - -+ R-OH + H20 + X
unde R-H este subs!ratul care se hidroxileaz# iar XH2 coenzima redus#
donatoare de hidrogen, de cele mai multe ori NADPH.
289
in sistemul de hidroxilare iocalizat in reticulul endoplasmic al celulelor
hepatice i suprarenale, rol esenfial are Cit P45Q ale cdrui Tnsujiri sunt
asemdndtoare cu ale citocromoxidazei din mitocondrii. El cuprinde i o
flavoproteind (FAD) la nivelul cdreia hidrogenul este disproporjionat in H+ i
e. Simplificat, acfiunea acestui sistem de hidroxilare este redata in Fig. VI.
14.
in ficat, acest sistem asigurd hidroxilarea unor compuji de origine exogend
(de exemplu medicamente) dar i a unor compuji endogeni (unii hormoni),
care, devenind solubili, se elimind uor din organism. In medulara
suprarenalei, acelai sistem participS la sinteza noradrenalinei i adrenalinei,
in limp ce in corticosuprarenald se introduc grupdri hidroxil pe nutieul de
perhidrociclopentanofenantren In cursul sintezei din colesterol a hormonilor
glucp i mineraicorticoizi.
2//f

Fig. VI.14 - Lanju! respirator cu rol de hidroxizare din reticulul endoplasmic ai


ceiuieior hepatice i renale
VI.8.9. SPECIIINCOMPLET REDUSE ALE OXIGENULUI
In lanpil respirator nefosforilant din reticulul endoplasmic prezentat: in Fig.
VI. 14, aldfuri de oxigenul compiel redus (Oa) care intrd in R-OH H20 apare si
o specie de oxigen partial redus, 07, care se mimejte ion superoxid. Mici
cantitd[i de 07 se formeazd in cursul oxiddrii ferohemului din Hb la 'ferihem.
Sisteme generaloare de radicali superoxid se afid i in membrana plasmaticS,

in peroxizomi cat i in citosol. O reacjie care face parte din catabolismul


purinelor, oxidarea xantinei la acid uric, genereazd permanent, insemnate
cantitdji din acest ion:
Xantin
Xantind + 202 + H20 --------------^ Acid uric + 202 + 2H+
oxidaza
Lanjul respirator mitocondrial este considerat de unii, in virtu tea faptului
cd reducerea 02 la 202 se face in trepte, o important^ sursd de 07 ; s-a
ardtat, insd, recent, cd
290
citocromoxidaza realizeazft nu numai reducerea dar i fixarea fermft a 02 i
tuturor formelor reduse ale acestuia, ea elibemnd doar produsui cuplarii O2'
cu ionii de H+, adicft apa.
Specii reactive ale oxigenului se genereazftin cursul iradierilor masive cu
raze X i y. Aniomil superoxid, cu caracter de radical, are o foarte mare
reactivate, putand interacfiona. cu
proteinele, acizii nucleici, lipidele etc.
Pe de altS parte, anionul superoxid genereaza alji radicali liberi i
molecule care au, de asemenea, o mare reaclivitate. Imporatanjft au mai ales
radicalul hidroxil 1 apa oxigenatft:
0 + 0- + 2H+
-----MHA + 02
2+
Fe
O2 + H202
----->- 02 + HO" + HOReactivitatea lor este, in anumite situajii, beneficft pentru organism. Un
caz este cel al fagocitftrii microorganismelor, particulelor slrftine i
fragmentelor de membranft de cade neutrofile i macrofage. Pentru
omorarea bacteriilor, aceste celule acjioneazft printr-un mecanism oxigenodependent i prin unul oxigeno-independent.
Mecanismul oxigeno-dependent include sistemul mieloperoxidazft i un
altul care genereazft radicali ai oxigenului. In iinii marl, acest mecanism
opereaza astfel: dupft ce s-a produs fagocitoza, NADPH oxidaza, localizafft in
membrana leucocitelor, transforms 02 din vecinfttftji in Op; procesul este atat
de rapid incat i s-a atribuit denumirea de explozie respiratorie" (respiratory
burst). Mai departe, 02 este transformat in H202 prin reacjia de mai sus, care,
in condijiile catalizftrii de cfttre superoxiddismutazft, este foarte rapid#. in
prezenja mieloperoxidazeL o enzimft lizozomalft, H202 i CP genereaza acid
hipocloros (HOC1) care omoarft bacteriile.
Mecanismul oxigeno-independent de distrugere a bacteriilor funcjioneazft
pe principiul hidrolizei prin enzimele lizozomale cuplat cu variajii irisemnate
de pH.
In cantitftfile produse in mod curent, efectele distruct!ve ale spcciilor
reactive ale oxigenului sunt nesemnificative deoarece organismul dispune de
sisteme de apSrare deosebit de eficace. Daca, ins#, limitele producer!!
normale a lor sunt. depftite, interacfia cu acizii nucleici, proteinele, lipidele
i alji compui se produce, efectele fiind multiple: mufafii, inactivitatea
multor enzime, modificarea ciclului celular i al tele, Nu este surprinzfttor, de
aceea, eft un rol major in producerea snu in complicajiile unor procese cum
sunt imbfttrSnirea, inflama|iile, ischemiile, diabetul, malignizarea, il au
speciile reactive ale 02. Douft dintre interacjiunile acestor specii cu divert

compup se dau in continuare:


1) Reacjia HO* cu bazele azotatedin acizii nucleici:
00

R
291
iiii
i
Catala
za

V
Superoxiddisrnutaza
ZZZTXZZ:
Hfi2
L
r
2G -SH
OH,
Glutation ~ peroxidaza
IHpG
i
G~ S~S - G
Fig. Vi.15 - Sistemui enzimatic de aparare impotriva speciiior reactive ale
oxigenului
Raclicalul format suferd, la randul lui, o serie de reacjii cu desf&urare
imprevizibilfl. Severitatea afectMi ADN este mare dacft se produc asemenea
lezruni pe ambele lanjuri ale moieculei deoarece sistemele reparatorii nu mai
pci reconstitui macromolecula iniJialS.
2) Peroxidarea lipidelor la nivelul acizilor grai polinesaturafi; este iivijiatd
de mai multi radical! intre care rQ; sau HO. Se produc in serie:
- atacu! radicaiic cu extragerea H :
- rearanjarea moleculara:
- incorporarea oxigenului:
HO-; O.
+ 05
- combinarea radicalului p-eroxi cu H:

O-OH
Sistemele de aparare ale organismului impotriva acestor efecte sunt de
douft tipuri: a) enzimatic, prin care compuii agresivi sunt transformaji in
compui inactivi; enzimele superoxiddismutazS, catalazft i
glutationperoxidazd, care catalizeazd reac{ii!e de
mai jos, sunt, la un loc, sistemui cel mai important de aparare (Fig, YL15):
Superoxid
20; a 2H+--------------------------------->- H202 a 0o
dismutaza
catalaza
2H202
3*- 2H20 + 02
Glutation
H202 + 2G-SH ----------------------- --->- 2H20 + G-S-S-G
peroxidaza
292
Acjiunea glutationperoxidazei este cupiata cu aceea a glutationreductazei,
cu coenzimd NADPH 4- H+, care reface glutationul redos:
Giutation
G S S G -h NADPH + H+
->* 2GSH + NADP*
reductaza
b) neenzimatic, prin care sunt impiedicate proceseie oxidative; o serie de
vitamine, respectiv, C, E i A, prin caracterul ior reducdtor, detoxified celulele
de intermediary reactivi ai oxigenului. Aceasta ar putea fi o explicate ia
constatdrile fdcute in timp cd. prezenja vitaminelor respective in cantitdfi
rnari in brand este corelatd cu on rise mai redos de producere a unor tipuri
de cancer i cu o freevenfd mai scdzutd a alter afecjiuriL

h if I
i
il
Cap. VII METABOLISMUL GLUCIDELOR
VII. 1. CHIMIA GLUCIDELOR
Glucidele sau zaharurile sunt compui polihidroxicarbonilici i derivajx ai
acestora. Numele de hidraji de carbon, care se mai foloset:e incd,
sugereazd di formuiele empirice. ale acestora con Jin C, H, O in raport.de
1/2/1. Degimulte zaharuri se conformeazS formulei empirice (CH20)n, denumirea s-a dovedit improprie pentru un numdr mare de compui din aceastft
dasa care conjin ait raport al atomilor de C, H, O sau conjin in plus azot, sulf,
fosfor.
Glucidele se impart in oze i ozide, dup5 comportarea la hidrolizih Ozele,
sau monozaharidele. sau zaharurile simple, conjin o singurS unitate
polilriita&CT
(sunt decx nehidrolizabiieh Dupd natura grupflrii carbonil din
ijiaiediltL se impart in alcjojffi i cetozg, iar dupii numSrul atomilor de carbon
se impart in trioze, tetrqze, pentqze, hexpze, hegtoze, octoze:'
(n = 1 - 6)
CH2OH
I
G = O (n = 0 - 5)
I
(CHOH)n

CHO
I
(CHOH)n
I
CH2OH

CH2OH
Cele mai import-ante i abundente sunt hexozele (gjucqzd, fnuctozS,
galactozji) i
pentozele (ribozd).
Ozidele se impart, dupd numarul de unitaji monozaharidice la care dau
natere prin hidrolizd, in oligozide si poliozide.
Oligozidele sau oligozaharideie sunt constituite dintr-un numSr relativ mic
de unitaji monozaharidice (intre douft i zece) legate covalent. Dintre
oligozaharideie care se gSsesc in Jesuturile animale i vegetale, ca atare,
cele mai frecvente sunt: zaharoza, lactpza, maltoza. Oligozaharideie
constituite din mai muite subunihlji monozaharidice nu se gftsesc libere; ele
formeazS lanjurile laterale ale unor catene polipeptidice din structura
glicoproteinelor.
Polizaharidele conjin un num&r mare de unitaji monozaharidice (de
ordinul sutelor sau miilor), pe care le pot elibera prin hidrolizS. Polizaharidele
cele mai rhspandite in regnul vegetal sunt amidonul i celuloza, iar in regnul
animal, glicpgenul.
294
VTL1.1. MONOZAHARIDELE Stereoizomeria monozaharidelor
Compuii care au aceeai formula structural# dar clifera prin configurajia
spajial# sunt stereoizomeri. Stereoizomerii aparuji' ca urmare a prezenjei in
molecul# a.-unui atom de carbon asimetric (C* - carbon ale card covalence
sunt satisf&cute cu patru substituenji diferiji) sunt stereoizomeri optic activi.
Num&rul de stereoizomeri posibiii ai umii compus conjinand n carboni
asimetrici este egal cu T; Toate monohazaridde (cu excepfia cetotriozei,
respectjv..dihidroxiacetona) confin in rnolecul# atomi de carbon asimetrici,
fiind optic active. Prezenja unui C* tntr-o molecule face ca aceasta s# poatii
exista in don# configurafii diferite, nesuperpozabile, comport&ndu-se una
fajd de alta ca obiectul i imaginea sa in oglind#, ca mana dreapte faj# de
cea slang#, Moleculele ozelor sunt deci molecule chirale (chiros - man#)
avand ca centra chiralic, de asimetrie, unul sau mai mulfi atomi dFclirbon
asimetrici.
Cea mai simple aldozil, aldotrioza (gliceraidehida), avand un singur
carbon asimetric, se prezint# sub forma a doi stereoizomeri optic activi care
se deosebesc intre ei exclusiv prin sensul in care rotesc planul luminii
polarizate (au aceleai propriety fizice i chimice). Aceti doi stereoizomeri
optic activi poartft numele de enantiomeri i se gfisesc unul faj# de celSlalt
ca obiectul fa{a de imaginea sa in oglinde, Prin convenfie, cei doi
stereoizomeri ai gliceraldehidei au fost desemnaji D i L. Configurafia
absolute a celor patru subsdtuienji ai carbonului asimetric, stability prin
studii de difracjre a razelor X, este redat# prin foimulele de perspective i
plane:

D - giiceraldehida
L - gliceraldehida
295

2>
i
confinfmd doud centre de chiralitate. (doi atomi de carbon asimetrici)* se
prezint# sub forma a 22 (patru) stereoizomeri optic activi care formeazd
(loud perechi . de enantiomeri (I i II):
CHO
CHO
CHO
CHO
r
I
i
|
I
i
H C
HO
C
HO
H
OH
-CH
OH

C
I
l
l
H|
H C
-CH
C
C
HOHO
H
OH I
|
H|
OH |
i
CH2O
CH2
CH2OH
CH2OH
H
OH
Aldopentozele confin trei. atomi de carbon asimetrici ,_gi deci se prezint#
sub forma a 23 (opt) stereoizomeri optic activi grupaji in patru perechi de
enantiomeri. Similar, exist# 16 aldohexoze siereoizomere grupate in opt
perechi de enantiomeri.
Aa cum s-a mai ardtat, stereoizomerii care difer# tntre ei prin
configuratia tuturor atomilor de carboiL^asimetdci... sunt.^nandon^ri. in
timp ce aceia care difer# prin configurafia a unu, maximum ;n T^afonf'Tsimetnci (din totalul de n C*), sunt diastereoizomgn.
Diastereoizomerii care diferd prin configurafia unui singur atom de caiton
asSrietric se numesc egim^g. Schimbarea configurafiei unui C* se numejte
epimerizare.
Enantiomerii se deosebesc inire ei exclusiv prin sensul de rotafie a
planulu; lumuiii polarizate, unghiul de rotafie fiind acelai. Amestecul
echimolecular al celor doi
CHO
HCOH
CH2OH

D - Gliceraidehida

CHO HO-C-H HQpH


CH2OH

D - Treoza
CfHO HCOH HQOH H(fOH CH2OH D - Riboza

Aloza
CHO HOCH HCOH HCOH HCOH CH2OH D -AltrozS
CHO
CHO
CHO

HQ~C~H
HQOH
HCpH

HCOH
HOCH
HCOH

HOCH
HOC{H
HCOH

CH2OH

CH2OH

CH2OH

DArabinoza

D-XHoza

D-L
ixoza

/\

/\

/\

CHO HCOH HCOH HOCH HCOH CH2OH D - Guloza


CHO HOCH HCOH HOCH HCOH CH2OH D- Idoza

CH2OH D - Gatactoza
CH2OH D - TaJoza
Fig. Vil. 1 - Seria D a aldozeior
296
-4
CH2OH
c=o
CH2OH

