Sunteți pe pagina 1din 147

MINISTERUL EDUCAIEI, CERCETRII I TINERETULUI

B iologie
Manual pentru clasa a XII-a

Gabriel Corneanu
Aurel Ardelean
Gheorghe Mohan


C ORINT
Manualul a fost aprobat prin O.MEdCT nr. 1262/50 din 6.06.2007, `n urma evalu\rii calitative [i este realizat
`n conformitate cu programa analitic\ aprobat\ prin Ordin al ministrului educa]iei [i cercet\rii nr. 5959 din
22.12.2006.

Date despre autori:


GABRIEL CORNEANU, profesor universitar doctor la Universitatea din Craiova, conductor de doctorat la
Universitatea Babe-Bolyai din Cluj-Napoca, membru a numeroase asociaii i organizaii tiinifice din
ar i din strintate, precum i autor de manuale i diferite lucrri tiinifice.
AUREL ARDELEAN, profesor universitar doctor la Universitatea de Vest Vasile Goldi din Arad, autor sau
coautor a circa 300 de lucrri (culegeri de teste, lucrri de laborator, manuale pentru clasele a V-a i a IX-a,
cursuri universiare).
GHEORGHE MOHAN, doctor n tiine biologice, cercettor tiinific la Gr\dina Botanic, Universitatea din
Bucureti, autor sau coautor a circa 150 de lucrri de specialitate, precum i manuale pentru clasele a V-a,
a VIII-a, a IX-a, a X-a, a XI-a ({tiin]e), cursuri universitare.

Referen]i:
Prof. dr. Viorel Laz\r, inspector de biologie, I.S.J. Dolj
Prof. univ. dr. Nicolae Coman, Universitatea Babe[-Bolyai, Cluj-Napoca

Redactor: Mihaela Zrnescu Enceanu


Tehnoredactare computerizat\: Andreea Dobreci
Coperta: Valeria Moldovan

Editura CORINT
Difuzare:
Calea Plevnei nr. 145, sector 6, cod po[tal 060012, Bucure[ti
Tel.: 021.319.88.22; 021.319.88.33; 0748.808.083; 0758.225.443; Fax: 021.319.88.66; 021.310.15.30.
E-mail: vanzari@edituracorint.ro
Magazin virtual: www.grupulcorint.ro
Redac]ia [i administra]ia:
Str. Mihai Eminescu nr. 54 A, sector 1, Bucure[ti
Tel./fax: 021.319.47.97; 021.319.48.20

Descrierea CIP a Bibliotecii Na]ionale a Romniei


CORNEANU, GABRIEL
Biologie: manual pentru clasa a XII-a / Corneanu Gabriel, Ardelean Aurel,
Mohan Gheorghe. Ed. a 2-a. - Bucure[ti: Corint, 2008
Bibliogr.
ISBN 978-973-135-352-4
I. Ardelean, Aurel
II. Mohan, Gheorghe

57(075.35)
575(075.35)
575.8(075.35)

ISBN: 978-973-135-352-4
Toate drepturile asupra acestei lucr\ri sunt rezervate Editurii CORINT,
parte component\ a GRUPULUI EDITORIAL CORINT.
2008
pag.001-050.qxd 8/1/2008 3:24 PM Page 3

Cyan Yellow Magenta Black pag 3

I. GENETICA

MOLECULARAADN

NUCLEU PASUL 1

ARNr
ARNm transcrip]ie
transcrip]ie ARNt
transcrip]ie

por nuclear

aminoacizi
PASUL 2 membran\ `n citoplasm\
subunit\]i nuclear\
PASUL 3 ribozomale
Met
Complex PASUL 4
de ini]iere

PASUL 6
Lan] polipeptidic PASUL 5 ATP
`n cre[tere
transla]ie

ADP
PASUL 7

ARNm
direc]ia transla]iei
ribozom
CITOPLASM|

PASUL 8
M
et Lan] proteic eliberat

Protein\ metabolizat\ codon start


(forma final\)
ARNm codon stop
pag.001-050.qxd 8/1/2008 3:24 PM Page 4

Cyan Yellow Magenta Black pag 4

1
Capitolul

Genetic molecular
Scurt istoric

Genetica molecular este o ramur a ge- ereditii (legile mendeliene ale ereditii i
neticii care studiaz natura chimic a genei acizii nucleici), ns rolul acizilor nucleici n
i modul n care funcia genelor afecteaz ereditate a fost demonstrat abia la mijlocul
caracterele organismelor vii, chimia acizilor secolului al XX-lea, cnd au nceput efectiv
nucleici i a altor molecule care particip la cercetrile de genetic molecular.
replicaie, funcie, mutaie i repararea mo- Rolul ADN n ereditate a fost stabilit de
leculei de ADN (Hartl & Jones). ctre O.T. Avery i colaboratorii (1944),
Se consider c nceputul geneticii mole- care au reluat un experiment efectuat de
culare dateaz imediat dup descoperirea E. Griffith (1928) la Streptococcus pneumo-
Legilor ereditii de ctre Mendel (1865). n niae. Griffith a experimentat cu dou tulpini
anul 1869, Friedrich Miescher a izolat din de pneumococi: tulpina tip S virulent, care
nucleii lapilor de somon i din alte celule, o prezint capsul i formeaz colonii netede
substan pe care a denumit-o nuclein. Ul- (sua SIII) i tulpina R, avirulent, care nu
terior, R. Altman a constatat caracterul acid prezint capsula i formeaz colonii rugoase
al acestei substane, denumind-o acid nucle- (sua RII). Prin mutaie, tulpina SIII poate
ic (1889). n anul 1884, O. Hertwig a avut pierde capsula i se transform n tulpin
intuiia s afirme c nucleina este substana acapsulat de tip RIII avirulent. Experi-
responsabil nu numai pentru fertilizare, ci, mentele au fost efectuate la oareci, la care
de asemenea, pentru transmiterea caracte- s-au injectat intraperitoneal pneumococi vii
risticilor ereditare. Cercetri ulterioare sau omori prin oc termic, singuri sau n
au stabilit compoziia chimic a acizilor amestec din ambele tulpini. S-a constatat c
nucleici, fiind evideniat existena a dou oarecii au murit n urma injeciei cu pneu-
tipuri de acizi nucleici, dependent de pen- mococi viruleni vii, de tipul SIII (situaie nor-
toza pe care o conin: acizii ribonucleici mal), ns i n cazul injectrii unui amestec
(ARN), cu riboz, i acizii dezoxiribonucle- constituit din pneumococi tip RII vii i SIII
ici (ADN), cu dezoxiriboz. A fost pstrat omori prin oc termic. Griffith nu a putut
termenul generic de acizi nucleici, dei s-a explica fenomenul de transformare genetic
stabilit c acizii dezoxiribonucleici se afl descoperit n acest experiment, respectiv
localizai cu preponderen n nucleu, iar transformarea pneumococilor aviruleni RII
acizii ribonucleici n citoplasm. n pneumococi viruleni de tip SIII, care au
Astfel, nc din ultima parte a secolului al cauzat moartea oarecilor, pe baza cuno-
XIX-lea erau cunoscute dou elemente ale tinelor din timpul su (fig. 1).

4
pag.001-050.qxd 8/1/2008 3:24 PM Page 5

Cyan Yellow Magenta Black pag 5

Capitolul 1

(a) Tulpin\ virulent\ Rolul ARN n ereditate a fost demon-


de pneumococ (S) strat independent de dou colective (H.
{oarecele moare Fraenckel-Conrat i R. Williams n anul
1955, n S.U.A., i A. Gierer i G. Schramm
n 1956, n Germania), care au efectuat
(b) Tulpin\ nevirulent\
de pneumococ (R) experimente cu virusul mozaicului tutu-
{oarecele s\n\tos nului (VMT). VMT este constituit dintr-o
molecul linear de ARN viral, protejat de
o capsid viral, de natur proteic (fig. 3).
(c) Tulpin\ virulent\ Ei au separat virusul n cele dou compo-
omort\ prin [oc
termic
{oarecele s\n\tos nente i au fcut infecii separate cu aces-
tea. S-a constatat prezena unei infecii
virale numai n regiunea unde a fost injectat
(d) Tulpin\ nevirulent\ `mpreun\ ARN viral, din regiunea respectiv fiind izo-
cu tulpin\ virulent\ lat virusul ntreg. Deci ARN viral poart
omort\ {oarecele moare
prin
informaia genetic pentru sinteza ntregu-
[oc lui virus.
termic
Celule vii de tulpin\ virulent\,
izolate din [oarecele mort molecul\
de ARN viral
Fig. 1. Experiena de transformare genetic a
lui Griffith [i a colaboratorilor s\i

O.T. Avery i colaboratorii au reluat


experimentul, fcnd infecii separate cu
diferite componente ale bacteriei. Astfel, capsid\
atunci cnd pe mediul de cultur al bac-
teriilor de tip RII au introdus ADN extras de
la bacterii de tip SIII, dup 24 de ore au con- Fig. 3. Structura VMT
statat prezena coloniilor de tip SIII. Deci,
ADN bacterian posed capacitate infec- Dezvoltarea ulterioar a geneticii mole-
ioas, el fiind purttorul informaiei gene- culare a fost punctat de urmtoarele eveni-
tice (fig. 2). mente:
1945 Erwin Schrdinger (Premiul
Colonii de tip R
Nobel pentru fizic n anul 1933), a emis
ipoteza conform creia informaia genetic
Celule de tip R
pentru sinteza proteinelor se afl localizat
Colonii de tip S
n acizii nucleici;
Celule de tip S 1951 a avut loc secven]area primei
Colonii de tip R
[i de tip S proteine;
Celule de tip R + 1953 a fost stabilit structura spaial
ADN de tip S a moleculei de ADN (J.D. Watson, F.H.C.
Fig. 2. Experien]a de transformare genetic\ a lui O.T. Crick i M.H.F. Wilkins, Premiul Nobel
Avery [i a colaboratorilor s\i pentru medicin i fiziologie, 1962); (fig. 4);

5
pag.001-050.qxd 8/1/2008 3:24 PM Page 6

Cyan Yellow Magenta Black pag 6

Partea I
Dezvoltarea geneticii moleculare a fost
influenat de (1) utilizarea unor instru-
mente i tehnici adecvate de investigaie;
(2) utilizarea substanelor fluorescente i
radioactive, i (3) tehnici de enzimologie n
analiza acizilor nucleici. Utilizarea tehno-
logiilor oferite de computer pentru a proce-
sa informaia biologic disponibil, adic
secvena de nucleotide din acizii nucleici,
respectiv de aminoacizi n molecula prote-
ic a condus la noi descoperiri n genetica
molecular i biotehnologie. Astfel, recent
au aprut noi domenii ale geneticii mole-
Fig. 4. J.D. Watson [i F.H.C. Crick `n fa]a modelului culare: bioinformatica, genomica i proteo-
moleculei de ADN, propus `n anul 1953 mica. Aceste domenii noi folosesc com-
puterul i softurile pentru a stoca, procesa
i analiza informaia biologic, respectiv
1958 a fost stabilit replicarea semi- secvenele de ADN i proteine.
conservativ a ADN; Instrumentele i tehnologiile care au
1961 a fost demonstrat caracterul contribuit la dezvoltarea geneticii molecu-
triplet al codului genetic; lare au fost variate: ultracentrifuga analitic,
1977 s-a descoperit c la eucariote microscopul electronic, electroforeza, difrac-
genele sunt constituite din introni i exoni; ia cu raze X i diferite tipuri de cromato-
1995 a fost secvenat genomul bac- grafe. Principalele tehnici utilizate au constat
terian; n separarea, reunirea, sinteza sau ruperea
2001 a fost secvenat genomul uman. moleculelor de acizi nucleici. Separarea mo-
Cercetrile din genetica molecular au leculei de ADN s-a realizat prin procesul de
condus la clonarea primei gene i implicit denaturare. Tierea moleculei de ADN n
la dezvoltarea unei noi ramuri a geneticii fragmente de mrime variabil s-a realizat
moleculare, denumit ingineria genetic att mecanic, ct i prin utilizarea enzimelor
(tehnologia ADN recombinant) din care de restricie, care taie molecula de ADN la
s-a dezvoltat industria biotehnologiilor. nivelul unor anumite locusuri specifice.

tiai c?
George Emil Palade a primit n anul Nicolae Paulescu a obinut primul extras
1974, mpreun cu Albert Claude i Chris- de pancreas endocrin, stabilind rolul hipo-
tian de Duve, Premiul Nobel pentru Medi- glicemiant al pancreoziminei (insulina).
Premiul Nobel pentru Medicin i Fizio-
cin i Fiziologie, pentru descoperirile lor logie n anul 1923 a fost acordat canadienilor
privind organizarea structural i funcio- F.G. Banting i J.J.R. MacLeod pentru des-
nal a celulei. coperirea efectuat\ cteva luni mai trziu.
Victor Babe, n anul 1901, a fost privat Gheorghe Benga [i colaboratorii
de obinerea Premiului Nobel pentru (UMF-Cluj), au descoperit prima protein\
canal pentru ap\ (aquaporina) n eritro-
Medicin i Fiziologie, dei a avut priori-
citele umane, n 1985. Totui, Premiul
tate fa de lucrrile lui Emil Adolf von Nobel pentru Chimie (2003) a fost acordat
Behring, n cercetrile efectuate n dome- lui Paul Agree, care a publicat cercetrile
niul seroterapiei i aplicrii ei n medicin. sale trei ani mai trziu (1988).

6
pag.001-050.qxd 8/1/2008 3:24 PM Page 7

Cyan Yellow Magenta Black pag 7

2
Capitolul

Acizii nucleici

1. Compoziia chimic a acizilor nucleici

Acizii nucleici sunt substane macro- Elementul structural al unui acid nucleic
moleculare, constituite din trei tipuri de l reprezint nucleotidul. Un nucleotid este
substane chimice: baze azotate (purinice alctuit dintr-o molecul de baz azotat
i pirimidinice), pentoze (glucide) i radi- (purinic sau pirimidinic), o molecul glu-
cal acid fosforic (tab. 1). cid (pentoz) i o molecul radical acid fos-
Principalele tipuri de baze azotate foric.
purinice din molecula de acizi nucleici sunt Bazele azotate purinice prezint un
adenina i guanina (prezente att n ARN, atom de hidrogen la N9, iar bazele azotate
ct i n ADN). n cazul bazelor azotate pi- pirimidinice prezint un atom de hidrogen
rimidinice, n molecula de ARN se afl cito- la N3, dispoziie care favorizeaz formarea
zina i uracilul, iar n molecula de ADN unei nucleozide. Prin legarea unei mole-
citozina i timina (fig. 5). n molecula de cule de baz azotat cu o molecul de pen-
ARN, pentoza este reprezentat de riboz, toz, n poziiile N9C1 sau N3C1, cu eli-
care este nlocuit cu 2-dezoxiriboz n minarea unei molecule de ap, va rezulta o
molecula de ADN (eliminarea unui atom molecul de nucleozid. Prin ataarea unui
de hidrogen la carbonul din poziia 2). n radical acid fosforic la atomul C3 sau C5 al
molecula de pentoz, atomii de carbon se pentozei, cu eliminarea unei alte molecule
noteaz cu specificarea prim, respectiv de ap, se va forma o molecul de nucleo-
C1 C5 (fig. 5). tid (fig. 6).

Tabelul 1 Compoziia chimic a acizilor nucleici

Compus chimic ARN ADN

Baze Purinice Adenina (A), Guanina (G) Adenina, Guanina


azotate Pirimidinice Citozina (C), Uracil (U) Citozina, Timina
Pentoz Riboz 2-dezoxiriboz
Acid fosforic Radical Radical

7
pag.001-050.qxd 8/1/2008 3:24 PM Page 8

Cyan Yellow Magenta Black pag 8

Partea I

Pirimidine H A
H
HO C5 H O OH
HO C5 H O OH
H C H H C1 H
H C H H C1 H
C3 C
C3 C
B OH OH
Citozin\ OH H
(prezent\ Riboz\ 2-dezoxi-riboz\
`n ADN
[i `n ARN) Purine

Timin\ (numai `n ADN) Adenin\

PO4
Baz\ azotat\

C5 Zah\r

Guanin\
Uracil (numai `n ARN)

Fig. 5. Glucidele (A) i bazele azotate (B) din com- Fig. 6. Structura unei nucleotide
poziia acizilor nucleici.

Deoarece n fiecare tip de acid nucleic compactarea fibrelor de cromatin, avnd


exist patru tipuri de baze azotate, rezult rol n reglajul genetic la nivelul fibrei de
c fiecare tip de acid nucleic conine patru cromatin), 5-hidroxi-metilcitozina (pre-
tipuri de nucleotide. Uneori, n nucleotide zent la bacteriofagii din grupul T de la
sunt ntlnite tipuri particulare de baze Escherichia coli) .a.
azotate: 5-metil-citozina (care determin

2. Structura primar i secundar a ADN


Structura primar a acizilor nucleici [ADN]
Acizii nucleici sunt substane chimice aproximativ egal cu masa unui atom de
macromoleculare cu mas molecular de hidrogen. Macromolecula de ADN de la
peste 10 000 daltoni, fiind polimeri de nucle- bacteriofagul 174 are masa molecular
otide. Daltonul este o unitate de mas mo- de 1,7 106 daltoni, iar ADN bacterian are
lecular, fiind a dousprezecea parte din o mas molecular cuprins ntre 4 106 i
masa unui atom de carbon (1,66 1024 g), 5 106 daltoni.

8
pag.001-050.qxd 8/1/2008 3:24 PM Page 9

Cyan Yellow Magenta Black pag 9

Capitolul 2
Structura primar a acizilor nucleici
este o structur monocatenar i rezult n
urma polimerizrii nucleotidelor. Polimeri- Continuarea catenei
zarea lor este facilitat de structura chimi-
c a elementelor componente i de legarea O P O Adenin\
lor n molecula de nucleotid.
Dou nucleotide alturate se leag prin O
N
intermediul unui radical acid fosforic. H2 C O
Acesta unete pentozele a dou nucleotide
vecine n poziiile C5C3 sau C3C5 (fig. 7). H H
Astfel, dac ntr-un nucleotid radicalul acid H H
fosforic este legat de atomul C5 al pento- O H
zei, acesta se va lega de pentoza nucleo-
tidului alturat la atomul C3, cu eliminarea O P O
unei alte molecule de ap. n acest fel Guanin\
rezult lanuri de polinucleotide (fig. 7). O
Caracteristica unei structuri primare N
H2 C O
monocatenare este dat de secvena (ordi-
nea) nucleotidelor din catena de acid nu-
cleic, caracteristic pentru o anumit mole- H H
cul de acid nucleic. Structura primar
O H
este caracteristic pentru acizii ribonucle-
ici i pentru moleculele de ADN de la une-
O P O
le virusuri (virusul 174, geminivirusuri Timin\
de exemplu). De menionat c n molecula O
de ARN pot exista regiuni bicatenare, prin N
Direc]ia 35

H2 C O
rsucirea macromoleculei, pe mici pori-
Direc]ia 53

uni, n jurul propriei axe i formarea de


puni de hidrogen de tipul A = U, respectiv H H
G C (A = adenin, U = uracil, G = guanin,
O H
C = citozin).
O P O
Structura secundar a ADN Citozin\
Structura secundar a macromoleculei O
de ADN a fost stabilit n anul 1953 de J.D. N
H2 C O
Watson, F.H.C. Crick i M.H.F. Wilkins
(Premiul Nobel pentru medicin i fiziolo-
gie n anul 1962). Ea corespunde tipului B H H
de ADN, prezent n regiunile cu eucroma-
tin, care conin gene active metabolic. O H
Continuarea catenei
Conform acestui model, molecula de ADN
este alctuit din dou catene macromole-
culare, antiparalele, cu direcie diferit de
Fig. 7. Structura primar a acizilor nucleici
naintare (antiparalele), rsucite n jurul

9
pag.001-050.qxd 8/1/2008 3:24 PM Page 10

Cyan Yellow Magenta Black pag 10

Partea I
unui ax comun, avnd forma unei scri n dou perechi alturate de nucleotide este
spiral (fig. 8). de 3,4 . Diametrul elicei, la tipul B al
ADN, este de 19 (fa de valoarea de 20
stabilit iniial). Dublul helix prezint rsu-
0,34 nm cirea spre dreapta, fiind uor asimetric i
1 nm prezint dou scobituri: scobitura mare i
Scobitura
mic\ scobitura mic. Acestea reprezint locul
unde acioneaz factorii mutageni.

Scobitura
mare

3,4 nm

Timin\
Punte de hidrogen

Adenin\

Fig. 8. Structura spa]ial\ a moleculei de ADN.

Grup
glucido-fosfat
Cele dou balustrade ale scrii sunt
Grup
reprezentate printr-un schelet glucido-fos- glucido-fosfat
foric, iar treptele scrii sunt reprezentate
prin baze azotate ntre care se stabilesc
puni de hidrogen de natur electrostatic
de tip A = T, respectiv G C i invers Citozin\
(fig. 9). Prin aezarea n interiorul mole-
culei a bazelor azotate i a punilor de
hidrogen, acestea sunt protejate de aci- Guanin\
unea diferiilor factori de mediu, asigurn-
du-se stabilitatea moleculei i implicit a
informaiei genetice, conferit de ordinea
de nuleotide dintr-o caten. Datorit faptu- Grup
lui c pot exista numai patru tipuri de leg- glucido-fosfat
turi de hidrogen, A = T, G C, respectiv Grup
T = A, C G, se asigur reproducerea cu glucido-fosfat
mare fidelitate a informaiei genetice n
urma procesului de replicare.
Pasul elicei (o rotaie complet a celor
dou catene n jurul unui ax comun) este Fig. 9. Punile de hidrogen formate ntre bazele
de 34 . Deoarece la un pas al elicei se afl azotate din cele dou catene ale moleculei de
10 perechi de nucleotide, distana dintre ADN

10
pag.001-050.qxd 8/1/2008 3:24 PM Page 11

Cyan Yellow Magenta Black pag 11

Capitolul 2

Tipuri de ADN
Forma clasic de ADN descris de
Watson, Crick i Wilkins, caracteristic
zonelor cu eucromatin, reprezint tipul B
de ADN. n alte condiii, duplexul de ADN
se poate afla sub alte forme structurale
(tab. 2; fig. 10).
Tipul A este ntlnit la concentraii
saline mari i n cazul unei deshidratri
pariale. Este prezent in vivo, n regiunile
dublu catenare din molecula de ARN, unde
prezena grupei hidroxil-2 mpiedic
adoptarea formei B, precum i n duplexu-
rile hibride ADN-ARN (avnd o caten de Fig. 10. Tipuri de ADN: ADN-Z (stnga) [i ADN-B
ADN i o caten complementar de ARN). (dreapta)
n structurile relativ compacte ale ARN,
similare formei A, bazele azotate sunt ncli- moleculei (12). Numele provine de la
nate fa de axul elicei i sunt mai multe forma n zigzag a catenei fosfo-glucidice.
perechi de baze pe pas al elicei. Prezint o singur scobitur. Este ntlnit
Tipul B reprezint structura general a n polimerii care au secvena de baze
macromoleculei de ADN n regiunile purinice i pirimidinice alterate. A fost n-
active metabolic (fig. 10, dreapta). Aceast tlnit n condiii in vitro, n unele cazuri
form prezint o scobitur principal mare neobinuite, folosind concentraii ridicate
i o scobitur mic. Diferenele dintre baze de sruri. Se pare c este posibil existena
sunt de obicei uor de evideniat n sco- unei tranziii de la forma B la forma Z. n
bitura principal, care reprezint locul prin- anumite condiii, o poriune din molecula
cipal de contact pentru proteine, care leag de ADN care prezint dubletele G C/C G
specific secvenele de ADN. poate fi convertit la forma Z, pe cnd alte
Tipul Z este singurul tip de ADN cu regiuni rmn n forma clasic B, caracte-
rsucire spre stnga, fiind n contrast cu ristic celulelor vii. In vitro, tipul Z este ca-
forma clasic, respectiv cu tipul B (fig. 10, racterizat prin existena unor secvene de
stnga). Este o form compact, avnd cele baze purinice i pirimidinice alturate,
mai multe perechi de baze pe o rotaie a repetate.

Tabelul 2 Caracteristicile moleculare ale diferitelor tipuri de ADN


Direc]ia Perechi Rota]ia Diametrul
Tipul de ADN de rota]ie baze pe pe perechi moleculei
a moleculei pas elice baze ()
A Dreapta 11 + 34, 7 23
B Dreapta 10 + 34,0 19
Z Stnga 12 30 18

11
pag.001-050.qxd 8/1/2008 3:24 PM Page 12

Cyan Yellow Magenta Black pag 12

Partea I

Fenomenul de denaturare renaturare. Hibrizii moleculari


Prin nclzirea unei soluii de ADN la o Dac soluia de ADN monocatenar este
temperatur de 85C95C sau prin men- rcit brusc, cele dou catene nu se mai
inere la o concentraie ridicat de sruri, reunesc (nu se mai refac punile de hidro-
legturile de hidrogen dintre cele dou gen), rezultnd ADN monocatenar.
catene complementare se pot rupe. Proce- Renaturarea reprezint capacitatea
sul este numit denaturare, rezultnd ADN catenelor complementare de a reface du-
denaturat monocatenar (fig. 11). Tempera- blul helix. Procesul are lor printr-o rcire
tura de denaturare (punctul de topire al treptat, lent, care permite refacerea
ADN), difer de la o specie la alta, fiind punilor de hidrogen i reasocierea cate-
dependent de procentul de legturi triple nelor, rezultnd ADN renaturat (fig. 11).
de hidrogen (G C) i proporional cu Procesul de renaturare se produce n dou
procentul acestora n molecula de ADN. etape. n prima etap, o caten de ADN din

ADN
3 5
GCAACTGTCAAATCGTCGCT
CGTTGACAGTTTAGCAGCGA
5 3
GA
Denaturare GC 3
A
C
G
A

T
A C AGTT Renaturare
TG
T
G

T GT
C

C C
A A
5 A
C A
3 A
G
T
C
G
CGU T
5 UG C
A G 5
C CT Hibridare
A
G
U
UU
ARN A GC
A G
C
G
A
3
3 5
GCAACTGTCAAATCGTCGCT
CGUUGACAGUUUAGCAGCGA
5 Hibrid ARNADN 3

Fig. 11. Procesul de denaturare al ADN [i ob]inerea unui hibrid molecular ARNADN

12
pag.001-050.qxd 8/1/2008 3:24 PM Page 13

Cyan Yellow Magenta Black pag 13

Capitolul 2
soluie se mperecheaz cu alt caten la cnd cele dou preparate de ADN mono-
ntmplare, formndu-se scurte regiuni catenar sunt amestecate n soluie) i hi-
bicatenare. Ulterior, n etapa urmtoare, bridizare de filtru (prin imobilizare pe un
regiunea de baze mperecheate se extinde filtru de hibridizare).
de-a lungul moleculei, ntreaga molecul Pe baza unor experimente de hibri-
devenind bicatenar. dizare i stabilind procentul de realizare a
Hibridizarea implic refacerea unui secvenelor dublu catenare, se poate obser-
dublu helix, pornind de la catene de ADN va nrudirea dintre specii (rol n stabilirea
de origine diferit sau de la o caten ADN relaiilor filogenetice dintre specii), fiind
i o caten ARN. Hibridizarea se poate rea- totodat o metod de lucru utilizat n teh-
liza pe dou ci: hibridizare lichid (atunci nologia ADN-recombinant.

3. Tipuri de ARN, structur i funcii


A fost descris existena mai multor eucariote (fig. 12). Are rolul de a copia
tipuri de ARN, care prezint caracteristici informaia genetic dintr-una din catenele
structurale i funcionale diferite. Acestea moleculei de ADN (de obicei din catena
sunt substane macromoleculare, alctuite 3 5) i de a o transporta la locul sintezei
dintr-o singur caten polinucleotidic, care
Gena A Gena B
n anumite regiuni poate prezenta o struc- ADN
tur bicatenar, datorit rsucirii catenei n Transcrip]ie
jurul propriei axe i formrii unor puni de Gena A Gena B
ARN-m
hidrogen de tipul A = U, G C i invers.
A Transla]ie
1. ARN viral constituie materialul gene- B
Protein\
tic de la ribovirusuri, ca: virusul mozaicu-
lui tutunului (VMT), virusul poliomielitei,
(A) Procariote
virusul gripal .a. Prezint de obicei o
Gena X
form linear, la virusul encefalomielitei ADN
oarecilor structura sa fiind ns circular. Transcrip]ie
Mrimea i masa sa molecular sunt ARN primar
dependente de cantitatea de informaie Maturarea ARN
genetic pe care o posed.
2. ARN nuclear mic (ARN-nm sau Eliminarea intronilor
ARN-sn) a fost evideniat n nucleii celu- `n timpul matur\rii
ARN-m matur
lelor animale. ARN-nm interacioneaz cu Nucleu
proteine specifice, formnd mici particule Transport `n citoplasm\
nucleare ribonucleoproteice. Sinteza
ARN-nm se realizeaz cu ajutorul enzimei Transla]ie
ARN-polimeraza III. ARN-nm are rol im- Protein\
portant n funcionarea nucleului: iniierea Citoplasm\
(B) Eucariote
sintezei proteice i maturarea ARN-m.
3. ARN mesager (ARN-m) se afl n Fig. 12. Procesul de transcripie i formarea ARN
celulele tuturor organismelor procariote i mesager la procariote (A) i la eucariote (B)

13
pag.001-050.qxd 8/1/2008 3:24 PM Page 14

Cyan Yellow Magenta Black pag 14

Partea I
proteice, pe suprafaa ribozomilor. Este aminoacizii la locul sintezei proteice de pe
sintetizat n procesul de transcripie a suprafaa ribozomului, n procesul de
informaiei genetice, cu ajutorul enzimei translaie a informaiei genetice (cea de a
ARN-polimeraza, proces care reprezint dou etap a sintezei proteice). Are mas
prima etap a sintezei proteice. Pe catena molecular mic (cca. 25 000), fiind format
3-5 a moleculei de ADN, codonul de din 75-90 de nucleotide. Are forma unei
iniiere a procesului de transcripie (res- frunze de trifoi, fiind alctuit din patru brae
pectiv a sintezei ARN-m) este TAC, iar (regiuni bicatenare), trei dintre ele fiind
codonul care marcheaz sfritul procesu- terminate cu bucle (regiuni monocatenare)
lui de transcripie poate fi unul din urm- i un ciot de mrime variabil (fig. 13).
torii trei codoni: ACT, ATT sau ATC Regiunile bicatenare sunt determinate de for-
(codonii stop). marea unor puni de hidrogen de tip A = U
Mrimea catenei de ARN-m este depen- i G C. Molecula de ARN-t prezint un ax
dent de cantitatea de informaie genetic pe
central alctuit din braul acceptor de
care o posed. Existena sa n timp este limi-
aminoacid (braul fr bucl, avnd o
tat, fiind distrus la sfritul sintezei prote-
secven terminal asimetric CCA) i
ice. ntre ARN-m de la procariote i eucari-
braul i bucla anticodon (are trei secvene
ote exist diferene privind mrimea, num-
mediane de nucleotide, complementare cu
rul de gene i componena lor structural.
secvena codon din molecula de ARN-m).
Molecula de ARN-m de la procariote
n acest fel, n fiecare celul exist teoretic
conine de obicei informaia genetic pen-
tru sinteza mai multor catene polipeptidice 64 tipuri de ARN-t (vezi codul genetic).
(conine mai multe gene). ARN-m prezint Datorit acestei secvene complementare
de obicei numai secvene informaionale cu secvena codon din ARN-m, ARN-t va
(exoni), lipsind secvenele non-informaio- recunoate un anumit codon din constituia
nale (introni). n plus, el rezult n urma ARN-m. n celula vie, celelalte dou brae
procesului de transcripie a informaiei (T i D) sunt rsucite n jurul axului central.
ereditare. Sinteza ARN-t este determinat de
La eucariote, ARN-m conine informaia genele din molecula de ADN, aflate ntr-un
genetic pentru sinteza unei singure ca-
tene polipeptidice, deci conine o singur Aminoacid
gen. n urma procesului de transcripie, la Locul de ata[are a
eucariote se formeaz un ARN precursor aminoacidului
sau premesager. Acesta conine secvene
informaionale (exoni) i secvene non-in- bucla TC
formaionale (introni). naintea procesului bucla D
Bucla
de translaie a informaiei genetice are loc anticodon
procesul de maturare al ARN. Acesta con-
st n eliminarea intronilor i asamblarea Anticodon
A U A
exonilor, cu ajutorul unor enzime specifice Codon
U A U ARN-m
(endonucleaze, ligaze .a.). Procesul repre-
zint un mecanism n reglajul genetic al (A) Anticodon (B) Rela]ia
sintezei proteice la eucariote.
4. ARN de transport (ARN-t) sau ARN Fig. 13. Structura moleculei ARN-t (A) [i rela]ia de com-
solubil (ARN-s) are rolul de a transporta plementaritate stabilit\ `ntre codon [i anticodon (B)

14
pag.001-050.qxd 8/1/2008 3:24 PM Page 15

Cyan Yellow Magenta Black pag 15

Capitolul 2
mare numr de exemplare, fenomen denu- Locus A
mit amplificare genic. Numrul genelor Locus P
implicate n sinteza ARN-t este de 130 la Locus Ex
Drosophila melanogaster, 450 de gene la Subunitatea
Xenopus laevis (amfibian), 5 200 de gene la mare (50 S)

Zea mays (porumb), 12 700 de gene la


Triticum aestivum (gru), iar la Hyacin- Subunitatea
thus orientalis (zambil\) sunt 32 000 de mic\ (30 S)
gene implicate n sinteza ARN-t.
5. ARN ribozomal (ARN-r) constituie Fig. 14. Structura unui ribozom la procariote
circa 85% din cantitatea total de ARN din
celul, fiind localizat n ribozomi, unde este Locusul P (polipeptid) este locusul
asociat cu proteinele. Are o mas molecu- unde are loc formarea unei legturi dipep-
lar de circa 5 105. Ribozomii sunt parti-
tidice ntre doi aminoacizi alturai.
cule ribonucleoproteice (alctuite din
Citirea informaiei genetice coninut n
ARN-ribozomal i proteine), de form rela-
secvena de nucleotide a ARN-m are loc n
tiv sferic, prezente att la procariote, ct i
mod linear, de la codonul de iniiere la
la eucariote. Se afl, de asemenea, n con-
ultimul codon prin adugarea unui amino-
stituia mitocondriilor i a cloroplastelor,
organite celulare de origine endosimbiont. acid de c\tre fiecare codon. Atunci cnd
Sunt formate din dou subuniti: subuni- ultimul codon al moleculei de ARN-m
tatea mic i subunitatea mare (fig. 14). Pe (UAA, UGA sau UAG) ajunge n dreptul
suprafaa ribozomilor se ataeaz molecula locusului Ex (exit) al ribozomului, catena
de ARN-m. Unitatea ribozomal prezint polipeptidic sintetizat se desprinde de pe
trei locusuri (regiuni): A, P i Ex. suprafaa ribozomului.
Locusul A (aminoacil) este locusul ntre ribozomii de la procariote i
unde se ataeaz iniial molecula de eucariote exist unele diferene privind
aminoacid, adus de un ARN-t a crui constanta de sedimentare, masa molecu-
secven anticodon este complementar cu lar i constituia lor. Ribozomii din mito-
secvena codon a ARN-m prezent n drep- condrii i cloroplaste prezint caracteristici
tul acestui locus. similare cu ribozomii de la procariote.

LUCRARE PRACTIC| MODELAREA STRUCTURII


SPAIALE A ADN I ARN-t
Materiale necesare: calculator perso- asambleaz, formnd cele patru tipuri de
nal (pentru structura virtual\). n lipsa sa, nucleotide. Acestea se aranjeaz n struc-
un stativ metalic (bun unul pentru biu- tura primar, formnd cele dou catene,
ret), srm subire de oel sau una ceva dup care se stabilete structura secun-
mai groas de fier negru, cartoane colo- dar, asigurnd corespondena ntre
rate, soluie de lipit, foarfeci, sfoar. bazele azotate (vezi modelele din fig. 4, 8,
A. Modelarea structurii spaiale a 9, 10). n lipsa unui computer, se taie din
ADN. Se vor stabili modele grafice diferite carton colorat elementele componente ale
pentru cele patru tipuri de baze azotate, unui nucleotid (cele patru tipuri de baze
pentoza i radicalul acid fosforic, care se azotate, care pot fi diferite ca form sau

15
pag.001-050.qxd 8/1/2008 3:24 PM Page 16

Cyan Yellow Magenta Black pag 16

Partea I

culoare, glucidul i radicalul acid fosforic) B. Modelarea structurii spaiale a


i se ntocmesc cele patru tipuri de nucle- ARN-t. Se execut n acelai fel, modelul
otide. Cu ajutorul lor se formeaz cele structurii ARN-t, ghidndu-v dup fig. 13.
dou catene (structura primar), dup Se stabilete structura spaial, prin rsu-
care se stabilete structura secundar n cirea braelor D i TC, n jurul axului for-
jurul stativului metalic, asigurnd cores- mat din braul acceptor de aminoacid i
pondena dintre bazele azotate. braul anticodon.

4. Funcia autocatalitic a ADN


Funcia autocatalitic a materialului bazele azotate (nucleotide) din cele dou
genetic const n procesul de replicare a catene pot fi numai de tipul A = T, G C i
materialului genetic. n cazul moleculei de invers, secvena nucleotidelor n cele dou
ADN bicatenar de la eucariote, acest pro- molecule rezultate este identic cu
ces are loc n timpul fazei S a ciclului celu- secvena de nucleotide din molecula origi-
lar. n prima faz are loc sinteza nucleotide- nal. Astfel, cele dou molecule, respectiv
lor, urmat de polimerizarea acestora. cele dou celule fiice rezultate, vor avea
Watson i Crick au emis ipoteza replicrii aceeai constituie genetic cu molecula,
ADN dup modelul semiconservativ. Con- respectiv celula iniial.
form acestui model, iniial are loc ruperea n procesul de replicare intervin mai
punilor de hidrogen, rezultnd ADN mono- multe tipuri de enzime.
catenar. Ulterior, fiecare caten original Exonucleaza intervine n ndeprtarea
servete drept matri (templat) pentru sin- unui nucleotid, a unei secvene de nucleo-
teza unei catene noi. Vor rezulta dou mole- tide sau a unor enzime.
cule noi, fiecare avnd o caten veche i o La eucariote, replicarea ADN ncepe si-
caten nou-sintetizat (fig. 15). Deoarece multan n mai multe regiuni situate de-a
punile de hidrogen complementare ntre lungul moleculei de ADN numite repliconi
sau ochiuri de replicare, care funcioneaz
Molecula Ad\ugarea de simultan. Repliconul este un fragment de
mam\ nucleotide sub ADN alctuit din 30 000300 000 perechi
Locul de ac]iunea
replicare ADN-polimerazei
de nucleotide, la nivelul cruia are loc
replicarea moleculei de ADN, n dou
direcii diferite. Genomul viral sau geno-
Catenele mul bacterian conine un singur replicon,
originale pe cnd genomul celulei eucariote conine
mai muli repliconi.
Replicarea ADN ncepe de la furca de
replicare (fig. 16), constituit dintr-o sec-
Catenele ven de nucleotide (circa 300 de perechi
nou-sintetizate
de nucleotide, dup unii autori). Aceasta
Moleculele constituie o regiune unde are loc o trecere
fiice de la duplexul parental la noile duplexuri
Fig. 15. Modelul semiconservativ de replicare a mo- fiice replicate. ADN-topoizomeraza taie
leculei ADN i apoi leag catene de ADN, reducnd

16
pag.001-050.qxd 8/1/2008 3:24 PM Page 17

Cyan Yellow Magenta Black pag 17

Capitolul 2

5
matri i a legturilor de specificitate tip
A = T, G C. Dup sintez, are loc rsu-
Primer
cirea catenei nou-formate fa de cea origi-
Fragmente nal, formndu-se structura bicatenar.
Okazaki `n 2. Catena iniial 53 servete ca ma-
catena lagging
tri pentru sinteza unei catene comple-
3 Primaz\
mentare noi, catena 35, denumit caten
SSBP
5
Helicaz\ ADN-polimeraz\ lagging (caten discontinu, segmentar,
sau ntrziat). Deoarece catena nou nu
Liber cap\tul 3OH are liber captul 3OH, sinteza este dis-
continu, avnd loc dup un alt mecanism,
5 de la furca de replicare spre captul liber al
3 catenei, ducnd la formarea de fragmente
Fig. 16. Schema biosintezei catenelor leading [i Okazaki. Enzima de iniiere a sintezei este
lagging. ARN-primaza, sub aciunea creia este sin-
tetizat un primer ARN alctuit din cteva
tensiunea din acestea, fcnd posibil des- nucleotide. Pornind de la primerul ARN,
facerea celor dou catene ale moleculei. La sub aciunea enzimei ADN-polimeraza III,
furca de replicare, actioneaz complexul are loc ataarea de nucleotide noi, de la
primozom, constituit din dou enzime furca de replicare ctre captul liber al
diferite: ADN-primaza i ADN-helicaza. catenei lagging, formndu-se un fragment
Enzima ADN-helicaza desface punile Okazaki. Cel de al doilea fragment Okazaki
de hidrogen dintre cele dou catene. Re- va ajunge n dreptul primerului fragmentu-
giunea monocatenar rezultat este com- lui Okazaki sintetizat anterior.
plexat cu o protein tip SSB (single-strand Fragmentul Okazaki este un fragment
binding-protein), care stabilizeaz regiu- de ADN, alctuit din cteva mii de nucleo-
nea cu ADN-monocatenar, mpiedicnd tide la procariote i 100200 de nucleotide
refacerea punilor de hidrogen. la eucariote. Dup sinteza unui fragment
Sinteza a dou catene noi are loc diferit Okazaki, ADN-polimeraza III este nltu-
pe cele dou catene matri, originale, de-
rat. Al doilea fragment Okazaki sintetizat
oarece enzima ADN-polimeraza, implicat
va ajunge n dreptul primerului primului
n polimerizarea nucleotidelor, poate ataa
fragment Okazaki sintetizat anterior. Ime-
un nou nucleotid numai la capatul 3 liber al
diat acioneaz enzima ADN-polimeraza I,
moleculei de pentoz. Modelul acceptat n
avnd loc ataarea ultimului nucleotid, care
prezent este modelul replicrii discontinue
ajunge lng primerul fragmentului Okazaki
propus de Okazaki.
sintetizat anterior. Dup aceasta, sub aci-
1. Catena veche 35 servete ca matri
unea unei exonucleaze are loc ndeprtarea
pentru sinteza unei catene complementare
primerului ARN de la fragmentul Okazaki
noi, catena 53, denumit caten leading
(caten directoare sau caten principal). sintetizat anterior, proces urmat de nde-
Deoarece noua caten prezint liber cap- prtarea ADN-polimerazei I. Cele dou
tul 3-OH, la care pot fi adugate noi fragmente Okazaki alturate sunt unite sub
nucleotide, sinteza sa are loc n mod con- aciunea enzimei ADN-ligaza, dup care are
tinuu, sub aciunea enzimei ADN-polime- loc rsucirea catenei nou-sintetizate n jurul
raza III, pe baza ordinii dictate de catena catenei matriei (fig. 16).

17
pag.001-050.qxd 8/1/2008 3:24 PM Page 18

Cyan Yellow Magenta Black pag 18

Partea I
Viteza de ataare a noilor nucleotide n structurai nucleozomi noi, pe baza protei-
timpul replicrii moleculei de ADN este mare nelor histonice componente, sintetizate con-
(circa 1 000 de nucleotide pe secund pe ge- comitent cu replicaia ADN. Prezena unor
nom). La aceast vitez, au loc erori de m- repliconi multipli reduce timpul total de
perechere, respectiv de ataare a unor replicare a ntregii molecule de ADN.
nucleotide noi, ntr-un procent de 1 eroare / Necesitatea existenei mai multor repli-
100 000 de perechi de nucleotide. Astfel, n coni rezult din urmtorul exemplu. Cel mai
cromozomul bacterian alctuit din 3 106 lung cromozom de la Drosophila melano-
perechi de baze azotate, se pot produce 300 gaster conine 7 107 nucleotide. La o rat
de erori pe celul. ADN-ul din celula uman de replicare de 50 de nucleotide pe secund,
conine cca. 3 109 perechi de baze, num- la temperatura optim de 25C, replicarea
rul de mperecheri greite (erori) fiind de ntregii cantiti de ADN din cromozom ar
30 000 de nucleotide pe celul. Majoritatea avea loc n circa 8 zile. n celulele de
erorilor sunt nlturate prin procese speci- Drosophila melanogaster exist ns circa
fice. ADN-topoizomerazele induc incizii n 8 500 de repliconi, situaie care reduce tim-
una din catenele moleculei de ADN, proces pul de replicare la cteva minute (fig. 17).
urmat de eliminarea nucleotidelor incluse Existena mai multor repliconi asigur repli-
greit, nlocuirea acestora cu nucleotide carea fiecrui cromozom n 1530 de
corespunztoare structurii iniiale i repa- minute. Deoarece nu toi cromozomii se
rarea greelilor de replicare. replic simultan, timpul total de replicare al
n celula eucariot, prezena nucleo- cromozomilor la eucariote este de 510 ore.
zomilor determin anumite particulariti
ale replicrii ADN. Astfel, fragmentele
Okazaki sunt de circa 10 ori mai scurte
(100200 de nucleotide) fa de cele de la
procariote, primerul ARN este mai scurt
(1020 de nucleotide), iar viteza de replicare
este mai mic (50 de nucleotide pe secund,
fa de 500 de nucleotide pe secund la pro-
cariote). Nucleozomii fibrei de cromatin Fig. 17. Aspect ultrastructural al unui segment
rmn ataai pe poriunile catenei matri- de ADN de 30 kb de la Drosophila melano-
conductoare, pe cealalt caten fiind gaster, cu cinci repliconi.

5. Funcia heterocatalitic a ADN


Dogma central
Este principiul fundamental al geneticii Retrovirusurile fac o excepie de la Dog-
moleculare, care sintetizeaz modul n care ma central a geneticii. Ele sunt virusuri cu
informaia genetic din molecula de ADN ARN, pe care l convertesc n ADN cu aju-
este transcris n secvena de aminoacizi torul unei enzime specifice (revers-transcrip-
din catena polipeptidic, n timpul procesu- taza, care transcrie informaia genetic n
lui de sintez proteic (fig. 18). sens invers, de la ARN-viral la ADN). Acest

18
pag.001-050.qxd 8/1/2008 3:24 PM Page 19

Cyan Yellow Magenta Black pag 19

Capitolul 2

ADN
Funcia heterocatalitic a materialului
genetic, explicat prin dogma central a
geneticii, arat circuitul informaiei genetice
TRANSCRIPIE
n celul. El are loc n dou etape. n prima
etap, secvena de nucleotide din molecula
de ADN este transcris ntr-o secven com-
ARNr ARNm ARNt
plementar de nucleotide la nivelul acizilor
ribonucleici. n cazul sintezei de ARN-me-
sager, acesta este procesul de transcripie,
Ribozom
respectiv transcrierea informaiei genetice
din secvena de nucleotide a ADN, ntr-o
TRANSLAIE secven complementar de nucleotide
(ARN-mesager). n cea de a dou etap, pro-
cesul de translaie (traducere), secvena de
Protein
nucleotide din molecula de ARN-m este tran-
Fig. 18. Dogma central a geneticii: relaia exis- scris n secvena de aminoacizi a unei
tent ntre ADNARN-proteina catene polipeptidice, cu ajutorul codului
genetic, avnd loc sinteza proteic.
ADN se poate integra n ADN-ul celulei Codul genetic reprezint corespondena
gazd. Cel mai cunoscut retrovirus este viru- dintre secvena de nucleotide din molecula
sul HIV (virusul imunodeficienei umane), de acizi nucleici, n secvena de aminoacizi
care provoac la om boala SIDA. din catena polipeptidic.

