Sunteți pe pagina 1din 34

1 AND nu :

Structura: catena nucleotidica bicatenara,legaturi fosfodiesterice,ordine aleatorie


a nucleotidelor,secundara:2 catene cu punti de h ,antiparalele dublu spiralizate
,tertiara:and histone nonhistone
Proprietati : replicare
reparative
denaturare
renaturare
heterogenitate
variabilitate
flexibilitate
fragilitate
Monomeri Dntp
Tipuri AGCTGATCCCTGAA
TCGATAGGGACTT
Functii: contine IG
realizeaza IG
Pastreaza IG
Nr in cel umane: 46 mol.
Localizare:nucelu,maturizare:nucleuSinteza nucelu prin replicare principiile replicarii:matricial
complementar
antiparalel
semiconservativ
fidel
complex
semidiscontinuu
bidirectional
AND mit Structura (monomeri, legtura covalenta) inel nucleotidic legaturi
fosfodiesterice,ordine aleatorie a nucleotidelor mnomeri dNTP
Proprieti : replicare
reparative
denaturare
renaturare
heterogenitate
variabilitate
flexibilitate
fragilitate
Tipuri /exemle AGTCTATGCATG
TCAGATACGTAC
Funcii contine IG ,realizeaza IG,Pastreaza IG
Localizare Mitocondrii
Locul sintezei + sintetaza caracteristic + principii in mit prin replicare

:matricial
complementar
antiparalel
semiconservativ
fidel
complex
semidiscontinuu
bidirectional
Locul maturizrii +enzimele responsabile + principii mturizare in Mit
Nr n celulele umane : variabil
ARN :Structura : catena polinucleotidica leg fosfodiesterice ordinea nucleotidelor
copia ADN secudara :bucle,punti de H tertiara:Arnr +protein ribozomale
=ribozomi,arnt+protein=aminoacid arnm+protein=infirmozom monomer ;NTP
Prprietati: heterogenitate
flexibilitate
adaptabilitate
Functii: Asigura sinteza proteinelor
copia genelor structural
matrice pentru sinteza
formarea ribozomilor
translatia corecta a ARNt
transporta aminoacizi
transleaza ARNm
regleaza expresia IG
Nr in cellule umane: ARNm-variabil
ARN R 4 Variante
ARNt 20-61 variante
Exemple :AUGCGCUAAUCGAUCGUGCA
Localizare: nucelu
Maturizare:nucelu
Sinteza :nucleu prin transcripite,principiile transcriptiei:
Matricial,complementar,antiparalel,unidirectional,de novo,nonreparativ
Proteine :
Monomeri : aminoacizi
Structura : lant polipeptidi,leg polipepticie,ordinea determinata de
arn,secundara :punti de h,alfa spirale si beta structuri,tertiara-punti
bisulfidice,forma globulara ,cuaternala-combinarea structurala a mai multor
polipeptide
Tipuri : simple(histone actina tubulina) conjugate (nucleoproteide,glicoproteide)
;acide ,bazice,neutre
Functi : catalitica ,hormonala,de receptie,de transport,structurala,de sprijin,de

dezintoxicare,homeostatica,substra energetic.
Proprietati : heterogenitate,pot fi bazice acide asu neutre,interactioneaza cu alte
molecule, catalizatori, adaptabilitae,denaturare-renaturare,flexibilitatepolimorfism,sub molecular,hidroliza
Localizare : in componente celulare si extracelulcare,
Maturizare :ag cu chaperoni
Sinteza- pe ribozomi prin translatie,principiile
translatiei :matricial,complementar,unidirectional,denovo,nonreparativ
Nr in cel umane : variabil
Exemple :ADN polimeraza,actina miozina tubulina insulina etc.
2 Componente supramoleculare :DNP Organizare mleculara :
(D) Structura teriar a ADN complexe DNP (DezoxiNucleoProteid) localizat n
nucleu (n cromozomi); o cantitate mic de ADN (2%) se afl n mitocondrii. ADN
+proteine (histone (nonhistone): 1 nivel-nucleosom,2-solenoid,3-bucla,4 cromosom
Rol Proteinele histone- structural, n organizarea supramolecular a ADN n
cromatin i cromozomi, Proteinele nonhistone- funcional, intervenind n reglarea
funciei ADN-ul ui (replicare, reparative, transcripie
RNP 40S (60S) (80S) ribonucleoproteine OM:ARNr +protein ribosomale ARN r 18
S +33 proteine=40S,ARNr 5S 5,8S 28 S+50 proteine=RNP 60S RNP 60 S+RNP 40
S= RNP 80 S
functie :protectie impotriva arn azelor,formeaza str tertiara a ARN
RNP U(1-6) om:splicesoma ARN sn U1,U2 U3 U4 U6+60 PROTEINE,functii:splicing
U1-recunoaste GU
U2 recunoaste siusul A a buclei,
U4 cliveaza capatul 5 prim a intronul si formeaza ucla
U5 recunoaste AG a intronului,
U6 cliveaza capatul 3 prim a intronului si il inlatureaza

Localizare
1. Actina
2. ADN-aza
3. ADN-ligaza
4. ADNpolimeraza I 5.
ADN-polimeraza
6. ADN-polimerza

7.ADNtopoizomer
aza
8. ADN-ligaza
9. ADN-helicaza
10. Aquaporina
11. ARN-aza
12.
ARNpolimerazaM
13. ARNpolimeraza I 14.
ARN-polimeraza II
15.
ARNpolimerazaIII
16 ArgARNtsintetaza
17. ATP-aza
18. ATP-sintetaza
19. Ca 2+ -ATPaza 20. Catalaza
21. Chaperone
22. Cl- ATPaza=CFTR
23. Clatrin
24. Colagen
25. Ciclina A
26. Cliclina B
27. Ciclina D
28. Clclina E
29. Karioferine
30. D-aminoaciloxidaz

citosol
nucelu
Nucelu
Nuceleu
Nucelu
Nucleu
Nucelu
nucleu
NUCLEU
MEMRAN
A
NUCELU
mitocond
ri
nucleu
nucleu
nucleu
citosol
mitocond
ri
mitocond
ri
MEMBRA
NA
peroxizo
m
AG
membran
a
citosol
citosol

citosol
peroxiso
m
nucleu

Locul sintezii
si maturizarii
Rib libericitosol
Rib libericitosol
Rib libericitosol
Rib liberi
citosol
Rib libericitosol
Riblibericitosol
Rib libericitosol
Rib liberi
citosol
Rib libericitosol
REr-AG
Rib libericitosol
Rib liber
-citosl
Rib libericitosol
Rib libericitosl
Rib libericitosol
Rib libericitosol
Rib liberi
citosol
Rib liberi
citosol
REn-AG
Rib liberi
citosol
REr-AG
REr -AG
Rib liberi
citosol

Procese la care
participa
Reparatie replicare
Replicare reparatie
Replicare,reparatie
Reparatie
Reparatie
replicare
reparatie,replicare

Transcriptia
Transcriptia
genelor cl 1
Transcriptia
genelor cl 2
Transcriptia
genelor cl 3
Translatie