Dihidroxiacetoni
CH2OH

c*o
HCOH CH2OH D- Eritruloza

<f.H2OH C o
HCOH
HCfQH
CH2OH
D- Ribuloza

c-o
HCOH
HCfOH
HCOH
CH2OH
D
Psicoza

CH2OH
C"o
HOCH
HOH
HCOH
CH2OH
D~
Fructoza

CH2OH

CH2OH

c=o .
HCOH
H0(fH
HCOH

C s? O
HOCH
HOCH
HCOH

CH2OH

CH2OH

CH2OH

DDSorboza Tagatoza
Fig.. VII. 2 - Seria D a cetozelor
enantiomeri, dextrogir t levogir, constituie un racemic. Sinteza organic^ dS
natere ia racemici, optic inactivi, in (imp ce natura sintetizeazd nurnai unul
sau altui dintre enantiomeri, grajie stereospecificitilfii enzimelor implicate in
sinteza,
Diastereoizomerii se deosebesc intre ei prin propriet&file chimice i fizice,
precum i prin valoarea unghiului sau sensul de rota{ie a planului luminii
polarizate.
Din motive de sistematizare, compuii optic activi s-au imp^rjit in doud
serii sterice, D i L, dupd inrudirea configurajionali cu un compus de referinpl.
care este gliceraldehida (vezi i aminoacizii). Se consider^ c&
monozaharidele avand configuratia atpm.ylni..de^aito
dej^moam^
aparfin seriei_ sterice D, iar cele avand configurafia aceluiai atom de
caftonTlenHcd cu cea a carbonuiui din L-gliceraldehidS aparfin seriei sterice
L. In Fig, VII. 1 i Fig. VII.2 sunt redate structurile stereoizomeriior aldozelor i
cetozelor aparfinand seriilor D.
297
5~
Nu toji stereoizomerii posibili se gasesc In nature. Cele mai rftspandite i
importante din punct de vedere biologic sunt aldozele D-ribozff, D-glucozS.
D-galactozU i I> manozll i cetozele D;:rihu]pzfi i D-fructozd (numele
cetozelor se formeazS in general inserand sufixul uiu in numele aldozei
corespunzatoare). In natura se gasesc i zaharuri aparfinand seriei L, cele
mai importante i rdspandite fiind L-fucoza i L-sorboza, De subliniat cd
apartenenfa la seria D sau L nu exprimS sensul de rotate a planului luminii
polarizate de c&tre zah&rui respectiv, ci se refers la configurafia absolute a
atomului de C* cel mai depdrtat de gruparea carbonil Din acest motiv este
necesar ca, pe langii convenfia de simbolizare D sau L, s3 se noteze i sensul
de rotafie prin + sau Un compus aparjinSnd seriei D poate fi levogir D (~)
sau dextrogir D (+). Evident, fiecare ozd aparfinand seriei D ti aflii

enantiomerul in seria L, Ozele confinand acelai numar de atomi de carbon i


aparfinand aceleiai serii sterice (D sau L) se g&sesc intre ele In relafie de
diastereoizomerie.

In moleeulele nionozaharidelor exist# grupari funcjionale care, In pozijii


sterice convenabile, pot s# interacfioneze. Astfel, gruparea carbonil poate fi
aJacat#_ nuclepfil de c&tre gruparile ~QEL(prin eleclronii nepaiticipanfi ai
oxigemihii) din pozitiile 4,5. sau 6cu formarea unui compus de._adi.fie
intramolecular# denumit semiacetal sau seniicefol intern; reamintim c#
produsul de adifie a unui alcool la un compus carbonilic se numegte
semiacetal in cazul aldehidelor i semicetal In cazul cetonelor:
o
ii
R CH(R) + R'OH
Gruparea hidroxil, aparutd la fostul carbon carbonilic, poart# numele de
hidroxil semiacelalic sau glicozidic i se deosebejle ca reactivate de celelalle,
Reacfiile de formare a semiacetalilor pentru aldoze i cetoze pot fi
schematizate;
OR
i
CH(R)
OH
HO
CH,OH
i CH2OH
r/
\
i
i.
HC . |
C=0
c
I XH
I
I
1
(CHOH 5=*= (CHOH) 0 ;
-~
) :
ij
(CHOH)n (CHOH),
I
1
CHOH HC -------1
CHOH
1
I
1
HC
CH2OH
1
1
CH2OH

CH^OH CH?OH
298
.Semiac^laliL^alfimi se iormeazh' cu participarea unei gmpflri -OH situate
intr-o
pozi|ic relativE,fatS...dc carbonileare..SilDemilt|^|m.......samjase
atomi (i nu mai mic sau mai mare), intrucat aces tea sunt favorizate din
punct de^ed&m engrfetic prin
In cazul ciclurilor de cinci atomi unghiurile pentagonului sunt foarte
apropiate de cele pe care le fac carbonul 1 oxigenuJ hibridizaji sp3 (108 fa$
de 1092jQ. In. cazul ciclurilor de ase, atomii nu sunt coplanari, generand
conformed, jpaijg sau scayri, in care unghiurile sunt de(l09^)
Structurile ciclice se formeazh in cazul aldohexozelor prin participarea
carbonilor 1 i 4 sau 1 i 5, iar in cazul cetohexozelor cu participarea
carbonilor 2 \ 5 sau 2 i 6. Structurile mongzahatildox continand numesc

furanozice (prin
analogic, cu heterociclul furan) in tiinp ce acelea conjinand ciclpri de sase
atomi se numesc piranorice^(prin analogic cu heterociclul piran).
r
GHO
CHOH
CH0OH
CH2OH
!" '
|
I
1
I
1
CHOH
CHOH
C-0
COH
I
10
1
i
CHOH
CHOH
CHOH
CHOH
i
i
1o
-CHOH
CH---CHOH
CHOH
11 1
|
a
Ho
1
l
1
1
/
CHOH .
CHOH
CHOH
CH-------}
I
1
1
i
1
CH2OH
CH2OH
CH2OH
CH2OH
fur
str.
cetohexo str.
an
aidohaxozS
furanozica
za
furanozica
piran
CHOH
I
CHOH
I.
CHOH
O
I
CHOH
i '
CH-----------------------1
I
CH2OH str. piranozica
CH2OH
1/i COH
I
CHOH
I
CHOH 0
I ' '
CHOH
CH2- - - -:1
str. piranozica
299
Structurile piranozice sunt mai stabile. In. solute decat cele ftrangzjce,
care se intalnesc, mai ales, in combinajii ale ozelor,
Ca urmare a reaqiei de ciclizare piin seniiaceXalizare, fostul carbon
carbonilic devine carbon asimelric putand sfi adopte douft configurajii sterice
diferite. Apar doi stereoizo- meri supranumerari numijiCgnorne^, in care

1X

i
-o
I
o

atomul de carbon care leagS gruparea -OH semiacetallcF^oaTe avea dou&


configurajii diferite* (anomer a i (3). Anomerii a se figureaza in formulele
ciclice de proiecfie cu gruparea -.OH... seJ&SQ.e|.alic& de aceiasi garte a
catenei de carbon ca i oxigenul din ciclu, spre deosebire de anomerii (3.
Cele doiul forme anomere pot trece una in cealaltd prin intermediul formei
aciclice care, in solujie apoasd, este prezentS in cantMfi minime. Fonnele
piranozice i furanozice (a i (3) ale glucozei (a) i fructozei (b) sunt
reprezentate in Fig. VII 3.
De menjionat c<1 cei doi anomeri diferS intre ei prin propriet&Jile chimice
i fizice ca 1 prin valoarea unghiului de rotajie.
Toate considerable de mai sus.cu privire la structura ozelor indreptftjesc
definirea lor mai degrabB ca poliliidroxisemiacetali, respectiv
polihidroxisemicetali, i nu ca polihidroxialdehide sau polihidroxicetone.
Formulele ciclice de proiecfie utilizate, cu tot avantajul claritBfii i
simplitftjii, nu Jin seama de relajiile sterice dintre atomii sau grupele de atomi
din moleculB,
Hgwgrth) utilizeazS structuri ciclice care Jin seama de distanjele
interatomice objinute pe diagramele de diiracjie a razelor X. in reprezentarea
Haworth, ciclurile furanozice i piranozice sunt imaginate ca poiigoane
regulate perpendiculare pe planul hartiei Laturile poligonului apropiate de
privitor se reprezintB adesea prin linii ingrogate. In general, formulele
Haworth se scriu astfel incat oxigenul s& fie situat in spatele planului hartiei.
Substituenjii care se gSsesc in formulele de proiecjie in dreapta se figureazft
in formulele Haworth sub planul ciclului, iar cele din stanga deasupra
planului. Pentru a deduce formula Haworth a unei oze - de exemplu a Dglucozei din formula sa de proiecjie se opereazB trei modificari ale locurilor
pe care le dejin in molecuLl cei trei substituenii de la carbonui 5. Se inchide
ciclul semiaceMie intre guparea OILdeJaX^ si gruparea aldehidica de la C,
obfinandu-se formula III care se scrie apoi conform convenjiei Haworth:
H
o
r
\#
_
C
H
c - OH
|
1
H
OH
H
c - OH
C
c
H
HO
- -H

1
-
1
OH
H
c - OH
1
Hj C 7
OH
HOH2C c - OH
fl)

^ CH2OH
O
300
HO H

v
C
H-C-OH
HO-C-H C !
H~C------s
H-C-OH
!
CH2OH

P glucofuranozS
HO H
v
C----------H-C-OH i
HO-C-H O
I
H-C-OH
1
H- C-----CH2OH
p - glucopiranoza

CHO
i
H-C-OH
\
HO-C-H
i
H-C-OH
l
H-C-OH
1
CH2OH

glucoza
a)
AT'
H-COH
H-C-OH
I
HO-C-H
1
H~C----l

H-C- OH
\
CH,OH
(X- giucofuranoza

CHgOH
(X - glucopiranoza
CH2OH
HOK 1 N0_ i
HO-C-H
1
O
H-C- OH j
H-CCH2OH

p- fructofuranoza
HO
HO'
HHCH2OH
0 1
C-H
C~
I
CH
OH
OH
p- fructopiranoza

CH2OH

I
c**o
I
HO-C-H
I
H-C-OH
i
H-C-OH
!
CH2OH
fructoza

CH2OH I .0# CHO-C-H


\
H-C~OH
i
-----------CH?OH
CC fructofuranoza
CH2OH I .Ort
c-- - HO-C-H
I
H-C-OH
1
H-C-OH
I
CH,------X- fructopiranoza
Fig. VIL-3 - Structuriie ciciice ale giucozei (a) i fructozei (b)
301

Structurile Haworth pentru anomerii a i p ai glucopiranozei,


galactopiranozei i fructofuranozei se reprezinta astfel:
CH2OH

CH2OH

CH2OH

a-D-fructofuranoza

Fig. VII. 4 - Conformafis scaun a unel piranoze


CH2OH

(3-D-fructofuranoza
Fqrmulele Haworth au a van lajul*. iajiiikxefe de?"ptbieeJIeV dc? 'pdsfra
indmduahtatea atunci cand sunt
unghi. De remarcat cS formulele Haworth prezlnta cicluriie ca fiind plane.
Aceasta este relativ cored pentru. ciclul furanozic degi studiile de difrac|ie a
razelor X efectuate pe fructofuranozS au demonstrat c3 patru din cei cinci
atomi ai ciclului sunt in acelasi plan, in timp ce al cincilea iese din plan cu
0,05 nm.
Cicluriie piranozice pot adopta, ca gi ciclo- hexanul, conformajii f&rS
tensiune corespun- zand conformerilor' baie sau scaun. Studiile cu raze X au
demonstrat ca cicluriie de ase, conjinand un atom de oxigen, se gilsesc
exclusiv in conformajie scaun (Fig. VIL4).
302
-JO

Aminozaharuri
Inlocuirea in molecula unejLozfi-a unei .gmp2i:U)idj:Qxi],cu o
gmpm^miEaJa nagtere la arninozaharuri. Cele mai importante aminozaharuri
sunt jlucozamina, galactozarmna, i manozamina. compusi care se gSsesc in
structura gligppro^n^r/f^ofcoghcanilor si' mai departe).
In proteogiicani se gasesc cu precMere sub forma N-acetilatft sau Nsulfatatfi:
CH2OH
CH2OH

CH2OH

CH2OH

NH S03H
cc-N-acetil-galactozamina
N-sutfatul-galaetozaminei
Prin condensarea unei molecule de manozamiml cu 0 molecula de acid
piruvic rezultft acidul neuraminic:
H
COO

C=0
H
t
I
H2
1
N
C
G-0

H|
|
HO C
CH2

H + | CH? CO COOH 1
H
C
1
H
C

OH
H
OH I

j
C
OH |
CH2O
H

H2N
HO
H
H

C
Hj
C
H
i
C
OH
C
OH
|
CH2O
H

303
-II-

; !r

\u :'S>.
H:
i-
*:
i'jil
CC
i: j

Acilarea acidului neuraminic d<1 natere ia N-acilderivaJi denumiji acizi


siaiici. Daca resiul acil este un rest acetil rezuM acidui N-acetil neuraminic
(NANA), constituent. principal al glicoproteinelor:
COOH
I
l---------------- C OH

I
CH2
0
I
.
u
H C GH
I
H,N C H
i
1
-------- C H
!
H C OH
I
H C OH
I
CH2OH

acid neuraminic
Dezoxizaharuri
Inlocuirea unei grupari hidrox.il din molecuia unei oze cu un atom
dejridrogen da natere la dezoxizaharuri. Un dezoxizahar important este 2dezoxiriboza, components glucidicft din structura acizilor dezoxiribonucleici
(vezi acizii nucleici).
Un alt dezoxizahar important, provenitdin galaciozl i anume 6-dezoxi-(5L-galactozi1 sau (i-L-fucoza, este prezent, aiaturi de acidui sialic, in structura
glicoproteinelor:
CHO
I
HO C H H C OH
I
H C OH
I
HO C H
I
CH3
L-fucoza
p-L-fucoza

acid N-acetil-neuraminic (NANA)


