Microbial Pathogenesis 101 (2016) 12e23

Contents lists available at ScienceDirect

Microbial Pathogenesis
journal homepage: www.elsevier.com/locate/micpath

Phylogenetic analysis of the pathogenic genus Aeromonas spp. isolated

from diseased eels in China
S.L. Guo*, Q.H. Yang, J.J. Feng, L.H. Duan, J.P. Zhao
Fishery College of Jimei University, Anguilla Modern Engineering Research Center of Industrial Technology of the Ministry of Education, Xiamen, China

a r t i c l e i n f o a b s t r a c t

Article history: Analyses of 16S rRNA and housekeeping genes (HKGs) were valuated as identication markers for
Received 26 August 2016 pathogenic Aeromonas isolated from diseased eels. The interrelationships of 32 Aeromonas strains which
Received in revised form had been veried as pathogens to eels were studied using phylogenetic analysis with 16S rRNA and HKG
7 October 2016
sequences (cpn60, gyrB, rpoB and dnaJ) and identied by Biolog automatic microbiology analysis system
Accepted 24 October 2016
(gene III). From the analysis of 5 genes, the mean gene divergences of 16S rRNA, cpn60, gyrB, rpoB and
Available online 25 October 2016
dnaJ in 32 isolates were 1.4 0.2%, 7.1 0.7%, 5.2 0.5%, 2.2 0.4% and 6.8 0.5%, respectively. The
results of comparative phylogeny between nucleotide based analyses (excluding the third codon posi-
Keywords:
Aeromonas
tion) of four HKGs with the sequences from 55 strains of Aeromonas (including 23 referenced strains of
Eels Aeromonas) showed cpn60 and dnaJ have higher discriminate power than gyrB and rpoB comparing with
Biolog system the taxonomical identication by Biolog system. In addition, amino acid sequences of concatenated
16S rRNA cpn60-rpoB-gyrB is a good method for Aeromonas pathogens identication. This study showed analysis
HKGs of HKG sequences can be used as an alternative method for sound identication of bacterial pathogens
China isolated from diseased eels in China.
2016 Elsevier Ltd. All rights reserved.

1. Introduction to several nucleotides [14,32,41,46]. DNA-DNA hybridization has

The genus Aeromonas is a collection of Gram-negative bacteria
in the natural habitats, especially freshwater, sludge and sewage,
and usually does not cause clinical disease [8,32,58,70], but it may
be conducive to the rapid proliferation of the bacteria under stress
factors (handling, trapping, and warm water) and then facilitating
disease [15,30,31,34,53,56]. Particularly, A. hydrophila,
A. salmonicida, A. veronii, A. caviae, A. sobria and A. jandaei are
considered to be the most important conditional pathogens,
infection with epizootic ulcerative syndrome (EUS) and a high rate
of mortality in many marine and freshwater sh of the world
[1,4,7,13,26,36,48,50,55,57,60]. According to the 10th edition of
Bergey's Manual of Systematic Bacteriology, this genus comprises 14
species [37,40,44].
Analysis based on the 16S rRNA and housekeeping gene (HKG)
are considered as efcient way for the identication of bacterial
species [2,5,32], but it showed highly conserved sequences among
different species, and some of them were discriminated only by one
* Corresponding author. Fishery College of Jimei University, Yindou Road, Xiamen
361021, China.
E-mail address: gsl@jmu.edu.cn (S.L. Guo).
been subjected to analysis the interrelationships between some
present species [21,49], but discrepancies were obtained between
different DNA-DNA hybridization studies and the DNA-DNA simi-
larity between two species of A. encheleia (CECT4342T) and Aero-
monas sp. strains (HG11) was 12% and 84% by changed into in two
studies respectively [11,22]. Moreover, discordances between DNA-
DNA hybridization and 16S rRNA gene analysis had added more
controversies regarding the species within the genus Aeromonas
[12,38,59].
In recent years, phylogenetic analysis of sequences of HKGs had
been recommended as an effective way to increase the discrimi-
natory power over 16S rRNA sequences analysis, and phylogenetic
studies based on cpn60, dnaJ, gyrB and rpoB gene sequences have
shown to be useful to identify species within a genus [3,6,14,44,54].
A highly conserved protein found in bacteria is Type I chaperonin
Cpn60 and gene sequences of it provided much better discriminate
ability than 16S rRNA gene at the species level in genus Aeromonas
[18,44]. The dnaJ gene, encoding heat shock protein 40, had been
demonstrated to be a good candidate gene for identication of the
species of the genera Legionella [35], Streptococcus [24] and Aero-
monas [49]. Phylogenetic analysis of gyrB gene (encoded the b-
subunit of DNA gyrase) discovered related species and it was also

http://dx.doi.org/10.1016/j.micpath.2016.10.016
0882-4010/ 2016 Elsevier Ltd. All rights reserved.
 S.L. Guo et al. / Microbial Pathogenesis 101 (2016) 12e23 13

used to characterize novel species within a genus [32,39,52]. Yanez from diseased eels in China and are listed in Table 1. The strains
et al. [67] reported an excellent molecular chronometer (gyrB gene) were grown overnight at 28
Con Tryptone soya agar base (TSA) and
sequence in discriminating the phylogenetic inference of 17 strains stored at 80
C in saline with 20% glycerol added. Thirty-two
of Aeromonas hydrophila [62]. The rpoB gene (B subunit of DNA- strains were ascertained as pathogenic bacteria by challenge test
dependent RNA polymerase) had also been used to identify Aero- as following [15,63,69]. Briey, bacterial suspension of 32 strains
monas strains [2,3,28,29,33,45]. was grown overnight in Tryptone soya broth (TSB) at 28
C for 18 h,
Eel (Japanese, European and American eel) is one of the most and the cells were harvested by centrifuging (3000  g, 10 min) and
important economic sh cultured in China, but diseases infected by washed three times with PBS. Bacteria were suspended in 10 mM
pathogenic bacteria limited the productivity and further develop- PBS (pH 7.4) and adjusted to the concentration of 1.0  108 cfu ml1.
ment of this industry [16,17,63,64], and some species of the genus Eels (7, 10 or 15 eels) were inoculated (i.p or i.m) with 0.1 ml bac-
Aeromonas had been implicated as pathogens in eels terial suspension respectively, and then reared in separate aquaria.
[10e12,25,68,69]. Traditional taxonomical identication of patho- Mortality was recorded daily up to 14 days.
genic bacteria in diseased eels was often inuenced by changeable
phenotypes [68]. Therefore, it is desirable to establish an alterna-
tive method to identify bacterial pathogens. In the present study, Table 2
we used phylogenetic analysis based on cpn60 gyrB, rpoB and dnaJ Primers used for PCR amplication and sequencing of 16S rRNA, cpn60, rpoB, gyrB
amino acid sequences to identify 32 pathogenic Aeromonas strains and dnaJ genes. Primer positions are given according to E. coli numbering. N, Any
isolated from diseased eels in recent 10 years. We referenced cor- nucleotide; R, A or G; S, C or G; Y, C or T; M, A or C.
responding sequences of type and reference strains of Aeromonas Primer Sequence (50 / 30 ) Reference
described thus far. Compared to other identication method based
16S rRNA
on Biolog system and 16S rRNA, phylogenetic method is more 27f AGAGTTTGATCCTGGCTCAG Moreno et al. [47]
reliable method. We investigated four independent phylogenetic 1492r ACGGCTACCTTGTTACGACTT Moreno et al. [47]
trees derived from the alignments of cpn60, rpoB, gyrB and dnaJ cpn60
C157 GAAATYGAACTGGAAGACAA ~ ana-Galbis et al. [44]
Min
amino acid instead of DNA sequences. The major aim of this study is
C938 GTYGCTTTTTCCAGCTCC ~ ana-Galbis et al. [44]
Min
to facilitate a reliable molecular method for identication of path- rpoB
ogenic Aeromonas from farmed eels in China. Pasrpob-L GCAGTGAAAGARTTCTTTGGTTC Kpfer et al. [32]
Rpob-R GTTGCATGTTNGNACCCAT Kpfer et al. [32]
gyrB
2. Materials and methods gyrB-3F TCCGGCGGTCTGCACGGCGT Soler et al. [62]
gyrB-14R TTGTCCGGGTTGTACTCGTC Soler et al. [62]
2.1. Bacterial strains dnaJ
Aero-dnaJF CGAGATCAAGAAGGCGTACAAG Nhung et al. [49]
Aero-dnaJR3 CACCACCTTGCACATCAGATC Nhung et al. [49]
Thirty-two Aeromonas strains used in this study were isolated

Table 1
Sources of 32 strains isolated from diseased eels used in the study.