Caracteristicile codului genetic


n anul 1944, O.T. Avery i colaboratorii Deoarece n molecula de ADN se afl
au demonstrat rolul ADN n transformarea patru tipuri de baze azotate (respectiv pa-
genetic la bacterii. Imediat, s-a emis ipo- tru tipuri de nucleotide), iar molecula pro-
teza existenei unei relaii ntre acizii nucle- teic este constituit din 20 de tipuri de
ici i proteine, realizat prin funcionarea aminoacizi proteici, rezult c un grup de
unui cod genetic, unitile de codificare trei baze azotate alturate (trei nucleotide),
fiind reprezentate de cele patru baze azo- constituie unitatea de codificare a unui
tate (respectiv patru nucleotide) din con- aminoacid n molecula proteic (tab. 3).
stituia ADN.
Tabelul 3. Relaia dintre numrul de baze azotate ntr-un
grup de determinism i numrul de aminoacizi proteici

Num\rul de baze azotate Num\rul de combina]ii


(nucleotide) implicate posibile determinat Num\rul de aminoacizi
n stabilirea pozi]iei de existen]a a 4 tipuri proteici
unui aminoacid de baze azotate
1 41 = 4 20
2 42 = 16 20
3 43 = 64 20

19
pag.001-050.qxd 8/1/2008 3:24 PM Page 20

Cyan Yellow Magenta Black pag 20

Partea I
Codonul reprezint un grup de trei nu- Codul genetic este degenerat, adic un
cleotide alturate din molecula de ARN-m, aminoacid poate fi codificat de doi sau mai
care determin poziia unui aminoacid n muli codoni. Astfel, aminoacidul fenilala-
molecula de protein sau sfritul sintezei nina este codificat de secvena UUU sau
proteice. UUC (cod genetic ARN-m; tab. 4, 5).
n prezentarea caracteristicilor codului Codoni stop. Exist trei codoni stop
genetic, se obinuiete s fie utilizai codo- (UAA, UGA, UAG), care la eucariote deter-
nii din molecula de ARN-m (tab. 4). min sfritul mesajului genetic i nu pozi-
Codonul este unitatea funcional a ia unui aminoacid n catena polipeptidic.
codului genetic. Codul genetic este alctuit Codoni ambigui. Exist doi codoni am-
din 64 de codoni. Acetia reprezint totali- bigui (AUG i probabil GUG), care depen-
tatea combinaiilor, n grupe de cte trei, a dent de poziia lor n molecula de ARN-m,
celor 4 tipuri de nucleotide (baze azotate). determin poziia unor aminoacizi diferii.
Fenomenul de colinearitate reprezint Ambii codoni se pot gsi la nceputul mole-
corespondena dintre secvena nucleotidelor culei de ARN-m sau n interiorul acesteia
din molecula de ADN sau ARN-m i secvena (dar nu terminal, unde se afl unul din
aminoacizilor din molecula proteic. cei trei codoni stop). Situai n prima po-
Codul genetic este nesuprapus i fr ziie, ambii codoni determin includerea
virgul, adic doi codoni alturai nu pre- aminoacidului metionin-formiat. Aflai
zint nucleotizi comuni (cod nesuprapus), n interiorul ARN-m (dar nu terminal), codo-
iar ntre ei nu se afl nucleotizi fr sens nul AUG determin includerea metioninei,
(cod fr virgul).
Tabelul 4. Codul genetic universal
Prima A treia
pozi]ie A doua pozi]ie pozi]ie
(cap\t 5) (cap\t 3)

U C A G
U Phe Ser Tyr Cys U
Phe Ser Tyr Cys C
Leu Ser Stop Stop A
Leu Ser Stop Trp G
C Leu Pro His Arg U
Leu Pro His Arg C
Leu Pro Gln Arg A
Leu Pro Gln Arg G
A Ile Thr Asn Ser U
Ile Thr Asn Ser C
Ile Thr Lys Arg A
Met* Thr Lys Arg G
G Val Ala Asp Gly U
Val Ala Asp Gly C
Val Ala Glu Gly A
Val* Ala Glu Gly G

20
pag.001-050.qxd 8/1/2008 3:24 PM Page 21

Cyan Yellow Magenta Black pag 21

Capitolul 2
iar codonul GUG pe cea a valinei. n gene- excepii ntlnite la organisme foarte vechi
ral, dup terminarea sintezei proteice, pri- filogenetic, precum i n codul genetic de
mul aminoacid din catena polipeptidic sin- la mitocondrii. Aceste excepii se refer n
tetizat este nlturat. special la codonii tip stop, care iniial au
Codul genetic este universal i are ori- avut rol n determinismul unui anumit ami-
gine foarte veche. Aceiai codoni determin noacid. Astfel, la procariotul Mycoplasma
poziia aceluiai aminoacid la organisme capricolum, codonul UGA determin pozi-
diferite, cu vechime filogenetic diferit. ia triptofanului. De asemenea, la unele cili-
Codul genetic a evoluat n timp, dovad ate (Tetrahymena sp. sau Paramoecium
fiind unele excepii de la codul genetic, sp.), codonii UAA i UAG determin pozi-
ia glutaminei.

Biosinteza proteic
Biosinteza proteinelor are loc n dou de modificri post-translaionale, n urma
etape principale, transcripia i translaia, crora va deveni activ metabolic.
la nivelul crora pot aciona diferite meca-
nisme de control (fig. 19). Dup ce a fost Transcripia informaiei genetice
sintetizat, catena polipeptidic (care pre- Transcripia informaiei genetice con-
zint structura primar), parcurge o serie st n transferul informaiei genetice din

Tabelul 5. Aminoacizii i codonii care i codific

Nr. Aminoacizi Simbol Codoni


1 Alanina Ala GCA, GCC, GCG, GCU
2 Cisteina Cys UGC, UGU
3 Acid aspartic Asp GAC, GAU
4 Acid glutamic Glu GAA, GAG
5 Fenilalanina Fen UUC, UUU
6 Glicina Gly GGA, GGC, GGG, GGU
7 Histidina His CAC, CAU
8 Izoleucina Ile AUA, AUC, AUU
9 Lisina Lys AAA, AAG
10 Leucina Leu UUA, UUG, CUA, CUC, CUG,CUU
11 Metionina Met AUG
12 Asparagina Asp AAC, AAU
13 Prolina Pro CCA, CCC, CCG, CCU
14 Glutamina Glu CAA, CAG
15 Arginina Arg AGA, AGG, CGA, CGC, CGG,CGU
16 Serina Ser AGC, AGU, UCA, UCC, UCG,UCU
17 Treonina Thr ACA, ACC, ACG, ACU
18 Valina Val GUA, GUC, GUG, GUU
19 Triptofan Trp UGG
20 Tirosina Tyr UAC, UAU

21
pag.001-050.qxd 8/1/2008 3:24 PM Page 22

Cyan Yellow Magenta Black pag 22

Partea I
secvena de nucleotide a uneia din catenele Unitatea de transcripie este o poriune
de ADN (de obicei din catena 35) sau din din molecula de acid nucleic care conine
catena de ARN viral n catena de ARN-m. informaia genetic pentru sinteza unei
Deci, informaia genetic se transcrie dintr-o molecule de ARN-m. ntre dou uniti de
secven de nucleotide n alt secven de transcripie alturate, se afl secvene de
nucleotide. Procesul de transcripie se rea- ADN non-informaional. Mrimea unei uni-
lizeaz cu ajutorul enzimei ARN-polime- ti de transcripie difer la procariote de
raza. Codonul de iniiere a sintezei unei eucariote. La procariote, o unitate de tran-
uniti de transcripie (a unei molecule de scripie conine informaia genetic a mai
ARN-m) se afl n general pe catena 35, multor gene, fiind deci implicat n sinteza
fiind de obicei TAC (mai rar CAC). Co- mai multor catene polipeptidice. n acelai
donul care indic sfritul procesului de timp, unitatea de transcripie de la procari-
transcripie este un codon complementar ote conine numai secvene informaionale
codonilor stop din codul genetic al ARN-m, (fig. 12). La eucariote, o unitate de tran-
respectiv ACT, ATT sau ATC. scripie conine informaia genetic a unei

ADN
TRANSCRIPIE (nucleu)

(`nveli[
nuclear)
Procesarea ARN
transcris

ARN-t Subunit\]ile
sau sau ARN-m
ARN-r

(citoplasm\)

Citoplasm\ cu aminoacizi,
ARN-t [i subunit\]i
ribozomale

TRANSLAIE

Lan] polipeptidic format


pe suprafa]a ribozomului
Protein\
Utilizat\ `n celul\ proprie sau `n alt\ celul\

Fig. 19. Reprezentarea schematic\ a transcrip]iei [i transla]iei informa]iei genetice la eucariote

22
pag.001-050.qxd 8/1/2008 3:24 PM Page 23

Cyan Yellow Magenta Black pag 23

Capitolul 2
singure gene, fiind deci implicat n sinteza polipeptidice (fig. 21) i sistarea sintezei
unei singure catene polipeptidice. La nivelul proteice (fig. 22).
moleculei de ADN, ntr-o unitate de tran- a) Iniierea sintezei proteice (fig. 20). n
scripie se afl att secvene informaionale citoplasm se afl molecule de ATP (ade-
(exoni), ct i secvene non-informaionale nozintrifosfat, substan macroergic), cele
(introni). Astfel, n urma procesului de tran- 64 de tipuri de ARN-t, cele 20 de tipuri de
scripie, la eucariote rezult un ARN-pre- aminoacizi proteici, ARN-m i ribozomi.
cursor care conine att exoni ct i introni ARN-m se ataeaz pe suprafaa ribozomu-
(fig. 12). naintea nceperii celei de-a doua lui, primul codon, respectiv codonul de
etape a sintezei proteice (procesul de tran- iniiere (AUG sau GUG) fiind poziionat n
slaie) este necesar maturarea ARN-m. dreptul locusului A de pe ribozom. n cito-
Procesul de maturare a ARN-m are loc plasm se produc relativ concomitent
prin eliminarea intronilor i asamblarea primele dou reacii, sub aciunea enzimei
exonilor, cu ajutorul unor enzime, dintre care E1, aminoacil-sintetaza, rezultnd complexul
fac parte endonucleazele i ligazele. Procesul aminoacil ARN-t. n dreptul codonului de
prezint importan n reglajul genetic al sin- iniiere AUG din molecula de ARN-m, situat
tezei proteice la eucariote (fig. 12). n dreptul locusului A, va veni complexul
ARN-t1 AA1 cu secvena anticodon UAC
Translaia informaiei genetice care poart aminoacidul metionin-formiat.
Translaia informaiei genetice const Imediat, are loc deplasarea relativ a ARN-m
n transferul informaiei genetice din sec- fa de ribozom cu o distan de un codon. n
vena de nucleotide a ARN-m n secvena
de aminoacizi din catena polipep- Iniierea translaiei
tidic. Are loc deci traducerea me-
sajului genetic, dintr-o secven de Translaia
ncepe cu
ARN-m+subunitatea
40S + ARN-t Mct
nucleotide ntr-o secven de amino- codonul AUG

acizi. Primul ARN-t ajunge Complexul de iniiere pe Urm-


n acest proces au loc trei reacii apoi n locusul P subunitatea 60S torul
ARN-t
principale, sub aciunea a dou
enzime: Fig. 20. Iniierea sintezei proteice

E1
(a) AA1 + ATP AA1 AMP + P P
Aminoacid activat
E1
(b) AA1 AMP + ARN-t1 AA1 ARN-t1 + AMP
Complex aminoacil-ARN-t
E2
(c) AA1 ARN-t1 + AA2 ARN-t2 AA1 AA2 + ARN-t1 + ARN-t2.
Legtur dipeptidic

Descris pe larg, procesul de translaie a acest fel, primul complex aminoacil ARN-t1
informaiei genetice poate fi mprit n trei (care a transportat metionin-formiat),
stadii: (a) iniierea sintezei proteice ajunge n locusul P de pe suprafaa ribo-
(fig. 20), formarea i elongarea catenei zomului, locusul A devenind liber.

23
pag.001-050.qxd 8/1/2008 3:24 PM Page 24

Cyan Yellow Magenta Black pag 24

Partea I
b) Formarea i elongarea catenei poli- c) Sistarea sintezei proteice (fig. 22).
peptidice (fig. 21). Formarea primului Atunci cnd codonul stop ajunge n dreptul
dipeptid este precedat de deplasarea com- locusului A, pe suprafaa ribozomului se va
plexului aminoacil ARN-t1 n dreptul locu- ataa un facor RF (factor de eliberare ).
sului P de pe suprafaa ribozomului, Ajuns apoi n dreptul locusului Ex, catena
locusul A devenind liber. polipeptidic sintetizat i factorul RF se
Aici va veni acel complex ARN-t2AA2, desprind de pe suprafaa ribozomului.
al crui anticodon este complementar Ulterior are loc desprinderea primului
codonului ARN-m din locusul A. Dup aminoacid (metionina-formiat) i for-
aducerea unui nou aminoacid n locusul A, marea structurii secundare a moleculei de
se formeaz o legtur dipeptidic ntre protein. Pe suprafaa unei molecule de
primii doi aminoacizi, sub aciunea celei de ARN-m se ataeaz de obicei mai muli
a dou enzime, peptid-polimeraza (E2). ribozomi, care formeaz aa-numiii poliri-
Dup formarea legturii dipeptidice, ribo- bozomi sau polizomi, avnd loc astfel sin-
zomul se mic relativ fa de ARN-m cu o teza mai multor catene polipeptidice pe
distan de un codon i locusul A devine baza aceleiai informaii genetice.
liber pentru a primi un nou aminoacid.
Modificri post-translaionale
Procesul are loc n acest fel, cu decodifi-
carea informaiei genetice din molecula de n urma sintezei proteice, rezult o
ARN-m, pn ce se ajunge la ultimul codon, caten polipeptidic, n care aminoacizii se
unul din codonii stop. n acest caz, nu mai afl ntr-o succesiune caracteristic. Aceasta
este adus niciun aminoacid la catena reprezint structura primar a catenei poli-
polipeptidic sintetizat. peptidice, form n care proteina este de

Elongare Sistare
ARN-m EF-1-GTP

(A)
Stadiul pre-
translaional Urmtorul ARN-t ARN-m
ajunge n locusul A

Legarea aminoacizilor
Metionin-Fenilalanin
Factor de
EF-1-GDP EF-2-GTP eliberare

Stadiul post-
translaional Urmtorul ARN-t
(B)

Subunitatea
mic
EF-1-GTP Locusul A cu fac-
EF-2-GDP torul de eliberare

Catena polipeptidic
Un nou amino- sintetizat
acid este adus la
locusul A

Eliminarea Reacia de legare


ARN-t a aminoacizilor
(C)
EF-1-GDP Subunitatea Subunitatea
EF-2-GTP mic (40 S)
mare (60 S)
Separarea
subunitilor
ribozomului
Stadiul post-
translaional ARNt Separarea
subunitilor
ribozomului
Complexul
ARNt-valin polipeptid

Fig. 21. Formarea i elongarea catenei polipeptidice. Fig. 22. Sistarea sintezei proteice

24
pag.001-050.qxd 8/1/2008 3:24 PM Page 25

Cyan Yellow Magenta Black pag 25

Capitolul 2
obicei inactiv. Catenele polipeptidice se pot n alte cazuri, proteina sintetizat va fi dige-
rsuci n spiral sau se pot plia, formnd rat parial sub aciunea peptidazelor, pen-
structura secundar. Forma tridimensional tru a deveni activ. De exemplu, n celulele
a polipeptidelor rsucite sau pliate constitu- beta ale pancreasului endocrin, n urma sin-
ie structura teriar, iar structura cuaternar tezei proteice rezult pre-proinsulina. Con-
este determinat de relaiile structurale din- versia acesteia n insulin activ are loc n
tre catenele polipeptidice componente ale dou etape. n prima etap are loc elimi-
unei proteine. Pentru a deveni activ, catena narea secvenei semnal (situate la captul
polipeptidic poate fi modificat prin par- catenei B), rezultnd proinsulina, alctuit
curgerea uneia sau a mai multor ci speci- din trei catene polipeptidice (A, B i C). n a
fice, aceasta fiind fosforilat sau glicozilat doua etap are loc eliminarea catenei
enzimatic, ori digerat parial sub aciunea polipeptidice C i formarea a dou legturi
enzimelor peptidaze .a. Fosforilarea im- disulfurice intercatenare (A7-B7, respectiv
plic adugarea uneia sau a mai multor A20-B19) i una intracatenar (A6-A11) i va
grupri fosfat, iar glicozilarea implic adiia rezulta insulina activ, alctuit din 51
uneia sau a mai multor grupri carbohidrat. aminoacizi (fig. 23).

Fig. 23. Modificarea posttranslaional a pre-proinsulinei rezultat n


urma sintezei proteice

tiai c?
Proteinele chaperone sunt un grup respectiv n modificrile translaionale pe
eterogen, alctuit din circa 200 de mole- care le parcurg acestea. Ele sunt implicate
cule proteice, prezente n toate comparti- n sinteza i traficul intra- i extracelular al
mentele celulei. Aceste proteine au rol proteinelor, n translocarea i asamblarea
esenial n determinarea structurii tridimen- factorilor de transcripie, activarea kina-
sionale a moleculelor proteice sintetizate, zelor proteice . a.

25
pag.001-050.qxd 8/1/2008 3:24 PM Page 26

Cyan Yellow Magenta Black pag 26

3
Capitolul
Organizarea
materialului genetic
*Genomica

n natur exist forme acelulare de necomplexat cu proteinele, iar citoplasma


via, reprezentate prin virusuri, viroizi i necompartimentat. Sunt reprezentate prin
plasmide i forme celulare de via (orga- bacterii, arhebacterii i bacterii sau alge al-
nisme), reprezentate prin organismele pro- bastre-verzi (Cyanobacteria = Cyanophyta).
cariote i eucariote. Formele acelulare de Organismele eucariote au nucleu ncon-
via nu au organizare celular i metabo- jurat de nveli nuclear, materialul genetic
lism propriu, iar dezvoltarea lor are loc este reprezentat prin cromatina nuclear
obligatoriu ntr-un organism sau celul (la nivelul creia ADN este complexat cu
gazd, fiind parazite (viroizii i virusurile) proteinele), iar citoplasma este comparti-
sau simbionte (plasmidele). mentat n organite cu structur i funcie
Organismele procariote nu au nucleu diferit. Prezint mitoz i meioz i ciclu
nconjurat de nveli nuclear, nu prezint de condensare al cromozomilor. Eucario-
mitoz i meioz, nu au ciclu de conden- tele sunt reprezentate prin: protociste sim-
sare al cromozomului, materialul genetic ple (parazii simpli, alge i mucegaiuri),
este reprezentat printr-o molecul de ADN fungi, plante i animale.

1. Forme acelulare i celulare de via


Organizarea materialului genetic la formele acelulare de via
(virusuri)
Organizarea cromozomului la virusuri.
Dup materialul genetic pe care l conin,
virusurile sunt de dou feluri: ribovirusuri,
Proteine
ADN Cap cu ARN, din care fac parte virusul moza-
icului tutunului (VMT; vezi fig. 3), virusul
Col imunodeficienei umane (HIV), virusul
Miez
gripei, al turbrii, poliomielitei i dezoxi-
Coad
Plac ribovirusuri, cu ADN, din care fac parte
bazal
majoritatea bacteriofagilor (fig. 24), virusul
Fibre de
adeziune herpesului, al variolei .a.
Cromozomul viral este alctuit de obicei
dintr-o singur molecul de ARN sau ADN,
Fig. 24. Bacteriofagul T2. monocatenar sau bicatenar, de form

26
pag.001-050.qxd 8/1/2008 3:24 PM Page 27

Cyan Yellow Magenta Black pag 27

Capitolul 3
linear (mai rar circular), pe care genele Plasmidele sunt molecule de ADN
sunt dispuse linear, ntr-o anumit ordine. bicatenar, de form circular sau linear,
Virusurile conin n medie 50 de gene. Fagul capabile de replicare autonom, indepen-
MS2 are un genom ARN alctuit din 4 gene, dent de cromozomul celulei gazd. Au fost
pe cnd fagii mai compleci i virusurile celu- descoperite iniial la bacterii, fiind ulterior
lelor animale au peste 250 de gene. Virusul identificate i n celulele altor specii, inclusiv
mozaicului tutunului prezint o molecul de la om (asociate cu nucleul sau n mitocondrii
ARN linear, pe cnd virusul mozaicului i cloroplaste). Pot fi transferate de la o
conopidei sau virusul simian SV40 prezint o celul la alta. n celula bacterian se pot gsi
molecul de ADN circular bicatenar. 10200 de copii ale aceluiai plasmid.
Unele virusuri au un genom segmentat, Plasmidele prezint un rol biologic foarte
respectiv posed mai multe molecule de important n celula bacterian, fiind impli-
acid nucleic. Astfel, virusul gripal (influen- cate n fenomenele de parasexualitate (plas-
za virus), prezint un genom segmentar, mide tip F), inducerea rezistenei la unii fac-
alctuit din 8 molecule de ARN-viral, prote- tori de stres (plasmide tip R), sau plasmide
jate de o capsid viral. Dac fragmentele implicate n producerea de antibiotice bacte-
de genom se afl n capside diferite, virusul riocine care omoar orice alt tip de bacterii,
este heterocapsidic, iar dac se afl n ace- fiind inofensive pentru propriul grup.
eai capsid, virusul este izocapsidic. Plasmidele bacteriene sunt utilizate pen-
Viroizii sunt o grup de ageni infec- tru producerea ADN-recombinant (fig. 26).
ioi, alctuii dintr-o singur molecul de Plasmidul tip Ti prezent la bacteria Agrobac-
ARN circular, monocatenar, constituit din terium tumefaciens prezint largi aplicaii n
circa 300 (240350) de nucleotide. Prin pli- ingineria genetic i biotehnologie, datorit
ere, poate forma o structur secundar capacitii de a include n constituia sa un
bicatenar avnd capetele legate (fig. 25). ADN exogen, care poate fi introdus apoi n
Provoac unele boli ca boala tuberculilor cromozomul unei celule gazd, rezultnd ast-
fuziformi la cartof, boala Kadang-Kadang a fel celule i organisme modificate genetic.
palmierilor sau marmorarea clorotic a cri-
zantemelor. Sunt replicai n celula gazd
sub aciunea enzimei ARN-polimeraza. EcoRI Clal
Hind III
Rezisten]a la BamHl
ampicilin\
AG CAUUG
GU C Sal I
GA Pst I
AC
Cz
zz

zz
z
zz

z
zz
z

AA
G

UC GU
AU CGUAAC
Pliere
Originea Rezisten]a la
z
z

replic\rii
z

zzzCGAGUAGCAUUGCAC tetraciclin\
zzz G CAUCGUAACGUG zzz
ADN
U
A
A

Fig. 25. Organizarea ARN la viroizi. Prin pliere, Fig. 26. Structura plasmidului pBR322, un vector
molecula circular poate forma o regiune de clonare clasic. Sgeata arat direcia de repli-
bicatenar. care, pornind de la locusul sau originea replicrii

27
pag.001-050.qxd 8/1/2008 3:24 PM Page 28

Cyan Yellow Magenta Black pag 28

Partea I

Organizarea materialului genetic la forme celulare de via


(procariote)
La bacterii, materialul genetic este re- n inele i prezena superrsucirii pozitive
prezentat prin ADN cromozomal (nucleo- permite compactarea moleculei de ADN.
idul bacterian) i ADN extracromozomal n acest fel, o molecul de ADN avnd un
de tip plasmidic. diametru de cca. 300 m diametru, poate fi
Cromozomul bacterian este alctuit mpachetat n celula bacterian care are
dintr-o singur molecul de ADN bicatenar o lungime de circa 3-5 m i diametrul de
reprezentnd nucleoidul bacterian. Pentru a 1,5-2,0 m (fig. 27). La iniierea sintezei
putea fi inclus n celula bacterian, ADN-ul proteice, bucla n care se afl gena impli-
din cromozomul bacterian se afl dispus cat n sintez este desfcut (sub aciunea
sub forma unor inele mari (40-50 de inele pe unei ribonucleaze), iar superrsucirea po-
cromozom bacterian). Fiecare inel este zitiv este eliminat prin aciunea unei
meninut ca atare fiind legat la baza sa de o dezoxiribonucleaze, fiind posibil fenome-
molecul de ARN, toate inelele fiind dispuse nul de transcripie a informaiei genetice
sub form de cerc. Aceast form de orga- (sinteza de ARN-mesager).
nizare permite existena unei alte structuri Superrsucirea negativ , ntlnit n
cu rol n compactarea moleculei de ADN, regiunea furcii de replicare, const n rsu-
structur reprezentat prin superrsucire. cirea moleculei de ADN n jurul propriei
Superrsucirea pozitiv const n rsu- axe, n sens opus acelor de ceasornic. n
cirea unui dublu helix de ADN n spaiu, n acest fel are loc dezrsucirea celor dou
sensul acelor de ceasornic, n jurul pro- catene (dispunere paralel pe o mic dis-
priului ax. Ea prezint aproximativ 400-500 tan), procesul avnd importan local,
de perechi de nucleotide. Dispunerea ADN la iniierea sintezei proteice.

Fig. 27. Structura molecular a cromozomului bacterian.

2. Organizarea materialului genetic la eucariote


Informaia genetic la eucariote se afl 1. Modelul nucleozomal al organizrii
n genomul nuclear (format din setul de cromozomului la eucariote
cromozomi ai celulei) i n genomul Cromozomii de la eucariote au o compo-
extranuclear, reprezentat n principal de ziie chimic i o structur mai complex
ADN-ul mitocondrial i ADN-plastidic. fa de cromozomul bacterian. Cromozomul

28
pag.001-050.qxd 8/1/2008 3:24 PM Page 29

Cyan Yellow Magenta Black pag 29

Capitolul 3

Miezul nucleozomului Apexul solenoidului


H2B

H2A
H4
H3
Octamer histonic
H3

H2B ADN
H2A

Fig. 28. Nucleozomul la eucariote.

de la eucariote este alctuit din ADN, ARN,


Fig. 29. Structura tip solenoid, avnd 6 nucleo-
proteine histonice i non-histonice, mici can-
zomi pe spir
titi de lipide, ioni de calciu i magneziu.
Cromozomul de la eucariote este format prin dou fibrile cu diametrul de 11 nm, una n
mpachetarea fibrei de cromatin, al crei jurul celeilalte, se formeaz fibra de cro-
element structural l reprezint nucleozomul. matin cu diametrul de 30 nm (fig. 30).
Nucleozomul constituie unitatea struc-
tural a fibrei de cromatin. El are forma
unui fragment de cilindru, avnd diametrul
de 11 nm i nlimea de 5,5 nm (fig. 28). ADN bicatenar
2 nm

Din punct de vedere chimic, nucleo-


zomul este un octamer histonic, alctuit din
11 nm
opt molecule de proteine histonice: 2 mole- Fibra
cule H2A, 2 molecule H2B, 2 molecule H3 i fundamental
2 molecule H4. Pe suprafaa sa se afl nf-
urat o molecul de ADN, aproape 200 de Fibra 30 nm
perechi de nucleotiode (2 spire). Legtura de cromatin
(basic fier)
dintre doi nucleozomi alturai se realizeaz
cu ajutorul a dou molecule de ADN-linker
(circa 70 de perechi de nucleotide fiecare), Regiune
necondensat 300 nm
ntre care se afl o molecul de protein his- a cromozomului
tonic de tip H1. Prin niruirea nucleo-
zomilor, se formeaz fibrila de cromatin, cu
un diametru de 11 nm. Fibrila de cromatin,
avnd 11 nm diametru, formeaz o struc- Regiuni 700 nm
condensate
tur n form de spiral care nainteaz ale cromozomului
(solenoid), avnd 6 nucleozomi pe spira
complet i un diametru de 30 nm (fig. 29).
Cromozom 1400 nm
Prin acest proces de condensare se formea- metafazic
z\ fibra de cromatin cu diametrul de
30 nm, caracteristic nucleului interfazic.
Un alt model de organizare a fibrei de Fig. 30. Formarea fibrei de cromatin prin rsu-
cromatin consider c, prin rsucirea a cirea a dou fibrile fundamentale

29
pag.001-050.qxd 8/1/2008 3:24 PM Page 30

Cyan Yellow Magenta Black pag 30

Partea I
Ultimul model explic existena tipului de
Telomeri
mutaii subcromatidale, mecanisme pentru
inducerea unui tip de poliploidie (pseudo- Heterocromatin\
poliploidia la genul Thyanta), existena mai
multor gene plasate n acelai locus (fiind
vorba de gene plasate pe cele dou fibrile
fundamentale alturate).
n nucleul interfazic, se observ regiuni Centromer
avnd coloraie diferit, luminoas sau
ntunecat. Regiunile n care cromatina
prezint o coloraie luminoas constituie Eucromatin\

eucromatina. Ele conin ADN nerepetitiv


(aflat ntr-o singur copie), genetic activ. n
regiunile cu o coloraie ntunecat, se afl Fig. 32. Structura unui cromozom metafazic
heterocromatina. Ele conin secvene repe-
titive, segmente non-informaionale sau
gene inactive metabolic (fig. 31). este alctuit din dou cromatide, unite prin-
La nceputul diviziunii celulare, conden- tr-un centromer, aflat n regiunea unei con-
sarea continu prin diferite mecanisme, stricii (constricia sau strangulaia primar).
conducnd la formarea cromozomilor La suprafaa centromerului se afl kineto-
metafazici (fig. 30). La nivelul acestora, corul (alctuit din ADN i proteine), locul
materialul genetic este condensat de circa unde fibrele fusului de diviziune se prind de
9 000 de ori, fiecare cromatid avnd un cromozom. Centromerii sunt importani n
diametru de 700 nm. Scopul acestei con- repartizarea egal a cromozomilor monocro-
densri l constituie necesitatea repartizrii matidici la cele dou celule fiice.
n mod egal, la cele dou celule fiice, a Telomerii sunt regiunile de ADN situa-
materialului genetic din celula eucariot, n te la capetele cromozomului de la eucari-
urma diviziunii celulare. ote, prezena lor fiind necesar pentru
2. Structura cromozomului metafazic replicaia i stabilitatea cromozomului.
Caracteristicile cromozomilor la eucari- Fiecare cromozom de la eucariote pre-
ote sunt analizate n metafaz, etap a divizi- zint pe lungimea lui mai muli repliconi.
unii celulare, cnd acetia sunt puternic Unii cromozomi pot prezenta pe unul din
condensai (fig. 32). Un cromozom metafazic brae o constricie suplimentar (constricia
secundar), urmat de o regiune heterocro-
matic denumit satelit. Prin coloraii speci-
fice, pot fi evideniate regiuni avnd conden-
sare diferit a fibrei de cromatin (regiuni cu
eucromatin i regiuni cu heterocromatin)
pe lungimea cromozomilor. Prin aceast
tehnic se produce bandarea cromozomilor,
cu rol n identificarea cromozomilor i a
mutaiilor cromozomiale. Numrul de cro-
Fig. 31. Nucleu interfazic cu regiuni de eucromatin\ mozomi i mrimea lor, poziia cen-
(culoare deschis\) [i de heterocromatin\ (culoare tromerului i prezena sateliilor, precum i
`nchis\) a benzilor situate de-a lungul cromozomilor

30
pag.001-050.qxd 8/1/2008 3:24 PM Page 31

Cyan Yellow Magenta Black pag 31

Capitolul 3
sunt caracteristice unei specii date, servind i sintez proteic proprie. Cromozomul
la caracterizarea i identificarea acesteia. mitocondrial sau cel plastidic este reprezen-
Tehnici recente permit colorarea difereni- tat printr-o molecul de ADN bicatenar, cu
at a fiecrei perechi de cromozomi. structur circular deschis sau circular
3. Materialul genetic extranuclear nchis. n cazul unei structuri circular des-
Organitele celulare de tipul mitocondriilor chise, una din catenele de ADN este ntre-
i cloroplastelor prezint ADN propriu (denu- rupt, fenomen ntlnit la ADN-mt. n acest
mit ADN-mt, respectiv ADN-cp), ribozomi caz, n mitocondrie se pot afla plasmide.

3. *Genomica
Genomica: obiect de studiu, ramuri
Genomica este un domeniu al geneticii proteinelor (aspect studiat de proteomic).
care se ocup cu studiul genomului, folo- n termeni generali, genomica structural
sind secvene mari de ADN, analiza expre- studiaz cartarea i secvenarea genomu-
siei genelor sau metode computaionale. lui unui individ.
Ea s-a dezvoltat dup anul 1980, exploatnd 2. Genomica funcional studiaz expre-
automat tehnicile i sistemele bazate pe sia genelor i modul n care acestea i
computer, pentru a colecta i analiza o uria- desfoar activitatea. Aceast abordare
cantitate de informaii despre secven- extrem de complex implic analiza tran-
ele de nucleotide i de aminoacizi de la scripiei seturilor de gene (aspect studiat
diferite organisme, cercetri generate de de transcriptomic), pentru a se stabili mo-
realizarea proiectului Genomul uman. dul n care expresia genelor este controlat
Genomul constituie setul complet de gene
al unui organism sau secvena complet de
Metabolism
nucleotide din molecula de ADN. Totui, cu 19,6% Procese celulare
Transcripie i 1,3%
ajutorul tehnicilor actuale nu este nc posibil translaie 19,1%
ca fiecare gen s fie identificat precis, pe Proteine
multi-
baza secvenei de nucleotide. Realizarea funcionale
proiectului Genomul uman (2001) a permis 2,3%
clasificarea genelor umane dup funcia lor Semna- Replicaia
(fig. 33). Mai mult de 40% din gene sunt lizare i modifi-
intra- carea
implicate n procesele celulare fundamentale, ADN 5,2%
celular
transcripie, translaie i metabolism. 11,0%
Plierea i
Genomica prezint mai multe ramuri Funcii degradarea
distincte, ns parial suprapuse. diferite 9,8% proteinelor
5,2%
1. Genomica structural studiaz car- Citoschelet i alte
tarea genomului n scopul de a obine n Comunicare
Transport
structuri 5,2%
intercelular
final secvena complet a ADN-ului unui 7,5%
6,9% Aprare i imunitate
6,4%
organism particular. Aceast activitate pre-
supune determinarea structurii molecu- Fig. 33. Clasificarea genelor umane dup func-
lare tridimensionale a acizilor nucleici i a ia lor

31
pag.001-050.qxd 8/1/2008 3:24 PM Page 32

Cyan Yellow Magenta Black pag 32

Partea I
i integrat, precum i modul n care se (vezi proteom). Aceast ramur a tiinei
produce schimbarea funciei genei n s-a dezvoltat i extins rapid, avnd o sem-
diferite condiii (n strile de boal .a.). n nificaie fundamental n multe ramuri ale
principiu, genomica funcional folosete biologiei i medicinei. Obiectivele proteo-
secvena de nucleotide din ADN i alte me- micii sunt multiple: determinarea tipului de
tode, pentru a studia expresia coordonat a proteine sintetizate de o celul, modul n
mai multor gene care acioneaz simultan. care acestea sunt sintetizate i n ce canti-
3. Genomica comparativ identific re- tate, modul cum funcioneaz diferitele pro-
giunile cu secven similar din geno- teine, unde funcioneaz i interaciunea lor
murile diferitelor specii. Ea analizeaz ase- cu alte componente celulare, inclusiv cu alte
mnrile i deosebirile existente ntre dife- proteine. Mai mult, proteomica ncearc s
rite genomuri, activitate care permite stabi- descopere factorii interni i externi care
lirea relaiilor evolutive existente ntre dife- influeneaz proteomul, de exemplu n tim-
rite grupe de organisme. Cunoaterea pul dezvoltrii, mbolnvirii i mbtrnirii
semnificaiei funcionale a unei secvene organismului (vezi transcriptomica).
particulare de ADN la o specie permite sta- Mrimea comparativ a genomului i
bilirea funciei unor secvene nrudite de proteomului la diferite organisme este pre-
nucleotide de la alte specii. n plus, anu- zentat n tabelul 6.
mite comparaii permit stabilirea unor Proteomul este setul complet de pro-
aprecieri asupra mecanismelor evoluiei teine codificat de un genom sau produse
genelor i ofer nelegere asupra relaiilor de o celul sau esut. El corespunde la mo-
evoluioniste ntre diferitele organisme leculele de ARN-m din transcriptom, dei
(vezi bioinformatica, metabolomica). pot exista diferene de detaliu, care reflec-
Apariia i dezvoltarea genomicii a con- t diferenele n abundena relativ sau sta-
dus la apariia i dezvoltarea unor direcii bilitatea ARN-m sau a proteinelor.
noi ale geneticii. 2. Metabolomica studiaz modul prin
1. Proteomica studiaz proteinele sinteti- care un grup de metabolii nrudii (meta-
zate ntr-o celul sau organism particular bolom) din celule se schimb n diferite

Tabelul 6. Mrimea genomului i proteomului la diferite organisme


Numrul
Mrimea Numrul
Denumirea de proteine Familii
Organism genomului estimativ
uzual\ distincte de proteine
(x 106 p.b.) de gene
n proteom
Haemophilus Virusul
4,6 1 700 1 400 ?
influenzae gripei
Saccharomyces Drojdia
13 6 150 4 400
cerevisiae de bere
Caenorhabdites 3 000
Nematod 100 18 250 9 500
elegans
5 000
Drosophila Musculia
120 13 350 8 000
melanogaster de oet
7 000
Homo
Om 3 200 32 000 10 000
sapiens

32
pag.001-050.qxd 8/1/2008 3:24 PM Page 33

Cyan Yellow Magenta Black pag 33

Capitolul 3

Gene paraloage

(B) Gena n specia (C) Duplicaia genei (D) Divergen n secven


descendent 1 i funcie

(A) Gena n
ancester
comun
Gene ortoloage Gene ortoloage
Gene paraloage

Gena n spe-
cia descen-
dent 2

Fig. 34. Relaiile existente ntre genele unor specii diferite: gene omoloage, ortoloage i paraloage

condiii fiziologice, n timpul dezvoltrii sau stilul i modul de via. De asemenea, com-
ca rspuns la modificri genetice (mutaii). paraia stabilit ntre genomurile diferitelor
Metabolomul reprezint ntregul com- specii ofer informaii asupra unor posibile
plement de metabolii existeni ntr-o celul relaii evoluioniste ntre ele (fig. 34).
n diferite condiii (de exemplu, ntr-o stare Protoctistele sunt organisme unicelulare
fiziologic particular sau ntr-un anumit sta- sau multicelulare, care posed nucleu i nu
diu de dezvoltare). Metabolomul este deter- pot fi clasificate ca animale, plante sau fungi.
minat folosind metode de spectrofotometrie. 4. Transcriptomica studiaza transcriptul
3. Bioinformatica se ocup cu nregis- ARN al unei gene sau organism (respectiv
trarea, pstrarea i analiza secvenei pro- transcriptomii). Transcriptomica este impli-
teinelor i a ADN, folosind sisteme compu- cat n determinarea modului n care tran-
terizate. Multe din informaiile rezultate din scriptomii (moleculele de ARN) i astfel mo-
studiile privind proiectele de secvenare a delul expresiei genei se schimb datorit
genomului i proteinelor sunt pstrate n aciunii unor factori variai: tipul de esut, sta-
diferite bnci de date, fiind disponibile diul de dezvoltare, hormoni, droguri sau boli.
cercetrii, prin intermediul internetului. Ea completeaz i se suprapune cu proteomica.
Multe programe de computer au fost dez- Transcriptomul este ntregul comple-
voltate, pentru a analiza secvena (succe- ment al ARN al unei gene, celule sau orga-
siunea) nucleotidelor i/sau ale aminoa- nism, iar dup ali autori, transcriptomul
cizilor, fiind posibil s fie identificate simi- reprezint setul complet de gene exprimate
lariti ntre secvenele stabilite recent la n condiii particulare. El este deci repre-
diferite organisme i secvenele existente.
zentat prin setul de molecule de ARN care
Aceasta permite, de exemplu, emiterea
sunt prezente, ntr-un singur tip de celul,
unor ipoteze privind structura i funcia
ntr-un esut sau ntr-un organism. Tran-
unei proteine, pornind de la secvena sa de
scriptomii includ att moleculele de
aminoacizi, sau de la secvena de nucleotide
ARN-mesager, ct i moleculele de ARN-
a genei sale. Analiza secvenei genomului
transcript, posed un anumit rol metabolic
organismelor nou descoperite, n special
i/sau fiziologic, nefiind implicate n sin-
bacterii i protoctiste, indic modul n care
sunt sintetizate proteinele i n acest fel, teza de proteine. Astfel, n locusul Xq13 de

33
pag.001-050.qxd 8/1/2008 3:24 PM Page 34

Cyan Yellow Magenta Black pag 34

Partea I
pe cromozomul uman X, se afl gena X-IST. Transcriptul este o caten de ARN pro-
ARN-transcript este implicat n heterocro- dus de o molecul ADN matri (templat)
matinizarea unei bune pri din cromo- i care posed o secven de nucleotide
zomul X la organismul femeie. complementar cu acesta.

4. Metode i tehnici utilizate n genomica structural


Conform conceptelor recente (decem- Harta genetic circular a microorganis-
brie 2006), domeniul de investigaie al melor, ataarea ribozomilor la molecula de
tiinei genomica structural implic deter- ARN-m, replicaia moleculei de ADN .a.
minarea structurii tridimensionale a tutu- au fost stabilite cu ajutorul microscopiei
ror proteinelor i a moleculelor de ARN, electronice.
codificate de secvena genomic a unui Electroforeza este o tehnic ce permite
organism viu. Stabilind structura acestor separarea moleculelor dup forma, ncr-
molecule, se poate stabili rolul lor n pro- ctura electric i masa lor molecular,
cesele biologice complexe. n realizarea ntr-un cmp electric, de obicei pe un su-
acestui deziderat, sunt utilizate diferite me- port solid sau semisolid (hrtie sau aga-
tode experimentale: microscopia electro- roz). Diferenele nregistrate n mobili-
nic, electroforeza, difracia cu raze X, cro- tatea proteinelor pot fi determinate chiar
matografia, utilizarea de tehnici de dena- de existena unui singur aminoacid diferit
turare-renaturare a ADN, utilizarea enzi- n molecula a dou proteine nrudite.
melor de restricie, cristalografia cu raze X, Astfel, hemoglobina normal i hemoglobi-
spectroscopia RMN sau metode com- na de tip S difer ntre ele printr-un singur
putaionale, ca modelarea homeoloag. aminoacid n poziia 6 a catenei . Aceast
Microscopia electronic este capabil diferen induce o diferen structural
s stabileasc ultrastructura organitelor ce- ntre celor dou proteine, care migreaz cu
lulare, a virusurilor i moleculelor (fig. 35). viteze diferite ntr-un cmp electric. n pre-
zent, electroforeza este utilizat pentru
realizarea unor aplicaii multiple n analiza
ADN i a proteinelor. Secvenarea mole-
culei de ADN utiliznd electroforeza n gel
de poliacrilamid sau n gel de agaroz este
utilizat pentru a izola i estima mrimea
fragmentelor de ADN, pentru a diferenia
izoenzimele (proteine avnd aceleai pro-
prieti enzimatice ns care prezint dife-
rene n structura lor primar).
Difracia cu raze X a fost esenial pentru
elucidarea structurii tridimensionale a aci-
zilor nucleici (ADN i ARN) i a proteinelor
(mioglobina, capsomerele virale, enzimele).
Fig. 35. Aspect electronomicroscopic al unui
cromozom anafazic. Sunt vizibile numeroase
Aceast tehnic a fost extins pentru a de-
bucle de cromatin de 30 nm la periferie. termina caracteristicile moleculelor.

34
pag.001-050.qxd 8/1/2008 3:24 PM Page 35

Cyan Yellow Magenta Black pag 35

Capitolul 3
La mijlocul secolului al XX-lea, au fost
dezvoltate diferite tehnici de cromatogra-
fie. Erwin Chargaff, utiliznd cromatogra-
fia pe hrtie, a determinat compoziia
acizilor nucleici provenii de la diferite sur-
se. El a stabilit existena unor raporturi
echivalente ntre adenin i timin, pe de o
parte, i guanin i citozin, pe de alt par-
te. Aceast constatare a fost esenial pen-
tru stabilirea structurii spaiale a moleculei
de ADN de ctre Watson, Crick i Willkins.
Hibridizarea moleculelor de acizi nucle-
ici a fost realizat prin aplicarea tehnicii de
denaturare-renaturare a ADN. Cu ajutorul
metodei a fost stabilit procentul de com-
plementaritate al nucleotidelor unor mole-
Fig. 36. Aspectul unor hibrizi ADN/ARN-m de
cule de ADN de provenien diferit, sunt
la ciuperci. Hibrizii au fost obinui cu secvene
analizate procesele evolutive, s-au obinut specifice.
hibrizi moleculari tip ADN/ARN sau
ADN/ADN (cele dou catene provenind este tiat la locusuri specifice, ligazele
de la surse diferite)(fig. 36) .a. leag fragmentele de acid nucleic .a.
Analiza enzimatic const n utilizarea Modelarea homeoloag este o metod
enzimelor materialului genetic, precum i computaional utilizat pentru determi-
n alte procese metabolice. Dependent de narea structurii unei proteine, bazat pe
tipul de reacii catalizate, enzimele sunt similaritile acesteia cu o structur cunos-
grupate n ase categorii principale: oxi- cut. Acurateea structurii determinate prin
doreductaze, transferaze, hidrolaze, liaze, modelare homeoloag este dependent n
izomeraze i ligaze. Utilizarea enzimelor mare msur de cantitatea de homeologie
permite studiul complex al moleculelor de ntre secvena proteinei necunoscute i
acid nucleic, obinerea de ADN-recombi- secvena proteinei cunoscute. Ea constituie
nant i implicit de organisme transgenice metoda optim n stabilirea structurii pro-
.a. Astfel, cu ajutorul enzimelor de res- teinei pornind de la secvena sa, fiind ns
tricie (enzime hidrolitice) molecula de ADN posibil mbuntirea metodei.

5. Tehnica PCR, importan


Tehnica PCR (Polymerase Chain (cteva zeci de minute), o molecul de
Reaction = reacia de polimerizare nlnu- ADN poate fi amplificat ntr-un numr de
it [n lan] = reacia de amplificare polime- pn la un milion de exemplare, tehnica
razic) a fost introdus de ctre Kary B. este utilizat pentru amplificarea materia-
Mullis (Premiul Nobel pentru chimie, n lului genetic n diferite investigaii de gene-
anul 1993, mpreun cu Michael Smith). tic molecular, precum i n investigaiile
Deoarece ntr-un interval scurt de timp de criminalistic (DNA fingerprinting,

35
pag.001-050.qxd 8/1/2008 3:24 PM Page 36

Cyan Yellow Magenta Black pag 36

Partea I

(A) Primul ciclu Secvena ADN care


cantitate suficient de nucleo-
va fi amplificat tide libere.
Denaturare, complementarizare Procesul de amplificare par-
curge mai multe cicluri, fiecare
Oligonucleotide
primeri
alctuit din trei etape. n plus, la
Replicarea ADN nceputul reaciei are loc o de-
naturare complet a moleculei
(B) Al doilea ciclu de ADN de interes, iar la sfrit
o etap de extensie final.
Este necesar utilizarea en-
zimei Taq-polimeraza care ac-
ioneaz la temperaturi nalte,
deoarece denaturarea mole-
culei de ADN are loc prin n-
(C) 20-30 Amplificarea clzirea acesteia la circa 95C,
cicluri secvenelor ADN
iar extensia are loc 7075C.
Desfurarea procesului de
amplificare este prezentat n
figura 37.
n cadrul primului ciclu (A),
secvena care va fi amplificat
este denaturat termic (ncl-
Fig. 37. Utilizarea tehnicii PCR pentru amplificarea unei
zire la 95C), rezultnd ADN
secvene particulare de ADN.
monocatenar, la care este cu-
respectiv amprenta ADN) i detectarea noscut secvena de nucleotide de la ca-
microsateliilor ADN. petele moleculei. Sunt sintetizate dou
Tehnica utilizeaz ADN-polimeraza i o oligonucleotide (avnd o lungime de circa
pereche scurt de oligonucleotide sintetice 20 de nucleotide), care posed o secven
(avnd pn la 20 de nucleotide), ce pre- complementar de nucleotide cu ale mole-
zint secvena complementar cu secvena culelor de ADN monocatenar. Acestea vor
de nucleotide de la capetele moleculei de servi ca primer-ADN pentru iniierea sin-
ADN care va fi amplificat. Acestea vor tezei catenelor complementare, sub aci-
servi ca primeri pentru elongarea catenei. unea Taq-polimerazei. Se vor forma cate-
Pentru realizarea procesului de amplifi- nele complementare, rezultnd dou mole-
care este nevoie de cel puin o molecul cule de ADN bicatenar, identic cu molecu-
din fragmentul de ADN care va fi amplifi- la iniial. Acest ciclu se repet de n ori,
cat, dou seturi de oligonucleotide care proces care conduce la multiplicarea expo-
conin secvena complementar a capetelor nenial a moleculei de ADN de interes (B
celor dou catene ale moleculei de ADN i C). Astfel, dac se ncepe cu o singur
care va fi amplificat, enzima Taq-polime- molecul de ADN, dup 25 de cicluri de
raza (o ADN-polimeraz provenit de la replicare repetat a acestuia vor rezulta
bacteria Thermus aquaticus, ntlnit n 225 = 3,4 107 molecule. Acest numr de
izvoarele fierbini din Yellowstone National exemplare al fragmentului amplificat este
Park, Wyoming, SUA), capabil s acio- incomparabil mai mare dect numrul unei
neze la temperaturi ridicate, precum i o alte molecule neamplificate, existente n

36
pag.001-050.qxd 8/1/2008 3:24 PM Page 37

Cyan Yellow Magenta Black pag 37

Capitolul 3
mixtura iniial. n acest fel, ADN amplifi- de ori. Ele sunt rspndite relativ uniform
cat poate fi utilizat fr o purificare ulterioa- de-a lungul genomului la un mare numr
r. Un alt exemplu: un singur fragment de de specii. Sunt utilizai ca markeri genetici,
3 000 de perechi de nucleotide la bacteria fiind uor de detectat prin tehnica PCR.
E. coli reprezint circa 0,06% din ADN-ul *DNA fingerprinting (genetic fingerprint-
bacteriei. Dac acest fragment este replicat ing ), amprenta ADN, este o tehnic prin care
de-a lungul a 25 de cicluri de replicare, sec- ADN-ul unui individ este analizat, pentru a se
vena amplificat va reprezenta 99,995%. stabili modul n care se repet o scurt sec-
ven de nucleotide (variable number tan-
Importana tehnicii PCR dem repeats = numr variabil repetat n tan-
Metoda PCR este aplicat la studiul dem) n genom. Obinerea unei cantiti su-
ADN de provenien diferit: genomic, ficiente de molecule ADN pornind de la o
mitocondrial, plastidic, exogen (n special mostr biologic mic (esut, snge, pr) este
viral), precum i la studiul moleculelor de posibil prin utilizarea tehnicii PCR. Tehnica
ARN-m. n acest caz, este necesar ca pe este utilizat n criminalistic, la stabilirea
baza informaiei din molecula de ARN-m, paternitii i n medicina veterinar (fig. 38).
s se obin o molecul de ADN-comple- Fingerprinting (amprenta minii) n
mentar, prin utilizarea revers-transcrip- electroforeza bidimensional n gel de poli-
tazelor (enzime care conduc la sinteza unei acrilamid prezint aspectul unei proteine
catene ADN pe baza informaiei genetice hidrolizate enzimatic.
dintr-o caten complementar de ARN). Au
fost elaborate numeroase variante ale
tehnicii PCR, care sunt utilizate n analiza
genetic, studii de evoluionism, diagnos-
ticul molecular al bolilor genetice, detecia
direct a mutaiilor, diagnosticul indirect
prin polimorfismul RFLP sau al markerilor
minisatelitici.
*Polimorfismul RFLP (restriction lengths
polymorphism = polimorfismul lungimii
fragmentelor de restricie) este o metod
care permite compararea unor secvene
polinucleotidice (eventual alele), pe baza
diferenelor nregistrate la nivelul profilu-
lui de hidroliz cu enzime de restricie, ca
urmare a producerii unor mutaii. Reflect
direct variaii ale secvenei de nucleotide
din molecula de ADN (modificri n struc-
tura sa primar).
*Microsateliii sunt secvene de ADN
de lungimi variabile, compuse din uniti
Fig. 38. Utilizarea tehnicii ADN fingerprinting
repetitive de di-, tri- i tetranucleotide. De
(amprenta ADN) n criminalistic. Compararea
exemplu: (CA)n, (CCA)n sau (CTCA)n. unei amprente de la o pictur de snge
ntr-o molecul de ADN, aceste grupe de descoperit la locul crimei, cu mostrele de
nucleotide se repet de un numr variabil snge provenite de la apte suspeci 17.

