Sunteți pe pagina 1din 53

Natanael Lamas Dias

IDENTIFICAO DE Staphylococcus aureus, AVALIAO DO SEU


POTENCIAL ENTEROTOXIGNICO E RESISTNCIA A METICILINA
PELA TCNICA DE PCR EM AMOSTRAS DE LEITE DA
MICRORREGIO DE SETE LAGOAS-MG, 2009.

Dissertao apresentada Universidade Federal


de Minas Gerais, Escola de Veterinria, como
requisito parcial para obteno do ttulo de
Mestre em Cincia Animal.

rea: Medicina Veterinria Preventiva

Orientador: Prof. Dr. Nivaldo da Silva

Belo Horizonte
Maro/2010
FICHA CATALOGRFICA/Dever ser feita pela Biblioteca/EV/UFMG -(verso p.1)

2
ASSINATURA DA BANCA = pgina 3 verso em branco..........................................

3
= pgina verso em branco..........................................

4
Dedico este trabalho a todos os brasileiros por terem custeado meus estudos e a realizao deste
sonho.

5
AGRADECIMENTOS

A Deus pela constante iluminao na minha vida,

Aos meus pais, Jos Viana e Selma e aos meus irmos, Leandro e Nathan, por toda dedicao,
companheirismo, amizade e amor e por sempre estarem estimulando meu crescimento pessoal.

Aos meus avs maternos (in memorian), que tenho muita saudade, pelo exemplo e
ensinamentos que contriburam muito na minha formao pessoal e aos meus avs paternos pela
amizade e carinho.

minha noiva, Daniela Cristina, companheira inseparvel, pelo carinho e por ter sido minha
maior incentivadora nesse mestrado, contribuindo muito para concretizao desse trabalho.

Ao meu orientador, professor Nivaldo da Silva, pelo apoio, incentivo e ensinamentos que foram
valiosos no meu aperfeioamento profissional.

todos os membros da banca examinadora, por aceitarem contribuir com este trabalho.

toda equipe do LANAGRO - Pedro Leopoldo, em especial ao Pedro Mota, Anapolino,


Marcelo, Antnio Augusto e Ana Cludia, por terem permitido a realizao desse trabalho nas
dependncias do LANAGRO.

equipe do LBM do LANAGRO, em especial a Mariana e ao Antnio Augusto por terem me


ajudado muito na realizao desse experimento.

Ao meu primo Maximiller pela amizade e pela colaborao neste trabalho.

equipe de microbiologia do LANAGRO, em especial a Sozinha por ter contribudo com


muita presteza na parte microbiolgica desse experimento.

6
SUMRIO

RESUMO ..................................................................................................... 10
ABSTRACT.................................................................................................. 11
1 INTRODUO ........................................................................................... 12
2 REVISO DE LITERATURA ................................................................... 13
2.1 Produo do leite............................................................................ 13
2.2 Qualidade do leite........................................................................... 16
2.3 Mamite bovina................................................................................ 17
2.4 Staphylococcus aureus .................................................................. 18
2.5 Intoxicao alimentar e Enterotoxinas........................................... 19
2.6 Staphylococcus aureus resistente Meticilina (MRSA)................ 22
2.7 PCR no diagnstico molecular ...................................................... 25
3 MATERIAL E MTODOS......................................................................... 26
3.1 Local de realizao do experimento............................................... 26
3.2 PCR................................................................................................. 26
3.3 Amostras bacterianas...................................................................... 27
3.4 Amostras de Leite........................................................................... 27
3.4.1 Contagem Bacteriana Total (CBT) e Contagem de Clulas
(CCS). ............................................................................................................ 27
3.5 Extrao de DNA........................................................................... 27
3.6 Reao de PCR e Deteco dos genes fem A, sea, seb, sec e mec A.
.................................................................................................................... 28
3.7 Otimizao da PCR........................................................................ 28
3.8 Especificidade da tcnica de PCR.................................................. 29
3.9 Sensibilidade da tcnica de PCR.................................................... 29
3.10 Utilizao da tcnica de PCR nas amostras de leite de tanque de
expanso. ....................................................................................................... 29
3.11 Anlises Estatsticas ......................... ............................................ 30
4 RESULTADOS............................................................................................. 31
4.1 Especificidade................................................................................. 31
4.2 Sensibilidade................................................................................... 31
4.2.1 Resultado da avaliao da sensibilidade................................. 34
4.3 Amostras clnicas............................................................................ 34
5 DISCUSSO................................................................................................. 36
6 CONCLUSO............................................................................................... 39
7 REFERNCIAS BIBLIOGRFICAS....................................................... 40

