Research Article

For reprint orders, please contact: reprints@futuremedicine.com

Genetic susceptibility to schizophrenia: role of

dopaminergic pathway gene polymorphisms
Aim: We investigated 16polymorphisms from three genes, dopamine receptor D2 (DRD2), catechol-O-
methyl transferase (COMT) and brain derived neurotrophic factor (BDNF), which are involved in the
dopaminergic pathways, and have been reported to be associated with susceptibility to schizophrenia and
response to antipsychotic therapy. Materials & methods: Single-locus association analyses of these
polymorphisms were carried out in 254patients with schizophrenia and 225controls, all of southern Indian
origin. Additionally, multifactor-dimensionality reduction analysis was performed in 422samples (243cases
and 179controls) to examine the genegene interactions and to identify combinations of multilocus
genotypes associated with either high or low risk for the disease. Results: Our results demonstrated initial
significant associations of two SNPs for DRD2 (rs11608185, genotype: 2=6.29, pvalue=0.043; rs6275,
genotype: 2 = 8.91, pvalue = 0.011), and one SNP in the COMT gene (rs4680, genotype: 2 = 6.67,
pvalue=0.035 and allele: 2=4.75, pvalue=0.029; odds ratio:1.33, 95% confidence interval:1.021.73),
but not after correction for multiple comparisons indicating a weak association of individual markers of
DRD2 and COMT with schizophrenia. Multifactor-dimensionality reduction analysis suggested a two locus
model (rs6275/DRD2 and rs4680/COMT) as the best model for genegene interaction with 90% cross-
validation consistency and 42.42% prediction error in predicting disease risk among schizophrenia patients.
Conclusion: The present study thus emphasizes the need for multigene interaction studies in complex
disorders such as schizophrenia and to understand response to drug treatment, which could lead to a
targeted and more effective treatment.

KEYWORDS: association study, BDNF, COMT, DRD2, genegene interactions,
schizophrenia
Schizophrenia is a common psychiatric dis
order with a worldwide lifetime prevalence of
0.51%[1,2] . The biological correlates of schizo
phrenia are not completely understood, but
altered dopamine function is thought to under
lie several symptoms, as also the action of antip
sychotic medication [3,4] . We have investigated
multiple polymorphisms in three important
dopamine signaling pathway genes: dopamine
receptor D2 (DRD2), catechol-O-methyl trans
ferase (COMT ) and brain derived neurotrophic
factor (BDNF) for association with schizophrenia
in a southern Indian population.
The DRD2 gene (Chr11q2223) codes for
the main target of dopamine and antipsychotic
drugs. Association studies of the DRD2 gene
attempted so far have produced inconsistent
results. Some studies have reported association
of DRD2 polymorphisms, including -141Del/C
(rs1799732), Ser311Cys (rs1801028), His313His
(rs6275) and Pro319Pro (rs6277) with schizo
phrenia [58] ; while other studies have not con
firmed these associations [912] . A recent study
has implicated the role of regulatory DRD2
polymorphisms in mRNA splicing, expression
Meenal Gupta1,
Chitra Chauhan1,
Pallav Bhatnagar1,
and working memory pathways [13] . We have Simone Gupta1,
previously reported a modest association of the Sandeep Grover1,
His313 synonymous polymorphism with dis Prashant K Singh1,
ease susceptibility in the Indian population[14] .
Meera Purushottam2,
In addition, meta-analysis of Ser311Cys poly
morphism in the DRD2 gene detected significant Odity Mukherjee2,
association with schizophrenia [15] . Sanjeev Jain2,
The COMT enzyme is involved in the metab Samir K Brahmachari1 &
olism of released dopamine [16] . The COMT gene Ritushree Kukreti1
(Chr22q11) is located in a region implicated in
Author for correspondence:
schizophrenia by several linkage studies [17,18] . A 1
Functional Genomics Unit,
1.53.0Mbp segment in this region is deleted in Institute of Genomics and
velocardiofacial syndrome (VCFS [Mendelian Integrative Biology (Council of
Inheritance in Man (MIM)192430]); VCFS Scientific and Industrial
is associated with high rates of psychotic ill Research), Mall Road, Delhi
ness [19] and COMT genotypes may predict the 110 007, India
emergence of psychosis in VCFS patients [20] . Tel.: +91 112 766 7298;
A common functional variant, Val158Met in Fax: +91 112 766 7471;
the COMT gene, has been shown to reduce ritus@igib.res.in
the activity of soluble isoform of COMT by 2
National Institute of Mental
approximately fourfold [21] and that of mem Health and Neuro Sciences,
brane bound isoform by approximately 40% in India
postmortem human prefrontal cortex tissues in
Met/Met homozygous individuals as compared
with Val/Val homozygotes [22] . Genetic studies