37
pag.001-050.qxd 8/1/2008 3:24 PM Page 38

Cyan Yellow Magenta Black pag 38

4
Capitolul

*Reglajul genetic
la procariote

n celula bacterian exist circa teia. S-au emis mai multe ipoteze care explic
2 0003 000 de gene care funcioneaz dis- mecanismul prin care o celul bacterian i
continuu, dependent de necesitile aces- regleaz activitile metabolice de sintez.

1. Teoria operonului. Represia enzimatic


Teoria operonului a fost elaborat n Situsul atenuator este un locus situat
anul 1961 de ctre F. Jacob i J.L. Monod, naintea primei gene structurale, care are
pe baza cercetrilor lui A. Lwff (Premiul rolul de a accelera sau ncetini procesul de
Nobel pentru medicin i fiziologie n anul sintez al moleculei de ARN mesager.
1965; fig. 39). Conform acestei teorii, la Locusul operator este un situs din mo-
bacterii exist urmtoarele gene i locusuri lecula de ADN, situat naintea situsului
(regiuni din molecula de ADN), implicate atenuator, la nivelul cruia acioneaz pro-
n sinteza proteic i n reglajul ei genetic. teina represor (sintetizat de gena regla-
Genele structurale sunt secvene de toare), pentru a bloca procesul de tran-
nucleotide dintr-o unitate de transcripie a scripie.
moleculei de ADN, care conin informaia Locusul promotor este situsul de pe
genetic pentru sinteza unei catene poli- molecula de ADN situat naintea operatoru-
peptidice. Unitatea de transcripie este o lui, unde se ataeaz enzima ARN-polime-
regiune a moleculei de ADN care servete raz pentru a iniia procesul de transcripie.
ca matri pentru sinteza unei molecule de Genele structurale, atenuatorul, opera-
ARN mesager. La procariote, ntr-o unitate torul i promotorul alctuiesc o unitate de
de transcripie se afl mai multe gene operare numit operon. n secvena de
structurale. ntre dou uniti de transcrip- nucleotide din molecula de ARN mesager,
ie alturate se afl secvene non-infor- va fi copiat numai informaia genetic
maionale de nucleotide (secvene repeti- cuprins n genele structurale din operon
tive). Primul codon din unitatea de tran- (fig. 39, A).
scripie n molecula de ADN va fi un codon Genele reglatoare regleaz activitatea
de iniiere (de exemplu, codonul TAC), iar genelor structurale din operon, prin inter-
ultimul codon va fi un codon tip stop (de mediul unui semnal chimic numit represor
exemplu, codonul ACT). (de obicei o molecul proteic). n celulele
38
pag.001-050.qxd 8/1/2008 3:24 PM Page 39

Cyan Yellow Magenta Black pag 39

Capitolul 4
Promotor Operator Gene structurale
Gena represor

{
A i p o z y a

B i p z y a

Represor legat la operator;


este blocat\ transcrip]ia
ARN-m genelor z, y [i a.

Represor

C i p o z y a

ARN-m lac
ARN-m

-Galactozidaza
Permeaza
Transacetilaza
Inductor
Complex inductor-represor care
nu blocheaz\ operatorul

Fig. 39. Reglajul genetic al sintezei proteice la procariote. Teoria operonului.


A componentele operonului lac de la Escherichia coli;
B n absena lactozei, represorul blocheaz situsul operator;
C n prezena lactozei, este declanat activitatea genelor din operon i are loc sinteza proteic.

situate n repaus sintetic, operonul este sintezei proteice (co-represor), precum i


cuplat la situsul operator, blocnd sinteza diferite sisteme enzimatice.
proteic, prin blocarea procesului de tran- Declanarea sintezei proteice. Declan-
scripie. area sintezei proteice (fig. 39, C), este pre-
Proteina represor (represorul) este o cedat de ptrunderea n celul i mrirea
protein reglatoare sintetizat de o gen cantitii de substan care trebuie meta-
reglatoare; este o protein alosteric, adic bolizat, respectiv de inductor. Atunci cnd
i poate schimba structura prin cuplarea concentraia inductorului depete o anu-
sa cu molecule mici, devenind activ sau mit limit, acesta se combin cu proteina
inactiv. Ea se poate cupla la un situs ope- represor pe care o inactiveaz. Locusul ope-
rator de pe molecula de ADN i va bloca ratorul fiind liber, enzima ARN-polimeraza
transcripia. acioneaz asupra promotorului, declan-
n cadrul sintezei proteice sunt impli- nd procesul de transcripie. n urma
cate, de asemenea, substana care trebuie acestui proces are loc sinteza unei mole-
metabolizat (inductor), produsul final al cule de ARN-m care copiaz informaia

39
pag.001-050.qxd 8/1/2008 3:24 PM Page 40

Cyan Yellow Magenta Black pag 40

Partea I
genelor structurale din operon. Urmeaz devine liber. Represorul liber se cupleaz
procesul de translaie care va conduce la cu produsul final al sintezei proteice (denu-
sinteza enzimelor corespunztoare. Aces- mit astfel, co-represor), devenind represor
tea acioneaz pe rnd asupra produsului activ. Acesta se va cupla la situsul operator
iniial, determinnd metabolizarea (trans- pe care l inactiveaz, inactivnd ntreaga
formarea) sa n produs final, prin mai cale metabolic (fig. 39, B). Procesul de
multe stadii intermediare. Procesul are loc, sintez se va relua atunci cnd n celul va
pn cnd n celul va scdea cantitatea de scdea cantitatea de produs final i va
produs iniial (inductor) i va crete canti- crete cantitatea de produs iniial care tre-
tatea de produs final (co-represor). buie metabolizat (inductor).
Sistarea sintezei proteice. n urma sin- Procesul de reglaj al sintezei proteice
tezei proteice, n celul scade cantitatea de dup acest mecanism poart numele de
inductor i crete cantitatea de produs final represie enzimatic. n acest proces, pro-
(co-represor). Atunci cnd cantitatea de dusul final al sintezei proteice regleaz pro-
produs iniial scade sub o anumit limit, pria sintez, prin cuplarea sa cu represorul
acesta se desprinde de pe represor, care i inactivarea situsului operator.

2. Reglajul sintezei proteice prin retroinhibiie


(feedback). Retroinhibiia enzimatic
Reglajul genetic al sintezei proteice Metabolizarea (transformarea) treoni-
dup teoria operonului a fost demonstrat nei n izoleucin are loc sub aciunea a
experimental n numeroase cazuri. Anali- cinci enzime diferite (E1E5), a cror sin-
znd ns numrul de gene dintr-o bacterie tez are loc prin activitatea a cinci gene
i numrul de substane implicate n sin- structurale (GS1GS5). Acest proces este
teza proteic, s-a ajuns la concluzia c acest reglat, la diferite specii de bacterii, prin
tip de reglaj nu poate explica activitatea tu- cele dou tipuri de reglaj genetic, respectiv
turor genelor, fiind necesar un numr prea prin represia enzimatic (conform teoriei
mare de gene i substane fa de volumul operonului) sau retroinhibiia enzimatic
mic al unei bacterii. De aceea s-a emis (conform teoriei feedback).
ipoteza existenei, n paralel, a unui alt tip n cazul represiei enzimatice (fig. 40,
de reglaj mai simplu, care s implice un partea de jos a figurii), izoleucina acumu-
numr mai mic de substane i gene. Con- lat n cantitate mare n celul cupleaz cu
form reglajului genetic prin retroinhibiie represorul, l activeaz i blocheaz astfel
(feedback), produsul final al sintezei prote- mpreun activitatea situsului operator.
ice, ajuns la o anumit concentraie, va Procesul de transformare a treoninei n
bloca propria sa sintez, prin cuplarea sa izoleucin se va relua atunci cnd n celul
cu una din primele enzime ale cii metabo- va scdea cantitatea de izoleucin i va
lice pe care o inactiveaz. Procesul de sin- crete cantitatea de inductor (treonin).
tez se va relua la scderea concentraiei n cazul retroinhibiiei enzimatice, izo-
de produs final din celul (fig. 40). leucina acumulat n cantitate mare se

40
pag.001-050.qxd 8/1/2008 3:24 PM Page 41

Cyan Yellow Magenta Black pag 41

Capitolul 4
cupleaz cu prima enzim a cii metabolice cantitatea de izoleucin. Aceasta se decu-
(treonin-dezaminaz) pe care o inactiveaz, pleaz de pe prima enzim care devine
blocnd astfel ntreaga cale metabolic iari activ i va aciona asupra treoninei
(fig. 40, partea de sus a figurii). Procesul provocnd dezaminarea acesteia, urmat
de transformare a treoninei n izoleucin de metabolizarea ei integral n izoleucin.
se va relua atunci cnd n celul va scdea

Fig. 40. Reglajul genetic prin retroinhibiie (feedback) la metabolizarea


treoninei.

TEST DE EVALUARE
1. Care sunt genele i locusurile impli- 3. n ce const reglajul genetic prin
cate n sinteza proteic i n reglajul gene- retroinhibiie (feedback)?
tic al acesteia? 4. n ce condiii se va relua procesul de
2. Precizai etapele declanrii sintezei transformare a treoninei n izoleucin (n
proteice. cazul represiei enzimatice)?

41
pag.001-050.qxd 8/1/2008 3:24 PM Page 42

Cyan Yellow Magenta Black pag 42

5
Capitolul

Reglajul genetic
la eucariote

Toate celulele somatice ale unui orga- care conduce la specializarea structural i
nism eucariot pluricelular conin acelai funcional a celulelor i esuturilor, proces
numr de cromozomi, respectiv aceeai n urma cruia n fiecare tip de esut sunt
cantitate de ADN. Cu toate acestea, n fie- active numai anumite ci metabolice, dei
care tip de esut sau celul, sunt active nu- celula posed ntreaga cantitate de infor-
mai anumite gene (respectiv anumite ci maie genetic. Acesta este reglajul genetic
metabolice), n urma diferenierii struc- pe termen lung, care n condiii normale
turale i specializrii funcionale a celulelor este stabil unui anumit organism.
i esuturilor. n acelai timp, activitatea n acelai timp, exist un reglaj genetic
genelor nu are loc tot timpul ntr-un anumit pe termen scurt, datorat faptului c sinteza
esut sau celul, ci numai atunci cnd este unui anumit produs nu are loc permanent
nevoie de sinteza unei anumite substane. (cu excepia glandelor endocrine, ns i n
Reglajul genetic la eucariote este astfel acest caz, secreia prezint diferite valori,
mult mai complex i se realizeaz prin dife- dependent de starea metabolic a organis-
rite mecanisme. n aceste condiii, n cazul mului), ci numai atunci cnd celula, res-
organismelor eucariote pluricelulare, se pectiv esutul sau organismul au nevoie de
poate face distincia ntre un reglaj genetic un anumit metabolit.

1. Reglajul genetic pe termen lung


Reglajul genetic la nivelul fibrelor de cromatin; diferenierea
i specializarea celulelor i esuturilor
Acest tip de reglaj genetic se realizeaz toate celulele somatice ale unui organism
n cursul dezvoltrii embrionare la eucari- conin aceeai cantitate de ADN, respectiv
ote, fiind implicat n diferenierea i spe- aceleai gene, n anumite celule sunt active
cializarea structural i funcional a numai anumite gene, respectiv anumite ci
celulelor i esuturilor unui organism metabolice. Aceast specializare structu-
pluricelular. n urma acestui proces, dei ral i funcional a celulelor i esuturilor

42
pag.001-050.qxd 8/1/2008 3:24 PM Page 43

Cyan Yellow Magenta Black pag 43

Capitolul 5
se realizeaz la nivelul fibrelor de croma- precum i ADN repetitiv, non-informaional.
tin (fig. 31). n aceste regiuni, fibrele de cromatin sunt
Genele active metabolic se afl numai puternic mpachetate, fcnd imposibil
n regiunile cu eucromatin. n aceste procesul de transcripie i formarea mo-
regiuni, fibrele de cromatin sunt relativ leculelor de ARN-m. Procesul de heterocro-
laxe, putnd fi copiat prin transcripie matinizare este determinat de absena pro-
informaia genetic de la nivelul moleculei teinelor non-histonice (care mpiedic pro-
de ADN. Structura lax a fibrelor de cro- cesul de mpachetare a fibrelor de croma-
matin este datorat prezenei, n aceste tin, deci procesul de heterocromatinizare),
regiuni, a unor proteine non-histonice spe- precum i prin metilarea bazelor azotate,
cifice care mpiedic mpachetarea fibre- care favorizeaz acelai proces. Astfel, n
lor de cromatin. n plus, n aceste regiuni regiunile cu heterocromatin, s-a constatat
nu are loc metilarea bazelor azotate. nlocuirea citozinei cu 5-metil-citozina, la
n regiunile cu heterocromatin se afl gru, mamifere .a. S-a constatat c genele
gene inactive metabolic (dar active n celu- inactive metabolic sunt puternic metilate, n
lele unor alte esuturi ale organismului), comparaie cu genele active metabolic.

Reglajul genetic prin inactivarea unor segmente de cromozomi,


a unor cromozomi sau genomuri
Reglajul genetic prin inactivarea unui Femeile nu prezint cromozomul Y, nea-
cromozom are loc la femela de mamifere vnd genele plasate pe acest cromozom i
prin inactivarea unui cromozom X (fig. 41). nici caracterele pe care acetia le deter-
Determinismul sexului la mamifere este min. Dac ar fi active toate genele de pe
de tip Drosophila, femelele sunt homozi- ambii cromozomi X, ntre cele dou sexe ar
gote avnd doi heterozomi identici, cromo- fi mari diferene datorate genelor implicate
zomii XX, pe cnd masculii sunt hetero- n metabolismul general al corpului, care
zigoi, avnd formula genetic XY. Cromo- ar fi n stare dubl la organismul femel.
zomul X este unul din cei mai vechi cro- Pentru a se stabili un echilibru ntre cele
mozomi aprui filogenetic. El este de di- dou sexe, unul din cromozomii X este
mensiuni mari, este eucromatic avnd inactivat la femeie, respectiv la femela de
numeroase gene, multe implicate n meta-
bolismul general al organismului, necesare
att la femele, ct i la masculi. Cromo-
zomul Y la mamifere este mic, heterocro-
matic, avnd puine gene implicate n
determinismul unor caractere particulare
prezente la masculi. Una din genele pre-
zente la om i plasate pe cromozomul Y
este gena responsabil pentru caracterul
hairy pinna (pr lung crescut pe ureche), Corpuscul
aspect prezent la numeroase familii din Barr
India, unde toi bieii manifest acest ca-
Fig. 41. Reglajul genetic prin inactivarea unui
racter, care nu este transmis la fete. cromozom X la femela de mamifere.

43
pag.001-050.qxd 8/1/2008 3:24 PM Page 44

Cyan Yellow Magenta Black pag 44

Partea I
mamifere n general. Inactivarea ntregului n stadiul de blastul al dezvoltrii embrio-
cromozom X are loc prin heterocroma- nare, are loc heterocromatinizarea ntregului
tinizarea acestuia. Astfel, el apare sub set de cromozomi (genom) de origine pa-
forma unei mici regiuni heterocromatice tern. Genele de pe aceti cromozomi nu
situate pe faa intern a nveliului nuclear, vor fi deci transcrise n timpul dezvoltrii
denumit corpuscul Barr (fig. 41). embrionare la mascul. n timpul meiozei,
Cercetri recente au semnalat o predis- nu are loc formarea cromozomilor biva-
poziie pentru inactivarea cromozomului X leni, diviziunea fiind de tip mitotic.
de origine patern. Pe cromozomul X n Reglaj genetic prin pierderea sau ampli-
regiunea Xq13, se afl centrul de inactivare ficarea unor segmente cromozomale. Pier-
al cromozomului X (X-IC, X inactivation derea sau amplificarea unor segmente cro-
center). La acest nivel se afl gena X-IST mozomale conduce de obicei la dezvolta-
care are o mrime de 450 kb. Gena X-IST rea unor organisme anormale. n unele ca-
codific un transcript de inactivare a cro- zuri ns, aceste fenomene constituie me-
mozomului X (X inactivation specific tran- canisme de reglaj genetic. La unele cope-
script). Aceasta este o molecula de ARN de pode (crustacee), dup primele diviziuni
17 kb, cu rol funcional, implicat n inacti- ale oului, n majoritatea celulelor are loc
varea unei mari pri din cromozomul X, o eliminarea unor segmente heterocroma-
parte din genele situate pe cromozomul X tice specifice din toi cromozomii, acestea
rmnnd n stare funcional. devenind celule somatice. Celulele n care
Reglajul genetic prin heterocroma- nu are loc eliminarea segmentelor hetero-
tinizarea ntregului genom a fost raportat cromatice vor conduce la formarea liniei
la masculii de Planococcus citri (2n = 10). germinale.

2. Reglajul genetic pe termen scurt


Reglajul genetic la nivelul transcripiei i translaiei informaiei
genetice
Prin acest tip de reglaj genetic se asi- procesul de maturare (eliminarea intro-
gur funcionarea sau nu a genelor din re- nilor i asamblarea exonilor).
giunile eucromatice ale nucleului, depen- 3. Reglajul genetic la nivelul transportului,
dent de nevoile celulei i organismului. prin care sunt selectate moleculele de ARN-m
Controlul activitii genelor, din regiunile matur care vor fi transportate prin porii
cu eucromatin de la eucariote, se asigur nveliului nuclear, din nucleu n citoplasm.
la cinci niveluri (fig. 42) i are loc sub aci- 4. Reglajul genetic la nivelul translaiei
unea mai multor enzime: informaiei genetice, prin care este declan-
1. Reglaj genetic la nivelul procesului de at sinteza proteic.
transcripie, prin care sunt selectate genele 5. Reglajul genetic post-translaional,
care vor servi ca matri la sinteza unui prin care sunt selectate catenele polipep-
ARN precursor (procesul de transcripie). tidice rezultate n urma sintezei proteice
2. Reglajul genetic la nivelul maturrii care vor fi modificate i transformate n
ARN, prin care sunt selectate moleculele proteine funcionale. De asemenea, tot la
de ARN precursor care vor parcurge acest nivel are loc degradarea ARN-m.
44
pag.001-050.qxd 8/1/2008 3:24 PM Page 45

Cyan Yellow Magenta Black pag 45

Capitolul 5

}
(nucleu) Reglajul genetic prin hormoni,
ADN
Control
la nivelul transcripiei
transcrip]ional
Hormonii sunt substane extracelulare,

}
care sunt transportate de la celulele pro-
ARN ductoare la celulele int. Muli dintre
transcris
Controlul hormonii steroizi (estrogen, progesteron,
modificare proceselor de aldosteron, glucocorticoizi, hormonii an-
transcrip]ie drogeni .a.), precum i unii hormoni din
ARN-t, ARN-r,
metabolismul bazal (insulina .a.), acio-
ARN-m neaz n mod obinuit asupra transcripiei.
Deoarece unii hormoni regleaz transcrip-
ia, ei sunt probabil un semnal pentru

} Controlul
ADN, n procesul de reglaj fiind prezent i

}
transport transportului
un receptor citoplasmic.
Hormonii steroizi (H) sunt substane
hidrofobe care trec n mod liber prin plas-
degradarea ARN-m Control malem (fig. 43). Ajuni n citoplasm, ei se
transla]ional combin cu un receptor citoplasmic speci-
lan] fic R, formnd complexul H-R. Dup for-
nucleotide polipeptidic marea acestui complex, receptorul se poate

}
(reutilizate) modifica structural, rezultnd complexul
modificare
H-R. Complexul H-R poate trece prin n-
veliul nuclear. Ajuns n nucleu, complexul
aminoacizi protein\ Control H-R sau numai hormonul (H) se ataeaz
(reutiliza]i) func]ional\ post-
transla]ional
la o anumit regiune a fibrei de cromatin i
ncepe fenomenul de transcripie. Procesul
degradare (citoplasm\) de recunoatere este probabil mediat de
proteine specifice legate de ADN (n drep-
Fig. 42. Regaljul genetic la nivelul transcripiei i tul secvenelor de iniiere a unei uniti de
translaiei informaiei genetice la eucariote. transcripie a informaiei genetice) sau
direct de molecula de ADN.
Membran celular Citoplasm Membran nuclear Nucleu ADN

Hormon mRNA
P
H H H H H
R R R
Complex
R H-R
Receptor

Posibil represor sau proteine specifice

Fig. 43. Reglajul genetic la nivelul transcripiei prin hormoni la eucariote

45
pag.001-050.qxd 8/1/2008 3:24 PM Page 46

Cyan Yellow Magenta Black pag 46

Partea I

Reglajul genetic la nivelul maturrii ARN-precursor


n celulele glandelor salivare i n hepa- exonul 4. n glanda salivar, n procesul de
tocitele de la oarece sunt produse dou maturare, pe lng introni i secvena I (eli-
molecule distincte de ARN-m, pornind de la minate n ambele organe, glanda salivar i
aceeai gen iniial, care conine infor- ficat), este eliminat i exonul L, pe cnd n
maia genetic pentru sinteza -amilazei ficat este eliminat exonul S (alturi de in-
(fig. 44). n glanda salivar se produce mai troni i secvena I). n urma procesului de
mult enzim dect n ficat, dei sunt tran- maturare, ARN-m pentru -amilaz are
scrise aceleai secvene de codoni. Mole- secvena S-E2-E3-E4 n glanda salivar i
cula de ARN precursor, sintetizat n urma secvena L-E2-E3-E4 n ficat, dei secvena
procesului de transcripie, posed aceeai regiunilor din ARN precursor a fost iden-
structur n cele dou organe. Secvenele tic n ambele organe. n acest fel, n urma
din constituia sa sunt: I (iniiator), exonul procesului de maturare al ARN-m, exonii
S, intron 1, exon L, intron I2, exon E2, S i L, devin alternativ iniiatori ai genei
intron I3, exon E3, intron I4, exon E4. ARN-m pentru sinteza -amilazei, sintetiza-
Secvena codificatoare ncepe cu 50 p.b. din t la rate diferite n cele dou organe.
exonul 2, unit cu exonul 3 (50 p.b.) i cu

Fig. 44. Reglajul genetic la nivelul maturrii ARN-mesager. Producerea de ARN-mesager pentru
-amilaz n glanda salivar i n ficat la oarece, are loc prin dou procese diferite de maturare ale
aceluiai ARN-precursor. Secvena de codare ncepe cu codonul AUG n exonul 2.

LUCRRI PRACTICE EVIDENIEREA


CROMATINEI SEXUALE LA OM
Materiale necesare: microscop de la- Sunt utilizate lamele microscopice
borator, pahare Borell sau pahare Berze- degresate, curate, umede i reci (pstrate
lius de 100 ml, cilindri gradai, lame la frigider, n alcool etilic 95, ntr-un
microscopice, alcool etilic 95, alcool etilic cristalizor sau cutie Petri), care prezint
75, alcool etilic 50, acid clorhidric 5 N, marginile lefuite. Se racleaz mucoasa
soluie cresyl-violet 1%, ap distilat. bucal, introducnd lama n cavitatea

46
pag.001-050.qxd 8/1/2008 3:24 PM Page 47

Cyan Yellow Magenta Black pag 47

Capitolul 5

bucal i fcnd o micare dinapoi-nainte ap distilat i se introduc pentru colorare


pe peretele obrazului. Se execut un n soluie cresyl-violet 1%, timp de cteva
frotiu de celule pe una-dou lame noi, minute (13 min). Se spal, se usuc si se
lsnd cteva minute pentru a se usca analizeaz la microscopul optic, pentru
frotiul. Toate operaiile urmtoare se efec- evidenierea cromatinei sexuale. Aceasta
tueaz la temperatura camerei. Lamele cu apare sub forma unui corpuscul hetero-
frotiuri se introduc prin seriile de alcool cromatic, situat de obicei pe faa intern a
etilic, fiind manipulate ncet, cu atenie: nveliului nuclear, avnd form plan-con-
alcool etilic 95 (20 min), alcool etilic 75 vex, triunghiular, alungit .a. (fig. 41).
(5 min) i alcool etilic 50 (5 min). Se Se numr corpusculii Barr din 100 de
spal rapid n ap distilat i se introduc, celule, stabilind frecvena lor. La o femeie
pentru hidroliz, ntr-o soluie HCl 5 N, normal, n celulele mucoasei bucale, frec-
unde se las 2030 min. Se spal rapid n vena corpusculilor Barr este de 2070%.

LUCRRI PRACTICE EVIDENIEREA CROMOZOMILOR


METAFAZICI I STUDIUL MORFOLOGIEI LOR

Caracteristicile morfologice ale cro- mici sticlue de antibiotice (cca 5-10 cc) n
mozomilor sunt analizate n metafaz, care vor fi efectuate tratamentele la mate-
etap n care ei sunt puternic contractai rialul biologic, lame i lamele microsco-
i condensai. n scop didactic, este de pice, pense oftalmologice i bisturie, hr-
preferat ca studiul cromozomilor meta- tie de filtru, bee de chibrituri, cilindru
fazici s fie abordat la o specie cu un nu- gradat de 100 cc, soluie colchicin 0,2%,
mr redus de cromozomi somatici, care alcool etilic, acid acetic glacial, acid
s prezinte dimensiuni mari i s fie dife- clorhidric 1 N, soluie 50% acid clorhidric
rii morfologic ntre ei. Deoarece eviden- (1/2 acid clorhidric fumans, = 1,19 +
ierea este mai facil la specii vegetale, la ap distilat), reactiv Schiff sau reactiv
care celulele n diviziune se afl la nivelul Carr.
unui esut meristematic, se va utiliza o Etapele de lucru sunt descrise mai jos.
specie vegetal, de la care se obine uor 1. Materialul biologic: esut meristema-
esut meristematic. tic (vrfuri de radicele de circa 10 mm), ca-
Materialul biologic este reprezentat re conin multe celule n diviziune mitotic.
prin rdcinie de circa 10 mm, obinute 2. Prefixarea, efectuat n scopul dis-
de la semine germinate sau bulbi de trugerii sau inactivrii fusului de diviziu-
Allium cepa (2n=16), rdcinie secundare ne, este efectuat prin introducerea se-
de la Vicia faba (2n = 12), rdcinie de la minelor germinate, n civa centimetri
semine de Nigella sativa (2n=12) .a. cubi de soluie colchicin 0,2%, timp de
Materiale: pahare Berzelius sau mici 2-3 ore, la temperatura camerei.
cristalizoare n care se vor introduce bul- 3. Fixarea are drept scop omorrea
bii de ceap pentru emiterea de rdcini celulelor i coagularea constituenilor
adventive, cutii Petri cu sugativ mbiba- celulari. Fixatorul utilizat nu trebuie
t n ap pentru germinarea seminelor, s altereze structurile celulare. Pentru

47
pag.001-050.qxd 8/1/2008 3:24 PM Page 48

Cyan Yellow Magenta Black pag 48

Partea I

executarea lor, dup ndeprtarea soluiei deasupra o lamel, iar prin bti sistema-
de colchicin, peste radicele se adaug tice cu un b de chibrit se etaleaz esutul,
civa centimetri cubi de fixator. Uzual prin mprtierea celulelor ntr-un singur
este utilizat fixatorul 3 : 1, constituit din strat. Se nltur excesul de soluie cu o
3 pri alcool etilic absolut i o parte acid hrtie de sugativ, fiind obinut astfel pre-
acetic glacial. n fixator, radicelele sunt paratul microscopic temporar, care poate fi
meninute timp de 212 ore, la 4C. analizat la microscop timp de cteva ore.
4. Hidroliza are rolul de a macera esu- Dac dorim s mrim durata de utilizare a
turile prin dizolvarea substanelor pectice unui preparat microscopic, n jurul lamelei
intercelulare, pentru a uura ptrunderea se va ntinde o pelicul de gum arabic,
colorantului i a asigura buna lor etalare. soluie de lipit cauciucul, care ntrzie cu
Dup eliminarea soluiei fixator i o cl- 1014 zile deshidratarea celulelor din pre-
tire rapid cu ap, peste rdcinie se toar- paratul semipermanent obinut.
n civa centimetri cubi HCl 1N (5 mi- La microscop se vor cuta metafazele
nute, temperatura camerei), iar dup care s aib ct mai puini cromozomi
ndeprtarea acestuia, civa centimetri suprapui (fig. 45). Se va constata c fie-
cubi de soluie 50% HCl, timp de 1020 care cromozom este alctuit din dou cro-
minute, la temperatura camerei (pn matide, unite ntr-o regiune numit cen-
cnd esutul devine moale). Dup hidro- tromer. La nivelul centromerului se afl
liz, este necesar cltirea rdcinielor strangulaia sau constricia primar. De-
timp de cteva secunde cu ap de robinet. pendent de poziia strangulaiei primare
5. Colorarea, efectuat prin meni- i a centromerului de-a lungul lungimii
nerea rdcinielor n reactiv Schiff (solu- cromozomului, acetia pot fi de mai multe
ie de fucsin bazic decolorat), timp de feluri. Pentru a stabili tipul de cromozom,
3060 minute la temperatura camerei sau se consider c jumtate din lungimea
la frigider (pn cnd vrful lor devine cromozomului este mprit n patru
rou-nchis sau brun-nchis), sau n reac- pri. Centromerul se poate afla n dou
tiv Carr, timp 1224 ore, cnd are loc colo- puncte (median sau terminal, respectiv la
rarea ntregii rdcini n violaceu-nchis. mijlocul sau la captul cromozomului),
6. Efectuarea preparatelor microsco- sau n una dintre cele patru regiuni
pice temporare, dup tehnica squash. Pe o (median, submedian, subterminal sau
hrtie de filtru aezat pe mas se aaz o terminal). Dependent de punctul sau
lam de sticl. La mijlocul acesteia, ntr-o regiunea n care se afl centromerul,
pictur soluie (ap distilat, acid acetic deosebim urmtoarele tipuri de cromo-
45% sau soluie carmin-acetic 1-2%), se zomi (fig. 46): cromozomi metacentrici
aduce vrful colorat al radicelei. Se aaz (centromerul este situat n punctul medi-
an, sau n regiunea median a cromo-
Fig. 45. zomului), submetacentrici (centromerul
Metafaz la este situat n regiunea submedian), sub-
vicia faba telocentrici (centromerul situat n regiu-
(2n = 12) nea subterminal), acrocentrici (cen-
tromerul situat n regiunea terminal, dar
nu n punctul terminal) i cromozomi
telocentrici (centromerul este situat n

48
pag.001-050.qxd 8/1/2008 3:24 PM Page 49

Cyan Yellow Magenta Black pag 49

Capitolul 5

punctul terminal, respectiv la captul cro- telofazei), dup care urmeaz o regiune
mozomului). Unii cromozomi prezint de heterocromatic, denumit satelit. De re-
obicei pe braul scurt o strangulaie secun- gul, satelitul este inclus n lungimea
dar la nivelul creia se afl regiunea NOR braului scurt (notat cu litera p).
(regiunea organizatorului nucleolar, cu Se vor analiza cromozomii la diferite
rol n structurarea nucleolului la sfritul specii.

Fig. 46. Tipuri de cromozomi dup poziia cen-


tromerului.
M punct median; T punct terminal; m re-
giune median; sm regiune submedian;
st regiune subterminal; t regiune terminal.
1 cromozom metacentric; 2 cromozom sub-
metacentric; 4 cromozom acrocentric; 5 cro-
mozom telocentric.
regiune sau punct n care se poate afla
centromerul.

I. GENETICA MOLECULAR SINTEZ


Dei au fost descoperii nc din a doua (Watson, Crick i Willkins, 1953, Premiul
jumtate a secolului al XIX-lea (F. Miescher, Nobel n anul 1962 pentru structura spaial
1869), rolul acizilor nucleici n ereditate a a ADN), precum i funcia acizilor nucleici.
fost stabilit abia la mijlocul secolului al Acizii nucleici prezint dou funcii princi-
XX-lea (experienele lui Avery, Mac Leod i pale: funcia autocatalitic este reprezentat
McCarthy, 1944). Cercetrile efectuate n prin biosinteza ADN; funcia heterocatalitic
prima parte a secolului al XX-lea au condus este reprezentat prin implicarea acizilor
la depistarea celor dou tipuri de acizi nucleici n sinteza proteic.
nucleici: acizii dezoxiribonucleici, localizai Legtura ntre secvena de nucleotide
n principal n nucleu, acizii ribonucleici, din molecula de acizi nucleici i secvena
sintetizai n nucleu ns localizai cu pre- aminoacizilor din catena polipeptidic este
ponderen n citoplasm, fiind ns pstrat realizat cu ajutorul codului genetic.
denumirea generic de acizi nucleici. nc nainte de stabilirea structurii spaia-
Dezvoltarea metodelor de investigaie i le a acizilor nucleici, pe baz de logic mate-
interesul oamenilor de tiin pentru pro- matic, s-a stabilit c o secven de trei baze
blemele ereditii au condus la centrarea azotate alturate (trei nucleotide n limbajul
cercetrii tiinifice pe stabilirea rolului actual, respectiv un codon), determin poziia
acizilor nucleici n ereditate. Dovada impor- unui aminoacid n catena polipeptidic.
tanei tiinifice a acestor cercetri rezult Cunoscnd codul genetic i caracteristi-
din faptul c majoritatea premiilor Nobel cile sale, pe baza rezultatelor experimentale,
pentru medicin i fiziologie (dar i o parte oamenii de tiin au stabilit etapele sintezei
a premiilor Nobel pentru chimie), acordate proteice i au elaborat mecanismele reglaju-
n cea de a doua jumtate a secolului al lui acestei sinteze, att la procariote (mate-
XX-lea, au ncununat cercetrile de biologie rialul genetic reprezentat printr-o molecul
i genetic molecular, respectiv studiul de ADN care nu este protejat de nveli
complex al acizilor nucleici. nuclear), ct i la eucariote (materialul gene-
n urma acestor cercetri, a fost stabilit tic reprezentat de ADN complexat cu pro-
structura primar i spaial a acizilor nucleici teinele este protejat de un nveli nuclear).

49
pag.001-050.qxd 8/1/2008 3:24 PM Page 50

Cyan Yellow Magenta Black pag 50

Partea I

Reglajul sintezei proteice la procariote organismului (reglaj genetic pe termen


este explicat prin teoria operonului (teorie scurt).
emis n anul 1961, de ctre Jacob i Mo- Cunoaterea caracteristicilor structu-
nod, pe baza cercetrilor lui Lwff, Premiul rale in vivo ale acizilor nucleici a permis ex-
Nobel n anul 1965) i pe baza teoriei feed- plicarea activitii metabolice a acestora,
back (retroinhibiia enzimatic). specializarea structural i funcional a
celulelor i esuturilor, aspecte ale reglajului
n reglajul sintezei proteice la eucariotele
genetic al celulelor .a.
pluricelulare intervin alte aspecte. n celulele Pe lng acestea, n genetica molecular
somatice ale corpului, indiferent de esut, se au fost nregistrate i alte realizri cu impor-
afl acelai numr de cromozomi, respectiv tan teoretic i practic deosebit: studiul
aceeai cantitate de ADN i aceleai gene. mutaiilor genice, fenomenele reparatorii la
Cu toate acestea, n fiecare tip de celul, nivelul acizilor nucleici, sinteza artificial a
dependent de esutul din care face parte, genelor, transferul de gene de la un individ la
sunt active numai anumite gene, respectiv altul sau de la o specie la alta, proces urmat
anumite ci metabolice. n acest caz, are loc de obinerea organismelor modificate gene-
iniial o specializare structural i funcio- tic (organisme transgenice) .a. Cercetri
nal a celulelor i esuturilor (datorit unui recente au stabilit baza teoretic i metodolo-
reglaj genetic pe termen lung), fiecare gia de cercetare a noi ramuri ale geneticii:
gen fiind activ dependent de necesitile genomica, proteomica, bioinformatica .a.

TEST DE EVALUARE
1. Precizai diferenele dintre ARN-me- 9. Argumentai motivul pentru care bio-
sager de la procariote i eucariote. sinteza ADN este de tip semiconservativ.
2. Care sunt caracteristicile ultrastruc- 10. Prezentai argumente care sprijin
turale ale regiunii de eucromatin, care de- evoluia n timp a codului genetic.
termin prezena genelor active metabolic? 11. Enumerai modificri translaionale
3. Folosind tabelul 4 (pagina 20), pre- cunoscute i importana lor.
ciza]i tipurile de aminoacizi care pot fi 12. Unele proteine de la eucariote, pre-
determinate, n cazul substitu]iei unui sin- zint\ o variabilitate mare privind abunden]a
gur nucleotid din codonul UUG. lor n celul\, dependent de condi]iile de me-
4. Care sunt diferen]ele ntre locusurile diu, de[i cantitatea de ARN-m n celul\ poate
atenuator, operator [i promotor ? r\mne constant\. Preciza]i unele meca-
5. Precizai diferena dintre funcia nisme care pot determina aceast\ situa]ie.
autocatalitic i heterocatalitic a ADN. 13. Reglajul genetic al matur\rii ARN-m:
6. Ce este repliconul i care este m- (a) determin\ care gene sunt transcrise n
rimea sa? ARN-m; (b) selec]ioneaz\ moleculele de
7. Precizai elementele constitutive ale ARN-m care vor migra din nucleu n cito-
primozomului i rolul lor n biosinteza ADN. plasm\; (c) selec]ioneaz\ moleculele de
8. Precizai care caten nou-sintetizat ARN-m utilizate n procesul de transla]ie;
a moleculei de ADN este constituit din (d) controleaz\ excizia intronilor [i asam-
fragmente Okazaki. Care este mrimea blarea exonilor; (e) selec]ioneaz\ molecu-
fragmentelor Okazaki i de ce este necesar lele de ARN-m care vor fi degradate. Alege]i
acest mecanism de sintez? r\spunsul/r\spunsurile corect/corecte.

50
pag.051-106.qxd 8/1/2008 3:26 PM Page 51

Cyan Yellow Magenta Black pag 51

II. GENETICA

UMANA
pag.051-106.qxd 8/1/2008 3:26 PM Page 52

Cyan Yellow Magenta Black pag 52

Genomul uman
1
Capitolul
complementul
cromozomial i
*harta genetic

1. Genetica uman obiect de studiu, identificarea


cromozomilor umani
Genetica studiaz ereditatea, variabili- transmiterea caracterelor ereditare n ca-
tatea i reproducerea organismelor. Anul zul cstoriilor interrasiale sau cele ale
apariiei geneticii ca tiin este considerat: unor cupluri particulare, n care partenerii
(a) anul 1865, cnd Gregor Mendel a elabo- prezint trsturi ereditare normale sau
rat primele legi ale ereditii sau (b) anul patologice distincte, asemenea abordri
1900, cnd aceste legi au fost redescoperite constituind esena studiilor familiale. Cu
n urma cercetrilor efectuate independent toate aceste impedimente n realizarea unei
de Hugo de Vries, Carl Erick von Correns analize genetice dirijate la om, ereditatea
i Erick von Tschermack. Avnd o dez- uman este cel mai bine cunoscut, dato-
voltare dinamic n decursul secolului al rit nregistrrii aspectelor ei din cele mai
vechi timpuri i mai ales datorit impactu-
XX-lea, iar odat cu realizarea Proiectului
lui pe care ereditatea l are asupra strii de
genomul uman (2001) o dezvoltare explo-
sntate a oamenilor. Cromozomii au fost
ziv, genetica i-a nsuit metode de inves-
evideniai n a doua parte a secolului al
tigaie de la alte tiine, n prezent fiind
XIX-lea, rolul lor n ereditate fiind stabilit la
cunoscute numeroase ramuri ale geneticii,
sfritul aceluiai secol. Numrul de cro-
devenite tiine independente. mozomi la om (2n = 46), a fost stabilit abia
Genetica uman i genetica medical n anul 1956 de ctre H. Tjio i A. Levan,
studiaz genomul uman n condiii normale odat cu mbuntirea tehnicilor de inves-
i patologice. Genetica medical st la baza tigaie citogenetic (fig. 1). Autozomii con-
dezvoltrii medicinei moleculare, a medi- stituie 22 perechi, iar heterozomii o pere-
cinei predictive i a terapiei genice. Din che, determinismul cromozomal al sexului
motive etice, religioase i socio-economice, la om fiind de tip Drosophila (femeia avnd
la specia uman nu pot fi realizate expe- o singur pereche de heterozomi, notat
riene de hibridare, la care s se efectueze XX, iar brbatul doi heterozomi diferii
analiza genetic a rezultatelor ncrucirii morfologic i genetic, notai XY).
dintre genitori, cum s-a fcut la Pisum sau Datorit numrului relativ mare al
Drosophila. Este posibil ns s fie analizat perechilor de cromozomi i a dificultilor

52
pag.051-106.qxd 8/1/2008 3:26 PM Page 53

Cyan Yellow Magenta Black pag 53

Capitolul 1

(A) (B)

Fig. 1. Placa metafazic (A) i cariotipul uman (B).

n identificarea unui cromozom de interes, benzi. Notarea regiunilor i benzilor se


n dezvoltarea investigaiilor de citogene- face de la centromer spre capetele cromo-
tic (ramura geneticii care studiaz orga- zomului. Utiliznd aceast notare, se poate
nitele celulare cu rol genetic, prin mbina- stabili cu uurin poziia unei gene pe cro-
rea metodelor de investigaie ale geneticii mozom. Astfel, dac gena G6PD se afl n
i citologiei), o importan deosebit a re- poziia Xq28, nseamn c ea se afl pe cro-
prezentat-o elaborarea i aplicarea tehnicilor mozomul X, braul lung (q), regiunea 2,
de bandare cromozomal. Prin aplicarea banda 8.
unor tehnici speciale de colorare a prepa-
ratelor microscopice (utiliznd de obicei
quinacrina sau colorantul Giemsa), de-a
lungul lungimii cromozomilor se disting re-
giunile de eucromatin i heterocromatin.
n figura 2 este reprezentat cromo-
zomul X uman bandat. Se observ pe
lungimea sa prezena unor benzi transver-
sale avnd intensiti diferite de culoare:
benzi ntunecate, alternnd cu interbenzi
luminoase (deschise la culoare). Benzile
transversale ntunecate reprezint regiu-
nile care sunt fluorescente cu quinacrina
sau nchise la culoare cu colorantul
Giemsa. Mai multe benzi alturate sunt
grupate ntr-o regiune. n cazul cromo-
zomului X, braul lung (q) i braul scurt
(p), prezint fiecare cte dou regiuni,
Fig. 2. Cromozomul X uman bandat
fiecare regiune avnd una sau mai multe
53
pag.051-106.qxd 8/1/2008 3:26 PM Page 54

Cyan Yellow Magenta Black pag 54

Partea a II-a

2. Cariotipul i genomul uman


Cariotipul uman
Cei 46 de cromozomi umani au fost m- secundar n regiunea proximal a braului
prii n apte grupe morfologice, depen- lung. ntre cromozomii din perechea 3, s-a
dent de mrimea lor, poziia centromeru- constatat un dimorfism de mrime.
lui, prezena sateliilor .a. (fig. 3). Grupa B conine perechile 4 i 5. Sunt
Grupa A cuprinde cromozomii din pere- cromozomi lungi (6,556,13 m), avnd
chile 13. Sunt cromozomi lungi (lungimea centromerul n regiunea submedian (cro-
medie cuprins ntre 9,08-7,06 m), cromozo- mozomi submetacentrici).
mii din perechea 1 i 3 fiind metacentrici, iar Grupa C cuprinde cromozomii din pere-
cei din perechea 2 sunt submetacentrici. Cro- chile 612, n acest grup fiind inclus i cro-
mozomii din perechea 1 prezint o constricie mozomul X al sexului. Sunt cromozomi de

Centromeru

Fig. 3. Prezentarea benzilor i interbenzilor situate pe lungimea celor 23 de perechi de cromozomi


umani

54
pag.051-106.qxd 8/1/2008 3:26 PM Page 55

Cyan Yellow Magenta Black pag 55

Capitolul 1
mrime mijlocie (5,844,46 m), cromo- mici (3,232,76 m), cu centromerul n re-
zomii din perechile 6, 7, 8 i 11 au cen- giunea median (perechea 16) sau sub-
tromerul n regiunea median, iar cromo- median (perechile 17 i 18). Cromozomii
zomii din perechile 9, 10 i 12 n regiunea din perechea 16 prezint o constricie
submedian. Cromozomii din perechea 9 secundar n regiunea proximal a brau-
prezint o constricie secundar n regiu- lui lung.
nea proximal a braului lung. Cromozo- Grupa F cuprinde cromozomii din
mul X, dup mrime, se poate situa ntre perechile 1920. Sunt cromozomi mici
cromozomii din perechile 69. (2,522,33 m), metacentrici.
Grupa D cuprinde cromozomii din Grupa G cuprinde cei mai mici cromozomi
perechile 1315. Sunt cromozomi de mri-
din cariotipul uman (1,831,68 m), acro-
me mijlocie (3,643,36 m), acrocentrici
centrici, cu satelit. n grupa G este inclus, pe
(centromerul situat spre captul cromo-
zomului), avnd constricie secundar pe baza m\rimii similare, cromozomul Y al sexu-
braul scurt i satelii. lui. Are o lungime apropiat (1,96 m), este
Grupa E cuprinde cromozomii din acrocentric (centromerul situat n regiunea
perechile 1618. Sunt cromozomi relativ subterminal), ns nu prezint satelit.

Genomul uman
Genom definete toate genele existente
pe un singur gamet, respectiv pe un singur 4 uniti 3 uniti

cromozom din perechea de omologi.


Proiectul genomul uman, iniiat n anul
1988, a fost definitivat n februarie 2001, 7 uniti

fiind completat n aprilie 2003. Scopul su a


fost ambiios: crearea hrilor genetice i fi- Fig. 4. Schi cu plasarea a 3 gene pe cromo-
zice ale celor 23 de perechi de cromozomi zom, dependent de procentul de crossing over
umani, stabilirea secvenei complete a geno- dintre ele.
mului uman, care au permis depistarea i
analiza genelor implicate n determinismul Harta citologic a cromozomilor (harta
caracterelor normale, precum i genele fizic), prezint poziia unui locus sau a
mutante care determin diferite maladii .a. unei gene pe cromozom, dependent de
Harta genetic const n reprezentarea anumite particulariti ale acestuia. ntoc-
grafic a poziiei genelor pe cromozomi, cu mirea ei are la baz tehnicile de bandare a
stabilirea distanei dintre ele. Ea prezint cromozomilor, prin care se evideniaz
ordinea genelor i definete poziia unei benzi transversale de culori i intensiti di-
gene fa de alte gene situate pe acelai ferite de-a lungul cromozomilor metafazici,
cromozom. Distanele dintre gene sunt ex- prin tehnici specifice de colorare.
primate n uniti de recombinare genetic ADN-ul uman, aflat n cele 23 perechi
(uniti de crossing-over ), notate n centi- de cromozomi, conine circa 3,2 109
morgani (cM). O distan de 1 centimor- perechi de nucleotide, 2,95 109 perechi
gan ntre dou gene adiacente, reprezint de nucleotide fiind constituite n eucroma-
un procent de crossing-over de 1% ntre tin. Au fost identificate circa 31 000 gene
aceste gene (fig. 4). care sunt transcrise n ARN-m i minim

55
pag.051-106.qxd 8/1/2008 3:27 PM Page 56

Cyan Yellow Magenta Black pag 56

Partea a II-a
750 de gene codificate n alte tipuri de ARN. de jumtate din genomul uman este consti-
Astfel, exist circa 500 de gene pentru tuit din ADN repetitiv. Aproape 45 % din
diferite tipuri de ARN-t (fig. 5). Genele sunt genom este derivat de la elemente genetice
distribuite pe cele 22 de perechi de auto- transpozabile (gene mobile, gene sltree
zomi i pe cei doi cromozomi ai sexului. sau gene vagaboande, capabile s i
Raportat la numrul perechilor de baze azo- schimbe poziia n interiorul aceluiai cro-
tate, cele mai multe gene au fost nregistrate mozom sau pe cromozomi diferii). Dei ge-
pe cromozomul 19, n timp ce numrul cel nomul uman posed numai de dou ori mai
mai mic de gene se afl pe autozomul 13 i multe gene care codific proteinele, com-
pe cromozomul Y. Genele (sau regiunile cu parativ cu Drosophila i Caenorhabdites,
rol n codificare), reprezint numai 12% din genele umane sunt mult mai complexe i
genom. Peste 40% din genele umane care parcurg procese de maturare, producnd o
codific proteine au ortologi la Drosophila gam variat de transcripi diferii. Mai mult
i Caenorhabdites (nematod). Aceast con- de 1 000 de gene sunt cauza unor boli speci-
statare prezint o deosebit importan pen- fice, mutantele lor fiind listate separat.
tru studiul unor maladii i al mijloacelor de Cromozomul mitocondrial uman, denumit
tratament, experimentele fiind efectuate pe ADN-mt sau cromozomul 25, este constituit
cele dou specii. Sute de gene umane au dintr-o molecul de ADN de form circular,
rezultat prin transfer orizontal de la bacterii alctuit din peste 16 500 de perechi de baze
n timpul evoluiei vertebratelor. Mai mult i conine aproape 40 de gene.