304
- M~

PROPRIETAjlLE FIZICE 1 CHIMICE ALE MONOZAHARIDELOR


Monozaharidele sunt sufestanfe solide, cristaiizate, solubile in solventi
polar! grade
num^iruIuFmai'e'ae grup1ri . . .
Ptezen{a ~gnip^ > C = 6 i - OH in moleeula ozelor le confer^ o
reactivitate chimicd deosebitft, exprimatft in multitudinea de reacfii pc care
le prezinta.
in solute, diversele forme ciclice,...:e.oexisl:ft cu forma, aciclicfl. chiar
dac& aceasta din urmfi nu dep<1ete 0,02%, fn prezenfa unui reactant
specific grupSrii > C = O echilibrul s^fo QfcJtceasta se; cotisumain reacfie
asffellndH
iolreaga cantibUedcoztl va reactions ca un campus-carbonilic. In prezcnta
unor reactanti
glieozidic oza va reactiona suL formS ciclici Propriedjile chimice ale ozelor,
avand interes pentru debrmmareaTor cantitativd. i calitativli in diverse niedii
biologice, nu vor fi prezentate. Vom menfiona aici exclusiv pe acelea
semnificative pentru transformSrile lor metabolice. Se vor alege formele
ciclice sau aciclice, funcjie de participarea efectivfl la reacjie a uneia sau
altcia dintre de.
1. Red.ucerea_monozahmdelor d5 natere la polialcooiii corespunzStori.
In organism, reacjia este catalizatfl de enzime NADH sau NADPH dependente.
D-glucoza se reduce la D-glucitol (D^orbltoTJTTar' fructoza d3 natefela do!
polioii diastereoizomeri: D- sorbitol i D-manilol:
CHO
CH2OH
CH2OH
CH2OH
|
I
H
Lo
C OH
H G OH
HO C-H

H
O
H
H
CH
O - Q-H
O -Q-H
HO C-H
1 -A
| <
1
A
1
H C OH
H C OH H C H
C OH

OH
C
H
C OH
H C OH H
OH H

1
1
C OH |
CH2OH
CH2OH
CH2OH
CH2OH
Dfructoz
D- giucoza
D-sorbitol
a
D-mariitol
In diabetul zaharat se formeazS mail cantitdji de sorbitol, prin excelenpt in
retiml, ceea ce contribute la instalarea refinopatid diabetice.
2. Oxidarea ozelor poale decurge fie la gruparea carbonii, cand se obfin
acizi aldonici, fie la gruparea alcool primar, cftnd se obfin acizi uronici.
Oxidarca glucozei, sub forms de ester glucozo-6-fosforic la add 6-fosfoglueonic este o reacjie catalizatft enzimatic cu care debuleazii o cale de
metabolizare a glucozei avand ca scop
objinerea de pentoze (vezi $untul pentozelor). Ca acceptor de

hidrogen funcfioneazd. NADPL


CHO
|
H C OH

CH2

305
-13f
3..
" ;
3

OPO3H2

H2OS NADP4
. (NADPH -r H+*

X
i
0
1
o
X

HO C H
1
H __ C OH
1
H C OH
j

COOH :!
|
H C OH
i
H C OH
1
H C OH
!
'1
;;
acid-6-fosfo-giuconic
CH2OPO3H2

Oxidarea energies a grupSrii alcooi primar duce la acid glucuronic i


reprezinUS o reaefie important^ utilizatS in procesele de detoxifiere sau in
sinteza unor proteoglieani. ce con fin in structura lor acid glucuronic (vezi
calea acizilor uronici).
3.
Condensarea cu compui c-ontinSrid grupftri amino dS
natere la compugi de tip baza Schiff, Interacfiunea glucozei cu grupSrile
amino ale unor proteine este responsabilS de form area in organism a
proteinelor glicozilate. Gradul de giicozilare a unor proteine, cum ar fi
hemoglobina, constituie un test de apreciere a cantitSfii de glucozS din
sange.
Se considers cS in hemoglobins grupSrile amino ale valinei terminale de
pe lanfurile (3 sunt glicozilate conform reaefiilor:
H3C CH3

CH
H3C

CH
I

+ H2N

valina
N

termin
als

'
HO
^H

C
H
1
1
C
H

CH,

CH =
N
1
i
c

OH 1
1
C~~
HI
1
C
OH
X
O
1

H3C

NH
1

Amadori

HO

CH2

transpozi
jie

CH
l
i
O
0
1

HC
|
i
H C
H1
1
HC
H i
1
HC
H |
i
CH2mH

CH3

CHgO
H

CO

C-01
1
CH
i
C
OH
1
X
0
1
o

H
CH2OH
Alterarea, prin giicozilare, a unor proteine in diabetul zaharat este
incriminatS in nefropatia, neuropatia, retinopatia diabetics.
4. Esterificarea ozelor cu acid fosforic reprezintS o etapS importantS in
insSi menjinerea ozelor in celulS ca i in metabolizarea lor ulterioarS. Printre
esterii fosforici ai ozelor menjion&m glucozo-6-fosfat.ul fruidozo-^ fnicto
(se
utilizeazS prefixul bis\ pentru desemnarea diesterilor fosforici).
306
CH2QPO3H2

a-gtucozo-6-fosfat
a-fructozo-6-fosfat

a-fructozo-1,6-bisfosfat
5. Formarea gUcozkldor. Gruparea -OH seiniacetaiic& poate forma oxigeneteri cu alji compugi care confin o gmpare-QH (de ex. cu alcooli). Compugii
formaji se numesc glicozide: giicozidele glucozei sunt glucozide, ale
galactozei-galactozide etc. Glicozidele se pot prezenta fie sub forma
anomerului a, fie a ceiui {3. Cele dou& forme anomere ale metil
-glucopiranozidului sunt:
CH2OH

CH2OH

Dadi eterificarea se face cu gruparea -OH a altei oze se objin oligo- i


polizaharidele (vezi mai departe),
Legarea unei componente neglucidice, desemnat&cii termenul general de
aglicon, duce la oxigen-, azot-, sulf-, glicozide. De exemplu, nucleozidele
sunt, a$a cum s-a arfttat, N- giicozide in care componenta monozaharidica
este D-ribo- sau D-dezoxiribofuranoza iar aglicouul este o baz& azotatSL
307
/S'
Importante din punct de vedere medical sunt glicozideie cardiotonice care
m ca agUcon compngi steroicjici. Administrate in in.suficienta cardiacs,
glicozidele cardiotonice scad frecvenja gi cresc intensitatea bMilor inimii.
Agliconii liberi (genine) nu numai cd nu suntjrizestr^cu vaioare terageutic&
dar reprezintS chiar otrdvuij.
VII.
1.2. OIJGOZAHARIDELE

Oligozaharidele sunt compusi glucidici rezultati prin condens&rea a dou3


sau mai multor monozaharide (maximum IQV Legilturastability intre
monozaharide este denature glicozMicA,
Cele mai importante si abundente oligozaharide sunt, dizaharidgje.'
Dizaharidele rezuM, formal, prin condensarea a douft molecule de
monozaharid, care se poatejace:
cu participareafambilor hidroxili semkcetalid) rezuJtandidizahaiide
dicru;borHliceg
(nereducStoare): . ........ . _
-----
- cu paidicjparealddrQxihilui semiacetalic al mzilyzfrfii a unui^idroxil
alcoolifijiT) (cdellalt.e 6zB) rezu.lta.nd flizalKinde
iTOnocai^^illce5^TredticArddre).
f------------------- -- -----O --------------- -1
HC
H C
CHOH
I
CHOH O
1
CHOH
I
H c---------I
CH2GH

CHOH
I
CHOH O
I
CHOH
H c---------I
CH2OH
dizaharid
dicarboniiic
H C ~ CHOH
I
CHOH 0 CHOH
I
H C---------I
CH2OH
0
. OH
H C ----1
CHOH
I
CHOH O - CH
I

H C --------I
CH2OH
dizaharid
monocarbonilic
308
ff1'
\l
Dintre dizaharidele diearboniiiee cel mai important este zaharoza
(sucroza), glucid foarte r&spandit In regnul vegetal i anume in trestia de
zahr si xn^ sfecllt, avand o valoare nutritive deosebiUL
.Zaharoza este constituitSi dintr-o molecule de a-giuc6pkanQz..$i una de
$-fTuctofuranozii legate 1 - 2, fiind un a-gIucopinifK)zido-|3~fructofuranozid (leg&tuni
diglicozidicil);
CH/OH
Ov
OH
HO
OH
O
zaharoza
HCH2C

OH
zaharazeil denumirtl i [invertaziU zaharoza,
Prin hidrolizS enzimatidt sub acjiunea. zah&r dextrogir ([a] ^ ~ + 66,5),
formeazS un amestec echimolecular de fructozft levogird# ([a] D = - 92)
sffiglucozji dextrogirgi ([a] jj? = + 52,5), care va roti planul luminii polarizate
spre stSnga. Acest proces de hidrolizS a zaharozei poarth, din acest moliv, i
ntimele de invertire a jfMnjliLi.
Zaharoza nu prezintS proprietdfile ozelor conferite de gruparea
semiacelalich, virtual ear bon il (caracter reduchtor, formare de osazone,
anomerie), intruc&t ambele gruphri sunt angajate in formarea leghturii
glieozidice.
Dintre dizahaiid.de monocarbonilice cele mai impoilante sunt maltoza,
celobiozji i lactoza.
Maliaza^rezulth formal prin eiiminarea apei infre hidroxitul semiaeetalie
al unei
mola:ule^^a-D:glucQX>Eanx)z^i hidroxi 1 ui rliii
D0zitia5.....a alte-i
molecule a-D^
glucopiranozd, fiind o a-glucopiranozido-4-glucopiranozh (legSturS
moooglicozidich):
CH2OH
CH2OH

IVlaitoza
309
if
Maltoza ia nagftere prin hidroliza enzimaticfl a amidonului si glicogenului.
Celobioza este dizaharidul format din douft molecule de B-glucopiranoza
legat.e 1,4 fiincl o g-glucopiianozido-4-glucopiranozfl:

Ceiobioza
Celobioza ia natere prin hidroliza celulozei.
Lactoza rezultft formal prin diminarea, unei molecule de aftjintre
hidroxilul semiacetalic al ft-D-galactopiranozei hidroxilul din pozi(:ia 4
aiumeLmolecule de j3- glucopiranozS, fiind o (3-galacto-piranozido-4gIucopiranoz&
CH20H
CH2OH

Lactoza
Lactoza se g&sete !n iaptele manriferelor care o sintetizeaza din glucoza.
Sub ac|iunea unei|p2gt^tozidaze}esie hidroiizatft la zaharurile componente.
Dizaharidele de tip monocarbonilic prezinfd, desigur, proprietajile ozeior
date de gruparea carbonil (caracter reducfttor, formare de osazone). Intrucat
dispun de un hidroxil semiacetalic liber, virtual carbonil, prexinta, de
asemenea, i fettomenul de anomerie.

VII.
1.3. POLIZAHARIDELE
Polizaharidele sau glicanii sunt compui glucidici care prin hidroliza
chimicd sau &QZmMk& fonneazd monozaharide sau derivaji ai acestora
(glucozamina, galacdozaminA acizi uronici, acid N-acetil - neuraminic).
310
~/<3
Se disting:.

homoglicani - produgi de policondensare a unui singur tip de


unitate_structuraia;
- heteroglicani produgi de policondensare a mai multor tipuri de unitap
structurale.
Dintre homoglicani, polimerii de glucoza (glicani) sunt cei mai r&spandifi,
fiind
reprexentaji de celjilozd, gljcogen, amidon! Se cunosc gi polimeri ai manozei
(manani), arabinozei (arabinani), galacjpzei (galactozani) etc.
Dintre heteroglicani, rmiconol i zahar idele, componente ale
proteoslicanilor (constituite, in general, din molecule de acid hexuronic gi
hexozanime,) gi poliozidele bacteriene sunt cele mai nlspandite.
Glicanii -indeplinesc roluri structurale (celuioza,. poHozidele grezente in
peretele ectoplasmic al bacteriilor gi in eapMmJBlL^^
sau
de depozitare a rezervelor energelice (amidonul, gljcogenul).
In acest capitol se vor face referiri la structura amidonului gi a
glicogenuiui.
Mucopolizaharidele vor fi descrise in capitolul Proteoglicani.
Amidonul este homoglicanul cel mai r&spandit in lumea vegetal!! unde
reprezinta r^empglucidicli.princlp este eonstituit din douft componente:
- amiloza, in care resturile glucozil se leagS prin legAuri a- (L41
-glueozidiee:
CH2OH
CHpH
CH2OH
CH2OH

OH
OH
OH
OH
- aniilopectina, in care resturile glucozil se leagS nu numai prin legaturi ot(M)glucozidice, ci gi prin legaturi q-( 1 AVglucozidice conferind moleculei o
structura
ramificata:

Masa molecular:! a amilpzei variaza de la cateva mil la jumatate de roil


ion. Nu este golubilLin apa, formftnd micelii hidratate care dau cu iodul o
coloratie albastra.
311
Amiloza formeazS structuri helicoidale, pasul helicei cuprinzSnd.4 - 5

rcsturi glucozil
(Fig. viirs).
este soiubil|ji ap3, fonpand solufo coloidale sau micelare care dau cu iodul o
colomtie rosie, Prezenfa ramificajiilor in amilopectinS duce la o molecuia de.
tip, globular, foarte condensajtL.(Fig. VII.6.)
Glicogenul este echivalentul animal al amidonului vegetal, reprezent&id
forma de depcjzitare a excesului de hidrati de carbon. Rezerve semnificative
de glicogen se giisesc in muschi i in ficat. CantitSti mici de glicogen se
gftsesc in (oate- fesuturile, inciusiv in creier. Din punct de vedere al
structurii, glicogenul este asem3n&tor amilopectinei, cu
deosebirea c& glicogenul,. avand on
numjfrm^
leglluri 1.6 y
glucozidkc. este
mai ramifieat. Catenele laterale sunt formate in medie din 10-15 Linitafi de
glucozS, in centrul moleculei int&lnindu-se o ramificafie la 3 - 5 uni^fi de
glacozS. Acest tip de organizare face ca glicogenul sd prezinte o sjructurfl
arborescent^ (Fig. VII.7).
Glicogenul
are,, o gnasd moleculard je
ordinul milioanelor.
formeazil solu|ii
cploidale care cu iodul dau o coloratie brun-ragcattLce nu dispttre la cald.
VIL2. DIGESTIA 1 ABSORBJIA GLUCIDELOR
Glucidele ne parvin din alimentajie sub forms de polizaharide (amiuon,
glicogen, penlozani, celujozg), dizahmde (zaharozd, maltozit, lactoz&) i
monozaliaride (glueozS, fruclozi, galactozii, pentoze) intr-un raport
procentual ce variazd cu varsta. Intrucat singura formS absorbabilil este cea
de monozaharid. este necesar ca polizaharidele i dizaharidele si fie mai intai
hidrolizate la monozaharidele componente in cursul procesului de digeslie.
Digestia amidonului, zaKSrul cel mai bogat: in diets, incepe prin acjiunea
tffmilazei)
i$airvarS)i continue in intestinul^subjire sub acfiunea Ijmilazei pancreatic^.
Ambele tipuri de amilaz.isi incep acjiunea de la periferia moleculei spre
cent.ru, desfftcand exclusiv

Fig. Vii. 5 - Structura helicoidata a amilozei


312
$
$
*
: *

a
#

**
V
*
V
.*
****
S* #
ffif
P*
#*
*
a#*
*
** ***
\~-x
*
<&
*
is,'
Fig. VII. 6 - Structura amiiopectinei

.* .
#

.: i//

* >**
X
r

/
1
/
?
'
1@ 1
L
#< 2
*
*
\
/

V
--V
.*:
*s
0

a4.'

