Documente Academic
Documente Profesional
Documente Cultură
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 5 August 2016
Received in revised form
4 November 2016
Accepted 9 November 2016
Available online 10 November 2016
This experiment was conducted to study the effect of various levels of ACV and Propionic acid (PA) on
expression of immune related genes and growth performance in white shrimp (Litopenaeus vannamei).
Three hundred and seventy-ve shrimps with an average initial weight of 10.2 0.04 g were collected
and acclimatized for two weeks. Five experimental diets including control diet, 0.5% PA diet and 1%, 2%
and 4% ACV diets were applied to feed the shrimps. They were fed 4 times a day with 2.5% of body
weight. After 60 days of culture, shrimps fed with ACV and PA diets showed no signicant difference in
growth performance. Expression of prophenoloxidase (proPo), lysozyme (Lys), penaeidin-3a (Pen-3a)
and Crustin (Cru) genes were determined from hepatopancreas, using the real-time PCR after 15, 30 and
60 days. Expression of Lys and proPo genes was signicantly up regulated in shrimps fed with ACV and
PA diets compared to the control group after 30 and 60 days of treatment. After 15 days, Pen-3a gene
expression was signicantly higher in PA group compared to the control group. Also, shrimps fed with 1%
and 4% ACV and PA diets showed signicantly increased expression of Pen-3a after 30 days. In contrast,
expression of Cru was signicantly down regulated in response to ACV diets, but, Cru expression in
treated shrimps with PA diet was greater than the control group after 30 and 60 days. Overall, the results
provided evidence that ACV could be used as a natural immunostimulant for shrimps in order to adjust
and enhance expression of the immune related genes.
2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND
license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Keywords:
Litopenaeus vanname
Apple cider vinegar
Propionic acid
Growth performance
Immune genes
1. Introduction
The occurrence and spread of diseases in aquaculture industry
can signicantly restrict the productivity and as a result, farmers
extremely use antibiotics in order to prevent diseases. The wide use
of antibiotics can increase concerns due to their negative effects on
growth performance, resistant bacterial strains in host animals,
potential harms to human and the environment. So their usage has
been limited or banned in many countries. Also, A protective way
such as using vaccines has been investigated to reduce the outbreak
of diseases and mortality in aquaculture systems; however, it
cannot be utilized for all crustaceans because they don't have
specic immune systems [1]. That is why, identifying appropriate
* Corresponding author. Department of Fisheries, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan, 49138-15739, Iran. Fax: 98
7142216191.
E-mail address: Sajjad5550@gmail.com (S. Pourmozaffar).
http://dx.doi.org/10.1016/j.fsi.2016.11.030
1050-4648/ 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
66
and reduces harmful bacteria in the host [5,11,12]. Oral consumption is the most common way to add organic acids. The Shrimps
(L. vannamei) fed with butyrate showed lower number of Vibrio sp.
in the intestine [9]. Also, total viable bacteria and Vibrio numbers in
the hepatopancreas tiger shrimps (Penaeus monodon) fed with
organic acids signicantly decreased [2]. Similarly, the benzoic acid
in piglets could reduce, the number of gram negative bacteria in
piglets [10]. Recently, in vitro assays have used organic acids to
evaluate the inhibitory effects on growth of Vibrio harveyi and the
results indicated that the minimum inhibitory concentrations of
acetic and propionic acids were 0.041% and 0.03%, respectively [13].
Because of these promising results, assessment of immune related
genes activity caused by products of organic acids has been deemed
essential.
At the present time, feed additives of natural origin, used in
natural medicine with a fractional afnity. ACV (Apple Cider Vinegar) is one of these natural substances known for hundred years
from renaissance. In fact, it was rstly used some 5000 years ago.
