b. Indicate whether each one is a single-stranded or double-stranded.

Write
Biology 140 (GENETICS) Problem Sets # 1-4:
your answer on the space on the table.
A Number-By-Number Explanation
Please refer to this guide for explanations of the answers to Problem Sets # The key here is looking at whether Chargaff's Rules (AT and GC Base Pairing)
1-4 of Biology 140 LAB. Note that this guide is student-made and is thus apply. If the number of A = T and G = C, then the molecule is double-
subject to error. Use it at your own risk. Any questions, comments,
stranded regardless of whether it's DNA or RNA.
suggestions or corrections are welcome. Good luck!

c. Based on the data, arrange all DOUBLE stranded nucleic acids from the
PROBLEM SET # 1 table according to INCREASING melting temperature. Write the species
I. Given below are the relative percentages of nitrogen bases from 6 numbers separated by "less than" sign.
different species.

ANSWER: 1 < 4 < 6 < 5

Species A T G C U DNA or RNA Single- or double-stranded The basis for determining melting temperature is the GC content of the
1 26 26 24 24 0 DNA Double-stranded double-stranded molecule. Since GC base pairs have more H-bonds than
2 23 17 21 29 0 DNA Single-stranded AT/AU base pairs, the more GC base pairs the molecule has, the HIGHER the
3 33 0 21 29 17 RNA Single-stranded melting point of the molecule.
4 21 0 29 29 21 RNA Double-stranded
5 13 13 37 37 0 DNA Double-stranded II. The following is a partial sequence of a gene in Drosophila
6 20 20 30 30 0 DNA Double-stranded melanogaster with some of the upstream sequences.

a. Determine the type of nucleic acid for each species. Write your answer on NOTE: An amino acid table must be consulted for this part.
the space on the table.
5' - TATAAAACCGGCGGGTTACGCGCCGATGCGCGCCTACGCGATGCGCTACCGATATTAG - 3'

The only thing you need to know for this part is that DNA has Thymine (T)
and RNA has Uracil (U). A lack of one or the other in the table above will tell 1. Which sequence will be used as a template for transcription? The above

you what kind of nucleic acid you're dealing with. sequence or its complement?
ANSWER: Complement
Always remember that the Hogness-Goldberg box (TATAAA) and Pribnow
box (TATAAT) are are on the coding strand or sense strand. This means that
the template strand or anti-sense strand is the complement of the given
strand.
2. Give the amino acid sequence.
ANSWER: Met - Arg - Tyr - Arg Tyr
The technique here is to remember that the transcription start site in
eukaryotes is 30 bases after the middle of the TATA box. After counting 30
bases, the first base after marks the start of the transcription. The process is
diagrammed below.
1 30 S determine that when both enzymes are added, the EcoRI site should be
TAT|AAACCGGCGGGTTACGCGCCGATGCGCGCCTA|CGCGATGCGCTACCGATATTAG
*S = Transcription Start Site
III. A DNA molecule is cut with EcoRI to yield a 16 kb fragment. When the
original molecule is cut withBgIII, fragments of 4.3 kb, 5.5 kb and 6.2 kb are
produced. When the molecule is digested by both enzymes, fragments of
2.7 kb, 3.5 kb, 4.3 kb and 5.5 kb result.
A. Is the DNA molecule circular or linear?
ANSWER: Circular
The key lies in the first statement, which says that using EcoRI, a 16 kb
fragment resulted. If the DNA molecule were linear, then a cut by this
enzyme would've resulted in two fragments, not just one.
B. Derive a restriction map:
Draw the restriction map such that there are three BgIII restriction sites that
produce 4.3 kb, 5.5 kb and 6.2 kb fragments. After which, you can
found somewhere on the 6.2 kb fragment.
IV. Consider the following normal amino acid sequence: Gly-Leu-Arg-Gln-
Cys-Ile-Phe. For each mutant protein below, indicate the nature of each
mutation based on the EFFECT ON THE PROTEIN. (NOTE: An amino acid
table must be consulted for this part.)
EFFECTS ON THE PROTEIN
1) Nonsense
2) Missense
3) Silent Mutation
4) Frameshift Mutation
A. Gly - Leu - Arg - Gln Mutation Enzyme 1 Enzyme 2
P- + -
ANSWER: Nonsense Q- - +
The amino acid chain appears to have been terminated prematurely, and if R- - -
you check the amino acid correspondence, it appears that cysteine S- + +
(UGU/UGC) underwent a base substitution to yield a stop codon (UGA).
Among P, Q, R and S, identify which of those are the repressor, operator and
B. Gly - Leu - Arg - Arg - Cys - Ile - Phe the structural genes.

ANSWER: Missense Repressor: S

Simply put, there was a substitution in the second base of the codon coding
for Glutamine (CAA/CAG), changing it into Arginine (CGA/CGG)
C. Gly - Phe - Lys - Thr - Met - Gln Ile
ANSWER: Frameshift Mutation
The best thing to do here is to find out the possible base sequences for the
original strand from Arg onwards and compare that with the modified
amino acid sequence. It will become clear that a frameshift mutation
occurred.
Recall that the repressor in an INDUCIBLE operon is attached to the
operator region, preventing transcription from happening until the presence
of a particular substance induces it to undergo a conformational change,
freeing it from the DNA. If there is a lack of a repressor, then transcription
should occur continuously. S should then be the repressor because the lack
of it causes both enzymes to be produced.
Operator: R
The apparent absence of the operator region prevents transcription from
continuing. I'm not entirely sure about the explanation here.

V. A new, inducible operon with four adjacent regions PQRS has been
identified. The operon makes two enzymes, 1 and 2. Mutations in the
following regions result in any one of the following: (+) = the enzyme is
produced; (-) = no enzyme is produced.
Structural Genes: P and Q
Note how the mutations in P and Q cause only a particular enzyme's
production to cease. This indicates that each one of these codes for one of
the enzyme and hence is a structural gene. It is also important to note that a
negative sign in the table for a particular mutation in either P or Q tells you
which gene codes for which enzyme (e.g. P codes for enzyme 2 because in particular blockages are bypassed. Arrange the substances in order of
its absence, enzyme 2 is absent.) increasing + or number of strains that grow. You'll get this,

VI. A number of nutritional mutant strains were isolated from the wild- Glutamic Acid (No +) Glutamic semialdehyde (1 +) Ornithine (2 +)
type Neurospora fungus that responded to the addition of certain Citruline (3 +) Arginine (All +)
supplements in the culture medium by growth (+) or no growth (-)
In order to determine the blockages, look at the + and - signs in rows and
Mutant supplements added to the minimal culture medium not columns this time. Since you know the pathway, you can deduce where
Strain Citruline Glutamic Arginine Ornithine Glutamic acid the mutations in each strain are by looking at what the strain can thrive on.
semialdehyde
For example, strain 1 can only thrive on citruline and arginine. We know
1 + - + - -
that citruline comes before arginine, and that ornithine comes before
2 + + + + -
citruline, so there must be a blockage in between citruline and citruline.
3 + - + + -
4 - - + - -
VII. A pregnant woman learns that her father has Huntington's disease, an
autosomal recessive disorder. There is no history of the disease in her
Given the above responses for single-gene mutants, diagram a metabolic
husband's family. A DNA digestion test reveals the presence of the allele for
pathway that could exist in the wild-type strain consistent with the data.
Huntington's disease is available. The test is performed on the woman's
Indicate where the chain is blocked in each mutant strain.
father, the woman, the husband and her unborn child through chorionic villi
sampling. The results of the DNA banding pattern appear below.
(2) (3) (1) (4)
Glutamic Acid Glutamic Semialdehyde Ornithine Citruline Arginine
Womans Father Woman Husband Unborn Child
The easiest way to go about this problem is by first determining the end of ____ ____ ____

the pathway. Look for that nutrient which, when given, causes all the strains ____ ____

