Vol. 7(34), pp.

4414-4421, 23 August,
2013 DOI: 10.5897/AJMR2013.5778
ISSN 1996-0808 2013 Academic
Journals African Journal of Microbiology Research
http://www.academicjournals.org/AJMR

Full Length Research Paper

Molecular investigation of antibiotic resistance genes in

methicillin resistant Staphylococcus aureus isolated
from nasal cavity in pediatric service
1 # 1# 2 2
Tarek ZMANTAR * , Karima BEKIR , Salem Ibrahim ELGARSADI , Omayma HADAD and
1
Amina BAKHROUF
1
Laboratoire dAnalyse, Traitement et Valorisation des Polluants de lEnvironnement et des Produits, Facult de
Pharmacie, Monastir 5000, Tunisia.
2
Faculty of Pharmacy, University Elfeteh, Libya.
Accepted 15 July, 2013

Methicillin-resistant staphylococci may also be resistant to some other antibiotics as well as -lactams.
Co-existence of resistance to methicillin and macrolides was genetically investigated in
Staphylococcus aureus. A total of 59 S. aureus strains isolated from nasal cavity of patients
hospitalized in the pediatric service were investigated for their susceptibility to oxacillin and
erythromycin. In addition, the -lactams resistance gene (mecA and blaZ), the erythromycin resistance
methylase genes (ermA, ermB, and ermC) and macrolide efflux genes msrA were analysed by multiplex
PCR. The minimal inhibitory concentration (MIC) values revealed that 98 and 97% of isolates were
resistant to oxacillin and erythromycin, respectively. In addition, the frequency of resistant strains for
tested genes was 66% (mecA), 100% (blaZ), 15% (ermA), 30% (ermB), 22% (ermC) and 36% (msrA). A
high rate of macrolide resistance was determined in methicillin-resistant staphylococci. The erm gene
was the most frequently detected. Results of susceptibility testing and the carriage of resistance genes
did not match. Thus, polymerase chain reaction (PCR) multiplex identification of antibiotic resistance
genes, as a rapid and accurate technique, could be a supplementary method, which can be easily
incorporated into the diagnostic molecular microbiology laboratory work flow.

Key words: Staphylococcus aureus, multidrug resistance, multiplex polymerase chain reaction (PCR).

INTRODUCTION

Staphylococcus aureus is an important bacterial
pathogen causing a wide diversity of infections ranging
from mild local infections of skin and soft tissue to severe
systemic infections such as sepsis and toxic shock
syndrome, which may be lethal (Mertz et al., 2007;
Gordon and Lowy, 2008). Methicillin resistant
Staphylococcus aureus (MRSA) are generally resistant to
all penicillins, carbapenems and cephalosporins
(Chambers, 1997). They account for a large part of
nosocomial infections worldwide (Lowy, 1998) and are
associated with longer hospitalisation and higher lethality
(Shurland et al., 2007).
The mecA gene responsible for methicillin resistance is
part of a mobile genetic element found in all MRSA strains. It
was demonstrated that mecA is part of a genomic island
designated staphylococcal cassette chro-mosome mec
(SCCmec) (Katayama et al., 2000). To date, four different
SCCmec elements varying in size from

*Corresponding author. E-mail: zmantar_t@yahoo.fr. Tel: +21673461000. Fax: +21673461830.