LISTA DE QUADROS

Quadro 01- Principais Microrregies produtoras de leite no Brasil.................................. 14


Quadro 02- Iniciadores utilizados...................................................................................... 27

6
LISTA DE TABELAS

Tabela 01- Estimativas de prevalncia de quartos infectados no rebanho e de perdas


de produo em relao CCSLT. ................................................................ 30

Tabela 02- Distribuio das amostras de leite com relao CBT e a presena de S.
aureus, identificadas pela amplificao do gene fem A , procedentes de
produtores rurais da microrregio de Sete Lagoas-MG, 2009....................... 35

Tabela 03- Distribuio das amostras de leite com relao CCS e a presena de S.
aureus, identificadas pela amplificao do gen fem a, procedentes de
produtores rurais da microrregio de Sete Lagoas-MG, 2009....................... 35

LISTA DE FIGURAS

Figura 1- Microrregio de Sete Lagoas ......................................................................... 14


Figura 2- Produtos de PCR utilizando iniciador FEM A. Canaleta 1 DNA de S.
aureus extrado de leite. Canaleta 2- DNA de S. aureus extrado de meio
BHI. Canaleta 3 - DNA de S. epidermidis extrado de meio BHI e M:
Padro de tamanho molecular (DNA Ladder 100 pb) visualizados sob luz
U.V. em gel de agarose 1,5%, corados com brometo de etdio (1,5
mg/mL)........................................................................................................... 31
Figura 3- Placas de BHI semeadas com leite contaminado nas diluies 10 -5, 10 -6 e
10 -7 , apresentando colnias de S. aureus. .................................................... 31
Figura 4- Produtos de PCR obtidos com DNA extrado a partir de diluies seriadas
de S. aureus, utilizando iniciador FEM A (132 pb), M: Padro de tamanho
molecular (DNA Ladder 1 Kb); 1- Diluio 10-; 2- Diluio 10-; 3-
Diluio 10-; 4- Diluio 10 -4; 5- Diluio 10 -5; 6- Diluio 10 -6; 7-
Diluio 10 -7 ; 8- Diluio 10 -8; 9- Diluio 10 -9, visualizados sob luz
U.V. em gel de agarose 1,5%, corados com brometo de etdio (1,5
mg/mL)........................................................................................................... 32

Figura 5- Figura 5: Produtos de PCR obtidos com DNA extrado a partir de diluies
seriadas de S. aureus, utilizando iniciador MEC A (533 pb): Diluio 10-;
2- Diluio 10-; 3- Diluio 10-; 4- Diluio 10 -4; 5- Diluio 10 -5; 6-
Diluio 10 -6; 7- Diluio 10 -7; 8- Diluio 10 -8; 9- Diluio 10 -9 ;M:
Padro de tamanho molecular (DNA Ladder 1 Kb), visualizados sob luz
U.V. em gel de agarose 1,5%, corados com brometo de etdio (1,5
mg/mL)........................................................................................................... 32

Figura 6- Produtos de PCR obtidos com DNA extrado a partir de diluies seriadas
de S. aureus, utilizando iniciador SEA (102 pb). M: Padro de tamanho
molecular (DNA Ladder 1 Kb); 1- Diluio 10-; 2- Diluio 10-; 3-
Diluio 10-; 4- Diluio 10 -4; 5- Diluio 10 -5; 6- Diluio 10 -6; 7-
Diluio 10 -7; 8- Diluio 10 -8; 9- Diluio 10 -9 visualizados sob luz U.V.
em gel de agarose 1,5%, corados com brometo de etdio (1,5 mg/mL)......... 33

8
Figura 7- Produtos de PCR obtidos com DNA extrado a partir de diluies seriadas
de S. aureus, utilizando iniciador SEB (164 pb). M: Padro de tamanho
molecular (DNA Ladder 1 Kb); 1- Diluio 10-; 2- Diluio 10-; 3-
Diluio 10-; 4- Diluio 10 -4; 5- Diluio 10 -5; 6- Diluio 10 -6; 7-
Diluio 10 -7 ; 8- Diluio 10 -8; 9- Diluio 10 -9, visualizados sob luz
U.V. em gel de agarose 1,5%, corados com brometo de etdio (1,5
mg/mL)........................................................................................................... 33