Genomul uman

Genomul Genomul
nuclear mitocondrial
30.000 gene 37 gene

25% 75%
Gene [i secven]e ADN ARNt 13 gene
2 ARNr
genice extragenic 22 gene polipeptidice

Unice sau repetitive


60% 40%
10% 90%

ADN ADN Unic sau `n num\r Repetitiv `n num\r


necodificat mai mare de
codificat mic de exemplare exemplare

Fragmente Introni, Repetitiv Repetitiv


Pseudogene secven]e `n tandem sau diversificat
de gene netranslate etc. `n ciorchine

Fig. 5. Organizarea genomului uman.

56
pag.051-106.qxd 8/1/2008 3:27 PM Page 57

Cyan Yellow Magenta Black pag 57

Determinismul
2
Capitolul
genetic al principalelor
caractere fenotipice
umane

1. Determinismul unor caractere fenotipice normale


Multe dintre caracterele morfologice nor- pereche de alele (Cc) care determin trei
male ntlnite la om se transmit conform genotipuri: CC creast nazal proeminen-
legilor mendeliene, fiind determinate de una t asociat cu narine largi (nas roman),
sau mai multe perechi de gene alele (fig. 6). cc creast nazal concav asociat cu narine
Dintre trsturile cu transmitere mendelian mici (nas crn), Cc creast nazal dreapt
se pot meniona: forma brbiei, foseta men- asociat cu narine nguste (nas grec).
tonier, forma nasului, tipul de fant pal-
pebral, culoarea ochilor, forma buzelor, linia
de inserie a prului n regiunea frontal,
mea alb frontal, aspectul lobului urechii,
forma sprncenelor i a genelor, precum i
numeroase caractere biochimice (sistemele
de grup sangvin, unele variante enzimatice
eritrocitare, unele proteine serice etc.).
Forma brbiei este determinat de o
pereche de gene. Starea homozigot a
alelei dominante (BB) corespunde fenoti-
pic cu brbia proeminent, starea homozi-
got a alelei recesive (bb) exprim brbie
teit (retrognat), iar starea heterozigot
(Bb) brbia dreapt. Prezena fosetei men-
toniere (gropia n brbie) este determinat
de prezena unei gene n stare dominant.
Forma nasului. Dimensiunea nasului, la
fel ca i alte caractere cantitative, este
determinat poligenic (intervin mai multe
perechi de gene nealele) sau multifactorial
(caracter determinat de mai multe gene
nealele sub influena factorilor de mediu). Fig. 6. Caractere fenotipice umane determinate
Forma crestei nazale este controlat de o poligenic: culoarea pielii, a ochilor i a prului

57
pag.051-106.qxd 8/1/2008 3:27 PM Page 58

Cyan Yellow Magenta Black pag 58

Partea a II-a
Culoarea ochilor este controlat de trei pr cre, specific rasei negre; P2P2 pr bu-
alele: O1, O2, O3, avnd grade diferite de clat i P3P3 pr neted. Combinaiile dintre
dominan ntre ele, care pot forma urm- diferite alele determin apariia unor forme
toarele combinaii genotipice: O1O1 intermediare: P1P2 pr buclat spre cre;
culoare neagr a ochilor; O2O2 ochi P1P3 pr ondulat; P2P3 pr uor ondulat.
cprui; O3O3 ochi albatri; O1O2 ochi Culoarea tegumentului, condiionat de
cprui nchis; O1O3 ochi cprui deschis; cantitatea de melanin sintetizat de celu-
O2O3 ochi verzi. lele epidermei, este determinat de dou
Linia de inserie a prului n regiunea perechi de gene nealele: P1p1 i P2p2. n
frontal poate fi dreapt sau formeaz un determinarea caracterelor cantitative, efec-
unghi cu vrful spre nas, ultimul caz prezen- tul genelor nealele este adiional sau suma-
tnd dominana. Genotipurile PP i Pp expri- tiv: luate individual determin o parte a ca-
m tipul dominant (inserie n forma literei racterului cantitativ, iar efectele lor totale
V), iar pp tipul recesiv (inserie dreapt). se nsumeaz; astfel, cu ct intr mai multe
Lobul urechii poate fi liber sau ataat, alele dominante n structura genetic a
fiind determinat de o pereche de gene alele organismului, cu att este mai intens cu-
(Ll), cu dominan complet. Exist dou loarea. n cazul culorii negre a pielii, sunt
fenotipuri, determinate de cele trei prezente toate alelele n stare dominant:
genotipuri: lob liber, dominant (LL, Ll) i P1 P1 P2 P2. Mulatrii au dou alele domi-
lob ataat, recesiv (ll). nante i dou recesive: P1 p1 P2 p2, i, n
Sprncenele sunt determinate mono- consecin, o cantitate mai mic de mela-
genic de o pereche de gene alele Ss. Sprn- nin, iar albii au toate alelele recesive:
cenele groase (SS, Ss) sunt dominante fa p1 p1 p2 p2, i, n consecin, cea mai mic
de cele subiri (ss). cantitate de melanin n piele. La populaia
Genele lungi i groase (GG, Gg) se trans- uman din regiunea Uganda, Ruanda,
mit dominant fa de cele scurte i subiri (gg). Burundi din Africa, este prezent cea de a
Forma prului este controlat de trei treia gen (P3). Aflat mpreun cu cele-
alele: P1, P2 i P3. n stare homozigot, sunt lalte gene n stare dominant, determin
determinante tipurile standard de pr: P1P1 nuana tip abanos a tegumentului.

2. Determinismul genetic al unor maladii umane


Bolile genetice sunt stri patologice modificarea materialului genetic con-
determinate predominant de factori genetici: duce la sinteza unor enzime sau proteine
modificarea unor gene, modificarea struc- diferite, care vor afecta structura i funcia
tural i numeric a cromozomilor. Pe lng normal a celulelor i a ntregului organism;
bolile genetice, determinate predominant de pot fi determinate prenatal, pot fi pre-
factorii genetici, exist boli cu predispoziie zente de la natere (congenitale) sau se pot
genetic, la care boala se manifest numai n manifesta ulterior, la vrste diferite;
anumite condiii de mediu. Bolile genetice bolile genetice se agraveaz odat cu
prezint anumite caracteristici: vrsta;

58
pag.051-106.qxd 8/1/2008 3:27 PM Page 59

Cyan Yellow Magenta Black pag 59

Capitolul 2
prezint frecvene diferite n populaii prezint forme diferite ale gradului de
diferite; manifestare i se pot manifesta diferit n
pot fi familiale sau sporadice; diferite condiii de mediu.

Boli genice
Sunt maladii produse de mutaia unei heterozigoi pot avea copii neafectai. O per-
gene (boli monogenice) sau a mai multor soan heterozigot are ansa de a transmite
gene nealele (boli poligenice). n descenden boala, n procent de 50%, in-
divizii fiind afectai indiferent de sex (fig. 7).
a. Bolile monogenice
Acestea se transmit n descenden Tat\l bolnav Mama s\n\toas\
dup legile mendeliene. Sunt cunoscute
peste 5 000 de boli genice, majoritatea se
manifest n copilrie, 10% dup pubertate
i 1% la vrsta naintat. O bun parte din
ele reprezint mutaii aprute recent n
populaia uman. Bolile moleculare sunt
bolile monogenice la care a fost identificat
proteina (enzima) anormal responsabil
de instalarea maladiei.
Dup modul de transmitere n descen-
den, se deosebesc:
boli cu transmitere autozomal domi- B\iat bolnav Fat\ bolnav\ B\iat s\n\tos
nant n descenden: Fat\ s\n\toas\
boli cu transmitere autozomal rece-
Fig. 7. Modelul transmiterii n descenden a
siv n descenden: ereditii autozomal dominante.
boli X-linkate (sex-linkate) dominante;
boli X-linkate recesive; Din aceast categorie fac parte: boala
boli Y-linkate. Marfan (datorat sintezei unei proteine
Bolile sex-linkate sunt determinate de anormale), letal n stare homozigot i
gene plasate pe cromozomii sexului, pu- caracterizat prin talie nalt, arahnodac-
tnd fi X-linkate (gene plasate pe cromozo- tilie (degete lungi), dislocare de cristalin i
mul X al sexului) sau Y-linkate (gene pla- anevrism aortic; boala (choreea) Huntington
sate pe cromozomul Y al sexului). Bolile (fig. 8) caracterizat prin deteriorarea
sex-linkate se transmit cu o frecven dife-
rit n descenden, dependent de tipul de
cromozom (X sau Y) i sexul descendenei.
1. Boli cu transmitere autozomal domi-
nant n descenden. Gena mutant fiind
dominant, persoanele afectate sunt de obi-
cei heterozigote (Aa), indivizii homozigoi
dominani putnd fi letali. Fiecare per-
soan afectat prezint cel puin un printe
bolnav, dup cum doi prini bolnavi Fig. 8. Doi copii afectai de choreea Huntington.

59
pag.051-106.qxd 8/1/2008 3:27 PM Page 60

Cyan Yellow Magenta Black pag 60

Partea a II-a
progresiv a inteligenei i a funciilor
Tat\l purt\tor Mama
motorii ncepnd de obicei dup maturitate, purt\tor
datorit unei gene care produce o substan
care interfereaz cu metabolismul normal al
creierului; polidactilia caracterizat prin
prezena unor degete suplimentare la mn
i/sau la picior; achondroplazia (un tip de

Normal Purt\tor Purt\tor Copil bolnav


Fig. 9. Infanta Margarita Teresa a Spaniei (stn-
Fig. 10. Modelul transmiterii n descenden a
ga) i o persoan afectat de achondroplazie
ereditii autozomal recesive
(dreapta).
transmitere autozomal recesiv n descen-
piticism) .a (fig. 9). n unele cazuri, per- den fac parte: fenilcetonuria, beta-tala-
soanele afectate pot prezenta o expresie semia, surditatea, albinismul, caracterizat
diferit a genei pentru diferite caractere, prin absena melaninei (fig. 11), galactose-
ducnd la impresia fals c gena (boala) nu mia, caracterizat prin leziuni la nivelul
se manifest. Astfel, unii indivizi cu boala creierului, ficatului i al ochilor, anemia fal-
Marfan pot manifesta talia nalt i o slab ciform cu hematii n form de secer,
expresie a celorlalte caractere afectate boala fiind letal la prezena genei n stare
(fenomen denumit penetran incomplet). homozigot .a.
2. Boli cu transmitere autozomal rece- Fenilcetonuria este datorat absenei
siv n descenden. Gena mutant fiind unei enzime (fenil-alanil-hidroxilaz) care
recesiv (a), maladia se manifest numai la conduce la acumularea de fenilalanin n
prezena sa n stare homozigot. Exist trei toate lichidele corpului. Se produce o
categorii de indivizi: sntoi (AA), purt-
tori (Aa, prezint gena, dar nu manifest
boala) i bolnavi (aa). Boala prezint o dis-
continuitate la transmiterea n descen-
den. Un individ afectat poate avea ambii
prini neafectai (heterozigoi). Doi indi-
vizi afectai vor avea toi copiii afectai,
indiferent de sex. Riscul ca doi indivizi
purttori (heterozigoi) s aib copii afec-
tai este de 25%, n 75% dintre cazuri copiii
fiind neafectai (50% purttori i 25%
sntoi; fig. 10). Din grupul bolilor cu Fig. 11. Un brbat tip albino din India

60
pag.051-106.qxd 8/1/2008 3:27 PM Page 61

Cyan Yellow Magenta Black pag 61

Capitolul 2
napoiere mental grav la indivizii afectai. (posed un singur cromozom X), vor mani-
Beta-talasemia este o mutaie genic ce festa boala n cazul prezenei genei rece-
conduce la sinteza unei catene beta a hemo- sive pe cromozomul X (XaY). Astfel, ei pot
globinei mai scurte. Indivizii homozigoi fi sntoi (XY) sau bolnavi (XaY). Femeile
recesivi prezint anemie hemolitic, defor- pot fi sntoase (XX), purttoare (XaX, pre-
mare scheletic, facies mongoloid .a. zint gena pe care o pot transmite n des-
3. Bolile sex-linkate dominante sunt cenden, dar nu manifest boala) sau bol-
determinate de gene plasate pe cromo- nave (XaXa). O femeie bolnav manifest
zomii sexului X sau Y. n cazul genelor X- boala (XaXa) i o va transmite n descen-
linkate, boala se manifest la ambele sexe, den la toi bieii, indiferent de consti-
ns cu o frecven diferit. n cazul tuia genetic a tatlui. Dintre bolile X-lin-
genelor Y-linkate, boala se manifest kate recesive fac parte: daltonismul (im-
numai la sexul masculin. posibilitatea de a distinge culorile rou-
Bolile X-linkate dominante sunt rare, verde, dar i galben-maron), hemofilia A
fiind determinate de o gen dominant (fig. 13), distrofia muscular Duchenne .a.
plasat pe cromozomul X (XA). Descenden- Distrofia muscular Duchenne este deter-
a este diferit, dependent de constituia minat de deleia parial a genei pentru
genetic a prinilor. Astfel, n cazul unui distrofin. Se manifest numai la bieii
cuplu n care tatl este afectat, iar mama care poart gena (XdY), dificultile n mers
este sntoas (XX x XAY), toate fetele vor manifestndu-se ntre 15 ani. Deoarece
fi afectate (XAX) i toi bieii vor fi sntoi
(XY), deoarece acetia motenesc cromo-
zomul X de la mam. Aceste boli sunt rare:
rahitismul hipofosfatemic rezistent la vita-
mina D, sindromul oro-digito-facial [.a.
4. Bolile X-linkate recesive sunt deter-
minate de o gen recesiv plasat pe cro-
mozomul X. Descendena este diferit, de-
pendent de constituia genetic a celor doi
prini (fig. 12). Brbaii fiind hemizigoi

Legend\: B\rbat s\n\tos B\rbat bolnav


Femeie s\n\toas\ C\s\torie
Femeie purt\toare Fr\]ie
Fig. 13. Transmiterea genetic a hemofiliei la
descendenii reginei Victoria a Angliei. arul
Fig. 12. Modelul transmiterii n descenden a Nicolae al II-lea, arina Alexandra i areviciul
ereditii recesive X-linkate Alexei (hemofilic)

61
pag.051-106.qxd 8/1/2008 3:27 PM Page 62

Cyan Yellow Magenta Black pag 62

Partea a II-a
boala are efect letal pn la vrsta ado- sau narine), aspect prezent la numeroase
lescenei, fetele pot fi numai heterozigote familii din India, unde toi bieii manifest
(XdX) i nu manifest boala. acest caracter, care nu este transmis la fete.
5. Bolile Y-linkate sunt determinate de
gene plasate pe cromozomul Y al sexului. b. Bolile poligenice
Acest cromozom, respectiv aceste gene Sunt determinate de gene nealele care
sunt prezente, se manifest i se transmit pot interaciona sau nu cu factorii de mediu.
numai pe linie patern, de la tatl afectat la Transmiterea lor nu este supus legilor
toii bieii. Nicio fat nu este afectat, ele mendeliene ale ereditii. Prezint deter-
neavnd cromozomul Y. Cromozomul Y minism poligenic acele malformaii ntl-
este n bun parte alctuit din heterocro- nite mai frecvent n unele familii, ca de
matin, fiind astfel descrise puine gene pe exemplu luxaia congenital de old. n
cromozomul Y, ca de exemplu, gena care cazul n care unul dintre prini este afectat,
determin un agent de histocompatibilitate riscul transmiterii afeciunii n descenden
(H-Y), specific masculin. Pe cromozomul Y este de 4%. Alte caracteristici avnd deter-
se afl gena responsabil pentru caracterul minism poligenic sunt: culoarea pielii,
hairy pinna (pr lung crescut pe ureche culoarea ochilor, culoarea prului .a.

Boli cromozomiale
Bolile cromozomiale sunt determinate participarea acestora la fecundare, vor
de modificarea numrului de cromozomi rezulta organisme aneuploide (fig. 14);
sau a structurii cromozomilor. Anomaliile
numerice sunt viabile atunci cnd sunt
implicai cromozomii sexului (absena cro- X XXX
mozomului X este incompatibil cu viaa), Trisomie x
XX
sau cromozomii de talie mic. Pe de alt
parte, au fost descrise puine anomalii
structurale viabile. De obicei, bolile cromo- XX Y XXY
zomiale nu sunt ereditare, deoarece modi-
ficarea numrului sau a structurii cromo- XX Sindrom
zomilor afecteaz grav viabilitatea purtto- Klinefelter
XX non-disjunc]ie
rilor (anomaliile fiind de obicei letale), iar
n cazul n care purttorii sunt viabili, este X
XO
afectat fertilitatea lor.
O Sindrom
a. Anomalii numerice ale cromozomilor
O Turner
Anomaliile numerice ale cromozomilor
sunt determinate de o serie de cauze, mai Y YO
importante fiind:
O neviabil
vrsta naintat a mamei, care favori-
zeaz fenomenul de non-disjuncie a cro- fertilizare cu game]i zigo]i
mozomilor (nesepararea lor) n timpul masculi rezulta]i
meiozei, conducnd la formarea de gamei
Fig. 14. Formarea gameilor femeli prin proce-
cu n + 1, respectiv n 1 cromozomi; prin
sul de non-disjuncie.

62
pag.051-106.qxd 8/1/2008 3:27 PM Page 63

Cyan Yellow Magenta Black pag 63

Capitolul 2
aciunea unor factori mutageni fizici
(radiaii ionizante) sau chimici (substane
chimice mutagene, unele antibiotice .a.)
asupra organismelor parentale sau n tim-
pul primului trimestru de sarcin a mamei;
prezena unor anomalii cromozomiale
echilibrate la unul dintre prini;
unul dintre prini sufer de boli neuro-
psihice, este alcoolic .a.
Sindromul Down (trisomia 21) se ca-
racterizeaz prin prezena a trei cromo-
zomi n perechea 21. Este ntlnit la
ambele sexe, avnd o frecven la natere
de 1/600-1/800 (fig. 15). Dependent de Fig. 16. Pacient cu sindrom Turner
gravitatea malformaiilor, att gradul de
inteligen (15-70 QI), ct i durata de via
sunt variabile. Indivizii afectai prezint 1/1 000. Deoarece n celulele somatice nu-
faa lat i ochii oblici, degete scurte, mal- mai unul din cromozomii X este funcio-
formaii cardiace i osteo-articulare, mus- nabil, cromozomii X suplimentari fiind he-
culatur atrofiat, infecii respiratorii, leu- terocromatinizai, indivizii cu sindrom
cemie .a. Klinefelter prezint n celulele somatice
Recent, s-a constatat o legtur ntre corpusculi Barr. Se caracterizeaz prin dis-
persoanele n vrst care manifest sindro- punerea esutului adipos de tip feminin
mul Down i maladia Alzheimer (maladie conducnd la obezitate, pilozitate redus,
degenerativ a sistemului nervos central, atrofie testicular, criptohidie nsoite de
care prezint efect letal), determinat de sterilitate, ginecomastie (dezvoltarea exa-
gene plasate pe cromozomul 21. gerat a mamelelor), afeciuni psihice .a.
Sindromul Klinefelter prezint formula Sindromul Turner (monosomia XO),
cromozomal de baz 47, XXY, (adic 47 ntlnit la femei, determinat de absena
cromozomi, avnd un cromozom X supli- unui cromozom X al sexului (45, XO), fiind
mentar, ns au fost descrise i alte modi- singurul caz de monosomie viabil la om
ficri numerice, de tipul 48, XXXY; 46, XY / (prezena unui singur cromozom din
47, XXY; 45, XO (mozaicism cromozomal) pereche). Maladia este prezent n raport
.a. Indivizii afectai sunt de sex masculin, de 1/10 000, persoanele afectate avnd
maladia fiind prezent cu o frecven de talie redus, atrofia ovarelor nsoit de
sterilitate, malformaii cardiace, dezvoltare
A B intelectual apropiat de normal (fig. 16).
Deoarece n celulele somatice exist un
singur cromozom X, pacientele cu sindrom
Turner nu prezint corpuscul Barr.
Trisomia X (47, XXX sau mozaicism 47,
XXX / 46, XX) se manifest la fete la 1/1 000
nateri. Indivizii prezint o dezvoltare nor-
Fig. 15. Pacieni cu sindrom Down: A - cariotip; mal sau manifest o uoar scdere a fer-
B fenotip. tilitii i o uoar ntrziere mental. n

63
pag.051-106.qxd 8/1/2008 3:27 PM Page 64

Cyan Yellow Magenta Black pag 64

Partea a II-a
celulele somatice se constat existena a
doi corpusculi Barr.
b. Anomalii structurale ale cromozomilor
Modificarea structurii cromozomilor
determin apariia a diferite anomalii struc-
turale: deleii, duplicaii, inversii, translo-
caii .a. Viabilitatea purttorilor depinde
de fragmentul afectat (mrimea sa i con-
stituia genetic).
Sindromul Cri-du-chat (ipt de pisic)
este determinat de o mic deleie (pierde-
re) pe braul scurt al cromozomului 5.
Indivizii afectai manifest malformaii
faciale, malformaii ale laringelui, malfor- segment C deletat
maii cardiace, renale, ntrziere mintal
(fig. 17).
Sindromul Prader-Willi este caracterizat
prin deleia unui fragment din braul lung al Fig.17. Copil mic afectat de sindromul Cri-du-
chat (a) i dup patru ani (b), cnd efectele sin-
cromozomului 15. Dup 56 ani, copiii cu
dromului au fost stopate. Reprezentarea deleiei
acest sindrom manifest un apetit exagerat, unui segment pe cromozomul 5p.
care conduce la obezitate nsoit de diabet,
dezvoltare fizic i sexual redus. structurii cromozomului sau a numrului
n tabelul urmtor (tab. 7), sunt pre- de cromozomi, precum i principalele ca-
zentate centralizat unele maladii determi- racteristici fenotipice pe care le manifest
nate de mutaii ale genelor, modificarea purttorii acestor mutaii.

Tabelul 7. Exemple de boli genetice umane

Tipul anomaliei Principalele consecine


Ereditatea autozomal dominant
Acondroplazie O form de piticism
Neurofibromatoz Pete tip cafea cu lapte
Osteogenez\ imperfect Deformri i fracturi ale oaselor
Porfirie variegat Fotosensibilitate cutanat

Ereditatea autozomal recesiv


Albinism Absena pigmentaiei
Fenilcetonurie napoiere mental
Boala Tay-Sachs Boal neurodegenerativ grav
Tirozinoz Insuficien hepatic i splenic
Boli X-linkat dominante
Hipofosfatazemie Rahitism
Sindrom Rett Afectat dezvoltarea SNC
Sindrom oro-digito-facial Afectate faa, cavitatea bucal, degetele

64
pag.051-106.qxd 8/1/2008 3:27 PM Page 65

Cyan Yellow Magenta Black pag 65

Capitolul 2

Boli X-linkat recesive


Hemofilie Incapacitatea de coagulare a sngelui
Daltonism Incapacitatea diferenierii unor culori
Sindrom Hunter napoiere mental, anomalii scheletice
Boli Y-linkate
Hairy-pinna Smocuri de pr n nri i la ureche
Modificri n structura cromozomilor
Sindrom Cri-du-chat (del 5p) napoiere mental, dezvoltarea anormal a
laringelui
Schimbare n numrul autozomilor
Sindrom Down (trisomia 21) napoiere mental, defecte ale inimii
Schimbare n numrul heterozomilor
Sindrom Turner Sterilitate, caractere sexuale anormale
Sindrom triplo-X Tulburri de comportament
Sindrom Klinefelter Hipogonadism, infertilitate
Sindrom XYY Tulburri de comportament

3. *Determinismul genetic n memorie, inteligen,


comportament i temperament
Genetica comportamentului (behavior epistemologia genetic, al crei obiect se
genetics) este o ramur a geneticii care stu- limiteaz la geneza categoriilor eseniale
diaz ereditatea i formele comportamentu- ale gndirii.
lui, precum jocurile de curtare a femelelor,
construirea cuibului .a. la animalele infe- a. Inteligena
rioare, precum i inteligena i trsturile Constituie capacitatea unui individ de a
de personalitate la om. Multe caractere nelege relaiile existente ntre elementele
care prezint interes n genetica comporta- unei situaii, precum i abilitatea de a se
mentului sunt caractere cantitative. adapta la mediu (familial, social sau ambi-
Psihologia genetic studiaz dez- ental), n aa fel nct s i poat realiza
voltarea mental la copil. Ea analizeaz propriile scopuri. Mult vreme s-a crezut
transformarea copilului n adult, progrese- c numai activitatea conceptual i logic a
le care au loc n timpul ontogenezei, stadi- omului, elaborate pe plan verbal, constituie
ile prin care trece individul pn la maturi- inteligena, pe cnd celelalte comporta-
tate, cutnd s neleag semnificaia lor mente adaptative ar rezulta din activitatea
funcional. Teoreticienii acestei psiholo- instinctiv. De la nceputul secolului al
gii, care se bazeaz pe noiunile cheie de XX-lea, s-a stabilit ns n mod cert exis-
maturizare i de nvare, au fost A. Gesell tena mai multor forme de inteligen,
(S.U.A.), J. Piaget (Elvetia), H. Wallon tipurile principale fiind (E.L. Thorndicke,
(Frana). Psihologia genetic nglobeaz 1920):

65
pag.051-106.qxd 8/1/2008 3:27 PM Page 66

Cyan Yellow Magenta Black pag 66

Partea a II-a
inteligena abstract sau conceptual,
caracterizat prin capacitatea de a utiliza
materialul verbal i simbolic;
inteligena practic, care implic

Frecvena
capacitatea de a manipula diferite obiecte;
inteligena social, care implic com-
prehensiunea fiinelor umane i uurina
de a se acomoda cu ele. Copiii au o inteli-
gen esenialmente practic.
Capacitatea de a rezolva probleme con-
crete o regsim la animalele superioare. n
IQ
urma observaiilor efectuate asupra cim-
panzeilor (W. Koehler i N. Ladghina-
Fig. 18. Valoarea coeficientului de inteligen n
Kots), s-a stabilit c maimuele superioare populaia din SUA
sunt capabile s confecioneze instrumente
(de exemplu, s ndrepte o srm fcut\
ghem, pentru a putea mpinge cu ajutorul inteligen superioar, 110-119;
su o momeal imobilizat ntr-un tub lung inteligen medie, 90-109;
i subire). Cimpanzeul este chiar capabil inteligen slab (dull), 80-89;
s rezolve probe practice accesibile copilu- inteligen limitat (borderline), 70-79;
lui normal n vrst de 910 ani (K. retardare uoar (moroni), 50-69;
Gottschaldt). Inteligena este instrumentul retardare moderat (imbecili), 25-49;
major al adaptrii. Dependent de zestrea retardare sever (idioi), 0-24.
lor ereditar, experiena personal i me- Valoarea coeficientului de inteligen se
diul ambiant, indivizii umani sau indivizii menine relativ constant n cursul vieii,
unei specii au forme i niveluri de inteli- unele aptitudini particulare fiind mai mult
gen diferite. sau mai puin variabile. Aptitudinile ver-
La animale, inteligena este rezultatul bale prezint n timp tendina de a evolua,
coordonrii memoriei, nvrii i al raio- n timp ce aptitudinile non-verbale prezint
namentului. Inteligena a mai fost definit
tendina de a regresa odat cu naintarea n
ca reprezentnd capacitatea unui individ
vrst. Inteligena prezint un dublu deter-
(animal sau fiin uman), de a stabili leg-
minism, genetic i ambiental. Fiecare indi-
turi asociative referitoare la evenimente
vid se nate cu o zestre genetic, fiind pur-
sau obiecte pe care nu a avut ocazia s le
ttorul unui fond genetic. Acest fond gene-
cunoasc anterior. La oameni, inteligena
este frecvent exprimat prin coeficientul tic se realizeaz n condiiile unui mediu
de inteligen (QI). QI constituie expri- ambiental care poate fi mai mult sau mai
marea procentual a raportului dintre vr- puin favorabil. Formarea corpului uman i
sta mental, stabilit prin teste standard, i implicit a structurilor sale nervoase se afl
vrsta real (fig. 18). sub control genetic. Neurogeneza este ns
Dup valoarea coeficientului de inteli- influenat de numeroi factori: alimentari
gen, fiinele umane pot fi caracterizate n (n special aportul de proteine), factori de
urmtoarele categorii (dup Binet i Simon): stres, diferii factori mutageni prezeni att
genii, peste 140; n timpul dezvoltrii intrauterine, ct i
inteligen foarte ridicat (foarte do- dup naterea copilului .a. Malnutriia, n
tai), 120-139; special n timpul primelor dou luni de

66
pag.051-106.qxd 8/1/2008 3:27 PM Page 67

Cyan Yellow Magenta Black pag 67

Capitolul 2
via intrauterin (cnd au loc procesele de cazuri de aneuploidie (prezena n plus sau
organogenez), iar apoi n primii doi ani de n minus a unui cromozom; tab. 8).
via n perioada post-natal, prezint con-
secine negative asupra segmentului cere- Normal Schizofrenie
bral, caracterizate prin: reducerea volumu-
lui encefalului, scderea numrului de neu-
roni, reducerea n densitate a astrocitelor
(nevroglii cu rol n procesele de memorie
i determinarea gradului de inteligen,
controlul mediului ionic al neuronilor, sta-
bilirea barierei hematoencefalice .a.).
Diverse forme ale ambientului (familial,
colar, social) condiioneaz n msur
diferit dezvoltarea posibilitilor intelec- sczut mediu nalt

tuale ale unui individ (fig. 19). Gradul de stres (mediu)


Diferitele cazuri de napoiere mental Fig. 20. Relaia dintre mediul ambiant (gradul de
prezint un determinism genetic variat stres) i ereditate (gena Ss) n determinismul
(fig. 20), putnd fi datorat unor mutaii schizofreniei. Constituia homozigot dominant
genice, restructurri cromozomale sau (SS) este predominant la indivizii normali, pe
cnd constituia homozigot recesiv (ss) este
predominant la indivizii cu schizofrenie.

Condi]ii
Morbiditate
insalubre
accentuat\
Venit redus [i
discontinuu Dezvoltare
fizic\ deficitar\
(malnutri]ie)
Alimenta]ie
nesatisf\c\toare
Nivel sc\zut
Suprapopulare
de instruire DEZVOLTARE
Familie MENTAL
numeroas\ Interes redus
Sarcini al p\rin]ilor
apropiate [i stimulare
social\ diminuat\ Fig. 19. Condiii de mediu
Mama cu probleme
afective datorit\ care influeneaz nefavorabil
instabilit\]ii familiale
dezvoltarea mental (OMS).

Tabelul 8. Determinismul genetic n unele cazuri de napoiere mental

Determinism genetic Sindrom


Autozomal dominant Acondroplazie
Neurofibromatoz
Scleroz tuberoas
Determinism Autozomal recesiv Fenilcetonurie
monogenic Galactozemie
Tirozinoz
X-linkat recesiv Sindrom Hunter
Sindrom Menkes

67
pag.051-106.qxd 8/1/2008 3:27 PM Page 68

Cyan Yellow Magenta Black pag 68

Partea a II-a

Determinism poligenic Gen autozomal Schizofrenie


Restructurri cromo- Deleii (del 5p) Maladia Cri-du-chat
zomale

Aneuploidie Autozomi Trisomia 21 (sindrom Down)


Heterozomi Sindrom triplo-X (47, XXX)
Sindrom Turner (45, XO)
Sindrom Klinefelter (47, XXY)
Sindrom XYY (47, XYY)

b. Memoria animalelor i omului. Cel mai nalt, propriu


Memoria beneficiaz de mai multe defi- omului care triete n societate, este
niii. ntr-o exprimare lapidar, memoria memoria social, care se caracterizeaz
reprezint mecanismele prin care informaia prin povestirea logic. ntre acestea dou
este stocat n creier. n concepia geneticii niveluri se situeaz memoria autistic,
comportamentului, memoria const n modi- memorie care i extrage materialele din
ficarea persistent a comportamentului, ca senzaii, din situaiile trite, dar care nu
rezultat al experienei. Memoria prezint ascult dect de legile incontientului. Ea
importan decisiv n procesele de nvare este cea care furnizeaz elementele visului
i de recunoatere a indivizilor i a obiec- i care, la psihopai, alimenteaz delirul
telor, pe baza experienei anterioare. Toate caracterizat prin faptul c trecutul nu mai
fiinele vii, chiar i animalele nevertebrate este recunoscut ca atare, ci este trit n
inferioare, au memorie. Dac se introduc prezent. Memoria autistic apare ctre
ntr-un acvariu viermi plai (plathelmini) vrsta de 3 ani. Se observ o nedifereniere
provenii de pe plaja marin, unde este a trecutului de prezent, a realului de ima-
prezent fluxul i refluxul, se constat c timp ginar. Copilul ia visurile drept realiti.
de cteva zile acetia efectueaz active Memoria social se instaleaz durabil
micri de ngropare i de ieire din nisip, odat cu dezvoltarea categoriilor logice.
micri care n mediul natural de via erau Studiile efectuate la un gasteropod
ritmate de flux i reflux (absente n acvariu). marin (Aplysia californica), au evideniat
Memoria deci fixeaz experienele trite, c n procesul de consolidare a memoriei
informaiile receptate i le restituie. pe termen scurt este implicat o protein
Se distinge o memorie imediat, o me- sintetizat de gena cAMP (E.R. Kandel i
morie ntrziat i alte multe forme de J.G. Schwartz, 1982). La Drosophila me-
memorie. Exist attea tipuri de memorie, lanogaster, gena dCREB2 codific o pro-
cte organe senzoriale sunt (memorie vi- tein (dCREBa) care activeaz transcripia
zual, auditiv, tactil .a.). genelor, care mresc abilitatea insectelor
Dup J. Delay, se pot distinge trei nive- de a consolida memoria de scurt durat,
luri ierarhice ale memoriei. Nivelul senzo- n memorie de lung durat. Izoforma
riomotor, cel mai elementar, privete ex- dCEUBb inhib acest proces (T. Tully i
clusiv senzaiile i micrile; el este comun colab., 1994).

68
pag.051-106.qxd 8/1/2008 3:27 PM Page 69

Cyan Yellow Magenta Black pag 69

Capitolul 2
c. Comportamentul prdtorilor, pn la ndeplinirea unor ro-
Reprezint totalitatea rspunsurilor unui luri precise n cadrul unei societi extrem
organism la stimuli externi i interni. de complex organizate. De exemplu, n ca-
Comportamentul unui animal poate fi ins- drul unei colonii de albine, exist diferite
tinctiv sau nvat n timpul vieii. Compor- categorii de indivizi care ndeplinesc func-
tamentul depinde att de individ, ct i de ii specifice: ngrijirea larvelor, procurarea
mediu i are ntotdeauna un sens. El cores- hranei i meninerea temperaturii potrivite
punde cutrii unei situaii sau unui obiect n stup prin bti de aripi care asigur
susceptibil s reduc tensiunile (C.L. Hull) aerisirea, aprarea coloniei (fig. 22).
i s satisfac trebuinele individului. De la
reflex, care tinde s suprime excitaia, pn
la nevroz, conceput ca o reacie neadec-
vat la angoas, toate comportamentele au
o semnificaie adaptativ.
Comportamentul nnscut este un com-
portament motenit, care se manifest n
acelai fel la toi indivizii din aceeai specie
i de acelai sex, care au crescut n con- Fig. 22. Comportament social la albine:
diii normale (fig. 21). ngrijirea matcii de c\tre albinele lucr\toare
Comportamentul social este reprezen-
Comportamentul matern este reprezen-
tat prin orice activitate comportamental
tat prin ataamentul mamei fa de proge-
manifestat de un grup de indivizi ai unei
nitura sa. C.J. Warden, n urma unei serii
specii animale, care interacioneaz ntre
de cercetri efectuate asupra obolanilor
ei. n aceast categorie se ncadreaz
albi, a artat c aceast tendin este n
o gam larg de situaii, de la deplasarea
general mai puternic dect oricare alta
n turm, pentru a minimaliza efectul
(sete, foame). Dup P.T.Young, comporta-
mentul matern s-ar explica, n mare parte,
prin necesitatea mamei de a-i deconges-
tiona glandele mamare, dureroase, prin
alptarea puilor. Dar n acest comporta-
ment intervin i ali factori, inclusiv ati-
tudinea puilor care uneori au rol activ n
regurgitarea hranei de ctre prinii lor
(psri, hiene .a.).
Cercettorii au cutat s studieze condi-
iile ataamentului mamei fa de pui. O
oaie nva s recunoasc mirosul mielului
ei la dou sau trei ore dup ftarea acestu-
ia, fenomen prezent i la pinguin, care i
recunoate puiul pe care l va hrni. La spe-
cia uman, pe lng cauzele biologice i
fiziologice, exist i cauze psihosociale
care joac un rol incontestabil n conduita
Fig. 21. Poziia de agresivitate la babuin mamei fa de progenitura sa. O femeie nu

69
pag.051-106.qxd 8/1/2008 3:27 PM Page 70

Cyan Yellow Magenta Black pag 70

Partea a II-a
va fi o mam bun dac ea nu a fost ndea- depete nlimea corpului, hiperactivi-
juns de iubit, n aa msur nct s se tate, impulsivitate i instabilitate, uneori
iubeasc ea nsi i s-i iubeasc pe ceilali tendin spre agresivitate i comportament
(fig. 23). aberant. Comportamentul aberant ar putea
fi i o consecin a unui coeficient de in-
teligen mai sczut, n comparaie cu br-
baii XY. Apariia indivizilor 2n = 47, XYY,
este determinat de obicei de o nondis-
juncie a cromozomilor Y n cea de a doua
diviziune a meiozei.
Cercetri recente au artat c n proce-
sele cognitive sunt implicate patru grupe
de gene: a) gene care codific proteine de
membran; b) gene care codific proteine
implicate n procesele de semnalizare;
c) gene care codific proteine (enzime)
care regleaz procesele de translaie;
d) gene care codific factorii de transcripie.
Unele proteine de membran, codificate
de prima categorie de gene, se cupleaz cu
integrinele (proteine), formnd complexe
transmembranare implicate n semnali-
zarea sinaptic i desfurarea proceselor
cognitive. S-a demonstrat c mutaia aces-
tor gene la Drosophila melanogaster con-
Fig. 23. Comportament matern. Mama adopiv duce la pierderea memoriei. La om, mutaia
hrnete puiul de cuc, care are o talie mai mare genei conduce la o form de retard mental,
dect a ei. legat de cromozomul X. n mod similar,
mutaii ale genelor din celelalte trei grupe
Comportamentul de agresivitate la om conduc la diferite tulburri congnitive,
(brbat) poate fi indus de prezena supli- afectarea procesului de nvare i memo-
mentar a cromozomului Y. S-a constatat rie, diferite forme de retardare mental .a.
ca brbaii avnd cariotip 2n = 47, XYY, se Mutaiile de gene pot conduce la restruc-
caracterizeaz, n general, prin talie nalt turri cromozomiale (translocaii, deleii),
(peste 180 cm nlime), alonja minilor datorit ruperii cromozomilor.

LUCRRI PRACTICE TRANSMITEREA


N DESCENDEN A UNOR BOLI GENETICE
Boli cu transmitere autozomal dominant\ a) Un cuplu tn\r, n care tat\l he-
Analiza]i figura 7 (pag. 59), privind trans- terozigot este afectat de boala Marfan, iar
miterea n descenden]\ a eredit\]ii auto- mama este s\n\toas\, a avut un copil pier-
zomal dominante, caracteristice unor maladii dut din alte cauze. Care este [ansa acestui
ca: boala Marfan, boala (choreea) Huntington. cuplu de a avea copii s\n\to[i sau afecta]i?

70
pag.051-106.qxd 8/1/2008 3:27 PM Page 71

Cyan Yellow Magenta Black pag 71

Capitolul 2

b) n cazul unui cuplu n care unul din- descenden]ei, precum [i fenotipul acesto-
tre parteneri (mama) are n ascenden]\ ra, n cazul bolilor X-linkate cu transmitere
rude care au manifestat choreea Hunting- dominant\ sau recesiv\ n descenden]\. V\
ton, descenden]ii pot fi s\n\to[i sau afecta]i? reamintim c\ ntre bolile X-linkate domi-
Defini]i fenomenul de penetran]\ incom- nante se afl\ rahitismul hipofosfatemic
plet\ [i prin ce se caracterizeaz\ acesta. rezistent la vitamina D, iar ntre bolile
Boli cu transmitere autozomal recesiv\ X-linkate recesive se afl\ daltonismul, hemo-
Analiza]i figura 10 (pag. 60), privind filia A, distrofia muscular\ Duchenne [.a.
transmiterea n descenden]\ a eredit\]ii a) Dac\ tat\l manifest\ afec]iunea
autozomal recesive. Prezenta]i constitu]ia rahitism hipofosfatemic, iar mama este
genetic\ a p\rin]ilor [i analiza]i probabili- s\n\toas\, care este [ansa de a avea copii
tatea descenden]ei acestora din punct de bolnavi? Este afectat\ sau nu n mod egal
vedere genotipic [i fenotipic, n urm\toa- descenden]a de ambele sexe? Dar n ca-
rele cazuri: fenilcetonuria, beta-talasemia, zul n care mama heterozigot\ manifest\
surditatea [.a. afec]iunea, iar tat\l este s\n\tos?
a) Mama manifest\ beta-talasemie, iar b) Dac\ mama este purt\toare a genei
tat\l este purt\tor al genei. Care este pentru daltonism, iar tat\l este s\n\tos,
[ansa de a avea copii afecta]i? Dar n cazul care va fi [ansa acestui cuplu de a avea n
n care tat\l este s\n\tos? descenden]\ copii s\n\to[i, purt\tori sau
b) Se va analiza descenden]a posibil\ a afecta]i? Sunt afecta]i n mod egal descen-
unui cuplu n care mama este purt\toare den]ii de ambele sexe sau nu?
(dar nu manifest\ boala), ns\ unul din c) Dac\ tat\l este afectat, iar mama
p\rin]ii so]ului s\u a manifestat afec]iunea este s\n\toas\, care va fi descenden]a
fenilcetonurie. Prin ce se caracterizeaz\ posibil\? Dar dac\ tat\l hemizigot este
aceast\ afec]iune [i care este probabili- afectat, iar mama este purt\toare, care va
tatea de a avea copii s\n\to[i, bolnavi sau fi descenden]a posibil\ a cuplului? Indi-
purt\tori? vizii din care sex vor fi mai afecta]i [i din
Boli X-linkate ce cauz\?
Analiza]i figura 12 (pag. 61) [i stabili]i d) Pot fi analizate diferite alte cazuri
constitu]ia genetic\ a genitorilor [i a existente printre cuno[tin]ele voastre.

TEST DE EVALUARE
1. Stabili]i cazul n care muta]iile domi- a. este specific unui singur sex; b. apare cu
nante determin\ un fenotip: a. dac\ se afl\ n frecven]\ egal\ la ambele sexe; c. apare cu
stare homozigot\ (AA): b. dac\ se afl\ n sta- o frecven]\ mai mare la unul din sexe;
re heterozigot\ (Aa); c. dac\ se afl\ n stare d. este determinat de o gen\ sex-linkat\;
homozigot\ (AA) sau heterozigot\ (Aa). e. este determinat de o gen\ autosomal\;
2. Specifica]i care dintre urm\toarele f. reprezint\ o anomalie numeric\ cromo-
afirma]ii se refer\ la sindromul Down: zomial\.

71
pag.051-106.qxd 8/1/2008 3:27 PM Page 72

Cyan Yellow Magenta Black pag 72

*Diversitatea

3 genetic uman
Capitolul

genetica raselor
umane

1. Originea i evoluia omului


Potrivit concepiilor actuale, procesul australopitecilor a evoluat pe linia umanizrii,
de evoluie a omului a fost marcat de patru parcurs de speciile Homo habilis, Homo
evenimente majore: trecerea de la viaa ar- erectus i Homo sapiens (fig. 24). Acest
boricol la viaa terestr, locomoia biped proces este caracterizat prin creterea pro-
ca rezultat al vieii terestre, encefalizarea gresiv a capacitii cutiei craniene,
(mrirea volumului encefalului) i civiliza- apariia limbajului articulat (proces n care
ia. Strmoul comun al maimuelor antro- este implicat gena FOX-P2), utilizarea
poide actuale i al omului a trit n urm cu minii pentru prelucrarea diferitelor mate-
810 milioane de ani. Separarea celor dou riale i confecionarea de unelte i arme,
linii evolutive, care a condus la apariia mbrcminte .a., descoperirea i folosi-
maimuelor antropoide actuale i a omului rea focului, organizarea social.
modern ar fi avut loc acum 6 milioane ani. Homo habilis (omul ndemnatic), pro-
Cele mai vechi forme pe calea umanizrii ductor de unelte, era biped, schelet fragil,
au fost speciile genului Australopithecus, capacitatea cutiei craniene ntre 500800 cc,
care au aprut n Africa acum 4 milioane de faa mai puin prognat.
ani i s-au perpetuat timp de 23 milioane Homo erectus a trit acum 1 800 000
de ani. Acum 2 milioane de ani, o ramur a 300 000 ani, fiind depistat n diferite pri

7 milioane de ani i Homo Sapiens

Ardipithecus ramidus Kenyanthropus


Ardipithecus kadabba platyops
Orrorin tugenensis
Sahelanthropus tchadensis Australopithecus anamensis
(Toumai)
Australopithecus afarensis
(Lucy)

6 mil. MIOGEN 5 mil. PLIOGEN 4 mil.