#
Authors contributed equally to this work.

21 to 67 kb have been characterized (Hiramatsu et al.,
2001).
Staphylococcal resistance to penicillin is mediated by
blaZ, the gene that encodes -lactamase. This
predominant extracellular enzyme, synthesized when
staphylococci are exposed to -lactam antibiotics,
hydrolyzes the -lactam ring, rendering the -lactam
inactive. blaZ is under the control of two adjacent
regulatory genes, the antirepressor blaR1 and the
repressor blaI (Kernodle, 2000). Recent studies have
demonstrated that the signaling pathway responsible for
-lactamase synthesis requires sequential cleavage of
the regulatory proteins BlaR1 and BlaI. Following
exposure to -lactams, BlaR1, a transmembrane sensor-
transducer, cleaves itself (Gregory et al., 1997; Zhang et
al., 2001). Zhang et al. (2001) hypothesized that the
cleaved protein functions as a protease that cleaves the
repressor BlaI, directly or indirectly (an additional protein,
BlaR2, may be involved in this pathway) and allows blaZ
to synthesize enzyme.
Methicillin-resistant S. aureus (MRSA) was considered
as one of the most difficult bacteria to treat in patients.
The difficulty in treating MRSA infections is compounded
by the fact that many strains also possess efflux pumps,
which export certain tetracyclines, macrolides, genes
which confer resistance to antibiotics and antiseptics
(Marshall and Piddock, 1997). In staphylococci, three
genes (ermA, ermB and ermC) encoding methyl
transferases are responsible for resistance to macrolide
by modification of the ribosomal target site in 23S rRNA
(Trzcinski et al., 2000; Fluit et al., 2001). It is known that
in MRSA, the msrA gene confer drug resistance by efflux
mechanism (Ross et al., 1995). Several studies
concerning the epidemiological distribution of genes
encoding erythromycin ribosomal methylases and efflux
pumps have been performed by dot blot or Southern
hybridization (Eady et al., 1993), and detection of
erythromycin resistance determinants by PCR has been
performed with staphylococci and streptococci (Sutcliffe
et al., 1996).
MRSA is commonly resistant to multiple antibiotics,
comprehension of the antimicrobial susceptibility profile
and resistance mechanisms in community- MRSA is
necessary. The aim of this study was to determine, by
conventional microbiological methods, the antibiotic
susceptibility of S. aureus strains (n = 59) isolated from
nasal cavity of patients (children and their mothers) in the
hospital. Furthermore, the antibiotic resistance genes
mecA and blaZ were detected by PCR. The erythromycin
(ERM) resistance genes (ermA, ermB and ermC) and
macrolide efflux (msrA) were determined by multiplex
PCR.
MATERIALS AND METHODS
Bacterial strains
Fifty nine (59) S. aureus strains were collected between June 2009
Zmantar et al. 4415
and June 2010, from the nasal swab of the nasal cavity of patients
(children and their mothers), samples were taken two times (at
admission and discharge) where the period of hospitalization was
not less than four days. Patients were hospitalized in the pediatric
service in General Department of Aljala Pediatric Hospital, Tripoli
capital.
Sampling was performed using sterile swabs and was directly put
in nutrient (Oxoid, UK), incubated over night at 37C; then they
were subcultured on mannitol salt agar (Oxoid, UK). Suspected
colonies of S. aureus were confirmed preliminarily by their positive
Gram-staining characteristics, catalase and DNAase positive
reaction (Oxoid, UK) and the presence of free plasma coagulase
using rabbit plasma. Species identification was obtained with
chromogenic media (BioMrieux) and latex agglutination kit
(BioMrieux) according to the manufacturers recommendation.
Molecular identification of S. aureus strains was performed using
specific primers (Sa442-1 and Sa442-2) as previously described
(Martineau et al., 1998).
Minimal inhibitory concentration determinations
The broth microdilution method was used in Mueller-Hinton nutrient
(Scharlau, Spain) to determine the minimum inhibitory concen-
tration (MIC) of oxacillin (OX), and erythromycin (ERY) (0 to 2048
g/ml) according to the Clinical and Laboratory Standards Institute
(CLSI) (CLSI, 2006). After incubation, bacterial growth was evalua-
ted by the presence of turbidity and a pellet on the well bottom.
Minimal inhibitory concentration was defined as the lowest concen-
tration of compound that had no macroscopically visible growth.
Molecular detection of antibiotics resistance genes
Chromosomal DNA was extracted using a Wizard Genomic
Purification Kit (Promega, Lyon, France) according to the
manufacturers specification.
Detection of mecA and blaZ gene
Molecular detection of mecA and blaZ genes was assessed using
forward and reverse primers presented in Table 1. PCR were
performed according to Geha et al. (1994) and Martineau et al.
(2000), respectively.
A PCR mixture (25 L) contained 1 L forward and reverse
primers (25 pmol/L), dNTP mix (100 mol/L of each), 1 U of GO Taq
DNA polymerase (Promega, France), 5 L green Go Taq buffer (5)
and 3 L of DNA template (50 ng). PCR conditions included initial
denaturation (5 min 94C), 30 cycles of denaturation (1 min 94C),
annealing (1 min 55C), and extension (2 min 72C), and final
extension (10 min 72C). PCR products (5 L) were analyzed on
2% agarose gel stained with ethidium bromide, visualized under UV
transillumination and photographed using Gel Doc XR apparatus
(BioRad, USA).
The presence of blaZ DNA was detected by PCR using forward
and reverse primers as described previously (Martineau et al.,
2000).
Detection of ermA, ermB, ermC and msrA by multiplex-PCR
The presence of the ermA, ermB, ermC and msrA genes encoding
macrolide resistance was examined in 41 strains using multiplex
PCR according to Martineau et al. (2000) and Lim et al. (2002).
PCR primers were chosen from the antibiotic resistance genes
ermA, ermB, ermC and msrA as listed in Table 1. PCR product was
resolved on a 2% agarose gel stained with ethidium bromide and
visualized under UV transillumination.
4416 Afr. J. Microbiol. Res.

