Communicating Current Research and Educational Topics and Trends in Applied Microbiology

A. Mndez-Vilas (Ed.)
_____________________________________________________________________

Learning to Operate Anaerobic Bioreactors

A. Franco, A. Mosquera-Corral, J.L. Campos, E. Roca*
Department of Chemical Engineering, School of Engineering, University of Santiago de Compostela,
Lope Gmez de Marzoa s/n, 15782 Santiago de Compostela, Spain

This chapter describes the main parameters and the different techniques used to characterize an anaerobic
bioreactor and how to apply the obtained information to learn how to operate it. In this kind of biological
systems, the large number of processes, operating parameters and removed compounds involved makes
necessary to combine knowledge from both Microbiology and Chemical Reactor Engineering. The main
difficulties encountered on the operation (start-up, operation) of anaerobic reactors are commented. In
each part, the pertinent measurements for improving the bioreactor performance in practice are
introduced.

Keywords, Anaerobic digestion, bioreactor operation, microbial populations, wastewater treatment

1. Introduction
The treatment of industrial wastewaters can be carried out by either aerobic or anaerobic biological
processes. To carry out an aerobic process, air must be continuously supplied to convert 50% of the
organic matter compounds, measured as Chemical Oxygen Demand (COD), into CO2 and 50% into
sludge which is a waste product requiring large investments for disposal. In the case of the anaerobic
process 90% of the COD is converted, in absence of oxygen, into biogas containing methane (CH4),
which can be used as fuel, and in advantage only very little COD is converted into sludge. Nevertheless,
this process must be operated at temperatures around 35 C increasing costs of energy consumption. The
anaerobic process is then recommended for the treatment of high concentrated wastewater since the
amount of methane generated can compensate the energetic cost to maintain the temperature of the
bioreactor.
Anaerobic digestion is a naturally occurring biological process by which organic matter compounds
are broken down to simple components under anaerobic conditions. Anaerobic micro-organisms digest
the organic materials to produce biogas containing methane and carbon dioxide as end-products [1, 2].
The biogas produced in the anaerobic bioreactor usually contains small amounts of hydrogen sulphide
(SH2) and ammonia (NH3), as well as trace amounts of other gases.
Anaerobic digestion is a complex process which comprises three main steps (Fig.1): hydrolysis,
acidogenesis and methanogenesis [3]. During hydrolysis, the fermentative bacteria convert the insoluble
complex organic matter compounds into soluble molecules such as volatile fatty acids (VFA), amino
acids and sugars. The complex polymeric compounds are hydrolyzed to monomers. In the second stage,
acetogenic bacteria, also known as acid formers, convert the products from the first stage into simple
organic acids, carbon dioxide and hydrogen. The main compounds produced are acetic, propionic and
butyric acids and ethanol. Finally, methane is produced during methanogenesis by bacteria called
methane formers in two ways: a.- by means of cleavage of two acetic acid molecules to generate carbon
dioxide and methane; or b.- by reduction of carbon dioxide with hydrogen. Usually the first reaction is
the preferred one.
The anaerobic digestion is a biological process involving many different types of micro-organisms in
a tight syntrophic relationship, where the production of methane gas is the slowest and most sensitive
step. For this reason, specific environmental conditions (temperature and pH) must be maintained for the

*
Corresponding author: e-mail: eqeroca@lugo.usc.es, Phone: +34 981563100

618

FORMATEX 2007
 Communicating Current Research and Educational Topics and Trends in Applied Microbiology
A. Mndez-Vilas (Ed.)
_____________________________________________________________________