10.2217/14622416.10.2.277 2009 Future Medicine Ltd Pharmacogenomics (2009) 10(2), 277291 ISSN 1462-2416 277
Research Article Gupta, Chauhan, Bhatnagar et al.
of this polymorphism have showed consider
able variation in allele frequencies around the
world [23] . Concurrently, association studies of
Val158Met with schizophrenia have produced
ambiguous results, with some studies showing
a positive association [2427] ; while others failed
to find any association [2832] . Other variants
including rs737865 in the first intron, rs165599
in the 3 region and a nonsynonymous variant
rs6267 have also been reported to be associated
with schizophrenia [33,34] . However, haplotype
based association methods are more powerful
than analogous allele-based methods when mul
tiple disease susceptibility variants occur within
the same gene [35] . Shifman etal. observed signifi
cant association of a three marker haplotype with
schizophrenia in a large Ashkenazi population,
though association with the specific Val/Met
polymorphism was modest [33] . Subsequently,
this haplotype was linked to lower expression of
COMT mRNA in human brain [36] . The bio
logical role of COMT in addition to the ambigu
ous genetic association findings make further
studies necessary in diverse sample sets.
The BDNF gene (Chr 11p13) regulates lev
els of trophic factors in the brain, and may be
a target for antipsychotic and antidepressive
drugs [37] . BDNF has critical effects on the
neurodevelopment of dopaminergic related sys
tems, and has been shown to influence meso
limbic and nigros triatal dopaminergic sys
tem [38,39] . It is involved in neuronal survival
and plasticity of dopaminergic, cholinergic and
serotonergic neurons in the CNS, and altera
tions in the expression of BDNF in the brain of
patients with schizophrenia have been reported
[40] . Numerous reports have suggested positive
[41,42] and negative [43,44] associations with respect
to the BDNF gene, and its overall contribution
to schizophrenia susceptibility.
Multiple genes, each with a small effect, may
interact in a nonlinear manner in concert with
environmental factors to influence susceptibility to
schizophrenia [45] . Susceptibility to complex disor
ders could depend on an underlying genetic path
way architecture, in which interaction between
the genes is the rule rather than the exception [46] .
A novel model free, nonparametric method was
used to identify genegene interactions in a spo
radic breast cancer casecontrol data set [47] . The
authors were able to identify high order interactions
between four polymorphisms from three different
estrogen metabolizing genes. Similar genegene
interactions have been identified in other com
plex disorders such as TypeII diabetes, essential
hypertension and prostate cancer [4850] .
278 Pharmacogenomics (2009) 10(2)
In this study, we have performed single-
locus association analyses of 16polymorphisms
from the DRD2, COMT and BDNF genes with
schizophrenia in samples from southern India,
along with multifactor dimensionality reduc
tion (MDR) analysis to identify combinations
of multilocus genotypes that are associated with
either high risk or low risk of the disease.
Materials & methods
Study population
Casecontrol association analysis was performed
in 254patients with schizophrenia (155 males
and 99 females; mean age: 29.227.65years),
and 225matched control subjects (139 males
and 86 females; mean age: 31.0811.06years).
All the patients were of southern Indian origin
and were recruited from the clinical services of
the National Institute of Mental Health and
Neuroscience (Bangalore, India). This research
was approved by the Institutional Review Board
of the National Institute of Mental Health and
Neuroscience, and all the participants gave writ
ten consent for an interview as well as sampling.
Subjects with schizophrenia met Diagnostic and
Statistical Manual of Mental Disorders, Fourth
Edition (DSMIV) criteria for diagnosis. The
final best estimate diagnosis was established on
the basis of structured interview of all the patients
by experienced psychiatrists using Schedules
for Clinical Assessment in Neuropsychiatry
(SCAN; WHO) [51] and OPCRIT3.1 (MRC
Social, Genetic and Developmental Psychiatry
Centre, London, UK)[52,101] . Additional infor
mation was obtained through examination of
hospital records and interviews of family mem
bers of the probands. Control individuals were
also recruited from the same region and eth
nicity with due consent. In addition, control
subjects were further interviewed by the same
initial protocol used for the cases, where their
ethnicity, mental health and family history of
diseases were ascertained. However, the detailed
structured interviews such as the SCAN were
not used for the controls. This is further work
of our previous study [14] .
Genotyping of DRD2, COMT &
BDNF SNPs
Blood samples were obtained from all the sub
jects and genomic DNA was isolated using a
modification of a salting out procedure [53] . We
selected SNPs from the three genes (DRD2,
COMT and BDNF) reported in literature for
this study. Additionally, SNPs reported in the
SNP database (dbSNP) [102] were evaluated for
future science group
Genetic susceptibility to schizophrenia: dopaminergic pathway gene polymorphisms
their potential functional role using the software
pupasuite [103] and the relevant SNPs were then
selected for the study.
A total of 12SNPs in the DRD2 gene were
selected from the public databases (dbSNP)
and from the previous studies. These included
one promoter polymorphism (rs1799732),
four intronic SNPs (rs4274224, rs12808482,
rs11608185 and rs2075652) and seven exonic
SNPs (rs4986918 in exon2, Val96Ala in exon3,
Val255Val in exon6, rs1801028, rs6275, rs6277
and Lys367Lys in exon7).
We selected eight SNPs, from the literature
and from the dbSNP database, spanning the
entire COMT gene. These included four exonic
SNPs (rs4633, rs6267, rs4818 and rs4680), which
could be of functional importance; three intronic
SNPs (rs3788319, rs737865 and rs6269); and
one in the 3 flanking region (rs165599).
A total of four SNPs (rs6265, rs1048218,
rs1048221 and rs2353512) in BDNF gene covering
the major exon were selected.
All the SNPs were genotyped by the SNP
genotyping platform primer extension reaction
followed by matrix-assisted laser desorption/ion
ization time of flight (MALDITOF) mass spec
trometry (Sequenom Inc., CA, USA). Primer
details are given in Supplementary Table 1. More
than 5% of the total sample were regenotyped
by direct sequencing of the amplicons using
BigDye Terminator kit (version 3.1, Applied
Biosystems, CA, USA) and by using single base
primer extension method (SNaPshotTM ddNTP
primer extension kit, Applied Biosystems).
Statistical analysis
The HardyWeinberg equilibrium and the dif
ferences in the genotype and allele frequencies
between the schizophrenia patients and control
group were tested using the 2 test. Genotypic
association was also calculated for these SNPs
separately under dominant and recessive genetic
models using the 2 test. The SNPs within a
gene are not completely independent and hence
Nyholt correction was applied to provide a gene
based significance [54] . This approach takes into
account the background linkage disequilibrium
(LD) present between the SNPs within one gene
and calculates the effective number of independ
ent marker loci and the significance thresh
old required to keep Type I error rate at 5%.
However, Bonferroni correction was applied to
provide experiment-wide significance, where, for
n independent tests we adjusted the significance
level to adj=/n. Odds ratio (OR) and 95% analysis was performed on this subset which
confidence interval (CI) were also calculated for
future science group
Research Article
each marker. Power calculations for the analy
sis were performed using Power for Association
With Error (PAWE) software, version1.2 [55,56] .
We have used a genetic model-free approach for
calculations of asymptotic power for a fixed sam
ple size, where the SNP marker allele frequencies
were known in the case and the control popula
tions. Power calculations have been done assum
ing the Douglas Skol Boehnke error model with
parameter settings of (0.01) and (0.01) at 5%
level of significance [104] .
Pairwise LD within the DRD2 and COMT gene
markers was calculated with Haploview program
(version 3.32) [57] using CI model for defining LD
blocks in 225unrelated control individuals.
Further, the interaction between the mark
ers was analyzed by MDR [46,58] . The method
defines a new one-dimensional variable as a
function of two or more variables, which is
then evaluated for its ability to classify and
predict disease status through tenfold cross-
validation. This procedure is carried out for
each possible model size. The model with the
combination of markers that maximizes the
cross-validation consistency (CVC; number of
times an MDR model is identified across the
ten runs) and minimizes the prediction error
(error in classifying disease status in the test
ing test) is selected as the best model. Due to
computation restrictions, we set out to detect
all two-locus interactions through five-locus
interactions. To ensure that the analysis was
not influenced by a chance division of the data
or by initial conditions, we ran the analysis
ten-times using different random number seeds
each time. Sign test of the best model was also
calculated. The sign test counts the number of
cases, k, where the prediction accuracy is higher
than 0.5 out of ten cross-validation cases. The
corresponding pvalue calculated is the prob
ability that we would get k cases or more of
prediction accuracy higher than 0.5 out of ten
cases with random prediction [59] . Additionally,
the statistical significance of the result was also
determined by comparing the average predic
tion error from the observed data with the
distribution of average prediction errors under
the null hypothesis of no associations derived
empirically from 5000 permutations. The null
hypothesis was rejected when the upper-tail
Monte Carlo pvalue derived from the permuta
tion test was 0.05 or more. Prior to the analysis,
a subset of samples was selected in which indi
viduals with missing data were removed. MDR
consisted of 422samples: 243cases (147 males,
www.futuremedicine.com 279
Research Article Gupta, Chauhan, Bhatnagar et al.

96 females; mean age: 29.137.27years) and
179controls (115 males and 64 females; mean
age: 30.5310.38years).
Results
We studied 479schizophrenia and control indi
viduals from the south Indian population. A total
of 24SNPs from three genes were genotyped in
50affected and 50unaffected unrelated individu
als as described in the methods. Of these, 16SNPs
were found to be polymorphic in our studied
population, including rs1799732, rs4274224,
rs12808482, rs11608185, rs2075652, rs1801028,
rs6275 and rs6277 from DRD2 gene; rs3788319,
rs737865, rs6269, rs4633, rs4818, rs4680 and
rs165599 from COMT gene; and rs6265 from
BDNF gene (Figures 13) . These 16 SNPs were
genotyped in the remaining 379 individuals.
The genotype distributions of all the 16mark
ers in the DRD2, COMT and BDNF genes were
in HardyWeinberg equilibrium with the excep
tion of one marker, rs6275, in all cases. The sta
tistical analysis of the observed data for all the
16markers from the DRD2, COMT and BDNF
genes has been presented in Table1. Comparison
of the genotype and allele frequencies for SNPs
rs11608185 and rs6275 in the DRD2 gene
revealed significant genotypic associations of both

Exon

Exonic SNP

Intronic SNP

rs12808482 rs1801028
rs1799732 rs4274224 rs11608185
rs6275
rs2075652 rs6277

5 3

~65.5 kb
Marker 1

Marker 2

Marker 3

Marker 4

Marker 5

Marker 6

Marker 7

Marker 8

Figure1. Distribution of SNPs and LD block structure across the DRD2 gene. The upper
panel shows the location of eight SNPs selected for the study from DRD2 gene. The lower panel
shows the output of a Haploview (version 3.32) LD plot where each square (with D values
written within the box) represent a pairwise LD relationship between the two SNPs. Red squares
indicate statistically significant LD between the pair of SNPs as measured by the D statistic.
Darker colour squares indicate higher values of D, up to a maximum of1. White squares
indicate pairwise D values greater than1 with no statistically significant evidence of LD. The LD
within the DRD2 gene markers was calculated in 225unrelated control individuals.
LD: Linkage disequibrium.

