Detection of RhDel in RhD-negative persons in

clinical laboratory

YA-HUI WANG, JUNG-CHIN CHEN, KUAN-TSOU LIN, YU-JEN LEE, YU-FEN YANG, and
TSUN-MEI LIN
TAIWAN, REPUBLIC OF CHINA

The Rhesus (Rh) blood group is the most polymorphic human blood group system,
and it is clinically significant in transfusion medicine. About 15% of Caucasoid
people are RhD-negative, whereas in the Asian population, the RhD-negative blood
type only occurs in 0.1% to 0.5%. However, approximately 30% of apparently
RhD-negative Taiwanese people actually were RhDel. Traditionally, we verify RhDel
by a serologically adsorption-elution procedure with polyclonal anti-D. In our re-
cent report, RhC phenotype is highly associated with RhDel, and RHD1227A is a
useful genetic marker for RhDel. For setting up a rapid protocol to detect RhDel in
clinical laboratory, a total number of 395 Taiwanese serological RhD-negative
blood samples, those with RhC () phenotypes as selected by serological tests,
were further screened by adsorption/elution tests and RHD1227A allele by specific
sequence primer-polymerase chain reaction (SSP-PCR) for RhDel. Among 395 blood
samples collected from RhD-negative subjects, the incidence of RhC () was 43%
(171/395). One hundred and twenty six of the 171 RhC () samples were positive for
both adsorption/elution for RhD detection and SSP-PCR assay for RHD1227A. The
sensitivity and specificity were 96.9% and 97.5%, respectively, for RHD1227A detec-
tion as compared with the traditional adsorption/elution test. Our results also indi-
cated that RHD1227A was highly linked to Ce haplotypes (95.2%). In conclusion,
combined RhC () phenotyping and RHD1227A analysis can be a simple and
accurate laboratory screening protocol for RhDel detection in RhD-negative popu-
lation. (J Lab Clin Med 2005;146:3215)

Abbreviations: Rh rhesus; SSP-PCR specific sequence primer-polymerase chain reaction;

HDN hemolytic disease of newborn

R
h antigens are acylated red cell transmembrane
proteins with a molecular weight of 30 32 kDa
and encoded by two highly homologous genes
RHD and RHCE. Both genes are located on chromo-
some 1p34-36 and about 30,000 bp apart. Although
RHD appears as an ancestral duplicate of RHCE, which
occurs in four allelic forms ce, cE, Ce, or CE.1 They
have opposite orientation and are highly homologous
retaining more than 90% identity.2,3 The Rh blood
group is the most polymorphic human blood group
system, but with high clinically significance in transfu-
sion medicine. Persons are clinically classified as Rh-
positive and Rh-negative depending on the presence or
absence of the D antigen on the red cell surface.
The RhD-negative trait could be generated by mul-
tiple genetic mechanisms, which have been shown to be
ethnic group-dependent. About 15% of Caucasoid peo-
ple are RhD-negative; most are associated with the

Submitted for publication May 4, 2005; accepted for publication July

From the Department of Medical Laboratory Science and Biotech-
nology, College of Medicine, National Cheng Kung University,
Tainan, Taiwan; the Department of Pathology, National Cheng
Kung University Hospital, Tainan, Taiwan; and the Kaohsiung Blood
Center, Taiwan Blood Services Foundation, Kaohsiung, Taiwan,
Republic of China.
Supported by Grant NCKUH93-068 from the National Cheng Kung
University Hospital, Tainan, Taiwan.
31, 2005.
Reprint requests: Tsun-Mei Lin, PhD, Department of Medical Laboratory
Science and Biotechnology, College of Medicine, National Cheng Kung
University, Tainan, Taiwan, 701; e-mail: ltmei@mail.ncku.edu.tw.
0022-2143/$ see front matter
2005 Mosby, Inc. All rights reserved.
doi:10.1016/j.lab.2005.07.007