S g2 mitoza
G2 mitoza
G1
G1 s

Functii
Asigura formarea citoscheletului
Scindeaza ADN
Uneste fragmente de ADN
Sinteza ADN
Paricipa la repararea ADN
Sinteza si repararea ADN
Despiralizarea ADN
Uneste fragmente de ADN
Denatureaza catena de ADN
Transporta H2O
Scindeaza ARN
Sinteza ARN
Sinteza ARNr
Sinteza ARN m
Sinteza ARNt si ARNr 5S
Sinteza ARG
Scindeaza ATP
Sinteza ATP
Transprtul ionilor de ca
Scindeaza H2O2
Maturizarea proteinelor
Trnsport de Cl
Formarea veziculelor de transport
Deermina structura matrici
extracelulare atesutului onjunctiv
confera elasticitate
1Controleaz distrugerea
complexului stadiului precedent;
2. Stimularea evenimentelor
perioadei corestunztoare; 3.
Formarea sau activarea
complexului fazei urmtoar
Transport moleculelor din nucleu
in cit
Formeaza h2o2
Catallizaeaza hidroliza leg
fosfodiesterice
??????
Hidroliza leg peptiice intrun lant

31. Endonucleaza
32. Endonucleaza
acid
33.
Endopeptidaza
34.
Endopeptidaza
acid
35. Exonucleaza
36. Exonucleaza
acid
37. eIF
38. eEF
39. Fosfataza
acid
40Fosfatidiltransf
eraza
41. Glicogenaza
42. Glicozidaza
acida 43.
Clicoliaza
44. Glicoziltransferaza 45. Gtransferaza
46. Gly-ARNtsintetaza 47. H+
-ATP-aza
48. H1
49. H2A
50. H2B
51. H3
52. H4
53. -globina
54. -globina
55. Insulina
56. Lamine
57. Lipaza acid
58. Melanina
59. Miozina
60. MetARNtsintetaza
61. Na+ /K+ -ATP-

?????

Rib liberi
citosol

citosol

Translatie
Translatie

Factori de translatie,initierea
translatiei
Elongarea translatiei
Scindarea gruparilor fosfat a
esterilor
Adauga grupe fosfat

nucleu
nucleu
nucelu
perozixo
m
REn
LIZOOZM
lisosom
AG
AG
nucleu
citosol
lisosom
nucleu
Nucleu
NUCLEU
Nucleu
Nuleu
Membran
e
membran
a
membran
a
anvelpa
nuc
lisosom
membran
a
citosol
citosol
membran
a
lisosom
nucleu
membran
a

Rib liberi
citosol
Rib liberi
citosol

Processing capare
Translare

Rib liberi
citosol
???????
Rib liberi
citosol

Rib liberi
citosl
Rib liberi
citosol
Rib liberi
citsl
Rib liberi
citosol
REr-AG
REr-AG
REr-AG
REr-AG
REr-AG
Rib liberi
citosol
Rib liberi
citsol
REr-AG
Rib liberi
citosol
Rib liberi

Distrug acizii nucleici

translatie

transcriptie

replicare
Processing
poliadenilare
mitoza

Scindeaza glycogen
Scindeaza glucide
Leaga moleculele de glycogen
Adauga grupe glicozil
Adauga G la capatul 5 prim al arn
Sinteza Gly
Transporta ionii de H
Compactizarea AND
Compactizarea ADN
Compactizare ADN
Compactizarea AND
Compactizarea AND
Formeaza hemoglbina
Formeaza hemoglobina
Regleaza nivelul de glucoza
plasmatica
Determina forma nucleului
Scindeaza lipidele
Modifica culoarea pielii parului
Asigura contractgia fibrelor
muscular
Sinteza Metiononei
Transportul inilor de Na si K
Descmpune acizii nucleici
Sinteza si maturizarea ribosmilor
Recunosv undele de lumina
Adauga gr peptidil
Transpotr membranar
Descompune proteine
Sinteza unui fragment ARN ca
[rimer
Polimerizeaza ATP
Maturizarea kinetokrilor

aza 62. Nucleaza


acid
63. Nucleoline
64. Opsina
65.
Peptidiltransferaz
a
66. Permeaza
67. Proteaza acid
68. Primaza
69. Poli(A)polimeraza 70.
Proteine
kinetocorice
71. Receptor
insulinic 72.
Receptor la
testosteron
73. Receptor
LDL=LDLR
74. Riboforina
75. Restrictaza
76.Reverstranscri
ptaza 77. RF
78. Spectrina
79. SSB-proteine
80. SAP-proteine
81. SL1
82. Tubulina
83. Taqpolimeraza 84.
Telomeraza
85. TFIID
86. TFIIA
87. TFIIB
88. TFIIIA
89. Val-ARNtsinteraza
90. UBF

ribosom
membran
a
lisoosm
nucleu
nucleu
nucleu
membran
a
membran
a
membran
a
membran
a
nucleu
nucleu
nucleu
membran
a
nuc leu
nucleu
nucleu
citosol
nucleu
nucleu
nucleu
nucleu
nucleu
nucleu
citosol

citosol
Rib liberi
citosol
Rib liberi
citosol
Rib liberi
citosol
REr-AG
REr -AG
REr-AG
REr AG
REr-AG
REr-AG
Rib liberi
citosl
Rib liberi
citsol
REr-AG
REr-AG
Rib liberi
citosol
REr-AG
Rib liberi
citosol
REr-AG
REr-AG
Rib liberi
citsol
Rib liberi
citosol
Rib liberi
citosol
REr-AG
REr-AG

nucleu
REr-AG
REr-AG
Rib liberi
citosl
Rib liberi
citsol
Rib liberi

Clonarea in vivo
Replicarea arn viral
translatie
replicare

clonarea in vivitro
transcriptie
transcriptie
transcriptie
transcriptie
translatie
transcritpie

Recunosc insulina
Recunosc testosteronul
Recunosc particulele lipoproteice
cu densitate joasa
Fixeaza ribosomul de REr
Cliveaza zigzag produc catene
adezive
Replicarea arn viral
Termintareatranslatiei arn
Asigura forma biconcave a
eritrocitelor
Linierea catenei ADN
Recunoaste boxa tata
Asigura formarea citoscheletului
exonucleaza
Reverstranscriptaza arn
dependenta
Recunoaste boxa tata
Recunoaste boxa caat
Initierea transcriptiei hgenelor de
cl 2
Initierea transcriptiei genelor de cl
3
Sinteza Valinei
Initiaza transcriptia genelor cl 1

citosol
REr-AG
Rib liberi
citosol
Rib liberi
citosol
Rib liberi
citosol
Rib liberi
citosol
Rib liberi
citosol
Rib liberi
citosol
Rib liberi
citosol
Rib liberi
citosol
Rib liberi
citosol
Rib liberi
citosol
Rib liberi
citosol
Rib liberi
citosol
4

1.CITOPLASMA
2 VEZICULA DE TRANSPORT
3mitocondri
4membrana plasmatica
5.lizozom
6centrul celular
7 RE neted
8disc de mielina
9 peroxizom
10 RErugos
11. Nucleol
12 cromatina
13ribozomi
14AG

Organizare moleculara

Rol biologic

Biogeneza(pentru
organite)

plasmalema

Bistrat lipidic,proteine integrste


periferice,de
transport,receptoare,enzime

Bariera
semipermiabila,transport
selectiv a
moleculelor,receptionarea
si transmiterea
semnalelor,cnexiune intre
celule,regleaza
hmeostazia,support
pentru enzime