280 Pharmacogenomics (2009) 10(2) future science group

Genetic susceptibility to schizophrenia: dopaminergic pathway gene polymorphisms Research Article

Exon

Exonic SNP

Intronic SNP

rs3788319
rs4633
rs4818 rs165599
rs737865
rs6269 rs4680

5 3

~27 kb
Marker 1

Marker 2

Marker 3

Marker 4

Marker 5

Marker 6

Marker 7

Figure2. Distribution of SNPs and LD block structure across COMT gene. The upper panel
shows the location of seven SNPs selected for the study from COMT gene. The lower panel
shows the output of a Haploview (version 3.32) LD plot where each square (with D values
written within the box) represent a pairwise LD relationship between the two SNPs. The LD
within the COMT gene markers was calculated in 225unrelated control individuals.
LD: Linkage disequibrium.

SNPs with schizophrenia (rs11608185, genotype:
2=6.29, pvalue=0.043; rs6275, genotype:
2=8.91, pvalue=0.011). Significant associa
tion was also observed for rs6275 in the recessive
model (genotype: TT vs TC and CC, 2=6.83,
pvalue=0.008, OR:1.94, 95%CI:1.173.20).
The associations did not remain significant
after applying Nyholt correction to test for
the gene based significance (pvalue>0.007).
In the COMT gene, we detected significant
genotypic and allelic associations for marker
rs4680 (genotype: 2 = 6.67, pvalue = 0.035
and allele: 2=4.75, pvalue=0.029; OR:1.33,
95%CI:1.021.73). The rs4680 SNP has also
achieved statistical significance in the domi
nant genetic model (genotype: GG vs GA and
AA, 2 = 6.66, pvalue = 0.009, OR: 1.64,
95%CI:1.122.41). The association of rs4680
in genotypic, allelic and dominant genetic model
remained significant after applying Nyholt cor
rection (pvalue<0.05). The rs6265 marker of
the BDNF gene has failed to show any significant
association at the genotypic, allelic and genetic
model level. However, the differences did not
reach statistical significance after Bonferroni
correction for 16SNPs. The genotypic distribu
tions of all the 16markers have been showed in
Supplementary Table2 .
Power calculations for all the 16 SNPs have
been represented in Supplementary Table3. Pairwise
LD within the eight SNPs of DRD2 was calcu
lated with Haploview program and the graphical

future science group www.futuremedicine.com 281

Research Article Gupta, Chauhan, Bhatnagar et al.

Exon

Exonic SNP

rs6265

5 3

~66.9 kb

Figure3. Location of one SNP in the BDNF gene. The figure shows the location of one SNP
selected for the study from the BDNF gene.

summary of the LD is represented in Figure1. apart (D=0.93, r2=0.87; Figure2 ). The LD

High LD was observed between SNP pair
rs12808482rs11608185 (D=0.96, r2=0.91),
which were located 21bp apart. The rs12808482
and rs11608185 SNPs also showed significant
LD with rs6277, located approximately 11.5kbp
apart (D = 0.92, r2 = 0.82; and D = 0.95,
r2=0.87, respectively). For COMT, moderate to
low LD was observed, with the exception of SNP
pair rs4633rs4680, located approximately 1kb
structure between SNPs rs4274224rs6275
rs6277 (DRD2) and rs737865rs4633rs4680
(COMT ) reported in a HapMap [105] Centre
dEtude du Polymorphisme Humain (CEPH)
population is similar to that observed in our
studied population.
Multifactor dimensionality reduction analysis
showed best interaction models selected for each
model size (Table3) . Amongst these, a two marker

Table1. Genotypic and allelic association of markers from the DRD2, COMT and BDNF genes.
Gene dbSNP ID Location Nucleotide Variant Fallele c2 (pvalue)
position
Controls Cases Genotypic Allelic
DRD2 rs1799732 Promoter 50879 C/del 13.0 9.9 2.22 (0.328) 2.23 (0.135)
rs4274224 Intron1 24079 A/G 37.4 32.3 3.16 (0.205) 2.61 (0.106)
rs12808482 Intron2 376 T/A 38.9 36.2 5.28 (0.071) 0.75 (0.385)
rs11608185 Intron2 398 T/C 38.6 36.0 6.29 (0.043)* 0.65 (0.417)
rs2075652 Intron2 476 C/T 4.3 3.2 0.86 (0.650) 0.80 (0.368)
rs1801028 Exon7 11890 C/G 9.1 9.8 0.45 (0.795) 0.14 (0.699)
rs6275
Exon7 11897 C/T 37.6 41.1 8.91 (0.011) *
1.27 (0.259)
rs6277 Exon7 11915 C/T 39.6 37.0 4.09 (0.128) 0.65 (0.417)
COMT rs3788319 Intron1 20499 A/G 46.9 48.8 1.13 (0.566) 0.34 (0.554)
rs737865 Intron1 19929 T/C 24.1 25.9 1.37 (0.503) 0.40 (0.524)
rs6269 Intron2 98 A/G 30.6 34.3 1.52 (0.465) 1.41 (0.234)
rs4633 Exon3 186 C/T 43.8 38.9 3.14 (0.207) 2.31 (0.128)
rs4818
Exon4 1158 C/G 31.6 36.6 2.41 (0.298) 2.58 (0.108)
rs4680
Exon 5 1222 G/A 44.0 37.0 6.67 (0.035) *
4.75 (0.029)*
rs165599 3UTR 6732 A/G 42.3 44.4 0.41 (0.811) 0.42 (0.514)
BDNF rs6265 Exon6 196 G/A 22.5 19.9 2.32 (0.312) 0.97 (0.324)
Nucleotide positions of the markers are with reference to the first base of the start codon (ATG, considering A as +1) of the gene. All variants are listed with the
major allele first and frequencies (Fallele) are reported for the minor alleles.
*
Significant pvalues (<0.05) of genotypic and allelic models.

Genotype (TT vs TC and CC): 2=6.83; p=0.008; df:1; odds ratio:1.94; 95% confidence interval:1.173.20.

rs4818 is a triallelic locus (C/G/T), but in the studied population only the C and G alleles have been observed.

Allele: df:1, odds ratio:1.33, 95% confidence interval:1.021.73; Genotype (GG vs GA and AA): c2=6.66, d.f.:1, odds ratio:1.64,
95% confidence interval:1.122.41, p=0.009.
df: Degrees of freedom; UTR: Untranslated region.

