APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Jan. 2011, p. 163171 Vol. 77, No.

1
0099-2240/11/$12.00 doi:10.1128/AEM.01673-10
Copyright 2011, American Society for Microbiology. All Rights Reserved.

Real-Time PCR Assay To Differentiate Listeriolysin S-Positive and

-Negative Strains of Listeria monocytogenes
Evelyn M. Clayton,1 Colin Hill,1,2* Paul D. Cotter,2,3* and R. Paul Ross2,3
Department of Microbiology, University College Cork, Cork, Ireland1; Alimentary Pharmabiotic Centre, Cork, Ireland2; and
Teagasc, Moorepark Food Research Centre, Fermoy, County Cork, Ireland3
Received 13 July 2010/Accepted 29 October 2010

Due to the severity of the food-borne infection listeriosis, strict legislation governs the detectable and
permissible limits at which Listeria monocytogenes is permitted in foods. These requirements, coupled with the
ubiquitous nature of L. monocytogenes strains and the potential for epidemic outbreaks, mean that the

Downloaded from http://aem.asm.org/ on January 21, 2017 by guest

pathogen can devastate affected sectors of the food industry. Although almost all L. monocytogenes strains have
the potential to cause listeriosis, those implicated in the vast majority of epidemics belong to a subset of strains
belonging to evolutionary lineage I. It has been established that a significant proportion of these strains,
including those implicated in the majority of outbreaks, produce an additional hemolysin, designated listerio-
lysin S (LLS), which may be responsible for the enhanced virulence of these strains. In order to ultimately
establish this definitively, it is important to first be able to rapidly discriminate between LLS-positive and
-negative strains. Here, after essential genes within the LLS-encoding cluster, Listeria pathogenicity island 3,
were identified by deletion mutagenesis, a real-time PCR assay which targets one such gene, llsX, was developed
as a means of identifying LLS-positive L. monocytogenes. The specificity of the assay was validated against a
panel of 40 L. monocytogenes strains (20 of which were LLS positive) and 25 strains representative of other
Listeria species. Furthermore, 1 CFU of an LLS-positive strain per 25 g/ml of spiked foods was detected in less
than 30 h when the assay was coupled with culture enrichment. The detection limit of this assay was 10 genome
equivalents.

The Gram-positive intracellular pathogen Listeria monocy-
togenes is the etiological agent of listeriosis, a predominantly
food-borne infection with well-defined risk groups, which in-
clude neonates, pregnant women, the elderly, and immuno-
compromised individuals. Initial manifestations of the infec-
tion are often nonspecific (e.g., influenza-like symptoms and
gastroenteritis), with more severe clinical consequences (e.g.,
septicemia, meningitis, encephalitis, perinatal infections, and
abortion) developing in susceptible populations (6, 18, 24, 36,
47, 56). Related outbreaks are most commonly associated with
a diverse range of ready-to-eat (RTE) meats, dairy products,
vegetables, and fish (3, 12, 16, 46, 53, 54). Although the inci-
dence of listeriosis appears to be decreasing in the United
States and other industrialized countries, increases have been
reported for some European countries (5, 11, 28, 30, 32, 34).
Occurrences of sporadic and epidemic cases are fortunately
rare compared to those of other food-borne diseases. How-
ever, as a consequence of its pathogenicity, L. monocytogenes
carries the highest hospitalization rates among known food-
borne pathogens (91%), with additional long-term sequelae
reported in many cases (26). In the United States, 20% of all
clinical infections result in death, and related fatalities are
estimated to reach 500 per annum (5). Indeed, after salmo-
nellosis, listeriosis is the second most frequent cause of
* Corresponding author. Mailing address for Colin Hill: Depart-
ment of Microbiology, University College Cork, Cork, Ireland.
Phone: 353-21-4901373. Fax: 353-21-4903101. E-mail: c.hill@ucc.ie.
Mailing address for Paul D. Cotter: Teagasc, Moorepark Food
Research Centre, Fermoy, Cork, Ireland. Phone: 353-25-42694.
Fax: 353-25-42340. E-mail: paul.cotter@teagasc.ie.
Published ahead of print on 12 November 2010.
food-borne infection-related deaths in Europe and the
United States, and in addition to the associated human costs,
such outbreaks also have considerable financial implications
for the food industry (1). Unfortunately, L. monocytogenes is
especially problematic due to its ubiquitous nature, intrinsic
physiological resistance to various environmental stresses, abil-
ity to grow at a wide range of temperatures (0 to 45C), and
propensity to persist within food processing centers and retail
and distribution outlets for long periods of time (14, 52). In
light of the high fatality rates associated with the infection (6),
strict legislation governs both the detection limits and permis-
sible levels of L. monocytogenes in RTE foods. The U.S. Food
and Drug Administration (FDA) maintains a zero-tolerance
policy (absent in 25 g of food), while in Europe, legislation (no.
2073/2005) imposes a zero-tolerance policy in respect to cer-
tain foods destined for high-risk consumer groups and other-
wise limits these bacteria to below 100 CFU/g (12a). As a
consequence, large quantities of foods are deemed unsuitable
for human consumption each year and destroyed. Unsurpris-
ingly, the associated economic burden is significant and is fur-
ther compounded by product recalls, which incur annual costs
that are estimated to reach $1.2 to 2.4 billion in the United
States (23).
However, given that not all L. monocytogenes strains have an
equal capacity to cause disease, the application of stringent
zero-tolerance policies to all L. monocytogenes strains is ques-
tionable. Indeed, more than 90% of human listeriosis cases are
caused by three specific L. monocytogenes serotypes, belonging
to lineage I (i.e., serotypes 1/2b and 4b) and lineage II (i.e.,
serotype 1/2a), with serotype 4b implicated in the majority of
listeriosis epidemics (17, 29, 38). Thus, if assays which could