Table 1. Primers used for detection of genes encoding antibiotics resistance.

Primer sequence 5-3 Hybridation Reference

mecA AACAGGTGAATTATTAGCACTTGTAAG 140 55C Geha et al., 1994
ATTGCTGTTAATATTTTTTGAGTTGAA
ermA TATCTTATCGTTGAGAAGGGATT 139 54C
CTACACTTGGCTTAGGATGAAA
ermB CTATCTGATTGTTGAAGAAGGAT 142 54C
GTTTACTCTTGGTTTAGGATGAAA
Martineau et al., 2000
CTTGTTGATCACGATAATTTCC
ermC 190 54C
ATCTTTTAGCAAACCCGTATTC
msrA TCCAATCATAGCACAAAATC 163 54C
AATTCCCTCTATTTGGTGGT
blaZ ACTTCAACACCTGCTGCTTTC 172 55C Martineau et al., 2000
TGACCACTTTTATCAGCAACC

Figure 1. Agarose gel electrophoresis of PCR amplicon of S.aureus

gene (107 bp) with clinical strains; 1,100-bp DNA ladder; 2, negative
control; 2, SD8; 3, SD3; 4, SD11; 5,O54; 6, SD10; 7,SD18; 8,15A and
9,11A.

RESULTS and ERY (Tables 2 and 3) according to the MICs values.

Molecular identification of S. aureus strains
Molecular identification using specific primers showed the
presence of 59 S. aureus isolated from hospital as
presented in Figure 1.
Majority of strains were resistant toward the two tested
antibiotic (OXA and ERY). In addition, 58 (98%) were
resistant to oxacillin (MIC > 2 g/ml), and 57 (97 %) were
resistant to erythromycin (MIC> 2 g/ml) according to the
CLSI (2006).

Antimicrobial susceptibility Molecular detection of antibiotics resistance gene

The isolates were screened for their susceptibility to OXA Positive strains for mecA gene showed a band with 140
 Zmantar et al. 4417

Table 2. Relationships between MIC of oxacillin and the

presence of resistance genes mecA and blaZ.

a Presence of genes
Oxacillin
mecA+ mecA- blaZ+ blaZ-
1024 22 11 33 0
512 12 2 14 0
256 3 4 7 0
64 1 3 4 0
2 1 0 1 0
a
Minimum inhibitory concentration: g/ml for the antibiotics.

Table 3. Relationships between MIC of erythromicyn and the presence of resistance genes ermA, ermB, ermC and msrA.

a Presence of genes
Erythromicin
ermA+ ermA- ermB+ ermB- ermC+ ermC- msrA+ msrA-
1024 7 12 7 12 7 12 11 8
512 0 9 3 6 1 8 2 7
256 0 3 1 2 2 1 1 2
64 0 10 2 8 1 9 2 8
32 1 7 2 6 1 7 2 6
16 1 6 2 5 1 6 2 5
4 0 1 1 0 0 1 1 0
2 0 1 0 1 0 1 0 1
0.5 0 1 0 1 0 1 0 1
a
Minimum inhibitory concentration: g/ml for the antibiotics.