Hippocrates, prescribed the mixture of honey and apple cider
vinegar as a therapy for various diseases [14]. ACV is an acidic solution produced by fermenting apples. ACV counteracts injurious
bacteria that might be present in some foods and could aid digestion process [15]. In addition, it was recently shown that this substance hase a variety of pharmacological functions, (e.g.
antioxidant, antidiabetic, etc.), and also is able to decrease the
cholesterol level [16].
Despite the benecial effects of dietary organic acids supplementation in animal species, to the best of our knowledge, no
previous studies exists regarding the application of dietary ACV in
aquaculture. Therefore, the objectives of the present study performed to investigate dietary ACV and PA effects on growth parameters and expression of immune related genes in Litopenaeus
vannamei with initial body weight of 10 g.
diet, 1%, 2%, 4% ACV and 0.5% PA diets to ensure equal amounts of
gelatin in all experimental diets. The proximate composition of
diets have been described in the methodology as determined
following standard AOAC methods [18] and previously described in
da silva et al. [9]. The method of Kjeldahl based on nitrogen levels
was used to determine the crude protein. The crude ber was
analyzed by the sulfuric acid detergent method. The dry matter was
estimated by gravimetric analysis after drying in an oven at 100 C
for 24 h. The crude ash was calculated gravimetrically by burning,
in a mufe furnace, at 550 C for 6 h. Finally, the crude lipid was
analyzed based on ether extractison.
2.2. Experimental design
Three hundred and seventy-ve healthy individuals of
L. vannamei (10.2 0.04 g) obtained from the local commercial
shrimp farm in Gomishan, Golestan province, Iran. They were
transported to the aquaculture lab at Gorgan university of Agricultural Sciences and Natural Resources then acclimatized to the
experimental conditions for two weeks. After adaptation, the
shrimps were randomly distributed to fteen 400 L berglass tanks
at 20.27 1.21 ppt and 25.84 1.64 C. Water quality parameters
were measured daily. Shrimps were fed daily with the experimental diets. Also, they were fed at 2.5% of body weight with its
experimental diets at 07:00, 11:30, 15:30 and 22:00 during the
experimental period (60 days). Food Ingredients and composition
are presented in Table 1. At the end of acclimatization, the shrimps
were randomly distributed to ve groups and fed with the commercial diet (control group) while the other groups were fed with
different doses of ACV (containing 5% acetic acid) including 1%, 2%
and 4% and 0.5% liquid Propionic acid (Sigma Aldrich St. Louis, Mo,
USA, pure 99.5%).
2.3. Biometry and growth parameters assay
Treatments
Control
1% ACV
Fish meal
255
255
Soybean meal
320
320
Wheat our
275
275
Wheat gluten
50
50
Shrimp shell meal
30
30
Fish oil
30
30
Lecithin
10
10
Vitamin complex
20
20
Mineral complex
10
10
Proximate composition (g kg1 dry weight)
Dry matter
907
907
Crude protein
475
475
Crude lipid
110
110
Crude ber
51
51
Crude ash
75
75
2% ACV
4% ACV
0.5% PA
255
320
275
50
30
30
10
20
10
255
320
275
50
30
30
10
20
10
255
320
275
50
30
30
10
20
10
907
475
110
51
75
907
475
110
51
75
907
475
110
51
75
based on the genes identied in the cDNA library (Table 2). Realtime PCR was carried out in IQ5 system (Bio Rad, USA) using 1x
SYBR Green PCR Master Mix (SYBR Biopars, GUASNR, Iran), 100 nM
of each forward and reverse specic primers, 10 ng of cDNA template and nuclease free water to nal volum of 20 ml were used and
all thermal prole of PCR reaction mixtures was done after Miandare et al. [3]. Table 2 reveals the primers used for amplication of
Lys, Cru, Pen-3a, proPo and b-actin. To validate the real-time PCR
primers, each genes specic primer pair was run in duplicate, along
a temperature gradiant (55e65 C) in the same plate. The PCR efciency and change in relative mRNA expression were calculated
based on the standard melting curve [21] analysis with dilution
series cDNA (including ve dilutions from 1/5 to 1/200). The PCR
efciency was to the following equation [22].