to grow - this is the endpoint. Hence, arginine is at the end. Next, the idea in ____ ____ ____
____ ____ ____
this problem is that as you go from the first substance in the chain to the
____ ____ ____
last, the number of mutants that can thrive in the medium increases since
____ ____ ____
A. Will the woman develop the disease? hybrid. Would this individual produce a functional enzyme? Justify your
answer.
ANSWER: NO
Looking at the banding patterns of the woman's father and the woman, we ANSWER: No, the individual is not capable of producing a functional
can note that only the first two rows are different. The bottom four yield no enzyme.
important pieces of information as both of them possess the bands. This
tells you that the presence of the uppermost band indicates Huntington's The idea here is that introns are removed during posttranscriptional
disease. modification of the RNA coded from the gene. If the introns were indeed
spliced from the RNA, loops would be formed in the intron regions since
B. Will the woman's unborn child develop the disease? there would be no corresponding sequence in the spliced RNA (which is
made up of only exons). Given that this did not happen, this can only mean
ANSWER: YES that the introns are still intact; hence, the enzyme cannot be functional.
I know what you're thinking. "What the hell? He/she has the exact same
banding pattern as the woman's father. we know he has Huntington's
disease!" Well, apparently, that's not all that matters here, sadly. It seems
PROBLEM SET # 2
that the fact that the woman's husband has NO HISTORY whatsoever of the
I. If 2x is the amount of DNA present at pachytene stage of meiosis I
disease makes a difference. Since the disease is autosomal recessive and the
husband's family has no history, there is no possible way for the kid to have
1. What would be the amount of DNA at the end of meiosis?
the disease. Be on the lookout!

ANSWER: X/2
C. Justify briefly your answers in A and B.
The key here is knowing that at pachytene stage, the homologous
chromosomes are paired up as tetrads. Note that after each meiotic
Please consult the explanations above.
division, the DNA content is divided in half. Since the question is asking how
much DNA there will be at the end of the entire meiosis (and not just
VIII. The gene of a hypothetical enzyme contains three introns. Cytoplasmic
meiosis I), the answer is such.
RNA obtained from one individual with a disease and the RNA was
hybridized to full length DNA with no loops being detected in the DNA-RNA
2. What would be the amount of DNA at G1 phase of a somatic cell from the
same organism?
ANSWER: X
We know that the DNA content is 2x at pachytene stage, which is the
amount of DNA right after the cell has undergone S phase. Since G1 phase is
before S phase, the double has not yet occurred and the answer should be
X.
II. The diploid chromosome number of a certain plant is 26.
1. How many bivalents are formed during prophase of meiosis I?
ANSWER: 13 bivalents
Bivalents are essentially two homologous chromosomes paired up together
to form tetrads. Given that, since there are two homologous chromosomes,
the answer should be half of the total chromosome count or 13.
2. How many centromeres are present in its endosperm cell during
anaphase of mitosis?
ANSWER: 78 centromeres
The endosperm of the plant has a chromosome count of 39, since its
haploid count is 13. Note that each chromosome in mitosis has two sister
chromatids. When these sister chromatids split during anaphase, note that
each one possesses a centromere. Hence, the answer is 78 centromeres in
anaphase.
3. How many sperm nuclei will be formed from a cluster of 4 microspores?
ANSWER: 8 sperm nuclei
It is vital to remember that each microspore generates two sperm nuclei, so
four microspores would generate eight sperm nuclei. Consult the diagram
below for a general relationship between the different stages of the pollen
grain.
1 Microsporocyte = 4 Microspores = 8 Sperm Nuclei
III. How many
1. Tetrads are found in the primary spermatocyte of a Rana pippins (2N =
26)?
ANSWER: 13 tetrads
The primary spermatocyte is undergoing meiosis I, and as explained earlier,
each tetrad is comprised of two homologous chromosomes. Hence, the
diploid number should be divided in two to get the number of tetrads.
2. Chromosomes are found in the mature leukocytes of chimpanzee?
ANSWER: 48 chromosomes
Chimpanzees have a chromosome count of 48 (2N = 48). Hence, since the
mature leukocyte of a chimpanzee is nucleated, it should possess this
number of chromosomes.
3. Human egg cells will be formed from 10 primary oocytes?
ANSWER: 10 human egg cells
Always remember than each primary OR secondary oocyte only forms one
egg cell. Hence, the relationship is as described below.
1 Oogonium = 1 Primary Oocyte = 1 Secondary Oocyte = 1 Ovum/Egg Cell
IV. Consider the cross AaBbCcDdEe x aabbccDDee. Assume complete
dominance and independent assortment.
A. What proportion of the progeny will phenotypically resemble
producing a DOMINANT phenotype since either a homozygous dominant or
heterozygous dominant results.
(2) Either parent
ANSWER:
The key word here is "either"; whenever you see this word, always use the
Sum Rule. We know that there's a 1/16 chance the offspring will resemble
the first parent phenotypically, so we calculate for the probability of
resembling the second parent, whose phenotype is abcDe. Based on the
data above, the answer is x x x 1 x = 1/16. If you add these two, you
get .

PHENOTYPES: Possible A Phenotypes: A; a (3) Neither parent

Possible B Phenotypes: B; b
Possible C Phenotypes: C; c ANSWER:
Possible D Phenotypes: 1 D Think of "neither" as the opposite of "either" and you should be fine. Since
Possible E Phenotypes: E; e you know that there is a chance of yielding an offspring phenotypically
resembling either parent, the probability of the offspring resembling neither
(1) The first parent of them is 1 - = .
B. What proportion of the progeny will genotypical resemble
ANSWER: 1/16
The phenotype of the first parent can be represented as ABCDE. Given the GENOTYPES: Possible A Genotypes: Aa; aa
data above and the probabilities calculated in the [PHENOTYPES] table, we Possible B Genotypes: Bb; bb
can see the answer is x x x 1 x = 1/16. You might be wondering why Possible C Genotypes: Cc; cc
there's a 1 there. Note that in the D locus, there's a 100% chance of Possible D Genotypes: DD; Dd
Possible E Genotypes: Ee; ee
(1) The second parent
ANSWER: 1/32
Given the data in the [GENOTYPES] column, we can calculate that in order
for the progeny to genotypically resemble the second parent, it should have
the genotype aabbccDDee. The probability is then x x x x = 1/32.
(2) Either parent
ANSWER: 1/16
Similar to problem A2, "either" means utilizing the Sum Rule. We know that
the probability of yielding a progeny with the second parent's genotype is
1/32, and we find that the probability of yielding a progeny with the first
parent's genotype is x x x x = 1/32. The answer is then 1/32 + Possible D Genotypes: DD; Dd; dd
1/32 = 1/16.
(3) Neither parent
ANSWER: 15/16
Similar to problem A3, "neither" means subtracting the probability of
getting "either" from 1. The answer is then 1 - 1/16 = 15/16.
V. Given D/d, E/e, and F/f are independently assorting. If both parents are
heterozygous for all genes, what is the probability of
MALE PARENT GENOTYPE: DdEeFf
FEMALE PARENT GENOTYPE: DdEeFf
A. an egg that is DEF
ANSWER:
Based on the genotype, there is a chance for a gamete to get each allele
in one locus. Hence, the probability is D x E x F = for DEF.
B. a sperm that is DeF
Once more, the probability is per allele per locus, so the probability is D
x e x F = DeF.
C. a child that is D_E_ff
Possible E Genotypes: EE; Ee; ee
Possible F Genotypes: FF; Ff; ff
ANSWER: 9/64
In order to acquire the probability for yielding the genotype D_E_ff, it is
wise to calculate the individual probabilities per locus. It can then be found
that there is a chance of getting D_, chance of getting E_ and chance
of getting ff. The answer is then D_ x E_ x ff = 9/64 D_E_ff.
VI. In tomatoes, red fruit is dominant to yellow, two loculed fruit is
dominant to many-loculed fruit, and tall vine is dominant to dwarf. Trihybrid
plants were cross fertilized. What is the probability of:
Y = red, y = yellow Possible Y Phenotypes: red; yellow
M = two-loculed, m = many-loculed Possible M Phenotypes: two-loculed; many-loculed
D = tall, d = dwarf
ANSWER: 3/16
MALE PARENT: YyMmDd (D = , R = for all gene loci) Simple application of the product rule tells you that the probability of
FEMALE PARENT: YyMmDd (D = , R = for all gene loci) obtaining plants with both these characteristics is red fruits x many-
loculed = 3/16.
A. obtaining eggs with one dominant and two recessive genes from the
female parents? D. getting plants that are hybrid in at least two loci?