321

322 Wang et al
deletion of RHD gene between the upstream and down-
stream Rheus boxes.4,5 However, the RhD-negative
blood type only occurs in 0.1% to 0.5% of the Asian
population.6 9 In contrast to Caucasoid persons, nearly
30% of the Chinese RhD-negative were RhDel, a rare
variant of the Rh system with intact RHD gene, but the
D antigen is detectable only by adsorption and elution
tests.7,8 In recent years, the effort to molecular catalog
Rh genetic variations has continued to impact on trans-
fusion medicine. Based on our previous molecular stud-
ies, RHD1227A was an important genetic marker in
RhDel persons.9 12
A considerable proportion of seemingly RhD-nega-
tive samples in Asian are carrying the intact RHD gene
presented RhDel phenotype.8 12 The classic adsorption/
elution method for RhDel typing is difficult and imprac-
tical for use in all transfused patients. Therefore, the
development of a simple laboratory protocol for correct
detection of RhDel is very important especially in Tai-
wan and some other countries that have a high preva-
lence of RhDel. This rationale prompted us to investi-
gate the performance of combined RhC phenotyping by
serological testing and genotyping identification of
RHD1227A by SSP-PCR in distinguishing RhDel and
true D negative in 395 RhD-negative samples, which
allowed us to set up a protocol for RhDel identification
feasible in a routine laboratory.
MATERIALS AND METHODS
Serological Rh phenotyping. A total of 395 RhD-nega-
tive unrelated blood donors were kindly provided by Tainan
and Kaohsiung Blood Centers, Chinese Blood Service Foun-
dation. The above apparently RhD-negative blood samples
were serotyped for RhC/c and RhE/e antigens by monoclonal
anti-C, anti-c, anti-E, and anti-e antibodies (Gamma Biologi-
cals, Houston, Texas). RhD-negative samples with RhC ()
were further screened by adsorption and elution tests with
polyclonal anti-D (Dominion Biologicals, Dartmouth, Can-
ada), and RHD1227A polymorphism by SSP-PCR.
Adsorption/elution test for RhD. Adsorption/elution tests
were performed on 171 RhC () samples. Red blood cells
were incubated with an equal part anti-D (Dominion Biologi-
cals) at 37C for 1 hour. The cells were then washed thor-
oughly. An eluate was prepared by heat elution technique.
The eluates and last-washed supernatants were used for indi-
rect antiglobulin tests (IAT) against an in-house panel made
up of RhD-positive and RhD-negative red cells.
RHD1227 analysis. Genomic DNA was extracted from
buffy coat fraction by a commercial kit (Blood & Tissue
Genomic DNA Extraction Miniprep kit; Viogene, Hsichih,
Taiwan). RHD1227 polymorphism in samples with RhC ()
was determined by SSP-PCR. Forward primer for RHD1227A