*
% // *u
*!/%
5
*-* * F *
*
#
* 1 5

t
*

Fig. Vli. 7 - Structura glicogenului


313
legdturi 1,4 - glucozidice. Cum legdturile 1,6 ca i cele 1,4 din vecin&tatea
ramificajiiior nu pot fi desfdcute de' cdtre amilazd, produsii de digcstie a
amidonului sub acjiunea' familazellvor fi maltoza i fragmente
oligozaharidice de dimensiuni variabile - dextrine Hnutd. Dextrinele limits
sunt hidrolizate ulterior, sub acjiunea unei hidroiaze, amilo~l,
6-gIucozidaza, la maltozd.
Ceiuloza nu poate fi digerata in tractul digestiv al omului, astfel incut ea
este lipsitd de orice valoare nuti'itivli.
Digestia dizaharidelor, provenite direct din alimentafie sau prin hidroliza
enzimaticd a amidonului, se realizeazd in intestinul subfire sub acjiunea
dizaharidazelor, enzime ce manifests specificitate pentru natura
dizaharidului i a legdturii. glucozidice. Astfel, maltoza este hidrolizatd de
maltazft (ooglucoB^iz^), lactoza de lactazd (p-galactbzidazaA zaharoza de
zaharazd (iFpiooz^^
. Toate aceste enzime sunt
concentrate la nivelul jejunufui i sunt sintetizate de c<1tre enterocite. Eie
acfioneaza la nivelul marginii in perie a enterocitului (i nu in lumenul
intestinal), in vecindtatea sistemului de transport al monozaharidelor
rezultate. De remarcat cd membrana plasmaticd a celuielor epiteliale
intestinale (suprafaja apicald) are o structurd microvilard, ceea ce mdregte
substantial suprafaja aclivd in procesul de digestie i absorbjie a zaharurilor.
Absorbjia monozaharidelor, respectiv a glucozei, fructozei, galactozei,
inanozei ca i a unor pentoze, se realizeazd prin sistemul port hepatic i
implied doiid mecanisme posibile: transports actitt (energodependenO,
contra gradientuiui de concentrajie, $i
difuzia facilitate.
Transportul activ este propriu ozelor cu structurd piranozied avand la;C?
aceea configurajieca a glucozei._s.UaX&' un^grupjp^etiL.Ml^ respectiv
glucozepi gaiadozei
Se presupune cd transportul glucozei in celula intestinald se face cu

participarea unui transporter gi ar fi dependent de prezenja Na* (sistemul


simpprt glucozd-sodiu).
Transportoml leagd la locuii separate atat glucoza cat i Nab Legarea Na+
create afinitatea transportorului pentru monozaharid. Odatd pdtrus in celula
epiteliale intestinald prin membrana apicald (absorbtivd), la concenlrajii mici
de sodiu, acesta este eliberat i odatd cu el i glucoza. Glucoza iese din
celuld prin difuzie facilitate, mediatd de un transporter prezent in membrana
bazald, iar Na+ este expulzat contra gradientuiui de concentrate prin
intervenjia ATP-azei Na+, K+ dependente (Fig. VII.8). Activitatea acestei
enzime, situatd In membrana bazald, permite menjinerea gradientuiui de
concentrajie a Na+ i deci reinedrearea transportorului cu glucoza. Pentru
acest mecanism de transport al glucozei pledeazd faptul cd transportul
acesteia.,este inhibat prin(61iabain2p cunoscut inhibitor al pompei de sodiu.
Considerate anterior a fi transportatd prin difuzie facilitate, s-ar pdrea cd
i fructoza recurge la un carrier, diferit insd de cel al glucozei.
Uncle constatdri experimentale contrazic mecanismele de absorbjie
propose care nu par, in forma actuald, incontesiabile.
314
Lumen intestinal - Epiteliu intestinal
Capiiare

ATP- aza
Fig. Vii. 8 - Transports glucozei prin mucoasa intestinal#
VII,2.1. DEFICITE ENZIMATICE IN DIGESTIA 1 ABSORB JIA GLUCIDELOR
Exist# anumite anomalii in digeslia dizahatidelpr, determinate de deficitul
enzimatic fal dizaharidazeiorjcare due la intolerant# la dizahjtride. Deficitul
de lactazd duce la intoleranjd la lactoz#, cel de zaharazd la intolerant# la
zaharozd. Semnele clinice ale intolerance! la dizaharide sunt eomune i se
exprim# prin/ybureri _abdominale^^iaree gmicd^jflaUile^i, -Acumuiarea in
intestin a dizaharidelor, compusi osmotic activL create presiunea osmotic# i
favorizeaza intrarea apei din spafiile interslijiale in lumenul intestinal ducand
la pierderi digestive de apd. Procesele fermentative declansate.deJlQm
microbian# genereaz# produgi care iritd mucoasaJnjjas.tmal4. (de ex. acid
lactic); in extremis, aceasta devine permeabild la dizaharide, care se vor
elimina prin urind.

De menjionat c# deficienja de lactazd poate fi mogtenitd, situajie in


carTse manifest# imediat dupa natere, sau se poate datora scaderii in limp
a activitajii enzimatice.
Deficitul de dizaharidaze poate fi secundar unor boll
ca^enteriteJicolite^prue. Se cunoaste si un deficit de trehalaz#, evidential
strict dupa ineestia de ciuperci tinere (unica sursd. de jrehalozdi.
315
VII. 3. CAILE DE METABOLIZARE A GLUCOZEI
Glucoza indeplinete in organism roluri metabolice multiple care o fac
indispensabila. Pe langft faptul cd reprezintS un combustibUj&xcelent
peiitojesutm (quasi-exclusiv pentru jesuturile glucodependente), glucoza mai
este n^cesj^ important) cum nr fi:
fi Y acizi uronici - pentru sinteza de protgoglipaoi i dBAijMSVMliJI
3mBmlldei0L sau exogenip
glicerol si acetil-CoA utilizate in procesul de neolipagsiiez^; '
- NADPH - necesar biosintezelor reducbve;
Utilizarea glucozei drept sursd de energie necesibl parcurgerea glicolizei
(dejp;adarea,., incomplete, panii la lactat sau piruvat^ji a ciclului Krebs
(degradarea compjetfl, pan& la CO?), Prin parcurgerea glicolizei se objin, de
asemenea, elementul.de conslructie a acizilor grai (a^etilrCoA) i gLiceroluL
Pentoze i NADPH se obfin in cursul desf3ur$rii cgii 6fosfo~gluconat, iar
acizi uronici in aa-zisa cale a^giucoronatului.
hidrocarbonat al acestora (a-cetoacizii rezultaji in ciclul Krebs).
Angajarea glucozei in una sau alta. dintre cSile metabolice posibile va fi
decisd de starea metabolic!! a Jesutului respectiv. In faza anabolidi,
caracterizatil prin abundenjft de substrate energogene, rezultat al absorbjiei
postprandiale, glucoza va fi transformant in piruvat i apoi oxidate terminal
in ciclul Krebs, in vederea asigunlrii resurselor energetice ale organismului.
Utilizarea glucozei drept combustibil energogen este permisft in faza
anabolic^ oricdrui Jesut, ala! celor glucodependente, cat i celor
glucoindependente (insulinodependente).
Cu precMere in ficat, dar i in alte jesuturi, variind cu specia, glicoliza se
poate desfa^ura exclusiv in vederea objinerii elernentelor de construcjie a
triglicerideior care vor fi depozitate in Jesutul adipos. Transfomiarea glucozei
in triacilgliceroli, fosfolipide, i colesterol are loc atunci cand posibilitfijile
ficatului de a stoca glucoza sub formal de glicogen au fost depute (2-3 ore
postprandial).
In faza catabolict - in perioade interprandiale sau in cursul unei
hiperactivitciji fizice sau intelectuale - glucoza nu mai reprezintS.
combastibilul principal decat. pentru jesuturile glucodependente, care o objin
prin glicogenolizd i gluconeogenezd hepatica. SursS de energie pentru
celelalte jesuturi devin rezervele de lipide constituite in fazfl anabolics i, in
extremis, proteinele.
Metabolizarea glucozei prin oricare dinlre caile enumerate este precedata,
cu obligativitate, de^fosforilare, condijie necesarft ramanerii ei in celuld. intradevSr,
i) - pentoze - utilizate In sinteza nucleotidelor i a acizilor nucleici;
Sinteza de aminoacizi se realizeazft prin

316
graparea fosfat, putemic ionizatii la pH~fizioiogic, conferd molecule! de
glucozo-6-fosfat o incdrcare net&jiegativli i anse minime de a strSbate
membrana celuiara,
Basforilarea glucozei, in prezen|a(^E^xaJaaator.de.-gnipai^^slatfl este o
reaejie ireyersibild catalizatS de;'bexpkiMz;'i
C
H
CHO
O
j
1
i
1
H C OH
H
C
OH

l
1
H
C H
HO
c
O
H
1

Mg2*
i
H C OH -f ATP
H
c OH
1
+
Jill
i
hexokinaze
H
H
c OH
C OH 1

1
CH2OPO3
CH2OH

H2

jfitexokinazei^ diverseior fesufuri sunt enzime alosterice ce se prezintd


sub forma mai multor specii moieculare, majoritatea avand rmc'^peniru
glucozd (prin excelenjd, izoenzima din order). Ele sunt inhibate alosteric,
temporal* i reversibil, ia coneentrajil man ale glucozp-WosfetuIui, produsul
acfiunii lor. Dacd necesitajile celuiei ia un moment dat impun inhibarea uneia
dintre cdile de metabolizare a glucozei, acumularea temporary de giucozo-6fosfat in eeluid va opri fosforilarea glucozei pana ce aceasta va fi consumaia,
evifandu-se sechestrarea inutild a fosfatului in celula. Jiexokinazele sunt
inhibate \ de acizii graph Scdderea captarii glucozei in condifiile unei
concentrajii intracelulare mari de acizi grai poate fi explicat'd prin prisma
acestei constatdri.
In float, are ioc, de asemenea, fosforilarea glucozei sub acfiunea unei
hexokinaze, desemnatd drept ^xoBnaS'^|J)sau ,(|lu'coBn5z|k izoenzima
majord din ficat^ Spre deosebire de alte hexokinaze, care pot utiliza drept
suBsCuTii al^fextizA^ucokinaza utilizeazS. exclusiv glucoza. Deosebirea
fundamental^ fajd de acestea o constituie insd diferenja valorilor pentru
glucozd. In limp ce hexokinazele altor fesuturi au un KM mic (-0,1 inM) deci
afinitate mare penlru glucozd, glucokinaza are un KM mare (-10 mM). Valorile
mici ale KM permit hexokinazelor sit lucreze la Vlmx i sil asigure necesarul de
glucozd pentru jesuturi chiar la concentrajii mici ale acesteia in sange, ceea
ce este esenjial pentru Jesuturiie glucodependente. Glucokinaza hepaticd
este activd numai in condijiile unui aport rnasiv de glucozd (valori peste 5
mM ale glicemiei) care, depdind nevoile de moment ale organismului, fi

depusd, dupd conversia la glucozo-6-fosfat, ca glicogen. La concentrajii mari


de glucoza (de ex. postprandial) o hexokinazd hepaticd oarecare ar fi
incapahild sd asigure fosforilarea glucozei in ritmul impus de necesitajile
restabilirii glicemiei, intrucat ea este saturatd chiar la concentrajii-fiziologice
de glucozd.
Cum viteza de fosforilare a glucozei sub acjiunea glucokinazei create pe
masura ce concentrajia intracelulard a acesteia create, glucokinaza poate fi
considerate o enzima potrivitd la locul potrivit.
Prezenja glucokinazei in ficat asigurd acestuia un rol central in reglarca
captdrii glucozei i menjinerea glicemiei. Fiintl o enzimd inductibild,
transcrierea genei sale este
317
'io
activatd de insulind, unui aporl glucidic substantial ii corespund, evident,
cantitdji maxi de enzimd in ficat i posihilitatea. restabilirii prompte a
giicemiei. De^ijpreluarea glucozei de cdtr^Cjelulele^piirenchiinuJui hepatic
nu este lQsulmo-dependentd, scMerea activitdtii glucokinazei in
diahetjustified, aldturi de perturbarea depuneru $x ufxlxzdrix glucozei (vezi
reglarea glicogenosxntezei 1 glicohzei), ingaji^
De menjionat cd glucokinaza, spre deosebire de alte hexokinaze. nu este
inhibatd de glucoz^64Qsfat; activitatea ei este controlata insd de esjerii
fostolci ai Jructozei: fmctozo-6-ibsfatul i fnictozo-1 -fosfatul cel_ diiitai
comporting
iar cel
de_al_doilea ca activator al sdm. Acftunea acestor efectori alosterici este
mediate de o proteind 3ispusd sd se lege la glucokinazd i sd o inhibe; la
concenlrajii rnari de fmctozo-6-fosfat acesta se leagd la proteind inducand o
modificare conformajionald favorabild legdrii sale la glucokinazd in timp ce
legarea fructozo-1 -fosfatului are efect invers, enzima rdmanand activd.
Stimularea glucokinazei prin fructozo-l-fosfat, provenit din aportul de
zaharozd, sugcreaza..dependen|a actly.itd.iii enzimei de starea nutritionald i
oferd o explicate rolului aterogen al excesului
L
VII.3.L GLICOLIZA (SECVENJA EMBDEN - MEYERHOF - PARNAS)
Funcjia major# a glucozei in organism este aceea de a servi drept sursd
de energie metabolicd. Eli'berarea energiei incorporate in molecula de
glucozd se reaiizeazd fie parfial, prin degradarea sa la piruvat, fie total, prin
oxidare la fco2.
Oxidarea glucozei pana la piruvat presupune parcurgerea glicolizei - caie
metabolicd elucidatd de cdu*e Embden, Meyerhof i Parnas. Pinxvatul
rezultat in glicolizd este oxidat in continuare paxid la C02 prin antrenarea sa
in ciclul Krebs, in condijiile in cai*e {esuturile dispun de oxigen sau este
redus la lactat, in condi Jiile in care aportul de oxigen este sedzut.
Desfdurarea glicolizei, proces putemic exergonic. (AG0 =-47 kcal/mol) se
rpalizeazd in.-jscopul procurdrii ATP. In condijiile unei disponibilitdti crescute
de glucozd
(postprandial) toate Jesuturile, inclusiv cele insulino-dependenfe (fesutul
.........................................................................................adipos,
xnuchiul), vox; utiliza glucoza in vederea obtinerii resurselor enersetice.
In ficat i alte tesuturi, glicoliza reprezintd gi modaiitalea metabolicd de
transform are a glucozei, oferitd in cantitdji rnari postprandial, in lipide de