Figura 8- Produtos de PCR obtidos com DNA extrado a partir de diluies seriadas
de S. aureus, utilizando iniciador SEC (451 pb): 1- Diluio 10-; 2-
Diluio 10-; 3- Diluio 10-; 4- Diluio 10 -4; 5- Diluio 10 -5; 6-
Diluio 10 -6; 7- Diluio 10 -7; 8- Diluio 10 -8; 9- Diluio 10 -9 ; M:
Padro de tamanho molecular (DNA Ladder 1 Kb), visualizados sob luz
U.V. em gel de agarose 1,5%, corados com brometo de etdio (1,5
mg/mL)........................................................................................................... 34

Figura 9- Distribuio dos genes produtores de enterotoxinas das 145 amostras de S.


aureus identificadas pela presena do gene fem A em amostras de leite da
microrregio de Sete Lagoas-MG, 2009........................................................ 36

ANEXOS

Anexo 01 Resultados das amostras analisadas............................................................... 48

9
RESUMO

Neste trabalho foi realizada a identificao de Staphylococcus aureus e a avaliao do seu


potencial enterotoxignico a partir de amostras de leite de bovinos de propriedades rurais
localizadas na microrregio de Sete Lagoas-MG, no perodo de maro a junho de 2009.
Utilizou-se a extrao de DNA de S. aureus diretamente de amostras de leite, seguida da
amplificao pela tcnica da PCR dos genes fem A, sea, seb e sec. Os S. aureus resistentes
Meticilina (MRSA) foram detectados pela amplificao do gene mec A. A avaliao da
sensibilidade e especificidade da tcnica foi realizada em leite artificialmente contaminado com
amostras de S. aureus padro (ATCC 25923, ATCC 13565, ATCC 14458, ATCC 19095 e
ATCC 33591) em concentrao bacteriana conhecida. A especificidade foi demonstrada pela
presena de produtos de PCR de tamanho esperado ao utilizar como molde, o DNA das
amostras de referncia (controle positivo) e pela ausncia de amplificao do DNA de S.
epidermidis (controle negativo). O limite de deteco dos microrganismos foi de 10 UFC/mL
para todos os genes avaliados com os iniciadores especficos. Foram analisadas 200 amostras de
leite de tanque de expanso da microrregio de Sete Lagoas -MG, quanto presena do gene
fem A. Das 200 amostras estudadas analisou-se estatisticamente se houve correlao entre a
presena de S. aureus identificados nas amostras de leite com maiores Contagens bacteriana
totais (CBT) e se as maiores Contagens de clulas somticas (CCS) tambm estavam
relacionadas com a maior presena de S. aureus. Dessas 200 amostras, em 145 (72,5%) houve
amplificao do gene fem A e estas foram analisadas quanto presena dos genes sea, seb, sec e
mec A. Os genes das enterotoxinas mais prevalentes foram: sea (60%), seguida de seb (37,93%)
e posteriormente sec (6,89%). Foram encontradas 18 amostras de leite (11,03 %) com S. aureus
portadores do gene mec A, identificando a presena de MRSA no leite da microrregio estudada.
No houve correlao entre as taxas de identificao de S. aureus e altas CCS e CBT. A
deteco de S. aureus diretamente do leite, sem a necessidade de isolamento bacteriano, e a
caracterizao do potencial enterotoxignico sugere a utilizao da tcnica de PCR para estudos
epidemiolgicos das infeces estafiloccicas da glndula mamria. O alto percentual (72,5%)
de amostras de leite positivas para a presena do gene fem A, sugere que S. aureus constitui-se
em um dos principais agentes causadores de infeces intramamrias na microrregio de Sete
Lagoas-MG e que seu potencial enterotoxignico representa um risco potencial sade pblica.
Ressalta-se que a presena de MRSA evidencia a seleo de microorganismos resistentes a
antibiticos, provavelmente devido ao uso indiscriminado de antibiticos alm de comprometer
a qualidade do leite e de produtos derivados tambm um risco a sade humana.