Lipide ren
glucide ag
proteine ribozomi

REn

Cisterne membrane lpg enzime

Sinteza lipidelor
memranare,sinteza
hormonilor,detoxifierea
xenobioticelor
medicamentelor,scindarea
glicogenului

Lipide ren
glucide ag
proteine ribozomi
fixati

REr

Cisterne si canale membrana


lpg+riboforine ce
fixeazaribozomii,transferaaze
chaperoniproteine r si cop 2

Asigura sinteza
proteinelor,sinteza
polipeptidelor,conformare
a proteinelor,sortarea si
transport spre AG

Lipide ren
glucide ag
proteine ribozomi
fixati

AG

Cisterne canalicule si
vezicule,membrana lpg +enzime ce
asigura maturizarea
proteinelor,secretoare,receptoare,cl
atrina si cop 1

Maturizarea si sortarea
proteinelor celularesi
secretilor celulari,
biogeneza lizozomilor,
reinoirea plasmalemei
polimerizarea
glicogenului

Lipide ren glucide


ag
proteine ribozomi
fixati

Mitocondrii

ADN inelar,ribozomi proprii,


arnm,arnt,arnr,enzime :atp
simtetaza ,enzimele aparatului de
replicare
,transcriptie,translatie,enzimele
lantului respirator,incluziuni de
fosfat de calciu

Asigura metaolismul
energetic, sinteza atp,
regleaza metabolismul
energetic , realizarea ig,
formarea rnp 55 s

Lipide ren
glucide ag
proteine ribozomi
liberi,import din
citosol si le
sintetizeaza
singure,sinteza
arnt,m,rtranscriptia

Nucleol

Secvente adn cu gene arnr,arnr 18s


5,8s 5 s 28 s,proteinele aparatului

Sinteza arnr
formarea subunitatilor

Transcriptia,

de sint\eaza si processing
arnr,proteine ribozomale

ribosomale

replicare

Lisosomi

Membrana LPG , contine h+atp aza


puternic glicolizata ,lizozom primarph=5,hidrolaze,nucleaze
acide,lipaze acide,lizozom
secundar=liz 1+substrat de
digerat,liz 3=reziduri dupa digerare

Hidroliza sub
organic,heterfagiadigestia sub
straine,autofagia-a
organitelor uzate ,
crinofagia-a hormonilr
sintetizati in exces

Lipide ren
glucide ag
proteine ribozomi
fixati

Peroxizomi

Lpg +oxidaze si catalaze

Detoxifierea,scindarea
h2o2

L-REn,G-AG,P-rib
liberi

Centrio li

4 triplete de microtubuli,fiecare cu
13 profilamente,alfa tubulina si beta
tubulina+dineina care fixeaza
microtubulii

Organizator al
microtubulilor,formeaza
fusul de diviziune in
timpul mitozei

Ribozomi

RNP80S=RNP 40S(ARNr 18S+ 33


proteine) + RNP 60 S(ARNr 5S .
5.8S,28S+ 50Proteine)

Asigura sinteza
proteinelor,sediul
translatiei ARNm

Cromozomi

Heterocrmatina puternic
compactizata,adn+
histome+nonhistone

Pastrarea si transmiterea
IG

Comatina(eu
si hetero)

Hetero :centromer,telomer, satelit ,


spacier,adn+histone+nonhistone
Eu slab condensata,doar adn

Asigura transcriptia IG
Sinteza
proteinelor,prevenirea
mutatiilor
genice,deferentierea cel
sex

Fusul de
dviziune

Microtubuli ai centriolului,alfa si
beta tubulina

Asigura aranjarea
cromozomilor la ecuator si
realizarea mitozei

__________________
_

Codifica pentru sinteza


proteinelor

____________

Gena
structurala

Fragment de adn

RNP 40S(ARNr
18S+ 33 proteine)
+ RNP 60 S(ARNr
5S .5.8S,28S+
50Protein)

________________

Gena cl 1

Fragment de adn

Codfica pentru sintweza


ARN r 5.8s 28s 18s

_____________

Gena cl 2

Fragment de adn

Codifica pentru sinteza

___________

proteinelor
Gena cl 3

Fragment de adn, monomeri ai


adnului dntp

Codifica pentru sinteza


ARNt si ARNr 5 s

ARNm

Monomeri ai arn ntp, fragmente de


arn

Matrita pentru sinteza


proteinelor

ARNt

Monomeri ai arn,fragmente de arn

Transleaza IG, transporta


aminacizi

Crs MC

Adn+histone +nonhistone+
telomeri

Pastarea si transmiterea
exacta a informatiei
ereditare

Crs BC

Adn+histone+nnhistone+telomer+c
entomer+ kinetocori

Pastarea si transmiterea
exacta a informatiei
ereditare

Bivalent

2 crs BC
Adn+histone+nnhistone+telomer+c
entomer+ kinetocori

Pastarea si transmiterea
exacta a informatiei
ereditare

splicesom

Rnp u1-u6

Inlatrarea intronilor

6 Replicare : Definiie-Proces molecular care se realizeaza prin copierea exacta a


mol de AND
Principii de realizare : matricial,complementar, bidirectional, abtiparale,
semiconservativ, fidel , semidiscontinuu , complex
Etape : Initierea:atasarea replisomului la punctual de origine a
replicrii,despiralizarea and,
sinteza arn primer
adaugarea de dezoxiribonucleotide la 3 prim
elongare : cresterea catenei lider
sinteza fragmentelor okazaki
controlul erorilor
terminare :inlaturare arn primer
inlocuirea golurilor
unirea capetelor
Aparat de realizare (caracterizat fiecare element):molecula AND
Situs ORI-originea repliarii
AND polimeraza polomerizeaza nucleotide
topoizomeraza-despiralizarea adn

helicaza-denatureaza
primaza-face un primer de 10 20 nucleotide
and ligazaprotein ssb-liniaza catena
telomeraza(pentrucapete)
Dntp
ntp
factori stimiulatori ai mitozei
Rol biologic: transmiterea exacta a IG de la o generatie la alta ,astfel toate cleulele
vor contien aceeasi informative genetic
Reparatie :process de restabilire a leziunilor din moleculelor de AND
Etape: NER

BER

RECUNOASTEREA DIMERULUI
modificate
inlaturarea fragmentelor
campletarea golului
fara baza
ligarea AND

recunoasterea bazei
inlaturarea bazei modificate
inlaturarea nucleotidului
completarea golului
legarea AND

Principii: complementar
antiparalel
specific
Aparat: AND+dimr pirimidinic
factori de recunoastere a dimerului
endonucleaze
helicaze
AND polimerza
Dntp
AND ligaza
XPA
XRA

AND cu o baza modificata


factori de recunoastere
glicoliaza
endonucleaze
AND polimeraza
dntp
and ligaza
ap liaza-cap 3 prim
ap hidrolaza-cap 5 prim

Rol : pastrarea intact a materialului genetic


Transcriptia: process de copier a IG din and prin sinteza molecllor de and
Etape: Initierea: identificarea si activarea genei tinta
formarea complexului de initiere a transcriptiei
identificarea +1 si directiei transcriptiei
formarea complexului deschis
asocierea cu enhancer