282 Pharmacogenomics (2009) 10(2) future science group

Genetic susceptibility to schizophrenia: dopaminergic pathway gene polymorphisms Research Article
Table2. Results of the multifactor dimensionality reduction analysis of the DRD2, COMT and BDNF dataset.
No. of variable Markers included in the best Cross-validation Prediction Sign test pvalue
considered candidate model consistency (%) error (%)
2 DRD2 rs6275, COMT rs4680 90 42.42 0.010
3 DRD2 rs4274224, DRD2 rs6275, COMT rs4633 30 49.76 0.828
4 DRD2 rs4274224, DRD2 rs6275, COMT rs3788319,
50 50.00 0.171
COMT rs4633
5 DRD2 rs4274224, DRD2 rs6275, COMT rs3788319,
30 51.25 0.623
COMT rs4818, COMT rs165599

model that included functional SNPs from two
genes: DRD2 (rs6275) and COMT (rs4680) had
the least prediction error of 42.42% and a maxi
mum CVC of 90%. This model had the smallest
pvalue in the sign test (pvalue=0.01). The pre Two major meta-analyses have suggested that
diction error was statistically significant with an
empirical p=0.05 based on 5000 permutations
(pvalue=0.047). Table3 shows the distribution
of high risk and low risk genotypes in the best
two-locus model.
Discussion
We observed nominal association for His313His
(rs6275), a synonymous SNP in exon 7 of
DRD2 gene in our studied population in both
a genotypic and recessive genetic model. The
same genotypic association was also observed
in our previous report [14] . In another south
ern Indian population, Vijayan etal. reported
a significant association of rs6275 in genotypic
(pvalue=0.008) and dominant genetic model
(pvalue=0.004) with schizophrenia[8] . This
SNP may be of special interest specifically in
the southern Indian population; although,
there is a need to further investigate the func
tional consequences of the T/C change in a
more detailed manner. The importance of
synonymous polymorphisms is evident from
studies that report a strong correlation between
bias in synonymous codon usage and the gene-
expression level [60] . Recent analysis has shown
association of rs6275 with tardive dyskinesia
where the genotypes TT and CT showed
increased risk [61] .
We observed genotypic and allelic association
for Val158Met (rs4680) in COMT gene. This
SNP has shown association under dominant
genetic model. For the present sample size power
of allelic and genotypic tests for rs4680 is approx
imately 58.77 and 48.11%, respectively. This is
one of the most extensively studied polymor
phisms and its role has been implicated in a wide
range of disorders such as cancer, hypertension,
panic disorder, acute coronary disease, obsessive
compulsive disorder and bipolar disorder [6266] .
Although this polymorphism has been associ
ated with altered prefrontal lobe function [67] ,
cognition [68] and brain morphology [69] , its asso
ciation with schizophrenia has been ambiguous.
this polymorphism is not associated with schiz
ophrenia in Asian populations [29,30] . Another
study in a northern Indian population also met
with negative results [28] . Lee etal. suggested
that the inconsistent associations of Val158Met
in Asian populations could be attributed to
another polymorphism, Ala72Ser (rs6267) [34] .
However, Ala72Ser is nonpolymorphic in our
studied Indian population.
These results are in accordance with other
studies that have clearly pointed out that
Val158Met allele is a small risk factor for schizo
phrenia susceptibility [26,33] . Additional loci in
the COMT gene that have an impact on the
enzymes function indicate that the relationship
between COMT loci and schizophrenia is more
complex and nonlinear [16] . Therefore, we have
studied association of the common haplotypes
of COMT gene with schizophrenia, which may
help in understanding the interacting effects of
polymorphic loci within the gene [70] .
The Val66Met (rs6265) SNP of the BDNF
gene, which was found to be polymorphic, did
not show any association with schizophrenia, in
agreement with a recent meta-analysis, which
also did not find this SNP to be associated with
schizophrenia [44] .
Several bodies of evidence suggest that
complex disorders may be genetically attrib
utable to complex interactions among multi
ple genes [4850] . The three genes included in
our study are involved in a common pathway
and one could expect to find an additive gene
effect, increasing the risk of developing the dis
order. Although a recent study failed to detect
interaction between COMT Val158Met and
BDNF Val66Met [71] , another study has pro
posed that an interaction of COMT Val158Met
and DRD2 Pro319Pro may be involved in the
generation of some working memory deficits in

future science group www.futuremedicine.com 283

Research Article Gupta, Chauhan, Bhatnagar et al.
Table 3. Distribution of the high-risk and low-risk genotypes in the best two
locus model.
Multilocus-genotype combinations
rs6275 rs4680
CC GG
CT GG
TT GG
TT GA
TT AA
CC GA
CC AA
CT GA
CT AA
schizophrenia[72] . We sought evidence of puta
tive interactions among the selected 16 indi
vidual markers using MDR approach. Among
several models with different numbers of loci,
the best genegene interaction model identified
in our study was a two-locus model including
the Val158Met COMT and His313His DRD2
polymorphisms with a minimum prediction
error of 42.42% and a maximum CVC of 90%.
Such prediction errors are quite likely for com
plex diseases where multiple SNPs interact in a
nonlinear manner to influence susceptibility to
the disease. To evaluate whether the best model
is statistically significant, a permutation test
based on data simulation was applied to obtain
a pvalue. The prediction error was statistically
significant (p-value = 0.02) based on 5000
permutations. Both the SNPs are functional
polymorphisms and have individually shown
association with the disease in this study. The
two locus model indicates that the individual
can become affected through possessing a pre
disposing genotype at either His313His (TT)
or Val158Met (GG). DRD2 and COMT genes
have been implicated to play a role in cognitive
functions and working memory. The working
memory performance needs an optimal level of
dopamine signaling within the prefrontal cortex,
which depends on COMT enzymatic activity
controlling dopamine level as well as dopamine
receptor sensitivity [73] . In addition, dopamin
ergic activity in the midbrain is influenced by
COMT activity as an indirect effect of prefron
tal feedback and high COMT activity leads to
increased levels of meso-limbic dopamine sign
aling hypothesized to result in increased risk for
delusions and hallucinations[16] . Therefore, the
genetic interaction indicated in our study may
reflect a functional relation between these two
genes, which may arise from their function in
284 Pharmacogenomics (2009) 10(2)
Ratio of cases Association with
to controls schizophrenia
2.21 High risk
1.70 High risk
1.75 High risk
2.54 High risk
4.50 High risk
1.16 Low risk
0.92 Low risk
0.81 Low risk
0.87 Low risk
dopaminergic transmission. The 5000permuta
tion test suggests that the two gene interaction
is unlikely due to chance; however, the study
needs to be replicated in a larger sample set for
confirmation, followed by functional studies.
Conclusion
In conclusion, the present study indicates a
weak role of individual variations in the DRD2
and COMT genes with susceptibility to schizo
phrenia in the southern Indian population.
A significant genegene interaction between
COMT and DRD2 suggested that multilocus
SNPs act in combination to influence disease
susceptibility. This interaction is of potential
biological interest and needs to be validated. Our
study thus emphasizes the need for multigene
interaction studies in complex disorders such as
schizophrenia. However, the present study has
moderate power to detect the weak association
signals and these results need to be replicated in
larger sample sets.
Future perspective
For complex disorders, multiple interactions
may be the norm in a given individual. Despite
large effects attributed to single gene poly
morphisms, genegene interactions need to
be considered for complex multifactorial dis
orders for better comprehension of the under
lying genetic pathway architecture, thereby
improving knowledge of disease mechanisms.
Our study has demonstrated the interaction
between DRD2 and COMT genes, which may
reflect a functional relation between these two
genes since both the genes belong to a common
pathway. These results need to be replicated in
a larger sample set for confirmation. Further,
similar interaction studies with additional
genes should be followed up in subsequent
future science group
Genetic susceptibility to schizophrenia: dopaminergic pathway gene polymorphisms
association studies, as well as investigated for
potential biological and mechanistic explana
tions. Additionally, future studies should also
focus on the demographic details of the studied
population along with data concerning cur
rent medication and psychopathology scores
for pharmacogenetic studies, which will make
it easier to replicate the findings and will help
in understanding the reason for heterogeneity
in some studies.
Research Article
Financial & competing interests disclosure
Financial support from Department of Biotechnology
(DBT) and Council of Scientific and Industrial Research
(CSIR) is duly acknowledged. The authors have no other
relevant affiliations or financial involvement with any
organization or entity with a financial interest in or finan
cial conflict with the subject matter or materials discussed
in the manuscript apart from those disclosed.
No writing assistance was utilized in the production of
this manuscript.