163
164 CLAYTON ET AL.
differentiate between high- and low-virulence potential strains
of L. monocytogenes were to be developed, one could envisage
the introduction of different tolerance levels reflective of the
virulence of the strain, in a manner analogous to that which
already exists for Escherichia coli strains with a high virulence
potential (e.g., E. coli O157:H7). However, the lack of a mo-
lecular explanation for the enhanced virulence of certain
strains has hampered previous developments along these lines
(9). Recently, premature stop codon (PMSC) mutations in the
inlA gene, which encodes the key virulence factor internalin A
(InlA), have been reported worldwide (13, 19, 27, 41, 45). InlA
facilitates the uptake of L. monocytogenes by epithelial cells
that express the human isoform of E-cadherin, and mutations
of InlA appear to be responsible for attenuated mammalian
virulence (40, 55). Such PMSC mutations have been identified
among serotypes of lineages I and II, have seldom been found
in epidemic clone strains of serotype 4b, and have thus pro-
vided a molecular marker for single-nucleotide polymorphism
(SNP) genotyping assays (55). Alternative explanations exist in
that it has also been established that a subset of strains of
lineage I L. monocytogenes produce an additional virulence
factor known as listeriolysin S (LLS), which is a cytolysin be-
longing to the extended family of streptolysin S (SLS)-like
peptides (8). SLS factors are associated predominantly with
group A streptococci, for which they significantly enhance the
pathogenicity of carrier strains by contributing to cytotoxicity,
inflammatory activation, and polymorphonuclear neutrophil
(PMN) resistance, thereby playing a role in necrosis and sys-
temic spread (42). SLS-like factors are also present in some of
the most notorious Gram-positive pathogens, including Staph-
ylococcus aureus and Clostridium botulinum. Studies have dem-
onstrated that LLS plays a role in the survival of L. monocy-
togenes in PMNs and also contributes to its virulence in the
mouse model (8). It has been noted that the production of LLS
is induced by oxidative stress, and it has been suggested that
this pattern of induction could enhance the ability of LLS-
positive L. monocytogenes to escape from the phagosome of
macrophages, a key event in L. monocytogenes pathogenicity
(8). The LLS cluster, designated Listeria pathogenicity island 3
(LIPI-3), has been identified only in lineage I strains and most
notably in several strains which have been implicated in epi-
demic outbreaks. Indeed, relatively few outbreak strains ana-
lyzed to date lack LIPI-3 (8). Should it be definitively estab-
lished that LLS is responsible for the enhanced virulence of a
subset of lineage I strains, the ability to distinguish between
LLS-positive and LLS-negative strains on the basis of the pres-
ence or absence of the associated genes would be highly de-
sirable.
In this study, the essential nature of several genes within
LIPI-3 with respect to LLS production was established through
deletion mutagenesis. A real-time PCR (RT-PCR) assay em-
ploying fluorescence resonance energy transfer (FRET) hy-
bridization probe technology was employed to detect one such
gene, the llsX gene, as a means of identifying LLS-positive L.
monocytogenes strains. When coupled with culture enrichment,
this assay enabled the detection of as low as 1 CFU of an
LLS-positive L. monocytogenes strain per 25 ml/g of milk or
cooked ham in less than 30 h.
APPL. ENVIRON. MICROBIOL.
MATERIALS AND METHODS
Bacterial strains, culture media, and growth conditions. Table 1 lists the panel
of 40 L. monocytogenes strains used in this study, 20 of which were LLS positive
(8). A further 25 strains representing other Listeria species (9 strains of L.
innocua, 6 of L. seeligeri, 5 of L. ivanovii, 1 of L. grayi, 3 of L. welshimeri, and 1
of L. murrayi) are listed in Table 2. The streptolysin S producer Streptococcus
pyogenes MGAS5005 and Staphylococcus aureus RF-122, which possesses genes
potentially encoding stapholysin S, were also included. All strains were obtained
from the Food Microbiology Microbial Collection (University College, Cork,
Ireland) and were stored at 80C in 40% glycerol and cultured at 37C for 16 h
before use. Listeria spp. and S. aureus were cultured in brain heart infusion (BHI)
broth/agar (Oxoid, Hampshire, United Kingdom), and Streptococcus pyogenes
was cultured in tryptone soy broth (Oxoid) supplemented with 0.6% yeast extract
(Difco, Detroit, MI) (TSB-YE).
Genomic DNA isolation and quantification. Unless otherwise stated, genomic
DNA was extracted with phenol/chloroform/isoamyl alcohol (25:24:1) per the
methodology described by Hoffman and Winston (21) with some modifications.
Downloaded from http://aem.asm.org/ on January 21, 2017 by guest
Single colonies were used to inoculate 10-ml volumes of BHI broth. Following
overnight incubation at 37C, cells (1.5 ml) were harvested by centrifugation at
10,000 g. Cells were resuspended in 200 l of lysis buffer (2% Triton X-100,
1% SDS, 100 mM NaCl, 10 mM Tris-HCl [pH 8], 1 mM EDTA), 300 l of
acid-washed beads, and 200 l of phenol-chloroform/isoamyl alcohol, and the
mixture was vortexed for 5 min. The aqueous phase was transferred to a sterile
tube, and the DNAs were precipitated with 600 l of cold 96% ethanol and 20
l of 5 M ammonium acetate at 20C for several hours. Following precipita-
tion, DNAs were pelleted by centrifugation, washed in 70% ethanol, air dried
and, finally, resuspended in 50 l of PCR-grade water and stored at 20C. All
reagents were obtained from Sigma, St. Louis, MO. A rapid DNA purification
method using Chelex-100 chelating ion exchange resin (Bio-Rad Laboratories,
Hercules, CA) was employed to facilitate colony PCR when appropriate. For
this, approximately 20 colonies were suspended in a solution of Chelex-100 (5%
[wt/vol] sterile distilled H2O [dH2O]), heated in a boiling-water bath for 12 min
and rapidly cooled on ice. Clear cell lysates containing PCR-ready nucleic acid
templates were collected after centrifugation at 15,000 g for 10 min and stored
at 4C.
Deletion mutagenesis by double-crossover homologous recombination. A de-
letion mutagenesis strategy was employed to investigate the contribution of the
individual genes of the LIPI-3 cluster in L. monocytogenes F2365LLSChly by
following the methodology described by Cotter et al. (8). Deletion mutants were
generated using a splicing-by-overlap-extension (SOE) procedure (22). Briefly,
two PCR fragments from the DNA flanking each gene were generated with the
oligonucleotide primer pairs soeA/soeB and soeC/soeD (Table 3). The products
were mixed in a 1:1 ratio and combined by SOE PCR using the oligonucleotide
pair soeA and soeD. The resultant product was cloned into the temperature-
sensitive shuttle vector pKSV7, and the spliced product was introduced into the
L. monocytogenes genome in place of the intact gene through double-crossover
homologous recombination as previously described (8). The impact of each
deletion was assessed by spotting 10 l of whole-cell suspensions onto Columbia
blood agar (Oxoid) containing 5% defibrinated horse blood (TCS Biosciences,
Buckingham, United Kingdom) and 1 mU/ml sphingomyelinase (Sigma).
PCR primer pairs and FRET hybridization probes for real-time PCR. Oligo-
nucleotide primers and a FRET probe pair targeting the llsX gene of L. mono-
cytogenes strain F2365 (National Center for Biotechnology Information [NCBI]
reference sequence number NC_002973.6; gene locus lmof2365_1115) were de-
signed by following published guidelines (7) and synthesized by Tib Molbiol
(Berlin, Germany) (Table 4). The primer pair llsXF and llsXR amplify a 200-bp
fragment of llsX, and the hybridization probe pair llsXFL and llsXLC recognize
internal sequences within the amplified product. The probes are separated by a
single nucleotide which allows a strong FRET signal to occur and are designed
to anneal to the antisense strand due to a lower number of guanine bases. The
donor probe llsXFL was labeled with fluorescein at its 3 end, the acceptor probe
llsXLC was labeled with light cycler 670 (LC 670) at its 5 end, and subsequent
fluorescence was measured with the Cy5 channel of the LightCycler 480 instru-
ment (Roche Diagnostics, Mannheim, Germany).
L. monocytogenes llsX real-time PCR assay. Real-time PCR amplification was
performed using LightCycler FastStart DNA HybProbe master mix (Roche).
Each PCR incorporated 2 l of template DNAs, 10 LightCycler buffer (with
the magnesium chloride adjusted to 3 mM), 0.3 M hybridization probes, and 0.5
M primers and adjusted to a final volume of 20 l with nuclease-free PCR-
grade water (Roche). The cycling parameters included an initial denaturation
step of 95C for 10 min followed by 45 cycles of denaturation at 95C, annealing
at 60C, and elongation at 72C for 10 s each. Subsequent analysis was carried out
VOL. 77, 2011 LLS-POSITIVE AND -NEGATIVE L. MONOCYTOGENES STRAINS 165