67
Table 2
Primers used for the real-time PCR assay of four immune related genes and one internal control b-actin gene of shrimp.
Gene
Accession number
Amplicon
Efciency (%)
ProPo
AY723296
122
98
Lys
AY170126.2
123
96
Pen-3a
Y14926
121
95
Cru
AF430076
141
97
b-actin
AF300705
CGGTGACAAAGTTCCTCTTC
GCAGGTCGCCGTAGTAAG
TGT TCC GAT CTG ATG TCC
GCT GTT GTA AGC CAC CC
CACCCTTCGTGAGACCTTTG
AATATCCCTTTCCCACGTGAC
ACGAGGCAACCATGAAGG
AACCACCACCAACACCTAC
CCACGAGACCACCTACAAC
AGCGAGGGCAGTGATTTC
150
98
68
Table 3
Growth performance of shrimp fed with control and ACV (Apple Cider Vinegar) and PA (Propionic acid) diets.
Parameters
Control
1% ACV
2% ACV
4% ACV
0.5% PA
IBW (g)
FBW (g)
WG (%)
SGR (% day
FCR
10.21 0.045a
14.09 0.59a
37.964 5.9a
0.64 0.08a
3.01 0.5a
10.26 0.045a
14.10 0.55a
37.451 5.8a
0.63 0.08a
3.06 0.52a
10.15 0.05a
13.87 0.59a
36.667 5.53a
0.62 0.08a
3.12 0.51a
10.20 0.025a
13.52 1.03a
32.867 5.21a
0.56 0.15a
3.67 0.99a
10.19 0.02a
13.69 0.43a
34.33 4.53a
0.59 0.06a
3.30 0.4a
1
IBW, Initial body weight; FBW, Initial body weight; WG, weight gain; SGR, specic growth rate; FCR, feed conversion ratio. Values (mean SE) containing different superscripts
in same row denote signicant difference among the treatments (p < 0.05).
enzymes in stomach, pancreatic and intestinal [7]. But, the mechanism of this effect in enhancing growth performance is not known
yet. In contrast, our results demonstrated that the additives used in
this study do not affect the performance in the stage of rearing
evaluated (10e14 g). In the present study, the shrimps fed with
ACV supplemented diets were obviously more active when feed
was supplied compared to those fed with the control diet after
about 15 days onwards. However, there is not sufcient data on
using ACV in aquaculture industry. Similarly, previous studies
have illustrated that utilizing different organic acids blends did not
signicantly enhance growth of tilapia (Oreochromis sp) and
rainbow trout (Oncorhynchus mykiss) [11,17].
Shrimp diseases globally are one of the main limitations for
making sustainable progress in shrimp aquaculture industry; so
studies of shrimp immune related genes expressions has received
accumulative attentions. The results of the present study were
exclusively based on the expressions of selected genes from
hepatopancreas. Furthermore, previous studies, have indicated that
the hepatopancreas is a crucial organ in the immune system of
penaeid shrimp [24]. In this study, it has been clearly shown that
the different immune related genes were expressed at different
times.
The crustaceans lack a highly developed specic immune system unlike the vertebrates and rely highly on non-specic cellular
and humoral factors. Humoral responses include the proPo activating system, phosphatase, Lys and antimicrobial peptides (AMPs)
such as Pen, Cru, anti-lipopolysaccharide factors (ALFs), etc. [25].
Lys was named by Fleming in 1922 for the rst time [26]. Lysozyme,
also recognized as muramidases is a well-known AMP and this
protein is involved in a broad range of defense mechanisms
including bacteriolysis, opsonization, immune response, and antimicrobial and antiviral activity [27]. The rst penaeidae Lys cDNA
was introduced in Litopenaeus vannamei [28]. The results revealed
that, shrimps fed with of ACV and PA showed an increased
expression level of Lys gene after 30 and 60 days after of treatments. Therefore, studies of enhancing of immune system of
shrimps arising by the organic acid compounds such as PA is scarce.