Acknowledgements Ethical conduct of research

We thank the patients and family members for their par
ticipation. MG and SG are grateful to CSIR for senior
research fellowship. We are grateful to Majumder PP,
Mukerji M, Mukhopadhaya A and Aggarwal A for intel
lectual inputs; Sharma S, Rana P, Verma B from TCGA
facility for SNP genotyping.
The authors state that they have obtained appropriate insti
tutional review board approval or have followed the princi
ples outlined in the Declaration of Helsinki for all human
or animal experimental investigations. In addition, for
investigations involving human subjects, informed consent
has been obtained from the participants involved.

Executive summary
Aim
The aim of this study was to investigate single-locus associations of 16polymorphisms from the DRD2, COMT and BDNF genes with
schizophrenia in samples from southern India, and to identify combinations of multilocus genotypes that are associated with
disease susceptibility.
Materials & methods
A total of 254patients with schizophrenia and 225matched control subjects, all of southern Indian origin, were recruited from the
clinical services of the National Institute of Mental Health and Neuroscience, Bangalore, India.
Genotyping of 16polymorphisms from three genes (DRD2, COMT and BDNF) was completed; statistical analysis was performed
utilizing 2 test to compare cases and controls to identify genotypic and allelic associations with schizophrenia, along with multifactor
dimensionality reduction analysis to identify combinations of SNPs that are associated with disease susceptibility.
Results
Significant associations of two SNPs in DRD2 (rs11608185 and rs6275) and one SNP in COMT (rs4680) was observed with
schizophrenia, which did not remain significant after correction for multiple comparisons.
Multifactor dimensionality reduction analysis revealed a two locus model (rs6275/DRD2 and rs4680/COMT) as the best model for
genegene interaction with 90% cross-validation consistency and 42.42% prediction error.
Conclusion
The present study indicates a weak role of individual variations in the DRD2 and COMT genes with susceptibility to schizophrenia.
Significant genegene interaction observed between COMT and DRD2 polymorphisms is of plausible biological interest and suggests
that multilocus SNPs act in combination to influence disease susceptibility.

Bibliography
Papers of special note have been highlighted as:
n of interest
nn of considerable interest
1 Muller DJ, Luca VD, Kennedy JL:
Overview: towards individualized treatment
in schizophrenia. Drug Dev. Res. 60, 7594
(2003).
2 Verma R, Mukerji M, Grover D et al.:
MLC1 gene is associated with schizophrenia
and bipolar disorder in southern India. Biol.
Psychiatry 58, 1622 (2005).
3 Seeman P: Dopamine receptors and the
dopamine hypothesis of schizophrenia.
Synapse 1, 133152 (1987).
4 Gupta S, Jain S, Brahmachari SK, Kukreti
R: Pharmacogenomics: a path to predictive
medicine for schizophrenia. Pharmacogenomics
7, 3147 (2006).
nn Comprehensive review that presents a
network model of the interaction between
the neurotransmitter signaling systems.
5 Arinami T, Gao M, Hamaguchi H, Toru M:
A functional polymorphism in the promoter
9 Verga M, Macciardi F, Pedrini S, Cohen S,
region of the dopamine D2 receptor gene is
associated with schizophrenia. Hum. Mol.
Genet. 6, 577582 (1997).
6 Serretti A, Lattuada E, Lorenzi C, Lilli R,
Smeraldi E: Dopamine receptor D2 Ser/Cys
311 variant is associated with delusion and
disorganization symptomatology in major
psychoses. Mol. Psychiatry 5, 270274 (2000).
7 Hanninen K, Katila H, Kampman O etal.:
Association between the C957T
polymorphism of the dopamine D2 receptor
gene and schizophrenia. Neurosci. Lett. 407,
195198 (2006).
8 Vijayan NN, Bhaskaran S, Koshy LV etal.:
Association of dopamine receptor
polymorphisms with schizophrenia and
antipsychotic response in a South Indian
population. Behav. Brain Funct. 3, 34 (2007).
Smeraldi E: No association of the Ser/Cys311
DRD2 molecular variant with schizophrenia
using a classical case control study and the
haplotype relative risk. Schizophr. Res. 25,
117121 (1997).
10 Hori H, Ohmori O, Shinkai T, Kojima H,
Nakamura J: Association analysis between
two functional dopamine D2 receptor gene
polymorphisms and schizophrenia. Am.
J.Med. Genet. 105, 176178 (2001).