Time Locations Species Major symptoms Organs Strains no. Challenge mortalitya

2002.8 Fuqing European eel Intestinal edema, skin bleeding Liver B09 1/10
B10 8/10
2002.9 Fuqing European eel Severe gill rot, sepsis Gill B11 15/15
Liver B14 8/15
2004.7 Fuqing European eel Liver khaki-colored, sepsis Liver B15 7/15
B20 15/15
B21 13/15
2004.8 Fuqing European eel Skin bleeding, sepsis Liver B26 9/15
B27 11/15
B28 13/15
2004.9 Fuqing European eel Skin bleeding, sepsis Liver B29 15/15
B30 15/15
B31 15/15
B32 15/15
2008.8 Shantou European eel Gill rot, red-mouth Liver B41 1/7
2008.8 Fuzhou Japanese eel Skin ulceration, sepsis Kidney B44 7/7
2009.5 Xiamen American eel Gill rot, intestinal edema Ascites B49 7/7
Gill B50 7/7
2009.6 Xiamen American eel Gill rot, sepsis Gill B51 7/7
Kidney B52 3/7
Heart B53 6/7
Gill B55 7/7
Liver B56 7/7
Liver B57 7/7
2009.7 Xiamen American eel Skin ulcers, liver congestion Liver B59 7/7
2009.8 Xiamen American eel Gill rot, skin bleeding Gill B60 7/7
2010.7 Xiamen American eel Tail ulceration, liver anemia Tail B65 7/7
Gill B66 7/7
2010.8 Xiamen American eel Fin bleeding, gill rot, liver anemia Gill B67 1/7
2010.8 Xiamen Japanese eel Fin congestion, gill rot, liver and kidney swollen Kidney B69 7/7
2010.9 Xiamen American eel Tail ulceration, liver anemia Liver B70 7/7
2010.9 Shantou European eel Tail ulceration and bleeding Heart B73 2/7
a
Numerator means dead eels, and denominator means challenged eels [10 g/eel, challenged (i.p or i.m) with 1  107 cfu bacteria/eel].
14 S.L. Guo et al. / Microbial Pathogenesis 101 (2016) 12e23

Table 3
Strains and accession numbers of GenBank sequences used in this study.

Strains 16S rRNA cpn60 gyrB rpoB dnaJ

Type or reference strains GenBank number

A. allosaccharophila S39232.2 EU306795 FN813470 AY851132 HQ443058

CECT 4199T CECT 4199T DSM 11576T CECT 4199T CECT 4199T
A. bestiarum AY987757 EU306796 FN691771 AY851097 HQ442989
ATCC23213 CECT4227T 68 F666i MDC162
A. caviae X74674.1 JF920578 AJ868400 JF972601 HQ443007
ATCC15468T E7EL42 ATCC15468T BCRC12286 MDC49
A. encheleia AJ224309 EU306802 HQ442655 AY851127 HQ443025
A1881 CECT4253 CECT 4253 ATCC35941 CECT4342T
A. enteropelogenes X71121.1 EU306836 FN796746 FN423800 HQ443038
DSM6394T CECT4255T ATCC49657T ATCC49657T CECT4255T
A. eucrenophila X60411.2 EU306803 AF417629 AY851117 HQ443015
NCIMB74T CECT4224T ATCC23309T F713E CECT4224T
A. hydrophila subsp. dhakensis AJ508765 EU306806 AM262163 DQ448289 AB280560
LMG19562T CECT5744T CIP107500T CIP107500T GTC2880
A. hydrophila subsp. hydrophila AB472954 EU306804 AY101778 AY851091 AB280561
JCM3995 CECT839T CECT839T ATCC7966T GTC2793
A. hydrophila subsp. ranae AM262151 EU306805 AM262162 DQ448290 AB280562
CIP107985T CIP107985T CIP107985T CIP107985T GTC2877
A. jandaei X60413.2 EU306807 AF242651 AY851121 HQ443074
ATCC49568T CECT4228T ATCC49568T ATCC49568T CECT4228T
A. media X60410.2 EU306808 FR682803 AY851112 HQ443012
ATCC33907T CECT4232T 179 ATCC33907T CECT4232T
A. molluscorum AY532690 EU306812 EF465523 DQ448284 HQ443000
848TT 849TT 869N LMG22218 CECT5864T
A. popofi AJ224308 EU306816 AF417636 AY851141 HQ442995
LMG317541 LMG17543 LMG17541 F548B CECT5176T
A. salmonicida subsp. achromogenes X60407.1 EU306824 AY101785 DQ448285 AB280568
NCIMB1110T LMG14900T CECT895T NCIMB1110T GTC2796
A. salmonicida subsp. masoucida AB027542 EU306825 AY101784 DQ448287 AB280569
JCM7873T CECT896T CECT896T ATCC27013T GTC2801
A. salmonicida subsp. pectinolytica AF134065 EU306827 AY101810 DQ448288 AB280570
34mel CECT5752T DSM12609T DSM12609T GTC2789
A. salmonicida subsp. salmonicida AY987751 EU306828 AY987517 AY851098 AB504903
CECT894T CECT894T CECT894T ATCC33658T RFAS1
A. salmonicida subsp. smithia AJ009859 EU306829 FN394064 DQ448286 AB280572
CCM4103T CIP104757T JF4097 NCIMB1320 GTC2883
A. schubertii X60416.2 EU741644 AF417628 FJ481641 HQ443088
ATCC43700T CECT4934 ATCC43700T CECT4254T CECT4240T
A. simiae AJ536821 EU306833 HQ442759 AY851143 HQ443083
IBS S6874T CIP107798T MDC55 IBSS 6874T MDC2374
A. sobria X60412.2 EU306834 HQ442698 AY851119 HQ443076
NCIMB12065T CECT4245T CECT4245T CIP7433T CECT4245T
A. veronii bv. sobria JF313415 EU306839 FR682510 EU313543 HM584530
Fars89A10b CECT4246 28 LMG13067 LMG13695
A. veronii bv. veronii X60414.2 EU306840 HM584527 AY851122 HM584528
ATCC35624T CIP107763T AMC35 ATCC35624T ATCC35624T
Filed strains isolated from diseased eels
B09 FJ494889 JQ004738 JQ234883 JQ004759 JQ074060
B10 JQ040101 JQ040090 JQ234884 JQ004760 JQ074061
B11 FJ494891 JQ004739 JQ234885 JQ004761 JQ074062
B14 FJ494894 JQ040091 JQ234886 JQ004762 JQ074063
B15 FJ494895 JQ004740 JQ234887 JQ004763 JQ074064
B20 JQ040102 JQ004741 JQ234892 JQ004764 JQ074065
B21 FJ494898 JQ040092 JQ234893 JQ004765 JQ074066
B26 JQ040103 JQ040093 JQ234894 JQ004766 JQ074067
B27 FJ494900 JQ040094 JQ234895 JQ004767 JQ074068
B28 JQ040104 JQ040095 JQ234896 JQ004768 JQ074069
B29 JQ040105 JQ004742 JQ234897 JQ004769 JQ074070
B30 JQ040106 JQ004743 JQ234898 JQ004770 JQ074071
B31 JQ040107 JQ004744 JQ234899 JQ004771 JQ074072
B32 JQ040108 JQ004745 JQ234900 JQ004772 JQ074073
B41 JQ040109 JQ040096 JQ234901 JQ040088 JQ074074
B44 JQ040110 JQ004746 JQ234902 JQ004773 JQ074075
B49 JQ040111 JQ040097 JQ234903 JQ004774 JQ074076
B50 JQ040112 JQ040098 JQ234904 JQ004775 /
B51 JQ040113 JQ004747 JQ234905 JQ004776 JQ074077
B52 JQ040114 JQ004748 JQ234906 JQ004777 JQ074078
B53 JQ040115 JQ040099 JQ234888 JQ004778 /
B55 JQ040116 JQ004749 JQ234889 JQ004779 JQ074079
B56 JQ040117 JQ004750 JQ234907 JQ004780 JQ074080
B57 JQ040118 JQ004751 JQ234890 JQ004781 JQ074081
B59 JQ040119 JQ004752 JQ234908 JQ004782 JQ074082
 S.L. Guo et al. / Microbial Pathogenesis 101 (2016) 12e23 15