allele was 5=-GATGACCAAGTTTTCTGGAAA-3= and for
RHD1227G allele was 5=-GATGACCAAGTTTTCTGGAAG-
3=, respectively. The reverse primer for both RHD1227A and
RHD1227G, 5=-GTTCTGTCACCCGCATGTCAG-3=, was
J Lab Clin Med
December 2005
Fig 1. Combined RhC phenotyping and RHD1227A genotyping in
395 RhD-negative subjects.
used to amplify a 348-bp product.10 Another pair of nucleotides
(forward primer: 5=-GCCTTCCCAACCATTCCCTTA-3=, re-
verse primer: 5=-TAGACGTTGCTGTCAGAGGC-3=) were in-
cluded as an internal control to generate a 629-bp PCR fragment
from the growth hormone gene. The PCR reactions were per-
formed at a total volume of 10 l, each containing 1 l of
genomic DNA, 0.5 U DNA polymerase (Supertherm Gold,
Sevenoaks, England), 200-M dNTPs, primers, and 2.5-mM
MgCl2 in a buffer provided by the manufacturer. Forty cycles
were programmed on a thermocycler (PE 9600 GeneAmp PCR
system; Applied Biosystems, Foster City, Calif) as follows:
denaturation at 94C for 5 min, then 35 cycles of 30 seconds at
94C, 40 seconds at 68C and 30 seconds at 72C. PCR products
were visualized in a 2% agarose gel.
RHD zygosity determination. Allele-specific primers were
designed to directly amplify the hybrid Rheus box13 (forward
primer: 5=-TGAGCCTATAAAATCCAAAGCAAGTTAG-3=;
reverse primer: 3=CCTTTTTTTGTTTGTTTTTGGCGGTGC
5=). An internal control of the 629-bp PCR fragment from the
growth hormone gene was included in the amplification re-
action. Thermal profile started with a first denaturation step of
5 min at 95C, followed by 35 cycles of 95C for 1 min,
annealing at 67C for 1 min, and extension at 72C for 2 min,
with a final step of 72C for 5 min. The PCR products were
visualized on 1% agarose gels with ethidium bromide stain-
ing. Consequently, the primers selectively amplify a 2778-bp
segment of the hybrid Rheus box that can accurately detect
RHD gene deletion.
RESULTS
The incidence of RhC () of the apparent RhD-
negative persons was 43% (171/395). The incidences
of RhDel in RhC () persons as determined by
RHD1227A, and adsorption and elution test were
74.3% (127/171) and 76.0% (130/171), respectively
(Fig 1). The comparative results of these 2 tests are
shown in Table I, 126 of the130 RhD adsorption/
elution-positive (RhDel) samples were also positive for
RHD1227A by SSP-PCR analysis (sensitivity 96.9%),
and 40 out of 41 RhD adsorption/elution-negative samples
were negative (specificity 97.5%). Only 5 samples re-
vealed an inconsistent result detected by these 2 methods.
However, all 224 RhC () samples were negative in
RHD1227A detection (Fig 1).
To understand the association of RHD1227A and
RHCE loci, further analysis of the 126 RhDel samples
(with both RHD1227A and adsorption and elution pos-
J Lab Clin Med
Volume 146, Number 6 Wang et al 323