future science group www.futuremedicine.com 285

Research Article Gupta, Chauhan, Bhatnagar et al.
11 Glatt SJ, Faraone SV, Tsuang MT: DRD2
141C insertion/deletion polymorphism is
not associated with schizophrenia: results of
a meta-analysis. Am. J.Med. Genet.
BNeuropsychiatr. Genet. 128, 2123 (2004).
12 Sanders AR, Duan J, Levinson DF etal.:
No significant association of 14candidate
genes with schizophrenia in a large
European ancestry sample: implications for
psychiatric genetics. Am. J.Psychiatry 165,
497506 (2008).
13 Zhang Y, Bertolino A, Fazio L etal.:
Polymorphisms in human dopamine D2
receptor gene affect gene expression,
splicing, and neuronal activity during
working memory. Proc. Natl Acad. Sci. USA
104, 2055220557 (2007).
14 Kukreti R, Tripathi S, Bhatnagar P etal.:
Association of DRD2 gene variant with
schizophrenia. Neurosci. Lett. 392, 6871
(2006).
15 Glatt SJ, Jonsson EG: The Cys allele of the
DRD2 Ser311Cys polymorphism has a
dominant effect on risk for schizophrenia:
evidence from fixed- and random-effects
meta-analyses. Am. J.Med. Genet.
BNeuropsychiatr. Genet. 141, 149154
(2006).
16 Tunbridge EM, Harrison PJ, Weinberger
DR: Catechol-O-methyltransferase,
cognition, and psychosis: Val158Met and
beyond. Biol. Psychiatry 60, 141151 (2006).
17 Owen MJ, Williams NM, ODonovan MC:
The molecular genetics of schizophrenia:
new findings promise new insights. Mol.
Psychiatry 9, 1427 (2004).
18 Williams NM, Owen MJ: Genetic
abnormalities of chromosome22 and the
development of psychosis. Curr. Psychiatry
Rep. 6, 176182 (2004).
19 Shprintzen RJ, Goldberg R, Golding-
KushnerKJ, Marion RW: Late-onset
psychosis in the velo-cardio-facial
syndrome. Am. J.Med. Genet. 42, 141142
(1992).
20 Gothelf D, Schaer M, Eliez S: Genes, brain
development and psychiatric phenotypes in
velo-cardio-facial syndrome. Dev. Disabil.
Res. Rev. 14, 5968 (2008).
21 Lotta T, Vidgren J, Tilgmann C etal.:
Kinetics of human soluble and membrane-
bound catechol O-methyltransferase:
a revised mechanism and description of the
thermolabile variant of the enzyme.
Biochemistry 34, 42024210 (1995).
22 Chen J, Lipska BK, Halim N etal.:
Functional analysis of genetic variation in
catechol-O-methyltransferase (COMT ):
effects on mRNA, protein, and enzyme
activity in postmortem human brain. Am.
J.Hum. Genet. 75, 807821 (2004).
286
23 Palmatier MA, Kang AM, Kidd KK: Global
variation in the frequencies of functionally
different catechol-O-methyltransferase alleles.
Biol. Psychiatry 46, 557567 (1999).
First global survey of frequency of COMT
n Ala72Ser polymorphism with COMT
polymorphism (rs4680) undertaken in
30diverse populations.
24 Chen X, Wang X, ONeill AF, Walsh D,
Kendler KS: Variants in the catechol-O-
methyltransferase (COMT ) gene are associated
with schizophrenia in Irish high-density
families. Mol. Psychiatry 9, 962967 (2004).
25 Handoko HY, Nyholt DR, Hayward NK etal.:
Separate and interacting effects within the
catechol-O-methyltransferase (COMT) are
associated with schizophrenia. Mol. Psychiatry
10, 589597 (2005).
26 Abdolmaleky HM, Cheng KH, Faraone SV
etal.: Hypomethylation of MB-COMT
promoter is a major risk factor for
schizophrenia and bipolar disorder. Hum. Mol.
Genet. 15, 31323145 (2006).
27 Pelayo-Tern JM, Crespo-Facorro B,
Carrasco-Marn E: Catechol-O-
methyltransferase Val158Met polymorphism
and clinical characteristics in first episode
non-affective psychosis. Am. J.Med. Genet.
BNeuropsychiatr. Genet. 147B, 550556
(2008).
28 Semwal P, Prasad S, Varma PG, BhagwatAM,
Deshpande SN, Thelma BK: Candidate gene
polymorphisms among North Indians and
their association with schizophrenia in a
casecontrol study. J.Genet. 81, 6571 (2002).
29 Glatt SJ, Faraone SV, Tsuang MT: Association
between a functional catechol
O-methyltransferase gene polymorphism and
schizophrenia: meta-analysis of casecontrol
and family-based studies. Am. J.Psychiatry
160, 469476 (2003).
30 Fan JB, Zhang CS, Gu NF etal.: Catechol-O-
methyltransferase gene Val/Met functional
polymorphism and risk of schizophrenia:
a large-scale association study plus meta-
analysis. Biol. Psychiatry 57, 139144 (2005).
31 Munafo MR, Bowes L, Clark TG, Flint J:
Lack of association of the COMT (Val158/108
Met) gene and schizophrenia: a meta-analysis
of casecontrol studies. Mol. Psychiatry 10,
765770 (2005).
32 Nunokawa A, Watanabe Y, Muratake T,
Kaneko N, Koizumi M, Someya T: No
associations exist between five functional
polymorphisms in the catechol-O-
methyltransferase gene and schizophrenia in a
Japanese population. Neurosci. Res. 58,
291296 (2007).
33 Shifman S, Bronstein M, Sternfeld M etal.:
A highly significant association between a
COMT haplotype and schizophrenia. Am.
J.Hum. Genet. 71, 12961302 (2002).
Pharmacogenomics (2009) 10(2)
n A highly significant association of
COMT haplotype was reported in a
large population.
34 Lee SG, Joo Y, Kim B etal.: Association of
enzyme activity and the risk of schizophrenia
in Koreans. Hum. Genet. 116, 319328
(2005).
35 Meyer-Lindenberg A, Nichols T, Callicott JH
etal.: Impact of complex genetic variation in
COMT on human brain function. Mol.
Psychiatry 11, 867877 (2006).
36 Bray NJ, Buckland PR, Williams NM etal.:
A haplotype implicated in schizophrenia
susceptibility is associated with reduced
COMT expression in human brain. Am.
J.Hum. Genet. 73, 152161 (2003).
n The haplotype implicated in schizophrenia
susceptibility was found to be associated
with lower expression of COMT mRNA in
human brain.
37 Angelucci F, Brene S, Mathe AA: BDNF in
schizophrenia, depression and corresponding
animal models. Mol. Psychiatry 10, 345352
(2005).
38 Galderisi S, Maj M, Kirkpatrick B etal.:
COMT Val(158)Met and BDNF C(270)T
polymorphisms in schizophrenia:
a casecontrol study. Schizophr. Res. 73,
2730 (2005).
39 Dluzen DE, Gao X, Story GM, Anderson LI,
Kucera J, Walro JM: Evaluation of
nigrostriatal dopaminergic function in adult
+/+ and +/- BDNF mutant mice. Exp.
Neurol. 170, 121128 (2001).
40 Durany N, Michel T, Zochling R etal.:
Brain-derived neurotrophic factor and
neurotrophin3 in schizophrenic psychoses.
Schizophr. Res. 52, 7986 (2001).
41 Egan MF, Weinberger DR, Lu B:
Schizophrenia,III: brain-derived neurotropic
factor and genetic risk. Am. J.Psychiatry 160,
1242 (2003).
42 Neves-Pereira M, Cheung JK, Pasdar A etal.:
BDNF gene is a risk factor for schizophrenia
in a Scottish population. Mol. Psychiatry 10,
208212 (2005).
43 Watanabe Y, Muratake T, Kaneko N,
Nunokawa A, Someya T: No association
between the brain-derived neurotrophic
factor gene and schizophrenia in a Japanese
population. Schizophr. Res. 84, 2935
(2006).
44 Naoe Y, Shinkai T, Hori H etal.: No
association between the brain-derived
neurotrophic factor (BDNF ) Val66Met
polymorphism and schizophrenia in Asian
populations: Evidence from a casecontrol
study and meta-analysis. Neurosci. Lett. 415,
108112 (2007).
future science group
Genetic susceptibility to schizophrenia: dopaminergic pathway gene polymorphisms
45 Cloninger CR: Multilocus genetics of
schizophrenia. Curr. Opin. Psychiatry 10,
510 (1997).
46 Moore JH, Williams SM: New strategies for
identifying genegene interactions in
hypertension. Ann. Med. 34, 8895 (2002).
nn A nonparametric and genetic model-free
approach was adopted to develop a software
for identifying genegene interactions.
47 Ritchie MD, Hahn LW, Roodi N etal.:
Multifactor-dimensionality reduction
reveals high-order interactions among
estrogen-metabolism genes in sporadic
breast cancer. Am. J.Hum. Genet. 69,
138147 (2001).
n First report which demonstrated a
four-locus interaction associated with a
complex multifactorial disease in absence
of any statistically significant independent
main effects.
48 Cho YM, Ritchie MD, Moore JH etal.:
Multifactor-dimensionality reduction shows
a two-locus interaction associated with
Type2 diabetes mellitus. Diabetologia 47,
549554 (2004).
49 Xu J, Lowey J, Wiklund F etal.: The
interaction of four genes in the inflammation
pathway significantly predicts prostate
cancer risk. Cancer Epidemiol. Biomarkers
Prev. 14, 25632568 (2005).
50 Motsinger AA, Brassat D, Caillier SJ etal.:
Complex genegene interactions in multiple
sclerosis: a multifactorial approach reveals
associations with inflammatory genes.
Neurogenetics 8, 1120 (2007).
51 Wing JK, Babor T, Brugha T etal.: SCAN.
Schedules for clinical assessment in
neuropsychiatry. Arch. Gen. Psychiatry 47,
589593 (1990).
52 McGuffin P, Farmer A, Harvey I:
A polydiagnostic application of operational
criteria in studies of psychotic illness.
Development and reliability of the OPCRIT
system. Arch. Gen. Psychiatry 48, 764770
(1991).
53 Miller SA, Dykes DD, Polesky HF: A simple
salting out procedure for extracting DNA
from human nucleated cells. Nucleic Acids
Res. 16, 1215 (1988).
54 Nyholt DR: A simple correction for multiple
testing for single-nucleotide polymorphisms
in linkage disequilibrium with each other.
Am. J.Hum. Genet. 74, 765769 (2004).
55 Gordon D, Finch SJ, Nothnagel M, Ott J:
Power and sample size calculations for
casecontrol genetic association tests when
future science group
errors are present: application to single
nucleotide polymorphisms. Hum. Hered. 54,
2233 (2002).
56 Gordon D, Levenstien MA, Finch SJ, Ott J:
Errors and linkage disequilibrium interact
multiplicatively when computing sample sizes
for genetic casecontrol association studies.
Pac. Symp. Biocomput. 490501 (2003).
57 Barrett JC, Fry B, Maller J, Daly MJ:
Haploview: analysis and visualization of LD
and haplotype maps. Bioinformatics 21,
263265 (2005).
58 Hahn LW, Ritchie MD, Moore JH:
Multifactor dimensionality reduction software
for detecting genegene and geneenvironment
interactions. Bioinformatics 19, 376382
(2003).
59 Kim SH, Jeong HH, Cho BY etal.: Association
of four-locus gene interaction with aspirin-
intolerant asthma in Korean asthmatics.
J.Clin. Immunol. 28, 336342 (2008).
60 Iida K, Akashu H: A test for translational
selection at silent sites in the human genome:
base composition comparisons in alternatively
spliced genes. Gene 261, 93105 (2000).
61 Mo GH, Liao DL, Lai IC etal.: Support for an
association of the C939T polymorphism in the
human DRD2 gene with tardive dyskinesia in
schizophrenia. Schizophr. Res. 97(13),
302304 (2007).
62 Tanaka Y, Sasaki M, Shiina H etal.:
Catechol-O-methyltransferase gene
polymorphisms in benign prostatic hyperplasia
and sporadic prostate cancer. Cancer Epidemiol.
Biomarkers Prev. 15, 238244 (2006).
63 Rothe C, Koszycki D, Bradwejn J etal.:
Association of the Val158Met catechol
O-methyltransferase genetic polymorphism
with panic disorder. Neuropsychopharmacology
31, 22372242 (2006).
64 Voutilainen S, Tuomainen TP, Korhonen M
etal.: Functional COMT Val158Met
polymorphism, risk of acute coronary events
and serum homocysteine: the kuopio ischaemic
heart disease risk factor study. PLoS ONE 2,
E181 (2007).
65 Pooley EC, Fineberg N, Harrison PJ:
The met(158) allele of catechol-O-
methyltransferase (COMT ) is associated with
obsessive-compulsive disorder in men:
casecontrol study and meta-analysis. Mol.
Psychiatry 12, 556561 (2007).
66 Shifman S, Bronstein M, Sternfeld M etal.:
COMT: a common susceptibility gene in
bipolar disorder and schizophrenia. Am.
J.Med. Genet. BNeuropsychiatr. Genet. 128,
6164 (2004).
www.futuremedicine.com
Research Article
67 Egan MF, Goldberg TE, Kolachana BS
etal.: Effect of COMT Val108/158 Met
genotype on frontal lobe function and risk
for schizophrenia. Proc. Natl Acad. Sci. USA
98, 69176922 (2001).
68 Woodward ND, Jayathilake K, Meltzer HY:
COMT val108/158met genotype, cognitive
function, and cognitive improvement with
clozapine in schizophrenia. Schizophr. Res.
90, 8696 (2007).
69 Ohnishi T, Hashimoto R, Mori T etal.:
The association between the Val158Met
polymorphism of the catechol-O-methyl
transferase gene and morphological
abnormalities of the brain in chronic
schizophrenia. Brain 129, 399410 (2006).
70 Gupta M, Bhatnagar P, Grover S et al.:
Association studies of catechol-O-methyl
transferase (COMT ) gene with
schizophrenia and response to antipsychotic
treatment. Pharmacogenomics (2009) (In
press).
71 Numata S, Ueno S, Iga J etal.: Interaction
between catechol-O-methyltransferase
(COMT ) Val108/158Met and brain-derived
neurotrophic factor (BDNF ) Val66Met
polymorphisms in age at onset and clinical
symptoms in schizophrenia. J.Neural
Transm. 114, 255259 (2007).
72 Xu H, Kellendonk CB, Simpson EH etal.:
DRD2 C957T polymorphism interacts with
the COMT Val158Met polymorphism in
human working memory ability. Schizophr.
Res. 90, 104107 (2007).
73 Gosso MF, de Geus EJ, Polderman TJ,
Boomsma DI, Heutink P, Posthuma D:
Catechol O-methyl transferase and
dopamine D2 receptor gene polymorphisms:
evidence of positive heterosis and genegene
interaction on working memory
functioning. Eur. J.Hum. Genet. 16,
10751082 (2008).
Websites
101 MRC Social, Genetic and Developmental
Policy Centre: resources for the
OPCRIT package
http://sgdp.iop.kcl.ac.uk/opcrit
102 dbSNP
www.ncbi.nlm.nih.gov/projects/SNP/
103 Pupasuite
http://pupasuite.bioinfo.cipf.es/
104 Power for Association With Errors (PAWE)
http://linkage.rockefeller.edu/pawe/
105 International HapMap Project Affiliations
www.hapmap.org/
287
Research Article Gupta, Chauhan, Bhatnagar et al.