Table 3 (continued )

Strains 16S rRNA cpn60 gyrB rpoB dnaJ

Type or reference strains GenBank number

B60 JQ040120 JQ004753 JQ234909 JQ004783 JQ074083

B65 JQ040121 JQ004754 JQ234891 JQ004784 /
B66 JQ040122 JQ004755 JQ234910 JQ004785 JQ074084
B67 JQ040123 JQ004756 JQ234911 JQ004786 JQ074085
B69 JQ004789 JQ040100 JQ234912 JQ004787 JQ074086
B70 JQ040124 JQ004757 JQ234913 JQ040089 JQ074087
B73 JQ045713 JQ004758 JQ234883 JQ004788 JQ074088

/: amplied no sequences.

2.2. Identication of 32 strains by Biolog system
Before this study, we identied 32 strains according to the 10th
edition of Bergey's Manual of Systematic Bacteriology in the year of
2012, and the result of these study shows the same taxonomic
names as the Biolog system [68]. Thirty-two strains were identied
by Biolog semi-Automatic Microbiology Analysis System (GeneIII,
Biolog Inc. USA) and the method was referred to the manual: a
bacteria sample was cultured on Biolog Recommended Agar Media
(BUG agar added 5% Blood) at 28
C and a colony was isolated to a
tube containing 10 ml IF-A (Biolog Catalog #72401). The bacteria
sample was adjusted to an appropriate turbidity (98% turbidity as
the blank tube) using a turbid meter and the cell suspension were
poured into the multichannel pipet reservoir. 96 MicroPlate wells
were lled with 100 ml suspension, and then the MicroPlate was
covered with its lid and placed into an incubator for 16e24 h at
28
C. The result was ascertained by reading MicroPlates using
Micro Station and OmniLog Software.
2.3. DNA extraction and PCR amplication
Genomic DNA was prepared using a TIANamp Bacterial DNA kit

Table 4
Results of 32 strains of pathogenic Aeromonas analysis by Biolog Microbial Identication System.

No. Strain no. Biolog Identication System No. Strain no. Biolog Identication System

Identication result Similarity Identication result Similarity

01 B10 A. hydrophila 0.966 17 B57 A. hydrophila 0.992

02 B11 A. hydrophila 0.944 18 B60 A. hydrophila 0.858
03 B15 A. hydrophila 0.953 19 B65 A. hydrophila 0.732
04 B20 A. hydrophila 1.000 20 B66 A. hydrophila 0.983
05 B26 A. hydrophila 0.895 21 B70 A. hydrophila 0.996
06 B27 A. hydrophila 0.885 22 B09 A. veronii 0.868
07 B28 A. hydrophila 0.947 23 B41 A. veronii 0.617
08 B30 A. hydrophila 0.834 24 B52 A. veronii 0.887
09 B31 A. hydrophila 0.858 25 B59 A. veronii 0.946
10 B32 A. hydrophila 0.855 26 B67 A. veronii 0.201
11 B44 A. hydrophila 0.998 27 B69 A. veronii 0.812
12 B49 A. hydrophila 0.992 28 B73 A. veronii 0.300
13 B50 A. hydrophila 0.582 29 B14 A. caviae 0.935
14 B51 A. hydrophila 0.989 30 B53 A. caviae 0.897
15 B55 A. hydrophila 0.996 31 B29 A. jandaei 0.834
16 B56 A. hydrophila 0.955 32 B21 A. jandaei 0.467

Table 5
Analysis of 32 Aeromonas (isolated from diseased eels) sequences from cpn60, gyrB, dnaJ, rpoB, 16S rRNA and concatenated three genes (cpn60-gyrB-rpoB).

Sequence information 16S rRNA cpn60 gyrB rpoB dnaJ cpn60-gyrB-rpoB

Number of sequences 32 32 32 32 29 32
No. of sites 1132 685 904 483 855 2072
No. of polymorphic sites (%) 67 (6.0%) 143 (20.9%) 183 (20.2%) 49 (10.1%) 181 (21.2%) 375 (18.1%)
Parsimony informative sites 32 120 134 37 135 291
No. of nt differences (range) 0e35 0e84 0e85 0e27 0e109 0e190
No. of nt differences (mean SE) 14.2 2.2 45.8 3.8 43.9 3.9 10.6 3.9 54.7 3.9 100.6 5.8
d (range) 0e0.043 0e0.134 0e0.104 0e0.058 0e0.140 0e0.098
d (mean SE)a 0.014 0.002 0.071 0.007 0.052 0.005 0.022 0.004 0.068 0.005 0.051 0.003
Rb (si/sv) 2.6 (11/4) 1.90 (30/16) 3.09 (33/11) 4.05 (9/2) 2.11 (37/18) 2.51 (72/29)
dSc N/A 0.302 0.031 0.222 0.020 0.095 0.016 0.280 0.027 0.088 0.008
dNd N/A 0.008 0.003 0.006 0.002 0.000 0.000 0.011 0.003 0.035 0.003
dS > dNe N/A P < 0.001 P < 0.001 P < 0.001 P < 0.001 P < 0.001

N/A: not applicable.

a
Jukes-Cantor distance standard error.
b
R: transiton/transversion ratio.
c
dS: number of synonymous substitutions per synonymous site standard error (Nei-Gobojori method using Jukes-Cantor distance).
d
dN: number of non-synonymous substitutions per non-synonymous site standard error (Nei-Gobojori method using Jukes-Cantor distance).
e
Acceptatin probability of a nule hypothesis of dS dN with dS > dN as the alternative hypothesis, using a Z-test.
16 S.L. Guo et al. / Microbial Pathogenesis 101 (2016) 12e23

Table 6
Intra- and inter-specic ranges of nucleotide differences of all cpn60, dnaJ, gyrB, rpoB, 16S rRNA and concatenated three genes (cpn60-gyrB-rpoB) sequences of 32 strains
isolated from eels.

Species A. hydrophila group 1 A. hydrophila group 2 A. veronii A. jandaei A. caviae

Number of strains 11 10 7 2 2
16S rRNA (1132bp, nt difference) Ranges of intra-species 0e9 0e36 0e8 5 9
Ranges of inter-species 10e33 5e44 6e44 5e36 1e30
cpn60 (685bp, nt difference) Ranges of intra-species 0e23 0e12 6e19 11 10
Ranges of inter-species 38e75 38e72 35e84 35e78 45e84
gyrB (904bp, nt difference) Ranges of intra-species 0e30 0e16 9e61 24 24
Ranges of inter-species 33e66 33e67 42e84 23e86 46e86
rpoB (483bp, nt difference) Ranges of intra-species 0e10 0e4 1e6 5 2
Ranges of inter-species 7e25 7e25 8e27 7e27 20e27
cpn60-gyrB-rpoB (2072bp, nt difference) Ranges of intra-species 0e51 0e24 25e80 40 36
Ranges of inter-species 85e144 85e147 75e190 75e189 118e190
Number of strains 11 8 7 2 1
dnaJ (855bp, nt difference) Ranges of intra-species 0e31 0e34 11e25 24 N/A
Ranges of inter-species 38e85 38e89 43e102 43e90 67e102

N/A: not applicable.