Palavras chave: Staphylococcus aureus,enterotoxinas, MRSA, PCR

10
ABSTRACT

The identification of Staphylococcus aureus in milk and the evaluation of its potential
enterotoxic were evaluable during period from march to june of 2009, on the milk samples from
cattle farms located in the microregion of Sete Lagoas-MG. A protocol for DNA extraction
from S. aureus directly from milk samples, followed by amplifications by PCR of the genes fem
A, sea, seb and sec were used. The Methicillin resistant Staphylococcus aureus (MRSA) were
detected by amplification of the mec A gene. The sensitivity and specificity of the technique
was tested in milk artificially contaminated milk using a decimal dilution of S. aureus standard
strains (ATCC 25923, ATCC 13565, ATCC 14458, ATCC 19095 and ATCC 33591). The
detection limit of microorganisms was 10 CFU / mL for all genes evaluated with specific
primers. The specificity was determined by the presence of expected PCR products from the
DNA of the reference strains (positive control) and not amplified DNA from S. epidermidis
(negative control). 200 milk samples from the expansion tank from the microregion of Sete
Lagoas-MG were available for the presence of the gene fem A. The results were analyzed
statistically if there was a relationship between the presence of S. aureus identified in milk
samples with higher Total bacteria cont (CBT) and the largest somatic cell cont (CCS) were also
related to increased presence of S. aureus. Of the 200 samples, 145 (72.5%) amplified the gene
fem A, and were analyzed for the presence of genes sea, seb, sec and mec A. The genes of
enterotoxins most prevalent were: sea (60%), followed by seb (37.93%) and then sec (6.89%).
There were found 18 milk samples (11.03%) with S. aureus carriers of the gene mec A,
identifying the presence of MRSA. There was no correlation between the rates of identification
of S. aureus and high CCS or CBT. The detection of S. aureus directly from milk, without the
need for bacterial isolation, and characterization of its enterotoxic potential suggests the use of
this PCR technique for epidemiological studies of staphylococcal infections. In addition, the S.
aureus is one of the major causative pathogen of intramammary infections in the microregion of
Sete Lagoas-MG and have a high potential enterotoxic. It is represents a potential risk to public
health. It should be noted that the presence of MRSA highlights the selection of antibiotics
resistant microorganisms, suggesting that the indiscriminate use of antibiotics in addition to
compromising the quality of milk and milk products is a risk to human health.

Keywords: Staphylococcus aureus,enterotoxins, MRSA, PCR

11
1. INTRODUO Sua presena no leite e derivados representa
srio problema sade pblica. Os sinais
O leite um alimento de alto valor clnicos observados nessa intoxicao
nutricional considerado como importante incluem nusea, vmito, diarria, dores
fonte de protena, energia, clcio, fsforo e abdominais, cefalia, entre outros. No se
vitaminas. Segundo dados da produo sabe ao certo qual a dimenso desse problema
pecuria do Instituto Brasileiro de Geografia na sociedade, devido subnotificao dessa
e Estatstica (IBGE, 2009), no primeiro enfermidade, o que refora a importncia da
trimestre de 2009, Minas Gerais foi o Estado inspeo e medidas de controle sanitrio dos
com a maior produo de leite do pas, com alimentos destinados ao consumo humano.
26,8% do total produzido. Dentre as
principais regies produtoras de leite em Devido m utilizao dos antimicrobianos
Minas Gerais encontra-se a microrregio de disponveis no mercado e a alta capacidade
Sete Lagoas. adaptativa dos S. aureus, houve uma seleo
de resistncia destes microorganismos a
A produo leiteira afetada por diversos diversos antimicrobianos. Atualmente,
fatores relacionados ao manejo e s doenas. amostras de S. aureus resistentes a meticilina
Na pecuria leiteira a mamite a enfermidade (MRSA) so reconhecidamente um dos
de maior prevalncia e economicamente a principais problemas de infeco hospitalar,
que mais causa prejuzos a esta atividade. tambm com relatos de infeces em animais.
Geralmente essa doena de natureza
infecciosa podendo ser causada por diferentes A produo de enterotoxinas por linhagens de
microorganismos e sua ocorrncia S. aureus pode ser determinada por diversas
determinada pelas interrelaes entre o tcnicas, entre elas a Sensibilidade tima em
hospedeiro, o ambiente e o agente infeccioso. Placa (OSP) e mtodos imunoenzimticos. A
O principal microorganismo envolvido nesta tcnica da reao da polimerase em cadeia
enfermidade o Staphylococcus aureus, (PCR) detecta os genes envolvidos na
bactria amplamente distribuda na natureza, produo de enterotoxinas estafiloccicas,
sendo veiculada aos alimentos e ao gado podendo com isso avaliar o potencial
leiteiro principalmente por portadores enterotoxignico das amostras isoladas, uma
assintomticos. vez que a bactria pode apresentar o gene,
porm sem o expressar.
No homem o S. aureus est presente na
superfcie da pele, destacando a regio das Mediante o risco de intoxicao alimentar
mos, mucosa nasal, olhos, garganta, trato pelas toxinas produzidas pelo S. aureus e a
gastrintestinal, sendo comumente encontradas importncia dessa enfermidade para a sade
em feridas e infeces. Essas bactrias pblica, trabalhos que objetivam identificar o
produzem vrias enterotoxinas (SE) que so microorganismo e o seu potencial de
importantes causadoras de intoxicaes de produo de toxinas nos alimentos
origem bacteriana no homem e animais, apresentam grande relevncia, a fim de
sendo consideradas como a principal causa de avaliar o risco de contaminao alimentar.
toxi-infeces alimentares no mundo. As
enterotoxinas estafiloccicas so resistentes Devido importncia das toxinas na
hidrlise de enzimas do trato gastrintestinal e patogenicidade de S. aureus veiculados em
so termoestveis, resistindo pasteurizao. alimentos como o leite e seus derivados e a