ANSWER: ANSWER:
It is best to utilize binomial expansion for this problem. Given that there are The probability of producing an offspring that is hybrid for one gene locus,
three gene loci, the equation would then be D3 + 3D2R + 3DR2 + R3. The since the parents are trihybrids, is . Since there are three gene loci, there
probability of getting one dominant and two recessive genes is indicated by are three possible loci that the offspring can be hybrids for, and thus three
2
"3DR ". Note that the coefficient here gives you the NUMBER OF different permutations of such. What should also be considered is the case
COMBINATIONS. Hence, the probability of getting one dominant and two wherein none of them are hybrids, and we can see that since the probability
2
recessive genes is 3 combinations x ()() = . of the offspring being hybrid for one gene locus is , the probability of
Manually, it's ( Y x M x d) + ( y x M x D) + ( Y x m x D) = . being a non-hybrid for that locus must then be . Given this, the math
follows below. Note that each term refers to a gene locus and each set of
B. male parents producing sperm cells bearing all dominant genes parentheses pertains to a possibility (no hybrids or one hybrid).

ANSWER: 1 - [( non-hybrid x non-hybrid x non-hybrid) + ( hybrid x non-

Given the binomial expansion earlier (D3 + 3D2R + 3DR2 + R3), the probability hybrid x non-hybrid) + ( non-hybrid x hybrid x non-hybrid) + ( non-
of producing sperm with all dominant genes is D3 or ()3 = . hybrid x non-hybrid x hybrid] =

C. obtaining among their dwarf offspring, plants with many-loculed and red VII. Xeroderma pigments is an autosomal recessive disorder that is caused
fruits? by the disruption in the ability of the person's DNA to repair damage caused
by ultraviolet radiation in sunlight. If people with this disorder are exposed
to sunlight, spots will immediately appear on their skin, which will
eventually become scabs. A man and a woman, who are carriers for the
disease, got married and are determined to have 6 children.
1. What is the probability that all 6 children will be normal?
ANSWER: 729/4096 or ()6
Since both parents are carriers for the disease, we know that they're both
heterozygous for the trait. When they are crossed, the ratio is then
homozygous dominant: heterozygous dominant: homozygous recessive.
The trait is inherited recessively, so it follows that there's a chance the
children will be normal. Given 6 children, this is simply ()6.
2. How many possible combinations can this couple have where 4 are
affected and 2 are normal?
ANSWER: 15 combinations
Application of binomial expansion yields D6 + 6 D5R + 15 D4R2 + 20 D3R3 + 15
D2R4 + 6 DR5 + R7. Remember that the coefficients of each term determine
the number of possible combinations. The term of interest is thus 15 D4R2,
and the answer is 15.
VIII. A pentahybrid plant with genotype AaBbCcDdEe is self-fertilized. There
is complete dominance at the A, B and E loci but incomplete dominance at
the C and D loci.
1. How many different kinds of gametes can the plant produce?
ANSWER: 32 gametes
A gamete has only one of the two alleles of the parent organism, and since
the parent is a pentahybrid, each locus may contribute one of two alleles.
Hence, there are (2 x 2 x 2 x 2 x 2) = 32 possible gametes.
2. How many phenotypes are expected among the progeny?
ANSWER: 72 phenotypes
For the loci that exhibit complete dominance (A, B and E), we know that
only two phenotypes can result, while for loci that exhibit incomplete
dominance (C and D), three phenotypes result (heterozygous is separate
phenotype). Hence, the number of possible phenotypes is (2 A x 2 B x 3 C x 2
D x 3 E) = 72 phenotypes.
3. What proportion of the progeny will be true breeding?
ANSWER: 1/32
True breeding means that for each gene locus, the offspring MUST be
homozygous, either dominant or recessive. This just means that there can
be NO heterozygous loci. As such, there is a probability for the offspring
to be homozygous in one gene loci. The proportion of progeny that are true
breeding is then ( x x x x ) = 1/32.
IX. Some 500 dormers from UP Diliman with 7 children in their families were For each child, determine whether the father is the wife's lover, husband, or
surveyed. The results are tabulated below. Does this distribution indicate indeterminate
that these boys and girls are occurring with equal frequency?
ANSWER: Child 1 Husband
No. of boys 7 6 5 4 3 2 1 0
No. of girls 0 1 2 3 4 5 6 7 EXPLANATION: By looking at the ABO blood group classification alone, you
No. of families 12 30 62 143 121 85 38 9 can already deduce which of the two is the father. Note that the first child is
of blood type O. The wife's lover couldn't possibly be the father because
he's blood type AB, which can in no way produce an offspring with blood
comp: 34.918, tab: 14.07; Degree of freedom: 7 Conclusion: Reject the
type O.
null hypothesis. The boys and girls are not occurring with equal frequency.

ANSWER: Child 2 Wife's Lover

PROBLEM SET # 3 EXPLANATION: This time, we examine the MN blood group system to

I. The M, N, and MN blood groups are determined by two alleles, LM and LN. determine the identity of the father. Child 2 is of blood type N, meaning

The Rh+ (rhesus positive) blood group is caused by a dominant allele R of a he/she has two copies of the N allele. The husband couldn't possibly be the

different gene. In a court case concerning a paternity dispute, each of two father because he's of blood type M (MM), which when crossed with the

men claimed three children to be his own. The blood group of the men, the wife's blood type N (NN) would result in purely MN offspring.

children and their mother were as follows:

PERSON BLOOD GROUP ANSWER: Child 3 Indeterminate

Husband O M Rh+
Wifes Lover AB MN Rh- EXPLANATION: First, let's examine the ABO blood group system. Child 3, just

Wife A N Rh+ like the mother, possesses blood type A, which is a possibility for both the

Child 1 O MN Rh+ husband and the wife's lover since they're O and AB respectively.

Child 2 A N Rh+
Child 3 A MN Rh- Regarding the MN blood group, matings between either the husband (MM)
or the wife's lover (MN) with the wife (NN) can yield an MN offspring.
Lastly, we must consider the Rh blood group system, which is governed by a BR and br (Non-Recombinants) = 12% (or 50% of 24%)
completely dominant gene locus. It is important to note that an Rh+ Br and bR (Recombinants) = 12% (or 50% of 24%)
individual can have one of two genotypes RR or Rr. The consequence of Total Frequency = 24%
this is that matings between Rh+ individuals can produce Rh- offspring.
Hence, a mating between the wife (Rh+) and the husband (Rh+) can produce III. Yellow versus gray body color in D. melanogaster is determined by the
an Rh- child so long as they're both heterozygous for the gene locus. For the alleles y and y+, vermilion versus wildtype eyes by the alleles v and v+, and
case between the wife (Rh+) and the wife's lover (Rh-), the child may also be singed versus straight bristles by the alleles sn and sn+. When females
produced if the wife is heterozygous. heterozygous for each of these X-linked genes were testcrossed with yellow,
II. A fruitfly of genotype B R/b r is testcrossed to b r/b r. In 76 percent of the vermilion, singed males, the following classes and number of progeny were
meioses, no chiasmata occur between the linked gene pairs; in 24 percent obtained:
of the meioses, one chiasma occurs between the pairs.
Yellow, vermilion, singed 58 Gray, vermilion, singed 4
What proportion of the progeny will be Bbrr? Yellow, vermilion, straight 103 Gray, vermilion, straight 347
Yellow, wildtype, singed 336 Gray, wildtype, singed 98
ANSWER: 6% Yellow, wildtype, straight 3 Gray, wildtype, straight 64