(Biotech. USA) and nally eluted in water. The sets of primers used
for amplication and sequencing of 16S rRNA, cpn60, rpoB, gyrB and
dnaJ genes are listed in Table 2. 16S rRNA gene sequences of these
strains were determined by a protocol described previously [47].
Amplication of cpn60 (about 555 bp) was performed as the
method of Min ~ ana-Galbis et al. [43] using primers C157 and C938.
Amplication reactions of dnaJ (approximately 805 bp) performed
as described by Nhung et al. [49] using primers Aero-dnaJF and
Aero-dnaJR3. A fragment of the gyrB gene (about 1100 bp) was
amplied and sequenced using primers gyrB-3F and gyrB-14R [62].
A fragment of approximately 517 bp from the rpoB gene was
amplied and sequenced as described by Kpfer et al. [32].
2.4. Accession numbers
The 157 accession sequencing numbers of 16S rRNA, cpn60,
rpoB, gyrB and dnaJ sequences and 115 referenced accession
numbers are list in Table 3. Raw sequence data of ve genes were
checked to conrm variable positions and insertions/deletions
found in the alignment. Translation of nucleotide sequences to
proteins of 4 HKGs was achieved to conrm no stop codons in the
middle of these sequences.
2.5. Phylogenetic analyses
The nucleotide sequence of 16S rRNA and amino acid sequences
of cpn60, rpoB, gyrB and dnaJ genes were aligned respectively by the
CLUSTAL_X program (version 1.83) [66]. DNA polymorphism data
was showed by phylogeny calculations, substitutions of synony-
mous and non-synonymous and Z-test of neutrality (dS dN).
Neighbour-joining (NJ) [61] analyses based on nucleotide or amino
acid sequences alignments and maximum-parsimony (MP) ana-
lyses [9] based on nucleotide excluding the third cordon position
alignments of 55 strains (23 referenced strains) were performed
using MEGA software, version 4.1 [65] respectively. Genetic dis-
tances were obtained using the Jukes-Cantor model [27]. A phylo-
genetic tree was also constructed from combined amino acid
sequences of cpn60, dnaJ, rpoB, gyrB genes using the Poisson
correction method [71]. Insertions/deletions found in each
compared pair of two different strains were completely excluded
from all comparisons. Bootstrap analyses were performed using
1000 replications for NJ and MP.
3. Results
In this study, four species of Aeronomas (A. hydrophila, A. veronii,
A. caviae, and A. jandaei) were isolated from diseased eels (Table 1).
The identied results by the Biolog Microbial Identication System
showed that the 32 isolates were identied as A. hydrophila (21),
A. veronii (7), A. jandaei (2) and A. caviae (2) (Table 4). The similarity
rate of 26 isolates was more than 0.80, but 2 strains of A. hydrophila
(B50 0.582, B65 0.732), 3 strains of A. veronii (B41 0.617,
B67 0.201, B73 0.300) and 1 strains of A. jandaei (B21 0.461)
were lower than 0.80.
One hundred and fty-seven sequences of ve genes were ob-
tained in our study (Table 3) except for three dnaJ gene sequences
(B50, B53, B65) that were not amplied by the referenced primers.
Gene lengths of 32 Aeromonas strains analyzed in the study were:
1132 bp for 16S rRNA (ranging from positions 68e1199), 685 bp for
cpn60 (positions 241e925), 854 bp for dnaJ (positions 518e1410),
904 bp for gyrB (positions 400e1303) and 483 bp for the gene of
rpoB (positions 1564e2046) (Table 5). Analyses of 16S rRNA, cpn60,
gyrB, rpoB and dnaJ sequences were obtained using the 157 se-
quences. Distances were calculated as the Jukes-Cantor (JC69)
model, the nucleotide substitutions number per site (d) was below
0.15 (0e140), and the transition to transversion rate (R) ranged
from 1.90 to 4.05. The average and the range pairwise distances of
JC69 are shown in Table 5. Signicant Differences (p < 0.001, Wil-
coxon signed rank test) between distances were obtained in four
HKGs, respectively. The mean gene divergences (mean SE) of 16S
rRNA, cpn60, gyrB, rpoB and dnaJ in 32 and 29 isolates were
1.4 0.2%, 7.1 0.7%, 5.2 0.5%, 2.2 0.4% and 6.8 0.5%
respectively. Divergences of three HKGs (cpn60, gyrB, dnaJ) proved
greater gene divergences than that of 16S rRNA and rpoB gene. 16S
rRNA gene, with the largest number of nucleotides, has the smallest
number of parsimony-informative sites, and the number of
parsimony-informative sites of rpoB was also smallest in 4 House
Keeping Genes (HKGs) of cpn60, gyrB, rpoB and dnaJ.
Similarities of thirty-two 16S rRNA sequences ranged from 96.9
to 100% (0e35 different nucleotides). The number of total variable
positions was 67 (about 6.0% of the determined fragment), corre-
sponding to 32 parsimony informative sites. Overlapping between
intra- and inter-species ranges of 16S rRNA was found for almost all
the species of A. hydrophila group 2 (10 strains, A. hydrophila subsp.
hydrophila and subsp. ranae), A. veronii, A. jandaei and A. caviae
except for A. hydrophila group 1 (11 strains, A. hydrophila subsp.
dhakensis) (Table 6). The phylogenetic tree based on 1095bp of 55
16S rRNA sequences (Fig. 1) showed separated strain-clusters only
for the species of A. veronii and 8 strains of A. hydrophila group 2. A
referenced strain identied as A. media (ATCC 33907) was unex-
pected clustered as A. hydrophila group 1. A strain of A. hydrophila
group 2 (B11) and a type strain of A. enteropelogenes (DSM6394)
 S.L. Guo et al. / Microbial Pathogenesis 101 (2016) 12e23 17

Fig. 1. Phylogenetic reconstructions based on individual analyses of the 16S rRNA of 55 sequences using the neighbour-joining method. Bars, 0.002 expected nucleotide sub-
stitutions per site. Only bootstrap values above 50% are shown (1000 resamplings) at branching points.

were located at the cluster of A. caviae. In the cluster of A. jandaei, a (percentage of 1000 replicates) ranged from 35% to 94%.
strain identied as A. hydrophila group 2 (B30) exhibited close re- Sequences exhibited 143, 183, 181 and 49 polymorphic sites for
lationships with 2 strains of A. veronii. The bootstrap values cpn60 (20.9%), gyrB (20.2%), dnaJ (21.2%) and rpoB (10.1%)
18 S.L. Guo et al. / Microbial Pathogenesis 101 (2016) 12e23

respectively, corresponding to 120, 134, 135 and 37 parsimony
informative sites (Table 5). Neither insertion nor deletion was
detected in the sequences of three HKGs (cpn60, gyrB and rpoB), but
to 29 sequences of dnaJ, all sequences showed one triplet insertion
(position 545) and six triplet deletion (position 624, 671, 686, 776,
779, 919). One sequence of A. caviae (B14) showed additional two
triplet deletion at position 649 and 735.
The pairwise differences of cpn60 ranged from 0 to 84 nucleo-
tides (0e12.3%), with the overall number of nucleotide differences
of 45.8 3.8 (Table 5). Overlapping of the intra- and inter-species
ranges of cpn60 was not found in four pathogenic Aeromonas spe-
cies (Table 6). The corresponding cpn60 phylogenetic tree (NJ)
based on 185 amino acids of 55 sequences (Fig. 2a) showed separate
clusters for 30 strains except for 2 strains identied as A. jandaei
(B21 & B29), which exhibited close relationships with seven strains
of A. veronii. Bootstrap values (percentage of 1000 replicates) of two
trees ranged from 52 to 99% and from 42 to 84%, respectively.
Sequence similarity of the gyrB between 32 strains ranged from
90.6% to 100% (0e85 nucleotide differences), showing the mean
number of nucleotide differences of 43.9 3.9 (Table 5).
Overlapping of intra- and inter-species ranges was found in B21
(A. jandaei) and B73 (A. veronii) since it showed 23 nucleotide dif-
ferences compare to 24 nucleotide differences between two strains
of A. jandaei (B21 & B29) (Table 6). In addition, intra-species be-
tween B73 and other six strains of A. veronii ranged from 55 to 61
nucleotide differences, which is higher than the differences of its
inter-species (42e84 nucleotide differences). The corresponding NJ
phylogenetic tree (Fig. 2b) derived from 55 amino acids (145 po-
sitions) sequences alignment showed unexpected clusters not only
between A. jandaei and A. veronii, but also between A. hydrophila
and A. veronii and between two A. hydrophila groups. The bootstrap
values (percentage of 1000 replicates) were lower than 50% except
for the cluster of A. caviae (63%).
Strain sequence similarities of gene rpoB of 32 strains ranged
from 94.4% to 100% (0e27 nucleotide differences) (Table 5). In all
sequences of four HKGs, the minimum inter-species substitution
rate was found in rpoB gene (Table 6), and inter-species substitution
rate of A. hydrophila group 2 (1.4e5.2%) clearly overlapped with its
intra-species (0e2.1%). Phylogenetic trees (NJ) derived from amino
acid sequences of 55 sequences (151 positions) (Fig. 2c) were