growth of methanogenic bacteria. It is also essential that the organic acids formed in the first and second
stages of the waste treatment process are converted to methane at the same rate as they are formed. If
not, they accumulate and ultimately lower the pH, leading to inhibition of the methanogenesis process
and to a bioreactor operation failure. In this sense, the operation of the anaerobic bioreactors requires a
wide knowledge of the kinds of micro-organisms involved and their kinetic characteristics [4].
One of the key factors for the quick implementation
Insoluble complex organic matter of the anaerobic treatment was the development of
high-rate reactor systems [5-7] allowing for an
Fermentative
extreme uncoupling of the solid retention time from
bacteria the hydraulic retention time (AF -Anaerobic Filter-;
Intermediate products: UASB -Upflow Anaerobic Sludge Blanket-; EGSB -
fatty acids, amino acids and sugars Expanded Granular Sludge Blanket-, etc.). In this
type of systems hydrodynamic conditions fulfil a
Acetogenic fundamental role in the compaction of the biomass.
bacteria Shear stress, caused by the operational
hydrodynamic conditions, promotes the phenomenon
H2 + CO2 Acetate of the cellular aggregation, provoking the formation
Methanogenic of dense biomass clusters which are easily retained
bacteria inside the bioreactor due to the improvement of its
Zone Settling Velocity (ZSV). Moreover,
CH4 + CO2 hydrodynamic conditions allow promoting intimate
contact between substrates and biomass and help to
Fig. 1 Main steps of the anaerobic digestion process. maintain the adequate environmental conditions
along the bioreactor [8-10].
The monitoring and diagnosis of the performance of anaerobic bioreactors becomes a complex task
due to the large number of processes involved, the important operating parameters to be determined and
the variety of removed compounds during the different stages. In order to fulfill these tasks it is
necessary to combine knowledge from both Microbiology to identify the micro-organisms and Chemical
Reactor Engineering to characterize the hydrodynamics of the bioreactor and to determine the kinetic
parameters of microbial populations. In the following sections the main variables and operational
parameters used to characterize the operation of an anaerobic bioreactor are described. The way this
obtained information is used to gain knowledge to operate this kind of bioreactors is also discussed.

2. Variables and operational parameters

Maintaining the stability of the anaerobic bioreactor is particularly important since the restoration of its
efficiency, after an unstable period, usually takes very long time [10-12]. The main parameters measured
to monitore the performance of these systems are the following:
Methanogenic activity.- Methanogenic biomass is responsible for transforming intermediate
metabolites such as hydrogen, acetate and other VFA. High values of methanogenic activity values (high
concentration of active methanogenic sludge) contributes to prevent the digester acidification as , it
avoids the accumulation of these intermediates. Furthermore, the determination of the microbial activity
of the main populations involved in the different anaerobic process steps (e.g. acidogenesis,
methanogenesis,) is useful to determine the limiting step and gives information about the maximum
organic load which can be applied to the system without causing a loss of its stability [13].
pH.- The bioreactor should be operated at pH values between 6.7 and 7.4 because the methanogenic
activity fails when the pH value decreases below 6.5.
Alkalinity.- Partial alkalinity, as a measure of bicarbonate concentration, and intermediate alkalinity,
as a measure of the concentration of VFA, are useful parameters for monitoring anaerobic digestion
processes. A total alkalinity (partial alkalinity plus intermediate alkalinity) of 1.5 g CaCO3/L is
recommended for an adequate performance of the anaerobic systems. However the true monitoring

619

FORMATEX 2007
Communicating Current Research and Educational Topics and Trends in Applied Microbiology
A. Mndez-Vilas (Ed.)
_____________________________________________________________________

parameter used is the intermediate alkalinity to total alkalinity ratio which must be maintained lower than
0.3-0.4 [9].
Biogas composition.- This parameter is a fast indicator of operational problems in the system. Under
stable operational conditions, the end products in the biogas are CH4 and CO2. Intermediate products
such as H2 and/or CO are frequently accumulated during perturbations. Therefore, the presence of these
compounds in the produced biogas can be used to detect the perturbation stages [11].
A global mass balance performed to the bioreactor allows the estimation of the amount of methane
produced by the system (Fig. 2, a) while the energy balance is a useful tool to calculate the energetic
requirement to maintain the bioreactor at the appropriated temperature value (Fig. 2, b).