TABLE 1. Listeria monocytogenes isolates screened by the llsX gene real-time PCR assay
Listeriolysin llsX PCR
Strain no. Equivalent name(s) Source Lineage Serotype
S status result

33104a F2365, JI-119, TS43 California outbreak, 1985 I 4b

33386a NI-225, H7550 Clinical (U.S. outbreak, 1998-1999) I 4b
33411b TS50, L.4760, FSL N3-022 Food (Halifax, Canada, outbreak, 1981) I 4b
33410b F4565, FSL N3-008 Clinical (Los Angeles, California, I 4b
outbreak, 1985)
33233a H7858 Food (U.S. outbreak, 1998-1999) I 4b
33423a G6003 Food I 1/2b
33186a 20674-01 Animal I 1/2b
33176a 20240-954 Animal I 1/2b
33126a 7034 Animal I 1/2b
33116 ATCC 19117 Animal I 4d
33083a F1109 Food I 4b
33068a 8058 Animal I 1/2b
33015a 12375 Unknown I 4b

Downloaded from http://aem.asm.org/ on January 21, 2017 by guest

33008a RM2387 Food I 4b
33120 ATCC 19118 Animal I 4e
33420b NI-227, H7738 Food (U.S. outbreak, 1998-1999) I 4b
33032a OB001186 Food I 1/2b
DPC-4608, SLCC1694 Unknown I 1/2b
CD1078c Chicken I 1/2b
SLCC4157 Cow milk I 4d
33413a Ts45 Food (United Kingdom outbreak, I 4b
1988)
CD749c Ground beef I Non-4
CD1198c Ground turkey II Non-4
CD1121c Ground beef I 4b
CD1061c Pork sausage II Non-4
CD1059c Pork sausage II 1/2
33226a LMB0456 Unknown II 3c
33225a LMB0455 Unknown II 3a
33115a 93-500 Arabian oryx III 4c
33090a 7675 Animal I 1/2b
33077a 98-18140 Bovine tissue III 4b
33028a OB001102 Food I 1/2b
33013a ScottA Clinical (Massachusetts outbreak, 1983) I 4b
33007a RM2218 Food I 4b
CD1028c Pork sausage II Non-4
NCTC7973 Clinical II 1/2a
CD243c Silage II 1/2a
CD241c Silage II 3
CD1742c Pork sausage II Non-4
F5817 Clinical (Massachusetts outbreak, 1983) I Non-4
a
Strain acquired from Todd Ward (Agricultural Research Service, U.S. Department of Agriculture).
b
Strain acquired from Martin Wiedmann (International Life Sciences Institute).
c
Strain acquired from Catherine Donnelly (Department of Nutrition and Food Sciences, University of Vermont).

using the absolute quantification/second-derivative-maximum method of the
LightCycler software. Genomic DNA from L. monocytogenes strain F2365 served
as a positive control for llsX, and a negative control, in which the template was
replaced with nuclease-free PCR-grade water, was included in each run.
Culture enrichment of food samples. Retail samples of pasteurized milk and
cooked ham were investigated in this study. A two-step enrichment process using
Fraser broth was used to improve the sensitivity of Listeria detection by following
the methodology described by OGrady et al., with some modification (43). Two
samples of each food (25 g/ml) were prepared in three independent experiments
as follows: one sample served as a control, and the second was spiked with
approximately 1 CFU of an overnight culture of L. monocytogenes strain F2365,
i.e., 100 l of a 108 dilution of an overnight culture of L. monocytogenes strain
F2365 which had been freshly subcultured over 5 h. Plate count assays on BHI
agar determined an average CFU content of 10 per ml. Samples were homoge-
nized for 2 min in sterile plastic Stomacher filter bags (Seward, Norfolk, United
Kingdom) containing 225 ml of half Fraser broth (Oxoid). The samples were
incubated for 22 h at 30C in 500-ml sterile conical flasks with shaking at 200 rpm
(water bath model SW22; Julabo, Seelbach, Germany). A secondary enrichment
was then performed whereby 100 l of each preenrichment sample was trans-
ferred into 10 ml of full-strength Fraser broth and incubated at 37C for 4 h with
shaking as before. Crude DNA templates were prepared for real-time PCR
analysis from 1.5-ml volumes of secondary enrichment broth as follows. Cell
pellets were collected after centrifugation, washed three times in 300 l of
washing buffer (75 mM NaCl, 25 mM EDTA, 20 mM Tris [pH 7.5]), and
resuspended in 200 l of a 5% Chelex-100 solution containing 0.4 mg/ml pro-
teinase K (Roche). Suspensions were incubated for 30 min at 56C and then
boiled, and the clear cell lysates containing the PCR-ready nucleic acid template
were collected after centrifugation as described above. In parallel, the secondary
enrichment broth was streaked onto Listeria selective agar (LSA; Oxoid).
RESULTS
Deletion of genes within the LIPI-3 gene cluster. Previous in
silico investigations have suggested that the presence of Rho-
independent terminators flanking the lls gene cluster (llsA,
llsG, llsH, llsX, llsB, llsY, llsD, and llsP) mark the boundaries of
LIPI-3 (8). It was also suggested that LIPI-3 was acquired
during the evolution of lineage I isolates and noted that a
number of these isolates have apparently undergone reductive
166 CLAYTON ET AL. APPL. ENVIRON. MICROBIOL.