Supplementary material

Supplementary Table 1. PCR primers and genotyping primers for the SNPs
genotyped by MALDI-TOF mass spectrometry (Sequenom).
Gene Locus Primer Sequence (5 -> 3)
DRD2 rs1799732 FP ACGTTGGATGAAAGGAGCTGTACCTCCTCG
RP ACGTTGGATGCTCAAAACAAGGGATGGCGG
hME CTCGGCGATCCCCGGCCTG
rs4274224 FP ACGTTGGATGGCTCCTTACCAATCCTTTCC
RP ACGTTGGATGCAAGCTCATTGTCACTTCCG
hME CCTTTCCACTCTAGGGAACC
rs4986918 FP ACGTTGGATGACTACTATGCCACACTGCTC
RP ACGTTGGATGTGACGATCAGGTAGTTGGTG
hME CACACTGCTCACCCTGCT
rs12808482 FP ACGTTGGATGAAGTAAGCCCAGAGTGAAGG
RP ACGTTGGATGACTCTAGCTCCCCACTGGCTT
hME AAGCACCAGGAAACTCA
rs11608185 FP ACGTTGGATGTCTACCCATTTCGTAAGGAG
RP ACGTTGGATGACCAATGAGTTTCCTGGTGC
hME GAGTGAAGGAAAAACCACC
rs2075652 FP ACGTTGGATGCGAAATGGGTAGATTGTTTCC
RP ACGTTGGATGTGCTGTGAGGGTTATATAGG
hME TGTTTCCTTAATAATCCCAACTA
Val96Ala FP ACGTTGGATGAAGCTAATCTCCCACTCCTG
RP ACGTTGGATGGATGTCACAGTGAATCCTGC
hME TATGTTGCTTTGTCCCCAGG
Val255Val FP ACGTTGGATGCACTGGGAAACTCCCATTAG
RP ACGTTGGATGTCCACAGGGCAACTGTACTC
hME ACTCCCATTAGACTTCATGAT
rs1801028 FP ACGTTGGATGAGCCACCACCAGCTGACTCT
RP ACGTTGGATGCATTCTTCTCTGGTTTGGCG
hME GACTCTCCCCGACCCGT
rs6275 FP ACGTTGGATGCATTCTTCTCTGGTTTGGCG
RP ACGTTGGATGAGCCACCACCAGCTGACTCT
hME GGAGTGCTGTGGAGACC
rs6277 FP ACGTTGGATGTCCCACCATGGTCTCCACAG
RP ACGTTGGATGCTTTGGCATGCCCATTCTTC
hME GGTCTCCACAGCACTCC
Lys367Lys FP ACGTTGGATGCTCAAGACCATGAGCCGTAG
RP ACGTTGGATGAACAATGGCGAGCATCTGAG
hME AGGAAGCTCTCCCAGCAGAA
COMT rs3788319 FP ACGTTGGATGAGTTCCTCCAGATTCCCCAC
RP ACGTTGGATGGCTGTGAAGTGATCTGACG
hME TTCCCCACCCCAAGTCCGGAGAC
rs737865 FP ACGTTGGATGCTTGGAGGGTCACTTTAAAC
RP ACGTTGGATGCTAACAGACCTGCTTTTTGG
hME GCAACAGGACACAAAAA
rs6269 FP ACGTTGGATGTTGCTTGGAGTGCCACCATC
RP ACGTTGGATGCAAGGCTGGCATTTCTGAAC
hME CACCATCGCCCCCTTGTGTT
FP: Forward primer; hME: Homogeneous MassEXTEND primer; MALDI-TOF: matrix-assisted laser desorption/ionization
time of flight; RP: Reverse primer.