Table I. Results of SSP-PCR for RHD1227A and Japanese and 30% of Chinese RhD-negative were Rh-
adsorption-elution in 171 RhC ()-apparent Del, a rare variant of Rh system with intact RHD gene,
RhD-negative samples but the RhD antigen is detectable only by adsorption
RhC () RHD1227A () RHD1227A ()
and elution test.6 8
N 171 N 127 N 44 The molecular mechanism of RhDel has long been
disputed. In 1997, it was reported that an RhDel person
Adsorption/elution () 126 4 might carry a grossly intact RHD gene.14 Subsequently,
N 130
Adsorption/elution () 1 40
Chang et al17 described a partial deletion of RHD gene
N 41 in 21 RhDel persons, and more recently, 2 alleles-
Sensitivity (%) 96.9 RHDIVS11A and RHD1227A were found in 3 Jap-
Specificity (%) 97.5 anese RhDel donors.18 Wagner et al5 found 15 RhDel persons
among 8442 RhD-negative donors, 7 with RHD885T, 5 with
RHD1227A, and 3 with RHDIVS31A alleles. In our
Table II. Relative incidence of Rh phenotypes and recent report, a uniform molecular mechanism in 94 Rh-
RHD1227A allele in 126 RhDel samples Del Chinese subjects in Taiwan was observed to have
RHD 1227A () & adsorption/elution D () exactly the same RHD1227A polymorphism.10 A similar
result had also been found in 26 RhDel and 2 weak RhD
A/A A/G A/- Chinese subjects from Mainland China.9 The population
(21/126) (4/126) (101/126)
frequency of RHD1227A allele in Chinese is 1:110, which
Rh Predicted
phenotype genotyping No % No % No %
is higher than the frequency of 1:9091 in Europeans.5,9
A weak D red cell phenotype exhibits weaker sero-
CCee Ce/Ce 14 11 1 0.79 3 2.38 logical reaction with anti-D antibodies. A part of weak
Ccee Ce/ce 7 5.6 1 0.79 97 77 D phenotypes could be explained by qualitatively al-
CCEe Ce/CE 0 0 1 0.79 0 0
tered RhD proteins called partial D. More than 20 types
CcEe Ce/cE 0 0 1 0.79 1 0.79
Total 21 17 4 3.17 101 80.2 of partial D have been analyzed, and most of them have
amino acid substitutions in the intracellular or trans-
membranous parts of the RhD protein.19,20 The other
part of weak D phenotypes is likely to possess the
itive) by SSP-PCR for RHD1227G and hybrid Rheus normal allele with depressed RhD expression on the red
box. As shown in Table II, the results demonstrated blood cells surface. Lately, several studies have shown
A/A, A/G, and A/ are 17.0% (21/126), 3.2% (4/126), that weak D alleles carry at least one point mutation in
and 80.2% (101/126), respectively. With analysis of its RHD gene.19 21 RhDel persons, with an intact RHD
association with RHCE haplotype, RHD1227A allele gene, may have different numbers of RhD-antigen sites
was found highly linked to Ce haplotypes (92.7%). The on the red blood cell membrane and be considered to be
distribution of each phenotype among 395 RhD-negative a type of weak D. The aim of this work was to answer
samples in this study and the previous reports from Hong an important question of how to distinguish RhDel and
Kong and Japan7,14 were summarized in Table III. The true D negative in clinical laboratory. To develop a
incidence of RhD-negative, RhDel, and true D negative simple protocol for routine laboratory use, we com-
groups were similar between Taiwan and Hong Kong pared the performance of combined RhC phenotyping
populations. Statistically, it is significantly different as by serological testing and genotyping identification of
compared with the Japanese population. However, it is RHD1227A by SSP-PCR. The results revealed 99.5%
of great interest to note that all RhDel persons were specificity and 92.5% sensitivity.
highly associated with RhC () phenotype in all 3 The SSP-PCR test system for RHD1227A evaluated
populations. here successfully detected most RhD negative samples
with RhDel phenotypes. Among the 127 samples with
DISCUSSION RHD1227A, 126 samples could be confirmed by a
The most frequent cause for RhD-negative Cauca- classic adsorption and elution test. Twenty five of 126
soid persons is the lack of the whole RHD gene and RhDel samples tested negative for hybrid Rheus box,
hybid Rheus box present on both chromosome.4,5 How- which indicates that of RHD existing in both chromo-
ever, total deletion of the RHD gene only accounts for somes, only 4 of the 25 samples were RHD1227G
10 23% of RhD-negative in African15 and 60 70% of positive. Therefore, homozygous RHD1227A seems to
RhD-negative Asian populations.8,10,13,16 There were be more frequent than theoretically expected.
several RHD positive but antigen D negative alleles It is in consistence with other reports; both Ccee and
were found in Asian.9 13 It is known that nearly 10% of CCee were highly prevalent in RhDel persons of Chi-
 J Lab Clin Med
324 Wang et al December 2005