EXPLANATION: The 24% given in the statement of the problem is actually TOTAL NUMBER OF PROGENY: 1,013
the recombination frequency. In order to proceed, it is essential that we list
down all the possible gametes that may result from an individual during (A) What is the order of the three genes? Construct a linkage map with the
recombination. Recall that in crossing over, recombinants can only surface a genes in the correct order, and indicate the map distances between the
maximum of 50% of the time, and the other 50% will be non-recombinants. genes.
Hence, the percentages are as follows,
ANSWER:
BR---------6% 20.53 cM 12.73 cM
Br---------6% y--------------------sn-------------------v
bR---------6%
br---------6%
EXPLANATION: First, let's determine the parental phenotypes and DCO Next, we calculate for the distances between y and sn and between sn and
individuals. We know that the parental phenotypes are the most commonly v. To do this, we must list the SCO phenotypes that result from crossing over
occurring, so they must be the "yellow, wildtype, singed" and "gray, events in each region. They are presented below. The parental phenotypes
vermilion, straight" individuals. On the other hand, DCO individuals are the
PARENTAL PHENOTYPES RE-ARRANGED
least frequent, and appear to be the "yellow, wildtype, straight" and "gray,
Yellow, wildtype, singed y v+ sn 58 y sn v+
vermilion, singed" individuals. Below, the parental and DCO cases are
Gray, vermilion, straight y+ v sn+ 64 y+ sn+ v
presented along with their genotypes for convenience.
and DCO phenotypes have been included for reference purposes.

PARENTAL PHENOTYPES DOUBLE CROSSING OVER PHENOTYPES RE-ARRANGED

Yellow, vermilion, singed y v+ sn Yellow, wildtype, straight y v+ sn+ 3 y sn+ v+
Gray, vermilion, straight y+ v sn+ Gray, vermilion, singed y+ v sn 4 y+ sn v

DOUBLE CROSSING OVER PHENOTYPES Phenotypes resulting from SCO between y and sn RE-ARRANGED
Yellow, wildtype, straight y v+ sn+ Yellow, vermilion, straight y v sn+ 103 y sn+ v
Gray, vermilion, singed y+ v sn Gray, wildtype, singed y+ v+ sn 98 y+ sn v+

Once these have been determined, the next step is to construct a linkage Phenotypes resulting from SCO between sn and v RE-ARRANGED

map, but in order to do that, the linear order of the genes must be Yellow, vermilion, singed y v sn 58 y sn v

ascertained. You can do this by comparing the parental phenotypes with the Gray, wildtype, straight y+ v+ sn+ 64 y+ sn+ v+

DCO phenotypes. Which gene appears to have swapped positions? Notice

how "y v+ sn" and "y v+ sn+" differ only in that sn+ was substituted for
sn. Hence, the sn locus must be the middle gene. Our gene order is then as Now that the data's been presented in an organized manner, it's time to

follows, compute for the gene distances. The equations and final gene distances are
found below. Always remember to include the DCO phenotypes in the

y-----sn-----v computations.
Distance(y-sn) = [(No. of SCO(y-sn) + No. of DCO) Total No. of Progeny] should look like this. Note that the map units/centiMorgans should be
x x 100% converted back to decimal form before plugging them into the formula.
= [(103 + 98 + 3 + 4) 1,013] x 100%
= 20.53 m.u. or cM C = (3 + 4) (0.2053 x 0.1273 x 1,013) = 0.264

Distance(sn-v) = [(No. of SCO(sn-v) + No. of DCO) Total No. of Progeny] Once you have C, calculating I is only a matter of plugging in the value.
x x 100% I = 1 - C = 0.736
= [(58 + 64 + 3 + 4) 1,013] x 100%
= 12.73 m.u. or cM IV. Given below are three linked genes and their respective distances.

Thus, the linkage map should look like the answer above.
(B) Determine the coefficient of coincidence and the interference.
ANSWER: C = 0.264 and I = 0.736
35 20
E--------------------------F---------------------G
[-------------------------31%-------------------]
(A) If there is no interference, determine the phenotypes and frequencies
of the double crossovers from the EFg/efG x efg/efg cross.

EXPLANATION: Recall the equations for the coefficient of coincidence (C) ANSWER: 3.5% each for Efg/efg and eFG/efg
and interference (I).
EXPLANATION: Double-crossing over would result in the following gametes
C = Observed No. of DCO Expected No. of DCO
I=1-C E F g E f g
--------- ---> ---------- (INDIVIDUAL 1)
The observed number of DCO is obtained by adding the total number of e f G e F G
individuals exhibiting DCO from the data, while the expected number comes e f g e f g
from multiplying the two gene distances (y-sn and sn-v) with each other and --------- ---> ---------- (INDIVIDUAL 2)
then with the total number of progeny, which is 1,013. The calculations e f g e f g
Matings between these two individuals would produce offspring with
phenotypes Efg/efg and eFG/efg. The frequencies of each can be
determined by obtaining the expected frequency of double crossovers.
Since the gene distances are given, we can apply the following formula.
Expected DCO = Distance(E-F) x Distance(F-G) = (0.35)(0.20) = 0.07 or 7%
The total frequency of double crossovers is 7%, but since there are two
gametes produced from this event, each gamete has a 3.5% probability of
occurring. Note that the frequency of the gamete efg occurring in the
second individual is 1 since it is homozygous recessive. Thus, the following
phenotypic frequencies are obtained.
Efg/efg = (0.035 x 1) = 0.035 or 3.5%
eFG/efg = (0.035 x 1) = 0.035 or 3.5%
(B) Indicate the phenotypes and calculate the single crossovers between E
and F.
ANSWER: 14% each for EfG/efg and eFg/efg
EXPLANATION: Calculation of the single crossovers requires that we know
the genetic distance between E and F. Thankfully, we know this to be 35
map units. However, the problem here lies in that this frequency of 35%
includes the double crossovers, which we need to take out to determine the
SCOs.
From the previous number, we know that DCOs have a collective frequency
of 0.07 or 7%. If we subtract this from the genetic distance between E and F,
we obtain our SCO frequency.
SCO(E-F) = 0.35 - 0.07 = 0.28 or 28%
EfG = 0.14
eFg = 0.14
The total SCO frequency between E and F is then 28%, but recall that a
single SCO produces two gametes, in this case EfG and eFg. Each would then
have a frequency of 14%. Listed below are the possible phenotypes that
result from the matings and their corresponding frequencies. Again, note
that the frequency of efg is 1 since the individual is homozygous recessive.
EfG/efg = (0.14 x 1) = 0.14 or 14%
eFg/efg = (0.14 x 1) = 0.14 or 14%
(C) What would be the frequencies of the double crossovers if there is an
interference of 0.3?
ANSWER: 2.45% each for Efg/efg and eFG/efg
EXPLANATION: Since there is the presence of interference, the observed
DCO will change depending on the amount of interference present. This can
be determined by using the equation below. Note that the expected DCO
was determined in previous parts of this number and is equal to 0.07.
I=1-C
I = 1 - (Observed No. of DCO Expected No. of DCO)
(Observed No. of DCO/Expected No. of DCO) = 1 - I
Observed No. of DCO = (1 - I)(Expected No. of DCO)
Observed No. of DCO = (1 - 0.3)(0.07)
Observed No. of DCO = 0.049 or 4.9%
Since there are two gametes produced from a crossing over event, the
0.049 or 4.9% will be halved into 0.0245 or 2.45% each for Efg and eFG.
V. The accompanying diagram summarizes the recombination frequencies
observed in a large experiment to study three linked genes.
A------------15%-----------B--------------20%------------C
(A) What was the observed frequency of double crossing over in this
experiment?
ANSWER: 0.02 or 2%
EXPLANATION: This problem requires much mathematical logic in order to
obtain the observed frequency for double crossing over. We will start off
with simple equations and combine them later to obtain the expression for
isolating the final answer.
We know that 15% or 0.15 is the frequency of SCO between A and B plus
the total number of DCOs. Thus, we can represent 15% as such,
0.15 = SCO(A-B) + DCO
Similarly, we can say that 20% or 0.20 is the frequency of SCO between B
and C plus the total number of DCOs. Thus, we can represent the 20% as,
0.20 = SCO(B-C) + DCO
As for the 31% presented above, this is simply equivalent to the number of
single crossovers between the points A and C. Mathematically, this can also
be equated to the frequency of SCOs between A and B plus the frequency of
SCOs between B and C (Since by mathematical logic, AB + BC = AC)
0.31 = SCO(A-C) = SCO(A-B) + SCO(B-C)
Adding up the first two equations, we obtain,
0.35 = SCO(A-B) + SCO(B-C) + 2DCO
In order to isolate the observed frequency of double crossing over, we will
need to subtract the first equation (0.31) from the second equation (0.35),
and we thus yield the following,
0.35 - 0.31 = SCO(A-B) + SCO(B-C) + 2DCO - (SCO(A-B) + SCO(B-C))
0.04 = 2DCO
DCO = 0.02 or 2%
(B) Calculate the interference.
ANSWER: 0.33
EXPLANATION: Again, we employ the equation for interference. Note that
the expected frequency is obtained by simply multiplying Distance(A-B) and
Distance (B-C)
(A) What conclusions are possible concerning the linkage relations of these
three genes?
ANSWER: Only the b and hk loci are linked together; the st locus is found on
another chromosome and is thus independent of the first two.