a Output: biogas produced b Input: biogas produced

Qg%CH4kgCH4/1.4m3CH44kgCOD/kgCH4 Qg%CH4kgCH4/1.4m3CH4Heat of combustionCH
4

Output: liquid stream

Input: liquid stream Output: liquid stream mCpTef

Input: liquid stream
QCODinf QCODef mCpTinf
Output: loss of heat
AU(Tef-Tenv)

Accumulation: biomass produced m: mass flow rate of wastewater (kg/d)

Qg: gas flow rate (m3/d)
10%Q(CODinf-CODef) Tinf Tef and Tenv: temperature of influent, effluent
and environment (C)
Q: flow rate of wastewater (m3/d) Cp: specific heat capacity of wastewater (kJ/kgC)
Qg: gas flow rate (m3/d) A: surface area of the bioreactor (m2)
CODinf and CODef: COD of influent and effluent (kg COD/m3) U: overall heat transfer coefficient (kW/m2C)
Fig. 2 Mass (a) and energy (b) balances applied to an anaerobic bioreactor.

The mass balance is done in terms of COD: 10% of the gap between COD of the inlet and outlet
liquid streams is accumulated inside the bioreactor as biomass and 90% is converted into methane. Based
on practical experience, a ratio of 0.35 m3 CH4/kg COD degraded can be considered as a realistic value
to estimate the methane production while the percentage of methane in the biogas can be estimated by
Eq. (1).
COD

4 1.5 TOC
%CH 4 = 0.5 100 (1)

8

where COD and TOC are the concentrations of Chemical Oxygen Demand and the Total Organic Carbon
of the influent, respectively.
Maintaining the bioreactor at an adequate operational temperature requires heating the inlet stream
and taking into account the losses of heat to the environment. By combining energy and mass balances it
can be calculated whether the energy recovered from biogas is enough to operate the system

3. Characterization of anaerobic sludge

The operation of the anaerobic bioreactors relies on the performance of the microbial populations present
in the sludge. It is then crucial the characterization of the sludge in terms of microbiological, kinetic and
physical properties.

620

FORMATEX 2007
 Communicating Current Research and Educational Topics and Trends in Applied Microbiology
A. Mndez-Vilas (Ed.)
_____________________________________________________________________

3.1. Microbial populations

The populations which limit the global performance of the process are those which perform the
methanogenic process. Thus a deep insight on the different populations types existing in the bioreactors
is advisable to understand and favour their appropriate operation. In order to determine the different
methanogenic bacteria populations present in the anaerobic sludge, microbiological analysis like those
based on the Fluorescence In Situ Hybridization (FISH) technique are often used nowadays [14].

Table 1. Oligonucleotide probes used for FISH.

Probe Target organism Probe sequence (5 3) Ref.
EUB338 Bacteria GCTGCCTCCCGTAGGAGT [15]
ARC915 Archaea GTGCTCCCCCGCCAATTCCT [16]
MS821 Methanosarcina CGCCATGCCTGACACCTAGCGAGC [17]
MX825 Methanosaetaceae TCGCACCGTGGCCGACACCTAGC [17]
MB1174 Methanobacteriales TACCGTCGTCCACTCCTTCCTC [17]

This technique is based on the use of fluorescently labelled oligonucleotide probes comprising from
15 to 24 nucleic acids (DNA type) to target specific regions of the 16S ribosomal RNA (rRNA) of the
searched bacteria (Table 1). The rRNA is present inside the ribosomes of the bacteria and it is in general
an indicator of their active state. These DNA oligonucleotide probes are designed in such a way that
depending on the targeted zone of the 16S rRNA different bacteria kingdom, phylum, class, order,
family, genus or specie can be detected by observation under the epifluorescence microscope.

a) Fluorescent dye
b) Ribosome
Oligonucleotide probe Cell
Ribosome Fluorescent
Cell dye
Oligonucleotide
probe
16S rRNA
16S rRNA

Fig. 3 Scheme of the FISH technique application: a) Oligonucleotide enters the cell and ribosome; b)
Oligonucleotide probe hybridizes with the targeted rRNA.