Fig. 24. O schi a evoluiei pe calea umanizrii, pornind de la Australopithecus (Pliocen)

72
pag.051-106.qxd 8/1/2008 3:27 PM Page 73

Cyan Yellow Magenta Black pag 73

Capitolul 3
ale Globului, n Africa i Asia (Java, China). celor dou linii evolutive (Homo sapiens
Avea mers biped, schelet robust, capacitatea neanderthaliensis i Homo sapiens sapiens)
cutiei craniane ntre 7801225 cc, tria n s-ar fi produs cu 370 000500 000 ani n
colectiviti i avea limbaj articulat, con- urm, iar genomul nostru are o structur
feciona i utiliza unelte, folosea focul. asemntoare cu cel al neanderthalienilor
Homo sapiens arhaicus (omul inteli- ntr-o proporie mare (analizele pariale
gent arhaic) a aprut n urm cu 500 000 de avanseaz cifra de 99,5%).
ani. Avea scheletul mai puin robust, cra- Homo sapiens sapiens a aprut acum
niul mai rotunjit, capacitatea cutiei craniene 200 000 de ani n Africa, ajungnd n Europa
de 1 300 cc, mrimea dinilor diminuat. n urm cu 40 000 de ani. Populaiile primi-
Homo sapiens neanderthaliensis a trit tive ale lui Homo sapiens prezentau trs-
cu 350 00030 000 ani n urm, prima fosil turile anatomice ale omului actual: talia ntre
fiind gsit n Germania, pe valea rului 160180 cm, schelet fragil, capacitate cra-
Neander. El avea corpul robust, masiv, nian medie de 1 600 cc, frunte nalt, arcade
capacitatea cutiei craniene de circa 1 450 cc, sprncenare slab dezvoltate, pilozitate re-
fiind adaptat la viaa n condiii de climat dus. Faa era ns uor prognat, brbia
rece i aspru. Tria n colectiviti, i con- proeminent, dinii relativ mari. Acum
feciona unelte, folosea focul i i realiza 50 000 de ani, n urma unei mutaii, s-a mrit
mbrcminte din pieile animalelor. Este plasticitatea creierului, ceea ce a condus la
considerat o form de Homo sapiens arha- dezvoltarea capacitilor i abilitilor sale n
icus. Poziia filogenetic a neandertha- procesul de prelucrare a materialelor i
lienilor este controversat, unii savani con- obinere a unor unelte i arme eficiente.
siderndu-l stins fr urmai, iar alii un pre- Tria n grupuri, i confeciona mbr-
decesor direct al lui Homo sapiens sapiens. cminte, unelte i arme perfecionate, avea
Progresele recente n genetica molecular preocupri artistice. Omul de Cro-Magnon
au permis noi abordri i interpretri (2006, este considerat primul reprezentat al speciei
2007). Analiza osemintelor vechi de 38 000 Homo sapiens sapiens n Europa (acum
de ani gsite ntr-o grot din Croaia (Vindija), 40 000 de ani). Reexaminarea n anul 2006 a
provenind de la Homo sapiens neandertha- unui craniu gsit n Romnia, susine aparte-
liensis, a permis descifrarea genomului nena acestuia la un hibrid ntre omul de
mitocondrial i nuclear. Cercetrile efectu- Neanderthal i omul de Cro-Magnon. Aceas-
ate de dou echipe din Germania i S.U.A., t constatare ridic noi aspecte privind
au adus informaii tulburtoare. Separarea evoluia liniei umane.
Homo Homo
ergaster floresiensis
Homo
gerogicus
(de Dmanisi)

Australopithecus
garhi
Australopithecus
bahrelghazali
(Abel) Homo rudolfensis Homo erectus
Homo
Homo neandertalensis
Homo habilis Homo antecessor heildelbergensis
Homo sapiens

Paranthropus robustus
Paranthropus aethiopicus
(Australopithecus?) Paranthropus boisei
Australopithecus africanus
3 mil. PLIOGEN 2 mil. PLEISTOGEN 1 mil. 00

Fig. 24. (continuare)

73
pag.051-106.qxd 8/1/2008 3:27 PM Page 74

Cyan Yellow Magenta Black pag 74

Partea a II-a

2.2. Formarea raselor umane


Originea oamenilor moderni este expli-
cat prin mai multe ipoteze, dou fiind pre-
dominante. Ipoteza multiregional consi-
der ca Homo erectus a prsit Africa acum
1 500 000 de ani, evolund spre specia
Homo sapiens ntr-un timp ndelungat
(circa 1 000 000 de ani), n zone geografice
diferite (Africa, Europa i Asia), indepen-
dent i simultan, formnd populaiile dis-
tincte. Aceast ipotez are n prezent puini Fig. 26. Migraia populaiilor umane moderne
adepi. Ipoteza uniregional (Out of Africa) din regiunea sub-saharian
consider c specia Homo sapiens a aprut
numai n Africa, de unde a migrat n celelalte urmat dou direcii. O ramur a migrat
continente, nlocuind populaiile de supra- spre Nordul Europei (cele mai vechi fosile
vieuitori ale speciei Homo erectus (fig. 25). datnd de 40 000 de ani n Europa), iar alta
Dispersia populaiilor umane din Africa spre estul i sudul Asiei (cele mai vechi
sub-saharian a nceput acum 100 000 de fosile datnd de 67 000 de ani). De aici ei
ani (fig. 26). Cele mai vechi fosile ale omu- au trecut n Oceania i Australia (cele mai
lui modern (Homo sapiens sapiens) gsite vechi fosile datnd de 40 00060 000 de
n Africa dateaz de circa 130 000 de ani. ani). Migraia final a avut loc din Asia de
Marea migraie din Africa a strmoilor est, prin strmtoarea Behring n America
actualelor rase umane a avut loc acum de Nord (fosile datnd de 20 000 de ani) i
100 000 de ani, datare bazat pe secvena n final n America de Sud (fosile vechi de
genelor din ADN nuclear i pe datele arhe- 13 000 de ani).
ologice. Marea migraie a fost iniial direc- Populaia uman modern este deci
ionat spre Orientul Mijlociu, de unde au originar din Africa sub-saharian, datnd

Africa/ Africa/ Africa/


Orientul Orientul Orientul
Europa Apropiat Asia Europa Apropiat Asia Europa Apropiat Asia

IPOTEZ UNIREGIONAL
IPOTEZ RETICULAT OUT OF AFRICA IPOTEZ MULTIREGIONAL

Fig. 25. Ipoteze privind originea oamenilor moderni

74
pag.051-106.qxd 8/1/2008 3:27 PM Page 75

Cyan Yellow Magenta Black pag 75

Capitolul 3
de circa 100 000 de ani. Diferenele de
nucleotide nregistrate n ADN-mt au per-
mis reconstituirea relaiilor istorice proba-
bile printre populaiile umane. La o rat a
substituiei de nucleotide n molecula de
ADN-mt, de 1 substituie/3 800 de ani, nu-
mrul mediu de diferene ntre dou
secvene de ADN-mt provenind de la des- Fig. 27. Principalele rase umane
cendenii din marea migraie este de
aproape 50, ntr-o molecul cu lungimea
total de 16,5 kb. Cu alte cuvinte, mole- Rasa european (caucazian) cuprinde
culele noastre de ADN-mt sunt identice n populaiile originare din Europa, Asia de Sud
procent de 99,7%. i Africa de Nord. Este caracterizat prin fa
Ca urmare direct a marii migraii au oval, nas proeminent, pr moale, drept sau
aprut rasele umane, datorit izolrii geo- ondulat, culoarea prului de la blond la
grafice i socio-culturale (factori principali negru, pilozitatea pielii de obicei accentuat,
fiind limbajul i religia). culoarea tegumentului de la deschis n nor-
Rasa este un grup subspecific distinct dul Europei, la mslinie n sudul Europei.
fenotipic i/sau geografic, constituit din Rasa mongoloid cuprinde populaiile
indivizi care ocup o regiune geografic originare din Asia Central i de Est, Indo-
i/sau ecologic definit i care prezint nezia, Siberia i America. Prezint figur
caracteristici fenotipice i frecven de lit, ochi alungii, pr drept, negru, puternic,
gene, prin care se disting de alte asemenea pilozitatea tegumentului redus, culoarea
grupuri. tegumentului de la glbui la brun-roietic.
Rasele se deosebesc ntre ele printr-o Rasa australo-negroid cuprinde popu-
serie de caracteristici morfologice, ns laia btina din cea mai mare parte a Afri-
prezint i numeroase forme intermediare cii, Australia, Noua Guinee i Micronezia.
caracteristice. Rasele sunt identice ns din Forma feei este variat, nasul de obicei este
punct de vedere al caracteristicilor i capa- lit i plat, prul de obicei nchis la culoare
citilor umane, avnd aceeai ans de a i cre, pilozitatea corporal extrem de
evolua. Indivizii aparinnd unor rase dife- redus, tegumentul foarte nchis la culoare.
rite se pot ncrucia ntre ei, avnd descen- Ali autori consider drept rase distincte cele
deni fertili. Prezint aceleai grupe sangvi- dou ramuri, respectiv rasa negroid exis-
ne i manifest aceleai boli i parazii. Ma- tent n cea mai mare parte a Africii i rasa
joritatea oamenilor de tiin consider c australoid, care se afl n restul teritoriului
exist trei rase umane principale (fig. 27). (Australia, Noua Guinee i Micronezia).

3. Dovezi ale geneticii moleculare n procesul


de umanizare
n studiile de paleogenetic este utilizat existena a numeroase experimente
ADN-mt, care confer mai multe avantaje: efectuate pe ADN-mt uman;
abundena ADN-mt (mai mult de absena contaminrii ADN-mt de ctre
1 000 de molecule pe celul), n comparaie ADN-nuclear n eantioanele analizate;
cu ADN-nuclear (2 molecule pe celul);

75
pag.051-106.qxd 8/1/2008 3:27 PM Page 76

Cyan Yellow Magenta Black pag 76

Partea a II-a
transmiterea pe linie matern a
ADN-mt n succesiunea de generaii;
acumularea mutaiilor la nivelul
ADN-mt permite stabilirea evoluiei;
ADN-mt nu sufer proces de recom-
binare genetic, variabilitatea fiind indus
numai de existena mutaiilor, produse la o
rat constant (1 mutaie/3 800 ani).
Pe lng ADN-mt, a fost utilizat n
acelai scop ADN-nuclear. Analiza ADN
nuclear la omul actual i la omul de Cro-
Magnon din Europa (populaie de acum
40 000 de ani), a evideniat corespondena
ntre secvenele acestora, fapt care sprijin
nrudirea dintre ei.
Studii citogenetice comparative, efectu-
ate la om i la maimuele antropoide
actuale, au evideniat att existena unei
diferene numerice (2n = 48 la maimuele
antropoide actuale i 2n = 46 la om), ct i
mecanismul de evoluie a numrului de
cromozomi. Analiza cromozomilor bandai
la om i cimpanzeu a evideniat existena
unei fuziuni telomerice a dou perechi de
cromozomi la cimpanzeu, proces care a
condus la apariia perechii 2 de cromozomi
Fig. 28. Originea cromozomului uman 2, prin
umani (fig. 28). De asemenea, exist o fuziunea a doi cromozomi de la cimpanzeu
mare asemnare ntre cromozomii din (stnga). Comparaie ntre cromozomii umani 5
perechea 5 la om i cimpanzeu. de la om i cimpanzeu (dreapta).

4. Implicaii genetice n caracterizarea raselor umane


Originea omului i a raselor umane a fost localizare geografic, provin de la un Adam
analizat i prin utilizarea metodelor i de la o Eva, originari din Africa (fig. 29).
geneticii moleculare. n acest scop, au fost Analiznd numrul de mutaii existente n
efectuate analize de genetic molecular la constituia ADN-mt, s-a stabilit c\ ipotetica
indivizi provenii din toata lumea. S-a analizat Eva a trit n Africa acum 140 000200 000 de
secvena ADN-mt (care se transmite pe linie ani. Se evideniaz existena a dou linii fun-
matern, de la o Ev ipotetic) i a ADN din damentale: una african, ntlnit numai n
cromozomul Y (care se transmite numai pe Africa i alta care include att populaia
linie patern, de la un Adam ipotetic). Datele african, ct i populaia non-african. n
obinute au fost prelucrate cu ajutorul com- mod similar, analiza ADN din cromozomul Y
puterului, ajungndu-se la concluzia c toi a stabilit c ipoteticul Adam a trit n Africa
brbaii i toate femeile, indiferent de ras i acum 100 00050 000 de ani.
76
pag.051-106.qxd 8/1/2008 3:27 PM Page 77

Cyan Yellow Magenta Black pag 77

Capitolul 3
populaiile de primate sau ntre populaiile
altor specii de animale.
Diversitatea genetic limitat a popu-
laiilor umane este datorat att timpului
scurt de evoluie, ct i schimburilor ge-
nice datorate migraiei populaiilor umane.
Populaiile umane sunt similare genetic,
deoarece au originea recent i nu au avut
timpul necesar pentru a-i fixa diferenele
genetice aprute prin mutaie. n prezent,
acest aspect nu mai este posibil, datorit
deplasrii rapide a indivizilor din diferite
populaii i al schimbului masiv de material
genetic ntre populaiile umane.
Diferenele dintre populaiile umane au
la baz mutaiile genetice, selecia unor anu-
mite mutaii sub influena factorilor de me-
diu caracteristici diferitelor zone geografice,
izolarea reproductiv .a. De exemplu, are-
alul populaiei umane din Eurasia a fost divi-
zat n trei regiuni separate de zonele mun-
toase neospitaliere ale Munilor Himalaia i
Altai. n cele trei regiuni, populaia uman a
evoluat diferit, ducnd la predominana unor
tipuri morfologice distincte. n mod similar,
populaia din PapuaNoua Guinee a fost izo-
lat genetic de populaia aborigen din
Fig. 29. Arborele filogenetic al populaiilor Australia cnd au fost colonizate aceste
africane i nonafricane areale, aproximativ cu 40 000, respectiv
30 000 de ani n urm. Timpul total pentru
Studiul variaiilor genetice n cadrul evoluie a fost astfel de 70 000 de ani (40 000
populaiilor actuale a evideniat c ntre de ani n PapuaNoua Guinee i 30 000 de
diferitele rase umane exist mai multe ase- ani n Australia). Dac schimbarea unei nu-
mnri dect deosebiri. Cercetrile desf- cleotide se produce la 3 800 de ani, numrul
urate n cadrul Proiectului Diversitii mediu al diferenelor n ADN-mt la actualii
Genetice Umane (iniiat n anul 1996), au locuitori din PapuaNoua Guinee i la abori-
permis mai multe constatri: genii din Australia este ateptat la valoarea
diversitatea genetic din cadrul unei de 18,4 nucleotide, cu o oarecare variabili-
populaii naturale, depete cu mult dife- tate statistic (o pereche de nucleotide).
renele genetice dintre populaii; Deci, rata evoluiei ADN-mt poate fi
diversitatea genetic cea mai mare a folosit pentru a stabili diferenele exis-
fost constatat ntre populaiile africane, tente ntre populaiile umane. Numrul
acestea avnd originea mult mai veche; diferenelor existente n perechile de nu-
diversitatea genetic uman (mitocon- cleotide pe populaie este utilizat pentru a
drial i nuclear) este mai redus com- estima timpul (numrul de ani) trecut de la
parativ cu diversitatea constatat ntre separarea populaiilor.

77
pag.051-106.qxd 8/1/2008 3:27 PM Page 78

Cyan Yellow Magenta Black pag 78

Partea a II-a

LUCRRI PRACTICE NTOCMIREA


ARBORELUI GENEALOGIC
Arborele genealogic constituie brbat normal femeie normal\
reprezentarea grafic a legturilor de brbat heterozigot femeie heterozigot\
femeie bolnav\
rudenie ntre membrii unei familii, pe brbat bolnav
trei femei s\n\toase
parcursul mai multor generaii. Cu aju- n\scut mort
decedat
torul su putem stabili modul de tran- avort spontan

smitere n descenden a caracteristi- c\s\torie sex necunoscut

cilor ereditare normale sau patologice copil nelegitim femeie ns\rcinat\


[n descendena unui cuplu parental].
ntocmirea arborelui genealogic pre- c\s\torie consangvin\
gemeni dizigo]i
supune efectuarea unei anchete fami- f\r\ urma[i
liale, urmat de reprezentarea grafic
gemeni monozigo]i
a relaiilor dintre indivizi i realizarea trei copii rezulta]i
dintr-o c\s\torie
arborelui genealogic, care arat rela-
iile dintre indivizi pe parcursul mai proband
gemeni cu zigo]ie
incert\
multor generaii. femeie purt\toare
examinat personal
Ancheta familial este efectuat n sco- (nu exprim\ defectul)
divor]at
pul culegerii datelor de interes, care sunt purt\tor asimptomatic

nregistrate n fia personal. Ea ncepe cu diagnostic prenatal adoptat


cu avort selectat
un proband (propositus, sau caz primar),
descoperit ntmpltor, care este purttor Fig. 30. Semne convenionale utilizate n cons-
al unui caracter particular. De la proband, truirea arborilor genealogici
se reconstituie ascendena i descen-
dena, pe linie direct i colateral. Linia reprezentare grafic prin semne con-
direct cuprinde prinii, bunicii, strbunicii i venionale (fig. 30), prin stabilirea relaiilor
descendena probandului. Linia colateral dintre indivizii care reprezint ascendena i
cuprinde fraii probandului i descendena descendena probandului, fiind ntocmit
lor, unchii, mtuile i descendena lor. Se arborele genealogic. Analiza acestuia ne
noteaz informaii privind persoanele n via ofer informaii asupra modului de trans-
i decedate, condiii de via i loc de munc, mitere n descenden\ a diferitelor carac-
stare de gemelaritate, avorturi spontane, tere, determinate de gene dominante sau
afeciuni ereditare, stri de consangvinizare recesive plasate pe autozomi sau pe hetero-
.a. Pentru o ilustrare explicit, este utilizat o zomi (fig. 31, 32).
I I
1 2
Mm Mm XDX XY

II II
1 2 3 4
Mm Mm Mm mm XDX XX XDX XY

III III 1 2 3 4
XX XDX XDX XY
Mm Mm Mm m
IV
IV 1
XDY
mm mm
Fig. 31 Arbore genealogic pentru ereditatea Fig. 32 Arbore genealogic pentru
autosomal recesiv\ ereditatea X-linkat recesiv\

78
pag.051-106.qxd 8/1/2008 3:27 PM Page 79

Cyan Yellow Magenta Black pag 79

Mutageneza
i teratogeneza.

4 Anomalii
Capitolul

cromozomiale
asociate cancerului

1. Mutageneza i agenii mutageni


Mutaiile pot aprea n orice celul i afectat (genice, cromozomiale sau geno-
pot prezenta o gam larg de efecte mice), tipul de celule n care sunt prezente
fenotipice, de la alterri minore, care pot fi (mutaii somatice sau gametice), modul n
detectate numai prin metode biochimice, care sunt exprimate, efectul lor asupra
pn la modificri ale metabolismului, care organismului .a.
pot provoca moartea celulelor i a organis- Mutaiile genice induc schimbri n
mului. Efectul mutaiilor este determinat ordinea nucleotidelor. Dac este afectat un
de tipul de celule n care apar, stadiul ciclu- singur nucleotid, mutaia este punctiform.
lui celular sau stadiul de dezvoltare al orga- Dependent de poziia nucleotidului n codon,
nismului n care acioneaz factorul muta- efectul mutaiei punctiforme este diferit. n
gen, starea de dominan sau recesivitate a urma unei mutaii punctiforme, codonul
genei afectate .a. O mutaie recesiv este mutant poate determina poziia aceluiai
detectat n generaiile ulterioare, n timp aminoacid (mutaie silenioas), codonul
ce o mutaie dominant este detectat n mutant poate determina includerea unui alt
generaia n care s-a produs. aminoacid, putnd fi schimbat structura
Agentul mutagen este orice agent de proteinei sintetizate (mutaie missens) sau
mediu care determin creterea numrului codonul mutant devine codon stop i sinteza
de mutaii ntr-o populaie (fig. 33). Agenii
mutageni opereaz fie prin inducerea de
modificri n molecula de ADN (deci n
structura genei), fie prin inducerea leziu-
nilor cromozomiale. Diferite chimicale (col-
chicina) i diferite tipuri de radiaii (radiaiile
X), au fost identificate ca fiind mutagene.
Mutaiile pot fi clasificate dup diferite
criterii: modul de apariie (spontane sau Fig. 33. Explozia submarin a unei bombe atomi-
induse), cantitatea de material genetic ce de tipul Hiroshima (arhipelagul Bikini, 1946)

79
pag.051-106.qxd 8/1/2008 3:27 PM Page 80

Cyan Yellow Magenta Black pag 80

Partea a II-a

Specificare Secven aminoacizi


TTG TTG TTG TTG
Secvena duplex original
xxx xxx xxx xxx
AAC AAC AAC AAC
Aminoacid codificat
Leu Leu Leu Leu
TTG TTG TTT TTG
xxx xxx xxx xxx
Substituie (G T)
AAC AAC AAA AAC
Leu Leu Phe Leu
Retromutaie Identic cu originalul
TTG TTG CTT TTG
xxx xxx xxx xxx
Tranziie (TTG CTT)
AAC AAC GAA AAC
Leu Leu Leu Leu
TTG TTG TTT GTT
Adiie (+T) xxx xxx xxx xxx
(inserie) AAC AAC AAA CAA
Leu Leu Phe Val

TTG TTT TGT TGT
xxx xxx xxx xxx
Deleie (G)
AAC AAA ACA ACA

Leu Phe Cys Cys
Inversie
TTG TTT GTT GTG
xxx xxx xxx xxx
AAC AAA CAA CAC

Leu Lys Gln His

Fig. 34. Principalele tipuri de mutaii genice

catenei polipeptidice este oprit (mutaie unei mutaii cromozomiale este explicat
non-sens). Principalele tipuri de mutaii prin mai multe ipoteze: ipoteza ruptur-
genice sunt prezentate n figura 34. reunire, ipoteza regiunilor de instabilitate
Mutaiile cromozomiale afecteaz struc- .a. Conform primei ipoteze, sub aciunea
tura i funcia cromozomului, ordinea ge- unui factor mutagen, de-a lungul cromo-
nelor fiind schimbat sub aciunea facto- zomului se produc rupturi. Majoritatea
rilor mutageni. Efectul este dependent de rupturilor se reunesc n poziie iniial,
mrimea cromozomului afectat, genele fiind refcut structura normal a cromo-
implicate .a. Mecanismul de producere a zomului (fenomenul de restaurare). O

80
pag.051-106.qxd 8/1/2008 3:27 PM Page 81

Cyan Yellow Magenta Black pag 81

Capitolul 4

A. ABERAII INTRACROMOZOMIALE

Deleie

Duplicaie

Inversie
pericentric

Inversie
paracentric

B. ABERAII INTERCROMOZOMIALE

Translocaie
reciproc

Fuziune

Fisiune

Fig. 35. Principalele tipuri de mutaii intracromozomiale (A) i intercromozomiale (B)

parte din rupturi pot rmne ca atare sau om, au fost raportate puine cazuri cnd
interacioneaz ntre ele, conducnd la deleiile au fost viabile, producnd ns
modificri n structura i funcia cromo- malformaii grave. Astfel, pierderea unui
zomului, deci la apariia mutaiilor cromo- mic segment din braul scurt al cromo-
zomiale. Principalele tipuri de mutaii cro- zomului din perechea 5 (notat -5p sau
mozomiale sunt prezentate n figura 35. 5pdel), caracterizeaz maladia Cri-du-chat.
Deleia const n pierderea unui seg- Duplicaia se caracterizeaz prin pre-
ment terminal sau intercalar de cromo- zena unui mic segment de cromozom n
zom. Dependent de perechea de cromo- stare dubl. Inversia const n inversarea
zomi implicat i de mrimea segmentului ordinii genelor dintr-un segment de cro-
afectat, efectul deleiei poate fi diferit. La mozom cu 180. Din grupul mutaiilor

81
pag.051-106.qxd 8/1/2008 3:27 PM Page 82

Cyan Yellow Magenta Black pag 82

Partea a II-a
intercromozomiale, fac parte translocaiile neomologi, cromozomi inelari, dicentrici,
reciproce (transfer reciproc de segmente fragmente acentrice de cromozom .a.
ntre cromozomi neomologi) i translocai- Mutaiile genomice constau n multipli-
ile nereciproce, fuziuni (unirea a doi cro- carea ntregului genom (poliploidia), sau n
mozomi care prezint centromerii n regiu- prezena unor cromozomi n plus sau n
nea terminal) i fisiuni cromozomiale minus (aneuploidia). La om, cazuri de poli-
(ruperea unui cromozom, ntlnit la specii ploidie au fost depistate numai la embrionii
care prezint cromozomi cu centromeri avortai. Cazurile de aneuploidie viabile au
multipli sau cu centromer difuz). fost depistate n cazul heterozomilor i al
n urma mutaiilor cromozomiale re- cromozomilor mici, (la adolescen sau ma-
zult cromozomi cu deficit de gene (dele- turitate ajungnd numai indivizii cu sindrom
ie), prezena unei gene n stare dubl (du- Down trisomia 21). Dup unii autori, fenotip
plicaii), inversarea poziiei genelor pe cro- similar sindromului Down este ntlnit i n
mozom, schimb de gene ntre cromozomi cazul trisomiei 22 (populaia asiatic).
Absena cromozomului X nu este compati-
bil cu viaa.

2. Teratogeneza i agenii teratogeni


Teratogeneza reprezint totalitatea organe, respectiv n intervalul dintre zilele
mecanismelor care determin producerea 1256 de dezvoltare intrauterin.
de malformaii la embrion sau la fetus. Astfel, n primul trimestru al sarcinii,
Agent teratogen este orice factor de medicamentul warfarin (utilizat pentru
mediu care acioneaz asupra ftului uman, tratamentul unor maladii sangvine), poate
determinnd anomalii congenitale. Ca cauza sindrom fetal warfarin (chondrodis-
exemple, se pot cita radiaiile ionizante din plazia punctat, hipoplazie nazal), iar n
timpul sarcinii (radiaii X), carenele ali- cazul aciunii n stadiile ulterioare ale
mentare, unele medicamente (thalidomi-
da), substanele chimice toxice i infeciile
virale materne (rubeola), testele hor-
monale efectuate n timpul sarcinii, con-
sumul mare de alcool .a. n tabelul 9, sunt
prezentate principalele grupe de ageni te-
ratogeni i principalele efecte care le
induc. Muli ageni carcinogeni sunt n
acelai timp ageni mutageni (fig. 36).
Un agent teratogen determin malfor-
maii numai dac acioneaz n perioada
cnd embrionul este sensibil la efectele
sale. Deci agenii teratogeni acioneaz
ntr-un mod comparabil cu acela al genelor
mutante, putnd interfera cu procesele de
embriogenez n timpul stadiilor critice ale Fig. 36. Efectul thalidomidei: absena segmen-
dezvoltrii. Aceste stadii corespund cu tului terminal al membrului superior (phoco-
momentul formrii primordiilor diferitelor melie)

82
pag.051-106.qxd 8/1/2008 3:27 PM Page 83

Cyan Yellow Magenta Black pag 83

Capitolul 4
Tabelul 9 . Efectele induse de unii ageni teratogeni la om
Agent teratogen Efecte induse
Alcool Cretere ntrziat, microcefalie, retard mental
Medicamente, droguri
Anti-tiroide Hipotiroidism
Chloroquina Surditate
Antagoniti ai acidului folic Malformaii ale sistemului nervos central
Teste hormonale n timpul sarcinii Diverse malformaii
Fenitoin Despicarea buzei superioare [i a palatului
Progestine Virilizare
Retinoide (vitamin A i substane Sindrom retinoid fetal (microcefalie, micro-
nrudite) ftalmie, boli congenitale ale inimii)
Fum de igar ntrzierea creterii
Streptomicin Surditate
Thalidomid Focomelie
Acid valproic Malformaii ale sistemului nervos central
Warfarin Sindrom fetal warfarin (chondrodisplazie punc-
tat, hipoplazie nazal)
Infecii
Cytomegalovirus Microcefalie
Herpes virus Microcefalie, choreoretinit, microftalmie
Rubeol Boli congenitale ale inimii, surditate, cataract
Toxoplasm Microcefalie, chorioretinit
Varicel Microcefalie, hipoplazia membrelor
Boli ale mamei
Diabet Agenezie sacral
Fenilcetonurie Retard mental
Radiaii
Radiaii X Microcefalie

sarcinii, el va produce deficiene ale sis- gen, momentul organogenezei n care aces-
temului nervos central. ta acioneaz, durata expunerii la agentul
Producerea malformaiilor depinde de teratogen i doza n care se afl acesta, par-
mai muli factori: natura agentului terato- ticulariti genetice ale embrionului .a.

3. Fenotipul cancerului. Tipuri de cancer


n termeni generali, cancerul este ca- Cancerul este o boal genetic produs
racterizat prin proliferarea necontrolat a de orice perturbare a dezvoltrii celule-
celulelor. lor, care are drept consecin invazia i

83
pag.051-106.qxd 8/1/2008 3:27 PM Page 84

Cyan Yellow Magenta Black pag 84

Partea a II-a
distrugerea esutului sntos din jur, de cromozomilor sau al numrului de cromo-
ctre celulele anormale. Celulele can- zomi. Instabilitatea genetic se manifest
ceroase provin din celule normale care au prin creterea numrului de mutaii, ampli-
suferit modificri ireversibile. Ele se multi- ficarea genelor, rearanjamente cromozomi-
plic mult mai rapid dect celulele normale ale sau aneuploidie. Mutaiile sunt produse
ale organismului i nu par a fi supuse unui ntr-o populaie celular care este eterogen
control nervos sau hormonal. Prin sistemul din punct de vedere genetic. n aceast
sangvin sau limfatic, ele se pot rspndi n populaie, orice celul care posed un avan-
orice alt parte a organismului, unde vor taj proliferativ, va fi reprezentat mai mult
produce ulterior leziuni ale esutului (meta- numeric n descendena celular. Mutaiile
staz). Tumora malign este un nume uti- succesive produse n descendena acestei
lizat pentru cancer. Un cancer care se for- celule, precum i expansiunea clonal a
meaz n epitelii este denumit carcinom, n celulelor derivate din ea mresc riscul ca o
timp ce acela ntlnit n esutul mezenchi- clon celular cu capacitate replicativ nalt
mal este denumit sarcom. Cancerul globu- s determine un tip de cancer (fig. 37).
lelor albe este numit leucemie, limfom este Multe cancere sunt rezultatul unei
cancerul esutului limfoid, iar mielom este alterri n controlul ciclului celular, parti-
cancerul celulelor plasmei i al mduvei culariti n controlul trecerii de la stadiul
osoase. Cancerul este deci reprezentat prin G1 S sau alte evenimente asociate cu
mai multe boli, care prezint caracteristici aceast tranziie. Aceste modificri pot
celulare similare. Toate formele de cancer afecta de asemenea apoptoza (moartea
sunt caracterizate prin multiplicare celular celular programat), prin diverse inter-
necontrolat, ca urmare a unor mutaii care aciuni. n mod normal, celulele tumorale
afecteaz un numr relativ mic de gene. manifest o expresie alterat, avnd inacti-
ntr-un organism, celulele tumorale sunt vate funciile diferitelor gene. Principalul
clonale, ele fiind descendente dintr-o sin- target mutaional pentru progresia can-
gur celul ancestral care a devenit can- cerului multistep l reprezint dou tipuri
ceroas. Conversia unei celule normale ntr-o de gene: proto-oncogenele i genele supre-
celul canceroas este un proces care im- soare ale tumorii (antioncogenele).
plic parcurgerea unor mutaii multiple. O Agenii care induc cancerul, respectiv
caracteristic important o constituie insta- agenii carcinogeni, sunt reprezentai prin
bilitatea genetic a populaiei de celule, care diferite substane chimice (inclusiv cele
servesc ca precursori ai celulelor cance- existente n fumul de igar), radiaiile ioni-
roase. Instabilitatea genetic poate fi deter- zante, particulele de siliciu i azbest, viru-
minat la nivel genic, la nivelul structurii surile oncogene, radiaiile ionizante. Este

Fig. 37. Formarea unei tumori maligne, avnd ca material iniial o celul mutant.

84
pag.051-106.qxd 8/1/2008 3:27 PM Page 85

Cyan Yellow Magenta Black pag 85

Capitolul 4

posibil ca la apariia cancerului s contribu- generaiilor de celule formate. Celulele ma-


ie i unii factori ereditari, precum i stresul. ligne prezint multiple leziuni genetice, care
Celulele canceroase transmit caracte- afecteaz genele, cromozomii i genomul.
rele lor anormale n succesiunea tuturor

*Oncogene, *proto-oncogene, *antioncogene


Cancerul este o boal genetic datorat Termenul oncogen definete o sub-
unor mutaii produse n mai multe tipuri de stan chimic, un organism sau un factor
gene: proto-oncogene, gene supresoare ale de mediu, care provoac apariia cancerului
tumorii (antioncogene), gene ale reparrii (fig. 38). Unele virusuri sunt oncogene pen-
leziunilor din ADN .a. tru vertebrate, n special retrovirusurile (de
1. Proto-oncogenele (protos = precursor; exemplu, virusul sarcomului Rouse al oului
oncos = tumora) se afl n mai muli cro- de gin), iar altele sunt presupuse a fi on-
mozomi din genom, fiind n stare silen- cogene (de exemplu, unele adenovirusuri
ioas sau avnd o funcie redus. Ele sunt i papovirusuri). Multe din aceste virusuri
active n stadiile timpurii ale dezvoltrii, conin gene (oncogene) care sunt respon-
fiind implicate n diferite ci de semna- sabile de transformarea unor celule gazd
lizare care stimuleaz creterea i prolife- normale n celule canceroase.
rarea celular, n structurile citoscheletului 2. Gene supresoare ale tumorii (TSG =
.a. Mutaiile care determin ctig de tumor suppressor gene) sau anti-oncogene
funcie (redobndirea funciei) determin se afl n stare activ n genom. Ele codific
transformarea proto-oncogenelor n onco- proteine cu rol n blocarea creterii i proli-
gene active (oncogene celulare, c-onc). ferrii celulare, reglarea negativ a ciclului
Unele oncogene celulare au omoloage celular, n apoptoza i n supresia unei proto-
virale (oncogene virale, v-onc). oncogene. Mutaiile care determin pier-
Oncogena este o alel mutant domi- derea funciei acestor gene promoveaz
nant a unei gene celulare (o proto-onco-
gen), care disrupe creterea i diviziunea a.
celular i care este capabil s transforme Cre[terea
[i diviziunea
o celul normal ntr-o celul canceroas. Proto-oncogen\ (off)
celular\
Oncogenele rezult n urma mutaiei unor inactiv\ normal\
gene normale (proto-oncogene). Oncoge-
Celul\ normal\
nele virale deriv din gene normale ale
gazdei, care au fost ncorporate n genomul
viral i ulterior au suferit mutaii.
Oncogenele virale nu conin introni, se Cre[terea
afl sub controlul unui promotor viral foar- Proto-oncogen\ (on) [i diviziunea
necontrolat\
te activ care determin o hiperexpresie a activat\ a celulelor
genei, unele sunt gene hibride rezultate
Celul\ normal\
prin fuzionarea cu o gen viral incom-
plet, pot conine mutaii punctiforme care b.
determin sinteza unei proteine anormale.
Fig. 38. Oncogenele [i producerea cancerului
n genomul uman, proto-oncogenele sunt a. Proto-oncogenele controleaz\ diviziunea celular\.
activate prin translocaii, inserii provirale, b. Activarea unei proto-oncogene determin\ divi-
amplificri genice, mutaii punctiforme. ziunea celular\ haotic\.

85
pag.051-106.qxd 8/1/2008 3:27 PM Page 86

Cyan Yellow Magenta Black pag 86

Partea a II-a
proliferarea clonal necontrolat, avnd induse n molecula de ADN, sunt asociate
drept rezultat dezvoltarea cancerului. La om, cu sindroame care prezint un risc crescut
au fost depistate antioncogene plasate pe nu- pentru cancer.
meroase perechi de cromozomi. Antionco- Unele cancere sunt asociate cu instabi-
genele sunt activate de deleii extinse (pier- litatea crescut a microsateliilor, determi-
derea unui segment de cromozom, mutaii nate de mutaii ale genelor implicate n
cromozomiale), deleia unor nucleotide repararea postreplicativ a erorilor de
(mutaii genice), hipermetilarea unor baze replicaie din molecula de ADN. Aceste
azotate .a. cancere cu localizri multiple sunt nca-
Antioncogenele au funcii diferite n drate n sindromul de cancer colorectal
celul. Unele pot facilita diferenierea celu- nonpolipozic ereditar (cancer de colon, sto-
lar ntr-un anumit stadiu al dezvoltrii, ca mac, endometru, pancreas, ci biliare,
rspuns la diferite semnale, destinate sto- rinichi, uretr). Instabilitatea microsate-
prii creterii i proliferrii celulare. Alte liilor este un aspect al imunodeficienei.
gene au o aciune protectoare, fiind impli- Aproape 99% din cancere sunt spo-
cate n declanarea proceselor apoptotice radice. Toate modificrile genetice care
pentru ndeprtarea celulelor n care s-au conduc la cancer sunt produse n linia so-
acumulat un mare numr de mutaii, care matic. Mai mult, schimbarea unei celule
pot face celula susceptibil de a se trans- normale ntr-o celul canceroas este pro-
forma n celul mutant, malign. gresiv. Cancerul este iniiat i progre-
3. Gene ale reparrii leziunilor din mo- seaz prin mutaii care permit celulelor
lecula de ADN. Mutaiile care afecteaz afectate s evite ciclul celular normal.
genele implicate n codificarea unor prote- Mutaiile care predispun la cancer pot fi
ine (enzime) cu rol n repararea leziunilor ereditare prin linia germinal.

4. Anomalii genetice asociate cancerului uman


Mutaii genomice. Fenomenul de aneu- gene himere care vor codifica oncopro-
ploidie este caracteristic cancerului, fiind teine care determin cretere celular
prezent n procent de 99%, celulele cance- necontrolat. Producerea unei translocaii
roase fiind caracterizate prin instabilitate este condiionat de pierderea telomerului
genomic, iar n multe cazuri sunt poliploide. (regiunea terminal a cromozomului).
Mutaii cromozomiale. Din grupul aces- Mutaiile punctiforme i amplificarea
tora, translocaiile constau n transferul genic pot activa proto-oncogenele. Amplifi-
reciproc sau nereciproc al unor segmente carea unei proto-oncogene n celula can-
ntre cromozomii neomologi. n acest fel, ceroas conduce la creterea cantitii de
are loc repoziionarea genelor din cromo- protein sintetizat. Acest proces are drept
zom. Acest proces poate avea consecine consecin apariia unor cromozomi tip mi-
variate: (1) plasarea proto-oncogenelor nutes n stare dubl (d-min = double minu-
lng un promotor activ sau lng un locus tes) i a regiunilor colorate omogen (HSR =
atenuator (care intensific activitatea lor); homogenous staining regions). Regiunile
(2) fuziunea ntre dou proto-oncogene amplificate pot fi depistate prin diferite
plasate pe cromozomi diferii sau ntre o tehnici: analiza cariotipului, hibridizarea
proto-oncogen i o alt gen, rezultnd genomic comparativ, tehnica PCR .a.

86
pag.051-106.qxd 8/1/2008 3:27 PM Page 87

Cyan Yellow Magenta Black pag 87

Capitolul 4
Amplificarea genic poate avea loc prin
diferite procese: crossing-over inegal ntre
cromatidele surori, replicarea adiional .a.
Implicarea situsurilor fragile n cancer.
Situsurile fragile sunt regiuni ale cromo-
zomului, unde cromatina nu este conden-
sat n timpul mitozei (fig. 39). Apar ca
lacune mono- sau bicromatidice, frag-
mente libere sau n forma unor structuri
inelare sau triradiale. Au fost depistate mai
multe situsuri fragile cu implicaii n can-
Fig. 39. Situs fragil pe cromozomul X, la o
cer, plasate pe unele perechi de cromozomi.
femeie (stnga) i la un brbat (dreapta)
Situsurile fragile reprezint locul de ori-
gine al unor translocaii sau deleii. n
cazul existenei unei translocaii, se va
forma o gen hibrid, al crei ARN-m nu va Modificrile citogenetice adiionale re-
fi implicat n sinteza proteic. Deleia unor prezentate prin mutaii structurale (mutaii
regiuni ale cromozomului conduce la pier- cromozomiale) sau numerice cromozo-
derea heterozigoiei unor gene supresoare miale (aneuploidii), aprute ca urmare a
de tumori situate la nivelul situsurilor fra- acumulrii diferitelor mutaii, pot conduce
gile. Aceasta conduce la apariia mai mul- la instalarea diferitelor tipuri de cancer
tor forme de cancer: leucemia limfocitic (tab. 10).
acut .a.

Tabelul 10. Modificri structurale sau numerice cromozomiale, cauza unor forme de cancer

Tipul de cancer Modificri citogenetice


Cancer de sn Trisomie 1q, deleie 1p, n 50% din cazuri
Cancer pulmonar cu celule mici (SCLC) Deleie 3p, 9p, 17p, n 70-80% din cazuri
Cancer pulmonar fr celule mici (NSCLC) Deleie 3p, 9p, 17p, n 50% din cazuri
Rabdomiocarcinom embrionar Trisomie 2q, 8, 20, la peste 70% din tumori
Liposarcom Cromozom inelar 12
Histiocitom fibris malign mixoid Cromozom inelar 12
Cromozom inelar 12, 17, la peste 70% din
Dermatifibrosarcom protuberans
tumori
Leiomiom uterin Deleie 7q la peste 20%; trisomie 12 la 10%
Lipoame Deleie 6p, 13q
Trisomii 7, 8, triploidie, tetraploidie, cromo-
Carcinom cervical, mamar, ovarian
zomi inelari

87
pag.051-106.qxd 8/1/2008 3:27 PM Page 88

Cyan Yellow Magenta Black pag 88

5
Capitolul

Imunogenetica

1. Imunitatea, imunologia i imunogenetica


noiuni generale
Imunitatea constituie rezistena i pro- rspuns imun. Rspunsul imun constituie
tecia organismului fa de aciunea agen- reacia organismului, mediat de o compo-
ilor patogeni din mediul extern sau intern nent a sistemului imun, la un antigen.
(bacterii, virusuri, substane alimentare, n grupul antigenilor sunt inclui aler-
esuturi moarte, celule modificate .a.) sau genii. Alergenul este un antigen care de-
fa de toxinele produse de acestea (fig. 40). claneaz un rspuns imun sub forma unei
Agenii patogeni sau toxinele eliberate de reacii alergice (stare patologic). Printre
acetia, care determin un rspuns din par- alergenii mai frecvent ntlnii, se afl po-
tea organismului, constituie antigenul . lenul i praful, unele alimente sau medica-
Deci antigenul reprezint orice substan mente, firele de pr din blana unor animale
(de obicei de natur proteic), pe care .a. La persoanele alergice, aceste sub-
corpul o consider strin, declannd un stane (care la un individ normal ar fi dis-
truse de anticorpi), stimuleaz eliberarea
de histamin, ducnd la apariia inflamai-
ilor i a altor simptome caracteristice
alergiei (astmul sau febra de fn).
Anafilaxia este un rspuns imun anor-
mal care apare atunci cnd un organism,
dup ce a fost n prealabil n contact cu un
anumit antigen, este expus din nou acelu-
iai antigen. Anafilaxia poate fi produs de
nepturi de insecte sau de injectarea unui
anumit medicament (penicilin). Este pro-
vocat de eliberarea de histamine sau de
alte substane similare i se poate manifes-
ta printr-o reacie generalizat, mai puter-
nic, cu dificulti de respiraie, paloare,
Fig. 40. Statuie n bronz comemornd prima
scderea tensiunii arteriale, pierderea
vaccinare efectuat de Edward Jenner.
contienei, chiar stop cardiac i moarte.

88
pag.051-106.qxd 8/1/2008 3:27 PM Page 89

Cyan Yellow Magenta Black pag 89

Capitolul 5
Prezena unui antigen sau alergen minat de prezena limfocitelor T. Imuni-
declaneaz producerea de ctre organism tatea activ este de obicei de lung durat.
a unei substane specifice denumite anti- Imunitatea pasiv este indus prin ino-
corp. Anticorpul este o protein (imuno- cularea de ser preluat de la un organism
globulin) produs de limfocite (globule care este deja imun la un anumit antigen,
albe) ca rspuns la ptrunderea unei sub- prin transferul anticorpilor de la mam la
stane strine (antigen sau alergen) n corp. ftul uman prin intermediul placentei sau
Are rolul de a mpiedica aciunea nociv a n primele zile de alptare a sugarului,
acesteia. Reacia anticorp-antigen prezint datorat anticorpilor existeni n colostru.
o nalt specificitate. Producerea de anti- Imunitatea pasiv este de obicei tempo-
corpi este parte component a rspunsului rar. Colostrul este un lichid secretat de
imun, fiind stimulat de diferii antigeni glanda mamar nainte de natere, bogat n
i/sau alergeni (bacterii invadante, hematii azot, anticorpi i vitamine. n primele zile
strine, granule de polen, particule de praf dup natere, are loc transformarea colos-
inhalate, grefe de esuturi strine .a.). trului n lapte propriu-zis.
Alergenii sunt prezeni n snge i n alte Autoimunitatea este un rspuns imun
lichide biologice (limf, lichid interstiial, fa de antigenii proprii. Este caracterizat
colostru .a.). Recunosc antigenul care a printr-o tulburare a mecanismelor de ap-
indus formarea lor, formnd cu acesta leg- rare a organismului, cnd se produce un
turi covalente i desfoar aciunea de rspuns imun contra propriilor esuturi,
neutralizare i distrugere (fig. 41). care sunt astfel lezate i distruse. Ea este
Imunitatea poate fi nnscut (mote- determinat de existena unor mutaii so-
nit) i dobndit. matice care conduc la formarea unui anti-
gen anormal, care reacioneaz cu anticor-
Imunitatea nnscut (motenit) exist
pii proprii preexisteni, sau de un antigen
de la natere, constituind prima barier de
similar cu unul propriu, care induce forma-
aprare mpotriva antigenilor. Ea se rea-
rea unui anticorp capabil s reacioneze cu
lizeaz prin mecanisme celulare (fagoci-
ambii antigeni. Exemple de boli autoimune:
toz) i umorale (interferoni). Prezint o
artrita reumatoid, eritromatous lupus
eficacitate medie i este rapid.
sistemic, miastenia gravis, precum i unele
Imunitatea adaptativ ( specific sau
forme de disfuncie tiroidian.
dobndit) este ctigat n cursul vieii
individului i se bazeaz pe existena lim-
focitelor. Rspunsul lor este lent i este
dobndit numai la contactul cu antigenul. Anticorpi
De asemenea, rspunsul este specific, fa
de un anumit antigen. Imunitatea adapta-
tiv poate fi activ sau pasiv.
Imunitatea activ este prezent atunci
cnd organismul produce anticorpi mpo- Antigeni

triva unei substane strine (antigen) care Reea antigeni-anticorpi

a ptruns n corp, prin contagiune sau prin Fig. 41. Anticorpii (imunoglobuline) se leag
imunizare. Ea poate fi umoral, atunci cnd specific la antigeni, formnd o reea de compo-
limfocitele B produc anticorpi care circul nente antigen-anticorp care anihileaz antigenul
liber n snge sau mediat celular, deter- invadat.

89
pag.051-106.qxd 8/1/2008 3:27 PM Page 90

Cyan Yellow Magenta Black pag 90

Partea a II-a
Imunologia studiaz fenomenele de evideniat rolul unui tip nou de ARN, denu-
rezisten a organismelor la diferii ageni mit ARN-i (ARN-interferent). Acesta are o
patogeni, abordnd att reacia antigen-anti- secven complementar cu un ARN-mesa-
corp, ct i mecanismele rspunsului imun. ger nociv, implicat n sinteza unei proteine
Prin combinarea tehnicilor de investi- anormale. Introdus n celula mutant cu
gaie ale geneticii i imunologiei, a aprut o ajutorul lipozomilor (mici sfere artificiale
nou ramur a tiinei, imunogenetica. Ea de natur lipidic), ARN-i intercepteaz
studiaz mecanismele genetice care deter- ARN-m nociv pe suprafaa unui complex
min\ rspunsul imun la organisme. Dez- (denumit RISC) i l distruge, eliminnd
voltarea acestei tiine a fost impulsionat de posibilitatea sintezei unei proteine toxice
cercetrile din domeniul imunologiei, care pentru celul i organism (fig. 42). Acest
prezint aplicaii practice i au o mare impor- rol imunologic, se pare c va revoluiona
tan teoretic. Reacia organismelor la acest domeniu fascinant i n permanent
bolile virale sau microbiene au la baz meca- evoluie al biologiei contemporane.
nisme naturale care asigur aprarea lor Injecii cu
medicamente
imunologic. De asemenea, organismul se cu lipozomi
coninnd ARN-i
apr i n cazul existenei unei incompati-
Lipozom
biliti ntre donor i receptor, n cazul gre- ARN-i
felor sau al transfuziilor sangvine. Studiile de Nucleu ARN-m
imunogenetic permit analiza mecanismelor ADN
nociv

moleculare care permit organismului s


acioneze mpotriva unor antigeni de natur
variat. n plus, ele au un rol important n RISC
cunoaterea unor maladii genetice ale sis- ARN
mesager
temului imun, profilaxia i tratamentul aces- Protein RISC
tor maladii. Sistemul imun posed capaci- ARN-m
Ribozom

tatea de a rspunde mult mai viguros i efi-


Calea normal Calea de interferen
cient la un contact ulterior cu un antigen
specific (comparativ cu rspunsul primar la
primul contact), fenomen denumit memorie
imunologic (immunological memory).
Cercetri recente efectuate de Andrew
Fire (Universitatea Stanford, California) i
Craig Mello (Universitatea Massachu-
setts), ncununate cu Premiul Nobel pen- Fig. 42. Implicarea ARN-i n terapeutic, prin
tru Medicin i Fiziologie n anul 2006, au inactivarea unor gene cu risc duntor

2. Anticorpi
Anticorpii (imunoglobulinele) sunt care prezint nucleu mare i citoplasm
produi de limfocite, fiind prezeni n plas- puin, avnd originea n ganglionii limfa-
ma sangvin, limf, lichidele interstiiale tici. Prezena antigenilor le stimuleaz pen-
.a. Limfocitele sunt un tip de leucocite tru a produce anticorpi. Dependent de

90
pag.051-106.qxd 8/1/2008 3:27 PM Page 91

Cyan Yellow Magenta Black pag 91

Capitolul 5
constituie o hibridare somatic, iar celula
hibrid este denumit hibridom. Aceasta
motenete dou caractere eseniale de la
B cele dou linii parentale: capacitatea de
diviziune repetat, caracter motenit de la
T celula malign i capacitatea de a sintetiza
un anticorp (o imunoglobulin) specific,
caracter motenit de la limfocit. Ea deci se
multiplic rapid i produce cantiti mari
de anticorpi. Anticorpii monoclonali sunt
Fig. 43. Dou elemente ale sistemului imun: utilizai pentru identificarea unui anumit
limfocite T (stnga) i limfocite B (dreapta)
antigen dintr-un amestec, identificarea
locul unde se vor matura, vor rezulta dou grupei sangvine, obinerea unor vaccinuri
tipuri de limfocite: limfocite B (la om ma- extrem de specifice i foarte eficace.
turate n mduva osoas, iar la psri n Un anticorp prezint o structur tipic
bursa cloacal), produc anticorpi care intr n form de litera Y, fiind constituit din 4
n circulaie i determin imunitatea catene polipeptidice: dou catene grele i
umoral i limfocite T, maturate n timus, dou catene uoare (fig. 44). Fiecare bra
care determin imunitatea mediat celular al acestei structuri n forma literei Y poart
(fig. 43). un locus de legare a antigenului. La om,
Limfocitele T, nainte de a prsi timu- exist cinci clase de imunoglobuline, cu
sul, parcurg o difereniere suplimentar, proprieti imunologice i fizice distincte.
rezultnd limfocite T helper i limfocite T Imunoglobulina G (IgG) este principala
citotoxice. Celula helper este o celul ne- imunoglobulin prezent n snge, limf i
cesar pentru dezvoltarea sau exprimarea n lichidul interstiial. Ea se leag de
unei alte celule, a unui virus sau al unui microorganisme, iniiind ncorporarea lor
vector recombinant. Limfocitele B, prin prin fagocitoz n celulele macrofage, pre-
activare se transform n plasmocite care cum i de virusuri i de toxinele bacte-
secret anticorpi, capabili s recunoasc riene, pe care le neutralizeaz. Ea leag de
antigenii. asemenea complementul care rezult n
Anticorpul monoclonal este un anticorp urma lizei celulei ]int\ i se poate lega la
specific produs de o linie de celule clonate. placent pentru a proteja fetusul (fig. 44).
Clona este o populaie de celule derivat Imunoglobulina M (IgM) este primul
dintr-o celul parental iniial. Populaia anticorp care este produs n urma imu-
de celule care alctuiete o clon, avnd nizrii sau infeciei. Se ntlnete n snge i
aceeai origine i aceeai ereditate, este o n limf, este un agregat a cinci uniti baza-
populaie monoclonal de celule. Celula le n forma lui Y, fiind capabil s nimiceasc
parental, care va da natere unei clone, microorganisme sau ali antigeni cu cele 10
este obinut prin fuzionarea unei celule situsuri de legare ale sale. El poate de
normale productoare de anticorpi (limfo- asemenea s activeze complementul.
cit), cu o alt celul provenit de la o Imunoglobulina A (IgA) este ntlnit n
tumoare malign din esutul limfoid. Pro- saliv, lacrimi, lapte de sn i secreii
cesul de fuziune ntre dou celule somatice mucoase, unde are rolul de a neutraliza
(o celul tumoral tip mielom, cu un lim- virusurile i bacteriile, precum i ali corpus-
focit B normal, care produce anticorpi), culi. Ea este ntlnit de asemenea n ser.