I=1-C EXPLANATION: The easiest way to look at the data is by assigning

= 1 - (Observed Frequency of DCO) (Expected Frequency of DCO) appropriate symbols to the different phenotypes and comparing these
= 1 - (0.02 (0.15)(0.20)) individuals with each other. What is being looked for here is whether or not
= 1 - 0.66 certain gene loci are linked together. How do we determine this?
I = 0.33
Compare two phenotypes where two traits are fixed, while the other one is
VI. The recessive mutations b (black body color), st (scarlet eye color), varied. For example, in the first two phenotypes, "black, wildtype, scarlet"
and hk (hooked bristles) identify three autosomal genes in D. (b + st) and "black, wildtype, wildtype" (b + +), both are the same for the
melanogaster. The following progeny were obtained from a test cross of body color and bristles loci but differ in the eye color one. The general
female heterozygous for all three genes. assumption is that if the number of progeny remains the same when an
allele is varied, the genes are independent of each other. In this case, the
Black, wildtype, scarlet b + st 248 248 and 242 offspring show little difference from each other, and so body
Black, wildtype, wildtype b + + 242 color and bristles must be independent of the eye color.
Black, hooked, wildtype b hk + 12
Black, hooked, scarlet b hk st 14 Next, let's take phenotypes two and three, "black, wildtype, wildtype" (b +
Wildtype, hooked, wildtype + hk + 237 +) and "black, hooked, wildtype" (b hk +) into consideration. This time, the
Wildtype, hooked, scarlet + hk st 229 bristles locus (hk) is varied while the other two are held constant. Since we
Wildtype, wildtype, scarlet + + st 15 know that the eye color locus (st) is independent of the other two, it is
Wildtype, wildtype, wildtype + + + 19 essential to confirm19
whether body color (b) and bristles (hk) are linked.
From the data, it appears that varying the position of the hk allele causes a
drop in frequency from 248 to 12 offspring, indicating linkage. Hence, the Given that (b +) and (+ hk) are the most frequent classes, they must
two gene loci are linked. represent the parental phenotypes. It then follows that (b hk) and (+ +)
represent the SCO classes. The distance between the two gene loci can then
(B) Calculate any appropriate map distances. be calculated from the following formula,

ANSWER: Distance(b-hk) = (Observed No. of SCO Total No. of Progeny) x 100%

b-------5.91 cM-------hk = [(34 + 26) 1,016] x 100%
= 5.91 m.u. or cM
EXPLANATION: Given that the body color (b) and bristles (hk) loci are linked,
and that they are independent of the eye color (st) locus, we can simplify
the data from the table above. Only body color and bristles need to be PROBLEM SET # 4
considered when calculating for gene linkage.
I. Given a population at Hardy-Weinberg-Castle equilibrium with p = 0.7

Black, wildtype (b +) 248 a. What is the frequency of matings among heterozygote individuals in the
Wildtype, hooked (+ hk) 237 population?
Black, wildtype (b +) 242 ANSWER: 0.1764
Wildtype, hooked (+ hk) 229
Black, hooked (b hk) 12 EXPLANATION: We know that heterozygotes are denoted by the term 2pq in
Wildtype, wildtype (+ +) 15 the Hardy-Weinberg population. First, calculate for 1, which is simply 1 - p
Black, hooked (b hk) 14 (0.7) = 0.3. Since the question's asking for the frequency of the matings
Wildtype, wildtype (+ +) 19 among heterozygote individuals, the answer should be
TOTAL PROGENY = 1,016
2pq x 2pq = 2(0.7)(0.3) x 2(0.7)(0.3) = 0.1764
(b +) = 248 + 242 = 490
(+ hk) = 237 + 229 = 466 b. What is the frequency of negative assortive phenotypic matings in the
(b hk) = 12 + 14 = 26 population?
(+ +) = 15 + 19 = 34
ANSWER: 0.163 Aa x aa = 2pq x q2
aa x Aa = q2 x 2pq
EXPLANATION: Negative assortive phenotypic matings are matings between
individuals with DISSIMILAR phenotypes. This means that one expressing Notice that the first two and the last two have the same equations, so
the dominant trait (AA or Aa) has to mate with another expressing the effectively, the equation (and answer) should look like this,
recessive condition (aa). It is thus convenient to list down ALL the possible
marriages so that you don't miss out on anything. Assuming complete 2(p2 x q2) + 2(2pq x q2) = 0.1638
dominance in this situation (unless otherwise stated),
c. Among the negative assortive phenotypic matings in the population, what
AA x Aa POSITIVE ASSORTIVE MATING (X) proportion of them will give a recessive phenotype?
Aa x AA POSITIVE ASSORTIVE MATING (X)
AA x aa NEGATIVE ASSORTIVE MATING (O) ANSWER:
aa x AA NEGATIVE ASSORTIVE MATING (O)
Aa x aa NEGATIVE ASSORTIVE MATING (O) EXPLANATION: Notice how this question is different from the last one in
aa x Aa NEGATIVE ASSORTIVE MATING (O) that it uses the word proportion or fraction of negative assortive phenotypic
AA x AA POSITIVE ASSORTIVE MATING (X) matings that give a recessive phenotype. Let's list down the possible
aa x aa POSITIVE ASSORTIVE MATING (X) negative assortive matings once more,
Aa x Aa POSITIVE ASSORTIVE MATING (X)
AA x aa NEGATIVE ASSORTIVE MATING (O)
Note that when the two individuals have different genotypes, there are two aa x AA NEGATIVE ASSORTIVE MATING (O)
possibilities (i.e. male is AA and female is Aa or male is Aa and female is AA). Aa x aa NEGATIVE ASSORTIVE MATING (O)
From the list above, there are only FOUR possible negative assortive aa x Aa NEGATIVE ASSORTIVE MATING (O)
matings in this situation, so we must compute for the probability of each
marriage occurring and add these numbers up. From this, determine which of these marriages can yield offspring with a
recessive phenotype. If you notice, the first two matings only produce
AA x aa = p2 x q2 heterozygote individuals, while the third and fourth matings yield both
aa x AA = q2 x p2
heterozygotes and homozygous recessive individuals. Thus, 2 out of 4 or
of the matings give a recessive phenotype.
d. What are the expected allelic frequencies four generations later?
ANSWER: p = 0.7 and q = 0.3
EXPLANATION: I know what you're thinking, and yes, this is a trick question.
The population is at Hardy-Weinberg equilibrium, and one of the
consequences of being in such is that the allele frequencies remain perfectly
the same.
e. What is the expected frequency of the heterzygous individuals after four
generations of inbreeding?
ANSWER: 0.02625
EXPLANATION: Recall that inbreeding leads to the decrease in the number
of heterozygotes and increase in the number of homozygotes. If no other
information is given, the following equation is generally applicable,
()n x 2pq
where n = number of generations
2pq = heterozygote frequency
= reduction in number of heterozygotes per generation
By plugging in 4 as the number of generations and inputting p and q, you get
the following,
()4 x 2(0.7)(0.3) = 0.02625
II. The color of screech owls is under the control of a multiple allelic series, G
(red) > g' (intermediate) > g (gray). A sample from a population was
analyzed and found to contain 38 red, 144 intermediate and 18 gray owls.
Calculate the allelic frequencies.
ANSWER: p = 0.1, q = 0.6 and r = 0.3
EXPLANATION: Let us denote the following variables as such,
G (red) = p
g' (intermediate) = q
g (gray) = r
TOTAL INDIVIDUALS: 38 + 144 + 18 = 200
Given three possible alleles, it is always easiest to start at the bottom of the
hierarchy because there is always only one possible genotype. In this case,
the 18 gray individuals would have a genotype of gg and nothing else. This
makes it easy to compute for the allelic frequency of r by simply taking the
square root of the genotypic frequency giving you,
(18/200) = 0.3
From this, we can get the frequency of the q allele. Note that intermediate III. A sex-influenced gene which is dominant in males but recessive in
individuals can have two possible genotypes g'g' or g'g. Since some of females governs the presence of horns in some breeds of sheep. If a sample
them may carry the gray allele, and we know the frequency of the gray of 300 female sheep from a population in equlibrium is found to contain 75
allele, we can denote this mathematically by horned individuals.