bp in 1.5% agarose gel (Figure 2). We found that 39 out
of 59 strains were mecA positive (Table 2). Furthermore,
all the isolated S. aureus were positive for blaZ gene
(Figure 3). We noted that the mecA gene was absent in
20 MRSA.
Among the 59 tested S. aureus strains, the ermC gene
(Figure 4) was detected in 13 isolates (22%).
Furthermore, 9 (15%) strains were ermA (Figure 5)
positive (Table 3) and 18 strains harboured ermB gene
(30%). The msrA gene was present in 21 (36%) S.
aureus strains (Figure 4). In three strains, the ermA,
ermB ermC and msrA genes were not detected, although
they were susceptible to erythromycin. In contrast, in 25
strains, no erythromycin resistance gene was detected,
although it was resistant to erythromycin.
DISCUSSION
The evolution of increasingly antimicrobial resistant
bacteria species stems from a multitude of factors that
includes the widespread and sometimes inappropriate
use of antimicrobials (Cohen, 1992). Multidrug resistance
is now the norm among these pathogens. S. aureus is the
pathogen of greatest concern because of its intrinsic
virulence, its ability to cause a diverse array of life
threatening infections, and its capacity to adapt to
different environmental conditions (Lowy, 1998;
Waldvogel, 2000).
The mortality of S. aureus bacteremia remains
approximately 20 to 40% despite the availability of
effective antimicrobials (Mylotte et al., 1987). S. aureus is
now the leading overall cause of nosocomial infections
and, since more patients are treated outside the hospital
setting, is an increasing concern in the community (Bettin
et al., 2012; Diekema et al., 2001).
Our data demonstrates that 65.5% of the MRSA strains
have the mecA gene which was contradictory to results
of Raimundo et al. (2002) and Oliveira et al. (2007) they
showed complete agreement between the presence of
the mecA gene and interpretation of oxacillin disc-
susceptibility test.
Among the 58 MRSA strains, the MIC between 512 and
1024 g/ml to oxacilline was observed in 47 (81%)
strains. Only 11 (19%) strains have MICs 256 g/ml.
Our results are in disagreement with the study conducted
by Mastouri et al. (2006) in Tunisia in which an incidence
of 65.6% for MICs 256 g/ml was reported. Phenotypic
expression of methicillin resistance is variable, and each
MRSA strain has a characteristic profile of the proportion
4418 Afr. J. Microbiol. Res.

1 2 3 4 5 6 7 8

200 bp
100 bp

Figure 2. Agarose gel electrophoresis of PCR amplicon of mecA gene

(140 bp) obtained with DNA of S. aureus strains; 1, 100-bp DNA
ladder; 2, negative control; 3, SD21; 4, SD22; 5, SD9; 6, O60; 7, SD10
and 8, 09.

1 2 3 4 5 6 7 8

200 bp
100 bp

Figure 3. Agarose gel electrophoresis of PCR amplicon of blaZ

gene (172 bp) with clinical strains; 1,100-bp DNA ladder; 2,
negative control; 3, SD8; 4, SD3; 5, SD11; 6, O54; 7, SD10 and 8,
SD18.
 Zmantar et al. 4419

1 2 3 4 5 6 7 8

200 bp
100 bp

Figure 4. PCR analysis of erythromycin-resistant determinants:

ermA (139 bp), msrA (163 bp) and ermC (190 bp) with clinical
strains; 1, 100-bp DNA ladder; 2, negative control; 3, O52; 4,
SD16; 5, SD3; 6, SD16; 7, SD1 and 8, SD13.