91
pag.051-106.qxd 8/1/2008 3:27 PM Page 92

Cyan Yellow Magenta Black pag 92

Partea a II-a
regiune variabil secretoare de anticorpi, unde activitatea sa
a catenei uoare
locus de
legare cu
locus de
legare cu
poate fi reglat. Ea acioneaz mpreun cu
antigenul
catene antigenul IgM, ca un receptor de antigen.
uoare
(L)
Imunoglobulina E (IgE) este ntlnit n
mod normal n concentraie foarte sczut n
snge i n esutul conjunctiv, ns joac un
rol crucial n reaciile alergice. Ea se leag la
celule i determin eliberarea de histamine
i provoac alte simptome comune alergice.
regiune variabil regiune variabil
a catenei grele a catenei grele Complementul constituie un grup de
proteine prezente n plasma sangvin i n
lichidul interstiial, cu rol n procesele de
catene
grele aprare a organismului, consecutive rspun-
(H)
sului imun. Codific gene care fac parte din
complexul major de histocompatibilitate.
Dup ce are loc reacia antigen-anticorp,
Fig. 44. Structura unei molecule de imunoglo- complementul este activat pe cale chimic i
bulin (IgG) se leag de complexul antigen-anticorp
(fixarea complementului). El poate determi-
Imunoglobulina D (IgD) este ntlnit na liza unor tipuri de bacterii sau poate
n ser, n concentraie foarte sczut, ns preda celula ]int\ cea mai susceptibil pen-
este ntlnit pe suprafaa celulelor B tru fagocitoz, proces denumit optimizare.

3. *Implicaii ale imunogeneticii n transplantul


de organe
Grefa const n transferul unor celule, sul are loc ntre indivizi diferii. Dependent
esut, organ sau poriune de organ, de la de gradul de nrudire dintre donorul i
un individ la altul, sau n alt regiune a receptorul de gref, acestea pot fi: grefa
aceluiai individ. n domeniul vegetal, autogen, implic un singur individ; grefa
operaia de grefare (altoire) este practicat alogen, donorul i receptorul de gref fac
frecvent, att pentru a propaga pomi i parte din aceeai populaie; grefa sin-
arbuti fructiferi, ct i pentru a obine genic, are loc ntre doi indivizi identici
forme valoroase economic sau decorativ. genetic (dou plante din aceeai clon sau
Grefele umane i animale sunt practicate doi frai gemeni), grefa xenogenic (xeno-
pentru a nlocui pri distruse sau nefunc- transplant) are loc atunci cnd donorul i
ionale ale corpului. Dependent de originea receptorul aparin unor specii diferite.
donorului i acceptorului de gref, se La om sau animale, grefele sunt rea-
deosebesc: autogrefa i alogrefa (homo- lizate chirurgical. Se practic uzual grefa
gref sau transplant). n cazul unei auto- de mduv osoas, grefa de piele, cornee,
grefe, transferul de material biologic are esut osos, diferite organe (rinichi, ficat,
loc n alt regiune a aceluiai individ, pe inim, plmn .a.). Organismul receptor,
cnd n cazul alogrefei (transplant), proce- n care a fost introdus o gref provenit de

92
pag.051-106.qxd 8/1/2008 3:27 PM Page 93

Cyan Yellow Magenta Black pag 93

Capitolul 5
la un alt individ, o recunoate ca fiind str- cromozomului 6, avnd rol n activarea i
in i declaneaz un rspuns imun, con- reglarea rspunsului imun. Sistemul HLA
cretizat printr-un fenomen de respingere a conine circa 4 106 k.b., n interiorul su
organului grefat. fiind identificate peste 300 de gene (fig. 45).
Antigenele de histocompatibilitate sunt Pe baza diferenelor structurale i funcio-
prezente n esuturi, fiind implicate n res- nale constatate, genele existente n MHC
pingerea grefelor de esuturi sau organe. au fost mprite n trei clase: primele dou
Grefa va fi respins n cazul n care orga- clase conin gene care codific antigeni
nismul acceptor consider antigenii esu- leucocitari umani (HLA), iar genele din cea
turilor donor, ca fiind strini. de a treia clas codific alte proteine.
Histocompatibilitatea este gradul n Antigenii leucocitari umani se afl pe
care un esut provenit de la un organism suprafaa celulelor, avnd rol n determi-
donor este tolerat de sistemul imunitar al narea acceptului sau respingerii grefelor de
altui organism. Pentru orice organism ani- organe i esuturi, de ctre organism.
mal, este esenial ca sistemul su imun s Fiecare specie sau individ posed un set unic
poat s disting propriile celule i esuturi de proteine MHC, existnd astfel o mare
de celulele i esuturile strine, pentru a le variabilitate ntre specii i indivizi. Acest
putea ataca pe cele din urm. Corpul aspect explic cauza pentru care transplan-
organismului receptor identific ca fiind turile sunt foarte dificil de efectuat la om,
strin orice esut grefat (sau un organism esuturile donorului i receptorului trebuind
invadant), datorit antigenilor de histo- s fie similare. n cazul a doi indivizi care
compatibilitate afla]i pe suprafaa sa. posed aceleai tipuri de HLA, ei sunt histo-
Fiecare individ posed un set propriu de compatibili. Pentru reuita unui transplant,
antigeni, fapt care determin ca grefa de este necesar ca ntre esuturile donorului i
esut s fie respins de sistemul imunitar al receptorului s existe un numr ct mai mic
organismului receptor. La vertebrate, aces- de diferene ale HLA. Proteinele MHC joac
te proteine (denumite la om antigeni leu- astfel un rol vital n rspunsul imun al lim-
cocitari umani sau HLA) sunt codificate de focitelor, legat de capacitatea celulelor T de a
un cluster de gene denumit complex major identifica antigeni strini. MHC codific dou
de histocompatibilitate (MHC). La om, sis- clase distincte de proteine de histocompati-
temul HLA este situat pe braul scurt al bilitate (glicoproteine la om). Antigenii din

Fig. 45. Harta genetic a segmentului HLA de pe cromozomul 6 uman

93
pag.051-106.qxd 8/1/2008 3:27 PM Page 94

Cyan Yellow Magenta Black pag 94

Partea a II-a
clasa I determin respingerea grefelor i ca receptori, prezentnd antigenele strine
ajut celulele citotoxice T s recunoasc ce- celulelor T helper. Aceste antigene sunt n-
lulele infectate cu virusuri. Aceste antigene tlnite numai n anumite celule ale sistemului
se afl la suprafaa celor mai multe celule ale imunitar (macrofage, limfocite B i limfocite
corpului. Antigenele din clasa a II-a acioneaz T activate).

4. Interferonul
Interferonii sunt o familie de glicoprote- succesive, datorit aciunii unei varieti de
ine mici, produse de celulele mamiferelor, ca tipuri virale.
rspuns la infecia viral, prezena unor mi- Sinteza interferonilor are loc n diferite
croorganisme sau a unor endotoxine micro- tipuri de celule. Astfel, interferonul este
biene. Sunt descrise dou tipuri structurale. produs de leucocite, iar interferonul este
Interferonii de tipul 1 sunt proteine produs de fibroblaste. Sinteza interferonu-
monomere produse de o mare varietate de lui este indus prin stimularea limfocitelor
celule infectate viral. Aceti interferoni de ctre un antigen sau mitogen. Interfe-
induc sinteza enzimelor care inhib proli- ronul este produs i de limfocitele killer
ferarea viral, prin blocarea sintezei aci- (killer = uciga) care atac celulele din esu-
zilor nucleici virali. turile modificate (celulele canceroase). Ca
Tipul 2 de interferoni este constituit din urmare, alte limfocite normale se transfor-
dimeri de proteine identice, nenrudit cu m n celule killer i produc o serie de mo-
tipul 1. Interferonii de tipul 2 sunt sinteti- dificri ale sistemului imunitar. De aceea,
interferonul are un mare potenial de uti-
zai de limfocitele T i celulele killer natu-
lizare att n tratamentul infeciilor virale
rale. Ei distrug unele celule canceroase i
acute, ct i n cel al cancerului. Pe lng
celulele infectate cu parazii.
aciunea antiviral, interferonii manifest o
Interferonii sunt glicoproteine, compo-
aciune imunomodulatoare (modific reaci-
nenta proteic constituit dintr-o peptid
ile imunologice ale organismului) i antitu-
alctuit din 146166 de aminoacizi, iar moral (mpiedic dezvoltarea unor celule
componenta glucidic este reprezentat normale sau tumorale, n special interfe-
prin lanuri polizaharidice cu acizi sialici ronul ). Spre deosebire de anticorpi, care
terminali. Interferonii prezint specificitate acioneaz direct asupra virusului, interfe-
de specie, iar n cadrul unei specii animale ronii acioneaz asupra celulei infectate, con-
exist mai multe forme de interferon, ca- ducnd la mpiedicarea replicaiei virusului.
racterizate prin antigenitate, mas molecu- n explicarea biosintezei interferonilor,
lar, grad de glicozilare specific .a. exist dou ipoteze:
La om exist cinci tipuri de interferon, a celulele produc n mod constant un pro-
cror sintez este determinat de gene interferon, care este activat n urma induciei;
plasate pe cromozomi diferii. Genele care interferonii sunt sintetizai de novo, n
determin sinteza tipurilor alfa, beta, tau i funcie de necesiti, n mod normal informa-
omega se afl plasate pe perechea 9 de cro- ia genetic pentru sinteza lor fiind represat.
mozomi, iar gena care determin sinteza n prezent, interferonii se obin prin
tipului gamma, se afl pe cromozomul 12. tehnicile de recombinare genetic (utiliznd
n cadrul fiecrui tip exist numeroase colibacili, levuri sau viermi de mtase), care
subtipuri, aprute n filogenie prin mutaii asigur o producie mare de interferon.

94
pag.051-106.qxd 8/1/2008 3:27 PM Page 95

Cyan Yellow Magenta Black pag 95

Domenii
de aplicabilitate i
6
Capitolul

consideraii bioetice
n genetica uman

1. Sfaturi genetice
Sfatul genetic const n evaluarea riscu- Stabilirea modului de transmitere al
lui unei persoane de a manifesta o maladie maladiei i a riscului recurent. Se urmrete
genetic sau posibilitatea unui cuplu de a posibilitatea de segregare a alelei mutante
avea un copil malformat. Sfatul este solicitat i se calculeaz riscul ca aceast\ afeciune
n cazuri variate: unul dintre prini este s apar i la ali membri ai familiei.
afectat; cei doi soi prezint un grad de Comunicarea ctre familie a riscului
nrudire sau aparin unei comuniti n care de recuren al maladiei, diagnosticului i
este frecvent o mutaie; una din rudele prognozei manifestrii acestei maladii, pre-
apropiate este afectat; prinii au deja n cum i posibilitile terapeutice. Se consi-
familie un copil afectat i doresc s cunoas- der c orice risc mai mic de 10% este ac-
c ansa de reapariie a malformaiei; unul ceptabil, iar orice risc mai mare de 20%
sau ambii parteneri au fost expui la un este inacceptabil.
mediu teratogen; avorturi spontane repe- n elaborarea sfatului genetic, sunt par-
tate ale mamei; cupluri sterile .a. curse mai multe etape.
Obiectivele i etapele sfatului genetic Cercetarea familial, urmat de ntocmi-
sunt multiple, cele mai importante fiind cele rea arborelui genealogic (fig. 46). Analiza
enumerate n continuare. Ramura Weber

Diagnostic ct mai exact, care s cu-


prind informaii privind istoricul familiei, Ramura Mozart
cu date concrete privind diferite stri pato-
gene; examenul clinic al individului afectat,
cat i al mai multor membri ai familiei,
investigaii paraclinice uzuale (analiza ca- W.A. Mozart Karl Maria von Weber
Legend\
riotipului, analiza heterocromatinei sexua- foarte
afoni talenta]i
le, diagnosticul ADN .a.). talenta]i muzician
Precizarea caracterului genetic al bo- genial

lii, fiind stabilit contribuia procentual


(de la 0% la 100%) a factorilor genetici n Fig. 46. Ascendena lui W.A. Mozart i gradul
determinismul bolii. de rudenie cu familia Weber.

95
pag.051-106.qxd 8/1/2008 3:27 PM Page 96

Cyan Yellow Magenta Black pag 96

Partea a II-a
acestuia va permite stabilirea incidenei riscul uzual pentru fiecare nou-nscut este
trsturii patogene, va putea oferi informaii de 1 : 2, pe cnd n cazul caracterelor deter-
privind modul de transmitere n descenden- minate de gene autozomal recesive, acelai
a acestei trsturi, va permite depistarea risc este de 1 : 4. n cazul caracterelor
prezumptivelor persoane purttoare ale unor X-linkate, transmiterea acestora este depen-
maladii autozomal recesive sau X-linkate. dent de sex. Astfel, pentru fiecare purttor,
Investigaiile citogenetice, moleculare din biei vor fi afectai i 1/2 din fetie vor
i biochimice sunt efectuate pentru a se fi purttoare. n cazul caracterelor Y-linkate,
obine date noi, necesare elaborrii sfatului acestea se vor transmite exclusiv pe linie
genetic. Investigaiile citogenetice permit patern, deci vor fi prezente numai la biei
stabilirea anomaliilor numerice (sindrom i absente la fete. n cazul bolilor multifacto-
Down, trisomia-X, sindrom Turner .a.), riale (determinate de mai multe gene
sau structurale ale cromozomilor. Studiul nealele i influenate de factorii de mediu),
ADN permite analiza mutaiilor genice, iar este utilizat riscul de recuren empiric,
testele biochimice sunt utilizate pentru dedus din observarea unui mare numr de
depistarea heterozigoilor sau a celor afec- cazuri, n familii diferite. Astfel, luxaia con-
tai de o boal metabolic. genital de old a fost ntlnit la 3-4 copii
Calcularea riscului genetic prezint afectai, nscui din prini normali. Dac
grade diferite de dificultate, dependent de ntr-o familie normal s-a nscut un copil
cauza bolii analizate. n cazul bolilor parial afectat, riscul ca urmtorul copil s fie afec-
genetice, prezint importan cunoaterea tat este de 0,5% pentru urmtorul biat ns-
condiiilor de mediu care interacioneaz cut i 6,3% dac urmtorul nscut este feti.
cu factorii genetici. Consangvinizarea mrete riscul pen-
n cazul maladiilor (sau caracterelor) de- tru o malformaie major, datorit homozi-
terminate de gene autozomal dominante, gotrii genelor.

2. Diagnosticul prenatal
Riscul de malformaii pentru orice ani, permind depistarea precoce a
sarcin este de circa 3%. Acest risc malfor- diferitelor anomalii, prin diferite metode de
mativ poate crete sub aciunea unor fac- investigaie.
tori care acioneaz asupra organismului Ecografia (ultrasonografia) permite
matern, n timpul diferitelor etape ale identificarea a numeroase anomalii struc-
sarcinii. Dintre acestea prezint impor- turale fetale i se poate efectua pe tot par-
tan: anumite infecii ale mamei n timpul cursul vieii intrauterine.
sarcinii, administrarea unor medicamente Amniocenteza const n recoltarea de
(n special antibiotice), factorii de mediu i lichid amniotic, prin puncia sacului amni-
noxele profesionale (radiaii ionizante, sol- otic, sub control ecografic. n mod normal,
veni chimici, metale grele .a.). amniocenteza se execut n sptmnile
Diagnoza prenatal este una dintre cele 1517 de via intrauterin, cnd se recol-
mai importante metode de profilaxie ge- teaz 1520 ml lichid amniotic (fig. 47).
netic i identific tulburrile fetale. Materialul recoltat este utilizat pentru efec-
Tehnicile de diagnostic au parcurs o tuarea de culturi celulare pentru stabilirea
evoluie i diversificare rapid n ultimii cariotipului i identificarea unor anomalii

96
pag.051-106.qxd 8/1/2008 3:27 PM Page 97

Cyan Yellow Magenta Black pag 97

Capitolul 6
numerice i structurale ale cromozomilor,
precum i pentru analiza unor markeri
fetali. Metoda prezint un risc de avort
spontan (0,5%-1%).
Analiza Doppler este utilizat pentru
evaluarea vitezei sngelui n circulaia
fetal ombilical i placentar.
Analiza sngelui fetal se execut prin
puncie ombilical percutanat, efectuat
sub control ecografic.
Analiza sngelui matern este efectuat
cu ajutorul unor markeri fetali, care evi-
deniaz unele maladii ale ftului, din cauza
legturii circulatorii care exist ntre ft i
organismul matern. Pot fi depistate sarci- Fig. 47. Tehnica amniocentezei transabdominale
nile cu sindrom Down .a.

3. Fertilizarea in vitro; clonarea terapeutic


Procesul de fertilizare
Fertilizarea const n unirea a doi care crete n partea inferioar a organului
gamei, n timpul procesului de reprodu- reproductiv femel (carpele), fcnd posibil
cere sexuat, conducnd la obinerea unui ca nucleul gametului mascul s fuzioneze
zigot. nc din anul 1780, L. Spallanzani a cu oosfera.
efectuat experimente de nsmnare artifi- La cele mai multe animale acvatice, pro-
cial la amfibieni i a demonstrat necesi- cesul de fertilizare are loc n mediul acva-
tatea contactului fizic al oulor (gamet tic, n care sunt eliberai gameii. n cazul
femel), cu fluidul spermatic pentru fer- unor animale terestre (de exemplu, la
tilizare i dezvoltare la amfibieni. n anul unele insecte i majoritatea mamiferelor),
1875 O. Hertwig, n urma studiilor efectu- procesul de fertilizare are loc n corpul
ate la ariciul de mare, a artat c procesul femelei, n care este introdus sperma. La
de fertilizare la animale i la plante const om (femeie), fertilizarea se produce la
n unirea fizic a nucleilor celor doi gamei. nivelul poriunii ampulare a tubei uterine
Fiecare gamet conine jumtate din nu- (trompa lui Fallope), respectiv n treimea
mrul de cromozomi. n urma procesului sa extern (partea cea mai lung i mai
de fertilizare are loc formarea zigotului i larg), care capteaz ovocitul expulzat n
restaurarea numrului caracteristic de cro- urma procesului de ovulaie (fig. 48).
mozomi, zigotul avnd o nou combinaie Infertilitatea este imposibilitatea unui
de cromozomi. Prin fertilizare are loc for- cuplu de a procrea timp de un an, avnd o
marea sexului genetic al zigotului, este via sexual normal, regulat i fr a
iniiat clivajul acestuia, urmat de procesul utiliza mijloace contraceptive. Infertilitatea
de embriogenez. poate fi primar sau secundar.
La plantele cu flori, dup polenizare, Infertilitatea primar apare atunci cnd
grunciorul de polen formeaz tubul polinic, un cuplu cu via sexual normal, regulat,
97
pag.051-106.qxd 8/1/2008 3:27 PM Page 98

Cyan Yellow Magenta Black pag 98

Partea a II-a
Procesul prin care are loc introducerea
artificial a unui embrion timpuriu ntr-un
oviduct sau uter al unei mame biologice
sau al unei mame surogat, se numete
transfer de embrion (transplantare). n
acest fel, o femeie care are blocai tubii
Fallopieni, poate avea un copil, prin fer-
tilizarea in vitro i transplantare de embri-
on. Procesul implic prelevarea unui ovul
din organismul mamei, operaiune prece-
dat de un tratament hormonal. Ovulul
prelevat este fertilizat in vitro, rezultnd un
zigot. n urma diviziunilor mitotice, va
rezulta un embrion, care va fi introdus n
uterul mamei pentru implantare.
Prima fertilizare in vitro ncununat cu
succes la om, a fost efectuat de Robert
Edwards i Patrick Steptoe n anul 1959. n
iulie 1978 s-a nscut, n Marea Britanie, pri-
Fig. 48. Locul procesului de fertilizare la om mul copil tip test-tube baby din lume (copil n
1 spermatozoizi; 2 glera cervical; eprubet, fetia Louise Brown), utiliznd
3 ovulaie; 4 fecundaie ovocite mature extrase naintea ovulaiei,
proces urmat de fertilizarea in vitro. Prima
fr a utiliza niciun mijloc contraceptiv, nu clinic de fertilizare in vitro a luat fiin n
Anglia. n anul 1982 s-au obinut 100 de sar-
a obinut nicio sarcin timp de minim un
cini prin fertilizare in vitro, iar n 1988, s-au
an.
nscut prin aceasta tehnic 1 000 de copii. n
Infertilitatea secundar este atunci
anul 1995, s-a ajuns la 3 000 de copii. n
cnd un cuplu a procreat anterior, dar care
prezent, numrul de copii nscui n diferite
dup cel puin un an de via sexual nor-
]\ri ale lumii depete cteva sute de mii.
mal, regulat i fr a utiliza contracep- n cazul animalelor de ras (de exem-
tive, nu mai poate obine nicio sarcin. plu, la elite de vaci de lapte), n urma trata-
n scopul depirii cazurilor de infertili- mentelor hormonale are loc inducerea unei
tate, se practic\ fertilizarea n vitro. superovulaii, urmat de eliberarea simul-
Fertilizare in vitro const n fertilizarea tan a mai multor ovule. Urmeaz splarea
experimental a unui ovul femel, n afara oviductelor pentru captarea ovulelor elibe-
organismului. n prezent, fertilizarea in vitro rate, fertilizarea lor in vitro, dup care
se utilizeaz n mod uzual la om, atunci fiecare embrion rezultat (n stadiul de 2 sau
cnd tubii Fallopieni de la femeie (care 4 celule) este transferat la diferite mame
asigura legtura ntre ovar i uter) sunt surogat pentru dezvoltarea ulterioar.
blocai. Embrionul rezultat va fi introdus n Vieii care se vor nate vor prezenta carac-
uter pentru implantare. terele naturale ale prinilor biologici.

Clonarea
Clonarea este cea mai comun tehnic La om, procesul este ntlnit n mod natural
de a crea un organism identic cu alt organism. n cazul gemenilor monozigoi, care prezint

98
pag.051-106.qxd 8/1/2008 3:27 PM Page 99

Cyan Yellow Magenta Black pag 99

Capitolul 6
acelai sex i posed aceeai zestre gene- vite cornute, capre, porci, oareci. Bene-
tic. n urma primei diviziuni a zigotului, ficiul potenial al unor astfel de clonri con-
cele dou celule rezultate se separ (devin st n faptul c animalele clonate pot fi uti-
zigoi secundari), din fiecare formndu-se lizate pentru producerea de proteine tera-
un embrion, respectiv un organism. Depen- peutice sau ca donori de esuturi i/sau
dent de scopul urmrit, exist clonare organe compatibile la om.
reproductiv i clonare terapeutic. n anul 1999, a fost raportat obinerea
Clonarea reproductiv urmrete obi- n S.U.A. (Advanced Cell Technology
nerea unor organisme identice cu organis- Institute, Massachussets) a primului em-
mul iniial. Este utilizat frecvent la plante brion uman in vitro, printr-o tehnic simi-
pentru multiplicarea clonar rapid, prin lar celei utilizate la obinerea oiei Dolly.
cultura in vitro a unor esuturi meristema- Obiectivul clonrii embrionului uman l
tice, care conin celule aflate n diviziune constituie stabilirea unor metode optime
mitotic activ. Prin inocularea lor in vitro, pentru a obine esuturi umane, n vederea
pe medii nutritive aseptice, avnd un ra- tratamentului unei game largi de maladii
port hormonal determinat, au loc procese- (boli degenerative ale sistemului nervos,
le de organogenez\ i obinerea de descen- diabet, boala Parkinson .a.).
deni identici. Clonarea terapeutic urmrete obi-
La animale, primul individ nscut prin nerea unui individ, identic din punct de
clonare reproductiv a fost oaia Dolly, la vedere genetic cu individul de la care a
Institutul Roslin din Edinburgh, Scoia, n provenit celula iniial, utilizat ca donor de
anul 1996 (colectivul lui Ian Wilmut). organe, esuturi sau celule. Acestea vor fi
Aceast clonare reproductiv, fr fecun- prelevate i transplantate la pacieni bolnavi,
dare, a avut drept material genetic iniial pentru nlocuirea organelor, esuturilor sau
nucleul unei celule somatice extrase din celulelor alterate genetic. Prin clonajul te-
glanda mamar a unei oi. Nucleul celulei rapeutic se urmrete crearea unor resurse
somatice a fost introdus ntr-un ovul anu- permanente de celule, esuturi sau organe,
cleat, obinndu-se un zigot care prezint care sa fie utilizate pentru transplant la
numrul somatic de cromozomi de la un pacieni. Ideal este ca donorul i receptorul
singur individ, genitorul mam. Din zigotul s fie compatibili din punct de vedere gene-
astfel obinut, introdus pe un mediu de cul- tic, pentru a se atenua rspunsul imun.
tur\ adecvat, a fost obinut in vitro, un Organele i esuturile compatibile pot fi
embrion. Acesta a fost introdus n uterul poteniale pentru crearea unei tehnologii
unei mame purttoare, rezultnd un clon implicnd fie (a) ingineria genetic la unele
somatic, oia Dolly, care a motenit ma- animale care prezint un gabarit similar
terialul genetic al unui singur printe. Oia omului (porc, de exemplu), sau (2) prin
Dolly a motenit ns i vrsta genetic a folosirea de celule stem embrionare, pen-
mamei sale, de la care a fost prelevat nucle- tru a obine organe umane in vitro. Pro-
ul celulei somatice. Dup clonarea lui cesul de transfer al unui organ, de la o
Dolly, au fost raportate numeroase succese specie la alt\ specie este denumit xeno-
privind clonarea la numeroase alte specii: transplant (xenos = strin).

99
pag.051-106.qxd 8/1/2008 3:27 PM Page 100

Cyan Yellow Magenta Black pag 100

Partea a II-a

4. Terapia genic
Terapia genic este procesul de inserare gene anormale sau supraexpresia unei gene
a unei gene, n scopul nlocuirii sau supli- normale, terapia genic va aciona pentru
mentrii aciunii unei gene cu disfuncie, n limitarea sau blocarea informaiei genetice
scopul tratrii unei boli sau al unui defect de la nivelul secvenei ADN a genei, prin uti-
genetic. Transferul genei se poate realiza lizarea tehnologiilor antisens.
folosind lipozomi sau vectori virali. El poate n general, expresia unei gene poate fi
fi efectuat att la nivelul liniei germinale, ct eliminat la nivelul transcripiei sau al
i la nivelul unor celule somatice (fig. 49). translaiei, prin diferite procedee care au la
Recent, termenul terapie genic tinde s fie baz utilizarea unor molecule de ARN cu
nlocuit cu termenul chirurgie genetic. secvena complementar cu cea a mole-
Chirurgia genetic const n nlocuirea culei de ARN-m implicat n sinteza pro-
uneia sau a mai multor gene ale unui teinei sau enzimei anormale, pe care o dis-
organism, cu ajutorul vectorilor plasmidi- truge. Repararea genelor mutante este
ali, sau prin introducerea unui material aplicat de circa un deceniu, fiind utilizate
genetic strin n celul cu ajutorul unei proceduri care au la baz mecanisme natu-
microseringi sau prin micromanipulare. rale de reparare. Dei n prezent pot fi
Terapia genic se aplic n urmtoarele reparate numai genele care prezint o sin-
cazuri: gur mutaie, n viitor vor putea fi reparate
sinteza unei gene artificiale pentru i genele afectate de mai multe mutaii.
nlocuirea unei gene alterate sau mutante; Terapia genic ne ofer posibilitatea de
utilizarea tehnologiilor antisens pen- a introduce n genomul unui pacient, gene
tru modificarea expresiei genelor alterate; normale care pot genera un efect terapeu-
repararea genei alterate, atunci cnd tic. Introdus n celulele esutului afectat,
este afectat secvena unui numr mic de gena normal trebuie s se integreze ntr-un
nucleotide. locus n cromozom. Intrnd n funciune,
Sinteza unei gene artificiale este realizat gena normal va sintetiza proteina nor-
prin tehnologia ADN-rec., utiliznd de obicei mal, care va nlocui proteina produs de
plasmide ca vectori de clonare. Atunci cnd gena mutant.
procesul patologic implic expresia unei Transferul genelor poate fi efectuat n
dou feluri: ex vivo i in vivo. n cazul trans-
ferului ex vivo, genele sunt transferate
iniial n celule care ulterior sunt introduse
n corpul pacientului. n cazul transferului
in vivo, genele sunt introduse direct n
esuturi. Acest transfer a fost reuit numai
n cteva aplicaii clinice. Tehnicile de
transfer genic includ vectori virali (diferite
tipuri de virusuri) sau vectori non-virali.
Dintre acetia sunt utilizai lipozomii (struc-
turi sferice artificiale constituite din lipi-
de), electroporarea (aplicarea unui oc
Fig. 49. Reprezentarea schematic a etapelor electric n urma cruia se produce un orifi-
terapiei genice ciu n plasmalem, prin care va fi introdus

100
pag.051-106.qxd 8/1/2008 3:27 PM Page 101

Cyan Yellow Magenta Black pag 101

Capitolul 6
Tabelul 11. Afeciuni potenial influenate prin terapie genic

Boala Tip de terapie genic


Afeciuni motenite Introducerea de gene noi (nlocuirea genelor mutante)
Hemofiliile A i B Exprimarea factorilor VIII i IX i eliberarea lor n circulaie
Talasemia Exprimarea globinei normale n eritrocite
Imunodeficiene Exprimarea genelor deficitare
Afeciuni metabolice Exprimarea enzimelor absente
Afeciuni metabolice Corecia genei
Anemie falciform Corectarea mutaiei genei a hemoglobinei
Fibroz cistic Corectarea unei mutaii n plmn

Boli cardio-vasculare Modificarea biologiei vasculare

Hipertensiune Corecia genelor pentru vasodilataie


Boal vascular periferic Inducerea angiogenezei
Cancer Abordri multiple
Expresia genelor toxice n celulele tumorale
Numeroase tipuri Expresia genelor protectoare ale celulelor normale n
chimioterapie
Boli infecioase
Boli virale Expresia genelor care blocheaz replicaia, funcia viral
Alte boli Expresia antigenelor ca vaccin recombinant
Diverse
Artrita reumatoid Expresia citokinelor antiinflamatorii n articulaii
Boal Parkinson Expresia genelor implicate n sinteze specifice (L-dopa)
Boli neurodegenerative Expresia factorilor neurotrofici

n celul\ informaia strin), sau captarea general a corpului. Spre sfritul secolului
direct a moleculelor de ADN (realizat de al XX-lea, factorul IX al coagulrii a fost
obicei prin bombardarea unei culturi de clonat n celulele somatice de la ovine,
celule cu particule de metale grele, ca aur, obinndu-se animale care sintetizeaz fac-
torul IX al coagulrii care este acumulat n
platin, tungsten). n tabelul 11 sunt pre-
lapte. Prin consumul acestui tip de lapte,
zentate unele afeciuni care pot fi tratate
pacienii bolnavi de hemofilie B, devin
prin terapie genic. independeni de administrarea acestuia pe
De exemplu, hemofilia B este o maladie alt cale (transfer sangvin, nerecomandat
X-linkat, determinat de deficitul factoru- n cazul pacienilor cu SIDA). n prezent,
lui IX al coagulrii sngelui. Acesta este pentru tratamentul pacienilor cu hemofilie
produs n ficat [i eliberat n circulaia B, gena factorului IX al coagulrii este

101
pag.051-106.qxd 8/1/2008 3:27 PM Page 102

Cyan Yellow Magenta Black pag 102

Partea a II-a
inserat ntr-un vector viral (AAV, virus majoritatea genelor nu sunt expri-
asociat adenovirusului), fiind introdus n mate n celulele stem i n celulele dife-
muchi i n hepatocite. Prin crossing-over reniate. Acest aspect negativ poate fi
gena este inserat n ADN, rezultnd ce- corectat prin cunoaterea caracteristicilor
lule transformate genetic care pot sintetiza genetice ale donorului de celule stem.
factorul IX al coagulrii sngelui. Terapia genic cu celule stem implic
parcurgerea urmtoarelor etape:
Terapia genic cu celule stem introducerea genelor normale n
Celulele stem sunt celule de tip embri- celulele stem (prin injectare sau cu aju-
onar, care se pot diferenia n celule nalt torul unor mediatori de natur viral sau
specializate aflate n constituia diferitelor non-viral);
organe. Dependent de caracteristicile lor, introducerea celulelor stem modifi-
se deosebesc trei tipuri de celule stem. cate genetic, n organul n care se afl
1. Celule stem totipotente sunt celule genele mutante.
care s-au obinut din primele diviziuni ale Transplantul de mduv hematogen
ovocitului fertilizat. Ele se pot dezvolta, for- este o terapie genic cu celule stem hema-
mnd un embrion complet. topoietice, aplicat anual la mii de pacieni,
2. Celule stem pluripotente capabile s n scopul de a trata diferite boli hematolo-
formeze esuturi derivate din toate cele trei
gice sau imunologice, de origine variat:
foi]e embrionare (ectoderm, endoderm i
boli cptate n timpul vieii (anemie
mezoderm).
aplastic, leucemie, limfoame .a.);
3. Celule stem multipotente, progeni-
boli motenite (deficiene imune,
tori ai celulelor din diferite esuturi. Unele
talasemie, anemie falciform .a.);
esuturi (mduva osoas, pielea, ficatul
posibilitatea aplicrii n unele afeci-
.a.), au un potenial regenerativ imens i
uni autoimune.
i rennoiesc permanent populaiile celu-
lare. Celulele stem multipotente dau na- Modificarea genetic a celulelor stem
tere unor tipuri celulare multiple. Cercetri hematopoietice poate ndeplini scopuri te-
recente au artat c unele esuturi adulte, rapeutice (rezistena la chimioterapie) sau
considerate anterior fr plasticitate sau s permit corecia unui defect genetic.
avnd puin plasticitate (sistemul nervos Bioetica i terapia genic
central sau inima), posed o anumit capa-
citate de regenerare, care implic prezena Termenul de bioetic a fost introdus de
celulelor stem sau posed capacitatea de a R. Potter (1970). El a considerat c bioetica
atrage i adopta celule stem din sistemul trebuie s constituie o nou disciplin
circulator. Sistemul hematopoietic, tractul care s combine cunoaterea biologic cu
gastro-intestinal i tegumentul, sunt esu- cea a sistemului valorilor umane. Dup sa-
turi nalt regenerative n care populaiile de vantul romn Denis Buican, bioetica con-
celule stem au fost parial caracterizate stituie etica privind aplicarea de cercetri
pn n prezent. biologice fundamentale, medicale i agro-
Celulele stem sunt ideale pentru terapia nomice la fiinele vii.
genic, datorit unor caracteristici specifice: Terapiile cu celule stem i terapia genic
sunt capabile de a prolifera, prin mul- ridic probleme etice i sociale. Aceste tera-
tiplicare mitotic; pii ofer strategii noi pentru tratamentul
au capacitatea de a se diferenia n unor boli, altfel ireversibile. Celulele stem
diferite tipuri de celule mature; sunt pluripotente, respectiv pot genera orice

102
pag.051-106.qxd 8/1/2008 3:27 PM Page 103

Cyan Yellow Magenta Black pag 103

Capitolul 6
alt tip de celule care sunt derivate de la privind originea i utilizarea celulelor stem
diferite esuturi. esutul embrionar foarte .a. La acestea se adaug problemele legate
timpuriu produce celule stem embrionare de transplantul de organe, transferul de
totipotente. n mod curent, etica cercetrii gene, fertilizarea in vitro .a. n unele state
pe celule stem este dezbtut n diferite ri. (SUA) este permis cercetarea care folo-
Controversa principal este concentrat pe sete celulele stem, ns a fost restrns uti-
obinerea embrionilor umani, care vor fi uti- lizarea fondurilor federale pentru obinerea
lizai n cercetare. Dac celulele stem sunt de noi linii celulare umane. Parlamentul
folosite pentru a crea organe, embrionul European, n declaraia n 16 puncte, a for-
este distrus. Dac sunt folosite pentru alte mulat principiile i exigen]ele proprii ctre
tehnologii, vor aprea alte probleme etice statele membre: clonarea fiinelor umane,
care vor trebui rezolvate. fie c este realizat cu titlul de experiment n
Sunt ridicate numeroase probleme da- contextul tratamentului fertilitii, a diag-
torate unor concepte religioase, drepturile nosticrii preimplanturilor, a transplantului
omului, tolerana la risc i incertitudine, li- de esuturi, fie c este realizat cu orice alt
mitele folosirii interveniilor umane pentru scop, nu poate fi n niciun caz justificat sau
a modifica evoluia unei boli, aspecte etice tolerat de societate.

II. GENETICA UMAN SINTEZ


Genetica uman\ [i genetica medical\ stu- gene (boli poligenice). La acestea se adaug\
diaz\ genomul uman `n condi]ii normale [i bolile cromozomiale, determinate de modi-
patologice. De[i preocup\rile pentru cu- fic\ri `n structura [i num\rul cromozomilor.
noa[terea eredit\]ii umane dateaz\ din Cercet\rile recente au stabilit determi-
Antichitate, studii aprofundate asupra bazei nismul genetic `n memorie, inteligen]\,
citologice a eredit\]ii umane au fost efectuate comportament [i temperament, care consti-
dup\ stabilirea tehnicilor pentru eviden]ierea tuie obiectul de studiu al altor ramuri ale
cromozomilor umani (Tjio [i Levan, 1956). geneticii: genetica comportamentului [i psi-
Realizarea cart\rii ADN uman `n cadrul pro- hologia genetic\. Coeficientul de inteligen]\
iectului genomul uman (finalizat la `nceputul este determinat att de factorii genetici, ct
mileniului III), va permite eradicarea bolilor [i de mediul ambiant.
ereditare prin `nlocuirea genelor mutante. Prin studiul secven]ei de nucleotide din
Cercet\rile de genetic\ uman\ au stabilit ADN-ul extras din fosilele preumane [i
att determinismul unor caractere fenotipi- umane, genetica [i-a adus o contribu]ie deci-
ce normale, ct [i determinismul unor ma- siv\ la stabilirea originii omului, clarificnd
ladii sau boli genetice. Acestea pot fi deter- rela]iile de filogenie dintre str\mo[ii acestu-
minate de o singur\ pereche de gene (boli ia, precum [i formarea raselor umane. Este
monogenice), sau de mai multe perechi de discutat\ contribu]ia geneticii moleculare,

103
pag.051-106.qxd 8/1/2008 3:27 PM Page 104

Cyan Yellow Magenta Black pag 104

Partea a II-a

att la analiza procesului de umanizare, ct Partea de genetic\ uman\ se `ncheie cu


[i la caracterizarea raselor umane. prezentarea succint\ a unor domenii de
Datorit\ dezvolt\rii explozive a societ\]ii aplicabilitate `n via]a cotidian\ [i unele
umane `n ultimul secol, o importan]\ deose- considera]ii bioetice. Sunt prezentate infor-
bit\ o constituie mutageneza [i teratogeneza ma]ii privind sfaturile genetice, diagnosti-
indus\ de mediul ambiant, precum [i studiile cul prenatal, fertilizarea in vitro [i clonarea
privind diferite tipuri de cancer. Aportul terapeutic\, terapia genic\, precum [i
geneticii la studiul cancerului este decisiv, unele probleme de bioetic\ legate de
prin depistarea [i analiza unei game variate acestea.
de gene (oncogene, proto-oncogene [i anti- n cadrul capitolului sunt prezentate apli-
oncogene), implicate `n determinismul [i tra- ca]ii practice privind transmiterea `n descen-
tamentul diferitelor tipuri de cancer. Imuno- den]\ a unor boli genetice, `ntocmirea
genetica prezint\ importan]\ `n analiza rezis- arborelui genealogic [i analiza transmiterii
ten]ei organismului la diferi]i agen]i patogeni unor maladii de-a lungul genera]iilor, pre-
sau la mutageneza mediului ambiant. cum [i teste de evaluare a cuno[tin]elor.

TEST DE EVALUARE
1. Prezentai principalele realizri obi- de gene nealele sunt plasate pe perechi
nute n cadrul proiectului Genomul uman. diferite de autozomi. Se ia `n considera]ie
2. O femeie cu brbia proeminent i c\s\toria a doi p\rin]i heterozigo]i, pentru
nasul tip roman are un copil cu brbia cele dou\ caractere. S\ se stabileasc\ geno-
teit i nas crn. Precizai tipul de brbie tipul [i fenotipurile posibile ale p\rin]ilor [i
i nas al tatlui. Stabilii genotipurile ale copiilor posibili.
prinilor i ale copilului. 6. Prognatismul mandibular (sindromul
3. O femeie cu gene lungi, groase i pr Habsburg) se transmite autozomal domi-
ondulat are un copil cu gene scurte, subiri nant. Preciza]i ce fenotipuri vor avea des-
i pr buclat. Prezentai fenotipul tatlui cenden]ii unui cuplu, `n care genitorii au
pentru cele dou caractere i genotipul prognatism mandibular: (a) toate fiicele vor
prinilor i al copilului. avea prognatism [i to]i fiii vor fi normali;
4. Precizai dac un cuplu de mulatri (b) fiice [i fii normali; (c) toate fiicele nor-
(tegument tip ciocolatiu) pot avea copii cu male [i to]i fii cu prognatism; (d) fiicele [i
tegumentul negru sau alb. Dac da, specifi- fiii cu prognatism. n ce condi]ii, un cuplu
cai genotipurile prinilor i ale copiilor cu prognatism mandibular poate avea des-
posibili, precum i fenotipul acestora. cenden]i care nu manifest\ acest caracter?
5. La om, caracterul de dreptaci (gena 7. Care dintre urm\toarele sindroame
A), este dominant fa]\ de cel de stngaci este caracterizat citogenetic 47, XXY: (a) sin-
(gena a). Gena pentru culoarea c\pruie a dromul Turner; (b) sindromul Prader-Willi;
ochilor (B) este dominant\ fa]\ de gena pen- (c) choreea Huntington; (d) sindromul
tru culoarea albastr\ (b). Cele dou\ perechi Klinefelter; (e) sindromul Down.

104
pag.051-106.qxd 8/1/2008 3:27 PM Page 105

Cyan Yellow Magenta Black pag 105

Capitolul 6

8. Se consider\ un cuplu la care se pro- 14. Prezentai factorii genetici, factorii


duce non-disjunc]ia heterozomilor la b\r- sociofamiliali i de mediu care afecteaz
bat. S\ se stabileasc\: (a) tipurile de game]i valoarea coeficientului de inteligen.
forma]i; (b) s\ se efectueze `ncruci[area 15. Precizai rolul factorilor genetici n
game]ilor [i s\ se stabileasc\ genotipurile determinismul proceselor cognitive.
rezultate; (c) s\ fie precizate bolile identifi- 16. Precizai formarea raselor umane
cate, sexul descenden]ilor [i simptomele dup ipoteza out of Africa.
prezentate de ace[tia; (d) s\ se noteze 17. Prezentai metodele moderne de
num\rul de cromozomi caracteristici fiec\- investigaie utilizate n stabilirea relaiilor
rei maladii. Stabili]i aceia[i parametri `n ca- filogenetice ntre formele preumane.
zul non-disjunc]iei heterozomilor la mam\. 18. Specificai originea omului modern
9. n urma c\s\toriei a doi indivizi i legtura sa cu alte forme preumane.
s\n\to[i, se nasc trei copii: doi s\n\to[i [i 19. Specificai diferenele dintre muta-
unul albinotic. Preciza]i: (a) tipurile de genez i teratogenez.
game]i parentali; (b) genotipurile posibile 20. Nominalizai tipuri de cancer i ca-
ale copiilor s\n\to[i; (c) stabili]i procentual racteristicile lor.
posibilitatea na[terii de copii albinotici [i 21. Prezentai relaia dintre protoonco-
genotipurile lor; (d) prezenta]i modul de gene i oncogene; specificai rolul lor n
transmitere al maladiei, caracteristicile declanarea procesului carcinogen.
sale [i determinismul s\u genetic. 22. Definii antioncogenele i funcia lor
10. Un b\rbat hemofilic se c\s\tore[te celular.
cu o femeie heterozigot\. P\rin]ii so]iei au 23. Prezentai principalele anomalii
fost: tat\l hemofilic [i mama normal\. P\- genetice (genice, cromozomale i geno-
rin]ii so]ului au fost fenotipic normali. mice), asociate cancerului.
Stabili]i genotipul celor doi so]i [i al p\rin- 24. Precizai principalele tipuri de
]ilor lor, precum [i genotipurile posibile ale imunoglobuline i aciunea lor.
copiilor. 25. Precizai caracteristicile interfero-
11. ntr-o familie, mama este s\n\toas\, nului, procesul de sintez i importana sa.
iar tat\l [i fiul lor sunt bolnavi de dalto- 26. Precizai importana sfaturilor ge-
nism. Stabili]i: (a) genotipurile p\rin]ilor; netice i a diagnosticului prenatal, n re-
(b) genotipurile [i fenotipurile celorlal]i ducerea riscului genetic al malformaiilor
descenden]i posibili; (c) procentul descen- umane.
den]ilor s\n\to[i din prima genera]ie. 27. Prezentai diferena ntre fertili-
12. Dac\ mama este purt\toare iar tat\l zarea in vitro i clonarea reproductiv
este hemofilic, cum vor fi descenden]ii lor, uman.
b\ie]i [i fete? Nota]i genotipul p\rin]ilor, 28. Precizai importana procesului de
fenotipul [i genotipurile posibile ale des- clonare terapeutic i a celulelor stem.
cenden]ilor. 29. Discutai implicarea celulelor stem
13. Un b\rbat fertil are trei gonozomi: n terapia genic.
XXY. Ce combina]ii ale gonozomilor se vor 30. Analizai ce probleme de bioetic
g\si `n game]ii acestui b\rbat: (a) X; (b) YY; intervin n cazul procesului de clonare te-
(c) XY; (d) Y; (e) XX. rapeutic.

105
pag.051-106.qxd 8/1/2008 3:27 PM Page 106

Cyan Yellow Magenta Black pag 106

Bibliografie recomandat\ elevilor


Genetic molecular i Genetic uman

* Corneanu M., Corneanu G. Gene- * Laz\r V., Ni]\ M., Bu[e V., Lucr\ri
tica general i evoluia genomului. practice de biologie. Editura Ar ves,
Editura Universitaria, Craiova, 2005. Craiova, 2005.
* Ceapoiu N., Evolu]ia biologic\, micro- * Lewin B. Genes VIII. Pearson
evolu]ia [i macroevolu]ia, Editura Educational Inc., Pearson Prentice Hall,
Academiei Romne, Bucure[ti, 1988. Upper Sanddle River, 2004.
* Dordea M., Coman N., Cr\ciuna[ C., * Mohan Gh., Ardelean A. Dicionar
Andras C., Genetic\ general\ [i molecular\ Enciclopedic de Biologie. Vol. I, II. Editura
abordare practic\. Editura Presa Univer- All, Bucureti, 2005.
sitar\ Clujana, Cluj-Napoca, 2004. * Raicu P., Genetica general\ [i uman\,
* Gavril\ L., D\bal\ I., Descifrnd Editura Humanitas, Bucure[ti, 1997.
tainele eredit\]ii, vol. I, II, Editura Dacia, * Rogoz I., Hertzog Z.-I., Genetic\
Cluj-Napoca, 1981. Lucr\ri practice. Editura Medical\
* Hartl L.D., Jones W.E. Esential Universitar\, Craiova, 2002.
Genetics a genomic perspective. Third * *** Oxford, Dicionar de Biologie.
Ed., Jones and Bartlett Publ., Sudbury, MA. Editura Univers Enciclopedic, Bucureti,
* King C.R., Stansfield D.W., 2002 1999.
A Dictionary of Genetics. Sixth Ed., Oxford
University Press, New York, 2002.