Table III. Distribution of RhD-negative, RhDel, and true D phenotypes in 3 different populations
This study Hong Kong7 Japan14

No. 395 126 269 465 136 329 306 102 204

Apparent Rh
phenotypes RhD() RhDel True D RhD() RhDel True D RhD() RhDel True D

C ()
CCee 4.8 14.3 0.4 6.9 19.1 1.8 2 3.92 0.5
CCEe 0.3 0.8 0.0 0 0 0 0 0 0.5
Ccee 37.0 83.3 15.2 33.8 78.7 15.2 28 52 16.2
CcEe 1.3 1.6 1.1 1.1 2.2 0.6 22 44.1 10.3
CcEE 0 0 0 0 0 0 0 0 0.5
Subtotal 43.3 100 16.4 41.7 100 17.6 52 100 27.9
C ()
ccee 54.7 0 80.6 56.8 0 80.2 19 0 28.9
ccEe 2.0 0 3.0 1.5 0 2.1 19 0 28.9
ccEE 0 0 0 0 0 0 9 0 14.2
Subtotal 56.7 0 83.6 58.3 0 82.3 48 0 72.1

nese populations,7,8,10,22 whereas the prevalence of the

CcEe phenotype was about 44% in the RhDel group of
the Japanese population (Table III).14 However, it is of
great interest to note that all RhDel persons were highly
associated with the RhC () phenotype in all 3 popu-
lations. In regard to D antigen density, Okuda et al16
pointed out that all serologically RhD-negative donors
carrying parts of the RHD gene under analysis showed
the C () phenotype. The suppressive effect of the Ce
haplotype on the weak D phenotype has been confirmed
as antigen density dropped dramatically below 500
antigens per red blood cell for weak D when they
present the DCCee or DCEce phenotypes. Therefore,
we propose that RhDel is probably paired with r= (dCe)
haplotype, which may suppress D antigen expression.
This study demonstrated a high association of DCe
haploptype with RHD1227A polymorphism.
Previous reports23,24 have indicated that antibody for-
mation may be induced in persons of the partial D phe-
notype. It was proposed that RhDel persons safely receive
RhD-positive units that carry the intact RHD gene. The
rare occurrence of hemolytic transfusion reaction and
anti-D-associated HDN among the Chinese is also
probably attributable in part to the existence of this
weak D (RhDel) phenotype among apparently RhD-
negative persons.25 In contrast, can a true D negative
person safely receive blood components from RhDel
carriers? Based on the recent report by Wagner et al,26
RhDel was found to be able to induce anti-D in a true D
negative recipient. Therefore, a rapid laboratory proto-
col for RhDel detection may help to ensure safety in
blood transfusion and reduce the rate of HDN occur-
rence, and it is certain that DNA typing will inevitably
Fig 2. Proposed laboratory protocol for RhDel detection.
be implemented in the conventional serological meth-
ods for RhD typing in the near future.
In this study, we found that the presence of the RHD
gene in RhDel samples seems to relate strictly to the
RhC phenotypes with high incidences of RhC () in
the apparent RhD-negative persons (43%), and partic-
ularly in RhDel persons (100%). All RhDel persosn with
intact RHD gene showed the CC or Cc phenotype but
not the cc phenotype. More important was to note that
almost the same results were demonstrated in the other 2
Asian populations, Hong Kong7 and Japan14 (Table III).
In addition, by SSP-PCR analysis, high sensitivity
(96.9%) and specificity (97.5%) were achieved in Rh-
Del persons for the detection of RHD1227A, which is a
useful genetic marker for RhDel identification.10 Based
on these findings, it is thus possible to correctly detect
RhDel in RhD-negative subjects by simply screening
RhC () phenotype and RHD1227A analysis. As
shown in Fig 2, phenotype RhC () followed by
RHD1227A detection is a reliable and simple method
for RhDel detection in RhD-negative persons in Taiwan
and probably other Asian populations. This simple pro-
tocol for RhDel identification applied in a routine lab-
J Lab Clin Med
Volume 146, Number 6
oratory is helpful to prevent anti-D alloimmunization
without adding much to the costs and time consumption
and without incurring an avoidable wastage of RhD-
negative blood units that are always not available in
Asian populations. In conclusions, we tried to explore
the genomic marker (RHD1227A) of RhDel and set up
a protocol simply by a combined RhC phenotyping and
RHD1227A analysis for RhDel detection in clinical
laboratories.
We express our thanks to Prof. Hock-Liew Eng (Chang Gung
Memorial Hospital, Kaohsiung, Taiwan) for editing of this manu-
script and critical comments, and Ms. Liao Pi-Ying for her technical