However, increase of Lys gene expression was as a result of
enhancement of innate immune protection against infectious
pathogens, environmental toxicants and stressors. In agreement
with our results, Miandare et al. [3] reported positive effect of dietary probiotic supplementation on Lys expression gene in white
shrimp. The expression of Lys was up-regulated in hepatopancreas
6 h post-injection lipopolysaccharide [29]. Park and Choi [30]
demonstrated that lysozyme activity was signicantly higher for
Nile tilapia (Oreochromis niloticus) fed the mistletoe (Viscum album
coloratum) supplemented diets as well signicant decrease in
mortality was observed after challenge with Aeromonas hydrophila
infection. However, the Lys also had wide range of antibacterial
activities against Gram positive and Gram negative shrimp pathogens such as Micrococcus lysodeikticus, V. harveyi, Edwardsiella
tarda, V. alginolyticus and V. parahemolyticus [26,31e33]. Viral
infection can result in 100% mortality of aquatic organisms within
69
supplemented with PrimaLac showed signicantly higher expression level of Pen-3a in comparison with the control group. Cell wall
component from multi-strain probiotic (PrimaLac) such as lipopolysaccharides and peptidoglycans stimulate expression level of
Pen-3a in shrimp. Conversely, injection of lipopolysaccharide
inhibited the expression of Pen level in white shrimp [4]. Also,
white shrimp fed with b-1,3-glucan diets down-regulated Pen-3
gene after 6 and 12 h feeding [44]. Pen-3a might be a powerful
antibacterial protein which plays a role in innate immunity in
penaeid shrimp. An et al. [40] reported that MjPen-II demonstrated
antibacterial activity against both Gram positive and Gram negative
bacteria in kuruma shrimp (Marsupenaeus japonicus). On other
study suggested that, Pen 3 mRNA expression was up regulated
after microbial challenge with Vibrio parahemolyticus [41]. The upregulation of penaeidin mRNA expression increases young haemocytes which are actively expressing penaeidin genes in the
circulating haemocyte population, resulting in an enhancing
phagocytosis and agglutination [4].
The proPo system is a strong regulated defense mechanism that
is involved in biosynthesis of melanin and production of toxic intermediates for pathogenic [45]. Also, proPO was rst introduced in
the freshwater craysh Pacifastacus leniusculus in 1995 [46]. The
prophenoloxidase activating system (proPOAS) is an efcient non
self-recognition system which consists of several important proteins including proPo, pattern-recognition proteins (PRPs), serine
protease (SP), and serine protease inhibitors (serpins). The proPO, is
inactive proenzyme of phenoloxidase (PO) [47]. According to the
other investigations two types proPo genes was cloned and
described from the species L. vannamei and Penaeus monodon
[48,49]. Relative expression of proPo, signicantly increased in
ACV and PA treatments during the treatment period. The proPO
activity response to immune stimulants such as, probiotic (PrimaLac and Lactobacillus plantarum), lipopolysacharide and Sargassum
wightii has previously been reported in L. vannamei and Penaeus
monodon [3,4,46,50]. These results demonstrated that dietary ACV
and PA administration could enhance PO activity resulting from
advancement the gene transcription and translation of proPOs in
L. vannamei. In agreement with our results, some researchers has
shown that, shrimps fed with the diet containing organic acids
blend showed enhanced PO activity and consequently led to higher
survival against Vibrio harveyi [2,5]. Amparyup et al. [48] and Chiu
et al. [46] reported up regulation of proPo expression increased
resistance to Vibrio alginolyticus. Furthermore, another study reported up regulation of proPo in shrimp fed with Bacillus subtilis
diets compared to the control group after challenge with V. harveyi
[20]. In contrast, based on some investigations proPo expression
was down regulated in shrimps challenged with white spot syndrome virus (WSSV) [51,52] and necrotizing hepatopancreatitis
bacterium after 24 days [53]. Similarly, ProPo expression was down
regulated and caused raised Penaeus monodon mortality following
V. harveyi infection [54]. So, the expression and regulation of proPo
of shrimps were signicantly related to the diet administration,
environmental changes and pathogens challenge. Previous studies
demonstrated that organic acids led to improved resistance of
shrimp to pathogens [2,5,11]. This led to the hypothesis that they
contribute to regulate the AMPs secration of shrimp and maintained or increased the immune response of shrimp. However, little
information is available about the molecular mechanisms of
organic acid on immune related genes of shrimp.