of bacterial cells that grow at specific concentrations of

Figure 5. Agarose gel electrophoresis of PCR
amplicon of erythromycin-resistant ermB gene
(142 bp): 1 ,100 bp DNA ladder ; 2 , negative
control ; 3, SD8 ; 4 , O68 ; 5, SD16 and 6,
SD23.
methicillin (Plata et al., 2013). Expression of resistance in
some MRSA strains is regulated by mecI and mecR1,
regulate the mecA response to -lactam antibiotics in a
fashion similar to that of the regulation of blaZ by the
genes blaR1 and blaI upon exposure to penicillin.
Our data demonstrated that in 20 MRSA isolated
strains, the mecA gene was absent and all the MRSA
strains harboured the blaZ gene. These results were in
agreement with study of Duran et al. (2012); who showed
that majority of staphylococci strains harboured the blaZ
gene. The blaZ gene encodes -lactamase (extracellular
enzyme), synthesized when staphylococci are exposed
to -lactam antibiotics, hydrolyzes the -lactam ring,
rendering the -lactam (Kernodle, 2000).
We noted also that in the MRSA isolates, 57/58 (98%)
of strains were resistant to erythromycin. These results
were in contrast with results of Petinaki et al. (2000); who
showed that 81% of MRSA were resistant to
erythromycin and in accordance with results (95%) of
Fatholahzadeh et al. (2008).
Erythromycin resistance in staphylococci is predomi-
nantly mediated by erythromycin-resistant methy-lase
encoded by erm genes (Weisblum, 1995; Duran et al.,
2012). Accordingly, investigation on the prevalence of
erythromycin resistance genes showed that out of 57
4420 Afr. J. Microbiol. Res.
strains resistant to ERY, 35 contained at least one erm
gene, 25 strains did not contain any ERY resistance gene
and one strain (4np) was resistant, although at low level,
to erythromycin (Table 3) which is contrary to the report of
Duran et al. (2012) which found that all isolates resistant
to erythromycin by phenotypic methods contained at least
one erythromycin resistance gene. Similarly, Sekiguchi et
al. (2004) reported discordance between phenotypic
susceptibility and the presence of erm genes.
In this study, 15% of S. aureus harboured ermA gene
and 30% of strains was ermB positive, 22% of S. aureus
were ermC positive. These findings are in disagreement
with the study by Duran et al. (2012) conducted with
staphylococci in Turkey in which an incidence of 33.1%
for ermA and 5.8% for ermB was reported. On the other
hand, 22% of S. aureus harboured ermC gene. Our
results are also different from those of a recent study of
Ardic et al. (2005) that reported a higher level of ermA
and ermC genes in MRSA isolated from hospital.
Staphylococcal strains resistant to macrolides and type-B
streptogramins frequently harbour msrA, which encodes
an ATP-dependent efflux pump (Eady et al., 1993). The
msrA was present in 21 out of 59 (36%) strains. Our
results are contradictory to that of Almer et al. (2002) and
Duran et al. (2012). The same investigators reported that
ermB and msrA appears to be more common in
coagulase-negative staphylococci (Lina et al., 1999;
Martineau et al., 2000).
In conclusion, in a hospital, the rapid diagnosis of
infections belonging to methicillin-resistant is of great
importance in epidemiological terms. The PCR multiplex
is a suitable and practical tool for the routine detection of
methicillin and macrolide resistance in S. aureus, which
can be easily incorporated into the diagnostic molecular
microbiology laboratory work flow.
REFERENCES
Almer LS, Shortridge VD, Nilius AM, Beyer JM, Soni NB, Bui MH, Stone
GG, Flamm RK (2002). Antimicrobial susceptibility and molecular
characterization of community-acquired methicillin-resistant
Staphylococcus aureus. Diagn. Microbiol. Infect. Dis. 43:225-232.
Ardic N, Ozyurt M, Sareyyupoglu B, Haznedaroglu T (2005).
Investigation of erythromycin and tetracycline resistance genes in
methicillin-resistant staphylococci. Int. J. Antimicrob. Agents 26:213-
218.
Bettin A, Causil C, Reyes N (2012). Molecular identification and
antimicrobial susceptibility of Staphylococcus aureus nasal isolates
from medical students in Cartagena, Colombia. Braz. J. Infect. Dis.
16:329-334.
Chambers HF (1997). Methicillin resistance in staphylococci: molecular
and biochemical basis and clinical implications. Clin. Microbiol. Rev.
10:781-791.
CLSI (2006). Methods for Dilution Antimicrobial Susceptibility Tests for
Bacteria That Grow Aerobically. Approved Standard - Seventh Edition
CLSI Document M7-A7
