Sunteți pe pagina 1din 3

Primer Design for the GATEWAY attB primers

Modified by Won Do Heo


Correct design of attB primers for amplification, cloning and expression of a gene in Gateway requires
consideration of the proper placement of protein expression elements (ribosome recognition
sequences, start codon, stop codons, reading frame considerations etc.) with respect to the attB
recombination sites. The proper position of expression elements is determined by the form of the
protein (native, N-terminal fusion, C-terminal fusion) desired. Information downstream of attB1 or
upstream of attB2 must be included in the amplification primer sequence.

When designing attB1 and attB2 primers two points must first be addressed:

1. What form of the protein would you like to express?


Native, N-terminal fusion or C-terminal fusion

This will determine the position of:


start codon - contributed by the Destination Vector for N-terminal fusions or
included in the PCR product downstream of attB1 for native or C-terminal fusions.
the ribosome recognition sequences - contributed by the Destination Vector for N-
terminal fusions or included in the PCR product downstream of attB1 for native or C-
terminal fusions.
stop codon - contributed by the Destination Vector for C-terminal fusions or included
in the PCR product upstream of attB2 for native or N-terminal fusions.

2. In what organism/organisms would you like to express the protein?


E. coli, Yeast, Baculovirus and/or Mammalian cells

This will determine which ribosome recognition sequence(s) (Shine-Dalgarno for E. coli
and/Kozak for eukaryotic expression) need to be present.

ATG Stop ATG Stop ATG Stop


B1 B2 rrs B1 B2 B2
B1

rrs rrs

Native N-terminal Fusion C-terminal Fusion

Figure 1. Structures of Expression Clones for native, N-terminal and C-terminal fusion expression. Note
the position of start codons, rrs, and stop codons with respect to the recombination sites.

Table 1 provides examples of primer pairs (attB1 and attB2) which can be used to amplify
genes for specific protein expression formats. Shine-Dalgarno (E. coli ribosome binding
sequence) and Kozak (eukaryotic ribosome recognition sequence) show are typical sequences.
Other sequences than those depicted may also function well for protein expression. Choose the
primer pair that will allow for the appropriate expression format.
How to design primers

Table 1. Suggested attB1&2 primer pairs to be used for different expression formats.

Choose Protein Native only N- terminal C-terminal Native & N-terminal


expression format fusion only fusion only Fusion

Choose organism(s) attB1 attB2 attB1 attB2 attB1 attB2 attB1 attB2
for expression
E. coli only A K C K A L A K
Yeast only B K C K B L B K
Baculovirus only B K C K B L B K
Mammalian only B K C K B L B K
Yeast, Baculovirus B K C K B L B K
and Mammalian only
E. coli, Yeast, A K C K A L A K
Baculovirus &
Mammalian

A. Non-stop PCR Protocol----Simpler way for low number of reactions

attB1 Primers to amplify the N-terminal of the gene

GGGG-attB1 Shine-Dalgarno Kozak Start

5' GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC* GAA GGA GAT AGA ACC ATG (18-24 gsp) 3'

A. 5' GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG (18-24 gsp) 3'

B. 5' GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC - - - - - - - - - - - - - - - ACC ATG (18-24 gsp) 3'

C. 5' GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC (ATG) - - - - - - - - - - - - - - - - - - - (18-24 gsp) 3'

attB2 Primers to amplify the C-terminal of the gene

GGGG-attB2 Stop

K. 5' GGGG AC CAC TTT GTA CAA GAA AGC TGG GTT TTA** (18-24 gsp)

L. 5' GGGG AC CAC TTT GTA CAA GAA AGC TGG GTG*** (18-24 gsp)

A & B. To leave the possibility open for N-terminal fusion, keep the ATG in-frame with the reading
frame of attB1.
C. For N-terminal fusion only primer, including the ATG of the open reading frame is optional. The
reading frame of the gene must match the reading frame through attB1.
L. The reading frame of the gsp must match the reading frame of the attB2 sequence.
* The following combinations are NOT possible because they form a STOP codon: TTA, TAG, TGA.
** CTA and TCA may also be used here for stop codon.
*** One base must be added here to complete this codon.
B. Adapter PCR Protocol----To save cost and avoid possible primer dimers

attB1 Primers to amplify the N-terminal of the gene

12 attB1 Shine-Dalgarno Kozak Start

5' AA AAA GCA GGC TTC* GAA GGA GAT AGA ACC ATG (18-24 gsp) 3'

A. 5' AA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG (18-24 gsp) 3'

B. 5' AA AAA GCA GGC TTC - - - - - - - - - - - - - - - ACC ATG (18-24 gsp) 3'

C. 5' AA AAA GCA GGC TTC (ATG) - - - - - - - - - - - - - - - - - - - (18-24 gsp) 3'

attB2 Primers to amplify the C-terminal of the gene

GGGG-attB2 Stop

K. 5' A GAA AGC TGG GTG TTA** (18-24 gsp)

L. 5' A GAA AGC TGG GTG *** (18-24 gsp)

Adapter attB1: G GGG ACA AGT TTG TAC AAA AAA GCA GGC T
Adapter attB2: GGG GAC CAC TTT GTA CAA GAA AGC TGG GT
If you with to insert a TEV protease cleavage site after the N-terminal tag for removal of the tag the following
forward primer is recommended:

5' GGGG ACA AGT TTG TAC AAA AAA GCA GGC TTC GAA-AAC-CTG-TAT-TTT-CAG-GGC-ATG-forward
gene specific sequence-3'

TEV will cleave between the 6th and 7th amino acid residues in the recognition site. Therefore, your protein will
contain a single glycine residue on the N-terminus of the protein. If this is undesirable, the ATG in your protein
can be replaced by the GGC (encoding a glycine residue) codon. Following cleavage with TEV, your protein will
contain a single Met -> Gly substitution.

The primer sequences for sequencing your entry vectors are:


Clones derived from pDONR201 (kanR) and pDONR207 (genR)

SeqL-A (proximal to attL1) TCGCGTTAACGCTAGCATGGATCTC

(106 nt from cloned ORFs)

SeqL-B (proximal to attL2) GTAACATCAGAGATTTTGAGACAC

(123 nt from cloned ORFs)