TABLE 2. Other Listeria species screened by the llsX real-time PCR assay
llsX PCR
Species Strain Equivalent name(s) Source
result

L. innocua FH2333a Lettuce

FH1890a Uncooked sausage
FH2070a Uncooked hamburgers
FH2117a Ham
FH2332a Uncooked hamburgers
FH2327a Salad/peppers
FH2381a Frozen sausage rolls
CD692b Dairy plant environment
SLCC5326 Unknown

L. ivanovii CD588b NB U4-1 Dairy plant environment

CD291b LA29 Brie cheese
CD165b Unknown
CD293b LA31 Brie cheese

Downloaded from http://aem.asm.org/ on January 21, 2017 by guest

CD264b Silage Silage

L. grayi CD671b ATCC 25400 Corn stalks

L. seeligeri CD944b Dairy plant environment

CD931b Dairy plant environment
CD930b Dairy plant environment
CD943b Dairy plant environment
CD166b ATCC 35967 Soil
FH2062a Breakfast (cooked)

L. welshimeri CD114b ATCC 35897 Plant

FH1874a Omelette
FH1968a Caesar salad

L. murrayi F12 ATCC 25403, CLIP12517, NCTC10814 Corn stalks and leaves
a
Strain acquired from the Public Health Microbiology Laboratory, St. Finbarrs Hospital (Douglas, Cork, Ireland).
b
Strain acquired from Catherine Donnelly (Department of Nutrition and Food Sciences, University of Vermont).

genome evolution, resulting in the loss of LIPI-3. Indeed,
genes flanking the presumptive island (e.g., the lmof2365_1111
and lmof2365_1120 genes) are found in tandem in some LIPI-
3-negative strains (8). In silico analysis of the cluster has re-
vealed similarities with the clusters responsible for production
of SLS, a potent bacteriocin-like streptococcal cytolytic pep-
tide which undergoes posttranslational heterocycle formation,
and of the bacteriocin microcin B17 (33, 57). For example, the
putative ATP binding cassette (ABC) transport machinery
coded by the llsGH genes is represented by three open reading
frames (ORFs) (sagGHI) in the SLS-associated gene cluster
(e.g., Streptococcus pyogenes MGAS8232, NCBI sequence ref-
erence number NC_003485.1). The llsB and llsD genes resem-
ble sagB and sagD, respectively (8), llsP is thought to be the
equivalent of sagE (18% identity and 36% similarity), and llsY
shares a 19.5% identity and 37.6% similarity with sagC. In
contrast, the llsX gene does not share any homology to any
known gene.
A series of deletion mutants were generated to establish
which of these genes are required for LLS production (Fig. 1).
These deletions were generated in the L. monocytogenes
F2365LLSChly background (8). In this strain, the lls genes are
constitutively expressed through replacement of the inducible
PLLS promoter with the constitutive highly expressed Listeria
promoter (PHELP; LLSC), thereby facilitating an assessment of
hemolytic activity on blood agar (8). This assessment of LLS-
associated hemolytic activity is facilitated by the absence of the
listeriolysin O (LLO)-encoding hly gene in this strain, as the
hemolytic activity of LLO had the potential to mask that of
LLS (8). In addition to the previously generated llsB version
of this strain (8), we also created a number of additional
derivatives of F2365LLSChly in which the llsG, llsH, llsX, llsY,
llsD, llsP, and lmof2365_1120 genes were independently de-
leted. Blood agar-based assays with this selection of mutants
established that the six lls genes located immediately down-
stream of the structural gene llsA (i.e., llsG-llsD) are essential
for LLS activity, whereas the deletion of the llsP gene had no
effect on the hemolytic phenotype. Similarly, deletion of the
downstream lmof2365_1120 gene, predicted to encode an
AraC-like regulatory protein, had no effect on LLS activity.
Specificity of the L. monocytogenes llsX-specific real-time
PCR assay. While a number of genes were established to be
essential for LLS production, it was the llsX gene that was
chosen as a strain-specific diagnostic marker for LIPI-3, since
no gene equivalent exists among other sag-like gene clusters or
indeed in the NCBI database (8). The putative LlsX protein is
a potential membrane spanning signal peptide of unknown
function. Basic local alignment search tool (BLAST) analysis
was used to confirm that the PCR primers and FRET hybrid-
ization probes which were designed to target a 200-bp region of
the gene did not correspond to any other microbial DNA
sequence in the nucleotide databases (2). Initial optimizations
of the real-time PCR assay were performed with purified DNA
from the reference strain L. monocytogenes F2365 (in which
VOL. 77, 2011 LLS-POSITIVE AND -NEGATIVE L. MONOCYTOGENES STRAINS 167

TABLE 3. SOE primers used for deletion mutagenesis studies

LIPI-3 gene Primer designation and sequence

llsG ............................................................................................soeA, (EcoRI)GACTGCAGAATGTGATAGGATG

soeB, ATGCACATGCACCTCATAAC
soeC, GTTATGAGGTGCATGTGCATGCAGTGAACAGGAGGTACTGA
soeD, (BamHI)CTGGATCCAAAATATTCTAATC

llsH ............................................................................................soeA, (XbaI)AATCTAGACAACGAAAGTTTTG

soeB, CTTGTCCATAAATAACTCAT
soeC, CATGAGTTATTTATGGACAAGTTTATTATACTCAAGGTATAG
soeD, (SmaI)TTCCCCGGGTCGATCATTTTGCTGTT

llsX.............................................................................................soeA, (EcoRI)TAAGAATTCCCGGATATTGATGC
soeB, AGATTACAAACAATCCTTTC
soeC, GAAAGGATTGTTTGTAATCTTCGACTATGAGAAAAAAGGC
soeD, (SmaI)GTACCCGGGCTTTGCTCAAGCAC

Downloaded from http://aem.asm.org/ on January 21, 2017 by guest

llsY.............................................................................................soeA, (EcoRI)TTGAATTCTCTAGATGTAGAT
soeB, GTCTGCGTTCCTATTCTAATATC
soeC, CGATATTAGAATAGGAACGCAGACCTAAAGGAGCTGATGAGTAGTG
soeD, (SmaI)TCACCCGGGCTAAAAATAATCCTGTCC

llsD ............................................................................................soeA, (XbaI)CATCTAGATTGATGTTTGTTC

soeB, AATAGGGTAAGAACTAGAGCC
soeC, GGCTCTAGTTCTTACCCTATTATGAAGAAATTGGAGGTGTGGT
soeD, (SmaI)CTTCCCGGGCAGGAAACCATACAATAC

llsP .............................................................................................soeA, (XbaI)GTTCTAGATAATTTGGATGATA

soeB, GCATACCTGGAAATAATGTG
soeC, CACATTATTTCCAGGTATGCGAGAACCACCGTAATTGGTAA
soeD, (SmaI)TAACCCGGGTGAGCAGCAATTTCCTC

lmof2365_1120 .........................................................................soeA, (XbaI)TTTCTAGAGTTCGTACTAGTA