5. Conclusion
The present study revealed that ACV and PA diets had no
benecial effects on growth performance in the stage of rearing
evaluated in this study (10e14 g). Furthermore, transcriptomic
70
zbir, Apple
[16] M. Nazirolu, M. Gler, C. Ozgl,
G. Saydam, M. Kkayaz, E. So
cider vinegar modulates serum lipid prole, erythrocyte, kidney, and liver
membrane oxidative stress in ovariectomized mice fed high cholesterol,
J. Membr. Biol. 247 (2014) 667e673, http://dx.doi.org/10.1007/s00232-0149685-5.
[17] Z. Xie, F. Wang, H. Liu, S. Guo, A. Zhu, H. Niu, Gelatin-walled microencapsulated diet for larval shrimp (Penaeus japonicus Bate) manufactured
using the uidized bed coating process, Aquac. Res. 42 (2010) 65e73, http://
dx.doi.org/10.1111/j.1365-2109.2010.02557.x.
[18] AOAC, AOAC Ofcial Methods of Analysis, Association of Ofcial Agricultural
Chemists, Washington, D.C., 1992, pp. 136e138, 15th.
[20] H. Zokaeifar, J.L. Balcazar, C.R. Saad, M.S. Kamarudin, K. Sijam, A. Arshad,
N. Nejat, Effects of Bacillus subtilis on the growth performance, digestive
enzymes, immune gene expression and disease resistance of white shrimp,
Litopenaeus vannamei, Fish Shellsh Immunol. 33 (2012) 683e689, http://
dx.doi.org/10.1016/j.fsi.2012.05.027.
[21] A. Larionov, A. Krause, W. Miller, A standard curve based method for relative
real time PCR data processing, BMC Bioinforma. 6 (2005) 62, http://dx.doi.org/
10.1186/1471-2105-6-62.
[22] A. Radonic, S. Thulke, I.M. Mackay, O. Landt, W. Siegert, A. Nitsche, Guideline
to reference gene selection for quantitative real-time PCR, Biochem. Biophysical Res. Commun. 313 (2004) 856e862, http://dx.doi.org/10.1016/
j.bbrc.2003.11.177.
[24] D. Pan, N. He, Z. Yang, H. Liu, X. Xu, Differential gene expression prole in
hepatopancreas of WSSV-resistant shrimp (Penaeus japonicus) by suppression
subtractive hybridization, Dev. Comp. Immunol. 29 (2005) 103e112, http://
dx.doi.org/10.1016/j.dci.2004.07.001.
[25] D. Banerjee, B. Maiti, S.K. Girisha, M.N. Venugopal, I. Karunasagar, A crustin
isoform from black tiger shrimp, Penaeus monodon exhibits broad spectrum
anti-bacterial activity, Aquac. Rep. 2 (2015) 106e111, http://dx.doi.org/
10.1016/j.aqrep.2015.08.009.
[26] Y. Tian, X. wang Liang, Y. qing Chang, J. Song, Expression of c-type lysozyme
gene in sea cucumber (Apostichopus japonicus) is highly regulated and time
dependent after salt stress, Comp. Biochem. Physiology Part - B Biochem. Mol.
Biol. 180 (2015) 68e78, http://dx.doi.org/10.1016/j.cbpb.2014.10.004.