Fig. 4 Images of anaerobic samples analyzed by the FISH technique.

According to Amann (1995) [18] a typical FISH protocol includes four steps: a.- the fixation and
permeabilization of the bacterial membrane to allow the probe to enter first inside the cell and latter
inside the ribosome (Fig. 3, a); b.- hybridization (coupling) of the probe to the targeted sequence of the

621

FORMATEX 2007
Communicating Current Research and Educational Topics and Trends in Applied Microbiology
A. Mndez-Vilas (Ed.)
_____________________________________________________________________

rRNA (Fig. 3, b); c.- washing steps to remove unbound probe; and d.- detection of labelled cells by
epifluorescence microscopy (Fig. 4). Further details can be found in Amann et al. (1990) [15].

3.2. Kinetic characterization

In order to determine the capacity of an anaerobic sludge in terms of inoculation and operation of an
anaerobic bioreactor, specific methanogenic activity (SMA) assays are performed by means of batch
experiments (Fig.5, a). The specific activity of the biomass is determined according to eq. (2) from the
amount of methane produced in sealed vials along the time (Fig. 5, b) and measured by means of liquid
displacement [19] or overpressure measurements [20].
dV
(g CH4/(g VSSd)) (2)
CH 4

SMA = dt
X V ft
0 R

where X0, VR and ft are the biomass concentration, reactor volume and time fraction, respectively.

180
a) 160
140 b)
120
mL C4H

100
dV CH 4

80 dt
60
40
20
0
0 50 100 150 200 250 300 350
Time (h)

Fig. 5 a) Pressure transducer and measurement device; b) Typical curve of methane

production.

3.3. Physical characterization

Anaerobic biomass normally appears in two different states: suspended or aggregated in granules.
Several physical properties of the biomass are measured in order to analyze its retention feasibility inside
the different used anaerobic bioreactors. These properties are described in the following sections.
Sludge Volumetric Index (SVI).- The SVI value is used to monitor the settling properties of the
anaerobic biomass (Fig. 6). It is relevant for its good retention inside the anaerobic bioreactors [21]. SVI
is measured, according to eq. 3, as the volume (expressed in millilitres) occupied by 1 gram of a biomass
sample after 30 minutes of settling.
(3)
Settled sludge volume(mL/L)
SVI =
Suspended solids(g/L)
This value gives an idea about the degree of compacting of a biomass sample. Normal values of this
parameter for a well settling sludge are ranging between 50 and 100 mL/g SS.
Zone Settling Velocity (ZSV).- The ZSV is determined to establish the rate of settling of sludge
samples. At high concentrations of suspended solids, suspensions settle in the zone-settling regimes
(discrete, flocculant and delayed ones) characterized by the presence of a different interface between the
water clarified zone and the sludge settling zones (Fig. 7) [21]. A typical value for a well settling sludge
is 1 m/h.

622

FORMATEX 2007
 Communicating Current Research and Educational Topics and Trends in Applied Microbiology
A. Mndez-Vilas (Ed.)
_____________________________________________________________________

Granules density.- When anaerobic biomass grows in form of granules, the biomass density (as mass
of granules per volume occupied by the granules) is determined by using different tracer reagents like
Dextran Blue [22]. The larger the granules density the larger the amount of bacteria is in a certain
volume of granules. Normal values for this parameter are ranging from 30 to 100 g VSS/L granules.

Water clarified zone

Discrete settling zone
Flocculant settling zone

Depth
Delayed settling zone

Compression zone
Time
Fig. 6 Experiment for determining SVI of a granular Fig. 7 Sludge settling profile.
anaerobic biomass sample.