288 Pharmacogenomics (2009) 10(2) future science group

Genetic susceptibility to schizophrenia: dopaminergic pathway gene polymorphisms Research Article
Supplementary Table 1. PCR primers and genotyping primers for the SNPs
genotyped by MALDI-TOF mass spectrometry (Sequenom).
Gene Locus Primer Sequence (5 -> 3)
COMT rs4633 FP ACGTTGGATGACAACCTGCTCATGGGTGAC
(cont.) RP ACGTTGGATGTTCTGCTCGCAGTAGGTGTC
hME CAGCGCATCCTGAACCA
rs6267 FP ACGTTGGATGACAACCTGCTCATGGGTGAC
RP ACGTTGGATGTTCTGCTCGCAGTAGGTGTC
hME AGCATGCGGAGCCCGGGAAC
rs4818 FP ACGTTGGATGACTGTGGCTACTCAGCTGTG
RP ACGTTGGATGATGCACACCTTGTCCTTCAC
hME CTGCTGTCACCAGGGGCGAGGCT
rs4680 FP ACGTTGGATGTTTTCCAGGTCTGACAACGG
RP ACGTTGGATGCATCACCATCGAGATCAACC
hME CATGCACACCTTGTCCTTCA
rs165599 FP ACGTTGGATGGGCTGACTCCTCTTCGTTTC
RP ACGTTGGATGACAGTGGTGCAGAGGTCAG
hME CTCTTCGTTTCCCAGGC
BDNF rs6265 FP ACGTTGGATGGACTCTGGAGAGCGTGAATG
RP ACGTTGGATGTCATTGGGCCGAACTTTCTG
hME CTGACACTTTCGAACAC
rs1048218 FP ACGTTGGATGTGGCTGACACTTTCGAACAC
RP ACGTTGGATGGACGTGTACAAGTCTGCGTC
hME CTGTTGGATGAGGACCA
rs1048221 FP ACGTTGGATGACCTAGATGCTGCAAACATG
RP ACGTTGGATGTACTGTCACACACGCTCAGC
hME CTGCAAACATGTCCATGAGGGTCC
rs2353512 FP ACGTTGGATGAGCGTGTGTGACAGTATTAG
RP ACGTTGGATGTGGCCTTTTGATACAGGGAC
hME TAGTGAGTGGGTAACGGC
FP: Forward primer; hME: Homogeneous MassEXTEND primer; MALDI-TOF: matrix-assisted laser desorption/ionization
time of flight; RP: Reverse primer.

future science group www.futuremedicine.com 289

Research Article Gupta, Chauhan, Bhatnagar et al.

Supplementary Table 2. Genotypic distributions of markers from the DRD2, COMT and BDNF genes.
Gene dbSNP ID Genotype counts (%) 2 (p-value)
DRD2 rs1799732 CC C.DEL DEL.DEL 2.22 (0.328)

Controls 169 (75.8) 50 (22.4) 4 (1.8)

Cases 205 (81.3) 44 (17.5) 3 (1.2)
rs4274224 AA AG GG 3.16 (0.205)
Controls 84 (40.8) 90 (43.7) 32 (15.5)
Cases 116 (45.7) 112 (44.1) 26 (10.2)
rs12808482 TT TA AA 5.28 (0.071)
Controls 79 (35.1) 117 (52.0) 29 (12.9)
Cases 109 (43.1) 105 (41.5) 39 (15.4)
rs11608185 TT TC CC 6.29 (0.043)
Controls 79 (35.4) 116 (52.0) 28 (12.6)
Cases 111 (43.7) 103 (40.5) 40 (15.8)
rs2075652 CC CT TT 0.86 (0.650)
Controls 205 (91.9) 17 (7.6) 1 (0.5)
Cases 238 (94.1) 14 (5.5) 1 (0.4)
rs1801028 CC CG GG 0.45 (0.795)
Controls 186 (82.7) 37 (16.4) 2 (0.9)
Cases 208 (81.9) 42 (16.5) 4 (1.6)
rs6275 CC CT TT 8.91 (0.011)
Controls 82 (37.1) 112 (50.7) 27 (12.2)
Cases 99 (39.0) 101 (39.8) 54 (21.3)
rs6277 CC CT TT 4.09 (0.128)
Controls 76 (33.8) 120 (53.3) 29 (12.9)
Cases 104 (40.9) 112 (44.1) 38 (15.0)
COMT rs3788319 AA GA GG 1.13 (0.566)
Controls 60 (26.7) 119 (52.9) 46 (20.4)
Cases 67 (26.7) 123 (49.0) 61 (24.3)
rs737865 TT CT CC 1.37 (0.503)
Controls 126 (56.8) 85 (38.3) 11 (5.0)
Cases 140 (55.8) 92 (36.7) 19 (7.6)
rs6269 AA AG GG 1.52 (0.465)
Controls 105 (47.3) 98 (44.1) 19 (8.6)
Cases 109 (42.9) 116 (45.7) 29 (11.4)
rs4633 CC CT TT 3.14 (0.207)
Controls 68 (30.4) 116 (51.8) 40 (17.9)
Cases 96 (38.1) 116 (46.0) 40 (15.9)
rs4818 CC CG GG 2.41 (0.298)
Controls 108 (49.1) 85 (38.6) 27 (12.3)
Cases 107 (42.3) 107 (42.3) 39 (15.4)
rs4680 GG GA AA 6.67 (0.035)
Controls 66 (29.6) 118 (52.9) 39 (17.5)
Cases 104 (40.9) 112 (44.1) 38 (15.0)
rs165599 AA GA GG 0.41 (0.811)
Controls 75 (33.8) 106 (47.8) 41 (18.5)
Cases 79 (31.4) 122 (48.4) 51 (20.2)
BDNF rs6265 GG GA AA 2.32 (0.312)
Controls 129 (58.6) 83 (37.7) 8 (3.6)
Cases 164 (64.6) 79 (31.1) 11 (4.3)
Genotype frequencies (in parentheses) are expressed as percentages (%). Significant p-values (<0.05) are marked in bold.

290 Pharmacogenomics (2009) 10(2) future science group

Genetic susceptibility to schizophrenia: dopaminergic pathway gene polymorphisms Research Article
Supplementary Table 3. Power estimates of allelic and genotypic tests for markers from the DRD2, COMT and
BDNF genes.
Gene dbSNP ID Power*
Allelic test (%) Genotypic test (%)
DRD2 rs1799732 31.33 24.12
rs4274224 37.34 29.00
rs12808482 13.65 10.87
rs11608185 13.02 10.43
rs2075652 13.40 10.70
rs1801028 6.48 5.17
rs6275 19.87 47.68
rs6277 12.94 10.37
COMT rs3788319 8.95 7.63
rs737865 9.70 8.14
rs6269 22.61 17.38
rs4633 33.09 25.53
rs4818 36.31 28.15
rs4680 58.77 48.11
rs165599 9.92 8.29
BDNF rs6265 16.26 12.72
Power calculations have been done assuming the Douglas Skol Boehnke error model with parameter settings of (0.01)and (0.01).
*

future science group www.futuremedicine.com 291