Elongarea:alunecarea and polimerazei 2 pe matrita and 3 prim 5 prim


sinteza arn 3prim 5 prim
terminarea:recunoasterea secventei poly a
intilneste arn polimeraza
disocierea complexului arn polimerazei
Principii: matricial
cmplementar
antiparslel
unidirectional
de novo
nonreparativ
Aparat de transcriptie: and ,arn polimeraza 1 2 3 -POLOMERIZEAZA NUCLEOTIDE
atp, ctp ,gtp, utp,-Monomeri ai arn
tfs2a,-recunoaste boxa caat
b denatureaza adn
d recunoaste boxa tata
e ,h permite alunecare arn polimerazei
f helicaza,denatureaza local
tf3a,b-initierea transcriptiei genelor de cl 3
ubf,sl1-initierea transcriptieu genelor de cl 1
Rol: sinteza ARN
Translatia process de convertire a tripletilor din molecula de arn in aminoacizi
Principii: matricial,complementar, unidirectional,de novo, nonreparativ,
Etape: Initierea : formarea leg peptidice intre aminoacozi
formarea complexuli met arnt
activarea complexului met arnt
activarea complexuli met arnt prin adaugarea gtp
formarea complexuli met arnt gtp sub mica
asocierea complexly la arnm
recnoasterea ag
elongare: formarea complexelor aminoacil arnt
activarea complexelor prin adaugarea de gtp
transportarea la situsul a
transfer din situs a in situs p a arnt
eliberarea din situsp ,gtp +ribosom
translocarea ribosomului
terminare :eliberarea lantli polipeptidic
Aparat:ARNm
arnt
ribosom c peptidil transferaza
aminoacizi
factori de translatie:eif,eef,rf

energie:atp,gtp
sub ribosomale:40s 60 s
peptidil transferaza
aa arnt sintetaza
translaori
ribosomi
ca=,hg+
Rol :sinteza proteinelor
Splicing: inlatrarea intronilor
Etape: Recnoasterea gu 5 prim-U1
recnoasterea situslui a a bceli-U2
recnoasterea ag a cap 3 prim a intronilor-U5
clivarea 5 prim a intronli si formarea bclei-------------------clivarea 3 prim si inlatrarea intronului--------------------nirea exonilor---------------------------------------------------------aparat: rnp u1-u6 ,intron pre arnm

U4-U6

Recombinare intracromozomiala: crossing over: incrucisarea cromosomilor


omologi si schimbl reciproc de fragmente omoloage
Etape:1 liptoten:incepe cndensarea cromozomilor
2 zigoten: conjugare
3politen-crossing over
4diploten: finalizarea crssing overli,respingerea cromosomilor
5 pregatire pentr rmatoarea etapa a meiozei,terminarea chiasmelor
Aparat: complexl sinaptonemal, crmozomi mologi
Rol: variabilitate genetica a gametilor
Recombinare intercromozomiala: orientarea aleatorie a cromozomilr omologi
spre polii opusi ai celulei
etape:anafaza 1
aparat:cromozomi neomologi paterni si materni
rol:variabilitatea genetic a gametilor
Apoptoza moartea celulara programata ,process fiziologic
Etape: Cresterea activitatii endoncleazelor
fragmentarea and,condensarea cromatinei si citoplasmei
fragmentarea ncleli si celulei cu formarea corpilor apoptotici
fagocitarea corpilor apoptotici de celle vecine
Mecanisme moleclare : Recunoaterea semnalului de ctre receptori
Transmiterea semnalului la factorul de transcripie 53
Creterea permeabilitii membranei mitocondriale datorit aciunii 53
asupra genei bcl-2
Activarea cascadei capsazelor i proteoliza
Activarea endonucleazelor nucleare i fragmentarea cromatinei

Fragmentarea celulei cu formarea corpilor apoptotici


Fagocitoza corpilor apoptorici
Rol: determina homeostazia tisulara
7 Fagocitoza: 1 recnoasterea hemotaxisului
2 inglobarea si formarea veziculei
3contopirea c vezicula lizozomli
4 formare lizozomului tertiar
1 Adeziunea - membrana celulei fagocitare ader la membrana particulei, ce
urmeaz a fi ingerat, etap datorat lectinelor de pe suprafaa microorganismului;
2 Ingestia - invaginarea particulei strine i formarea fagozomului;
3 Digestia - realizat de enzime intracelulare.
Exocitoza: . 1Transportul veziculelor de-a lungul fibrelor citoscheletale
Proteinele sintetizate n re sunt transportate la ag unde sufer modificri secundare.
La ieirea din ag proteinele sunt din nou ncorporate n vezicule ce le vor transporta,
de-a lungul fibrelor de actin sau tubulin, ctre periferia celulei.
2. Capturarea veziculelor lng membrana int[
Odat ajunse lng membrana int, molecule asociate acesteia interacioneaz cu
molecule asociate membranei veziculare, limitnd n acest fel mobilitatea cruilor.
3. Ancorarea veziculelor la membrane
descrie alturarea la distane mai mici de 5-10 nm i interaciunea stabil a unor
membrane. Acest proces depinde de un complex (numit SNARE) carel fixeaza
vezicula lng membran.
4. Condiionarea
secreia sinaptic.
5. Fuziunea
Reprezint unirea celor dou membrane (vezicular i int), fiind finalizat fie prin
eliberarea coninutului veziculei (enzime, hormoni, neurotransmitori, toxine) n
spaiul extracelular
Biogeneza lisozomilor : 1lipide de la ren,proteine de la rer
2 ag glicozilare
3impachetare in vezicle
4 reinnoirea organitelor
Biogeneza peroxizomilor: membrana peroxizomilor este generat prin rennoirea
fosfolipidelor de la RE neted. Proteinele peroxizomale sunt sintetizate de ribozomii
liberi din citozol. Se presupune, c catalaza are o secven semnal, orientat spre
citozol, ce recunote enzimele peroxizomale ntegrndu-le n organit. Noii
peroxizomi apar prin diviziunea peroxizomilor preexisteni.

Biogeneza ribosomilor: RNP80S=RNP 40S(ARNr 18S+ 33 proteine) + RNP 60


S(ARNr 5S .5.8S,28S+ 50Proteine) ARNR 18S.28S 5,8S- EXPRESIA GENE DE CL
1,ARNR 5S EXPRESIA GENELOR DE CL 3
Etapele expresiei genelor de cl 1 :
gene arnr 18s 5,8 s 28 s

1 identificarea si transcriptia genei- ubf sl1,arn polimeraza1 ntp-pre arnr 45 s


2 processing-arnsno,arnaza si ribozime--arnr 18s 5,8s 28s
3 formarea sbnitatilor ribozomale-ncleolinernp 40s 60s
4transfer in citoplasma-exprtineribozom 80s
Etapele expresiei genelor de cl 2
1 identificarea si transcriptia genei-tafs+tf2d,a,b,f,e,h , arn polimeraza 2 ,ntppre
arnm
2 processing : capare-g tranferaza +gtp
poliadenilare-poliapolimeraza +atp
splicing-ribozime u1-u6arnm
3 transfer din ncle in citoplasma-eportine
4translatia arnm-arnt,aa,factori de trasnlatiepolipeptid
5 matrizarea proteinei-chaperoni,transferaze,peptidaseproteina
Etapele expresiei genelor de cl 3
arnr 5s
1Identificarea si transcriptia-tf3a,b,arn plimeraza 3 ,ntp prearnr
2 processing-riozimearnr5s
3 formarea sb ribozmalernp60s
4 transfer din ncle in citoplasma-exportineribozom 80s
arnt
1Identificarea si transcriptia-tf3a,b,arn plimeraza 3 ,ntp prearnt
2 processing-riozimearnt
3 transfer din ncle in citoplasma-exportinearnt
4.asocierea arnt+aa-aa-arnt-sintetazaaa arnt
Functia
gena