12
resistncia dos S. aureus a antibiticos Brasil ser considerado o sexto produtor
utilizados no tratamento de mamite, este mundial com aproximadamente 26,1 bilhes
trabalho objetivou identificar S. aureus de litros (EMBRAPA, 2009), o consumo per
utilizando a tcnica de PCR, com extrao de capta brasileiro estimado para 2010, segundo
DNA realizada diretamente das amostras de dado da FAO (2004), de 129,72 litros no
leite, avaliao do potencial enterotoxignico satisfazendo a exigncia mnima de 180 litros
dos S. aureus pela identificao dos genes por habitante ano, preconizada pela
que codificam as enterotoxinas A, B e C, Organizao Mundial de Sade (Guimares,
alm do destaque para deteco de MRSA, no 2006).
leite de tanques de expanso da microrregio
de Sete Lagoas MG. O Estado de Minas Gerais, maior produtor de
leite do pas (IBGE, 2009), possui 10
2. REVISO DE LITERATURA macrorregies e 66 microrregies. Dentre
estas microrregies, destaca-se a microrregio
2.1- Produo de leite de Sete Lagoas (Fig.1) composta pelos
municpios de Araa, Baldim, Cachoeira da
O leite um dos alimentos mais completos Prata, Caetanpolis, Capim Branco,
que existem na natureza por conter protenas Cordisburgo, Fortuna de Minas, Funilndia,
de alto valor biolgico, por sua riqueza em Inhama, Jaboticatubas, Jequitib,
clcio e fsforo e por conter notveis Maravilhas, Matozinhos, Papagaios,
quantidades de vitaminas A e B2, alm de Paraopeba, Pequi, Prudente de Morais,
exercer uma influncia reguladora sobre a Santana de Pirapama, Santana do Riacho e
flora bacteriana do trato intestinal (Luz, Sete Lagoas. Essa uma das principais
2008). regies produtoras de leite do Brasil, sendo
que em 2007 ocupou o trigsimo primeiro
A produo mundial de leite foi de 560,5 lugar nacional, com uma produo de 177
milhes de toneladas em 2007, sendo 66% milhes de litros de leite.
desse volume produzido na Europa e na
Amrica. A expanso da produo tem O Quadro 1 registra, pela ordem, as
registrado crescimento maior nos pases em microrregies que produziram, em 2007, mais
desenvolvimento, com destaque para os de 130 milhes de litros.
asiticos e latino-americanos. Apesar de o

13
Figura 1 Microrregio de Sete Lagoas- MG

Quadro 01: Principais Microrregies produtoras de leite no Brasil.