Fig. 2. Phylogenetic reconstructions based on individual analyses of the Cpn60 (a), GyrB (b), RpoB (c) and DnaJ (d) of 55 sequences using the neighbour-joining method. Bars, 0.005
(aeb), 0.001 (c) and 0.01 (d) expected amino acid substitutions per site. Only bootstrap values above 50% are shown (1000 resamplings) at branching points.
 S.L. Guo et al. / Microbial Pathogenesis 101 (2016) 12e23
Fig. 2. (continued).
consistent with all 50 strains, except for the unexpected location
found for referenced strains A. simiae S6874 and A. schubertii
CECT4254, which clustered with 66% bootstrap value, and
A. encheleia ATCC35941, A. molluscorum LMG22218 and
A. eucrenophila F713E clustered with the bootstrap value of 28%.
The dnaJ sequence alignment yielded sequence similarities
ranging from 87.3% to 100% (0e109 nucleotide differences)
(Table 5), and the intra- and inter-species ranges of dnaJ overlapped
were not found in 4 species of 29 sequences (Table 6). Phylogenetic
tree derived from 234 amino acids of 52 sequences (Fig. 2d) showed
separate clusters for four species of 28 strains except for one strains
of A. jandaei (B21). However, relatively low bootstrap were found
for clusters of A. hydrophila group 1 (54%), A. hydrophila group 2
(54%), and A. jandaei (26%). Phylogenetic reconstruction based on
amino acid sequences of concatenated cpn60-rpoB-gyrB is a sound
method for bacterial Aeromonas pathogens identication which
classied 32 pathogens into distinct 5 groups (Fig. 3). Numbers of
nucleotide differences between intra and inter species of 5 groups
were obviously separated in 32 pathogens isolated from eels
19
(Table 6).
4. Discussion
After comparing the results of amino acid based analysis and
nucleotide based analysis excluding the third cordon position of 4
HKGs, we found out the nucleotide based analysis was not con-
servative as the respective amino acid sequences based analysis.
Four phylogenetic trees were obtained based on amino acid instead
of nucleotide sequences in order to construct a consistent molec-
ular method for pathogenic Aeromonas identication in eels
farming. So far, we did not found similar study based on amino acid
instead of nucleotide sequences in the study of bacteria identi-
cation. Phylogenetic trees based on nucleotide sequence of cpn60
created 5 groups in 32 isolates in our another study [68], and many
studies showed that phylogenetic trees based on nucleotide se-
quences of cpn60, gyrB and dnaJ separated Aeromonas in the species
level of type strains [2,13,32,44,49,52,59,62]. However, 32 strains of
Aeromonas used in this study cannot be completely separated in the
20 S.L. Guo et al. / Microbial Pathogenesis 101 (2016) 12e23