rezervjL respectiv iriglfoeride, formd ideaid de depozitare a energiei la care


se va face ape! in condijiile in care concentrajia glucozei in sange este
redusd. Glicoliza furnizeaz# a tat components glicerol a trigiiceridelor cat i
elementul de construcjie a acjyz^ acetifoCoA)(vezi melabolismul lipidelor).
De menjionat; cd ficaiu j_utilizeazd components ghcerol (ca.. glicerolfosfot) i
in vederea ob|inerii fosfolipidelor, iar componenta acetil-CoA i in scopul
sintezei colesterolului. Aceti compui de naturd lipidied -vor fi exportaji
Jesuturilor extrahepatice, cu preeddere Jesutului adipos, sub formd de
lipoproteine.
Secventa glicoliticd se desfdoard in^Gitosal i presupune urmdtoarele
transformdri enzimatic catalizate:
318
n /'
(K Ko
\ 1 .A^onversia giucozo-6-fosfatului la fructozo*6-fosfat. Izomerizarea aglucopirajiozo-6- Tosfatului la p-fructofuranozO6~fos*faF s~7ealizeazi sub
acfiunea g;fucQzo~6~ro$Pn"\ cTzomeraze#. Enzima realizeazft izomerizarea
odor dornl oze intr-o reacjie reversIBilFce necesita prezenfo ionilor de Mg2*
sau Mn2+;
H2O3POCH2

0H

OH
2, Fosforilarea frugtozo-6-fosfatului (P-6-P)
Fosforilarea
gjructofuranozQrl.,6 -bisfosf^|. (F-l, 6-P,)^
se realizeaz# tntr-o reac^kevgrsibilg' (AG = - 3,4 kcal) jsatalizatii de[6fosfofructo-1 -)
kin^a>(6-FF4K).^^^
~

OH
'
OH
Diiitre toate enzimele implicate in giicoliza, 16-fosfofructo-1 -kinaza^ste,
atat in ficat cat in rinichi i mu^chi, enzima cu activitatea
ceTmmlegiisy"Xmpioarea degradarii hexozomonofcsfafilor depinde, in aceste
tesuturi, de.viteza conversiei(|mctozo-6~fosfat - fructozo-jU^bisfosfat, care
este dec? etapa limitantft de-j/itezilin giicoliza.
6-Fosfofructo-i-kinaza este o enzim&~aiosteric2 a carei activitate este
controlata de numerogi efectori metabolici, pozitivi sau negativi.
Astfel, 6-fosfofructo-J.ddnaza este sgns^bi^ .energe.ti.ee a celulei, ATP
comportandu-se ca inhibitor alosteria Concentrajiile mari de ATP intraeelular
inhiM activitatea enzimei prin legarea la un situs alosteric, difent de
locuf^Sv^cel^^AlP^ ca substrat, sub forma complexului iMg 2+-ATP. /
1
Forma anomerica preferata de enzimele glicolizei. (ca gi de cele ale
^untului pentozelor) este forma (k aga cum atesta studii recente de cinelica

enzimalica gi RMN.
319
De menjionat ca AMP (ca i ADP) se comportd ca efector poziiiv,
suprimand inhibijia pria ATP.
Constat area eft in mu^chi fluxul glicolitic poale varia de peste 100 de ori
in tisnp ce coneentraj'ia ATP variazd cu mai pujin de 10% in irecerea de la
stanea de repaos la activitate intense poate ft explicate prin consideraiea
activitdjii adenilat kinazei (miokinaza). Aceastd enzimd, preeminent^ In
muchi (dar i in float i alte Jesuturi), converted ADP rezultatin cursul
contracjiei musculare in ATf i AMP: 2ADP ^ ATP + AMP, IntrucSt concentrajia
ATP este de aproximativ 10 ori mai mate decat cea a ADP i de aproximativ
50 de ori mai mare decat a. AMP este uor de injeles cd semnalul metabolic
reprezentat: de variajii minore in concentrajia ATP este amplifleat, fiind
perceput ia nivelul activitdjii miokinazei in concentrajia ADP, dar mai ales in
concentrajia AMP care se modified major :
([AMP] = [ADP]2 Kccb/[ATP]); astfel, o crejtere procentual minord in
concentrajia ATP, incapabild sd inhibe substantial activitatea 6-fruct.ozo-l
-kinazei, antreneazd o seddere procentual majord a concentrajiei AMP,
suficienld pentru a deprima semnificativ activitatea enzimei,
cf>Fosfofructo-l:kinaza| este inhibatd. de asemenea, de fnafoenolgmivat
i 1,3._ llisfosfoglicerat, intermediari macroergi,ei.mi,.gMcoIizei.
Dependenta activitdjii 6-fosfofructo-1 -kinazei de modiflcdri minore in
statpsul energetic^ celulaijpeimite un control riguros al cantildju de glucozd
antrenatd in glicoliza.
A5 Un inhibitor pateniic nl enzimei s-a dovedit a iiMcMtik care
acceiitu.eazd inhibijia prin ,v#' \ ATP, Citratul, internediar a! ciclului Krebs,
format din acetiTCpA provenit in faza ,n j anabolied din piruvat, recle din
glucozd, se acumuleazd la concentrajii man de ATP (vezi 1 reglarea ciclului
Krebs) i iese in citosol unde inhibd. enzima cheie a giicolizei. Hfecti.il \
Pasteur - respectiv inhibijia giicolizei prin respirajie - ar putea avea aceastd
explicajie.
In Jesuturile ettre fac sintezd de acizi grai din glucozd, citratul ieit in
citosol servete ca donator de grupdri acelil i totodatd ca activator alosteric
al enzimei cheie a procesului- de neolipogenezd. Acumularea de citrat in
citosol reprezintd semnalul celular al satisfacerii nevoilor energetice ale
fesuturilor ca i al necesarului de int:ermed.iari biosintetici al acestora.
Inhibijia prin citrat a 6-fosfofnicto-l-kinazei are i o alia rajiune in jesuturile
care utilizeazd de preferinjd acizii gmi ca sursd energetied (muchiul
scheletic i cardiac) ca i in jesuturile glucoindependente in perioadele
catabolice. in fazd catabolicd raportul glucagon insulind mare, care-i este
propriu, activeazd lipoliza in Jesutul adipos avand ca rezultat aflux de acizi
grai spre Jesuturi. Degradarea acestora prin (Toxidare dace la acetil-CoA
mitosolic care este introdus in ciclul Krebs, via oxaloacctat, sub foimd de
citrat. Cfrnd concentrajia de citrat depdeie posibilitdjile de utilizare In ciclul
Krebs, citratul acumulat iese in citosol i, desigur, inhibd 6- FF-i-K, ceea ce se
soldeazd cu acumulare de glucozo-6-fosfat, inhibitor alosteric al
hcxokinazelor extrahepatice. Reducerea capacitdjii de preluare a glucozei din
circulajie, subseeventd utilizdrii acizilor grai, reprezintd una dintre
modalitdjile prin care jesuturile glucoindependente cmjd glucoza sangvind

care, in condijii de austeritate glucidicd, trebuie sd satis feed, exclusiv,


necesitdjile jesutuiilor glucodependente.
320
cA.0
4
O particularitafe important^ a, 6-fosfotructo-l-kmazei)o reprezintS
activarea prin produsLii ac^uiw^sale, dructozo -1, 6-bisfosfa tuk ~~
AceastS stimulare prin produs final (feed-back stimulare, proces
rarintalnit, opus feed- back inhibijiei) prezintS-un interes-major in truest
Sxuctozo-1 .6-bisfosfataj)este in acelagi timp un inhibitor al fructozo-l, 6bisiostatazeu enzimS ce catalizeazS reaefia inverse, de form are a imcto^-6fosfatuluhdin tfructozo-l^6^^os|ay Cum aceste douS enzime reprezintS
puncte cheie in controlul /glicolizeijgi giuconeoggnezei (GNG), cSi
antagoniste ce nu trebuie sS se desfSoare simultan la viteze comparabile,
se poate imagina important reglatoare a fenomenului descris (vezi reglarea
gluconeogenezei).
Efectorui alosteric poxitiv cel. mai eficient al fS-fosfofructO 1
-kinazei]hepalice s-a dovedit a fi((Snct^-2^bis^S^(F-2, 6-P2) care
actioneazS sinergic cu AMP (Fig, V1I.9); el crete afinitatea enzimei pentru
substratui sSu scSzand-o insa pe cea pentru efectorii alosterici negativi ai
acesteia: citratul i ATP,
MolecuiScu rol de semnal, de integrator metabolic, F-2, 6~P2 este
sintetizat i degradat de cStre 0 enzimS bifuncJionalS: fosfofructo-2kinaza/fructozo-2, 6-bisfosfataza (FF-2- K/F-2, 6-P2-aza), Enzima, izolatS i
secvenJializatS, cuprinde 470 de aminoacizi care pot fi divizaji in douS
domenii: domeniul 'kinazic, aminoterminal (reziduurile 1-249) i domeniul
fosfatazic:carboxito
250-470). Enzima este reglatS covalent,
prin interconversie fosfo -defosfo, Prin fosforilare, sub aejiunea proteinkinazei
A, AMPC dependents, activitatea kinazicS scade in timp ce activitatea
fosfatazicS create.
Concentrafia hepaticS de fructozo-2,6-bisfosfat este controlatS de doi
factor! i anume: fructgzo-b-fosfatul i AMP^.C55e^ mesager secund al
imor
hormoni (vezi Hormoni).
Fructozo-6-fosfatul create concentrafia de fructozo-2, 6-bisfosfat prin
activarea alostericS a fosfofructo-2-kinazei i inhibitia fructozo-2,6bisfosfatazei;
AMPC scade concentrafia de fructozo-2,6-bisfosfat, inactivand, via
proteinkinaza-AMPc dependents, fosfofructo-2-kinaza (inactivS in forms fosfo)
i activand simultan fructozo- 2,6-bisfosfataza (activS in formS fosfo) (Fig. VII.
10).
Dependent concentrafiei de fructozo-2,6-bisfosfat de AMPc lace 6fosfofructo-l- kinaza susceptibilS la control hormonal i explicit cel pujin
parjial, efectul glucagonului i insulinei asupra glicolizei, gluconeogenezei i
lipogenezei. ScSzSnd concentra]ia lrmctozo-256bisfosESuIuTr^Tiva7oFal^TdsTolfucb-i-kinazei 1 inhibitor al fructozo-1,6bisfosfatazei, glucagonul inhibS glicoliza i lipogeneza i activeazS
gluconeogeneza.
Dependenta conceniratiei de fructQzo-2T6-blsfosfat de-factori nutritipnali

(concentrajia de fructozo-6-fosfat, respectiv de glucozo-6-fosfat) gH^monali.