Produo de Leite (milhes litros) Produtividade (litros/vaca/ano)
UF Microrregio 2003 2004 2005 2006 2007 2003 2004 2005 2006 2007
1 SC Chapec 289 333 355 405 503 2.593 2.508 2.617 2.649 2.901
2 PR Toledo 319 367 394 425 441 2.892 3.047 3.171 3.443 3.511
3 GO Meia Ponte 360 372 373 361 392 1.137 1.159 1.114 1.147 1.158
4 RO Ji-Paran 327 370 389 347 376 762 760 762 764 787
5 SC So Miguel dOeste 271 327 334 366 347 2.274 2.632 2.520 2.523 2.425
6 MG Patos de Minas 297 312 326 320 328 2.012 2.000 2.051 1.975 1.982
7 MG Frutal 344 330 339 320 327 1.031 1.031 1.036 1.026 1.039
8 RS Passo Fundo 216 224 275 310 326 2.718 2.765 3.132 3.502 3.982
9 MG Arax 287 302 301 301 317 2.053 2.083 2.018 2.030 2.038
10 PR Ponta Grossa 267 270 304 302 300 3.560 3.553 4.302 4.607 4.706
11 GO Sudoeste de Gois 300 295 291 285 297 1.468 1.453 1.461 1.462 1.472
12 MG Patrocnio 226 235 245 270 287 2.037 2.127 2.208 2.383 2.494
13 MG Uberlndia 214 214 223 258 271 1.399 1.354 1.388 1.363 1.334
14 PR Francisco Beltro 212 233 223 249 266 1.960 1.991 1.739 1.942 2.373
15 MG Paracatu 220 228 238 233 264 1.396 1.373 1.387 1.396 1.441
16 MG Passos 160 199 244 240 261 1.572 1.672 2.128 2.014 2.086
17 MG Bom Despacho 253 272 280 282 256 2.564 2.542 2.323 2.328 2.289
18 RS Lajeado Estrela 150 173 172 191 217 2.363 2.607 2.514 2.635 2.756

14
continuao
Produo de Leite (milhes litros) Produtividade (litros/vaca/ano)
UF Microrregio 2003 2004 2005 2006 2007 2003 2004 2005 2006 2007
19 PE Vale do Ipanema 88 104 142 178 202 1.700 1.881 2.180 2.285 2.289
20 GO Entorno de Braslia 180 198 210 208 200 987 1.039 1.087 1.104 1.097
21 MG Trs Marias 146 171 176 177 199 2.279 2.333 2.342 2.473 2.518
22 MG Juiz de Fora 158 171 194 194 199 1.413 1.453 1.577 1.522 1.556
23 SC Concrdia 148 163 169 203 195 2.292 2.379 2.375 2.327 2.325
24 SC Xanxer 102 112 135 154 191 2.680 2.698 2.988 3.093 3.490
25 RS Trs Passos 152 152 175 186 188 2.018 2.023 2.296 2.382 2.444
26 RS Erechim 108 110 114 117 185 1.875 1.936 2.015 1.852 1.839
27 PR Foz do Iguau 140 144 170 168 182 2.416 2.501 2.792 2.707 2.790
28 RS Guapor 131 139 142 147 178 2.875 2.962 3.008 3.024 3.346
29 GO Anpolis 176 181 185 182 178 1.036 1.036 1.038 1.040 1.057
30 GO Pires do Rio 105 113 177 179 177 1.288 1.321 1.386 1.393 1.404
31 MG Sete Lagoas 151 163 180 181 177 2.281 2.377 2.467 2.476 2.456
33 GO Porangatu 167 171 176 179 176 1.023 1.030 1.052 1.068 1.082
34 RS Santa Rosa 141 163 175 186 173 2.273 2.232 2.439 2.509 2.593
35 GO Ceres 210 211 204 178 168 1.040 1.043 1.014 1.006 1.006
36 MG Divinpolis 150 157 156 163 162 2.038 2.126 2.107 2.144 2.161
37 PR Cascavel 49 112 181 222 161 976 1.250 1.608 1.910 1.443
38 RS Frederico Westphalen 99 99 108 120 160 1.803 1.829 1.891 1.699 1.677
39 MG Piu 136 139 145 148 157 1.884 1.940 1.777 1.787 1.961
40 PR Pato Branco 81 123 136 144 155 2.417 2.704 2.833 2.855 3.051
41 MG Cataguases 144 150 140 152 154 1.784 1.808 1.827 1.848 1.828
42 BA Porto Seguro 141 140 144 148 154 609 610 620 610 629
43 MA Imperatriz 86 126 145 161 153 726 842 850 890 861
44 GO Catalo 131 138 139 139 152 1.215 1.248 1.253 1.257 1.370
45 MG Varginha 133 140 132 143 149 1.654 1.585 1.719 1.703 1.685
46 PA So Flix do Xingu 128 141 169 168 148 716 716 718 718 691
47 GO Vale do Rio dos Bois 135 141 146 142 145 1.169 1.166 1.159 1.158 1.174
48 RS Iju 114 114 135 139 144 2.787 1.577 1.697 1.974 2.646
49 SE Sergipana do Serto de 58 70 98 140 144 1.439 1.577 1.697 1.974 1.961
So Francisco
50 PE Vale do Ipojuca 66 66 128 140 142 979 989 1.584 1.632 1.665
51 MG Uberaba 106 115 145 141 141 1.807 1.808 1.879 1.632 1.879
52 GO Goinia 142 140 147 145 141 1.219 1.206 1.241 1.231 1.221
53 GO Quirinpolis 180 132 131 143 139 1.552 1.535 1.549 1.557 1.555
54 MG Curvelo 139 167 168 167 139 1.125 1.275 1.268 1.249 1.058
55 MG Governador Valadares 113 119 128 120 134 973 965 972 967 935
56 MG Una 100 110 107 112 133 1.529 1.790 1.769 1.767 2.042
57 MG So Sebastio do Paraso 104 104 99 135 133 1.563 1.542 1.538 1.609 1.579
Fonte: IBGE (2009) Pesquisa da Pecuria Municipal. Elaborao: R.ZOCCAL - Embrapa Gado
de Leite Ordenao por produo de leite em 2007.