Histona
3

clas
a

Etapele expresiei

La nivel
molecular

La nivel
celular

La nivel de
organism

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in

Codifica
pentr u
sinteza
proteinei
histona 3

Compactizar
ea adnului

Pastrarea ig

citoplasma
4translatia
5 matrizarea proteineiARNr
28S

1Identificarea si transcriptia
2 processing
3 formarea sb ribozmale
4 transfer din ncle in
citoplasma-

Codifica
pentru
sinteza
proteinei
ARNr 28 s

Formarea
subunitatilor
ribozomale

Sinteza
proteinelor

Tubulin
ei

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Codifica
pentru
sinteza
proteinei
tubulina

Formeaza
fusul de
diviziune

Asigura
mitoza si
meioza

Histonei
2a

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Codifica
pentr
sinteza
proteinei
histona 2a

Compactizar
ea adnului

Pastrarea ig

SerARNt

1Identificarea si transcriptia
2 processing3 transfer din ncle in
citoplasma4.asocierea arnt+aa

Codifica
pentru
sinteza
proteinei ser
ARNT

Transprta
aminoacizii
spre
ribozomi

Sinteza
proteinelor

Helicaze
i

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Codifica
pentr
sinteza
proteinei
helicaza

Despiralizar
ea adnului

Asigura
replicarea

Ncleazei
lizozom
ale

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Codifica
pentr
sinteza
proteinei
ncelaza
lizozmala

Scindeaza
acizii
nucleici

ARNr 5s

1Identificarea si transcriptia2 processing- 3 formarea sb


ribozmale
4 transfer din ncle in
citoplasma

Codifica
pentru
sinteza
ARNr 5s

Formarea sb
ribozomale

Sinteza
proteinelor

Catalaz
ei

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Cdifica
pentr
sinteza
prteinei
catalazei

Oxidarea
peroxizomil
or

Asigura
detoxifierea

TF2d

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Codifica
pentr u
sinteza
proteinei
tf2d

Recunoaste
boxa tata

Initiaza
transcriptia,
asigura
sinteza
proteinelor

Actinei

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Codifica
pentru
sinteza
actinei

Formeaza
fibrele
musclare

Participa la
contractia
musclara

ARN
polimer
azei
beta

Arn
polimer
azei 1

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Codifica
pentru
sinteza arn
polimerazei
peta

Sinteza ARN

Realizeaza
replicarea

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Codifica
pentr
sinteza arn
polimerazei
1

Sinteza arn

Transcriptia
genelor de cl
1

Spectri
na

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Codifica
pentr
sinteza s
spectrinei

Stabilitatea
eritrocitelor

Asigra forma
biconcave a
eritrocitelor

cl-ATP
aza

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Codifica
pentr
sinteza cl
atp azei

Asigra
transportl
ionilor de
clor

Asigra
transportul
transmembra
nar

MetARNt

1Identificarea si transcriptia
2 processing3 transfer din ncle in
citoplasma4.asocierea arnt+aa

Codifica
pentr
sinteza metarnt

Transporta
aminoacizii
spre ribozmi

Sinteza
proteinelor

TF2D

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Codifica
pentru
sinteza tf2d

Recnoaste
boza tata

transcriptia

Ciclina
A

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Codifica
pentru
sinteza
ciclinei a

Stimularea
evenimentel
or perioadei
corestunzt
oare g1 s

Asigra mitoza

Lipaza
acida

1 identificarea si 2transcriptia
genei
processing : capare
poliadenilaresplicing3 transfer din ncle in
citoplasma
4translatia
5 matrizarea proteinei-

Codifica
pentr
sinteza
proteinei
lipaza acida

Scindeaza
lipidele

9 clasificarea micromoleclelor :forma :liniara,si spatiala


legatri formate :fosfodiesterice,peptidice
locl sintezii :nucle,citoplsma
locul maturizarii : nucleu citoplasma
rol biologic : purtatoare de informatie :adn,arn ,biogeneza organitelor :lpg
Clasificarea acizilor ncleici :dpa tipl de ncleotide,dupa strctra,dpa functie etc
Clasificarea proteinelor :simple :histone nonhistone,actina tblina
conjugate:collagen keratina fibrinogen
solbile(fibroase)
insolbile(globlare)
fnctie:protective :imunogloblinele
structural:collagen elastina
contractile :actina miozina
transport :hemoglobina
catalitica :hormoni

Regleaza
ciclul cellar

grpari : fofoproteide
glicoproteide metaloproteine
membranare : intreseci
periferice
transmembranare
Clasificarea organitelor functie : scindare : lizozomi peroxizomi,ncleu
mit,citoplasma
sinteza :ren rer ag ncle,rib mit cit
transport : organite membranare
detoxifiere :ren peroxizomi
prezenta ribosomilor :+ ncle rer mit
- celelalte
detine ig : nucleu mit
- celelalte
prezenta membranei : 1 ren,rer,ag lizozomi,peroxizomi
0 ribozomi,centrozomi,ncleol
2 mit nucleu
prezenta :obligatorie :ren rer ag liz,pero,mit,nucleu
speciale :microvilozitati,citoschelet,vezicle,flageli
permanente(obligatorii)
provizorii :inclziuni,fs de diviziune
nr in cella : 1 ncleu re ag centrozom
mlte : celellalte
Clasificarea genelor activitate :active inactive
clasa :1 2 3
fnctia : structurale, arnr anrt microarn pseudogene,transpozomi
localizare : mit nucleu
tip de proteine sintetizate : enzime
receptori
modulatori
jormoni
imnoglobline
locl expresiei : hose keeping
test specific
perioada expresiei
nr de copii : nice repetitive familii de gene
sperfamilii de gene
10 Comparatie :
ADN
ARN
dublu catenar

monocatenar
ncleotide
leg covalente fosfodiesterice
baze azotate constante

T
datp,dgtp,dctp,dttp

U
utp,ctp,gtp,atp

structura secundara :pnti de h


adn + proteine histone+nonhistone
arnr+proteine=ribozomi
arnm+proteine=infimosom
arnt + proteine
=aminoacid

replicare
adn polimeraza
pastrarea IG
IG sinteza prot
mitocondrial,nclear
realizarea IG
proteinelor
dezoxiriboza
Gene cl 1
arnr
biogeneza ribozomilor
sinteza proteinelor
sinteza proteinelor
arn polimeraza 1
promotor partial transcris
ste de copiii
active in toate cel
in toate celulele

localizare nucleu
maturizare nucleu
sinteza
functie

transcriptie
arn polimeraza
transmiterea

clasificare
ROL BIOLGIC

arnt arnm arnr


sinteza

pentoza

riboza

gene cl 2
gene cl 3
protein
arnt
asigura strtra si funtiile org
organosm fercit
``
organism sanatos
arn polimeraza 2
arn polimeraza 3
+enhancer silencer,intron exon situs poli a
netranscris
transcris
nice irepetabile
mii de copii
active in toate ,inactive tesut specifice
active