Average diameter of the granules.- Morphology of the granules is measured by means of image
analysis (IA) consisting of a combination of a stereomicroscope and a digital camera to record the
pictures (Fig. 8), which are later analyzed by a computer program [23]. The granules sizes of a
representative biomass sample are generally expressed as the mean feret diameter, which is calculated as
an average value from the shortest and the longest measured segment from a granule (Fig. 9). The size
distribution of granules is quite wide ranging from 0.2 mm to several millimetres.
a

Fig. 8 Picture of granules for size Fig. 9 Dimensions of the granule Fig. 10 Scanning electron micrographs
determination. to calculate the feret diameter. of anaerobic granules.

Scanning Electron Microscopy.- Morphological studies of the biomass are also performed by scan
electron microscopy (Fig. 10). This analytical technique gives information about the structure of the
surface of the granules, the observed surface roughness and porous sizes [12].

4. Hydraulic behaviour of anaerobic bioreactors for wastewater treatment

The knowledge of the hydraulic behaviour of anaerobic bioreactors is a key issue for establishing the
conditions of their optimal operation. The first step for estimating the hydraulic behaviour of a bioreactor
is to obtain the Residence Time Distribution (RTD) curve. RTD curve is obtained by injecting a tracer
pulse at the inlet stream of the bioreactor and measuring, along the time of the experiment, the tracer
concentration at the outlet stream. In case of a bioreactor with immobilised or self-aggregated micro-

623

FORMATEX 2007
Communicating Current Research and Educational Topics and Trends in Applied Microbiology
A. Mndez-Vilas (Ed.)
_____________________________________________________________________

organisms, it is recommended a method which uses two different tracers, as it allows the determination
of the volume of the different phases present in the reactors (e.g. liquid and biomass volume). Two of the
compounds most widely used as tracers in lab-scale experiments are Dextran Blue and LiCl [24].
Two RTD curves can simultaneously be obtained for each reactor, by injecting a pulse containing both
Dextran Blue and LiCl. Due to the different molecular weight of these tracers, LiCl can be transported
within the biomass while Dextran Blue (high molecular weight compound) can not. Experimental RTD
data for each tracer can be observed in Fig. 11, together with the Continuous Stirred Tank Reactor
(CSTR) model and two tanks in series model (Two CSTR) curves [25].
1
0.9 CSTR Model
0.8
0.7
Two CSTRs Model
0.6
0.5
C

0.4
0.3
0.2
0.1
0
0 0.5 1 1.5 2 2.5 3 3.5 4

Fig. 11 RTD curves of Dextran Blue () and LiCl () obtained in an anaerobic bioreactor, together with
complete stirred tank reactor (CSTR) model and two CSTR in series model curves.

These tracer curves supply valuable information for evaluating the hydraulic behaviour parameters of
the anaerobic digester (e.g. real Hydraulic Residence Time HRT, number of theoretical tanks, useful
liquid volume, total and hollow biomass volume, etc.). In this way, deviations (dead zones, shortcuts,
bad mixing) from ideal flow behaviour can be identified and the pertinent measures for improving the
bioreactor performance in practice can be applied.
As an example, an increase in the liquid upflow velocity or the re-injection of the produced off biogas
(CH4 and CO2) can be used to improve the agitation and therefore mixing inside the bioreactor. If the
digester presents high biogas retention within the biomass aggregates, a subsequent decrease in the
useful volume occurs. In this case, external energy (e.g. pulsed feeding) can be applied for improving
external mass transfer and solve the problem. The curves obtained from the two tracers supply
information about the internal diffusivity of the substrate inside the biomass aggregates. If the curves are
different it is an indicative of the presence of internal mass transfer resistance, which can condition the
characteristics of micro-organisms and the distribution of micro-organisms populations inside the
granules.

5. Operation of anaerobic wastewater treatment plants

Anaerobic digestion is being applied for the treatment of a wide type of industrial effluents in more than
1400 treatment plants in 65 countries [8, 26]. Upflow Anaerobic Filter (UAF) is a widely extended
technology for the treatment of wastewater (high-rate anaerobic reactors, pre and post-treatment,),
however its implementation at industrial level has decreased drastically in the last few years, mainly due
to the two main drawbacks presented by this technology [27]: i) Clogging of the bed (leading to the
formation of preferential pathways and an important decrease of reactor useful volume) and ii)
Entrapment of biogas bubbles (impedes mass transfer between liquid and solid and also decreases the
useful volume).