15
2.2 Qualidade do leite cl/mL constituem um forte indcio da
mamite subclnica.
A perda de qualidade do leite assume
destacada importncia no que se refere A CBT um ndice que est diretamente
sade pblica. No Brasil, embora no exista associado higiene da ordenha e ao
estatstica disponvel sobre o assunto, so resfriamento do leite. Quanto mais higinica
freqentes os casos de doenas associadas ao for a ordenha e a limpeza dos utenslios e
consumo de leite cru ou de derivados quanto mais rpido for o resfriamento do
produzidos com leite contaminado com leite, menor ser a contaminao e a taxa de
microrganismos patognicos. Contribui para multiplicao das bactrias no leite. A sujeira
isto, entre outras causas, o fato de mais de encontrada nos tetos e bere considerada a
44% do leite consumido no pas ser principal fonte de bactrias do ambiente para
proveniente do mercado informal, ou seja, a glndula mamria, podendo causar mamite
comercializado sem qualquer tratamento e, para o leite, podendo causar aumento da
trmico ou controle laboratorial (Fagundes e CBT (Galton et al., 1982).
Oliveira, 2004).
Costa (2008) correlacionou positivamente
As condies sanitrias dos rebanhos, a CCSLTs com as taxas de isolamento de S.
qualidade do leite, o transporte e a agalactiae e de S. uberis. Porm,
temperatura de conservao do leite podem contrariamente ao relatado pela literatura, no
explicar a variabilidade dos percentuais de observou correlao entre CCSLT e as taxas
amostras imprprias ao consumo humano. de isolamento de S. aureus. Este mesmo autor
(Brant et al., 2007). constatou que quando se verificam aumentos
nos ndices de mamite clnica ou subclnica,
Contagens bacterianas totais (CBT) e de verifica-se aumento tambm na CCSLT.
clulas somticas (CCS) so mtodos de
referncia e comumente so utilizados na Altas CCSTs so indicativas de ndices
avaliao da qualidade do leite cru. A elevados de mamite subclnica no rebanho o
contagem individual de clulas somticas que traz reflexos diretos na qualidade do leite
(CCSI) um recurso laboratorial comumente e na produtividade do rebanho (Santos e
empregado para o diagnstico da mamite Fonseca, 2007). Rebanhos que apresentavam
subclnica, enquanto a contagem de clulas os maiores ndices de mamite subclnica,
somticas do leite do tanque (CCSLT) um sobretudo com o envolvimento de S. aureus e
parmetro utilizado para estimar o ndice de S. agalactiae foram tambm aqueles
mamite subclnica presente no rebanho e as apresentaram os maiores escores de CCST.
perdas de produo (Ruegg e Reineman, Cinco propriedades, que tinham S. agalactiae
2002; Silveira Filho, 2007; Costa, 2008). como agente principal, foram as que
Segundo Harmon (1994), existe alta apresentaram os escores mais elevados de
correlao entre a CCSLT, ndices de mamite CCST no leite (1.702 a 3.181 x 103 cel./mL),
subclnica e diminuio de produo de leite o que demonstra a importncia deste
pelo rebanho. De acordo com Cassoli e microrganismo no aumento da CCST em
Machado (2007), CCSIs entre 100.000 e relao aos demais patgenos contagiosos,
200.000 cl/mL so consideradas normais, conforme relatado por Zafalon et al. (1999) e
enquanto que escores superiores a 200.000 por Costa et al. (2005).