Fig. 3. Phylogenetic reconstruction based on concatenated Cpn60-RpoB-GyrB amino acid sequences. Analysis was done using the neighbour-joining method. Bar, 0.005 expected
amino acid substitutions per site. Only bootstrap values above 50% are shown (1000 resamplings) at branching points.
 S.L. Guo et al. / Microbial Pathogenesis 101 (2016) 12e23
species level based on the amino acid sequences of 4 HKGs, and it
may be explained by the relatively conservative of the amino acid
sequences. Phylogenetic trees of four genes were produced by the
neighbour-joining (Fig. 2) method since maximum parasimony
trees gave the same overall clustering of strains with no signicant
differences [51].
The intra- and inter-specic threshold values of cpn60 were
established by Min ~ ana-Galbis et al. [44] with 3.5% intra-specic
divergence rates, and inter-specic rates between 3.7 and 16.9%.
Studies showed the intra- and inter-specic threshold values were
3% and >3% for gyrB and rpoB genes, and 5.2% and >5.2% for dnaJ
genes [14,44,49]. Divergence rate of the intra- and inter-species of 4
species (ve groups) for cpn60 were 3.4% (0e23 nucleotides) and
from 5.1 to 11.7% (35e84 nucleotides) respectively. It was less than
or equal to 4.0% (0e34 nucleotides) and from 4.4 to 11.9% (38e102
nucleotides) for dnaJ, respectively (Table 6). In terms of the gyrB and
rpoB gene as well as 16S rRNA gene, overlappings between intra-
and inter-species of ve groups were distinctively and we acquired
no divergence rate (Table 6). All A. hydrophila subspecies were in a
monophyletic group in the gyrB and rpoB trees, but these were in
contrast to the 16S rRNA gene, cpn60 and dnaJ trees, on which
A. hydrophila subsp. dhakensis belonged to a separate cluster from
the remaining A. hydrophila subspecies [42,49]. Min ~ ana-Galbis et al.
[44] suggested that A. hydrophila subsp. dhakensis could be
considered as a new Aeromonas species and concluded that the
cpn60 UT sequence (555 bp) showed a clear differentiation between
A. molluscorum and A. bivalvium strains, similar to the result ob-
tained by AFLP ngerprinting [23,59]. Study of dnaJ gene in our
study (Fig. 2d) conrmed that dnaJ gene is a promising phyloge-
netic marker in the genus Aeromonas [2,14].
In the present study, cpn60 and dnaJ sequencing was shown to
have a better discriminatory power for pathogenic Aeromonas
strains isolated from diseased eels (Fig. 2a and d). The amino acid
sequences of cpn60 showed a powerful tool not only for differen-
tiating A. hydrophila group 1/A.media, A. hydrophila (B30)/A.jandaei
and A.caviae/A.enteropelogenes, but also for the pairs of species
A. hydrphila group 1/A. hydrphila group 2, A. caviae/A. veronii and
A. caviae/A. jandaei, with mean inter-species distances of 1.1, 3.6 and
3.5% respectively (Table 6). However, the pair of A. veronii/
A. jandaei, which showed <0.1% inter-species distances and could
not properly clustered by cpn60 gene, was separated by dnaJ gene
with 2.4% inter-species divergences. In addition, dnaJ also gave
sound resolution for separating the pairs of A. hydrphila group 1/
A. hydrphila group 2, A. caviae/A. veronii and A. caviae/A. jandaei,
with mean inter-species distances of 0.4, 8.5 and 7.1%, respectively.
In contrast, gyrB and rpoB sequences were found to be more
conserved than cpn60 and dnaJ sequences in our study. The gyrB
gene could only separate A. caviae from other species and strains
groupings were consistent in rpoB phylogenetic trees, in which
sequence (amino acids) similarity between all 32 isolates and 18
referenced strains were 100% and clustered in a monophyletic
group. However, results of other researchers [62] showed gyrB was
a better resolution for differentiating the pairs of Aeromonas sp.
HG11/A. encheleia and A. veronii/A. culicicola/A. allosaccharohila and
rpoB differentiated A. salmonicida more clearly from A. bestiarum at
inter-species level using phylogenitic trees based on nucleotide
sequences. For 4 protein-encoding HKGs, we examined the amino
acid instead of nucleotide sequences, applying NJ and MP analyses
using the Poisson correction. Due to more conservative character of
amino acid sequences, these sequences should be result in a less
clear separation between species [51]. However, to 32 strains iso-
lated from eels, phylogenetic trees derived from 55 amino acid
sequences of cpn60 and 52 amino acid sequences of dnaJ got similar
separating results as the analyses of its nucleotide sequences (data
not show). Therefore, it can be concluded that the 16S rRNA, gyrB
21
and rpoB sequences were not adequate for resolution of the 32
pathogenic Aeromonas. In contrast, the other two genes, cpn60 and
dnaJ, can generally resolve each of the four species, although
several strains of A. jandaei cluster together with A. veronii in the
phylogenetic tree of cpn60 (Fig. 2a).
In this study, phylogenetic trees derived from cpn60 and dnaJ
grouped A. allosaccharophila and A. veronii on the same branch, in
agreement with the result reported by Nhung et al. [49]. Huys et al.
[19] concluded that members of the species A. allosacchrophila was
belong to the species A. veronii. DNA-DNA hybridization, as well as
AFLP genotyping and dnaJ sequencing studies [20,44], conrmed
that A. allosacchrophila could be considered as A. veronii. In addi-
tion, A. sobria, A. enteropelogenes, A. media, A. eucrenophila, A.
molluscorum, A. encheleia, A. popofi, A. schubertii, A. simiae, A. sal-
monicida and A. bestiarum were represented in the trees by their
type strains only. The housekeeping gene derived trees for these
species had been obtained and analyzed by other researchers
[2,14,32,44,49,52,59,62].
A strain of A. caviae (B53) was identied as A. bestiarum at rst,
but it clustered within the A. caviae by three trees (Figs. 1, 2a and b).
Therefore, we reidentied it by the Biolog system, the result
showed it was actually A. caviae. Pascual et al. [51] reidentied eight
environmental Vibrio strains according to the clustered result of six
genes (16S rRNA, recA, pyrH, rpoD, gyrB, rctB), they found out four of
them identied as V. haveyi were reidentied as V. rotiferianus.
Finally, similarity of the Biolog identication result of a strain of
A. veronii (B67 0.201) and a strain of A. jandaei (B21 0.467) is
relatively low, indicating Biolog system is not suitable to identify it,
but B67 and B21 was clustered in A. veronii and A. jandaei respec-
tively by the concatenated phylogenetic tree of three HKGs (Fig. 3).
Identication of Aeromonas species based on sequencing of
different genes was generally applied in type strains or environ-
mental samples. In this study, the use of taxonomical identication
by Biolog system and function genes allowed us to clarify the re-
lationships of taxonomy and the phylogenetic of Aeromonas strains
isolated from farming eels. The results of our study indicated 16S
rRNA, gyrB and rpoB gene sequencing were useful to dene isolates
at the genus level for 32 pathogenic Aeromonas isolated from eels.
In contrast, cpn60 and dnaJ sequences were a powerful method in
differentiating 32 strains of pathogenic Aeromonas at species level.
Moreover, although amino acid sequences are more conserved than
nucleotide sequences, we agree completely with the suggestion of
using cpn60 and dnaJ amino acid instead of nucleotide sequences
not only for sound identication of Aeromonas species in phyloge-
netic trees but also for strain differentiation of closely relationship
isolates from diseased eels. The present work demonstrated that
the resolution of independent single gene (cpn60 and dnaJ)
contributed to a clearer identication of some relatively low simi-
larity strains of the genus Aeromonas identied by Biolog system
(gene III).
Acknowledgements
This work has been nanced by a National Natural Science
Foundation of China (No. 31001136), the Natural Science Founda-
tion of Fujian Province (No. 2015J01143) and Regional development