g'g' (q2) a. What percentage of the females is expected to be heterozygote?

g'g (2qr)
gg (r2) ANSWER: 50%

Look familiar? Yup, you can make a binomial expansion from the three EXPLANATION: Let us denote the following conditions using these variables,
terms. Add them up, equate them to the genotypic frequencies and simplify H = presence of horns
the terms to get, h = absence of horns
p = frequency of H allele
2 2
q + 2qr + r = (144 intermediate + 18 gray)/200 = 162/200 q = frequency of h allele
2
(q + r) = 162/200
(q + 0.3)2 = 162/200 Here's what the phenotypes of the corresponding genotypes would look like
q = 0.6 in males and females. This is a sex-influenced gene, so the heterozygote
condition is different in each.
From this, you can determine p by simply plugging q and r into the following
equation and simplifying it. Recall that the sum of the frequencies of all GENOTYPE MALE PHENOTYPE FEMALE PHENOTYPE
alleles should equal 1. HH HORNED HORNED
Hh HORNED NO HORNS
p+q+r=1 hh NO HORNS NO HORNS
p + 0.6 + 0.3 = 1
p = 0.1 Since this is a sex-influenced gene, we must consider the male and female
populations separates. Luckily for us, the problem gives us the proportion
within the female population, so it becomes much simpler from here on.
Also, note that in a population in equilibrium, p and q are the same in the
male and female populations.
Given 75/300 HH females, we can solve for the allelic frequency of H by
taking the square root, which should give you p = 0.5. You can then solve for
q, which is equal to 1 - p = 1 - 0.5 = 0.5.
The frequency of heterozygous females is then simply equal to 2pq =
2(0.5)(0.5) = 0.5 or 50% of the population.
b. What percentage of the males is expected to be horned?
ANSWER: 75%
EXPLANATION: Recall that the allele frequencies in males and females
should be equal given Hardy-Weinberg equilibrium. We know that in males,
the horned condition is a dominant trait, and as such it can be represented
as both HH and Hh. Hence, taking the frequencies of each of these and
adding them together yields,
HH (p2) + Hh (2pq) = 0.25 + 0.5 = 0.75 or 75%
IV. In a given human population, the frequencies of the recessive allele for
colorblindness among the females and males are 0.3 and 0.4, respectively.
a. Is the population at genetic equilibrium?
ANSWER: No, it is not.
EXPLANATION: A population at genetic or Hardy-Weinberg equilibrium
assumes equal allele frequencies between the sexes. Hence, since the
colorblindness allele is 0.3 for females and 0.4 for males, there is a violation
of one of the conditions and so equilibrium is not present.
b. What is the frequency of the dominant allele for the entire population?
ANSWER: 0.66
EXPLANATION: First, it is essential to calculate the frequencies of the
dominant allele for each sex.
Females = 1 - 0.3 = 0.7
Males = 1 - 0.4 = 0.6
Since this is an X-linked trait, we know that affected females carry two X
alleles, while affected males carry only one. Consequently, this means that
of all alleles are carried by women, and only are carried by men. Hence,
the equation can be written as follows,
(0.7) + (0.6) = 0.66
c. What is the frequency of marriages among affected individuals?
ANSWER: 0.036
EXPLANATION: First, let's define some variables.
Let p = 0.6 = frequency of dominant allele in males
q = 0.4 = frequency of recessive allele in males
r = 0.7 = frequency of dominant allele in females
s = 0.3 = frequency of recessive allele in females
Note that this question is once again about the frequency of marriages. We
know that for females to be affected, they must have two copies of the
recessive allele, which can be denoted as s2. Males, on the other hand,
require only one copy of the recessive allele, which can be denoted as q.
Hence, the frequency of marriages between these individuals must be,
q x s2 = 0.4 x (0.3) 2 = 0.036
V. In a population, a recessive allele was initially neutral and had a
frequency of 0.3. The environment then changed so that the homozygous
recessive genotype becomes completely lethal.
a. What is the type of selection for this population?
ANSWER: Directional selection against the homozygous recessive individuals
EXPLANATION: When determining the type of selecting present, note that
there are only three possibilities - directional selection, stabilizing selection
and disruptive selection. In this case, we can see that one of the extremes,
the homozygous recessives, is not favored, so there is directional selection
against them.
b. What is the expected frequency of the recessive allele after one
generation?
ANSWER: 0.23
EXPLANATION: In this number, I will present two variants of obtaining the
answer. The former is much simpler and gives you the answer in the
shortest possible time, while the latter is more logical and allows you to
answer part c of this problem.
OPTION 1: EQUATION METHOD
When there is no mutation present and there is selection against the
homozygous recessive individuals, the following equation can be utilized to
determine the frequency of the recessive allele.
q = qo/(1 + tqo)
where qo is the initial frequency of the recessive allele
t is the number of generations passed.
By simply plugging in the recessive allele frequency (qo = 0.3) and the
number of generations passed (t = 1), you can obtain the following answer,
q = 0.3(1+1(0.3)) = 0.23
OPTION 2: TABULAR METHOD
It is first necessary to calculate the allelic frequency of the dominant allele p = 0.54 + (0.46) = 0.77
(p) and the genotypic frequencies of each class (homozygotes and q = 0 + (0.46) = 0.23
heterozygotes).
c. Give the expected genotypic frequencies after one generation of
First, we know that p is simply 1 - q = 1 - 0.3 = 0.7. As for the genotypic selection.
frequencies of the different classes, they can be found below,
ANSWER: AA = 0.54 and Aa = 0.46
AA = p2 = (0.7) 2 = 0.49
Aa = 2pq = 2(0.7)(0.3) = 0.42 EXPLANATION: Please refer to the table above in problem b for the solution
aa = q2 = (0.3) 2 = 0.09 and explanation to this problem.

Then, we note the fitness values (W) by taking 1 - selection coefficient. For
the homozygous dominant and heterozygous dominant individuals, the st is
0 and the W is 1. On the other hand, there is complete lethality for the
homozygous recessive class, meaning s = 1 and W = 0. We then collate this
into a single table and get this,
VI. In a population of 900 fish, the frequency (p) of the fast allele of the
enzyme ADH is 0.6 and the frequency of the slow allele (q) is 0.4. Five
hundred (500) fish migrate to this population and among the migrants, the
frequency of the slow allele is 0.8. Calculate the allelic frequencies in the
new population.