soeB, CGTTCCCCCTCCTTTTTAGAGCA
soeC, TGCTCTAAAAAGGAGGGGGAACGAACAATATTGTTTGACTATG
soeD, (SmaI)AATCCCGGGTCTAAATCTTCTACCCC

LIPI-3 was first identified [8]) to ensure specific amplification
of llsX. Accordingly, amplification of a single product 200 bp in
length was verified by agarose gel electrophoresis (not shown).
No amplification was detected from Streptococcus pyogenes
MGAS5005 and S. aureus RF-122, which contain related gene
clusters (streptolysin S and the potentially encoding stapholy-
sin S). A rapid screening method, in which Chelex-100 chelat-
ing ion exchange resin was used to extract the PCR-ready
template directly from cell colonies, was then employed to
evaluate the specificity of the real-time PCR assay. The capac-
ity of the PCR to detect L. monocytogenes strains that harbor
the llsX gene was demonstrated against a panel of 65 Listeria
strains. All LLS-positive L. monocytogenes strains generated
good amplification curves. Strains CD1078 and DPC4608/
SLCC1694, which were previously reported to be LLS negative
(8), are also LLS positive by RT-PCR which is likely due to the
TABLE 4. Oligonucleotide primers and hybridization probes used
in the llsX real-time PCR assay
Primer Sequence
llsXF TTATTGCATCAATTGTTCTAGGG
llsXR CCCCTATAAACATCATGCTAGTG
llsXFL ACTCTTTTAATGTGCCATCATTCA
TGTG
llsXLC ATGTAACCTAAACCAATAGCCACA
AAGCA
enhanced sensitivity of real-time PCR compared to that of
conventional PCR. No amplification was generated from LLS-
negative L. monocytogenes or a selection of other Listeria spe-
cies.
Sensitivity of the assay. The quantification and detection
limits of the real-time PCR assay were determined using pu-
rified genomic DNA isolated from L. monocytogenes F2365.
Amplification reactions included a range of duplicated dilu-
tions of DNA equivalent to 100,000 target molecules down to
1 target molecule (estimated by a relative genome size of 2.94
fg [50]). DNA concentrations were verified by Nanodrop anal-
ysis (Thermo Scientific). Logarithms of DNA concentrations
were plotted against their relative crossing points, which were
determined by the second derivative maximum method. PCR
efficiency (E) was calculated from the slope of the standard
curve by the formula E 101/slope, the optimal value of which
is 2.0 (when the slope of the regression curve is 3.32), rep-
resenting 100% doubling with each cycle. The E value, calcu-
lated over five logs representing 100,000 to 10 target cell equiv-
alents, was 1.805 (or 90.25% doubling with each PCR cycle),
Position and the slope was 3.9, indicating that the assay is suitable to
3557
detect the llsX gene when 10 cells or more are present and
213235 therefore can be employed for quantification purposes (Fig. 2).
109136 Adaptation of the real-time PCR assay for use in food. The
practical usefulness of the real-time PCR assay was deter-
79107 mined by assessing its ability, when combined with culture
enrichment (by following the methods described by OGrady
168 CLAYTON ET AL. APPL. ENVIRON. MICROBIOL.

FIG. 1. Arrangement of the proposed listeriolysin S gene cluster mapped from L. monocytogenes strain F2365 (NCBI reference sequence
number NC_002973.6 [lmof2365_1111-lmof2365_1120]) using the Clone Manager program (version 7; Science and Educational software, NC).
Hemolysis of Columbia blood agar (5% defibrinated horse blood) of F2365chly in which the lls genes are under the control of the constitutive

Downloaded from http://aem.asm.org/ on January 21, 2017 by guest

highly expressed Listeria promoter (PHELP). Locations (I to VIII) of the oligonucleotide primer pair binding sites (soeA/soeD) used to delete each
of the lls genes (llsG-lmof2365_1120) by splicing by overlap extension PCR. The resulting hemolytic phenotype of each deletion is indicated
underneath. , deletion mutant previously created (8).

et al., with slight modifications [44]), to detect LLS-positive L.
monocytogenes in retail samples of RTE foods (pasteurized
milk and cooked ham). This approach taken by OGrady and
colleagues compares well with the current ISO standard
method 11290-1 and has been proposed by these researchers as
a potential alternative for the rapid detection of L. monocyto-
genes in food (44). The culture enrichment component of the
rapid method is based on the ISO standard and includes 24 h
of incubation in half-Fraser broth and 4 h of incubation in
Fraser broth followed by DNA extraction and real-time PCR
detection. The method can be performed in 2 working days
compared to 7 days for the ISO standard method. We used
Chelex-100 resin as a rapid means of extracting real-time PCR-
ready template DNAs and adapted the method to detect the
llsX gene of LIPI-3. Following culture enrichment, the assay
enabled the detection of low levels of L. monocytogenes (1
CFU per 25 g/ml). When coupled with real-time PCR and
Chelex-100 PCR-template purification, it was possible to re-
duce the time taken for culture enrichment from the recom-
mended 72 h to 26 h. The nonspiked control samples were
consistently negative.
DISCUSSION
To address the extensive labor and time required for the
detection and identification of L. monocytogenes by conven-
tional means, a number of rapid and highly sophisticated real-
time PCR-based technologies have been developed (4, 44, 48,
50, 51). More specifically, such technologies are attractive due
to the fact that culture-based methods, which typically involve
selective enrichment, culturing on selective media, and a bat-
tery of biochemical tests and serology, can take from 5 to 10