106
pag.107-144.qxd 8/1/2008 3:29 PM Page 107

Cyan Yellow Magenta Black pag 107

III. ECOLOGIE

UMANA
pag.107-144.qxd 8/1/2008 3:29 PM Page 108

Cyan Yellow Magenta Black pag 108

1 Caracteristicile
Capitolul

ecosistemelor
antropizate

1. Introducere n ecologia uman


Ecologia uman este o ramur a ecolo- (biocenoz), care formeaz un ansamblu
giei generale care studiaz relaiile dintre integrat, n permanent aciune, i n care
oameni (ca indivizi), dintre populaiile se poate realiza productivitatea biologic
umane i mediul lor abiotic, biotic i social. poart numele de ecosistem.
Ecologia uman i stabilete drept Dup originea lor, ecosistemele se gru-
obiectiv fundamental studiul ecologiei siste- peaz n: ecosisteme naturale (aprute
melor socio-economice i al mediului uman. spontan pe baza evoluiei naturale a facto-
Ecologia sistemelor om-natur constitu- rilor ecologici) i ecosisteme antropizate
ie obiectul ecologiei umane i se poate (aprute pe cale artificial, sub influena
reprezenta ca n schema de mai jos (fig. 1). factorului uman).
Organismele din natur, inclusiv specia O alt clasificare a ecosistemelor, util
uman sunt strns legate de mediul lor de pentru ecologia uman, este cea prezentat
via cu care formeaz un tot unitar. de ecologul Haber (1990), ntocmit pe
Unitatea de baz structural i funcional baza gradului de artificializare a ecosis-
a ecosferei, alctuit dintr-o component temului, pe care o reproducem n tabelul 1.
abiotic (biotop) i o component biotic Ecosistemele antropizate sau amenajate
sunt create i dirijate de om, pentru satis-
populare/management facerea imediat sau de perspectiv a nece-
sitilor sale de via. Aa au luat natere
Sisteme ecologice Sisteme ecosistemele acvatice antropizate, cum
naturale socio-economice sunt: lacurile de baraj, lacurile de acumula-
re, iazurile i heleteiele piscicole i ecosis-
resurse/recreere
temele terestre antropizate, cum sunt eco-
sistemele agricole sau agroecosistemele,
reprezentate prin diferite culturi agricole
(culturi cerealiere, legumicole, pomicole,
ECOLOGIE UMAN viticole etc.), complexele zootehnice de
cretere intensiv a animalelor, i locurile de
Fig. 1. Obiectul ecologiei umane sla ale omului, constnd din sate i orae.

108
pag.107-144.qxd 8/1/2008 3:29 PM Page 109

Cyan Yellow Magenta Black pag 109

Capitolul 1
Tabelul 1 Principalele ecosisteme terestre aranjate
dup gradul de artificializare (sau descreterea caracterului natural)
A. BIO-ECOSISTEME Se caracterizeaz prin dominaia componentelor
naturale i a proceselor biologice.

A.1. Ecosisteme naturale Fr influenare uman direct.


Capabile de autoreglare.

A.2. Ecosisteme aproape-naturale Influenate de om, dar similare cu A.1. Se schimb


puin dac se sisteaz influena uman.
Capabile de autoreglare.

A.3. Ecosisteme semi-naturale Rezult din folosirea de ctre om a tipurilor A.1. i


A.2. dar nu create intenionat.
Se schimb semnificativ dac influena omului nceteaz.
Capacitate limitat de autoreglare.
Managementul este necesar.

A.4. Ecosisteme antropogene Create intenionat de om.


(biotice) Dependente n totalitate de managementul i con-
trolul uman.
B. TEHNO-ECOSISTEME Sisteme tehnice antropogene.
Domin structurile (artefactele) i procesele tehnologice.
Exemple: Create intenionat de om pentru activiti industri-
aezri umane (sate, orae) ale, economice, culturale.
sisteme de trafic Dependente n ntregime de controlul uman i de
complexe industriale bio-ecosistemele cu care alterneaz sau de care
sunt nconjurate.

2. Ecosisteme acvatice antropizate


Lacurile de baraj i lacurile de acumulare
Lacurile de baraj i lacurile de acumula- Bistria, n Carpaii Orientali, ntre care
re sunt ecosisteme cu trsturi particulare, lacul Bicaz este tipic de acumulare, iar
rezultate din condiiile noi n care evoluea- lacrurile din aval Pngrai, Vaduri, Btca
z biocenozele atunci cnd se bareaz un Doamnei .a., sunt lacuri de baraj (fig. 2).
curs de ap.
Se cunosc dou categorii de lacuri arti-
ficiale: lacuri de baraj, n care reinerea
Fig. 2.
apei dureaz ore sau zile i lacuri de acu-
Ecosistem
mulare, cu o durat a staionrii apei de
ordinul lunilor sau anilor. Un exemplu ca- antropizat
racteristic n acest sens l reprezint lac de acu-
lacurile din sistemul hidroenergetic de pe mulare

109
pag.107-144.qxd 8/1/2008 3:29 PM Page 110

Cyan Yellow Magenta Black pag 110

Partea a III-a
Lacurile de acumulare, ca: Bicaz, Vidraru datorate modificrii sezoniere a raportului
(Arge), Vidra (Lotru), se caracterizeaz dintre debitul de ap acumulat [i cel deversat.
prin biotopuri i biocenoze proprii. Biotopurilor lacurilor de acumulare le
este specific i o presiune hidrostatic
Particularitile biotopurilor mare, a crei influen se manifest selec-
n funcie de adncimea lacurilor, care tiv n distribuia biocenozelor.
variaz ntre 1092 m, se realizeaz o stra-
tificare termic tipic lacustr, n funcie de Particularitile biocenozelor
care se distinge spre suprafa o zon euri- Biotopul pelagic este populat de neus-
term, cu oscilaii anuale de la 0 la 24oC; ton, plancton i necton.
urmeaz o zon a saltului termic, situat Neustonul este pelicula de ap aflat la
ntre 3540 m i o zon stenoterm, cores- zona de contact dintre mediul aerian i cel
punztoare adncimilor sub 40 m, n care acvatic, n structura creia intr specii de
valorile termice sunt cuprinse ntre 410oC. bacterii, alge, protozoare, cladoceri .a.
n ceea ce privete oxigenarea apei la- Planctonul este compus din fitoplancton,
curilor de acumulare, acest proces se afl, populat din diferite specii de alge albastre,
pe de o parte, ntr-o dependen fizic, dat verzi, diatomee, i zooplancton, populat de di-
fiind solubilitatea oxigenului n ap n verse specii de rotiferi, cladoceri, copepode.
funcie de temperatur, iar pe de alt parte, Nectonul lacurilor de acumulare este
ntr-o dependen biochimic i chimic, reprezentat prin populaiile piscicole, n
exprimate prin consumul gazului n proce- care predomin crapul (Cyprinus carpio),
sele de respiraie a organismelor i de mi- somnul (Silurus glanis), porcuorul
neralizare a substanelor organice. (Gobio gobio), boitenul (Phoxinus phoxi-
O alt caracteristic a lacurilor de acu- nus), obletele (Alburnus alburnus), sco-
mulare o reprezint oscilaiile mari de nivel, barul (Chondrostoma nasus).

Iazurile i heleteiele piscicole


Iazul este un ecosistem artificial, ame- regiunile colinare i de es, destinate pisci-
najat att n scopul obinerii unor producii culturii sistematice; sunt uniti produc-
apreciabile de pete, ct i pentru folosirea tibile cu producii intensive controlabile.
rezervei de ap n alte scopuri practice
(morrit, agrement etc.).
Un iaz este o acumulare de ap amena-
jat de regul pe fundul unor vi mici sau a
unor albii prsite ori cu debit redus, afec-
tnd n general terenuri agricole inefi-
ciente, izlazuri neproductive sau zone cu
stufriuri i ppuriuri. Acest bazin acvatic
se formeaz prin ridicarea unui baraj din
pmnt de-a latul vii, n spatele cruia se
adun ap de ploaie sau din izvoare (fig. 3).
Heleteiele sunt bazine cu ap special
amenajate pe locuri plane, de regul n
Fig. 3. Aspectul unui iaz.

110
pag.107-144.qxd 8/1/2008 3:29 PM Page 111

Cyan Yellow Magenta Black pag 111

Capitolul 1
Apa este reinut n heleteu cu ajutorul caracteristice masei de ap i biocenoze
ridicturilor naturale de pmnt sau cu di- caracteristice prii fundice a bazinului.
guri, care-i confer bazinului forme geo- Astfel se poate vorbi de pelagos comu-
metrice bine definite. Heleteul se alimen- nitatea de organisme pentru biocenozele
teaz gravitaional sau prin pomparea apei din masa apei i de bentos comunitatea
dintr-o ap curgtoare. de organisme din biocenoza bentic.
Pelagosul. n masa apei din iazuri i
Particularitile biotopurilor
heleteie exist dou biocenoze: neustonul
Principalii factori care caracterizeaz
i planctonul, plus o asociaie de organis-
biotopul acestor ecosisteme sunt apa i
me animale ce formeaz nectonul.
sedimentul de pe fundul bazinelor. De
Neustonul reprezint biocenoza pelicu-
mare importan pentru desfurarea pro-
ceselor de via n aceste ecosisteme mici lei de la suprafaa apei, populat de nume-
ca ntindere este i climatul zonei n care roase specii de bacterii, alge, protozoare,
se gsesc iazurile i heleteiele. rotiferi, unele cladocere etc.
n iazuri, condiiile fizico-chimice ale Planctonul este o biocenoz bine dez-
apei depind n primul rnd de natura solu- voltat n a crei componen ntlnim
lui i de nivelul precipitaiilor. Topirea specii de bacterii cu rol n descompunerea
zpezilor i ploilor dilueaz apa primvara organismelor vegetale i animale moarte,
i n verile ploioase, iar o secet n sezonul protozoare, flagelate, alge albastre, verzi,
cald determin, prin evaporarea apei, o diatomee, cladoceri i copepode.
concentrare n sruri nutritive. Adncimea Nectonul este reprezentat de asociaii
mic a masei de ap face ca iarna iazurile de peti, amfibieni, unele reptile i psri.
s nghee pn la fund, iar un vnt mai pu- Iazurile i heleteiele sunt populate cu
ternic n anotimpurile de tranziie poate specii de peti, urmrind interesele omu-
tulbura ntreaga mas de ap. lui, care de fapt le i dirijeaz. Iazurile i
Fiind ecosisteme cu destinaie prepon- heleteiele de tip ciprinicol sunt populate
derent piscicol, calitatea apei intereseaz cu specii de crap, caras, caracud, lin, ba-
n special. Oxigenarea masei de ap consti- buc, biban i tiuc, iar cele de tip sal-
tuie una dintre caracteristicile de baz n monicol cu specii de pstrv (fig. 4).
bonitarea (determinarea calitii) iazurilor.
n condiiile uniformitii termice produse
de curenii de convecie, concentraia oxi-
genului se menine ridicat pn la orizon-
turile de fund, iar n perioadele de stratifi-
caie termic, la suprafa oxigenarea este
mai bun. Cantitatea de oxigen dizolvat
reprezint o rezultant a celor dou pro-
cese fiziologice antagoniste: respiraia
(a)
organismelor vii proces consumator de
oxigen i fotosinteza productorilor pri-
mari proces furnizor de oxigen.
Particularitile biocenozelor (b)
n iazurile i heleteiele piscicole de
mrimea lor se disting biocenoze ce sunt Fig. 4. Cultura crapului (a) i a pstrvului (b).

111
pag.107-144.qxd 8/1/2008 3:29 PM Page 112

Cyan Yellow Magenta Black pag 112

Partea a III-a

3. Ecosisteme terestre antropizate


Agroecosistemele
Agroecosistemele sau ecosistemele n concordan cu condiiile naturale i
agricole s-au format ca urmare a interven- necesitile de hran ale omului, agroeco-
iei omului asupra ecosistemelor naturale. sistemele se mpart n: ecosistemul cul-
Acestea sunt extrem de diversificate i turilor ierboase anuale i bienale; ecosis-
au luat natere prin defriarea pdurilor, temul plantaiilor de pomi i arbuti fruc-
asanarea unor lacuri i terenuri mlti- tiferi; ecosistemul culturilor protejate; eco-
noase. sistemul complexelor zootehnice de cre-
tere intensiv a animalelor.

Ecosistemul culturilor ierboase anuale i bienale


Acest ecosistem este extrem de diferit care are un pronunat grad de uniformizare,
i corespunde culturilor de cereale, plante dar variabil pe anotimpuri. La uniformizarea
leguminoase, oleaginoase, textile, medici- microclimatului particip irigaiile, n caz de
nale, aromatice i de nutre. secet, sau desecrile, n situaia unui exces
de umiditate. Uniformizarea aproximativ a
Particularitile biotopurilor condiiilor ecologice atrage dup sine extin-
Aceste culturi se caracterizeaz printr-o derea arealului unor specii de buruieni i
uniformizare spaial accentuat privind duntori, care trec dintr-o regiune n alta.
substratul necesar unei anumite culturi. O
parte din contribuie o aduce omul, care Particularitile biocenozelor
prin lucrri de mbuntiri funciare i apli- Matricea structural i funcional a agro-
carea unei agrotehnici specifice, mode- biocenozelor ierboase anuale i bienale o
leaz componentele pedologice spre valori formeaz plantele de cultur, care la nivel
ct mai apropiate de cerinele optime ale mondial se ridic la circa 300 specii. Dintre
plantei cultivate. acestea, numai circa 30 de specii ocup supra-
Microclimatul agroecosistemului se edi- feele cele mai mari, ntre care grul, orezul,
fic pe msura creterii plantei cultivate. orzul, ovzul, porumbul (fig. 5), cartoful, cea-
Diferenele microclimatice ntre agrosis- pa, tomatele, varza, batalele, maniocul, floa-
temele amintite nu sunt mari, ele se afl ns rea-soarelui (fig. 6), sfecla-de-zahr .a., care
sub influena climatului local sau regional asigur producia cea mai mare de alimente.

Fig. 5. Cultura porumbului. Fig. 6. Cultur de floarea-soarelui.

112
pag.107-144.qxd 8/1/2008 3:29 PM Page 113

Cyan Yellow Magenta Black pag 113

Capitolul 1
n cadrul agrobiocenozelor, populaiile singur strat dominant protejat de om prin
plantelor de cultur conin o repartiie uni- nlturarea buruienilor.
form a indivizilor, acetia alctuind un

Ecosistemele plantaiilor de pomi i arbuti fructiferi


Ecosistemul cuprinde plantaiile de
pomi fructiferi, arbuti fructiferi i plantai-
ile de vi-de vie.

Particularitile biotopurilor
n cadrul acestui ecosistem distingem o
multitudine de biotopuri, fiecare cu nsui-
rile sale abiotice particulare. Eterogenitatea
lor este determinat de variaiile de expu-
nere, nclinaie i de tipul de sol, la care ine-
vitabil se adaug clima cu un anumit regim
termic, precipitaiile i vnturile. Microcli-
matele locale se afl sub controlul climei Fig. 7. Plantaie de portocali.
regionale i variaz mult n plan orizontal i
vertical, pe latitudine i longitudine. speciilor, fiind specifici pentru un anumit
gen de plantaie. Dominante sunt insectele
Particularitile biocenozelor i larvele lor, acarienii i psrile insecti-
Fiecare biocenoz corespunztoare vore. Lanurile trofice din cadrul acestor
unui anumit tip de agrosistem (plantaii de biocenoze sunt, n general, de tip fitofag,
meri, peri, cirei, coaczi, smochini, porto- saprofag i de hiperparazitism.
cali, lmi, vi-de-vie) realizeaz local un Lanurile fitofage se realizeaz prin con-
microclimat caracteristic, dup specie i sumul de muguri, frunze, fructe, semine,
sistemul de cultur (fig. 7). scoara i lemnul tulpinilor i al rdcinilor.
n culturile intensive i superintensive, Consumatorii de ordinul II sunt insectele
stratul ierbos este nlocuit prin culturi inter- carnivore, dar mai ales psrile, iar cu
calate (ovz, borgeag, batat etc.), iar stratul acestea se hrnesc psrile rpitoare care
ierbos spontan este nlturat prin ierbicidare sunt consumatori de ordinul III (fig. 8).
sau prin praile repetate. nlturndu-se plan- Lanurile trofice saprofite realizeaz
tele, se elimin funcia pedogenetic i de consumul biomasei vegetale moarte de
protecie a solului pe care acestea o realizau. ctre flora i fauna saprobiont de la
Consumatorii sunt foarte numeroi ca suprafaa solului sau din straturile lui
numr de specii i de indivizi n cadrul superficiale avnd ca efect mineralizarea.

Fig. 8. Lan trofic


fitofag.

113
pag.107-144.qxd 8/1/2008 3:29 PM Page 114

Cyan Yellow Magenta Black pag 114

Partea a III-a
n toate biocenozele edificate de pomi psri i mamifere. Aici, sunt evidente i
i arbuti fructiferi sau de vi-de-vie se lanuri trofice de hiperparazitism, n care
remarc n reeaua trofic importana larvele fitofage ale insectelor sunt parazi-
major a consumatorilor de ordinul II i III, tate de alte larve de insecte, iar acestea
constnd din insecte, acarieni, reptile, sunt parazitate de virusuri.

Ecosistemul culturilor protejate


Culturile protejate urmresc prelun- tru sere i fr de care culturile nu pot
girea perioadei de vegetaie a unor plante exista. Se urmrete n permanen asigu-
legumicole i floricole i sunt practicate n rarea condiiilor ecologice optime nece-
toate rile. sare speciei cultivate de-a lungul dezvol-
Culturile protejate se realizeaz n trii sale fenologice. Astfel, se asigur o
rsadnie, destinate pentru pregtirea anumit intensitate i cantitate de lumin, o
rsadurilor necesare plantrii n cmp; n anumit umiditate n sol i atmosfer, o fer-
sere, unde culturile sunt protejate pe toat tilizare corespunztoare, o dozare a dioxi-
perioada lor de vegetaie; n solarii, unde dului de carbon etc. Se aplic la timp lu-
culturile ncep mult mai devreme prim- crrile de ngrijire i de combatere a bolilor
vara (fig. 9, fig. 10). i duntorilor.

Particularitile biotopurilor Particularitile biocenozelor


Fiecare biotop este realizat i controlat Biocenozele din cadrul agrosistemelor
de ctre om. Pentru reglarea permanent a protejate se menin nesaturate, aspect pus
factorilor ecologici de microclimat i nutri- n eviden de cultivarea unei singure specii,
ie mineral, de care planta cultivat are uneori a unui singur soi, de nlturare a
nevoie, se investete o cantitate apreciabil buruienilor i de controlul strict al bolilor i
de energie. Aceasta const n cldura bio- duntorilor. Conexiunile trofice din cadrul
logic, rezultat din descompunerea guno- fiecrei biocenoze sunt asemntoare cu
iului de grajd (mai ales n producerea cele din culturile neprotejate, dar se modi-
rsadurilor) sau n utilizarea cldurii obi- fic sub raport cantitativ prin favorizarea
nute pe cale tehnic, att de necesar pen- unor anumite tipuri de consumatori primari.

Fig. 9. Cultura plantelor decorative n sere. Fig. 10. Cultura legumelor n solarii.

114
pag.107-144.qxd 8/1/2008 3:29 PM Page 115

Cyan Yellow Magenta Black pag 115

Capitolul 1
n condiiile ecologice de ser, prolifereaz Lanurile trofice de prdtorism (animale
micozele, bacteriozele, virozele, iar dintre rpitoare) sau de hiperparazitism sunt
animale: afidele, musculia alb, musculia foarte puine sau lipsesc. Meninerea
de ser, nematozii etc. Consumatorii secun- duntorilor la un nivel redus se realizeaz
dari sunt mult mpuinai sau lipsesc. pe calea tratamentelor chimice.

Ecosistemul complexelor zootehnice de cretere intensiv


a animalelor
Acest tip de agroecosistem cuprinde condiii, animalele i-au pierdut instinctul
cresctoriile de animale create de zooteh- de teritorialitate i instinctul matern, n
nia modern, n scopul obinerii de pro- schimb se remarc creterea agresivitii
ducii mari i constante. i apariia unei stri de stres.
n cadrul nielor ecologice, exist o
Particularitile biotopurilor stare de nesaturare prin nlturarea oric-
Totalitatea biotopurilor fiecrui ecosis- ror specii, exceptnd-o pe aceea care asigu-
tem agrozootehnic are un anumit microcli- r producia biologic. Animalele domes-
mat interior generat de temperatur, umi- tice sunt nsoite n adposturi i de alte
ditate i luminozitate. nsuirile ecologice specii de consumatori care devin concu-
ale biotopului asigur fiecrei specii o pro- reni pentru hran, aa cum sunt roz-
ductivitate maxim. toarele (obolani, oareci). Tot aici exist
activitate desfurat de ectoparazii i
Particularitile biocenozelor endoparazii. Predomin organismele pato-
Biocenozele existente n complexele gene productoare de pneumonii, gas-
zootehnice care concentreaz animale troenterite, salmoneloze, trichineloze etc.
domestice (psri, porcine, ovine, bovine) n complexele zootehnice din cadrul
aparin unei singure specii i de multe ori acestui ecosistem, baza trofic a ani-
unei singure rase cu performane produc- malelor este reprezentat de culturile fura-
tive ridicate (fig. 11, fig. 12). Indivizii sunt jere. Proteinele i energia din furaje sunt
ntreinui n adposturi i boxe, pe cate- transformate n proteine proprii specifice
gorii de vrst i sexe. Populaiile sunt i energie necesar proceselor vitale.
omogene genetic i fenotipic. n aceste

Fig. 11. Creterea porcinelor Fig. 12. Creterea bovinelor

115
pag.107-144.qxd 8/1/2008 3:29 PM Page 116

Cyan Yellow Magenta Black pag 116

Partea a III-a

Ecosistemele aezrilor umane


n aezrile umane, oamenii se gsesc folosesc n mare msur energia pro-
n interaciune cu factorii abiotici, biotici dus n centralele electrice, de termoficare,
naturali i cu factorii artificiali, introdui nucleare etc;
sau produi de om (locuine, maini, dife- aprovizionarea cu ap se face prin
rite instalaii, construcii). sisteme hidrografice special amenajate;
Aezrile sunt de tip rural i de tip urban. sursa de produse alimentare provine
Ecosistemele de tip rural sunt ctunele, din agroecosistemele limitrofe sau de la dis-
satele, comunele (fig. 13) i se caracte- tan, precum i din industria alimentar;
rizeaz prin: au producie industrial;
contact strns cu mediul natural; sunt dotate cu staii de depozitare a
folosesc n mic msur energia reziduurilor i deeurilor, de epurare a apei
neconvenional, hidroenergia; uzate etc.
aprovizionarea cu ap se face din n ambele tipuri de ecosisteme, omul
surse imediate, locale (fntni sau izvoare este factorul care determin optimizarea
naturale); condiiilor de mediu i a raportului om-so-
sursa de hran provine direct din cietate-natur.
ecosistemele naturale i agroecosisteme. Indiferent de tipul de aezare uman,
Ecosistemele de tip urban sunt oraele oamenii trebuie sa acioneze pentru dimi-
(fig. 14)i se caracterizeaz prin: nuarea i nlturarea factorilor poluani,
contact redus cu mediul natural; care sunt rezultatul activitii lor.

4. *Particulariti ale fluxului de materie i energie


n ecosistemele antropizate
Fluxul de materie
Ca urmare a proceselor metabolice materie se caracterizeaz printr-o anumit
care au loc n organismele dintr-un ecosis- producie biologic produs de indivizii
tem natural sau antropizat, fluxul de ecosistemului.

Fig. 13. Ecosistem de tip rural Fig. 14. Ecosistem de tip urban

116
pag.107-144.qxd 8/1/2008 3:29 PM Page 117

Cyan Yellow Magenta Black pag 117

Capitolul 1
Fig. 15. Prin fotosintez
se realizeaz transformarea
ENERGIE
energiei luminoase
LUMINOAS n energie chimic.
ENERGIE Aceasta este stocat
CHIMIC
FOTOSINTEZ din n materia organic pro-
MATERIA dus de plante sub form
ORGANIC
(1 g = 18 kJ)
de producie primar.

PRODUCIE
PRIMAR
CO2 H2O N, P, K O2

Producia biologic exprim cuantumul Producia primar brut (PB) este


de cretere a substanei organice ntr-un sporul total de biomas i energie realizat
interval de timp. de productori. O parte din energie este
Spre deosebire de producia biologic, folosit pentru desfurarea diferitelor pro-
biomasa este cantitatea de substan cese metabolice ale productorilor (sinteze
organic vie existent n ecosistem la un organice, micare, reproducere etc.). O
moment dat. alt parte se acumuleaz n corpul acestora
Producia biologic a ecosistemului sub form de substan organic.
(global) este reprezentat printr-o pro- Producia primar net (PN) reprezint
ducie primar (datorat productorilor) i sporul de materie organic realizat de pro-
o producie secundar (datorat consuma- ductori, din care se scade cantitatea de
torilor, indiferent de nivelul trofic). materie organic consumat prin respiraie
Producia primar este masa de sub- pentru desfurarea proceselor metabolice.
stan organic sintetizat de productori Deci PN = PB consumul respirator,
(plante) ntr-o anumit unitate de timp i unde producia primar net (PN) consti-
un anumit spaiu (fig. 15). Ea asigur efi- tuie sursa de hran disponibil pentru
ciena schimbului de energie i circulaia nivelul trofic al consumatorilor primari
nutrienilor ntre productori, consumatori (fitofagi). Aceasta nu rmne constant n
i descompuntorii dintr-un ecosistem. ecosistem, deoarece o parte este neutrali-
Producia primar se exprim printr-o zabil, iar unele pri din corpul plantelor
producie brut i una net. mor i intr n descompunere (fig. 16).

E = energie luminoas
E1 E1 = energie luminoas
neutilizabil
R C1 = consumatori fitofagi
D = descompuntori
E R = respira]ie
P P = produc]ie
PB Fig. 16. Producia
PN PB = producie primar brut
C1 PN = producie primar net primar net
SN = substan neutilizabil circul n nivelurile
SN
D consumatorilor.

117
pag.107-144.qxd 8/1/2008 3:29 PM Page 118

Cyan Yellow Magenta Black pag 118

Partea a III-a

PRODUCIE PRODUCIE
PRIMAR SECUNDAR
920 g 100,5 g

85%
adic 782 g

7,75%
vac: 95 g
adic 71 g
(lapte: 85 g; carne: 10 g)

7,25% neasimilat
48,5 g
Valorile numerice sunt expri-
mate n grame de materie neutilizat nevertebrate
uscat pe hectar i pe an ierbivore: 5,5 g

Fig. 17. Transferul de biomas de la productori la consumatori

n agroecosisteme, producia primar n general, consumatorii de talie mare


net se evalueaz pe baza cantitii de sub- consum mai mult hran i au o producie
stan organic produs pe o anumit secundar mai mare dect consumatorii de
suprafa de teren n unitatea de timp, talie mic.
reprezentat prin recolt (exprimat de n ceea ce privete tipul de ecosistem,
obicei n kg sau t / ha / an). producia secundar este, de obicei, mai
Producia secundar reprezint bio- ridicat n ecosistemele terestre dect n
masa acumulat n ecosistem ca urmare a cele acvatice; de asemenea, n agroecosis-
asimilaiei organismelor heterotrofe (con- teme dect n ecosistemele naturale. n
sumatori i descompuntori). Transferul agroecosisteme, omul elimin multe specii
care ar putea concura pentru hran cu ani-
de biomas de la productori la consuma-
malele domestice, n timp ce n ecosis-
torii fitofagi precum i transferul de bio-
temele naturale, producia secundar se
mas ntre celelalte categorii de consuma-
repartizeaz ntre toate speciile consuma-
tori variaz de la un nivel trofic la altul i de
toare.
la un ecosistem la altul (fig. 17).

Fluxul de energie
Pentru a supravieui, organismele au parial de productori i variaz n funcie
nevoie de energie pe care o folosesc n sin- de anotimp.
teza substanelor organice necesare O parte din energia solar captat de
creterii, dezvoltrii i activitii lor. Din ctre plante este transformat n substane
aceast cauz, funcionarea unui ecosistem organice (producie primar net), iar o
este condiionat de consumul energetic. parte se pierde n procesul de respiraie.
Sursa principal de energie ntr-un eco- Energia stocat n producia primar
sistem este energia solar. Ea este captat net constituie sursa de hran pentru

118
pag.107-144.qxd 8/1/2008 3:29 PM Page 119

Cyan Yellow Magenta Black pag 119

Capitolul 1

E = energie luminoas
E1 = energie necesar fotosintezei
R1 R2 R3 P = productori
C1 = consumatori fitofagi
E C2 = consumatori zoofagi
D = descompuntori
P C1 C2 R1,2,3 = respiraie
PN1 PN2 PN3 A1,2,3 = asimilaie
A3 SN1,2 = substane neasimilabile
A2 PB = producie primar brut
PB = A1 PN1,2,3 = producie primar net

E1 D
SN1 SN2 SN3

Fig. 18. Transferul de energie ntr-un ecosistem de cmpie

consumatorii fitofagi, iar producia acestora Populaia uman reprezint un ansam-


constituie sursa de hran pentru consuma- blu de indivizi, care triesc pe un teritoriu
torii secundari. i procesul continu bine delimitat, aa cum este cazul populai-
Trecerea energiei de la productori la ilor naionale.
consumatori prin intermediul lanurilor
trofice se numete flux energetic (fig. 18). E
Energia se diminueaz de la o verig la
alta a lanului trofic, deoarece o parte este
napoiat mediului sub form de cldur, o
alt parte este consumat n procesele
vitale proprii, iar alt fraciune este nglo-
bat n produii finali de degradare (fig 19).
Fluxul de energie ntr-un ecosistem
agricol se caracterizeaz prin:
energia stocat n producia primar
net care scade n lanul trofic de la pro-
ductori spre ultimii consumatori;
energia eliminat prin respiraie
crete de la productori spre consumatorii
de rangul cel mai nalt;
pierderile de energie se reduc de la energie din moleculele organice
nivelul productorilor spre cel al consuma-
energie eliberat sub form
torilor de vrf;
de cldur
eficiena utilizrii energiei (asimilrii
hranei) crete de la nivelul productorilor
spre cel al consumatorilor de vrf. Fig. 19. Diminuarea energiei ntr-un lan
trofic.

119
pag.107-144.qxd 8/1/2008 3:29 PM Page 120

Cyan Yellow Magenta Black pag 120

Partea a III-a

LUCRRI PRACTICE ANALIZA FACTORILOR ABIOTICI


Msurarea temperaturii: folosim o sticl cu o rondea de plumb la
aerului se face cu un termometru partea inferioar, astupat cu un dop de
gradat de la -50oC la -100oC; msurto- care se leag un nur; sticla se las n
rile se fac n mediul studiat, la umbr i ap i printr-o smucitur a nurului se
la soare (fig. 20, a); deschide dopul i se umple cu ap. Se
solului se realizeaz astfel: se face scoate sticla la suprafa, se introduce n
iniial o cresttur n sol cu un hrle n ea termometrul 5 minute, dup care se
form de X, se introduce termometrul la citete temperatura.
ntretierea braelor X-ului i se acoper Msurarea umiditii:
cu pmnt (fig. 20, b); aerului se realizeaz cu ajutorul
apei se poate face la suprafa unui aparat numit higrometru sau higro-
introducnd n masa apei termometrul graf care va nregistra valorile umiditii
pratie; citim temperatura dup 5 minu- (fig. 20, c);
te, dar se poate nregistra i temperatura solului se realizeaz cu ajutorul
apei de la o anumit adncime. Atunci unei sonde (fig. 20, d) cu care se recol-

a) b) c)
termometrul
de aer are
gradaia termometrul
pn la de sol se
100C acoper
cu pmnt
pentru a
nu suferi higrometru
influene
externe
i se las
10 min.

d) e) f)
pluviometrul
este un cilindru,
n interior cu
un vas colector
i o plnie;
apa colectat
se msoar
dimineaa,
cu un cilindru
gradat, care
indic nlimea
Fig. 20.
stratului
Aparate folosite de ap
pentru analiza fac- anemometru
sond de sol
torilor abiotici

120
pag.107-144.qxd 8/1/2008 3:29 PM Page 121

Cyan Yellow Magenta Black pag 121

Capitolul 1

teaz probe de sol care se vor cntri i i se mparte la intervalul de timp n


apoi se vor usca. Diferena de greutate care s-au rotit cupele. Astfel obinem
pierdut prin evaporarea apei va da gradul viteza vntului n m/s.
de umiditatea a solului (gradul 1-5). Determinarea intensitii luminii
Msurarea cantitii de precipitaii se se face cu luxmetrul, care indic intensi-
face cu ajutorul pluviometrului (fig. 20, e), tatea luminii n luci (lx).
care se fixeaz la 1,5 m fa de sol. Volu-
mul de ap colectat se msoar cu aju-
torul recipientului gradat, zilnic la ora 8.
Msurarea pH-ului apei sau al solu-
lui se face cu hrtia indicatoare de la 114
sau de la 714, care se pune n contact cu
apa sau solul recoltat. Culoarea obinut se
compar cu etalonul, de obicei aflat pe
cutie, i se citete valoarea pH-ului (fig. 21).
Msurarea vitezei vntului se face
cu anemometrul (fig. 20, f). Aparatul se
aduce n btaia vntului, se pune n
funcie, avnd grij ca acul indicator s
fie la zero; cnd rotaia cupelor se Fig. 21. Determinarea pH-lui cu hrtia indi-
oprete, se citete valoarea nregistrat catoare.

TEST DE EVALUARE
1. Definii obiectul de studiu al ecolo- 7. Prezentai particularitile biotipuri-
giei umane. lor i biocenozelor din ecosistemul cultu-
2. Enumerai care sunt principalele eco- rilor protejate.
sisteme antropizate. 8. Enumerai care sunt particularitile
3. Artai particularitile biotopului i biotipurilor i biocenozelor din ecosis-
biocenozei dintr-un lac de acumulare. temul complexelor zootehnice de cretere
4. Care sunt principalele agroecosis- intensiv a animalelor.
teme din Romnia? 9. Care sunt deosebirile dintre ecosis-
5. Prezentai particularitile biotopului temele de tip rural i cel de tip urban?
i ale biocenozelor din ecosistemul cul- 10. Ce este biomasa?
turilor ierboase de plante anuale i bienale. 11. n ce const deosebirea dintre pro-
6. Enumerai care sunt particularitile ducia primar brut i cea net?
biotipurilor i biocenozelor din ecosis- 12. Ce reprezint producia secundar?
temele pomilor i arbutilor fructiferi. 13. Ce este fluxul energetic i cum cir-
cul el n lanurile trofice ale unui ecosis-
tem agricol?

121
pag.107-144.qxd 8/1/2008 3:29 PM Page 122

Cyan Yellow Magenta Black pag 122

2 *Structura
Capitolul

i dinamica
populaiilor umane

1. Structura populaiei
Populaia uman poate fi mprit dup Conceptul de structur a populaiei gru-
diferite criterii (demografice, economice, peaz indivizii dup dimensiunile lor, vr-
sociale, educaionale), fiecare parte con- sta, raportul ntre sexe sau forma de repro-
stituind o subpopulaie: urban sau rural, ducere.
masculin sau feminin, activ sau inactiv
etc. Structura pe vrste
n ansamblu, populaia constituie o uni- Aceasta este analizat n funcie de
tate organizatoric complex i obligatorie vrst i ponderea vrstei respective, repre-
pentru indivizii tuturor speciilor. zentndu-se de obicei sub forma unui grafic
Populaiei umane i sunt caracteristici cartezian (cu dou axe), cunoscut sub
anumii parametri de static, structur i numele de piramid a vrstelor (fig. 22).
dinamic. Structura pe vrste se exprim prin pro-
Statica populaiei exprim starea popu- poriile diferitelor clase de vrst (tineri,
laiei ntr-o perioad de timp privind efec- maturi, vrstnici). Ea influeneaz direct
tivul i densitatea populaiei. numrul i densitatea indivizilor.
Efectivul populaiei umane presupune n funcie de reproducere exist trei
realizarea unui recensmnt, care se refer
vrste ecologice:
vrsta prereproductiv (juvenil),
la nregistrarea populaiei la un moment dat
caracterizat prin intensitatea proceselor
mpreun cu o serie de caracteristici demo-
de cretere i lipsa maturaiei sexuale;
grafice i socio-economice (domiciliu, vrst,
vrsta reproductiv (matur), cu un
sex, stare civil, cetenie, nivel de instruire,
ritm lent i apoi unul de cretere, dar
loc de munc, categorie social, ocupaie
creia i este specific actul reproducerii;
etc.) Recensmntul populaiei este organi-
vrsta postreproductiv (senescen-
zat n vederea determinrii numrului, struc-
t), cu un ritm nul de cretere, iar procesul
turii i repartizrii teritoriale a populaiei. de reproducere este sistat.
Densitatea populaiei reprezint para-
metrul ecologic care precizeaz numrul de Structura pe sexe
indivizi pe unitatea de suprafa (km2). Proporia relativ a sexelor ntr-o popu-
laie difer foarte mult.

122
pag.107-144.qxd 8/1/2008 3:29 PM Page 123

Cyan Yellow Magenta Black pag 123

Capitolul 2
vrsta n ani
90

65
45

15
numr
populaie populaie populaie de indivizi
n cretere stabil n scdere

Fig. 22. Reprezentarea grafic a unor exemple de structuri pe vrste ale unei populaii.

Aceasta poate avea urmtoarele valori: 1 > 1 cnd femelele sunt n numr
1 : 1 cnd numrul femelelor este mai mare dect masculii, presupune dez-
egal cu numrul masculilor, avem de-a face voltarea numeric a populaiei;
cu o populaie stabil; 1 < 1 cnd femelele sunt n numr
mai mic dect masculii, avem de-a face cu
regresul populaiei.

2. Dinamica populaiei
Dinamica populaiei reprezint totali- Rata natalitii nu este constant, ea este
tatea modificrilor cantitative ale unei po- modificat n funcie de starea populaiei,
pulaii, sub influena variaiilor diferiilor aflat n relaie direct cu factorii ecologici.
factori abiotici i biotici. Evoluia unei po- Pot exista explozii de natalitate ale po-
pulaii cunoate mai multe faze: pulaiilor pentru un timp scurt sau de cte
faza de nceput, n care densitatea ori condiiile de via se mbuntesc.
populaiei crete treptat; Rata natalitii se calculeaz prin relaia:
faza de cretere exponenial, n care
Rn = n / N ,
crete rapid numrul de indivizi;
faza staionar, n care la o anumit n care:
valoare a densitii populaiei acioneaz Rn este rata natalitii;
diveri factori inhibitori, astfel nct n = numrul de indivizi aprui prin
creterea populaiei se diminueaz i trep- reproducere;
tat devine staionar. N = efectivul populaiei.
Creterea sau descreterea unei popu-
laii este infleunat de natalitate, mortali- n general, fluctuaiile natalitii se
tate, migraie, explozie demografic. datoreaz presiunii mediului, dar i altor
Natalitatea asigur intrarea de indivizi cauze: cantitatea i calitatea hranei, densi-
ntr-o populaie. Fiecare populaie are capa- tatea populaiei n cauz, fecunditatea i
citatea de a se menine n ecosistem prin fertilitatea populaiei.
perpetuarea indivizilor. Mortalitatea constituie procesul de elimi-
Rata natalitii const n raportul dintre nare prin deces a anumitor indivizi din popu-
indivizii nou-aprui ntr-un interval de laie. Moartea survine fiziologic dup ce in-
timp prin natere i efectivul populaiei. dividul a parcurs ntregul ciclu de dezvoltare

123
pag.107-144.qxd 8/1/2008 3:29 PM Page 124

Cyan Yellow Magenta Black pag 124

Partea a III-a
ce i este caracteristic sau, la ntmplare, prin Explozia demografic
aciunea bolilor sau a unor calamiti (inun- Explozia demografic reprezint ten-
daii, incendii, taifunuri, cutremure etc.). dina aprut la un moment dat n evoluia
Indiferent de cauz, rata mortalitii se populaiei mondiale, constnd din accele-
calculeaz prin relaia: rarea ratei medii de cretere a populaiei,
Rm = n / N , ca urmare a reducerii foarte accentuate a
mortalitii i creterea natalitii, pe o
n care: perioad de timp oarecare (fig. 23).
Rm este rata mortalitii; Una dintre cele mai importante con-
n = numrul de indivizi mori ntr-un secine ale exploziei demografice va fi dis-
interval de timp; pariia populaiilor izolate i scderea ma-
N = efectivul populaiei. siv a cstoriilor endogame.
Privind aspectele menionate, creterea Dezvoltarea populaiei
ratei mortalitii este condiionat genetic, 50
A
fiziologic i ecologic.
rata pe 1 000 de persoane
40
Migraia
Migraia reprezint deplasarea n mas
30
sau individual a unei populaii dintr-o
regiune n alta, cauzat de obicei de factorii
rata
climatici, condiiile de via, suprapopu- 20 natalitii
larea unui teritoriu etc.

creterea
natural
Oamenii au migrat dintotdeauna. Euro-
10
penii, de pild, au ajuns n America; negrii
rata
adui ca sclavi reprezint acum un contin- mortalitii
0
gent important din populaia ntregii 1775 1825 1875 1900 1925 1955 1990
Americi; mongolii au atins coastele Africii An
i ale Americii. Pretutindeni au avut loc Dezvoltarea populaiei
amestecuri, dar importana lor nu a fost 50
B
aceeai. De obicei, nou-veniii tind s se
izoleze de restul populaiei. Cu toate aces- 40
rata pe 1 000 de persoane

rata
tea, negrii din S.U.A., n ciuda segregaiei, natalitii
au aproximativ 30% dintre genele lor 30
amestecate cu albii.
creterea

n America Latin, unde nu a existat


natural

20
niciodat o segregaie rasial real, ames-
tecul a fost de la nceput intens. Fr nici o
ndoial, migraiile sunt condiionate de 10
factorii social-economici. rata
mortalitii
Prin migraie se realizeaz o infiltraie 0
de gene strine ntr-o populaie. 1775 1825 1875 1900 1925 1955 1990
An
Creterea populaiei umane n urmtoa-
rele decenii va pune n mod necesar i pro- Fig. 23. Creterea populaiei:
blema valorificrii unor noi regiuni: zonele A n perioada revoluiei industriale;
arctice, tropicale, zonele situate pe nlimi. B dup cel de-al Doilea Rzboi Mondial.

124
pag.107-144.qxd 8/1/2008 3:29 PM Page 125

Cyan Yellow Magenta Black pag 125

Capitolul 2

Populaia lumii
n anii:

Europa/Rusia
S.U.A./Canada

Africa

America Latin
Australia

Fig. 24. Distribuia populaiei pe Glob n perioada 18002000.

Odat cu industrializarea, cu crearea de rasial a lui Homo sapiens va fi cu totul


noi drumuri, cu mecanizarea intens a diferit de cea din trecut.
agriculturii, numrul celor care se vor Dup toate probabilitile, aceast cre-
ocupa de cultivarea pmntului se va tere preferenial a populaiei Globului nu
reduce pn la cteva procente din totalul va afecta nici n sens pozitiv i nici n sens
populaiei. negativ evoluia uman. n treptele evo-
Explozia demografic nu se produce n luiei numerice a populaiei lum ca reper
toate rile cu aceeai intensitate; ritmuri anul 600 . H. Atunci existau pe Glob circa
mai nalte se nregistreaz n rile n curs 5 milioane de oameni. n anul 2025 vor fi
de dezvoltare din America Latin, Africa, 12 miliarde de oameni, iar n anul 2150
Asia de sud i sud-vest, n vreme ce n - cifra estimat este de 150 miliarde. Se va
rile dezvoltate i cu deosebire n cele euro- ajunge la densitatea de 1 000 locui-
pene se constat creteri mult mai lente, tori/km2.
sau, la unele dintre ele, chiar o stagnare de- n perspectiv, fiina uman trebuie s
mografic (fig. 24). Analiznd acest aspect, conceap noi strategii i modaliti de
Simpson spunea: Deoarece n prezent nu exploatare a resurselor biologice i s nu
avem niciun criteriu biologic prin care o depeasc capacitatea de suport i de
ras sau o naiune poate fi obiectiv consi- regenerare a ecosistemelor naturale.
derat ca superioar sau inferioar, nu Pentru aceasta, trebuie s se realizeze o
exist nicio cale pentru a evalua rezultatele cooperare internaional pentru conser-
biologice posibile ale acestui fel de varea resurselor naturale i a biodiver-
evoluie, cu excepia faptului c structura sitii.

125
pag.107-144.qxd 8/1/2008 3:29 PM Page 126

Cyan Yellow Magenta Black pag 126

Partea a III-a

LUCRRI PRACTICE ANALIZE STATISTICE


ALE STRUCTURII I ALE DINAMICII POPULAIILOR
Structura pe vrste la Drosophila melanogaster
Drosophila melanogaster avnd gene ortoloage cu omul, este utilizat\ pentru studii
de genetic\ uman\ (efectul substan]elor mutagene, carcinogene, anticarcinogene [.a.)
Materiale necesare: aduli (mascul Cultura se pstreaz la temperatura
i femel de Drosophila melanogaster camerei (2025oC). Se urmrete, pe
(fig. 25), borcane de 250 ml, acoperite parcursul a 23 zile, mperecherea indi-
etan cu tifon, mediul de cultur (amestec vizilor i depunerea de ou de ctre
n pri egale de mlai, omogenat de femele n mediul nutritiv. Adulii sunt
fructe sau zahr); acesta se fierbe i se eliminai apoi prin deschiderea capacului
adaug puin drojdie de bere; lup 5x, de tifon. Dup 3 zile se repet lucrarea,
cloroform, creion, hrtie milimetric. realizndu-se o nou faz de depuneri de
ou pe parcursul altor dou zile. n acest
Fig. 25.
fel s-au scurs zece zile de la prima la ulti-
Drosophila
ma operaie t = 2(3 + 2) = 10 zile.
melanogaster La circa 20oC, durata de via a unei
indivizi femel generaii este de 15 zile, iar la 26oC de 10
i mascul zile. Prin durata de via se nelege inter-
mpreun cu valul de timp de la depunerea oului pn
garnitura cro- cnd adultul respectiv se mperecheaz i,
mozomial. dac este femel depune prima pont.
Cultura realizat posed dou generaii de
Modul de lucru indivizi. La temperatura de 2025oC, la
ntr-un borcan de 250 ml se pune me- circa 1-5 zile dup terminarea celei de a
diul de cultur (strat de 2 cm grosime). n doua operaii se obin primii aduli.
vas se introduc indivizii aduli din primul n acest stadiu se trece la numrarea
stadiu(5 perechi). Pentru aceasta, con- indivizilor din cultur i la estimarea
trolul preliminar al sexului indivizilor se piramidei vrstelor pentru populaia stu-
realizeaz cu ajutorul lupei 5x, indivizii diat. La drosofila exist aproximativ ase
fiind anesteziai cu cloroform. Adulii con- stadii: ou, trei stadii larvare, stadiul de
trolai se introduc n borcanul de cultur. pup i dou stadii de adult.

TEST DE EVALUARE
Verificai-v cunotinele, rspunznd la urmtoarele ntrebri:

1. Enumerai parametrii care exprim 4. Cum se calculeaz rata natalitii i a


starea unei populaii. mortalitii?
2. Care sunt vrstele ecologice n func- 5. Ce nelegei prin migraie?
ie de reproducere? 6. Cum se va realiza n perspectiv ex-
3. Stabilii structura pe sexe a elevilor plozia demografic?
din coala unde nvai.
126
pag.107-144.qxd 8/1/2008 3:29 PM Page 127

Cyan Yellow Magenta Black pag 127

3
Capitolul
Impactul antropic
asupra ecosistemelor
naturale

1. Deteriorarea ecosistemelor naturale


Natura se gsete n mod evident n faa n acest context se nscriu: deteriorarea
unor dezechilibre ecologice, n care fac- ecosistemelor prin eroziune, deteriorarea
torul antropic a avut rolul determinant, ca prin construcii de canale i baraje, intro-
factor de determinare prin mijloace ducerea de noi specii n ecosistem, supra-
directe/indirecte, multiple i complexe, exploatarea resurselor biologice, urbaniza-
apropiate sau ndeprtate n timp. rea i industrializarea, deteriorarea mediu-
lui prin poluarea fizic, chimic i biologic.