Genotypic Classes AA Aa aa ANSWER: p = 0.46 and q = 0.54

Genotypic Frequency 0.49 0.42 0.09
Fitness Value (W) 1 1 0 EXPLANATION: First, let's establish a few variable assignments and lay down
New Genotypic Frequency 0.49 0.42 0 some facts. Here are the variables I will be using for this problem.
TOTAL: 0.91
Relative Genotypic Frequency 0.54 0.46 0 Porig = fast allele frequency of original fish population of 900 = 0.6
Qorig = slow allele frequency of original fish population of 900 = 0.4
From the relative genotypic frequencies, we can obtain p and q, and so we Pmig = fast allele frequency of migrant fish population of 500 = 0.2
get, Qmig = slow allele frequency of migrant fish population of 500 = 0.8
Pmix = fast allele frequency of mixed fish population of 1400
Qmix = slow allele frequency of mixed fish population of 1400 A. What will be the frequency of N after 2 generations?

In calculating the new allele frequencies of the final population, we need to ANSWER: 0.199996
use the following equations,
EXPLANATION: You just need to plug the values into the following equation
Qmix = mQmig + (1-m)Qorig to obtain the answer,
Pmix = mPmig + (1-m)Porig
N = No(1 - u)n
OR
where N = frequency of allele N after n generations of mutation
Qmix = m(Qmig - Qorig) + Qorig No = initial frequency of allele N
Pmix = m(Pmig - Porig) + Porig u = forward mutation rate from N to n
n = number of generations passed
Ok, so we have almost everything in place for the equation. Question now
is, how do we get m? m is simply the proportion of migrants in the final The substitute equation should then look something like this,
population. Since we know that 500 fish migrated to the original population
of 900, and that the final population has 1400 members, m is simply N = 0.2(1 - 10-6)2 = 0.199996
500/1400 or 0.357142857. By plugging in the values, we obtain P mix and
Qmix, b. How many generations will it take for the recessive gene to rise in
frequency from 0.8 to 0.9.
Pmix = (0.36)(0.2) + (0.64)(0.6) = 0.46
Qmix = (0.36)(0.8) + (0.64)(0.4) = 0.54 ANSWER: 69,314 generations

VII. *Missing text* gene N for achondroplasia mutates to n (normal) at a EXPLANATION: First off, I'd like to mention that if you have an alternative
rate of 10-6, and backward mutation is absent. The frequency for N is initially method of explaining this, please let me know so that I may add it. Here I
0.2. will present my method of solving it under the specific assumptions and
conditions mentioned in the problem.
What we can do here is use the equation earlier by obtaining some 1. What is the phenotypic ratio in the F1 of a cross between a pure
alternative values from the new data given. Since there is no backward breeding white Wyandotte and pure breeding white Leghorn?
mutation, we know that N can only become n. In this case, when n rises
from 0.8 to 0.9. That must mean that N decreases from 0.2 to 0.1. ANSWER: 100% white Leghorn

Given this data, you can substitute 0.2 and 0.1 back into the earlier equation EXPLANATION
given below, Pure Breeding White Wyandotte = ppRRii
N = No(1-u)n Pure Breeding White Leghorn = PPRRII

The initial frequency No would be 0.2 and the final frequency would be 0.1. Make the cross ppRRii x PPRRII and you will get only one genotype, which is
You know u to be 10-6 from the problem earlier, so if you plug them all in, PpRRii.
you should get the following,
PP x pp = 100% Pp
-6 n
0.1 = 0.2(1 - 10 ) RR x RR = 100% RR
-6 n
0.1/0.2 = (1 - 10 ) II x ii = 100% Ii
-6
Log (0.1/0.2) / Log (1 - 10 ) = n
n = 69,314 generations Since PpRRIi is the genotype of the white Leghorn phenotype, the offspring
from such a cross would be 100% white Leghorn.

2. What would be the phenotypic ratios expected from a trihybrid white

SUPPLEMENTARY NOTES Leghorn and a white Silkie with the genotype Pprrii?

QUESTION 1: In poultry, two dominant complementary genes, P and R give

colored feathers. Another dominant gene, I, inhibits the expression of color ANSWER: 3/16 white Leghorn : 1/16 white Wyandotte : 3/16 white Silkies :

even in the presence of P and R. Thus, white Leghorn has the genotype P-R- 3/16 colored feathers : 6/16 colorless

I-; white Wyandotte are ppR-ii and white Silkie are P-rrii. Answer the
following questions based on this information. EXPLANATION
CONCEPT: Two key points are essential to understanding the problem at
hand complementary genes and suppression genes.
Complementary genes are genes that work hand-in-hand in order to create
a particular gene product or phenotype. In the case of this problem, a
dominant complementary gene interaction means that for the given
phenotype to be expressed, both gene pairs must be dominant (either
homozygous or heterzygous) in the individual. Specifically, the poultry must
have a genotype of P-R- (PPRr, PPRR, PpRr or PpRR) for it to have colored
feathers.
The third gene locus appears to house a suppression gene, which, when
expressed, prevents the expression of the phenotype coded for by other
gene pairs. For this example, a dominant suppression gene is present,
indicating that the presence of an I- (II or Ii) in the genotype prevents the
expression of color, even if the complementary genes are both dominant
(e.g. PPRRII or PPRRIi individuals would NOT have colored feathers).
PROBLEM SOLVING
Trihybrid White Leghorn: PpRrIi
White Silkie: Pprrii
Make the cross PpRrIi x Pprrii and you will get the following:
Pp x Pp = PP: Pp: pp
Rr x rr = Rr: rr
Ii x ii = Ii: ii
P(White Leghorn or P-R-I-) = PP/Pp x Rr x Ii = 3/16 White Leghorn
P(White Silkies or P-rrii) = PP/Pp x rr x ii = 3/16 White Silkies
P(White Wyandotte or ppR-ii) = pp x Rr x ii = 1/16 White Wyandotte
P(Colored Feathers or P-R-ii) = PP/Pp x Rr x ii = 3/16 Colored Feathers
P(Colorless) = 1 - (3/16 + 3/16 + 1/16 + 3/16) = 6/16 Colorless
AUTHOR'S NOTE: Since there is no specification of what genotypes like
pprrii code for, I simply assumed that they result in a different "colorless"
phenotype. If you have any other ideas as to how this problem should be
tackled, please comment on the document. Thanks!
QUESTION 2: The crossover frequency between linked genes a and b is 3%,
between a and c is 13% and between b and c is 11%
1. What is the sequence of the genes in the chromosome?
ANSWER: a--b--c
EXPLANATION
The first step to solving this kind of problem is to look at the largest
frequency values and plot that (or those if there are many) down first. You
know that a--c is 13%.
13%
a---------c
Next, you need to determine where the logical position of b is such that The b and d crossover frequency as determined by the cross ++/bd female x
they fit the a--b = 3% and b--c = 11% values. Clearly, these values are bd/bd male is 17%
SMALLER than the 13%, meaning b must be in the middle for these to be
true. 4. Does this confirm your answer to question 3?
3% 11% ANSWER: Yes, it does.
a--------b-------c
EXPLANATION
Another 2-point test cross discloses a crossover frequency of 19% between We know that b--c = 11% and that c--d = 7%, which gives a b--d of 18%. This
a and d. is very close to the b--d of 17%. Any discrepancy can be accounted for by
2. Where is gene d located in the chromosome? intereference.

ANSWER: a--b--c--d or d--a--b--c, so before a OR after d 5. Justify your answer.