FIG. 2. Real-time PCR amplifications of serial dilutions of L. monocytogenes F2365 DNA equivalent to 100,000 to 10 target molecules. Solid
squares, 100,000 cell equivalents; solid circles, 10,000 cell equivalents; triangles, 1,000 cell equivalents; inverted triangles, 100 cell equivalents; ,
10 cell equivalents; and left-facing triangles, H2O. Duplicate logarithms of DNA concentrations were plotted against their relative crossing points
(inset). PCR efficiency (E) was calculated from the slope of the standard curve by the formula E 101/slope and was 1.805; the slope was 3.9.
VOL. 77, 2011 LLS-POSITIVE AND -NEGATIVE L. MONOCYTOGENES STRAINS
days from the initial presumptive identification of Listeria to
the identification of isolated strains to the species level.
Through the targeting of a variety of different species-specific
L. monocytogenes markers, such as hlyA (48), prfA (51), or
RNA sequences (4, 44), real-time PCR technologies operate at
a greatly reduced cost and dramatically lower the turnaround
time required to detect the pathogen. These assays utilize one
of the many fluorescent detection chemistries available, includ-
ing the fluorescent dye SYBR green and strain-specific hybrid-
ization probe technologies based on the FRET principle of
hybridization/hydrolysis assays. Indeed, the latter technology is
currently adopted in commercially available diagnostic kits for
L. monocytogenes detection in food samples (e.g., LightCycler
Foodproof Listeria monocytogenes detection kit; Roche/Biotecon
Diagnostics). While almost all L. monocytogenes strains have the
potential to cause infection, it has been acknowledged for some
time that lineage I L. monocytogenes strains are more frequently
associated with spontaneous and epidemic outbreaks of listeriosis
(25, 58). Here, a real-time PCR assay was designed to target LLS;
this assay can be used in conjunction with diagnostic kits for L.
monocytogenes to differentiate between LLS-positive and LLS-
negative forms of the pathogen. First, a series of deletion mutants
were generated to investigate which of the lls genes are required
for LLS production. The llsG and llsH genes are predicted to code
for an ABC transport system (LlsG is predicted to contain an
ATP-binding domain, while LlsH has six membrane-spanning
domains) potentially responsible for LLS export. Indeed, sim-
ilar arrangements have been noted among bacteriocin trans-
porters, and the proteins are predicted to dimerize at the
cytoplasmic membrane to form an active translocation com-
plex (20). Disruption of these genes resulted in the elimi-
nation of LLS activity from F2365LLSChly. It has been
previously established that the elimination of llsB, a homolog
of sagB, results in a loss of LLS activity in this strain (8).
Similarly, the elimination of the llsY or llsD genes, which as a
consequence of being homologs of the sag genes sagC and
sagD, respectively, and predicted to encode biosynthetic en-
zymes (8), also resulted in a loss of LLS activity. Interestingly,
no loss of LLS activity was observed following the deletion of
the llsP gene, which is annotated as a CAAX amino-terminal
putative metalloprotease gene. It is becoming increasingly ap-
parent that several bacteriocin clusters contain a gene en-
coding an endopeptidase of this class. These endopeptidases
are proposed to contribute to bacteriocin immunity, i.e.,
self-protection, or bacteriocin maturation and transporta-
tion. Indeed, a novel immunity function has been demon-
strated for the sagE and pncO genes of streptococci, the skkI
gene of Lactobacillus sakei, and the plnI and plnLR genes of
Lactobacillus plantarum (10, 31, 37). It may be that LLS
evolved from a bacteriocin-like peptide to a peptide that lacks
antibacterial activity (data not shown), thereby explaining why
the llsP gene is not essential. The nonessential role of LlsP is
consistent with the observation that an LLS chimeric peptide
which retains an N-terminal leader (in the relevant case, a
SagA leader is retained) retains in vitro hemolytic activity (39).
A lmof2365_1120 strain also retained LLS activity. While
these investigations indicate that neither the llsP nor the
lmof2365_1120 gene is essential for LLS production, these
results are generated using a strain in which LLS is constitu-
tively expressed; thus, we cannot exclude the possibility that
169
these genes have roles which contribute to the regulation of
LLS production in wild-type strains.
The llsX gene was chosen as a strain-specific diagnostic
marker for LIPI-3 as a consequence of its essential nature and
the fact that no gene equivalent exists among other sag-like
gene clusters (8). The specificity of the llsX real-time PCR
assay was validated against a panel of 40 L. monocytogenes
strains (20 of which were LLS positive). Further investigations
focused on assessing the detection limits of the assay. In this
respect, the capacity of the assay to accurately detect down to
10 cell equivalents of targeted cells per PCR was demonstrated
and compares well to that of published real-time PCR assays
for L. monocytogenes (43). The practical usefulness of the
real-time PCR assay was determined by assessing its ability to
detect LLS-positive L. monocytogenes in retail samples of RTE
Downloaded from http://aem.asm.org/ on January 21, 2017 by guest
foods (e.g., pasteurized milk and cooked ham) and enabled the
detection of 1 CFU per 25 g/ml of food samples, which com-
plies with international recommendations of the Association of
Official Analytical Chemists (AOAC) (15). To achieve this, it
was necessary to employ selective culture enrichment whereby
a rapid method which combines an enrichment step with real-
time PCR, previously described by OGrady et al. (43), was
employed and adapted to target the llsX gene as a marker for
the LIPI-3 cluster. This method has been described as a po-
tential alternative to the ISO 11290-1 standard method and can
be performed in 2 working days compared to 7 days for the
ISO standard. Accordingly, the time taken for the enrichment
procedure was significantly reduced, from 72 h to 26 h, when
coupled with real-time PCR. Furthermore, our method incor-
porated a rapid PCR template purification step which utilized
Chelex-100 resin, thus avoiding the need for expensive and
tedious DNA isolation/purification procedures. Specifically
designed for extraction of the PCR-ready template, the ion
exchange resin attenuates potential PCR inhibition by scav-
enging polyvalent metal ions which catalyze the degradation
of nucleic acids. Additionally, the resin has also been re-