(prezenja sau absen{a glucagonului) face_ca fructozo-2,6-bisfosfatul sS fie
considerat serpnal de abundenjS glucidicS, in contrastcu AMPc, considerat
semnal. de absents a glucozei (hunger signal).
Fructozo-2,6-bisfosfat5 va decide fluxul de substrate fie . ..glicolizS fie
spre
glucpneogenezS.
Concentratiile fructozo-2,6-bisfosfatului sunt redass injinanifie i diabet.
Se considers cS aejiunea unor factori|pitQgeniJancogeni sifeomotori
tumoralLasupra glicolizei s-ar rcaliza prin controlul activitSlii FF-2-K/F-2,6P 2aza.
321
:
i
;. i

: ;
'23
I

i:
ii-

Fig. VIL 9 - Activarea atosterica a 6-fosfofructo-1 -kinazei prin AMP i


fructozo-2,6 bisfosfat
a - cinetica sigmoidala devine hiperbolica b - efectui sinergic al AMP i F-2,6P2
v
Fructozo 6-fosfat
6-EE -2-K/ F2,&-P2"

6~EE -2~K/F2f6-P2~ aza

322
- 3D
3. Scindarea. fructozo- 1^6-bisfp^fatului
Fructozo-1,6-bisfosfatul este scindat la doud trioze: glicgraldehid-3-fosfat
i dihidroxiaccton-fosfat, intr-o reacfie reversibild catalizatd de o liazd.
fructozo-1,6^ - bisfosfat iiaza sau aldolaza:

CH2O

I
C=0

CHO

I
+ CHOH
CH2OH
CH2O0
Intre esteriifosforici ai triozelor objinute se stabilegte un echilibru,
conversia unuia.in celdlalt fund catalizatd de o triozofosfat izomerazd:
CH2OH
CHO
1
I
1
C-0
CHOH
j
|
CH2O0
CH20
Cum forma aldehidicd este foarte reactlvd, toate transformdrile ulterioare
vor avea ca punct de plecare gBceFaIdehid-3-fosfatul fapt ce implied
deplasarea echilibrului de mai susjn
geji^urautilkgrii jale.
4, Oxidarea fosforilanta a gliceraldehid-3-fosfatului ___
Qxidarea gliceraldehid-3-fosfatului la 3-fosfoglicerat este catalizatd
defidceraldehid-i) iosfat dchidrogiBzLsi implied participarea obligatorie in
procesul catalitic a unor grupdri sulfhidril ce coopereazd cu iNADj legat ferm
de enzimd (spre deosebire de aite dehidrogenaze NAD dependente), Enzima
este mhibatd de iodpacetat i alfi reactivi liplici. Procesul de oxidare
presupune urnidtoarele etape:
a. adi{;ia^unepgrupdr^-SH din central activ al enzimei la gliceraldehid-3fosfat, cu form area unui semitiaacetal (analog semiacetalilor) i oxidarea

serpitioacetaluliiipp seaipfl NAD legat, cu form area unui tioester:


HH

b. fosforoliza tioesterului cu formarea 13-bisfp?fogliceratu 1 ui si eliberarea


grupdrii -SH
323
a enzimei:
HH

PO,H3

c. depIasare:a^_NADH .legal

decApe^N^

CONH2

NAD+
NADH + H+
SH

oo

De remarcat c&, 1.3-bisfosfogliceratul confine o legftturft aciifosfat


macroemc# (prin
hidroliz# elibereaz# 12 kcal/mol). Cum leg&tura fosfat-terminald a ATP este
de ordinal a 8 kcal/mol, rezultS posibilitatea formdrii unei molecule de ATP
prin transferul restului
fosforil de pe 1,3-bisfosfoglicerat pe ADP (fosforilare la nivelul substxatului).
Reacjia este catalizat# de Jfosfoglicerat leinaz#3
COOH'
1
1 X OPO...K
-i- ADP
MgCHOH
CHOH
i
CH2O0
CH2O0+ ATP
Desf3urarea etapei; gliceraldehid-3-fosfat + Ps + ADP + NAD+ -> 3fosfoglicerat + ATP + NADH- + H+ implied necesitatea reoxidarii permanente
a NADH rezuilat in cursul
glicolizei ce se desfdoar& in citosol
O deviere a 1,3-bisfosfogliceratului (1,3 BPG) din calea glieolitica,
paradoxal# la prima vedere intruc&t. se soldeaz# cu risipd de energie (ATP),

decurge in eritrocif. 1,3-Bisfosfoglice- ratui este convertit sub aejiunea unei


mutaze specifice la 2,3-bisfosfoglicerat apoi la 3fosfoglicerat sub aejiunea aceleiai enzime care manifest# i activitate
fosfalazic# (Fig. VII-11).
Glucoza
G/iceraldehid -3 - P
Pa-w -NAD +
T"
K
NADH + H +
1, 3 - Bisfosfoglicerat
mutaza
1,
3- Bisfosfoglicerat
ADR
\
y
3-fosfoglicerat kinaza
2,3- Bisfosfoglicerat
ATP
Pa
3-Fosfoglicerat
2,3Bisfosfoglicerat fosfataza
2-Fosfoglicerat
.
Lactat
>Fig. Vli, 11 - untul 2,3-bisfosfogiicerat krnazei in eritrocit (by pass~ul 3fosfoglicerat kinazei)
2,3-Bisfosfogliceraj-ul este un ester bisfosforic esenjiai in exercitarea
......................................................................................fuacXtel.. de
transpwtor^oxigen a^h^iaglobiB^L Acest; ligand (efector alosteric), prezent
in eritrocit la concentratii ecliimoleculare cu hemoglobina, scade marcat
afinitatea acesteia pentru oxigen, favorizand disocierea complexului Hb.40xi
deci oxigenarea jesuturilor.
Din cantitatea de glucozft angajatd in glicolizd aproximativ 25 la sut&
urmeazft in eritrocit untul 2,3-bisfosfoglicerat.
Viteza de desfelSmFe'Ti^picolizei modified, desigur, afinitatea pentru
oxigen a hemoglobinei; deficite enzimatice in glicolizd pot dace fie la
creterea, fie la sedderea eoncentrajiei de 2,3-bisfosfoglicerat, funefie de
situarea deficitului - inainte de sinteza
1,3-bisfosfogliceratului (seddere) sau dupd (cregtere, prin acumularea
produgilor netransformaji). Astfel, in deficitul genetic al hexokinazei
eri'trocitare afinitatea hemoglobinei pentru oxigen este crescuta iar oferta de
oxigen cdtre fesuturi sedzutd.
Eritrocitul insui este victima acestui deficit enzimatic intrucat blocarea
glicolizei in chiar etapa de debut ii scade dramatic ansa de a obfine ATP
necesar funefiondrii pompelor ionice, rezulfatul fiind swellingul eritrocitului i
liza ulferioaid.

10

Diminuarea producerii de ATP in eritrocit, ca rezultat al parcurgerii


seevenfei 1,3- bisfosfoglicerat 2,3-bisfosfoglicerat 3-fosfoglicerat, face
posibild desfdurarea glicolizei i implicit menfinerea unei concentratii
optime de 2, 3-bisfosfoglicerat chiar in condifiile in care necesitdjile de ATP
ale eritrocitului sunt reduse.
325
5. Transformarea 3-fosfogliceratului in 2Tfosfoglicerat sub acfiunea unei
mutazespecifice - fosfoglicerat mutaza - in prezenja obligatorie a Mg2+:
COOH
COOH
CHOH
CHO
1
^ 1 CH2C(P)
CH2OH
6. Tranrfom
Intr-o prima etapa, reacfia implicafconversia 2-fosfogliceratului la 2fosfoejiolpiruyat v sub acjiunea unei lenblazej enzimS care necesita prezenfa
Mg2+ i este, ca atare, susceptibiia la mhibifta prin _ fluoruri:
COOH
COOH
CHO
-**---
1
- H20
II
CH2OH
CH2
Recoltarea sangelui in vederea determinarii glucozei se face pe o fluorurd,
tocmai pentru a inhiba utilizarea glucozei de cfttre eritrocite.
2-Fosfoenolpinivatul este un compus macroergic; leg&tura enolfosfat
elibereaza prin hi^oRzil^-I4..kcal/mol, in prezenfa Spiruvat.
kinazeugrupareajosforil este transferatape ADP cu formarea unei molecule
de ATP.
in aceastS etapa a glicolizei se formeaztt ojioua,molecdd de ATP prin
fosforilare...
la nivelul substratului:
COOH
i
1
C 0-0 + ADP
II

COOH
i
K*

------*
Mg2*(M
n2t)

1
C - 0 + ATP
i

CH3
Piruvat kinaza se prezinta sub forma a jfouft flzoenzimS de tipJL, proprie
ficatului, 1 de tip M, proprie mu$chiului, izoenzimele de tip L sunt enzime
alosterice, tetrameri, suscgptibile la acfiunea a numero^.i efectori
metaboJigi: etapa catalizata de piruvat kinaza reprezinta, din acest motiv, un
punct de control important al caii glicolitice. Printre
efectorii
.enzimei hepatice se numara fructozo-1, 6-bisfosfatul care
funcjioneaza ca
activatoijffiActivarea unei etape dintr-o secventadereactii printr-un metabolit,
.........................................................................................substrat
al unei etape anterioare poarta numele de feed-forward stimulare.
Exptimand. activitatea enzimei limitanta de vitezd, fructozo-1, 64)isfosMul
3reviiiea enzima, situata. in aval, asupra cantitatii de fosfoenolpiruvat caieia
CH2

va trebui sa-i facd faff. ajuslflndu-i corespunzto^


Aiaturi de feed-back inhibifie i feed-back stimulare. feed forward stimularea
reprezinta o modalitate de realizais a unor inJc|im.metabolice .complexe
avand ca scop desf3urarea armonioasa a proceselor vitale (vezi reglarea
gluconeogenezei).
326
Piruvat kinaza (ca. i fosfofructo-1 -kinaza) este inhibatd. alosteric de
cStre ATP, Alanina - aminoacid glucoformator - este gi ea un inhibitor
putemi.c.af.fenzimei hepatice, ca i acd CoA i acetilCoA.
Piruvat kinaza hepaticS este o enzijnS interconvertibilS jnaciivS in form#.,,
foslo, promovatS de glucagon i catecolamine via protein kinaza A, AMP C
dependents, gi activS in formS defosfo, promovatS de* msulinS. De remarcat
cS msulina funcJioneazS
gi ca inductor al enzimei,. activ&nd' transcrierea genei
................................................................ce:i.^.coresp,undie, in limp ce
glucagonul acfioneazS ca represor.
Piruvatul rezultat pnrTparcurgerea cSii Embden-Meyerhof poate fi redus
3a lactat in conditii de relative anaerobiozS (in mugchiul in contracjie, ficat,
rinichi) sau in..J^uJ_ujri care nu dispun de echi^entul enzimatic ,necesari
metabolizSrii aQrob^ a piruvatului
(retina, jcsuturile embrionare sau neoglazice, hematiile, fibrele _ musculare
jtlfoe)- Reducerea se face pe seama NADH rezultat in etapa de oxidare a
gliceraldehid-3- fosfatului, fapt care asigurS reoxidarea NADH gi dec!
posibilitatea desfS^urSrii
glicolizei, respectiv furnizarea de ATP, in absenfa 02;
COOH LDH
!
+
+ NADH + H _____ CHOH + NAD*
I
CH3
Lactatul este ..trimis pe calc
smmm& ficatului, miocardului gi
rinichiuluj unde se
reox.ide.azS, in prezenta LDH, la piruvat care va servi ca substrat pentru
gluconeogenezS. G.lucoza rezultatS din lactatul muscular poate fi furnizatS
mugchiului, care o va utiliza, formand din nou lactat (vezi ciclul C.ori).
Abiiitatea glicolizei de a funcjiona in conditii de anaerobiozS o consacrS
drept cale unicS de supraviejuire (sintezS de ATP) pentru unde Jesuturi intr-o
astfel de conjuncturS. Mai mult, prezenja enzimelor glicolizei in concentrajii
man ii permite acestei cSi sS producS ATP mult mai rapid decat o face
degradarea aerobS, chiar -dacS producerea de ATP este mai eficientS in
prezenja oxigenului. De menjionat cS functionarea glicolizei este limhatS^
care-gi deprimS activitatea la pH mai mic de 7,.
In condijii de aerobiozS, piruvatul este convertit la acetil ~CoA care va
servi ca subslrai^alciclului Krebs, asigurandu-se astfel
NADHLrezultat
in glicplizS este reoxidat in lanjul respirator (vezi metabolism energetic).
In ficat, acetil -CoA rezultatS din jduQOzA, in cadrul procesului de
neolipoaenezS.
In Fig, VII, 12 este redatS schema generals a glicolizei.
COOH

I
c-oI
CH3

327
-bfr
Glucoza
ATP
ADP
hexokinaza giucokinaza
"O
. Glucozo 1 -P
Glicogen
Glucozo 6-P
t
Fructozo 6-P
ATP ADP *
6FF-1-K
Qi-----ATP, citrat
(+)'-------------------AMP, fructozo-2,6-bisfosfat
Fructozo 1,6-bisfosfat- -Citoplasma
2xGliceraidehid~3-P - 2xNAD+
-2xNADH + H+
2x1,3-bisfosfoglicerat 2ADP
I 2ATP
2x3-Fosfoglicerat
2x2-Fosfoglicerat
2x2-Fosfoenoipiruvat
2ADP2 ATP l .
Piruvatkinaza
0
2 x Plruvat ATP, alanina

NAD
2 xLactat
NAD +
Citrat
Oxaloacetat
Acetil-CoA

I
Acizi grasi
I
Liplde
Fig. VII. 12 - Glicoliza (reacjii i reglarea procesului)
BILANJU'L ENERGETIC AL GLICOLIZEI
Degradarea glucozei pane ia lactat reprezintS un proces exergonic ce
eiibereaz& o cantitate redusft din conjinutul energetic ai glucozei. Energia
eliberate_ este partial incorporate sub forma de ATP. De remarcat c8. in
procesul de glicoliza anaerobe energia nu se,_elibereaze prin oxidarea -NADH
la niveiul. lanjului respirator, urmate de cuplarea cu fosforilarea, ci exciusiv
..substratulni. In aceste
328
condifii glicoliza isi asigurd pe cent propriu" reoxidarea echivalenfilor
reduedtori, MAOH^rezultat in^et^a glicgraldehidfosfat dehidrogenazieg.
fiind reoxidat la NAD, in cursul readier de tregere a miniva^^
Etapele de fosforilare la nivelul substratului, in care energia incorporate
infoun substrat macroergi'c este transferatd ADP, cu form area ATP, sunt:
- conversia 1,3-bisfosfoghceratului la 3-fosfoglicerat;'
- cqny^rsia.fosfp^
la piruvat.
Cum dintr-o molecule de glucozd rezultd dou3 molecule de.trioze,
cantitatea de ATP formate este de 4 ^
.glucozd fransformatd in lactat.
Cagtigul energetic
net este insd de numai moli ATP dacd^degradarea pornegte de la glucozdj
intrucat reacfiile catalizate de kina/e ?i aiiurne:
ATP
glucoza------------------------------^ glucdzo-6-fosfat *
ATP
fructozo~6-fosfat ----------------fructozo-1, 6-bisfosfat .
s
gmsurngf^ moli ATP) Daed degradarea pomete de la glicogen cajtigul net
este de .Mali AJP intrucat gkicozo-6Tosfatul se obtine prin fosforoliza
glicogenului, neconsuma- toare de ATP. Considered cd energia eiiberatd ia
hidroliza iegdturii fosfat terminate din ATP este de 73 keal/mol, cantitatea de
energie eiiberatd in cursul glicolizei este de 73x2=14,6 keal/mol glucozd,
respectiv 73x3=21,9 keal/mol glucozS. Caotdatea. de energie eiiberatd este.
relatiy mied, astfel incat glicoliza anaerobd pare neayantajoasd. din punct
dej/edere energetic, Viteza foaite mare a fluxului. glicqUtic. permite insd
funxizarea unei cantitlgi de energie care sit satisfacd, cel pu{in pentru
perioade relativ scurte, necesitdjile energetice ale fesuturilor in absenfa
oxigenului. Consumul crescut de glucozd face totui din glicolizd o cale
neecqnomicd.
Dacd anaerobioza este de scurtd duratd i in sistem apare oxigen, lactatul
este oxidat la piruvat. In condijii de aerobiozd piruvatul, format prin
parcurgerea edii Embden- Meyerhof de cdtre glucozil, este oxidat pand la C02
i H20 in scopul eliberdrii integrate a energiei incorporate in molecula
glucozei. Oxidarea finald a oriedrui metabolit presupune antrenarea acestuia