EXPLANATION ANSWER: Please refer to explanations above to justify the entire genetic
Technically, from the information given above, d can be either before a or map.
after c, but we will see from the next question that it MUST be after c.
QUESTION 3: The following tetrads were produced by a cross of
3. If the crossover frequency between c and d is next found to be 7%, where a Neurospora strain that had white spores (w) and a nutritional requirement
should gene d be located in the sequence? for the amino acid arginine (arg) with a strain that had dark spore and no
arginine requirement.
ANSWER: a--b--c--d, so after c for sure. Spore pairs 1 2 3 4 5 6
1-2 w arg w arg w arg w arg w + w +
EXPLANATION 3-4 w arg w + + arg + + w + + +
Since c--d = 7% and a--d = 19% (from the previous number), we know that d 5-6 + + + arg + + + arg + arg w arg
cannot be before a because if it were, then c--d would be 32%, which isn't 7-8 + + + + w + w + + arg + arg
true! No. 58 14 15 2 1 10
1. What is the map distance between the arg locus and the centromere? AA++
++AA
ANSWER: 8 m.u. +A+A
A+A+
EXPLANATION
CONCEPT: The important thing to know here is the equation for calculating Again, I emphasize that both alleles must be adjacent to its identical
the distance between a gene and its centromere, which is given by the partner. In cases I and IV, only one pair is matched correctly, while the
figure below: members of the other pair are separated from each other.
Gene-to-Centomere Distance = [(Second Division Segregation)] Total x
100% PROBLEM SOLVING: Determine which columns show second-division
segregants. From the explanation above, it can be ascertained that columns
What then is a first-division or second-division segregant? 2 and 4 are second-division segregants. Applying the formula, the answer
should then be,
Looking at just one gene, determine if the same alleles are both adjacent to
each other. IF they are, then they are first-division segregants. (Example [ (16)] 100 x 100 = 8 m.u. or cM
below)
2. What is the map distance between the w and arg loci?
A +
A or + ANSWER: 23.5 m.u. or CM
+ A
+ A EXPLANATION

As for second-division segregants, these can be determined by those tetrads
wherein the same alleles are not adjacent to each other or when one of the
alleles isn't adjacent to its pairs.
CONCEPT: It's important in this type of question to define three terms,
namely parental ditype (PD), non-parental ditype (NPD), and tetratypes (TT).
First off, parental ditypes are offspring with the exact same gene order as
the parents, indicating there was no crossing over. Non-parental ditypes
result from crossing over between the four-strands, giving you two gene
orders that are matched up but not of the parental type. Lastly, tetratypes EXPLANATION
are offspring whose tetrads show four different gene orders. These
concepts will be put into use in the problem solving section below. Note CONCEPT: Note that linked genes are found on the same chromosome, but
that the formula for calculating gene distance in tetrad analysis is given by on which arm of the chromosome each resides is a whole different story
the following, (and problem solving number, unfortunately). This requires calculating the
distance between each gene and the centromere and the distance between
Gene Distance = [( TT) + 3 NPD] Total x 100% both genes. After which, a map must be constructed to determine where
the centromere lies along the chromosome. If the centromere is between
the two genes, then they are on different arms. If they lie to one or the
PROBLEM SOLVING: other side of the chromosome, then they are on the same arm.
Using the definitions above, we can place each column under one of the
three categories: PROBLEM SOLVING: (From the problems earlier)
w--arg distance = 23.5 m.u. or cM
Parental Ditype (DP) = 1 arg--centromere distance = 8 m.u. or cM
Non-Parental Ditype (NDP) = 5
Tetratypes (TT) = 2, 3, 4 and 6 We then calculate for the w--centromere distance to determine the map.

Tetratypes = 14 + 15 + 2 + 10 = 41 w--centromere = [ (second-division segregant)] Total x 100%

Non-Parental Ditypes = 1
Total Individuals = 100 From the table earlier, we note that for the w gene, only columns 3, 4 and 6
are second-division segregants, totaling 27 individuals.
Gene Distance = [ (41) + 3(1)] 100 x 100%
Gene Distance = 23.5 m.u. or cM w--centromere = [ (27)] 100 x 100% = 13.5 m.u. or cM

3. Are the arg and w loci on the same or different arms of the chromosome? Taking the largest frequency first, we map w and arg on the map.

ANSWER: Different
 23.5 m.u. The reciprocal pairs of classes with the most representatives are
w-----------------arg those resulting from no crossovers and can tell us the genotypes of
the original parents.
Note that the distance of w--centromere and arg--centromere is smaller and
actually sum up to roughly 23.5, indicating that the centromere is in the SRL/SRL x srl/srl
middle. F1: SRL/srl

13.5 m.u. 8.0 m.u.
w-----------------------centromere----------------------arg
8.0 m.u. + 13.5 m.u. = 21.5 m.u. (almost equal to 23.5 m.u.)
In the Chinese primrose, slate-colored flower is recessive to blue flower; red
stigma is recessive to green stigma; and long style is recessive to short style.
The F1 of a cross between two true-breeding strains, when testcrossed,
gave the following progeny:
2. Make a map of these genes showing gene order and distance
between them.
The reciprocal pairs of classes representing the results of double crossing-
over have the least number of representatives and order of the genes can
be determined from these.
Srl/srl and sRL/srl

slate, green, short 27 slate, green, long 427 The gene pair that has changed its position relative to the other two
pairs of alleles is the middle gene.
slate, red short 85 slate, red, long 977

blue, red, short 402 blue, green, short 960 Order of genes: RSL or LSR
F1 testcross: RSL/rsl x rsl/rsl
blue, green, long 95 blue, red, long 27

Distance between R and S:

(829 + 54)/3000 x 100% = 29.43 map units
1. What were the genotypes of the parents in the cross of the two
true-breeding strains?
Distance between S and L:
(180 + 54)/3000 x 100% = 7.8 map units
 Map: r_____________s_________l Coefficient of confidence compares the frequency of observed and expected
29.4 7.8 DCOs.

Expected frequency of DCO = 0.21 x 0.13 = 0.027

3. Derive the coefficient of confidence for interference between these
genes. C = O E, therefore the frequency of the observed DCO is equal to the C
multiplied by the frequency of the expected DCO.
Coefficient of confidence = frequency of observed DCO (O)
(O= C x E, 0.6 x 0.027 = 0.016 or 0.008 of each type, 16/8 per 1000)
frequency of expected DCO (E)
Frequency of SCO in region 1 = 21/100 0.016 = 0.194 or 194/1000
O = (54/3000) x 100% = 1.8%
Frequency of SCO in region 2 = 13/100 0.016 = 0.114 0r 114/1000
E = 29.4% x 7.8% = 2.3%
The DCOs need to be subtracted from the calculation of singles, because
C = 1.8/2.3 = 0.78 this number will be added in when the map distances are tallied from the
raw data.

In other words, 78% of the expected DCO did indeed take place; there were ABC 338 Abc 97 ABc 57 AbC 8
only 22% interference (I = 1 - C).
abc 338 aBC 97 abC 57 aBc 8

This figure shows a genotype of a trihybrid cross together with the known
In Drosophilia, the genes ct (cut wing margin), y (yellow body), and v
map distances for the two regions. Assume the coefficient of confidence for
(vermillion eye color) are X-linked. Females heterozygous for all three
the DCO is 0.6. Determine the type and frequencies of the gametes
markers were mated with wild-type males and the following progeny were
produced by this trihybrid, and the genotypes expected in a sample of 1000
obtained:
progeny.
ct y v 4 + y v 331
a 21 b 13 c
ct y + 93 + y + 66
ct + v 54 + + v 97 Determine the order of the three genes and construct a linkage map
showing the genetic distances between adjacent genes.
ct + + 349 + + + 6

1. What was the genotype of the female parent?

2. What is the order of the genes?
3. Draw the genetic map of the genes.
4. Calculate the interference between the genes.

In corn, the alleles C and c result in colored versus noncolored seeds, Wx

and wx in nonwaxy versus waxy endosperm, and Sh and sh in plump versus
shrunken endosperm. When plants grown from seeds heterozygous for
each of these pairs of alleles were testcrossed with plants from colorless,
waxy, shrunken seeds, the progeny seeds were as follows:

Colorless, nonwaxy, shrunken 84

Colorless, nonwaxy, plump 974

Colorless, waxy, shrunken 20

Colorless, waxy, plump 2349

Colored, waxy, shrunken 951

Colored, waxy, plump 99

Colored, nonwaxy, shrunken 2216

Colored, nonwaxy, plump 15

AY 2011-2012