ported to improve cell lysis of Gram-positive bacteria
(35, 49).
The development of a better understanding of LLS produc-
tion and its contribution to virulence could potentially lead to
a reassessment of the levels of L. monocytogenes that are tol-
erated in food, with limits being dependent on the virulence
potential of the strain isolated. Should that be the case, having
the ability to distinguish between LLS-positive and LLS-nega-
tive isolates will allow more effective and targeted control
measures to be introduced by the food industry and the devel-
opment of more effective therapeutic strategies by clinicians.
ACKNOWLEDGMENTS
This study was funded by the Enterprise Ireland Commercialization
fund.
Work for this study was performed at the University College Cork,
Cork, Ireland.
We thank Todd Ward (Agricultural Research Service, U.S. Depart-
ment of Agriculture), Martin Wiedmann (International Life Sciences
Institute), and Catherine Donnelly (Department of Nutrition and
Food Sciences, University of Vermont) for providing a number of
Listeria strains.
REFERENCES
1. Allerberger, F., and M. Wagner. 2010. Listeriosis: a resurgent foodborne
infection. Clin. Microbiol. Infect. 16:1623.
170 CLAYTON ET AL.
2. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller,
and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation
of protein database search programs. Nucleic Acids Res. 25:33893402.
3. Anonymous. 2008. Outbreak of Listeria monocytogenes infections associated
with pasteurized milk from a local dairyMassachusetts, 2007. Morb. Mor-
tal. Wkly. Rep. 57:10971100.
4. Aparecida de Oliveira, M., E. G. Abeid Ribeiro, A. M. Morato Bergamini,
and E. C. Pereira De Martinis. 2010. Quantification of Listeria monocyto-
genes in minimally processed leafy vegetables using a combined method
based on enrichment and 16S rRNA real-time PCR. Food Microbiol. 27:
1923.
5. Bennion, J. R., F. Sorvillo, M. E. Wise, S. Krishna, and L. Mascola. 2008.
Decreasing listeriosis mortality in the United States, 19902005. Clin. Infect.
Dis. 47:867874.
6. Berche, P. 2005. Pathophysiology and epidemiology of listeriosis. Bull. Acad.
Natl. Med. 189:507516; discussion, 516521.
7. Caplin, B. E., R. P. Rasmussen, P. S. Bernard, and C. T. Wittwer. 1999. The
most direct way to monitor PCR amplification for quantification and muta-
tion detection. Biochemica 1:58.
8. Cotter, P. D., L. A. Draper, E. M. Lawton, K. M. Daly, D. S. Groeger, P. G.
Casey, R. P. Ross, and C. Hill. 2008. Listeriolysin S, a novel peptide hae-
molysin associated with a subset of lineage I Listeria monocytogenes. PLoS
Pathog. 4:e1000144.
9. Crossman, L., A. Cerdeno-Tarraga, and N. R. Thomson. 2004. Chalk and
cheese. Nat. Rev. Microbiol. 2:528529.
10. Datta, V., S. M. Myskowski, L. A. Kwinn, D. N. Chiem, N. Varki, R. G.
Kansal, M. Kotb, and V. Nizet. 2005. Mutational analysis of the group A
streptococcal operon encoding streptolysin S and its virulence role in inva-
sive infection. Mol. Microbiol. 56:681695.
11. Denny, J., and J. McLauchlin. 2008. Human Listeria monocytogenes infec-
tions in Europe: an opportunity for improved European surveillance. Euro
Surveill. 13:8082.
12. Donnelly, C. W. 2001. Listeria monocytogenes: a continuing challenge. Nutr.
Rev. 59:183194.
12a.European Commission. 2005. Commission regulation (EC) no. 2073/2005 of
15 November 2005 on microbiological criteria for foodstuffs. Off. J. Eur.
Union L338:126.
13. Felicio, M. T., T. Hogg, P. Gibbs, P. Teixeira, and M. Wiedmann. 2007.
Recurrent and sporadic Listeria monocytogenes contamination in alheiras
represents considerable diversity, including virulence-attenuated isolates.
Appl. Environ. Microbiol. 73:38873895.
14. Freitag, N. E., G. C. Port, and M. D. Miner. 2009. Listeria monocytogenes:
from saprophyte to intracellular pathogen. Nat. Rev. Microbiol. 7:623628.
15. Gasanov, U., D. Hughes, and P. M. Hansbro. 2005. Methods for the isolation
and identification of Listeria spp. and Listeria monocytogenes: a review.
FEMS Microbiol. Rev. 29:851875.
16. Gormley, F. J., C. L. Little, K. A. Grant, E. de Pinna, and J. McLauchlin.
2010. The microbiological safety of ready-to-eat specialty meats from mar-
kets and specialty food shops: a UK wide study with a focus on Salmonella
and Listeria monocytogenes. Food Microbiol. 27:243249.
17. Gray, M. J., R. N. Zadoks, E. D. Fortes, B. Dogan, S. Cai, Y. Chen, V. N.
Scott, D. E. Gombas, K. J. Boor, and M. Wiedmann. 2004. Listeria monocy-
togenes isolates from foods and humans form distinct but overlapping pop-
ulations. Appl. Environ. Microbiol. 70:58335841.
18. Hamon, M., H. Bierne, and P. Cossart. 2006. Listeria monocytogenes: a
multifaceted model. Nat. Rev. Microbiol. 4:423434.
19. Handa-Miya, S., B. Kimura, H. Takahashi, M. Sato, T. Ishikawa, K. Iga-
rashi, and T. Fujii. 2007. Nonsense-mutated inlA and prfA not widely dis-
tributed in Listeria monocytogenes isolates from ready-to-eat seafood prod-
ucts in Japan. Int. J. Food Microbiol. 117:312318.
20. Havarstein, L. S., D. B. Diep, and I. F. Nes. 1995. A family of bacteriocin
ABC transporters carry out proteolytic processing of their substrates con-
comitant with export. Mol. Microbiol. 16:229240.
21. Hoffman, C. S., and F. Winston. 1987. A ten-minute DNA preparation from
yeast efficiently releases autonomous plasmids for transformation of Esche-
richia coli. Gene 57:267272.
22. Horton, R. M., Z. L. Cai, S. N. Ho, and L. R. Pease. 1990. Gene splicing by
overlap extension: tailor-made genes using the polymerase chain reaction.
Biotechniques 8:528535.
23. Ivanek, R., Y. T. Grohn, L. W. Tauer, and M. Wiedmann. 2004. The cost and
benefit of Listeria monocytogenes food safety measures. Crit. Rev. Food Sci.
Nutr. 44:513523.
24. Jackson, K. A., M. Iwamoto, and D. Swerdlow. 2010. Pregnancy-associated
listeriosis. Epidemiol. Infect. 138:15031509.
25. Jeffers, G. T., J. L. Bruce, P. L. McDonough, J. Scarlett, K. J. Boor, and M.
Wiedmann. 2001. Comparative genetic characterization of Listeria monocy-
togenes isolates from human and animal listeriosis cases. Microbiology 147:
10951104.
26. Jemmi, T., and R. Stephan. 2006. Listeria monocytogenes: food-borne patho-
gen and hygiene indicator. Rev. Sci. Tech. 25:571580.
27. Jonquieres, R., H. Bierne, J. Mengaud, and P. Cossart. 1998. The inlA gene
APPL. ENVIRON. MICROBIOL.
of Listeria monocytogenes LO28 harbors a nonsense mutation resulting in
release of internalin. Infect. Immun. 66:34203422.
28. Kasper, S., S. Huhulescu, B. Auer, I. Heller, F. Karner, R. Wurzner, M.
Wagner, and F. Allerberger. 2009. Epidemiology of listeriosis in Austria.
Wien. Klin. Wochenschr. 121:113119.