Deteriorarea ecosistemelor prin eroziune


Eroziunea, ca form de degradare a so- vnt puternic l ridic n atmosfer i for-
lului sau a rocilor, se datoreaz aciunii ploi- meaz norii de praf cu aciune devastatoare.
lor, vntului i omului, care, prin lucrrile Ca msuri de evitare a eroziunii, omul a
agricole i silvice, a distrus textura solului, folosit i folosete cultivarea n terase limi-
l-a dezgolit n faa radiaiilor solare i l-a sr- tate de anuri care rein apa, aratul n
cit de asociaiile vegetale naturale (fig. 26). brazde, care urmeaz curbele de nivel,
Omul, prin folosirea abuziv a pmntu- acoperirea n permanen a solului cu un
lui, a dus la o micorare a capacitii de strat de resturi vegetale sau de culturi care
reinere a apei din sol. Apa se evapor sau s restabileasc echilibrul chimic n sol.
se scurge rapid la suprafa, provocnd
dese inundaii, deoarece lipsete stratul cu
vegetaie arborescent care s amorti-
zeze efectele precipitaiilor puternice.
Aceast eroziune se datoreaz polurii cu
pesticide i ngrminte chimice, ploilor
acide, tierilor masive de pduri, lucrrilor
necorespunztoare ale solului, care, n
timp, degradeaz textura acestuia.
Se tie c solul uscat, degradat i lipsit de
vegetaie, formeaz praful fin, pe care un Fig. 26. Versani de dealuri supuse eroziunii.

127
pag.107-144.qxd 8/1/2008 3:29 PM Page 128

Cyan Yellow Magenta Black pag 128

Partea a III-a

Deteriorarea ecosistemelor prin construcii de canale i baraje


Pentru asigurarea de ap potabil, iri-
gaii, ci de comunicaii, producerea de
energie electric, omul a intervenit n eco-
sistemele acvatice prin construirea de
canale i baraje (fig. 27). Aceste construcii
duc la inundarea unor terenuri aluvionare
i schimb componena cantitativ i calita-
tiv a florei i faunei locale.
Marile baraje au i o pierdere imens
de ap prin evaporare, mai ales n zonele
calde i aride, i o reinere a sedimentelor
i a aluviunilor n amonte de baraj. Datorit
acestor reineri de sedimente, producia
piscicol a nregistrat o scdere brusc. Fig. 27. Aspectul unui baraj.

Deteriorarea ecosistemelor prin introducerea de noi specii


n interveniile sale asupra naturii, omul Lantana camara, originar din America tro-
s-a condus dup avantajele imediate, modi- pical, n Noua Caledonie, pentru formarea
ficnd biocenoza prin transportul i introdu- de bariere n calea vitelor s-a soldat cu in-
cerea unor specii noi, exogene, n anumite vadarea punilor de ctre aceast buruian
ecosisteme. Spre exemplu, astzi, grami- i diminuarea produciei furajere. Un alt
neele i plantele ierboase cultivate sunt pre- exemplu nefast a fost introducerea castorilor
zente pe toate continentele. Majoritatea legu- din Canada n zonele pdurilor din America
minoaselor provin din Europa apusean i de Sud, unde acetia au construit diguri pen-
mediteraneean. Se tie c odat cu plantele tru reinerea apei i au contribuit la produ-
furajere au fost introduse n zonele respec- cerea de inundaii catastrofale. i la noi n
tive i numeroase graminee, cu consecine ar au ptruns spontan specii de plante pre-
negative asupra ecosistemelor naturale. cum ciuma-apei (Elodea canadensis), origi-
n cazul speciilor lemnoase, pdurile au nar din America i stabilit n majoritatea
suferit profund prin selecia artificial a apelor dulci i blilor dunrene. Bibanul-soa-
esenelor autohtone i introducerea de esen- re (Lepomis gibbosus) din America de Nord
e exogene, n scopul rempduririlor sau al apare n apele dulcicole, iar gasteropodul
aclimatizrii unor specii din alte zone geo- Rapana thomasiana, din apele Japoniei,
grafice. De exemplu, introducerea plantei apare din anul 1950 i n Marea Neagr.

2. Deteriorarea ecosistemelor prin supraexploatarea


resurselor biologice
Intervenia omului n biosfer, n mod dereglarea echilibrelor naturale. Aceste
activ, a dus la srcirea speciilor i la procese i fenomene se datoreaz unor
creterea instabilitii biocenozelor, cu cauze, prezentate n continuare.

128
pag.107-144.qxd 8/1/2008 3:29 PM Page 129

Cyan Yellow Magenta Black pag 129

Capitolul 3

Defriarea pdurilor
Despdurirea a contribuit la degrada-
rea solurilor, la creterea ariditii climatu-
lui, intensificarea vitezei vnturilor i apa-
riia inundaiilor (fig. 28).
Pdurile reprezint factorul determi-
nant n meninerea echilibrului ecologic,
climatic i hidric, reprezentnd ecosistemul
cu o capacitate de regenerare de 3-5 ori mai
mare dect oricare alt ecosistem natural.
Tierile masive de pe Terra, din ultimii
80 de ani, au dus la o reducere a suprafeei de
la 9 milioane de hectare de pduri la 6,3 mi- Fig. 28. Defriarea pdurilor.
lioane de hectare de pduri, din care astzi
5,5 % sunt afectate de poluare i duntori. tie c n viitor nevoia de lemn va spori cu
Dei s-au fcut rempduriri cu foioase 17%, iar pdurile risc s dispar la sfritul
i rinoase n diverse zone ale Globului, acestui mileniu.
aceste pduri artificiale sau amenajate nu Astzi aurul verde este ameninat n
prezint o diversitate pe vrste, specii i mare parte de ploile acide, care au distrus
categorii ecologice de plante, lipsind multi- n Germania, Maria Britanie i Scandinavia
tudinea relaiilor interspecifice i o stabili- pn la 45 % din suprafaa mpdurit (n
tate ecologic asigurat n sute de ani. Se special pdurile de conifere).

Suprapunatul
Distrugerea covorului vegetal dintr-un accentuat a biotopului, care i pierde
ecosistem apare ca urmare a procesului de posibilitile sale de regenerare (fig. 29).
punare intensiv de ctre animalele erbi-
vore. Dac aceste limite sunt depite, n
populaiile animalelor slbatice apare auto-
reglarea, adic se intensific activitatea pr-
dtorilor, crete frecvena bolilor i a para-
ziilor, deoarece populaiile de insecte fito-
fage se gsesc n echilibru relativ, suferind
oscilaii n funcie de fluctuaiile acestuia.
n cazul animalelor domestice, care r-
mn n afara factorilor ecologici i se supun
factorului antropic (voinei omului), apare
suprapopularea punilor i o dezgolire Fig. 29. Suprapunatul.

Supraexploatarea faunei terestre


Omul, ca parte constituent a biosferei, unor duntori i parazii, ct i indirect,
a acionat asupra componentelor acesteia, producnd dezechilibre ecologice, cu efec-
att direct, prin vntoare, pescuit, combaterea te ntrziate asupra florei i faunei.

129
pag.107-144.qxd 8/1/2008 3:29 PM Page 130

Cyan Yellow Magenta Black pag 130

Partea a III-a

Fig. 30. Bizonul. Fig. 31. Rsul.

Aciunile necontrolate, abuzive ale primigenius), a bizonului european (Bison


omului n natur, mai ales n ultimele se- bonasus) i a caprei alpine (Capra ibex).
cole, au redus simitor potenialul genetic n Romnia, interveniile omului au dus
al biosferei, ceea ce a dus la dispariia unor la modificarea ecosistemelor naturale, la
specii de plante i animale. reducerea numrului sau la dispariia unor
Dintre animalele care populeaz bio- specii. Astfel, au disprut nc din secolul
murile terestre, cel mai mult au avut de trecut bourul (Bos primigenius), zimbrul
suferit mamiferele i psrile. Spre exem- (Bison priscus bonasus), tarpanul (Equus
plu, distrugerea pe scar mare a bizonului cabalus gmelini), antilopa de step (Saiga
(fig. 30) din America de Nord; de la 75 mi- tatarica), capra de munte (Capra ibex),
lioane de exemplare existente nainte de marmota alpin (Arctomys marmota).
colonizarea Americii, astzi mai exist Unele specii ca rsul (Lynx lynx) (fig. 31)
cteva sute de exemplare protejate prin i capra neagr (Rupicapra rupicapra) s-au
legi speciale. Aceeai situaie o au antilopa redus numeric, iar dintre psri, multe au
american (Antilocapra americana) i disprut sau sunt ameninate s dispar.
ursul grizzly (Ursus horribilis) din Mexic, Astfel sunt: zganul (Gypatus barbatus),
care au astzi areale foarte restrnse. vulturul pleuv sur (Gyps fulvus), vulturul
n Asia, speciile de asin persan (Equus pleuv negru (Aegypis monachus), dropia
hemionus onager), rinocerul asiatic (Rhi- (Otis tarda), cocoul de mesteacn (Lyru-
noceros sandaicus), ursul de bambus rus tetrix) (fig. 32).
(Ailuropoda melanoleuca) i-au redus nu-
mrul pn la 200 exemplare fiecare, iar
arealul la circa 1 300 km2.
n Africa, au disprut antilopa african
(Alcelephus baselaphus), (nc din anul
1925), rinocerul alb (Ceraotherium si-
mum) din savana rurilor Zambezi i
Orange, cerbul de Barbaria (Cervus ela-
phus barbatus), zebra quagga (Equus
quagga), iar turmele de bivoli, antilope,
elefani, zebre, girafe i lei, existente n
sudul Saharei, i-au redus mult efectivele.
n Europa, echilibrul ecologic a fost
Fig. 32. Cocoul de mesteacn.
afectat prin dispariia bourului (Bos

130
pag.107-144.qxd 8/1/2008 3:29 PM Page 131

Cyan Yellow Magenta Black pag 131

Capitolul 3

Supraexploatarea resurselor oceanice


Biocenozele marine sunt foarte com- Grav ameninate cu dispariia sunt speciile
plexe, cu un numr mare de lanuri trofice, de balene: Balaenoptera physalus, balena
de la plante i animale planctonice, peti, borealis, Megaptera nove-angliae i balena
pn la mamiferele acvatice. albastr (Balaenoptera musculus).
Dei mediul acvatic pare o surs inepu- Supraexploatarea fondului piscicol a
izabil, cu ecosisteme de nalt productivi- dus la:
tate, exploatarea lui n mod intensiv, mai diminuarea cantitativ a petelui;
ales n apropierea rmurilor, a dus la deze- regresia taliei petilor capturai;
chilibre grave. o reducere efectiv a speciilor de
Pescuitul abuziv al mamiferelor uriae interes piscicol n anumite zone de pescuit
(cetacee, sirenieni) a dus la dispariia unor oceanic.
specii de pinipede i colonii imense de otarii Numeroase specii de peti i-au dimi-
(Arctocephalus philippi) n insula Fernandez. nuat substanial numrul indivizilor prin
suprapescuit; astfel, amintim: heringul
(Clupea harengus), batogul (Gadus mor-
rhus), merlanul (Merlucius merlucius),
scrumbia albastr (Scomber scomber)
(fig. 33).
n aceeai situaie disperat se afl i
broatele estoase de mare, cutate pentru
carnea lor gustoas, ou i baga (carapace).
Spre exemplu, specia de broate estoase
fr carapace luthul (Dermochelys cori-
acea), considerat o adevrat fosil vie,
se ntlnete doar pe plaja din Malaysia, n
Fig. 33. Pescuitul oceanic intensiv. numr de aproximativ 2 300 de indivizi.

Urbanizarea i industrializarea
Creterea vertiginoas a oraelor n depit 3,1 miliarde de locuitori, ceea ce
ultimele ase decenii a dus la dezvoltarea reprezint jumtate din populaia Globului.
impresionant a industriei. Oraul a fost Aceast explozie urban, dezvoltarea
creat la interferena cilor de transport (ci industriilor i a transporturilor au dus la
ferate, navigaie cu mijloace mecanizate, formarea cunoscutelor noxe ale oraului,
automobile, avioane); acestea au reprezen- reprezentate de smog, particule de praf, de
tat un nou impuls n dezvoltarea oraelor. fum, compui chimici, dioxid de carbon,
Dezvoltarea industriei n marile orae ceea ce creeaz un mediu neprielnic pen-
de pe Glob a atras dup sine migrarea po- tru sntatea oamenilor, ducnd cu timpul
pulaiei de la sate, care sper c aici vor la slbirea rezistenei organismului uman,
gsi un trai mai bun. Dup datele furnizate la apariia unor boli ale sistemului nervos
de ONU, n anul 2000, populaia urban a i endocrin, ale cilor respiratorii.

131
pag.107-144.qxd 8/1/2008 3:29 PM Page 132

Cyan Yellow Magenta Black pag 132

Partea a III-a

3. Deteriorarea mediului prin poluare


Poluarea fizic
Agenii fizici implicai n poluarea me- sau caloric, poluarea radioactiv i polua-
diului nconjurtor sunt: poluarea termic rea sonor.

Poluarea termic sau caloric


Diverse gaze care se acumuleaz n se fac deja simite, cum sunt schimbarea
atmosfer, n primul rnd dioxidul de car- global a climei, accentuarea caracterului
bon, duc la nclzirea global prin efectul eratic al precipitaiilor, taifunurile mai frec-
de ser pe care l provoac (fig. 34). vente i mai puternice, ridicarea nivelurilor
Creterea concentraiei dioxidului de apelor i erodarea rmurilor.
carbon n atmosfer i a altor gaze cu efect
de ser (oxizi de azot, clorofluorocarburi
.a.) se realizeaz pe dou ci: prin acti-
vitile industriale i agricole (despduriri,
desecarea mlatinilor eutrofe) i prin
extinderea aezrilor umane i a reelelor
de comunicaie (fig. 35).
n perspectiv, efectele nclzirii glo-
bale ar fi catastrofale i ar duce la: topirea
calotelor polare, creterea nivelurilor
mrilor i oceanelor, inundarea rmurilor
i, odat cu ele, a multor localiti litorale,
orae i insule ar disprea sub ape etc.
Dac ritmul topirii calotelor polare nu
reprezint nc un pericol iminent, alte re-
zultate ale fenomenului de nclzire global

Fig. 35. Surse de emanaie a dioxidului de


Fig. 34. Efectul de ser. carbon n atmosfer.

132
pag.107-144.qxd 8/1/2008 3:29 PM Page 133

Cyan Yellow Magenta Black pag 133

Capitolul 3

Poluarea radioactiv
Una din consecinele nedorite ale extin- Poluarea radioactiv poate fi produs i
derii folosirii energiei nucleare este polua- de unele deficiene la centralele nucleare,
rea radioactiv a mediului prin radiaii i aa cum a fost accidentul de la centrala ato-
radionuclizi. moelectric de la Cernobl, din 26 aprilie
Exist trei surse de contaminare radio- 1986 (fig. 36).
activ a apelor. Prima este reprezentat de
depunerile radioactive care au ajuns n ap
odat cu ploaia, dar capacitatea lor poluan-
t este redus. A doua surs de poluare
radioactiv este reprezentat de apele
folosite n uzinele atomice i deversate n
apele curgtoare. A treia surs o constituie
deeurile atomice care sunt introduse n
recipiente sigilate i incluse n blocuri de
beton, nainte de a fi depuse n apele ocea-
nice. S-a stabilit c n aceste condiii de pro-
tecie, la adncimi mari, exist cureni pu-
ternici care pot transporta la mari distane
substane radioactive i, accidental, s fie Fig. 36. Poluare radioactiv la Cernobl, n
aduse din nou la suprafa. urma accidentului nuclear din 1986.

Poluarea sonor
Poluarea sonor sau fonic este deter- poluare sonor sunt: transporturile teres-
minat de zgomote puternice sau de emisi- tre i aeriene, antierele de construcii,
uni de sunete cu vibraii neperiodice, de o complexele industriale .a. S-a admis c\
anumit intensitate, care produc o senzaie sunetele devin nocive la 80 decibeli (dB).
dezagreabil, jenant i chiar agresiv. Consecinele negative ale polurii so-
Poluarea sonor se ntlnete n cele nore sunt: dereglarea auzului, contraciile
mai variate ambiane: n locuine, pe arterelor, accelerarea pulsului i a ritmului
strad, n locuri de munc i de odihn, pe respiraiei, diminuarea reflexelor, stresul.
uscat, pe ap i n aer. Principalele surse de

Poluarea chimic
Substanele chimice utilizate n indus- Substanele la care se observ acest
trie i agricultur constituie forma cea mai fenomen sunt, n general, nebiodegradabile
rspndit i periculoas de poluare. sau foarte greu biodegradabile, fapt pentru
Substanele toxice (noxele) eliminate n care persist timp ndelungat n ecosistem.
mediu prin activitile umane, cum sunt De exemplu, DDT-ul este utilizat pentru
DDT-ul, pesticidele, unele metale grele, se combaterea diverilor duntori vegetali,
acumuleaz de-a lungul lanurilor trofice n dar este duntor altor specii animale, i
concentraii din ce n ce mai mari prin chiar omului, fapt pentru care el i alte pes-
fenomenul de amplificare biologic. ticide sunt tot mai rar utilizate n agricultur.
133
pag.107-144.qxd 8/1/2008 3:29 PM Page 134

Cyan Yellow Magenta Black pag 134

Partea a III-a
n atmosfer sunt emise o serie de gaze Poluanii solizi (pulberile) conin nume-
poluante, cum sunt: oxidul de carbon, care roase particule de cuar, calciu, azbest,
n concentraii mari inhib procesele respi- oxizi de fier, oxizi de siciliu, funingine, par-
ratorii la plante, animale i om; dioxidul de ticule de plumb, mercur, zinc etc.
sulf, care n concentraii mari produce
arsuri frunzelor plantelor (necroze), iar n
combinaie cu apa rezultat din precipitaii
formeaz acidul sulfuric, producnd ploile
acide, care usuc diverse specii de conifere
(fig. 37); compuii azotului (oxidul i dio-
xidul de azot), care contribuie la formarea
smogului; derivaii halogenilor (clor, brom,
acid clorhidric), care provin din industrie
i produc arsuri (necroze) frunzelor i boa-
la numit fluoroz, la animale, manifestat
prin deformarea oaselor, cderea dinilor. Fig. 37. Efectul ploilor acide asupra unei
pduri.

Poluarea biologic
Se produce prin contaminarea bacterio- Eutrofizarea puternic a apelor favori-
logic a apei, alimentelor i eutrofizarea zeaz dezvoltarea n masa apei a unor
apelor. microorganisme (bacterii filamentoase,
Principalele surse de contaminare sunt ciuperci, ciliate etc.), care pot acoperi n
apele menajere i apele industriale uzate, ntregime suprafaa apei, ducnd la o dis-
n special cele provenite din industria ali- trugere a echilibrului biologic din ecosis-
mentar, care sunt deversate n cursurile temul respectiv. Srurile care apar n exces
de ape sau n lacuri fr s fie n prealabil duc la creterea duritii apei fcnd-o inu-
decontaminate. tilizabil pentru unele procese industriale,
Poluarea biologic a apei i alimentelor pentru dezvoltarea unor specii sau pentru
se produce i pe cale indirect, prin conta- alimentarea populaiilor umane (fig. 38).
minarea lor cu substane organice fer-
mentescibile. n afara apelor de canal, con-
taminarea se poate produce cu apele rezi-
duale din industria alimentar (abatoare,
fabrici de produse lactate, fabrici de za-
hr), din industria hrtiei i din alte indus-
trii, ape care conin cantiti nsemnate de
substane organice fermentescibile.
Eutrofizarea apelor reprezint un pro-
ces natural de acumulare n timp a unor
cantiti crescute de substane organice pe
fundul apei. Acest proces poate fi accelerat
de om, prin evacuarea de ape uzate bogate
n substane organice. Fig. 38. Eutrofizarea apelor

134
pag.107-144.qxd 8/1/2008 3:29 PM Page 135

Cyan Yellow Magenta Black pag 135

Capitolul 3

De aceea, o inginerie ecologic a re- care le consider ca absolut necesare pen-


surselor de ap reprezint, n fiecare ar tru o via uman decent, alturi de ali-
sau localitate, un test foarte serios al nive- mente, adpost, educaie, loc de munc,
lului tiinific de gospodrire. Organizaia condiii de igien, enumer accesul la o
Naiunilor Unite, printre puinele bunuri pe surs de ap potabil.

Efectele deteriorrii ecosistemelor asupra sntii umane


Noxele eliminate n atmosfer sub cum ar fi: colibaciloza, hepatita viral,
form de gaze sau pulberi au efect nociv holera, dizenteria etc.
asupra sntii organismului uman. Efectele polurii radioactive a solului i
Oxidul de azot, anhidrida sulfuroas elimi- aerului se manifest la om prin diverse tul-
nate n atmosfer formeaz smogul, care burri ce pot merge uneori pn la moar-
provoac n marile orae tulburri cronice tea indivizilor.
la indivizii cu afeciuni respiratorii i car- n general, toate radiaiile ionizante pre-
zint un risc de cancerizare sau de muta-
diace. Sulfura de carbon emanat n aer
genez pentru o anumit fraciune a popu-
provoac la copii simptome neurologice.
laiei afectate.
DDT-ul i alte pesticide, chiar i unele n-
n marile orae industriale, poluarea so-
grminte chimice administrate iraional,
nor determin la persoanele care muncesc
n concentraii mari, ajungnd n corpul ntr-un mediu cu zgomote puternice i per-
productorilor (plantelor), apoi n corpul manente tulburri neurovegetative nsoite
consumatorilor i, ulterior, n organismul de unele manifestri generale, conturnd o
uman, produc grave afeciuni ale sistemu- patologie foarte variat (nevroze, hiperten-
lui digestiv i neuroendocrin. siune arterial, tulburri endocrine etc.).
Metalele grele au efecte grave asupra
organismului uman. Astfel, amintim: plum-
bul inhib enzimele i prin aceasta metabo-
lismul celular. Saturnismul (intoxicaia
cronic cu plumb) se manifest prin sali-
vaie, convulsii, perturbri n activitatea
cerebral i renal, diaree, urmat de
moarte; molibdenul produce o degenerare
a ficatului, modific metabolismul fosforu-
lui ducnd la malformaii osoase; cadmiul
se ntlnete n concentraii ridicate n cor-
pul fumtorilor i iniiaz cancerul la pl-
mni (fig. 39).
Poluarea apei potabile cu azotai i con-
sumul ei timp ndelungat pot determina
apariia unor tulburri caracterizate prin
cefalee, grea, diaree, fenomene cunos-
cute sub numele de boala apei, care repre-
zint o intoxicaie cronic.
Poluarea apei cu ageni microbieni de-
termin creterea frecvenei unor afeciuni, Fig. 39. Plmn afectat de aciunea cadmiului.

135
pag.107-144.qxd 8/1/2008 3:29 PM Page 136

Cyan Yellow Magenta Black pag 136

Partea a III-a

LUCRRI PRACTICE EVIDENIEREA IMPACTULUI


ANTROPIC ASUPRA ECOSISTEMELOR
1. ntocmii un proiect al unei zone unde se gsesc staiile de epurare a
poluate din apropierea localitii voastre. apei i ce rol au acestea;
Proiectul trebuie s\ con]in\ urm\toa- dac se face risip de ap potabil.
rele puncte: scopul proiectului, obiective, Ce efect negativ are acest fapt?
ac]iuni, grup ]int\, beneficiarii direc]i [i 3. Efectuai o anchet privind poluarea
indirec]i, evaluarea activit\]ilor, rezulta- atmosferei de ctre mijloacele de trans-
tele proiectului, efecte, durabilitatea. port. Aflai:
2. Efectuai o anchet privind poluarea ce conin gazele de eapament;
apei n localitatea voastr. Observai: care sunt gazele toxice emanate;
cum ajunge apa n casele voastre; ce efect au asupra omului i al altor
cum modific detergenii calitile vieuitoare (plante i animale);
apei; cum se poate reduce cantitatea lor.
ce efect negativ au uleiurile mine-
rale deversate n ap;

TEST DE EVALUARE
Verificai-v cunotinele, rspunznd la urmtoarele ntrebri:
1. Ce efecte nocive apar n ecosistemele
naturale datorit defririi pdurilor?
2. Care sunt speciile de plante i ani-
male pe cale de dispariie din ara noastr,
din cauza modificrii unor ecosisteme na-
turale?
3. Ce specii de animale au disprut ori
s-au redus numeric, pe diverse continente,
din cauza vnatului i pescuitului excesiv?
4. Privii imaginea din figura 40 i expli-
cai cum se produce efectul de ser.
5. Cum apar ploile acide i ce grupe de
plante afecteaz?
6. Care sunt factorii care determin
poluarea biologic?
7. Specificai afeciunile organismului
uman determinate de DDT i metalele grele?
8. Ce boli produc agenii microbieni
din ap? Fig. 40. Efectul de ser.

136
pag.107-144.qxd 8/1/2008 3:29 PM Page 137

Cyan Yellow Magenta Black pag 137

Capitolul
4 Conservarea
resurselor naturale
i a biodiversitii

Conservarea mediului nconjurtor, ca resursele de minereuri, resursele de c\r-


bun unic al biosferei, a devenit o necesitate buni, speciile de plante i animale.
universal. Conservarea mediului presupune men-
Consevarea mediului n raport cu dez- inerea circuitelor regionale a resurselor,
voltarea economico-social ia n conside- depoluarea natural, conservarea solurilor
rare mediul, ca furnizor de resurse natu- i prevenirea eroziunii, conservarea biodi-
rale, i mediul, ca loc de trai pentru socie- versitii.
tatea uman, pentru plante i animale.
Resursele naturale includ toate ele-
mentele mediului de
natur material, ener- animale
getic i informaional. terestre
plancton
Unele dintre ele sunt
regenerabile. Acestea
se refac prin activitatea plante
urin
biosferei n cadrul cir-
cuitelor biogeochimice azot descompuntori
globale, cum sunt: oxi- dizolvat (bacterii i ciuperci)
genul, dioxidul de car-
bon, azotul, apa, sub-
stanele organice etc. animale roci i
terestre minerale
(fig. 41).
Alte resurse sunt
azot
neregenerabile. Nu se dizolvat
mai refac sau reface- plante
descompuntori
i alge
rea necesit un timp (bacterii i ciuperci)
animale
foarte lung, cum sunt: acvatice

bacterii
bacterii
anaerobe
Fig. 41. Circuitul
azotului n natur. sol nitrificat

137
pag.107-144.qxd 8/1/2008 3:29 PM Page 138

Cyan Yellow Magenta Black pag 138

Partea a III-a

1. Conservarea biodiversitii
Convenia asupra diversitii biologice Noiunea de biodiversitate poate fi defi-
(1992), semnat pn n prezent de peste nit n mod mai succint incluznd de fapt
170 de state, reprezint structura cadru dou componente de baz reprezentate de
care fixeaz obiectivele generale (conser- capitalul natural i de sistemul socio-eco-
varea diversitii biologice, utilizarea pe nomic, ntre care exist o relaie dinamic
termen lung a componentelor diversitii i o evoluie complementar (fig. 43).
biologice i distribuirea echilibrat a bene- Cadrul natural include de fapt sistemele
ficiilor rezultate din utilizarea resurselor ecologice care funcioneaz n regim natural
genetice) i strategia mondial de conser- i seminatural, la care se adaug sistemele
vare a biodiversitii. atropizate rezultate prin transformarea sau
Diversitatea biologic exprim de fapt simplificarea primelor dou categorii.
diversitatea ecosistemele ecologice de dife- Sistemele ecologice naturale i semi-
rite nivele: diversitatea sistemelor biolo- naturale sunt reprezentate de: ecosisteme
gice cu rang superior speciei (biocenoza, i complexe de ecosisteme marine i ocea-
complexe de biocenoze, biomii, biosfer), nice; ecosisteme i complexe de ecosiste-
integrate acestora; diversitatea sistemelor me acvatice continentale (lacuri, bli,
biologice cu rang de specie (diversitatea ruri, praie, fluvii, delte, zone inundabile,
speciilor, fig. 42), i cu rang inferior speciei turbrii, sisteme carstice); ecosisteme i
(diversitatea infraspecific), la care se complexe de ecosisteme terestre (ecosis-
adaug diversitatea sistemului socioeco- teme arctice i alpine, pduri de rinoase,
nomic. pduri de foioase, pduri tropicale, ecosis-
teme de step, savana,
deerturile).
Sistemele ecologice
antropizate sunt repre-
zentate de: agrosisteme,
plantaii forestiere, fer-
me zootehnice, ferme
piscicole, lacuri de acu-
mulare, zone umede ar-
tificiale.
Sistemul socio-eco-
nomic include, de ase-
menea, sistemele antro-
pizate la care se adaug
capitalul social i capi-
talul cultural.
Conservarea biodi-
versitii cuprinde: con-
servarea patrimoniului

Fig. 42. Diversitatea


speciilor.

138
pag.107-144.qxd 8/1/2008 3:29 PM Page 139

Cyan Yellow Magenta Black pag 139

Capitolul 4

BIODIVERSITATEA
(Sens larg)

CAPITALUL NATURAL SISTEMUL SOCIOECONOMIC

1. Reeaua sistemelor ecologice care 1. Specia uman\ mpreun\ cu totali-


funcioneaz n regim natural tatea componentelor creat de c\tre
2. Reeaua sistemelor ecologice care aceasta:
funcioneaz n sistem seminatural 1.1. Re]eaua sistemelor antropizate
3. Reeaua sistemelor antropizate 1.2. Capitalul social
rezultate prin transformarea i/sau 1.3. Capitalul cutural
simplificarea primelor dou categorii

Relaie dinamic
CAPITALUL NATURAL SISTEMUL SOCIOECONOMIC
(local, regional, european, mondial) (local, regional, european, mondial)

Evoluie complementar

Sisteme naturale Capital cultural

Sisteme seminaturale Capital social

Sisteme antropizate (dominante sau create de om)

Fig. 43. Biodiversitatea.

genetic spontan, conservarea patrimoniului integrate, unde orice intervenie uman este
genetic agricol, conservarea patrimoniului exclus, cu excepia unor cercetri tiinifice.
genetic microbiologic, conservarea naturii
pe Glob prin parcuri i rezervaii naturale. Conservarea patrimoniului
genetic agricol
Conservarea patrimoniului Conservarea patrimoniului genetic agri-
genetic spontan col se face prin banca de gene, care repre-
Conservarea patrimoniului genetic zint o colecie de soiuri sau rase cu impor-
spontan asigur eficiena circuitelor natu- tan genetic i economic actual sau de
rale ale elementelor chimice i ale energiei, perspectiv. Prima banc de gene a fost cre-
cu pstrarea capacitii de autoreglare a at n S.U.A. (1958) cu o capacitate de depo-
biosferei i ecosferei. Speciile florei spon- zitare de 180 000 probe de semine apari-
tane i faunei spontane sunt surse ines- nnd la numeroase specii de plante. Fiecare
timabile de gene pentru speciile nrudite prob cntrete 450 g. A urmat apoi nfiin-
de plante cultivate sau de animale domes- area de bnci n multe ri, ca Rusia, Dane-
tice privind rezistena fa de boli i dun- marca, Italia, Germania, Ungaria, Turcia etc.
tori. Deja s-au fcut transferuri de cromo- Conservarea genofondului animalelor
zomi, fragmente de cromozomi pe care se domestice a fost ntreprins n Anglia n
gsesc gene de rezisten de la plantele sl- anul 1964, unde au fost reinute 16 rase din
batice la cele cultivate, cum este, de exem- diverse specii. n 1966 FAO pune problema
plu, rezistena grului la rugin i finare. evalurii, utilizrii i conservrii resurselor
Pentru pstrarea patrimoniului genetic genetice ale animalelor de ferm larg
spontan, s-a recurs la rezervaii naturale folosite n lume, care servesc ca surse de

139
pag.107-144.qxd 8/1/2008 3:29 PM Page 140

Cyan Yellow Magenta Black pag 140

Partea a III-a
proteine i energie de traciune, acestea complet noi, obinute prin inginerie gene-
constnd din: bovine, oi, capre, porci, p- tic, n scopul folosirii benefice pentru
sri, cai, asini; conservarea resurselor gene- omenire i nu pentru distrugerea ei.
tice privind animalele adaptate la condiii
speciale de mediu, cum sunt: cmila de de- Conservarea naturii pe Glob
ert, lama, iakul, huanaco, vignona. prin parcuri i rezervaii naturale
S-au nfiinat bnci de gene sub form Meninerea balanei ecologice favora-
de sperm, ovule i embrioni congelai, bil vieii a necesitat luarea de msuri la
acestea urmnd s fie utilizate la nevoie. nivel mondial de conservare a naturii i
biodiversitii prin creare de parcuri i re-
Conservarea patrimoniului zervaii naturale.
genetic microbiologic Parcul naional este un areal relativ n-
Patrimoniul genetic microbiologic este tins, cu mai multe ecosisteme sau com-
constituit din sue (culturi) de microorga- plexe de ecosisteme care nu sunt alterate.
nisme izolate din natur sau obinute prin n cadrul acestora sunt interzise exploatarea
mutaii de laborator. Ele au proprieti forestier, exploatarea minier, vntoarea
optime n descompunerea reziduurilor, i pescuitul, punatul animalelor domes-
epurarea apelor poluate, fermentaia pro- tice, practicarea agriculturii, construcia de
duselor alimentare, fixarea azotului atmos- locuine, de baraje, linii electrice de nalt
feric, producerea de antibiotice sau vacci- tensiune, construirea cilor de comuni-
nuri. n acest scop, numeroase ri i-au caie, practicarea comerului, instituirea
constituit stocuri genetice integrate n pa- unor industrii etc. Nu se permite nicio
trimoniul naional i protejate juridic. activitate desfurat de om care ar duce la
Astfel, s-a emis nfiinarea unei Reele ruperea echilibrului ecologic.
Mondiale de Centre i resurse Microbio- n Romnia sunt decretate 13 parcuri
logice (MIRCEN), cu rolul de a ncorpora naionale: Parcul Naional Retezat rezer-
uniti funcionale regionale i interre- vaie a Biosferei, Parcul Naional Delta
gionale axate pe gestiunea, distribuia i Dunrii rezervaie a biosferei, Parcul
utilizarea resurselor de gene microbiene. Naional Munii Rodnei rezervaie a
Se pune problema conservrii patrimoniu- biosferei (fig. 44, 45), Parcul Naional
lui genetic microbian existent i a celor Domogled Valea Cernei, Parcul Naional

Fig. 44. Aspect din Parcul Naional Retezat Fig. 45. Aspect din Parcul Naional Delta
Dunrii.

140
pag.107-144.qxd 8/1/2008 3:29 PM Page 141

Cyan Yellow Magenta Black pag 141

Capitolul 4

Cheile Nerei-Beunia, Parcul Naional natural sau anumite exemplare floristice,


Munii Semenic Cheile Caraului, faunistice, geologice, paleontologice.
Parcul Naional din Munii Climan, Parcul Dup specificul lor, acestea se mpart
Naional din Munii Ceahlu, Parcul n: rezervaii complexe, rezervaii floristice,
Naional Cheile Bicazului Lacul Rou faunistice, geologice, paleontologice, speo-
Munii Hma, Parcul Naional Piatra logice (fig. 46).
Craiului, Parcul Naional din Munii Coziei,
Parcul Naional Munii Mcin, Parcul
Naional Buila-Vnturaria i 13 parcuri
naturale: Parcul Natural din Munii
Bucegi, Parcul Natural din Munii Apuseni,
Parcul Natural Cazanele Dunrii Porile
de Fier, Parcul Natural Cetile Dacice de
la Cioclovina-Grditea Muncelului, Parcul
Natural Balta Mic a Brilei, Parcul
Natural Vntori Neam, Parcul Natural
Lunca Mureului, Parcul Natural Munii
Maramureului, Parcul Natural Comana,
Parcul Natural Lunca Joas a Prutului infe-
rior, Parcul Natural Putna Vrancea,
Geoparcul Dinozaurilor ara Haegului,
Geoparcul Platoului Mehedini.
Rezervaiile naturale sunt teritorii n
care sunt ocrotite prin lege ntregul cadru Fig. 46. Aspect din Petera Polovraci.

TEST DE EVALUARE
Verificai-v cunotinele, rspunznd la urmtoarele ntrebri:

1. Enumerai principalele resurse natu- 6. Artai cum se poate conserva patri-


rale regenerabile. moniul genetic spontan. Dar cel agricol?
2. Ce msuri trebuie luate pentru con- 7. Enumerai resursele naturale ale
servarea resurselor naturale? Romniei care trebuie conservate.
3. Menionai sistemele ecologice natu- 8. Selectai rspunsul corect:
rale i seminaturale. Biodiversitatea reprezint:
4. Precizai care sunt sistemele ecolo- a. cadrul natural; b. diversitatea speci-
gice antropizate. ilor; c. sistemul socioeconomic; d. diversi-
5. Ce cuprinde conservarea biodiver- tatea ecologic.
sitii?

141
pag.107-144.qxd 8/1/2008 3:29 PM Page 142

Cyan Yellow Magenta Black pag 142

5
Capitolul

*Dezvoltarea durabil

n anul 1992 a avut loc Conferina lung de timp, prin utilizarea armonioas a
Naiunilor Unite pentru Mediu i Dezvol- resurselor regenerabile din sistemele eco-
tare (de la Rio de Janeiro), n care se pre- logice capabile s produc o gam larg de
cizeaz c dezvoltarea durabil presupune produse i s suporte standardele optime
satisfacerea cerinelor prezente i viitoare de via.
de dezvoltare; creterea calitii vieii Pentru a garanta dezvoltarea pe termen
oamenilor; redimensionarea creterii eco- lung i deci persistena n timp i n spaiu
nomice; conservarea calitii mediului i a a sistemului socioeconomic, este necesar
resurselor naturale; participarea ferm a implementarea la nivel global a strategiei
organismelor de guvernare n luarea de- de utilizare a capitalului natural, ca suport
ciziilor privind economia i mediul. al existenei speciei umane.
Conceptul de dezvoltare durabil se re- Dezvoltarea durabil este privit de
fer la o aciune de dezvoltare pe o perioad majoritatea oamenilor de tiin prin prisma
celor cinci dimensiuni ale vie-
ii noastre materiale i spiri-
tuale (fig. 47).
Durabilitatea social
Durabilitatea social este
strns legat de dezvoltarea
uman i se realizeaz prin
oameni i pentru oameni, iar
formarea acestora i antre-
narea lor ca participani i pro-
tagoniti ai vieii sociale con-
stituie o obligaie pentru cei
instruii de societatea crora
le aparin. Inechitile exis-
tente ntre Nordul dezvoltat i
Sudul n curs de dezvoltare,
ntre diverse pturi sociale, se
rsfrng n mod negativ

Fig. 47. Relaia dintre capi-


talul natural presiunea antro-
pic i dezvoltarea durabil.

142
pag.107-144.qxd 8/1/2008 3:29 PM Page 143

Cyan Yellow Magenta Black pag 143

Capitolul 5
asupra viului, punnd n pericol chiar fiina dar i n acord cu exigenele ambiante ale
uman. fiinei umane.
Durabilitatea economic Durabilitatea spaial
Durabilitatea economic presupune, Durabilitatea spaial privete armo-
nainte de toate, o repartizare i gestionare nizarea ofertei economico-sociale din spaiul
mai eficient a resurselor, dar i un flux rural i urban, din rile Nordului i Sudului,
constant de investiii dinspre Nord spre cu cerinele unei viei decente din punct de
Sud, astfel ca rile Sudului s se poat dez- vedere material i al sntii. Migraiile
volta singure. Identificarea, evaluarea i masive sat-ora, Sud-Nord pot declana
conser varea resurselor rmn atribute dezechilibre ecologice dintre cele mai grave.
specifice naturalitilor.
Durabilitatea cultural
Durabilitatea ecologic Durabilitatea cultural vizeaz menine-
Durabilitatea ecologic urmrete s asi- rea i dezvoltarea spiritual a fiecrei
gure marele echilibru, n concordan cu comuniti umane, n acord cu tradiiile
necesitile dezvoltrii sociale i economice, morale n care s-a format, n concordan
cu ambiana ecologic specific.

ECOLOGIE UMAN SINTEZ


n selecia vastei tematici a ecologiei introducerea de noi specii, supraexploa-
umane contemporane am abordat toate tarea resurselor biologice prin urbaniza-
acele probleme ale ecologiei generale rea, industrializarea i poluarea mediului.
care ntr-un fel sau altul susin viaa indi- n prezent, a devenit o necesitate uni-
vidului uman, apoi a comunitilor umane versal conservarea resurselor naturale i
locale i regionale, ca n final s se dez- a biodiversitii.
bat situaia ecologic a speciei umane. Conser varea mediului presupune
Ecosistemele antropizate sunt caracteri- meninerea circuitelor regionale a resur-
zate pe baza particularitilor specifice bioto- selor, depoluarea natural, conservarea
pului i biocenozei, a relaiilor interspecifice. solurilor i prevenirea eroziunii i conser-
Pentru a explica structura i dinamica varea biodiversitii.
populaiilor umane, se explic anumii pa- Conservarea biodiversitii poate fi
rametri de static, structur i dinamic, definit ca o relaie dinamic ntre cadrul
cum ar fi: efectivul i densitatea popu- natural i sistemul socioeconomic.
laiei, structura pe vrste i pe sexe, rata Conceptul de dezvoltare durabil se
natalitii i a mortalitii, migraia i refer la o aciune de dezvoltare pe o peri-
explozia demografic. oad lung de timp, prin utilizarea armo-
Factorul antropic a contribuit n mod nioas a resurselor regenerabile din sis-
evident la deteriorarea ecosistemelor prin temele ecologice.

Bibliografie recomandat\ elevilor Ecologie uman


* Blteanu Dan, {erban Mihela, Modi- * Prvu C-tin, ndrum\tor pentru cu-
fic\ri globale ale mediului, Editura Coresi, noa[terea naturii, Editura Didactic\ [i Pe-
Bucure[ti, 2005. dagogic\, Bucure[ti, 1981.
* Botnariuc N., V\dineanu A., Ecologie, * Rojanschi Vladimir, Bran Florina, Dia-
Editura Didactic\ [i Pedagogic\, Bucu- conu Gheoghi]a, Protec]ia [i ingineria me-
re[ti, 1982. diului, Editura Economic\, Bucure[ti, 2002.
143
pag.107-144.qxd 8/1/2008 3:29 PM Page 144

Cyan Yellow Magenta Black pag 144

CUPRINS
I. GENETIC MOLECULAR . . . . . . . . . . . . . . . . .3 Capitolul 4. Mutageneza i teratogeneza.
Capitolul 1. Genetic molecular. Scurt istoric . . .4 Anomalii cromozomiale asociate cancerului . . . .79
1. Mutageneza i agenii mutageni . . . . . . . . . . . . . . . . . .79
Capitolul 2. Acizii nucleici . . . . . . . . . . . . . . . . . . . .7 2. Teratogeneza i agenii teratogeni . . . . . . . . . . . . . . . .82
1. Compoziia chimic a acizilor nucleici . . . . . . . . . . . . . .7 3. Fenotipul cancerului. Tipuri de cancer . . . . . . . . . . . .83
2. Structura primar i secundar a ADN . . . . . . . . . . . . .8 *Oncogene, *proto-oncogene, *antioncogene . . . . . .85
3. Tipuri de ARN, structur i funcii . . . . . . . . . . . . . . . .13 4. Anomalii genetice asociate cancerului uman . . . . . . .86
Lucr\ri practice Modelarea structurii spa]iale Capitolul 5. Imunogenetica . . . . . . . . . . . . . . . . . . . . .88
a ADN [i ARN-t . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .15 1. Imunitatea, imunologia i imunogenetica
4. Funcia autocatalitic a ADN . . . . . . . . . . . . . . . . . . . . .16 noiuni generale . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .88
5. Funcia heterocatalitic a ADN . . . . . . . . . . . . . . . . . . .18 2. Anticorpi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .90
Capitolul 3. Organizarea materialului genetic. 3. *Implicaii ale imunogeneticii n transplantul
*Genomica . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .26 de organe . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .92
1. Forme acelulare i celulare de via . . . . . . . . . . . . . . .26 4. Interferonul . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .94
2. Organizarea materialului genetic la eucariote . . . . . .28 Capitolul 6. Domenii de aplicabilitate i
3. *Genomica: obiect de studiu, ramuri . . . . . . . . . . . . . .31 consideraii bioetice n genetica uman . . . . . . . . .95
4. Metode i tehnici utilizate n genomica structural . .34 1. Sfaturi genetice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .95
5. Tehnica (PCR); importan . . . . . . . . . . . . . . . . . . . . . .35 2. Diagnosticul prenatal . . . . . . . . . . . . . . . . . . . . . . . . . . .96
3. Fertilizarea n vitro; clonarea terapeutic . . . . . . . . . .97
Capitolul 4. *Reglajul genetic la procariote . . . . . .38
4. Terapia genic (celulele stem) . . . . . . . . . . . . . . . . . .100
1. Teoria operonului. Regresia enzimatic . . . . . . . . . . .38
Sintez Genetic uman . . . . . . . . . . . . . . . . . . . . . . . .103
2. Reglajul sintezei proteice prin retroinhibiie (feedback).
Test de evaluare . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .105
Retroinhibiia enzimatic . . . . . . . . . . . . . . . . . . . . . . . .40
Bibliografie Genetic molecular
Test de evaluare . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .41 i Genetic uman . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .106
Capitolul 5. Reglajul genetic la eucariote . . . . . . . .42
1. Reglajul genetic pe termen lung . . . . . . . . . . . . . . . . . .42 III. ECOLOGIE UMAN . . . . . . . . . . . . . . . . . . . . .107
2. Reglajul genetic pe termen scurt . . . . . . . . . . . . . . . . .44 Capitolul 1. Caracteristicile ecosistemelor
Lucrri practice Evidenierea cromatinei sexuale antropizate . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .108
la om . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .46 1. Introducere n ecologie uman . . . . . . . . . . . . . . . . . .108
Lucrri practice Evidenierea cromozomilor metafazici 2. Ecosisteme acvatice antropizate . . . . . . . . . . . . . . . . .109
i studiul morfologiei lor . . . . . . . . . . . . . . . . . . . . . . . . . .47 3. Ecosisteme terestre antropizate . . . . . . . . . . . . . . . . .112
Sintez Genetic molecular . . . . . . . . . . . . . . . . . . . . .49 4. *Particulariti ale fluxului de materie i energie
Test de evaluare . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .50 n ecosistemele antropizate . . . . . . . . . . . . . . . . . . . . . . .116
Lucrri practice: Analiza factorilor abiotici . . . . . . . . . .120
Test de evaluare . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .121
II. GENETIC UMAN . . . . . . . . . . . . . . . . . . . . . . .51
Capitolul 2*. Structura i dinamica populaiilor
Capitolul 1. Genomul uman complementul
umane . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .122
cromozomial i *harta genetic . . . . . . . . . . . . . . . . .52
1. Structura populaiei . . . . . . . . . . . . . . . . . . . . . . . . . . .122
1. Genetica uman obiect de studiu, identificarea cro-
2. Dinamica populaiei . . . . . . . . . . . . . . . . . . . . . . . . . . .123
mozomilor umani . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .52
Lucrri practice: Analize statistice ale structurii
2. Cariotipul i genomul uman . . . . . . . . . . . . . . . . . . . . .54 i ale dinamicii populaiilor . . . . . . . . . . . . . . . . . . . . . . .126
Capitolul 2. Determinismul genetic al principalelor Test de evaluare . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .126
caractere fenotipice umane . . . . . . . . . . . . . . . . . . . . .57 Capitolul 3. Impactul antropic asupra
1. Determinismul unor caractere fenotipice normale . .57 ecosistemelor naturale . . . . . . . . . . . . . . . . . . . . . . . .127
2. Determinismul genetic al unor maladii umane . . . . .58 1. Deteriorarea ecosistemelor naturale . . . . . . . . . . . . .127
3. *Determinismul genetic n memorie, inteligen, com- 2. Deteriorarea ecosistemelor prin supraexploatarea
portament i temperament . . . . . . . . . . . . . . . . . . . . . .65 resurselor biologice . . . . . . . . . . . . . . . . . . . . . . . . . . .128
Lucrri practice Transmiterea n descenden 3. Deteriorarea mediului prin poluare . . . . . . . . . . . . . .132
a unor boli genetice . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .70 Lucrri practice: Evidenierea impactului antropic
Test de evaluare . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .71 asupra ecosistemelor . . . . . . . . . . . . . . . . . . . . . . . . . . . .136
Test de evaluare . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .136
Capitolul 3. *Diversitatea genetic uman
genetica raselor umane . . . . . . . . . . . . . . . . . . . . . . . .72 Capitolul 4. Conservarea resurselor naturale
1. Originea i evoluia omului . . . . . . . . . . . . . . . . . . . . . .72 i a biodiversitii . . . . . . . . . . . . . . . . . . . . . . . . . . . . .137
2. Formarea raselor umane . . . . . . . . . . . . . . . . . . . . . . . .74 1. Conservarea biodiversitii . . . . . . . . . . . . . . . . . . . . .138
3. Dovezi ale geneticii moleculare n procesul de Test de evaluare . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .141
umanizare . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .75 Capitolul 5. *Dezvoltarea durabil . . . . . . . . . . . . .142
4. Implicaii genetice n caracterizarea raselor umane . .76 Sintez Ecologie uman . . . . . . . . . . . . . . . . . . . . . . . .143
Lucrri practice ntocmirea arborelui genealogic . . . .78 Bibliografie selectiv Ecologie uman . . . . . . . . . . . .143

144