project of science and Technology Department of Fujian Province
(No. 2016N3002).
References
~ oz, C. Rodrguez-Martnez, G. Castro-
[1] M.G. Aguilera-Arreola, M. Portillo-Mun
Escarpulli, Usefulness of Chromogenic CromoCen AGN agar medium for the
identication of the genus Aeromonas: assessment of faecal samples, J. Aquat.
Anim. Health 90 (2012) 100e104.
[2] A. Alperi, A.J. Martnez-Murcia, W.C. Ko, A. Monera, M.J. Saavedra,
22 S.L. Guo et al. / Microbial Pathogenesis 101 (2016) 12e23
M.J. Figueras, Aeromonas taiwanensis sp. nov. and Aeromonas sanarellii sp. nov.,
clinical species from Taiwan, Int. J. Syst. Evol. Microbiol. 60 (2010) 2048e2055.
[3] A. Alperi, A.J. Martnez-Murcia, A. Monera, M.J. Saavedra, M.J. Figueras, Aero-
monas uvialis sp. nov., isolated from a Spanish river, Int. J. Syst. Evol.
Microbiol. 60 (2010) 72e77.
[4] R. Beaz-Hidalgo, F. Latif-Eugenn, M.J. Figueras, The improved PCR of the fstA
(ferric siderophore receptor) gene differentiates the sh pathogen Aeromonas
salmonicida from other Aeromonas species, Vet. Microbiol. 166 (2013)
659e663.
[5] R. Beaz-Hidalgo, F. Latif-Eugenn, M.J. Hossain, K. Berg, R.M. Niemi, J. Rapala,
C. Lyrac, M.R. Lilesb, M.J. Figueras, Aeromonas aquatica, sp. nov. aeromonas
nlandiensis, sp. nov. and aeromonas lacus, sp. nov. isolated from nnish
waters associated with cyanobacterial blooms, Syst. Appl. Microbiol. 38 (2015)
161e168.
[6] R. Beaz-Hidalgo, A. Martnez-Murcia, M.J. Figueras, Reclassication of aero-
monas hydrophila, subsp. dhakensis, huys et al. 2002 and aeromonas aqua-
riorum, martnez-murcia et al. 2008 as aeromonas dhakensis, sp. nov. comb
nov. and emendation of the species aeromonas hydrophila, Syst. Appl. Micro-
biol. 36 (2013) 171e176.
[7] S. Dallaire-Dufresne, J.G. Emond-Rheault, S.A. Atte re
, K.H. Tanaka, M.V. Trudel,
M. Frenette, S.J. Charette, Optimization of a plasmid electroporation protocol
for Aeromonas salmonicida subsp. salmonicida, J. Microbiol. Methods 98 (2014)
44e49.
[8] G.H. Dar, S.A. Dar, A.N. Kamili, M.Z. Chishti, F. Ahmad, Detection and charac-
terization of potentially pathogenic aeromonas sobria, isolated from sh
hypophthalmichthys molitrix, (cypriniformes: cyprinidae), Microb. Pathog. 91
(2016) 136e140.
[9] R.V. Eck, M.O. Dayhoff, Atlas of Protein Sequence and Structure, National
Biomedical Research Foundation, Silver Springs, Maryland, 1966.
[10] C. Esteve, C. Amaro, A.E. Toranzo, O-serogrouping and surface components of
Aeromonas hydrophila and Aeromonas jandaei pathogenic for eels, FEMS
Microbiol. Lett. 117 (1994) 85e90.
[11] C. Esteve, M.C. Gutie rrez, A. Ventosa, Aeromonas encheleia sp. nov., isolated
from European eels, Int. J. Syst. Evol. Microbiol. 45 (1995) 462e466.
[12] C. Esteve, L. Valera, C. Gutie rrez, A. Ventosa, Taxonomic study of sucrose-
positive Aeromonas jandaei-like isolates from faeces, water and eels: emen-
dation of A. jandaei Carnahan et al. 1992, Int. J. Syst. Evol. Microbiol. 53 (2003)
1411e1419.
[13] M.J. Figueras, A. Suarez-Franquet, M. Chacon, L. Soler, M. Navarro, C. Alejandre,
B. Grasa, A. Martinez-Murcia, J. Guarro, First record of the rare species Aero-
monas culicicola from a drinking water supply, Appl. Environ. Microbiol. 71
(2005) 538e541.
[14] M.J. Figueras, A. Alperi, R. Beaz-Hidalgo, E. Stackebrandt, E. Brambilla,
A. Monera, A.J. Martnez-Murcia, Aeromonas rivuli sp. nov., isolated from the
upstream region of a karst water rivulet, Int. J. Syst. Evol. Microbiol. 61 (2011)
242e248.
[15] P. Guo, N. Wang, Y.J. Liu, L.U. Cheng-Ping, Antimicrobial susceptibility and
characterization of outer membrane proteins of aeromonas hydrophila iso-
lated in China, J. Integr. Agric. 13 (4) (2014) 911e917.
[16] S.L. Guo, The Pathogenic Bacteria Identication and Correlative Immune
Studies in Eels, Institute of Hydrobiology, Chinese Academy of Sciences,
Wuhan, 2006, pp. pp.14e80.
[17] S.L. Guo, Y. Wang, R.Z. Guan, J.J. Feng, Q.H. Yang, P.P. Lu, L.L. Hu, J.P. Zhao,
Immune effects of a bivalent expressed outer membrane protein to American
eels (Anguilla rostrota), Fish Shellsh. Immunol. 35 (2013) 213e220.
[18] J.E. Hill, S.L. Penny, K.G. Crowell, S.H. Goh, S.M. Hemmingsen, cpnDB: a
chaperonin sequence database, Genome Res. 14 (2004) 1669e1675.
[19] G. Huys, M. Cnockaert, J. Swings, Aeromonas culicicola Pidiyar et al. 2002 is a
later subjective synonym of Aeromonas veronii Hickman-Brenner et al. 1987,
Syst. Appl. Microbiol. 28 (2005) 604e609.
[20] G. Huys, R. Coopman, P. Janssen, K. Kersters, High-resolution genotypic
analysis of the genus Aeromonas by AFLP ngerprinting, Int. J. Syst. Evol.
Microbiol. 46 (1996) 572e580.
[21] G. Huys, P. Ka mpfer, M. Altwegg, R. Coopman, P. Janssen, M. Gillis, K. Kersters,
Inclusion of Aeromonas DNA hybridization group 11 in Aeromonas encheleia
and extended descriptions of the species Aeromonas eucrenophila and
A. encheleia, Int. J. Syst. Evol. Microbiol. 47 (1997) 1157e1164.
[22] G. Huys, P. K ampfer, M. Vancanneyt, R. Coopman, P. Janssen, K. Kersters, Effect
of the growth medium on the cellular fatty acid composition of aeromonads:
consequences for the chemotaxonomic differentiation of DNA hybridization
groups in the genus Aeromonas, J. Microbiol. Methods 28 (1997) 89e97.
[23] G. Huys, J. Swings, Evaluation of a uorescent amplied fragment length
polymorphism (FAFLP) methodology for the genotypic discrimination of
Aeromonas taxa, FEMS Microbiol. Lett. 177 (1999) 83e92.
[24] Y. Itoh, Y. Kawamura, H. Kasai, M.M. Shah, P.H. Nhung, M. Yamada, X. Sun,
T. Koyana, M. Hayashi, K. Ohkusu, dnaJ and gyrB gene sequence relationship
among species and strains of genus Streptococcus, Syst. Appl. Microbiol. 29
(2006) 368e374.
[25] S.J. Joh, E.H. Ahn, H.J. Lee, G.W. Shin, J.H. Kwon, C.G. Park, Bacterial pathogens
and ora isolated from farm-cultured eels (Anguilla japonica) and their envi-
ronmental waters in Korean eel farms, Vet. Microbiol. 163 (2013) 190e195.
[26] S.W. Joseph, A. Carnahan, The isolation, identication, and systematics of the
motile Aeromonas species, Annu. Rev. Fish. Dis. 4 (1994) 315e343.
[27] T.H. Jukes, C.R. Cantor, Evolution of protein molecules, in: H.N. Munro (Ed.),
Mammalian Protein Metabolism, Academic Press, New York, 1969, pp.
21e132.
[28] B. Korczak, H. Christensen, S. Emler, J. Frey, P. Kuhnert, Phylogeny of the
family Pasteurellaceae based on rpoB sequences, Int. J. Syst. Evol. Microbiol. 54
(2004) 1393e1399.
[29] B.M. Korczak, R. Stieber, S. Emler, A.P. Burnens, J. Frey, P. Kuhnert, Genetic
relatedness within the genus Campylobacter inferred from rpoB sequences, Int.
J. Syst. Evol. Microbiol. 56 (2006) 937e945.
[30] A. Kozin  ska, Dominant pathogenic species of mesophilic aeromonads isolated
from diseased and healthy sh cultured in Poland, J. Fish Dis. 30 (2007)
293e301.
[31] K. Krovacek, K. Huang, S. Sternberg, S.B. Svenson, Aeromonas hydrophila sep-
ticaemia in a grey seal (Halichoerus grypus) from the Baltic Sea: a case study,
Comp. Immunol. Microbiol. Infect. Dis. 21 (1998) 43e49.
[32] M. Kpfer, P. Kuhnert, B.M. Korczak, R. Peduzzi, A. Demarta, Genetic re-
lationships of Aeromonas strains inferred from 16S rRNA, gyrB and rpoB gene
sequences, Int. J. Syst. Evol. Microbiol. 56 (2006) 2743e2751.
[33] B. Lamy, F. Laurent, A. Kodjo, Validation of a partial rpoB gene sequence as a
tool for phylogenetic identication of aeromonads isolated from environ-
mental sources, Can. J. Microbiol. 56 (2010) 217e228.
[34] C.C. Lazado, C.M.A. Caipang, M.F. Brinchmann, V. Kiron, In vitro adherence of
two candidate probiotics from Atlantic cod and their interference with the
adhesion of two pathogenic bacteria, Vet. Microbiol. 148 (2011) 252e259.
[35] H. Liu, Y. Li, X. Huang, Y. Kawamura, T. Ezaki, Use of the dnaJ gene for the
detection and identication of all Legionella pneumophila serogroups and
description of the primers used to detect 16S rDNA gene sequences of major
members of the genus Legionella, Microbiol. Immunol. 47 (2003) 859e869.