Replicare
transcriptie
ori
secventa reglatoare a initierii
promotor
intilnirea frcilor replicative
a terminarii
temrinator
etape :initerea elongarea terminarea
dntp
monomer
ntp
adn polimeraza
arn polimeraza
bidirectional,fidel,
matricial
unidirectional,nonreparativ
semiconservativ
complememntar
de novo
swmidiscontinuu,complex
antiparalel
continuu
ambele catene
catena matrita
catena
anticodogena
mol de adn
prods final
mol de arn
s
perioada ciclli cellar
interfaza

transmiterea ig altor celle


proteinelor

ROL BIOLOGIC

sinteza

Transcriptie
translatie
copierea scventei de ncleotide definitie
decodificarea sec
de ncleotide
arn
prods final
polipeptid
antiparalel
matricila,complementar,nidiretinal,de novo nonreparativ
catean anticodogena adn catena matrita
arn
3 prim 5 prim
directia citirii matritii
5 prim 3
prtim
3 prim 5 prim
directia polimerizarii
5 prim 3
prim
ncleotide
nitati de polimerizare
aminoacizi
arn polimeraza
peptidil polimeraza
promotor
secvente initiatoare
aug
terminatr
secvente terminator
cdon stop
nucleu
locul desfasurarii
ribizomi
sinteza arn
rol biologic
sinteza proteinelor
REPLICARE
dublara cantitatii adn
defectului
pastrarea ig
generatii

REPARATIE
inlaturarea
transmiterea ig altor

Prods final mol de and


monomer dntp
initiere elongare terminare
defectului

recunasterea
INLATRAREA,
completarea golului

Splicing constitutive

Splicing alternative
inlatrarea intronilor
processing

inlaturarea ttror intronilor


intronilor
obtinerea mai multor protein de acelasi fel
de protein
Clonarea in vivo
Etape:izolarea plasmidelor ca vedtor de clonare
amestecului cu toate
izolarea and uman
clivarea plasmidei si and man

inlaturarea diferentiata a
obtinerea mai mltor tipuri
clonarea in vitro
Pregtirea
componentele reactante
Rcirea pn la t de

renaturare a prime introducerea and rec in celula bacteriana


Elongarea
catenelor ADN la 72o
clonarea celulei transformate
Repetarea procedeiloe de 30-35 ori C.
selectia cel transformate
Analiza produilor PCR electroforeza colorarea - interpretarea
rezultat
Tehnica and recombinant
tehnica pcr
replicarea intrn vector de clonare c tilizare
replicarea nei secventa
de interes cu
a aparatli de replicare a cellei gazed
ajutorl nui aparat
de repl artificial
c posibilitatea obtinerii produsului proteic
Mitoza

Meioza
1 div
2div
cel somatice
cel ce se divid
cel sexuale
+
replicarea inaintea divizinii
+
condensarea cromosomilor
P
disocierea anvelopei nucleare
formarea ap de div
mat kinetocorilor
condensarea cromosomilor
mat
kinetocorilor
disocierea anvelopei nucleare
formarea fusului de divizine
disparitia nucleoli
crossing over
Formarea fsuli de diviziune
organizarea crs la ecuat
unirea crs si centriolilor

Clivarea long a centromerilor


a centro
separarea cromatidelor srori
cromatide surori
migrarea spre poli
spre poli
set tetraploid de crs

orientarea crs spre polii cel


crs bivalenti la ecuator

Migrarea crs spre poli


T
reorganizarea anv nucl
decondensarea
reducerea nr de crs
disocierea fibrelor fsuli
reasamblarea memb ncleare
Celle somatic diploid
cel obtinute
spermatozoizi

disjnctia crs

clivarea long

migrarea spre poli

disj

rec.intercromozomiala

reorganizarea anv nucl


reducerea nr de crs
citochineza
spermatocit sec

migrarea

ovocit sec
ovule
Rol
transmiterea IG de la mama la copil

Asigra cresterea si dezvoltarea


organismului,transmiterea IG
Mitoza
Cel normale
Imltirea cel somatice
etape :p,m,a,t

Apoptoza
cel mutante,batrine,straine
moartea programata
fradmentarea adn
fratgmentarea nucleului
fagocitoza corpurilor apoptotice

process fiziologic
in urma nor favtori
G1
Intensificarea transcriptiei
decondensarea cromatinei
reorganizarea nucleolilor
MC

G2
replicarea AND
Transcriptia
sinteza de protein sinteza proteinelor
dblarea centriolilor formarea microtbulilor
BC
BC

Transcriptie,translatie ,reparative
replicare (S)
pregatirea pentr mitoza `
comactizarea and pregatirea pentr mitoza
realizarea ig
sinteza proteinelor sinteza proteinelor
Recombinare intracromozomiala
intre crs omologi
crossing over p
are 5 faze
determinate de complexul sinaptonemal
poli
rol: variabilitate genetic a gametilor

11

Identificati
procesul la care e
implicat

recombinare intercromozomiala
intre crs neomologi
a1
2 la n combinatii
orientarea aliatorie a crs omologi spre
variabilitate genetic a gametilor

Gasiti responsabilii
de recnoastere

Consecintele defectului

Situs A

Translatie

Bucla acceptor arnt

Lipsa proteinei

Sintus P

Translatie

Peptidul arnt

Lipsa proteinei

Situs R

Translatie

Arnm

Lipsa replicarii adn

Situs T

Translatie

Peptidil transferaza

Protein defecta

ORI

Replicare

Replisoma

Lipsa replicarii

Bozele
promot
genei cl 1

Transcriptie

UBF SL1

Lipsa proteinei

Transcriptie

TF3A,B,C

Lipsa proteinei

Tata-box

transcriptie

Tf2d

Lipsa proteinei

Caat-box

transcriptia

Tf2a

Lipsa proteinei

Situs +1

transcriptia

Arn polimeraza 1 2
3

Lipsa proteinei

Cap

processing

Ribozom

Lipsa proteinei

Poly a

processing

Porii nucleului

Lipsa proteinei

Secventa
lider arnm

translatie

Arn polimeraza 2

Protein defecta

Aug

translatie

Anticodonl arnt

Proteina defecta

UAG

translatie

Sitsrile ribosomlui

Protein defecta

Bucla d

translatie

Aminoacil arnt
sintetaza

Lipsa proteinei

Bucla psi

translatie

Ribozom

Lipsa proteinei

Sr(sits de
restrictie)