624

FORMATEX 2007
 Communicating Current Research and Educational Topics and Trends in Applied Microbiology
A. Mndez-Vilas (Ed.)
_____________________________________________________________________

Anaerobic filters have been partially replaced by the use of new technologies (UASB, EGSB), or
well combined with another type of reactors (hybrid upflow sludge bed filter USBF) which preferably
require the granulation of the present biomass. This new configurations are able to avoid the clogging of
the bed or the flotation of biomass. The main disadvantage of this type of digesters is, in turn, the start-
up process [28], since the granulation of the biomass usually takes several months [29]. This biomass
aggregation is usually achieved by a progressive increase of the Organic Loading Rate (OLR) up to the
design value. OLR values must initially be low (1 kg COD/m3d), causing poor hydraulic mixture,
especially in UASB reactors, and impeding a proper mass transfer between the three phases present in
the reactor. In fact, it normally takes 4-8 months before steady state conditions are reached in this kind of
systems.
Another important difficulty in the operation of anaerobic bioreactors is to maintain the process
operating in stable conditions, without the accumulation of intermediates, such as VFA, hydrogen gas
and carbon monoxide, among others [30]. If an overload is produced (due to a sudden increase in the
COD concentration or to the presence of inhibitors), then measures have to be taken to avoid the
complete destabilization of the bioreactor, e.g. decreasing the feeding flow and increasing the recycling
flow and the alkalinity concentration.
Non stable operation is mainly due to the variation of the wastewater quality (pollutants
concentrations) and flow-rate. These perturbations are common at the industrial wastewater plants and
are difficult to overcome by the wastewater treatment facilities. As a consequence, the anaerobic
bioreactor operation is vulnerable to changes in the influent flow-rate, quality and environmental
conditions. This is especially important in high rate wastewater treatment processes (e.g. OLR between
5-25 kg COD/m3d), where a disturbance such as an overload, may produce even a complete and
irreversible failure of the process [31]. Thus, it is very important the early detection of an overload state
or other type of disturbance, such as toxic or pH shocks, for driving the process to a normal operation
before its efficiency is reduced or the biomass results damaged [32-35].

5.1. Quality of biogas

As it was commented above, when organic material is anaerobically degraded the end products in the
biogas are carbon in its most oxidized form (CO2) and its most reduced form (CH4). The ratio between
CH4 and CO2 depends on the oxidation sate of the carbon compounds present in the organic material, i.e.
the more reduced the organic carbon content is, the more CH4 will be produced [36]. If the composition
of organic material is known and a biogas conversion is total, the theoretical methane yield potential can
be calculated by means of Buswells equation [37]. In anaerobic digestion processes, different theoretical
biogas percentage in methane can be obtained depending on the degree of reduction of the degraded
substrate (see Table 2).

Table 2 Methane percentage in the biogas for different substrate based wastewaters.
Substrate type Composition CH4 %
Carbohydrate (C6H10O5)n 50
Protein C5H7NO2 50
Lipid C57H104O6 >75
Ethanol C2H6O 75
Acetate C2H4O2 50
Propionate C3H6O2 58

The practical biogas yield obtained in the digester will always be lower than the theoretical values,
mainly due to the following reasons: a.- A fraction of the substrate is utilized to synthesize biomass
(typically 5-10% of the organic material degraded); b.- Some of the substrate remains unconverted in the
effluent (Typically 10%); and c.- Nutrient limitation.