[36] Z. Ma, H. Yang, T. Li, L. Luo, J. Gao, Isolation and identication of pathogenic
Aeromonas veronii isolated from infected Siberian sturgeon (Acipenser baerii),
Wei Sheng Wu Xue Bao Acta. Microbiolo. Sin. 49 (2009) 1289e1294.
[37] A.J. Martnez-Murcia, A. Monera, M.J. Saavedra, R. Oncina, M. Lopez-Alvarez,
E. Lara, M.J. Figueras, Multilocus phylogenetic analysis of the genus Aero-
monas, Syst. Appl. Microbiol. 34 (2011) 189e199.
[38] A.J. Martnez-Murcia, A. Monera, A. Alperi, M.J. Figueras, M.J. Saavedra,
Phylogenetic evidence suggests that strains of Aeromonas hydrophila subsp.
dhakensis belong to the species Aeromonas aquariorum sp. nov, Curr. Micro-
biol. 58 (2009) 76e80.
[39] A.J. Martnez-Murcia, M. Saavedra, V. Mota, T. Maier, E. Stackebrandt,
S. Cousin, Aeromonas aquariorum sp. nov., isolated from aquaria of ornamental
sh, Int. J. Syst. Evol. Microbiol. 58 (2008) 1169e1175.
[40] A.J. Martnez-Murcia, Phylogenetic positions of Aeromonas encheleia, Aero-
monas popofi, Aeromonas DNA hybridization group 11 and Aeromonas group
501, Int. J. Syst. Evol. Microbiol. 49 (1999) 1403e1408.
[41] A.J. Martnez-Murcia, L. Soler, M.J. Saavedra, M.R. Chaco  n, J. Guarro,
E. Stackebrandt, M.J. Figueras, Phenotypic, genotypic, and phylogenetic dis-
crepancies to differentiate Aeromonas salmonicida from Aeromonas bestiarum,
Int. Microbiol. 8 (2010) 259e269.
[42] D. Min ~ ana-Galbis, M. Farfan, V. Albarral, A. Sanglas, J.G. Lore n, M.C. Fuste
,
Reclassication of Aeromonas hydrophila subspecies anaerogenes, Syst. Appl.
Microbiol. 36 (2013) 306e308.
[43] D. Min ~ ana-Galbis, M. Farfan, J.G. Loren, M.C. Fuste , Proposal to assign Aero-
monas diversa sp. nov. as a novel species designation for Aeromonas group
501, Syst. Appl. Microbiol. 33 (2010) 15e19.
[44] D. Min ~ ana-Galbis, A. Urbizu-Serrano, M. Farfa n, M.C. Fuste, J.G. Loren, Phylo-
genetic analysis and identication of Aeromonas species based on sequencing
of the cpn60 universal target, Int. J. Syst. Evol. Microbiol. 59 (2009)
1976e1983.
[45] C. Mollet, M. Drancourt, D. Raoult, rpoB sequence analysis as a novel basis for
bacterial identication, Mol. Microbiol. 26 (1997) 1005e1011.
[46] A. Morandi, O. Zhaxybayeva, J.P. Gogarten, J. Graf, Evolutionary and diagnostic
implications of intragenomic heterogeneity in the 16S rRNA gene in Aero-
monas strains, J. Bact. 187 (2005) 6561e6564.
[47] C. Moreno, J. Romero, R.T. Espejo, Polymorphism in repeated 16S rRNA genes
is a common property of type strains and environmental isolates of the genus
Vibrio, Microbiology 148 (2002) 1233e1239.
[48] F. Natrah, M.I. Alam, S. Pawar, A.S. Harzevili, N. Nevejan, N. Boon, P. Sorgeloos,
P. Bossier, T. Defoirdt, The impact of quorum sensing on the virulence of
Aeromonas hydrophila and Aeromonas salmonicida towards burbot (Lota lota
L.) larvae, Vet. Microbiol. 159 (2012) 77e82.
[49] P.H. Nhung, H. Hata, K. Ohkusu, M. Noda, M.M. Shah, K. Goto, T. Ezaki, Use of
the novel phylogenetic marker dnaJ and DNAeDNA hybridization to clarify
interrelationships within the genus Aeromonas, Int. J. Syst. Evol. Microbiol. 57
(2007) 1232e1237.
[50] M. Nielsen, L. Hi, A. Schmidt, D. Qian, T. Shimada, J. Shen, J. Larsen, Is Aero-
monas hydrophila the dominant motile Aeromonas species that causes disease
outbreaks in aquaculture production in the Zhejiang Province of China? Dis.
Aquat. Organ 46 (2001) 23e29.
[51] J. Pascual, M.C. Macian, D.R. Arahal, E. Garay, M.J. Pujalte, Multilocus sequence
analysis of the central clade of the genus Vibrio by using the 16S rRNA, recA,
pyrH, rpoD, gyrB, rctB and toxR genes, Int. J. Syst. Evol. Microbiol. 60 (2010)
154e165.
[52] V.J. Pidiyar, K. Jangid, K. Dayananda, A. Kaznowski, J.M. Gonzalez, M.S. Patole,
Y.S. Shouche, Phylogenetic afliation of Aeromonas culicicola MTCC 3249 T
based on gyrB gene sequence and PCR-amplicon sequence analysis of cytolytic
enterotoxin gene, Syst. Appl. Microbiol. 26 (2003) 197e202.
[53] J.W. Pridgeon, D. Zhang, L. Zhang, Complete genome sequence of the highly
 S.L. Guo et al. / Microbial Pathogenesis 101 (2016) 12e23
virulent aeromonas hydrophila al09e71 isolated from diseased channel catsh
in west alabama, Genome Announc. 2 (3) (2014).
[54] J.W. Pridgeon, M. Yildirim-Aksoy, P. Klesius, K. Kojima, J.A. Mobley,
K. Srivastava, P. Reddy, Identication of gyrB and rpoB gene mutations and
differentially expressed proteins between a novobiocin-resistant Aeromonas
hydrophila catsh vaccine strain and its virulent parent strain, Vet. Microbiol.
166 (2013) 624e630.
[55] J.W. Pridgeon, P.H. Klesius, X. Mu, D. Carter, K. Fleming, D. Xu, K. Srivastava,
G. Reddy, Identication of unique DNA sequences present in highly virulent
2009 Alabama isolates of Aeromonas hydrophila, Vet. Microbiol. 152 (2011)
117e125.
[56] J.W. Pridgeon, P.H. Klesius, L. Song, D. Zhang, K. Kojima, J.A. Mobley, Identi-
cation, virulence, and mass spectrometry of toxic ECP fractions of West
Alabama isolates of Aeromonas hydrophila obtained from a 2010 disease
outbreak, Vet. Microb. 164 (2013) 336e343.
[57] M. Rahman, T. Somsiri, K. Tajima, Y. Ezura, Distribution of Aeromonas sp.
emphasizing on a newly identied species of Aeromonas sp. T8 isolated from
sh and aquatic animals in Southeast Asia, Pak. J. Biol. Sci. 7 (2004) 258e268.
[58] M.E. Reith, R.K. Singh, B. Curtis, J.M. Boyd, A. Bouevitch, J. Kimball,
J. Munholland, C. Murphy, D. Sarty, J. Williams, The genome of Aeromonas
salmonicida subsp. salmonicida A449: insights into the evolution of a sh
pathogen, BMC genomics 9 (2008) 1e15.
[59] M. Saavedra, M. Figueras, A. Martnez-Murcia, Updated phylogeny of the
genus Aeromonas, Int. J. Syst. Evol. Microbiol. 56 (2006) 2481e2487.
[60] A. Sanglas, V. Albarral, M. Farfan, J.G. Lore
n, M.C. Fuste
, Direct evidence of
recombination in the recA, gene of Aeromonas bestiarum, Syst. Appl. Microbiol.
39 (2) (2016) 106e114.
[61] N. Saitou, M. Nei, The neighbor-joining method: a new method for recon-
structing phylogenetic trees, Mol. Biol. Evol. 4 (1987) 406e425.
[62] L. Soler, M. Yanez, M. Chacon, M.G. Aguilera-Arreola, V. Catala n, M. Figueras,
23
A. Martnez-Murcia, Phylogenetic analysis of the genus Aeromonas based on
two housekeeping genes, Int. J. Syst. Evol. Microbiol. 54 (2004) 1511e1519.
[63] G. SongLin, F. JianJun, Y. QiuHua, G. RuiZhang, W. Yu, L. PanPan, Immune ef-
fects of bathing European eels in live pathogenic bacteria, Aeromonas hydro-
phila, Aquac. Res. 45 (2014) 913e921.
[64] G. SongLin, L. PanPan, F. JianJun, Z. JinPing, L. Peng, D. LiHua, A novel re-
combinant bivalent outer membrane protein of Vibrio vulnicus and Aero-
monas hydrophila as a vaccine antigen of American eel (Anguilla rostrata), Fish
Shellsh Immunol. 43 (2015) 477e484.
[65] K. Tamura, J. Dudley, M. Nei, S. Kumar, MEGA4: molecular evolutionary ge-
netics analysis (MEGA) software version 4.0, Mol. Biol. Evol. 24 (2007)
1596e1599.
[66] J.D. Thompson, T.J. Gibson, F. Plewniak, F. Jeanmougin, D.G. Higgins, The
CLUSTAL_X windows interface: exible strategies for multiple sequence
alignment aided by quality analysis tools, Nucleic Acids Res. 25 (1997)
4876e4882.
[67] M. Yanez, V. Catalan, D. Apraiz, M. Figueras, A. Martinez-Murcia, Phylogenetic
analysis of members of the genus Aeromonas based on gyrB gene sequences,
Int. J. Syst. Evol. Microbiol. 53 (2003) 875e883.
[68] Q.H. Yang, Isolation and Identication of the Pathogenic Aeromonas spp. from
Farmed Eels, JiMei University, XiaMen, China, MD, 2012, pp. 16e24.
[69] S.W. Yi, M.J. You, H.S. Cho, C.S. Lee, J.K. Kwon, G.W. Shin, Molecular charac-
terization of Aeromonas species isolated from farmed eels (Anguilla japonica),
Vet. Microbiol. 164 (2013) 195e200.
[70] D. Zhang, J.W. Pridgeon, P.H. Klesius, Expression and activity of recombinant
proaerolysin derived from Aeromonas hydrophila cultured from diseased
channel catsh, Vet. Microb. 165 (2013) 478e482.
[71] E. Zuckerkandl, L. Pauling, Evolutionary divergence and convergence in pro-
teins, Evol. Genes Proteins 97 (1965) 97e166.