And recombinant
clonare

Enzime de restricite

And defect

And cu
dimer

Reparare ner

Factori de
recunoastere a
dimerulului

And defect

And cu baza
modificata

Reaprare ber

Factori de
recnoastere a

And defect

Boxele
promot
genei cl 3

+bazei modificate
R1 g1/s

mitozza

Ciclina d ,e+cdk

Mitoza cu greseli

R2 g2/mitoza

mitoza

Ciclina a b

Mitoza cu greseli

12
Celula
umana

Nr de crs

Functia crs

Nr de gene

biogeneza

Zigot

46

Pastreaza IG

30 mii perechi

fecundare

STEM

46

Pastreaza IG

30 mii perechi

Limfocit

46

Pastreaza IG

30 mii perechi

mitoza

Eritrocit

--------

Pastreaza IG

30 mii perechi

mitoza

Neuron

46

Pastreaza IG

30 mii perechi

mitoza

Miocit

46

Pastreaza IG

30 mii perechi

mitoza

Osteocit

46

Pastreaza IG

30 mii perechi

Mitoza

Enterocit

46

Pastreaza IG

30 mii perechi

Mitoza

Hepatocit

46

Pastreaza IG

30 mii perechi

mitoza

Ovogonie

46MC

Pastreaza IG

30 mii perechi

ovogeneza

Ovocit 1

46 BC

Pastreaza IG

60 mii perechi

replicare

Ovocit2

23BC

Pastreaza IG

30 mii perechi

Meioza 1

Spermatog
onie

46 MC

Pastreaza IG

60 mii perechi

spermatogenez
a

Spermatoc
it 1

46 BC

Pastreaza IG

30 mii perechi

replicare

Spermatoc
it2

23 BC

Pastreaza IG

30 mii perechi

Meioza 1

Spermatid
a

23BC

Pastreaza IG

30 mii perechi

Meioza 1

NR DE
CROMOZO
MI

NR DE MOL
DE ADN

NR DE
CROMATIDE

FROMULA
CROMOZOMI
ALA

G1

46

46

46

2N=2c

46

92

92

2n=4c

G2

46

92

92

2n=4c

PROFAZA

46

92

92

2n=4c

METAFAZA

46

92

92

2n=4c

ANAFAZA

92

92

92

4n=4c

TELOFAZA

46

46

46

2n=2c

PROFAZA 1

46

92

92

2n=4c

METAFAZA 1

46

92

92

2n=4c

ANAFAZA 1

46

92

92

2n=4c

TELOFAZA 1

23

46

46

N=2c

PROFAZA 2

23

46

46

N=2c

METAFAZA 2

23

46

46

N=2c

ANAFAZA 2

23

46

46

2N=2C

TELOFAZA 2

23

23

23

N=c

13

CELULE
SOMATI
CE

CELULE
SEXUAL
E

Procese
genetice
caracteris
tice

Evenimente moleculare si cellare

Rol biologic

G1

Transcript
ie,
translatie,
reparatie

Intensificarea transcriptiei si
proteosintezei
decondensarea cromatinei
reorganizarea nucleolilor
cromozomi mnocromatidieni

Pregatirea
pentru
mitoza
realizarea IG

Transcript
ie,
translatie,
reparatie

Replicare
semiconservativa,asincrona a adn
dblarea cantitatii de and
cromozomi bicromatidieni

Compactizare
a adn
sinteza

14

C
E
L
U
L
E
S
O
M

A
T
I
C
E

C
E
L

sinteza de protein histone si


nonhistone
dblarea centriolilor

proteinelor

Transcriptia
sinteza proteinelor
inceperea formarii microtbulilor

Sinteza
proteinelor,
transcritpia

PROFAZ
A

Condensarea crs
maturizarea kinetocorilor
disparitia ncleolli
disocierea membrane ncleare
centriolii de deplaseaza spre polii
opusii ai cellei
asamblarea microtubulilor

Asigura
cresterea si
dezvoltarea
organsimlui

METAFA
ZA

Formarea fusului de divizine


unirea crs si centriolilor prin
kinetocori
formarea placii ecatoriale
cromozomi maximal compactizati

Formarea fsului
de dicviziune

ANAFAZ
A

Clivarea long a centromerului


separarea celor 2 cromatide
surori
migrarea cromatidelor spre polii
celulei
crs monocromatidieni
set tetraploid de crs
segregarea mat genetic

Impartirea
egala a mat
genetic

TELOFAZ
A

Migrarea crs spre polii cellei


fiecare poli contine 2n MC
decondensarea progresiva a crs
revenirea la starea cromatinei
interfazice
disocierea fibrelor fusil acromatic
reasamblarea membrane ncleare
reaparitia nucleolului
citochineza-separarea masei
citplasmatice in 2

Mostenirea mat
genetic exact

Disocierea anvelopei nucleare


condensarea crs
formarea fsuli de divizine

Recombinarea
materialului

replicare
G2

PROFAZ
A1

Transcript
ie,
translatie,
reparatie

replicare

U
L
E
S
E
X
U
A
L
E

1
2
3
4
5
6
7
8

maturizarea kinetocorilor
formarea comlexuli sinaptonemal
crossing over:liptoten,zigoten
,pahiten, diploten diochienza

genetic

METAFA
ZA 1

Crs bivalenti la ecuator


orientarea crs spre polii celulei

Formarea placii
metaepifizare

ANAFAZ
A1

Disjunctia crs omologi


migrarea spre poli a crs BC cite n
la fiecare pol
recombinarea independent a
omologilor-intercromozomiala

Recombinarea
intercromozomi
ala formarea
gametocitului
primar

TELOFAZ
A1

Reorganizarea anvelopei nucleare


cu formarea a 2 nuclei haploizi
citochineza
rezlta 2 gametociti cu set haploid
de crs BC reducerea nr de crs

Formarea
gametocitli
secundar

PROFAZ
A2

Formarea aparatlui de divizine


maturizarea kinetocorilor

Formarea
fusului de
diviziune

METAFA
ZA2

La ecator crs intrun singur plan

Formarea placii
ecuatoriale

ANAFAZ
A2

Clivarea longitudinal a
centromeruli
disjnctia cromatidelor surori
migrarea spre poli a crs MC

Impartirea
exacta a mat
genetic

TELOFAZ
A2

Reorganizarea anvelopei nucleare


ci formarea a 2 nuclei haploizi
citochineza
4 gameti cu set haploid de crs MC

Formarea
gametilor

g1
2n=2c
s
2n=4c
profaza
2n=4c
metafaza 2n=4c
anafaza
4n=4c
telofaza
2n=2c
celula fiica
2n=2c
celula fiica
2n=2c

1
2
3
4
5
6

g1
2n=2c
s
2n=4c
profaza 1 2n=4c
metafaza 1
2n=4c
anafaza 1 2n=4c
telofaza 1 n=2c
7 profaza 2 n=2c
8metafaza 2
n=2c

9 anafaza 2 2n=2c
10 telofaza 2
n=c
11 gametocit secndar n=c
16

Etape

Aparat de realizare

Rol practice

Clonarea
in vivo

1 Izolarea ADN de cercetat i a


vectorilor de clonare
2 Clivare enzimatic a ADN de
cercetat i vectorului de clonare
3 Ligarea fragmentului de ADN de
interes cu vectorul de clonare
obinerea ADN recombinant
4 Introducerea ADN recombinant
ntr-o gazd de clonare
transformare
5 Clonarea genei de interes prin
replicarea vectorulu
6 Expresia genei de interes prin
sinteza proteinei
7 Selecia celulelor transformate
prin tratare cu antibiotice i utiliznd
marcherei radioactivi sau
fluoresceni

-ADNde clonat :
FR,ADN c
-vector de clonare
-2 et :enzime de
reztrictie
-gazda de clonare
comatribila c
vectorul
-sistem de selectie a
clonelor analizate
-set de enzime
pentru maniplare
ADN
ADN ligaza

Terapie
genic
(alegerea
genei int,
construirea
vectorilor de
gene etc.).