625

FORMATEX 2007
Communicating Current Research and Educational Topics and Trends in Applied Microbiology
A. Mndez-Vilas (Ed.)
_____________________________________________________________________

Under favourable conditions and the presence of high soluble COD concentration in wastewater, a
degree of conversion as high as 90-95 % can be achieved. Conversion values in a range of 30-60 % are
obtained for highly particulate organic matter as manures [36]. The pH in the reactor plays an important
role in the biogas composition especially in the equilibrium of the CO2. Carbon dioxide is highly soluble
in water, thus it is partially dissolved in the liquid phase of the reactor or converted to bicarbonate
depending on the pH value, and thus its concentration in the gas phase is always lower than the
theoretical value. On the other hand, CH4 is practically insoluble in water and ends up in the gas phase.
In this way the percentage of methane in biogas can be used for calculating the energetic requirements to
maintain the bioreactor at an appropriate temperature, according to mass and energy balances (Fig. 2).
In order to learn how to operate an anaerobic bioreactor, information relative to the system has to be
collected [38]:
1. The values of the main control parameters have to be determined corresponding either to the
liquid phases or to the micro-organisms involved in the process (sludge) to be able to
characterize the state of operation of the process.
2. The establishment of the hydrodynamic patterns at macroscopic scale by means of the RTD
determination is crucial to understand the behaviour of the different populations of micro-
organisms inside the reactor.
The appropriated use of the collected information leads to the establishment of the conditions for a
successful operation of the anaerobic bioreactors [39, 40].

Acknowledgements The support by the Galician Government (Project SEDDAN, PGIDIT04TAM265006PR) and
the Spanish Government (Ministry of Science and Technology through the Project ANACOM, CTQ2004-07811-
C02-01/PPQ and Ministry of Education and Science through the Project CONSOLIDER CSD2007-00055) is
gratefully acknowledged.

References
[1] G. Lettinga, Antonie Van Leeuwenhoek International Journal of General and Molecular Microbiology 67(1), 3
(1995).
[2] J.M. Lema, R. Mndez and M. Soto, Ingenieria Qumica 24(274), 191 (1992).
[3] M. Henze and P. Harremoes, Water Science and Technology 15(1), 1 (1983).
[4] A.J.M. Stams, Antonie Van Leeuwenhoek International Journal of General and Molecular Microbiology 66(1-
3), 271 (1994).
[5] G. Lettinga, A.F. van Velsen, S.W. Hobma, W. de Zeeuw and A. Klapwyk, Biotechnology and Bioengineering
22(4), 699 (1980).
[6] P.L. Mc Carthy, In: Anaerobic Digestion. D.E. Hughes et al. Eds. (Elsevier Biomedical Press, Amsterdam,
1981), pp. 3-22.
[7] J.C. Young and P.L. McCarty, Journal of Water Pollution Control Federation 41(5), 160 (1969).
[8] Y. Huang, G. Huang, S. Chou and S. Cheng, Water Science and Technology 42(3-4), 43 (2000).
[9] A. Franco, E. Roca and J.M. Lema, Journal of Environmental Engineering 133(2), 186 (2007).
[10] A. Franco, E. Roca and J.M. Lema, Water Research 40(5), 871 (2006).
[11] A. Pual, E. Roca and J.M. Lema, Water Research 36(10), 2656 (2002).
[12] A. Franco, G. Gresia, E. Roca, A. Rozzi and J.M. Lema, Water Science and Technology 45(10), 163 (2002).
[13] R.K. Voolapalli and D.C. Stuckey, Water Research 35(7), 1831 (2001).
[14] M. Figueroa, J.R. Vzquez-Padn, J.L. Campos, R. Mndez and A. Mosquera-Corral, Luminiscence 21, 320
(2006).
[15] R.I. Amann, B.J. Binder, R.J. Olson, S.W. Chisholm, R. Devereu and D.A. Stahl, Applied and Environmental
Microbiology 56(6), 1919 (1990).
[16] D.A. Stahl and R. Amann, In: Nucleic acid techniques in bacterial systematics, E. Stackebrandt and M.
Goodfellow ED. (John Wiley & Sons Ltd., Chichester, England, 1991), pp. 205-248.
[17] L. Raskin., J.M. Stromley., B.R. Rittmann and D.A. Stahl, Applied and Environmental Microbiology 60(4),
1232 (1994).