in ciclul Krebs, Admisia piruvatului in ciclul Krebs implied conversia la acetil


~CoA i se realizeazd prin decarboxilarea sa oxidativd in matrixul mitosolic.
Transpoitul piruvatului in mitosol este efectuat de un transporter specialize \
presupune cotranspoitul unui proton (mecanism simport).
VII.3.2. DECARBOXILAREA OXIDATIVA A PIRUVATULUI
Este un proces mitosolic complex ce presupune colaborarea urmdtoarelor
enzime: (Eju i cofactori:
- - piruvat dehidroggnaza (decarboxilantd), constituitd din doud
subunitdlii: E.l0C i EjP avand ca grupare prostetied tiamin pirofosfatul (TPP):
329
- E2 - lipoil reductaz transacetilaza, avand ca.. grupare prostetica acidul
lipoic. De
menjionat cS acidjiHipok se leagS la enzimS prin gruparea - amino a unei
molecule de lizi.nl;
s---s
(CH2)4 CO NH ~ CH2 CH2 CH2 CH2 CH CO
NH
- Ea^~ lipoiLdehidxQgenaza, avand ca grupare prpstetic^ F^.
- kinaza AMEe independent:
fosfataza specific^, dependent de Ca2* i Mg2*, asociatii, tranzitoriu,
complexului. Aceste enzime aicrituiesc un sistem multienzimatic, cu un
aranjament spajial rigid,
care poartii numele de comglexu]Structural i functional diferite, fM sft fie
legate covalent, enzimele componente catalizeazft etapele succesiye ce due
la objinerpa acetil_~CgA din piruvat, Complexul are p masa molecular# de
aproxixnativ 5 x ID3 k.D i conjine un foarte mare num&r de copii din fiecare
enzimtl
Decarboxilarea piruvatului necesitd aditia TPP la piruvat - adifie efectuata
ca urmare a unui atac nucleofil realizat de.ionul iljdL forma ionizatft a
nucleului tiazolic ai TPP, asupra cmitojiuluLfiM
.: C
+ CH3 C COOH
II
O
H+
i
CH,
HOOC C ' "S
i
OH
Compusul de adifie se decarboxileaz3 cu-formarea acetaldehidei- active:
+
S
NCH,
C07
HOOC C x S

I
OH
pi
o<
V
CH
I
HC
I
OH
Reacfia este catalizakl de subunitatea a a E,,
UrmeazS etapa de oxidate proptiu-zisfi. constand in
pierderea_hi.drogenului i tonsformarea acetaldehidei in radical aeet.il
Reacjia este catalizatft de subunitatea [3 a pjruvat dehidrogenazei (E,). Cum
reaejia se desOioarii in prezenja acidului lipoic, se
330
'03
formeaz# agid...j^cetiLdipoic. De remarcat faptui c# energia eliberat# prin
oxidare se reg&sete in tioesterii care se formeaz# (acetil ~ lipoic i apoi
acetil -CoA).

OH
Radicalul acetil, temporar legat la acidul lipoic, este transferal coenzimei
A cu form area acetil-CoA-tioester macroergic:
SH S ~ COCK
SH SH
4- CoASH
+ CH* C
o
SCoA
Acidul lipoic astfei redus se reoxideaz# in prezenja lipoat dehidrogenazei,
flavin enzim# ce transfer# hidrogenul acidului lipoic pe FAD,
SH SH
S ----------------------------.s
+
FAD
+ FADH2
Atomii de hidrogen din FADH2 sunt apoi transferafi pe NAD.
Reacfia global# a decarboxildrii oxidative a piruvatului:
CH3COCOOH + NAD* + CoASH ^ CH3CO - SCoA + NADH + H+ + C02
este o reacfie ireversibil# avand un AG* foarte negativ (-8 kcal).
Ireversibilitatea acestei reacjii constituie motivul pentru care acizii grai cu
numSr par de atomi de carbon sau divert aminoacizi ce formeaz# prin
degradare acetil -CoA nu sunt glucoformatori (vezi gluconeogeneza).

331
De menjionat cS in avitaminoza B, decarbo?$ais^ realiza prin lipsa TPP,
ceea ce are grave repereusiuni asupra
in
sitiiajiaj^^nu jutea^M
Defi ci tul,, si stem u! ui
vat dehidrog
este responsabil de fenomeneje nervoase ce caracterizeazS boaia beriberi (in
dialect indonezian = nu pot! exprimand deficitul jieuro-muspplar) dar i
pejnarii amafori de aicooL Enzimeie implicate in decarboxilarea oxidativS a
piruvatului, i anume: piruvat dehidrogenaza, lipoil reductaz transacetilaza i
lipoatdehidrqgenaza, alc&tuiesc, aa cum
s-a ar&fat, un sistern^multienzimatic cu o determinaae
Pe .jniezuT
sistemului, reprezentat de lipoil reductaz transacetilazS, sunt ancorate
celelalte douS enzime. Transfonnarea substratelor presupune ca acestea sS
fie purtate succesiv la enzimeie sistemului, Intr-adevSr, operajiunea este
realizatS de eSire acidul lipoic legal la radical ul lizil din molecula lipoil
reductaz transacetilazei care realizeazS astfel un braj flexibil de
aproximativ 1,4 nm:
S "--- S

CH2CH2~~CH2CO NHCH2CH2CH2CH2OH CO
NH
Acest hraf incSrcat efectueazS o migcare de du-te vino intre grupSrile
prostetice ale sistemului multienzimatic in cursul cSreia fiecare enzimS ii
realizeazS acjiunea, produsul unei reac^ii enzimatic cataiizate devenind
substrat pentru urmStoarea enzimS, fSrfi sS difuzeze din complex (Fig. VII.
13).
Grganizarea color trei enzime intr-un sistem multienzimatic confers o
eficienfS deosebitS procesului catalitic, excluzand hazardul coiiziunii
substratelor cu enzimeie respective, pe care bar presupune existenja
acestora in stare liberS.
CercetSri recente au evidential faptul cS la mamifere sistemul piruvat
dehidrogenazS este sediul unui control metabolic riguros realizat atat prin
efectori alosterici cat i prin modificare covalenlS, respectiv prin trecerea
reversibilS a formei fosfo in defosfo. Conversia defosfo-piruvat
dehidrogenazei la fosfo-piruvat dehidrogenazS se realizeazS in prezenja unei
kinaze, AMPC independents, parte integrants a complexului multienzimatic, i
coincide cu innctivarea enzimei, in limp ce conversia fosfo-piruvat dehidrogenazei la defosfo -enzimS este catalizatS de o fosfatazS specifics i duce la
activarea enzimei.
Forma activS, defosfo, a complexului piruvat dehidrogenazS este inhibatS
alosteric de produii acjiunii sale, acetil ~CoA i NADH care sunt in acelai
timp i activatori
332
alosterici, ca i ATP, ai piruvat dehidrogenaz-kinazei, enzixM ce fosforileazft
subunitatea
Ela a piruvat dehidrogenazei, inhiband-o.
Spre deosebire de acetil CoA i. NApfl. piruvatuL ca i CoA-i NAD,
substrate ale complexului multienzimatic, ina.ctiveazfi, la ^oaenlxalMjIiari,

piruvat dehidrogenaz- kinaza. Simultan, are loc reactivarea complexului


pimvat dehidrogenazS. prin legarea i activarea piruvat dchidrogenaz
fosfatazei promovatH de Ca2+ crescut, ca expresie a scftderii concentrajiei
ATP (Fig. VII. 14).
Aprecierea dependent activit&jii complexului piruvat dehidrogenazii de
rapoxturile moiare acetil CoA/CoA, NADH/NAD duce la concluzia al
metabolizarea piruvatului la acetil-CoA este deprimaUl in condijii de
austeritate glucidicd, situate in care Jesuturile glucoindependente recurg la.
acizii grai ca surs5 energetical; acetil-CoA i NADH, rezultate prin (i oxidarea
acizilor grai, inactiveazS complexul piruvat dehidrogenazS f3c3nd
imposibilft utilizarea energetics a piruvatului (proven.it, in spe$, din lactat i
alaninS) care se va orienta spre gluconeogenezS.
In faza anabolics, activitatea complexului piruvat dehidrogenazS este
crescuta cand necesitS{ile energetice crescute impun antrenarea unor
cantit&Ji mai mari de acetil-CoA, de sorginte glucidicS, in ciclul Krebs.
VIL3.3. CICLUL ACIZILOR TRICARBOXILICI (CICLUL KREBS)
Ciclul acizilor tricarboxilici (ciclul acidului citric! reprezintS o succesiune de
reaclii prin parcurgerea cSrei'a fragmentul acetil - CoA este oxidat pans la
CP2, Etapele ciclului au fost postulate i demonstrate ulterior de ciitre Hans
Krebs care, cu capva ani inainte, elucidase etapele procesului de ureogenezl
Introducerea fragmentului acetil-CoA !n ciclul Krebs se realizeaza prin
condsnsarea sa cu oxaloacetatul. Parcurgerea acestui ciclu, unnatg de
oxidarea hidrogenului in iasatul respirator, se sojdeazg cu oxidarea totalS-a.aQ^t,jl-CQA. (in cursul cdreia se formeazi 12 moli ATP/moLacetil-CoA) i
regenerarea oxaloaceUatnluiAmorsarea secvenfei de reac|ii presupune condensarea acetil" CoA cu
oxaloacetatul in urma ciireia se formeazS citrat. Reacjia este catajizatft de
ffitrat sintazS)i reprezinta, In fapt, o condensare aldolicS intro oxaloacetat
(componenta carbonilicS) i acetil-CoA (componenta metilenicd). Absenja
fenomenului de mezomerie in tioesteri este responsabikl de efectul atrftgdtor de electroni al grupei >00 din gruparea c 0
avand ca
SCoA
rezultat labilizarea hidrogenului din pozijia a.
H CH2 CO SCoA
?H2 ~ COOH
2
+ HOH
I
---------HO C COOH
Q
HOOC - C (
CoASH
I
CH2COOH
CH2 COOH
0
AG = ~9kca!/moi

Fig. Vii. 13 - Organizarea compiexului piruvat dehidrogenaza


acetil CoA / CoA-SH NADHI HAD + ATP / ADP

Fig. Vii.14 - Controlui modificarif covaiente i aiosterice a activitajii


compiexului piruvat dehidrogenaza

Xo

334
fCitrat sintazafeste o enzima alostgric^ inhibata de ATP, NADH, citrat,
acted gva$i cu lant-lung, ca i de succinil-CoA.. intermediar al ciciului Krebs.
S.e4der^j^inMjiiMciti:3t ,sintazei penfru acetil~CoA ia concentratii marl de
ATP permite ciclnlui Krebs s&-si adaoteze ritmul la necesitatile energetice ale
tesuturiloL De remarcat oil in ficaf si alte. tesirturi.care fae neolipogeneza, formarea
citralului reprezintil o r&sp&ntle metabolic^ extrem de important# in care se
hot&r&gte soarta acetatuiui activ. Acesta se poate angaja nu numai in
etapele ulterioare ale ciciului Krebs ci i in biosinteza de novo a acjgjtoi
jgrasL care are loc In citosol. Intruc&t acetibCpA
nu .poate IravgmiBmbraaa mitosoUca, strategia adogtatf.
de celuia consta in eaaaiMjau SUb-JonaLik....dlat, prin mtermediul unui
transportor
specializat, urmatft de clivarea la acetil-CoA si.oxaloacetaf;
citrat iiaza
citrat
acetil~CoA * oxaloacetat
ATP
ADP + P\
Iesirea ctotului din mitosol, In vederea angajdrii sale in neolipogeneza, are
loc exclusiv in condijiile in care evolufia sa in ciclul Krebs este blocaUl prin
cantitatile man de ATP si NADH, rezuitate prin metabolizarea glucozgi, care
sunt mhibitori ai enzimei limitante de yiteza (vezi mai jos),
2. lntr-o etapa ulterioara, citratul este izomerizat la izocitrat prin
intermediui aciduiui, cis-aconitic sub actiunea j^onilazeD
CH2 COOH
CH
HOCOOH
C COO
H H

II
+ H20
H20
C
_____
COOH
1
1
3Bw
C HO C
"
H COO
COOH
S---H
I
41
H2O

CH2 COOH H20


CH2
COO
COOH
H
Echilibrul care se stabilete intre cele trei forme depinde de viteza de
oxidare a 'aciduiui izocitric sub acfiunea izocijrat ^deh^^ Trecerea aciduiui
citric in acid,.
3. Sub acjiunea Jkomtnk dehidrogenazeij izocitratul. sufer# o oxidare
insojit# de
decarboxilare, fonn5nd^-cetogiutarat
HO CH COOH
I
CH COOH'
I
CH2 COOH