1 Pregtirea amestecului cu toate


componentele reactante
2 Repetarea automat a
procedurelor de
denaturarerenaturare-elongare de
30-35 ori
-denaturarea AND la 96 gr C
-Rcirea pn la temperatura de
renaturare a primerilor 30 gr c
-Elongarea catenelor ADN la 72 gr C

- ADN de cercetat
- Primeri specifici
secvenei de clonat
complimentari
secvenelor
flancante
- Taq-polimeraza
ADN-polimeraz
termostabil
Dezoxinucleozidtrifos
fai (dNTP)
- Instalaie de
modificare ciclic a
temperaturii:

Conarea
in vitro

3 Analiza produilor PCR


- electroforeza
- colorarea
- interpretarea rezultatelor

1 eta Cellule
nucleate
sol hipotonice
detergent
proteaza
solvent organic
alcooli,saruri

Identificarea
polimorfism
elor
individuale
multiplicare;
izolare i
formare a
bibliotecilor
de ADNrec
analiz
molecular.

Terapie
genic
(alegerea
genei int,
construirea
vectorilor de
gene etc.).
Identificarea
polimorfism
elor
individuale
multiplicare
izolare i
formare a

- t de denaturare
ADN
- t de renaturare
(ADN+primer)
- t de polimerizare
(elongarea catenelor
noi de ADN)

bibliotecilor
de ADNrec
analiz
molecular.

Eletrofore
za

1. Tamponul de electroforez
2. Prepararea gelului de agaroz
2. Turnarea gelului
3. Pregatirea probelor
4. Montarea electroforezei i
incarcarea probelor
5. Pornirea electroforezei
6. Colorarea gelului
7. Vizualizarea moleculelor de ADN
din gel

-tampoane de
electroforeza
gel de agaroza
aparat de
electroforeza
proba de and
bromura de etidiu
aparat de fotografiat

Cercetarea
adn
stabilirea
paternitatii

Restrictia
and

1 Izolarea and de cercetat si a


vectorilor de clonare (identificare
SR)
2 clivare enzimatica a adn de
cercetat si vectorlui de clonare (c
BamHI)
3 ligarea fragmentlui de adn de
interes c vectorl de clonare
obtinerea adn recombinant

ADNde clonat :
FR,ADN c
-vector de clonare
-enzime de reztrictie
-gazda de clonare
comatribila c
vectorul

Recombinar
ea genetica

RFLPs

Polimorfisml lungimii fragmentelor


de restrictive ce identifica
diferentele individuale a mol de
ADN

Fr adn

Identificarea
polimorfism
elor
individuale

PCR

1 Pregtirea amestecului cu toate


componentele reactante
2 Repetarea automat a
procedurelor de
denaturarerenaturare-elongare de
30-35 ori
-denaturarea AND la 96 gr C
-Rcirea pn la temperatura de
renaturare a primerilor
-Elongarea catenelor ADN la 72 gr C

- ADN de cercetat
- Primeri specifici
secvenei de clonat
complimentari
secvenelor
flancante
- Taq-polimeraza
ADN-polimeraz
termostabil
Dezoxinucleozidtrifos

Identificarea
polimorfism
elor
individuale

3 Analiza produilor PCR


- electroforeza
- colorarea
- interpretarea rezultatelor

fai (dNTP)
- Instalaie de
modificare ciclic a
temperaturii:
- t de denaturare
ADN
- t de renaturare
(ADN+primer)
- t de polimerizare
(elongarea catenelor
noi de ADN)

Izolarea
and
genomic

1 colectarea materialului biologic


(celle nucleate din orice tesut)
2 izolarea nucleilor (prin lezarea
cellelor in sol hipotonice)
3 lezarea cellelor(prin actinia
detergentilor)
4 deproteinizarea(prin actinia
proteazelor si prelcrat cu solvent
org.)
precipitarea acizilor nucleic(in
prezenta alcoolilor si sarurilor)

Cellule nucleate
sol hipotonice
detergent
proteaza
solvent organic
alcooli,saruri

Clonare in
vivo

Obtinerea
and c

1Izolarea ARN poli a


2 hibridarea poli a cu oligo dT
3 sinteza ADNc cu ajutorul
revertazei(ARN polimeraza AND
dependent)
4 Hidroliza ARN
5 sinteza AND bicatenar (AND
polimeraza)

Arn c poli a
oligp dT
revertaza
hidrolaze
and polimeraza

Clonare in
vitro

Izolarea
arnm

1Colectarea mat biologic(din test


de interes)
2 lezarea celulelor(in prezenta
detergentilor)
3 deproteinizarea(c solvent organic)
4 precipitarea selective a arn(in
prezenta sarrilor)
5precipitarea arn(in prezenta
alcoolului)

Tesut de interes
detergent
solvent organic
saruri
alcool

Clonare in
viov

Obtinerea
and rec

1 Izolarea and de cercetat si a


vectorilor de clonare (identificare

ADNde clonat :
FR,ADN c

Recmbinare
adn

SR)
2 clivare enzimatica a adn de
cercetat si vectorlui de clonare (c
BamHI)
3 ligarea fragmentlui de adn de
interes c vectorl de clonare
obtinerea adn recombinant

-vector de clonare
-enzime de reztrictie
-gazda de clonare
comatribila c
vectorul

Caracteristica

Rol practic

ADN genomic

ADN constitent al
genomului unei celule sau
a unui organsim

Pastrarea ig

ADNc

Adn complementar genei


de interes obtinut pe baza
arnm caracteristic genei

Clnare in vitro

FR (fragment de
restricite)

Fragment de adn bicatenar


obtinut prin clivare c
ajutorul restrictazelor

Clonare in vivo

Plasmid

Plasmid este o molecla


de ADN prezent n
unele bacterii care se
poate replica autonom
de cromozomul "gazdei",
dar folosind aparatul
replicativ al celulei n care
se gsete.

Clonare in vivo

Cella bactriana-gazda de
clonare

Celula gazda este celula


care asigura gazduirea
unui virus, a unui plasmid,
ADN recombinat in vitro
sau a unei celule intregi.

Clonare in vivo

BAC

Un cromozom artificial
bacterian (BAC) este un
construct ADN, plasmidic
bazat pe (sau F-plasmid),
utilizat pentru
transformarea i clonare n
bacterii, de obicei E. coli.

Clonare in vitro

polimorfism

Bacteriofag

Bacteriofag este numele


generic
acordat microorganismelor
care pot distruge bacteriile

Clonare in vitro

Taq-polimeraza

Adn polimeraza
termostabila

Clanare in vitro

Reverstranscriptaza

Acesta este o ADN


polimeraza care utilizeaza
o matrita ARN pentru
sinteza unei catene de
AND

Clonare in vitro

Primeri artificiali

Clonare in viro

Sonde moleculare

Fragmente de and sau arn


natural sa artificial
caresunt tilizate in
examene de laborator

Clonare in vitro

Termociclor

main PCR sau


amplificator ADN) este un
aparat de laborator cel mai
frecvent utilizat pentru a
amplifica segmente de
ADN prin reacia n lan a
polimerazei PCR

Clonare in vitro