626

FORMATEX 2007
 Communicating Current Research and Educational Topics and Trends in Applied Microbiology
A. Mndez-Vilas (Ed.)
_____________________________________________________________________

[18] R.I. Amann. In A.D.L. Akkerman, J.D. van Elsas and F.J. de Brujin (ed), Molecular microbial ecology manual.
(Kluwer Academic Publisher, Dordrecht, The Netherlands, 1995), pp. 1-15.
[19] M. Soto, R. Mndez and J.M. Lema, Water Research 27(8), 1361 (1993).
[20] B.R. Buys, A. Mosquera-Corral, M. Snchez and R. Mndez, Water Science and Technology 41(12), 113
(2000).
[21] APHA-AWWA-WPCF 20th Edition. L.S Clesceri, A.E. Greenberg and A.D. Eaton Eds., (Washington, 1999).
[22] J.J. Beun., M.C.M. van Loosdrecht and J.J. Heijnen, Water Research 36(3), 702 (2002).
[23] L. Tijhuis, W.A.J. van Benthum, M.C.M. van Loosdrecht and J.J. Heijnen, Biotechnology and Bioengineering
44(8), 867 (1994).
[24] A. Franco, E. Roca and J.M. Lema, Water Science and Technology 48(6), 51 (2003).
[25] O. Levenspiel, Chemical Reaction Engineering. (John Wiley, New York, 1988).
[26] R.J. Frankin, Water Science and Technology 44(8), 1-6 (2001).
[27] M. Jawed and V. Tare, Bioresource Technology 72(1), 75-84 (2000).
[28] A. Pual, P. Melloni, E. Roca, A. Rozzi and J.M. Lema, Journal of Environmental Engineering 127(5), 397
(2001).
[29] J. Rintala, Water Science and Technology 24(1), 69-74 (1991).
[30] P.D. Pullammanappallil, S.A. Svoronos, D.P. Chynoweth and G. Lyberatos, Biotechnology and Bioengineering
58(1), 13 (1998).
[31] J. Tay and X. Zhang, Journal of Environmental Engineering 126(8), 713 (2000).
[32] A. Marsili-Libelli and A. Mller, Pattern Recognition Letters 17(6), 651 (1996).
[33] R. Hickey, W. Wu, M. Veiga and R. Jones, Water Science and Technology 24(8), 207 (1991).
[34] R. Hickey and M. Switzenbaum, Journal of the Water Pollution Control Federation 63(2), 129 (1991).
[35] F. Molina, G. Ruiz, C. Garca, E. Roca and J.M. Lema, Water Science and Technology (In Press) (2007).
[36] I. Angelidaki and W. Sanders, Re/Views in Environmental Science and Bio/Technology 3(2), 117 (2004).
[37] E. Buswel and S. Neave, Laboratory studies of sludge digestion. Illinois Div. of State Water Survey 30 (1930).
[38] A. Pual, A. Lorenzo, E. Roca, C. Hernndez and J.M. Lema, Water Science and Technology 40(8), 237
(1999).
[39] A. Pual, J. Rodrguez, A. Franco, E.F. Carrasco, E. Roca and J.M. Lema, Water Science and Technology
43(7), 191 (2001).
[40] O. Bernard, B. Chahuat, A. Hlias, B. Le Dantec, J.-P. Steyer, L. Lardon, P.Neveu, S. Lambert, P. Ratini,
S.Frattesi, J. Lema, E. Roca, G. Ruiz, J.Rodriguez, A.Franco, P. Vanrolleghem, U.Zaher, D.J.W. De Pauw, K.
De Neve, K. Lievens, D. Dochain, O. Schoefs, H. Fibrianto, R. Farina, V. Alcaraz Gonzalez, V. Gonzalez
Alvarez, P. Lemaire, J.A. Martinez, O. Duclaud and J.F. Lavigne, Water Science and Technology 52(1-2), 457
(2005).

627

FORMATEX 2007