[27] W. jun Mai, W. na Wang, Protection of blue shrimp (Litopenaeus stylirostris)
against the against WSSV challenge (WSSV) when injected with shrimp
lysozyme, Fish Shellsh Immunol. 28 (2010) 727e733, http://dx.doi.org/
10.1016/j.fsi.2010.01.002.
[28] T. Chen, C. Ren, Y. Wang, P. Luo, X. Jiang, W. Huang, C. Chen, C. Hu, Molecular
cloning, inducible expression and antibacterial analysis of a novel i-type
lysozyme (lyz-i2) in Pacic white shrimp, Litopenaeus vannamei, Fish Shellsh
Immunol. 54 (2016) 197e203, http://dx.doi.org/10.1016/j.fsi.2016.04.008.
[29] A.B. Peregrino-Uriarte, A.T. Muhlia-Almazan, A.A. Arvizu-Flores, G. GomezAnduro, T. Gollas-Galvan, G. Yepiz-Plascencia, R.R. Sotelo-Mundo, Shrimp
invertebrate lysozyme i-lyz: gene structure, molecular model and response of
c and i lysozymes to lipopolysaccharide (LPS), Fish Shellsh Immunol. 32
(2012) 230e236, http://dx.doi.org/10.1016/j.fsi.2011.10.026.
[30] K.H. Park, S.H. Choi, The effect of mistletoe, Viscum album coloratum, extract
on innate immune response of Nile tilapia (Oreochromis niloticus), Fish
Shellsh Immunol. 32 (2012) 1016e1021, http://dx.doi.org/10.1016/
j.fsi.2012.02.023.
[31] W. Mai, C. Hu, cDNA cloning, expression and antibacterial activity of lysozyme
C in the blue shrimp (Litopenaeus stylirostris), Prog. Nat. Sci. 19 (2009)
837e844, http://dx.doi.org/10.1016/j.pnsc.2008.10.008.
[32] E. De-La-Re-Vega, A. Garca-Galaz, M.E. Daz-Cinco, R.R. Sotelo-Mundo, White
shrimp (Litopenaeus vannamei) recombinant lysozyme has antibacterial activity against Gram negative bacteria: Vibrio alginolyticus, Vibrio parahemolyticus and Vibrio cholerae, Fish Shellsh Immunol. 20 (2006) 405e408,
http://dx.doi.org/10.1016/j.fsi.2005.06.005.
[33] H. Li, M.G. Parisi, M. Toubiana, M. Cammarata, P. Roch, Lysozyme gene
expression and hemocyte behaviour in the Mediterranean mussel, Mytilus
galloprovincialis, after injection of various bacteria or temperature stresses,
Fish Shellsh Immunol. 25 (2008) 143e152, http://dx.doi.org/10.1016/
j.fsi.2008.04.001.
[34] C. Sun, X.J. Du, W.T. Xu, H.W. Zhang, X.F. Zhao, J.X. Wang, Molecular cloning
and characterization of three crustins from the Chinese white shrimp, Fenneropenaeus chinensis, Fish Shellsh Immunol. 28 (2010) 517e524, http://
dx.doi.org/10.1016/j.fsi.2009.12.001.
[35] P. Supungul, S. Tang, C. Maneeruttanarungroj, V. Rimphanitchayakit, I. Hirono,
T. Aoki, A. Tassanakajon, Cloning, expression and antimicrobial activity of
crustinPm1, a major isoform of crustin, from the black tiger shrimp Penaeus
monodon, Dev. Comp. Immunol. 32 (2008) 61e70, http://dx.doi.org/10.1016/
j.dci.2007.04.004.
[36] W. Rattanavichai, Y.N. Chen, C.C. Chang, W. Cheng, The effect of banana (Musa
acuminata) peels hot-water extract on the immunity and resistance of giant
freshwater prawn, Macrobrachium rosenbergii via dietary administration for a
long term: activity and gene transcription, Fish Shellsh Immunol. 46 (2015)
378e386, http://dx.doi.org/10.1016/j.fsi.2015.06.031.