29. Kathariou, S. 2002. Listeria monocytogenes virulence and pathogenicity, a
food safety perspective. J. Food Prot. 65:18111829.
30. Khatamzas, E., H. Hughes, K. A. Grant, J. McLauchlin, and I. C. Bowler.
2010. The increasing prevalence of listeriosis: what are we missing? QJM
103:519522.
31. Kjos, M., L. Snipen, Z. Salehian, I. F. Nes, and D. B. Diep. 2010. The ABI
proteins and their involvement in bacteriocin self-immunity. J. Bacteriol.
192:20682076.
32. Koch, J., and K. Stark. 2006. Significant increase of listeriosis in Germany:
epidemiological patterns 20012005. Euro Surveill. 11:8588.
33. Li, Y. M., J. C. Milne, L. L. Madison, R. Kolter, and C. T. Walsh. 1996. From
peptide precursors to oxazole and thiazole-containing peptide antibiotics:
microcin B17 synthase. Science 274:11881193.
34. Little, C. L., S. M. Pires, I. A. Gillespie, K. Grant, and G. L. Nichols. 2010.
Attribution of human Listeria monocytogenes infections in England and
Downloaded from http://aem.asm.org/ on January 21, 2017 by guest
Wales to ready-to-eat food sources placed on the market: adaptation of the
Hald Salmonella source attribution model. Foodborne Pathog. Dis. 7:749
756.
35. Liu, D. 2008. Preparation of Listeria monocytogenes specimens for molecular
detection and identification. Int. J. Food Microbiol. 122:229242.
36. Low, J. C., and W. Donachie. 1997. A review of Listeria monocytogenes and
listeriosis. Vet. J. 153:929.
37. Lux, T., M. Nuhn, R. Hakenbeck, and P. Reichmann. 2007. Diversity of
bacteriocins and activity spectrum in Streptococcus pneumoniae. J. Bacteriol.
189:77417751.
38. McLauchlin, J. 1990. Distribution of serovars of Listeria monocytogenes
isolated from different categories of patients with listeriosis. Eur. J. Clin.
Microbiol. Infect. Dis. 9:210213.
39. Mitchell, D. A., S. W. Lee, M. A. Pence, A. L. Markley, J. D. Limm, V. Nizet,
and J. E. Dixon. 2009. Structural and functional dissection of the heterocyclic
peptide cytotoxin streptolysin S. J. Biol. Chem. 284:1300413012.
40. Nightingale, K. K., R. A. Ivy, A. J. Ho, E. D. Fortes, B. L. Njaa, R. M. Peters,
and M. Wiedmann. 2008. inlA premature stop codons are common among
Listeria monocytogenes isolates from foods and yield virulence-attenuated
strains that confer protection against fully virulent strains. Appl. Environ.
Microbiol. 74:65706583.
41. Nightingale, K. K., K. Windham, K. E. Martin, M. Yeung, and M. Wied-
mann. 2005. Select Listeria monocytogenes subtypes commonly found in
foods carry distinct nonsense mutations in inlA, leading to expression of
truncated and secreted internalin A, and are associated with a reduced
invasion phenotype for human intestinal epithelial cells. Appl. Environ.
Microbiol. 71:87648772.
42. Nizet, V., B. Beall, D. J. Bast, V. Datta, L. Kilburn, D. E. Low, and J. C. De
Azavedo. 2000. Genetic locus for streptolysin S production by group A
Streptococcus. Infect. Immun. 68:42454254.
43. OGrady, J., S. Sedano-Balbas, M. Maher, T. Smith, and T. Barry. 2008.
Rapid real-time PCR detection of Listeria monocytogenes in enriched food
samples based on the ssrA gene, a novel diagnostic target. Food Microbiol.
25:7584.
44. OGrady, J., M. Ruttledge, S. Sedano-Balbas, T. J. Smith, T. Barry, and M.
Maher. 2009. Rapid detection of Listeria monocytogenes in food using culture
enrichment combined with real-time PCR. Food Microbiol. 26:47.
45. Olier, M., F. Pierre, J. P. Lemaitre, C. Divies, A. Rousset, and J. Guzzo.
2002. Assessment of the pathogenic potential of two Listeria monocytogenes
human faecal carriage isolates. Microbiology 148:18551862.
46. Petruzzelli, A., G. Blasi, L. Masini, L. Calza, A. Duranti, S. Santarelli, S.
Fisichella, G. Pezzotti, L. Aquilanti, A. Osimani, and F. Tonucci. 2010.
Occurrence of Listeria monocytogenes in salami manufactured in the Marche
region (Central Italy). J. Vet. Med. Sci. 72:499502.
47. Roberts, A. J., and M. Wiedmann. 2003. Pathogen, host and environmental
factors contributing to the pathogenesis of listeriosis. Cell. Mol. Life Sci.
60:904918.
48. Rodriguez-Lazaro, D., M. Hernandez, M. Scortti, T. Esteve, J. A. Vazquez-
Boland, and M. Pla. 2004. Quantitative detection of Listeria monocytogenes
and Listeria innocua by real-time PCR: assessment of hly, iap, and lin02483
targets and AmpliFluor technology. Appl. Environ. Microbiol. 70:13661377.
49. Rodriguez-Lazaro, D., A. Jofre, T. Aymerich, M. Garriga, and M. Pla. 2005.
Rapid quantitative detection of Listeria monocytogenes in salmon products:
evaluation of pre-real-time PCR strategies. J. Food Prot. 68:14671471.
50. Rodriguez-Lazaro, D., A. Jofre, T. Aymerich, M. Hugas, and M. Pla. 2004.
Rapid quantitative detection of Listeria monocytogenes in meat products by
real-time PCR. Appl. Environ. Microbiol. 70:62996301.
51. Rossmanith, P., M. Krassnig, M. Wagner, and I. Hein. 2006. Detection of
Listeria monocytogenes in food using a combined enrichment/real-time PCR
method targeting the prfA gene. Res. Microbiol. 157:763771.
52. Swaminathan, B., and P. Gerner-Smidt. 2007. The epidemiology of human
listeriosis. Microbes Infect. 9:12361243.
VOL. 77, 2011 LLS-POSITIVE AND -NEGATIVE L. MONOCYTOGENES STRAINS
53. Tham, W., H. Ericsson, S. Loncarevic, H. Unnerstad, and M. L. Danielsson-
Tham. 2000. Lessons from an outbreak of listeriosis related to vacuum-
packed gravad and cold-smoked fish. Int. J. Food Microbiol. 62:173175.
54. Uyttendaele, M., P. Busschaert, A. Valero, A. H. Geeraerd, A. Vermeulen, L.
Jacxsens, K. K. Goh, A. De Loy, J. F. Van Impe, and F. Devlieghere. 2009.
Prevalence and challenge tests of Listeria monocytogenes in Belgian pro-
duced and retailed mayonnaise-based deli-salads, cooked meat products and
smoked fish between 2005 and 2007. Int. J. Food Microbiol. 133:94104.
55. Van Stelten, A., and K. K. Nightingale. 2008. Development and implemen-
tation of a multiplex single-nucleotide polymorphism genotyping assay for
171
detection of virulence-attenuating mutations in the Listeria monocytogenes
virulence-associated gene inlA. Appl. Environ. Microbiol. 74:73657375.
56. Vazquez-Boland, J. A., M. Kuhn, P. Berche, T. Chakraborty, G. Dominguez-
Bernal, W. Goebel, B. Gonzalez-Zorn, J. Wehland, and J. Kreft. 2001. Lis-
teria pathogenesis and molecular virulence determinants. Clin. Microbiol.
Rev. 14:584640.
57. Wessels, M. R. 2005. Streptolysin S. J. Infect. Dis. 192:1315.
58. Yde, M., N. Botteldoorn, S. Bertrand, J. Collard, and K. Dierick. 2010.
Microbiological and molecular investigation of an increase of human liste-
riosis in Belgium, 20062007. Euro Surveill. 15:19482.
Downloaded from http://aem.asm.org/ on January 21, 2017 by guest