Cohen ML (1992). Epidemiology of drug resistance: implications for a
post-antimicrobial era. Science 257:1050-1055.
Diekema DJ, Pfaller MA, Schmitz FJ, Smayevsky J, Bell J, Jones RN,
Beach M (2001). Survey of infections due to Staphylococcus species:
frequency of occurrence and antimicrobial susceptibility of isolates
collected in the United States, Canada, Latin America, Europe, and
the Western Pacific region for the SENTRY Antimicrobial Surveillance
Program, 1997-1999. Clin. Infect. Dis .32(2):114-132.
Duran N, Ozer B, Duran GG, Onlen Y, Demir C (2013). Antibiotic
resistance genes and susceptibility patterns in staphylococci. Indian
J. Med. Res. 135:389-396.
Eady EA, Ross JI, Tipper JL, Walters CE, Cove JH, Noble WC (1993).
Distribution of genes encoding erythromycin ribosomal methylases
and an erythromycin efflux pump in epidemiologically distinct groups
of staphylococci. J. Antimicrob. Chemother. 31:211-217.
Fatholahzadeh B, Emaneini M, Gilbert G, Udo E, Aligholi M, Modarressi
MH, Nouri K, Sedaghat H, Feizabadi MM (2008). Staphylococcal
cassette chromosome mec (SCCmec) analysis and antimicrobial
susceptibility patterns of methicillin-resistant Staphylococcus aureus
(MRSA) isolates in Tehran, Iran. Microb. Drug. Resist. 14:217-220.
Fluit AC, Visser MR, Schmitz FJ (2001). Molecular detection of
antimicrobial resistance. Clin. Microbiol. Rev. 14:836-871.
Geha DJ, Uhl JR, Gustaferro CA, Persing DH (1994). Multiplex PCR for
identification of methicillin-resistant staphylococci in the clinical
laboratory. J. Clin. Microbiol. 32:1768-1772.
Gordon RJ, Lowy FD (2008). Pathogenesis of methicillin-resistant
Staphylococcus aureus infection. Clin. Infect. Dis. 46(5):350-359.
Gregory PD, Lewis RA, Curnock SP, Dyke KG (1997). Studies of the
repressor (BlaI) of beta-lactamase synthesis in Staphylococcus
aureus. Mol. Microbiol. 24:1025-1037.
Hiramatsu K, Cui L, Kuroda M, Ito T (2001). The emergence and
evolution of methicillin-resistant Staphylococcus aureus. Trends
Microbiol. 9:486-493.
Katayama Y, Ito T, Hiramatsu K (2000). A new class of genetic element,
staphylococcus cassette chromosome mec, encodes methicillin
resistance in Staphylococcus aureus. Antimicrob. Agents Chemother.
44:1549-1555.
Kernodle DS (ed) (2000). Mechanisms of resistance to -lactam
antibiotics. In Gram-positive pathogens., Vol. American Society for
Microbiology. Washington, DC, USA, Washington, DC, USA
Lim JA, Kwon AR, Kim SK, Chong Y, Lee K, Choi EC (2002).
Prevalence of resistance to macrolide, lincosamide and
streptogramin antibiotics in Gram-positive cocci isolated in a Korean
hospital. J. Antimicrob. Chemother. 49:489-495.
Lina G, Quaglia A, Reverdy ME, Leclercq R, Vandenesch F, Etienne J
(1999). Distribution of genes encoding resistance to macrolides,
lincosamides, and streptogramins among staphylococci. Antimicrob.
Agents Chemother. 43:1062-1066.
Lowy FD (1998). Staphylococcus aureus infections. N. Engl. J. Med.
339:520-532.
Marshall NJ, Piddock LJ (1997). Antibacterial efflux systems.
Microbiologia 13:285-300.
Martineau F, Picard FJ, Lansac N, Menard C, Roy PH, Ouellette M,
Bergeron MG (2000). Correlation between the resistance genotype
determined by multiplex PCR assays and the antibiotic susceptibility
patterns of Staphylococcus aureus and Staphylococcus epidermidis.
Antimicrob. Agents Chemother. 44:231-238.
Martineau F, Picard FJ, Roy PH, Ouellette M, Bergeron MG (1998).
Species-specific and ubiquitous-DNA-based assays for rapid
identification of Staphylococcus aureus. J. Clin. Microbiol. 36:618-
623.
Mastouri M, Nour M, Ben Nejma M, Bouallegue O, Hammami M,
Khedher M (2006). Antibiotics resistance of meticilline-resistant
Staphylococcus aureus: detection of the first glycopeptides low
sensibility strains in Tunisia. Pathol. Biol (Paris) 54:33-36.
Mertz D, Frei R, Jaussi B, Tietz A, Stebler C, Fluckiger U, Widmer AF
(2007). Throat swabs are necessary to reliably detect carriers of
Staphylococcus aureus. Clin. Infect. Dis. 45:475-477.
Mylotte JM, McDermott C, Spooner JA (1987). Prospective study of 114
consecutive episodes of Staphylococcus aureus bacteremia. Rev.
Infect. Dis. 9:891-907.
Oliveira AD, d'Azevedo PA, de Sousa LB, Viana-Niero C, Francisco W,
Lottenberg C, Martino MD, Hofling-Lima AL (2007). Laboratory
detection methods for methicillin resistance in coagulase negative
Staphylococcus isolated from ophthalmic infections. Arq. Bras.
Oftalmol.70:667-675.
Petinaki E, Miriagou V, Tzouvelekis LS, Pournaras S, Hatzi F, Kontos F,