[37] A. Rattanachai, I. Hirono, T. Ohira, Y. Takahashi, T. Aoki, Cloning of kuruma
prawn Marsupenaeus japonicus crustin-like peptide cDNA and analysis of its
expression, Fish. Sci. 70 (2004) 765e771, http://dx.doi.org/10.1111/j.14442906.2004.00869.x.
[38] S.G. Hipolito, A. Shitara, H. Kondo, I. Hirono, Role of Marsupenaeus japonicus
crustin-like peptide against Vibrio penaeicida and white spot syndrome virus
infection, Dev. Comp. Immunol. 46 (2014) 461e469, http://dx.doi.org/
10.1016/j.dci.2014.06.001.
[39] J.E. Shockey, N.A. O'Leary, E. de la Vega, C.L. Browdy, J.E. Baatz, P.S. Gross, The
role of crustins in Litopenaeus vannamei in response to infection with shrimp
pathogens: an in vivo approach, Dev. Comp. Immunol. 33 (2009) 668e673,
[49]
[50]
[51]
[52]
[53]
[54]
71
and its role in shrimp immune responses against major pathogens, Fish
Shellsh Immunol. 34 (2013) 990e1001, http://dx.doi.org/10.1016/
j.fsi.2012.08.019.
M.S. Yeh, C.Y. Lai, C.H. Liu, C.M. Kuo, W. Cheng, A second proPO present in
white shrimp Litopenaeus vannamei and expression of the proPOs during a
Vibrio alginolyticus injection, molt stage, and oral sodium alginate ingestion,
Fish Shellsh Immunol. 26 (2009) 49e55, http://dx.doi.org/10.1016/
j.fsi.2008.10.003.
M. Sivagnanavelmurugan, B.J. Thaddaeus, A. Palavesam, G. Immanuel, Dietary
effect of Sargassum wightii fucoidan to enhance growth, prophenoloxidase
gene expression of Penaeus monodon and immune resistance to Vibrio parahaemolyticus, Fish Shellsh Immunol. 39 (2014) 439e449, http://dx.doi.org/
10.1016/j.fsi.2014.05.037.
H.S. Ai, J.X. Liao, X. De Huang, Z.X. Yin, S.P. Weng, Z.Y. Zhao, S.D. Li, X.Q. Yu,
J.G. He, A novel prophenoloxidase 2 exists in shrimp hemocytes, Dev. Comp.
Immunol. 33 (2009) 59e68, http://dx.doi.org/10.1016/j.dci.2008.07.017.
H.S. Ai, Y.C. Huang, S.D. Li, S.P. Weng, X.Q. Yu, J.G. He, Characterization of a
prophenoloxidase from hemocytes of the shrimp Litopenaeus vannamei that is
down-regulated by white spot syndrome virus, Fish Shellsh Immunol. 25
(2008) 28e39, http://dx.doi.org/10.1016/j.fsi.2007.12.002.
M.D. Figueroa-Pizano, A.B. Peregrino-Uriarte, G. Yepiz-Plascencia,
n, L.R. Martnez-Co
rdova, Gene expresM. Martnez-Porchas, T. Gollas-Galva
sion responses of white shrimp (Litopenaeus vannamei) infected with necrotizing hepatopancreatitis bacterium, Aquaculture 420e421 (2014) 165e170,
http://dx.doi.org/10.1016/j.aquaculture.2013.10.042.
W. Charoensapsri, P. Amparyup, I. Hirono, T. Aoki, A. Tassanakajon, Gene
silencing of a prophenoloxidase activating enzyme in the shrimp, Penaeus
monodon, increases susceptibility to Vibrio harveyi infection, Dev. Comp.
Immunol. 33 (2009) 811e820, http://dx.doi.org/10.1016/j.dci.2009.01.006.