assistance.
REFERENCES
1. Wagner FF, Flegel WA. RHCE represents the ancestral RH
position, while RHD is the duplicated gene. Blood 2002;99:
22723.
2. Mouro I, Colin Y, Cherif-Zahar B, Cartron JP, Le Van Kim C.
Molecular genetic basis of the human Rhesus blood group sys-
tem. Nat Genet 1993;5:625.
3. Okuda H, Suganuma H, Kamesaki T, Kumada M, Tsudo N, Omi
T, et al. The analysis of nucleotide substitutions, gaps, and
recombination events between RHD and RHCE genes through
complete sequencing. Biochem Biophys Res Commun 2000;274:
670 83.
4. Wagner FF, Flegel WA. RHD gene deletion occurred in the
Rheus box. Blood 2000;95:3662 8.
5. Wagner FF, Frohmajer A, Flegel WA. RHD positive haplotypes
in D negative Europeans. BMC Genet 2001;2:10.
6. Okubo Y, Yamaguchi H, Tomita T, Nagao N. A D variant, Del?
Transfusion 1984;24:542.
7. Mak KH, Yan KF, Cheng SS, Yuen MY. Rh phenotypes of
Chinese blood donors in Hong Kong, with special reference to
weak D antigens. Transfusion 1993;33:348 51.
8. Sun CF, Chou CS, Lai NC, Wang WT. RHD gene polymor-
phisms among RhD-negative Chinese in Taiwan. Vox Sang
1998;75:527.
9. Shao CP, Maas JH, Su YQ, Kohler M, Legler TJ. Molecular
background of Rh D-positive, D-negative, D(el) and weak D
phenotypes in Chinese. Vox Sang 2002;83:156 61.
10. Chen JC, Lin TM, Chen YL, Wang YH, Jin YT, Yue CT. RHD
1227A is an important genetic marker for RhD(el) individuals.
Am J Clin Pathol 2004;122:193 8.
11. Que X, Grootkerk-tax MGHM, Maaskant-van Wijk PA, van der
Schoot CE. Systemic analysis and zygosity determination of
RHD gene in a D-negative Chinese Han Population reveals a
novel D-negative RHD gene. Vox Song 2005;88;35 40.
Wang et al 325
12. Kim JY, Kim SY, Kim CA, Yon GS, Park SS. Molecular
characterization of D-Korean persons: development of a diag-
nostic strategy. Transfusion 2005;45:34552.
13. Perco P, Shao CP, Mayr WR, Panzer S, Legler TJ. Testing for the
D zygosity with three different methods revealed altered Rhesus
boxes and a new weak D type. Transfusion 2003;43:3359.
14. Fukumori Y, Hori Y, Ohnoki S, Nagao N, Shibata H, Okubo Y,
et al. Further analysis of Del (D-elute) using polymerase chain
reaction (PCR) with RHD gene-specific primers. Transfus Med
1997;7:22731.
15. Singleton BK, Green CA, Avent ND, Martin PG, Smart E, Daka
A, et al. The presence of an RHD psedogene containing a 37 base
pair duplication and a nonsense mutation in Africans with the
RhD-negative blood group phenotype. Blood 2000;95:12 8.
16. Okuda H, Kawano M, Iwamoto S, Tanaka M, Seno T, Okubo Y,
et al. The RHD gene is highly detectable in RhD-negative Jap-
anese donors J Clin Invest 1997;100:3739.
17. Chang JG, Wang JC, Yang TY, Tan KW, Shih MC, Peng CT,
et al. Human RhDel is caused by a deletion of 1,013 bp between
introns 8 and 9 including exon 9 of RHD gene. Blood 1998;92:
2602 4.
18. Singleton BK, Green CA, Kimura K, Minami A, Okubo Y,
Daniels GL. Two new RHD mutations associated with Del phe-
notype. Transfus Clin Biol 2001;8:9s.
19. Huang CH, Chen Y, Reid ME, Okubo Y. Evidence for a separate
genetic origin of the partial D phenotype DBT in a Japanese
family. Transfusion 1999;39:1259 65.
20. Rouillac C, Gane P, Cartron J, Le Pennec PY, Cartron JP, Colin
Y. Molecular basis of the altered antigenic expression of RhD in
weak D(Du) and RhC/e in RN phenotypes. Blood 1996;87:4853
61.
21. Wagner FF, Frohmajer A, Ladewig B, Eicher NI, Lonicer CB,
Muller TH, et al. Weak D alleles express distinct phenotypes.
Blood 2000;95:2699 708.
22. Lee YL, Chiou HL, Hu SN, Wang L. Analysis of RHD genes in
Taiwanese RhD-negative donors by the multiplex PCR method.
J Clin Lab Anal 2003;17:80 4.
23. Beckers EA, Thijssen PM, Geraedts JP, Van Rhenen DJ. A study
of the prevalence and patterns of inheritance of partial D antigen
category VI in a white donor population. Transfusion 1994;34:
455.
24. Mayne K, Bowell P, Woodward T, Sibley C, Lomas C, Tippett
P. Rh immunization by the partial D antigen of category DVa.
Br J Haematol 1990;76:5379.
25. Lin-Chu M, Broadberry RE, Chang FJ. The distribution of blood
group antigens and alloantibodies among Chinese in Taiwan.
Transfusion 1988;28:350 2.
26. Wagner T, Kormoczi GF, Buchta C, Vadon M, Lanzer G, Mayr
WR, et al. Anti-D immunization by DEL red blood cells. Trans-
fusion 2005;45:520 6.