Maniati M, Maniatis AN (2001). Methicillin-resistant Staphylococcus
aureus in the hospitals of central Greece. Int. J. Antimicrob. Agents
18:61-65.
Plata KB, Riosa S, Singh CR, Rosato RR, Rosato AE (2013). Targeting
of PBP1 by beta-lactams Determines recA/SOS Response Activation
in Heterogeneous MRSA Clinical Strains. PLoS One 8:61083.
Raimundo O, Heussler H, Bruhn JB, Suntrarachun S, Kelly N, Deighton
MA, Garland SM (2002). Molecular epidemiology of coagulase-
negative staphylococcal bacteraemia in a newborn intensive care
unit. J. Hosp. Infect. 51:33-42.
Ross JI, Eady EA, Cove JH, Baumberg S (1995). Identification of a
chromosomally encoded ABC-transport system with which the
staphylococcal erythromycin exporter MsrA may interact. Gene
153:93-98.
Sekiguchi J, Hama T, Fujino T, Araake M, Irie A, Saruta K, Konosaki H,
Nishimura H, Kawano A, Kudo K, Kondo T, Sasazuki T, Kuratsuji T,
Yoshikura H, Kirikae T (2004). Detection of the antiseptic- and
disinfectant-resistance genes qacA, qacB, and qacC in methicillin-
resistant Staphylococcus aureus isolated in a Tokyo hospital. Jpn. J.
Infect. Dis. 57:288-291.
Zmantar et al. 4421
Shurland S, Zhan M, Bradham DD, Roghmann MC (2007). Comparison
of mortality risk associated with bacteremia due to methicillin-
resistant and methicillin-susceptible Staphylococcus aureus. Infect.
Control. Hosp. Epidemiol. 8:273-279.
Sutcliffe J, Grebe T, Tait-Kamradt A, Wondrack L (1996). Detection of
erythromycin-resistant determinants by PCR. Antimicrob. Agents
Chemother. 40:2562-2566.
Trzcinski K, Cooper BS, Hryniewicz W, Dowson CG (2000). Expression
of resistance to tetracyclines in strains of methicillin-resistant
Staphylococcus aureus. J. Antimicrob. Chemother. 45:763-770
Waldvogel FA (ed) (2000). Staphylococcus aureus (including
staphylococcaltoxic shock). , Vol. In Principles and practice of
infectious diseases, Churchill Livingstone. Philadelphia,
Pennsylvania, USA. pp. 20722083.
Weisblum B (1995). Erythromycin resistance by ribosome modification.
Antimicrob. Agents Chemother. 39:577-585.
Zhang HZ, Hackbarth CJ, Chansky KM, Chambers HF (2001). A
proteolytic transmembrane signaling pathway and resistance to beta-
lactams in staphylococci. Science 291:1962-1965.