NAD* NADH + H+
O
ii
C COOH + CQ2 OH2
CH2 COOH
A fost demonstrata exislenja a doua izoenzime ale izocitrat
dehidro^eitazei; una NAD dependenta, prezenta exclusiv intramitosolic, si
cealaltS KADP dependenta, avand o dubl& localizare: intrarnitosplica gi
citosolic&.{Enzima NADJdependenta estep enzima alosterica av^nd ca
efector pozitiv APR, ceea ce sugereazS ca ea este forma implicata in
desi:aurarea ciciului Krebs, calc catabolici avand ca scop sinteza de ATP.
Activarea
335
4V
enzimei prin ADP antreneazft faptul c3, ori.de cSte ori concentratia ADP este
mare,' enzima isi mSrggte semmficativ activitatea. Simultan, activitatea
intregului ciclu create, etapa..calaikatS de izocitrat dehidrogenazariind_etaga
iimitania de vitezli, Enzima:...este inhibata alosteric si
Uzocitrat dehidrogenaza NADP dependents! este, dimpotriva, inhibata de
ADP i stimulate de ATP. Cum enzima este active tn condifii ce favorizeaza
sintezele (ATP crescut), s-a conchis ca enzima este impiicata, aiaturi
defenzim^mabcljgi zeTeHsunf^ in fumizarea NADPH necesar sintezelor
reductive ce se
desf3oarS esenjial in citosol.
4. Decarboxilarea oxidativa a a-cetoglutaratului la succinat are loc similar
cu decarboxilarea piruvatului. Ea necesita prezenja sistemului
multienzimatic^cetopItaF^
dehidrogenaza |care utilizeazS drept cofactori TPP, acid lipoic, CoASH, NAD,
FAD. Energia eliberata la oxidate este Incorporate sub forma unci legSturi tiol
esterice In succinil~CoA:
COOH
COOH
1
|
1
1
CH2
C-01
1
1
- co2 1
CH2 + NAD" + CoASH
CH2 + NADH
+
CH2

CO - SCoA
1
1
COOH
Succinil~CoA. in prezenja GDP si fosfatuiui anorganic, formeazS jjTP i
succinat. Se formeazd o legdturd fosfat macroergicd realizatd prin fosforilare
la nivelul
substratului,
.....
Reacjia este catalizate detsuccinil tiokinaza tsuccinil CoA sintetaza).
CH2 Ct)OH
CH2 COOH

I
+ GDP + P04H3
|
+ CoASH + GTP
CH2 CO ~ SCoA
CH2 COOH
Sistemul a-cetogiutarat dehidrogenazic este inactivat de succniil-CoA gi
NADH i
activat de Ca_2+.
TTalta modalitate de transformare ajuccmihCoA reprezentata,
exclusiv In Jesuturile extrahepalice. de triinsferul CoAjjejiceto
COOH CH2 CH2 CO - SCoA 4- CH3 CO CH2 COOH
s- .
COOH CH2 CH2 COOH -f CH3 CO CH2 CO- SCoA
Reacjia permite metabolizarea ulterioarft a acetoacetatului sub forme de
acetoacetil CoA. Reacjia este catalizate de succinil CoA - acetoacetat
tioforaza (vezi cetogeneza).
336
... ~J 7
la-Cetoglutarat dehidrogenazai este, ca i ipiru vat dehidrogenaza^
inhibatfl de produsii reacj.iei enzimatice; succinil-CoA i MADE, De asemenea,
enzima este sensibil^ la incflrcarea energetic^ aceluiei, fond inhibatS de.ATP
si activ^ta...<kCai+.
5. Oxidarea succinatuiui la fumarat se realizeazS pnn acpunea
pucelfMAMiilrog^ nazeij enzirngj}Janju|u],^respjra,to ayand drept toenzfmd
PADn
CH2 COOH CH2 COOH
Oxidarea succinatuiui la fumarat este jnJiitod competitiv de malonat, un
fals substrat, ca i de concentratii mail de oxaloacetat. Acwnularea de
oxaloacetat inhM propria-i foimare din succinat.
6. Hidratarea fumaratului duce la L-malat i este catalizatS de|fumaraz|
2;enzimd cu stereospecificitate mareabl fumaraza mi folose^te drept
substrat maleatui:
HOOC CH
II
+ H2O
H C COOH
7. Oxidarea maiatului la oxaloacetat se realizeazli sub acjiunea
^alaSehidrogenazeiFi
COOH
COOH
I
NAD*
NADH + H* I

COOH
COOH
I
CH OH
I
CH2

COOH
FAD
FADH,
HOOC CH
II
HC COOH

COOH

Derularea ciclului Krebs duce deci ia oxidarea,acetil ~JCoA i regenerarea


oxaloaceta- tului (Fig. VII. 15),
Sin oxidarea.acetil~CoA .se fonneazltIou& molecule de CO?sgi patru
perechi de echivaienju (3_NADH + 3H^.+^FADH^ csL^fir fi oxidafi in iaotul
jesoirotor. Necesitatea reoxidlni permanente a acestora la nivelul lanjului
respirator permit ciclului Krebs s se desfdoare exclusiv in cpndifii de
aerpbioz& .(spre deosebire de glicolizi). Ox^acetatul regenerat poate
accepta o nou8 moleculS de acetil-CoA pe care o introduce in ciclu.
Reacfia global?* cle desfiigurare a ciclului Krebs se poate formula;
CH3CO~SCoA + 3 NAD+ + FAD + GDP + 2H2Q + P] > 2C02 + 3NADH +
FADH2 + GTP + 2H+ + CoASH
Ciclul Krebs constituie o cale finaia de degradare, cornunS glucidelor,
lipidelor,
projemelpc
337
L
fb"
H2
ivlata'i dehidrogenaza
BO-CH-COO"
I
CH2- COO" L-Maiat
Fumaraza /
A*
H - C - COO" il
OQC-C-H
Fumarat
<i
^FADH2 r Sucdnat ^dehidrogenaza
A- FAD
i
CH2- COO"
I
CH2- COO"
Sucdnat
\^GTP
CoA - SH GDP + Pi
Sucdnat \
tiokinaza CH2-COO'
e
CH22; Q
\*
g|O = C ~ S - CoA
x QSucdnil - CoA
I0
t -\L.^ CompiexiuKPfeeto- gfutarat

r
o
dehldrogen aza

NAD
NADH+H
NAD"
0 ii
C- COO
1
CH2 * coo
CH3-C0-S-C0A
Ace til CoA Cftrat dt?taZCX-*sH*,^ CoA-SH
CH2- COO" -COO"
r CL >
16
2: X
6'
o
>
HO-C- I
CH2~ coo"
Citrat \
\ AcoWita&Si
A
H2O^ \
CH2- COO" C - COO" CH - COO"
Cis-aconiiat
H2O
Aconitaza
N Fe
2+
NAD
CH2-COO"
CH - COO"
I
HO CH - COO + Izodtrat
NADH+H**

CoA-SH
CO 2
CH2-COO t ifr 2+
Mn
CH2 *
c- coo"
ot- Cetogiutarat

CH2-COO CH - COO" O C - COO"

Oxalosucdnat
L ADP,Ca2+
ATP,NADH
izodtrat
dehidrogenaza

Fig. VII. 15 - Cidul acizilor tricarboxilici (ciclul Krebs)


Acizii grasi inlrS in ciclul Krebs prin components acetii-CoA, prcxlus al ftoxidgriL Aminoacizii glucoformatori (giutamal, aspartat, arginin&, proiing,
histidine, valinS,- inedonina, scrim! giicoco! treoning, cisteinfl, tirozinS,
fenilatojnS) se catabolizeazg pe d& proprii dand natere la intermediari ai
ciclului Krebs. Aminoacizii cetoformatori (leucii|4 fenManinS) genereazS
aeetil~CoA jvezi metabolismul aminoacizilor).
De remarcat c3 acizILg^i ca i aminoacizii cetoformatpri, pot furniza ,
exclusiv componentaJ^etil-CoA.l Spre deosebire de acetia, unii aminoacizi,
dar mai ales jlucidele, pot forma nu numai componenta acetil-CoA (prin
piruvat) care se consume, ci i componenta oxaloacetat care permite
ainorsarea ciclului Krebs_. Reacjia de formare a oxaloacetatului
condilioneazS, evident, utilizarea gnisimilor. Form area oxaloacetatului are
loc esential prin carboxilareapiruvatului^ub actiunea IpiimvafcCT ft
localizatS iiUramitosolic care necesM biolina drept grupare prostetic&
CH3COCOOH + C02 4- ATP > COOH CH2 CO COOH + ADR 4- Pi
338
1 Piruvat carboxiligazajeste o enzimft ajosterigft a cSrei activitate depinde
de prezenla acetll-CoA- efector pozitiv al enzimei; in absenta acestuia enzima
este compiet inactive Cregterea concentratiei acelil-CoA va induce cregterea
activit^tii piruvat carboxiligazeL favorizand asffel inixarea restului acetil in
jdclui de oxidare, prin cupiare cu oxaloacetatul. Diminuarea concentrajiei de
acetil~CoA favorizeazS activitatea piruvat dehidrogenazei, enzimS ce
catalizeazi form area acetil~CoA.
este, aga cum. se va anlta, prima enzima a gluconepj^enezei. Orientarea
piruvatului spre gluconeogenezil sau spre ciclul Krebs va fi decisft, .in ultima
instant, de disponibilit&Jile energetice ale fesuturilor.
CICLUL KREBS - CALE AMFIBOLICA
Pe langd faptul cfi reprezintd o cale de degradare comund pentru glucide,
iipide gi proteine, ciclul-Krebs poate fumiza intermediary s&i diverselor
procese metabolice. Astfel, oxaloacetatul gi a - cetoglntamluL cei doi
cetoacizi ai ciclului, pot forma, prin transaminare sau aminare reductive!.
aminoacizii corespunzfltori - aspartic gi glutamic, dac& celula ii reclame.
~~ *"*
COOH CH2 CO COOH + CH*CH -COOH
COOH CK-CH COOH
+ CHs-C COOH
I
I
II
NH2
NH2
0
COOH-CH2~CH2-CO-COOH+CH3-~CH~COOH ^ COOH~-CH?-CH2-CH~COOH +
CH3-C--COOH
I
I
II

NH2

COOH-CH2-CH2-CO-COOH + NH; + NAD(P)H


+ NADP* + H2O

0
COOH~~CH2-OH2CH-CDOH

NH2

NH2

Acidul aspartic constituie un punct de plecare in biosinteza nucleotidelor


WimidiniceJ
in limp ce glutamina provenita din, inijiazS biosinteza imcleotidelorf^imce;}
SuccinatuL alt intermediar al ciclului Krebs, este antrenat in biosiiiteza
hemuliii priiL
CitratnL reprezintft forma de.transport a accliJ - CoA. din mitosol in citosol;
acetil
CoA citosolic este antrenat in
CH2 COOH HO C COOH
I
CH2 COOH
+ CoASH citrat iiaza
ATP
ADP-fPj
CH2COOH COCOOH
+ CH3CO~SCoA
OxafoacetatuLtransportat din mitosol in citosol ca malat, este convertit la
fosfoenoipi- ruvat care se angajeazS in gluconeogeneziL.
AspartatuL glutamatul, porfirinele, glucoza, pirimidinele, acizii gragi igi
construiesc scheletul hidrocarbonal pe seama intermediarilor ciclului Krebs.
339
4*r'ii i :U
r.r;

fj
hi

q i

Funcfionarea ciclului Krebs, pe cle o parte drept calc catabolicii iar pe de


altii parte'- drept cale de initiere anabolic^ il consacri drept cakM amfibolicft
(anabolic^ i catabolic#). Relafiile intermetabolice ale ciclului Krebs sunt

redate In Fig. VII. 16, UliJizarea in diferite procese biosintelice a


intennediarilor ciclului Krebs necesitii, evident, mecanisfne complementare
ce permit refacerea acestora
rilor ciclului Krebs poart numele de reactii anaplerotice, (ana = din nou;
pliro = a ample, a cornpleta).
Necesitatea reumplerii't cu substrate decurge din caracterul endergonic
al reactiilor biosintetice a c<1ror desf3urare se asigurd prin funcfia
catabolicii a ciclului Krebs.
Reaclia anapler.Oticij cea mai important^ este cea de carboxilare a
piruvatului la maEa^tkivezi mai sus).

Krebs se traduce prin acumulare de acetil-CoA, percepufiT de c&tre piruvat


carboxiligazfl care, activandu-jc, produce oxaloacetat. Acesta va fi utilizat in
reacjiile de sinteza sau va create viteza de desfaprare a ciclului Krebs (dac5
nu este suprasaturat).
in faza catabolica, enzjmele cheie ale ciclului Krebs sunt inhibate la
conceiitrajli^nwi^ dej^ADH, provenit prin 6 oxidarea acizilor grasi. fn
aceasta situate, oxaloacetatul se reduce la malat si iese in citosol unde- va fi
utilizat in gluconeQgeneza^"~^

Reacjii anaplerotice s-unt considerate i calfe 7ie"degradaie.;.a.


acizilor^grasi.................................................................cu numSr
impar.de atoms de carbon i a unor aminoacizi (izoleucnia, valinft,
metioniiia),. soldate cu formarea succinil-CoA.
Oxidarea glutamatului la a-cetogluteit este, de asemenea, o reacfie
anapleroticL
OxaioaceiaO
- Fosfoeno! piruvat
Glucoza
l
- Piruvat acetoacelil-CoA
f Triptofan < Leucina Feniiaianina ^Tiroana
Aspartat i
aminoaazi
Oxaloacetat
1 Pirimidinel
Maiatc
-Malat
Tirozina
Feniiaianina
Porfirine
- Fumarat
\
--- Sucanat
: Aceiii-CoA
- Cisteina Alanina Serina Glicina Treonina
-Acizi grasi I Leucina L Izoleudna f
Triptofan I
....
' compusi steroidia acid grasi

acetil-CoA
Izodtrat
-oc-Cetoglutarat Valina Metionina <J Izoleudna Treonina . Propionat
Glutamina t
* Glutamat
t,
Arginina Prolina S- HistidinaJ
Purine
aminoaaa
Fig. VII, 16 - Giclui Krebs - cale amfibolica (m s= mitosol; c = citosol)
340
QSL
4*1
->?;ATP
BILANJUL ENERGETIC AL ARDERII GLUCOZEI

In succesiunea de reacfii ce reprezintd ciclul Krebs, semnificative din


punct de vedere energetic sunt reacfiiie de oxidare. In ciclul Krebs, reactiile
de oxidare se soldeazd cu formarea de echiyplent'i feducdlori: NADH. FADH?,
Oxidarea coenzimelor reduse are loc la nivelul lanfului respirator, proces in
cursul cdruia, prin cupiarea oxidarii cu fosforilarea, este
VoaMLJiQfleXa.
Cml&g?
maclulpr cMuiui Krebs cu lanful respkatojSi^QSibiI3 grape localiz&rii
ijUramitpsplipe ji vecindtdfii spafiale p sistemelor enzipigtice indicate in cele
cloud.grocese. Oxidarea N ADH'duce, a$a cum s-a ardtat.