16
Pinheiro de S et al (2004) verificaram pela reduo na produo de leite dos animais
correlao entre a produo de enterotoxinas acometidos, gastos com medicamentos,
e a resposta celular verificada pela CCS, descarte de leite de animais em tratamento,
revelando que nos casos de deteco de reposio precoce de vacas e, eventualmente,
enterotoxinas, as amostras eram provenientes a morte de animais. Alm desses aspectos,
de quartos mamrios com CCS superior a verificam-se alteraes nas caractersticas
1000 x 103 clulas por mL de leite, o que fsico-qumicas do leite, tais como a reduo
pode sugerir possvel fator de virulncia para dos teores de gordura e casena e o aumento
este agente. da contagem de clulas somticas,
ocasionando baixo rendimento industrial,
O mercado interno e externo est muito mais alm de depreciao no valor nutricional e
exigente e observador. Considerando no das caractersticas sensoriais do produto
somente o ganho financeiro adquirido com a (Santos, et al. 2005). Dessa forma, pode-se
produo de leite de alto padro, a melhoria considerar que mamite a doena infecciosa
na qualidade deste produto reflete a maior mais comum que afeta as vacas leiteiras e a
eficincia da produo nas propriedades que proporciona as maiores perdas
rurais e eleva o rendimento dos produtos econmicas para o setor leiteiro, tanto por sua
lcteos na indstria. Conseqentemente, esta alta freqncia, quanto pelos aspectos
eficincia beneficia o negcio destas econmicos a ela relacionados (Silva, 2003;
empresas e da cadeia de leite como um todo. Silva e Silva, 2005).
A legislao em vigor, Instruo Normativa O S. aureus destaca-se como um dos
N 51 de Setembro de 2002 (Brasil, 2002), microrganismos mais freqentemente
desde julho de 2.008, estabelece 750.000 associados s infeces intramamrias de
cl./mL como limite mximo de CCSLT para bovinos em todos os continentes e o agente
o leite produzido atualmente nas regies sul, que isoladamente determina as maiores
sudeste e cento oeste do Brasil, e para perdas na pecuria leiteira (Vasudevan et al.,
400.000 cl./mL em 2.012. 2003; Costa 2008). Diversos autores
relataram que a mamite clinica e subclnica
2.3 Mamite bovina de causa estafiloccica de considervel
relevncia, especialmente a subclnica, onde
A mamite bovina constitui-se em um dos este agente representa cerca de 20% a 40%
problemas sanitrios mais importantes na dos isolamentos. (Langoni et al. 1991;
pecuria leiteira nacional, embora doenas Fitzgerald et al. ,1997; Langoni et al., 1998;
infecciosas de grande importncia econmica, Pinheiro de S et al., 2004).
como a brucelose e tuberculose ainda sejam
endmicas no rebanho brasileiro. Tal fato No Brasil, S. aureus considerado o principal
gera uma demanda, por parte de toda cadeia agente causal da mamite bovina, com taxas
produtiva do leite, por alternativas que de isolamento variveis entre 8,3% e 49,23%
venham minorar os prejuzos relacionados (Costa et al., 1995; Donatele et al., 2002,
com ocorrncia dessa doena que, alm de Costa, 2008). Outros autores relatam
depreciar a qualidade do leite, diminui a resultados variveis entre 9,1% e 85% em
rentabilidade do empreendimento pela queda diferentes regies e estados e entre diferentes
de produo que se verifica nos rebanhos pases (Langenegger et al., 1986; Costa,
endemicamente acometidos (Costa, 2008). O 1986; Vianni e Nader, 1989; Trinidad et al.,
nus determinado pela doena se justifica 1990; Langoni et al. 1991; Wilson et al.,

17
1997). Dessa forma pode-se considerar que Fonseca 2007). O nome desta espcie deriva
em diversas regies do Brasil a mamite da colorao de suas colnias que passaram a
contagiosa a mais freqente, tendo como ser estudadas e isoladas por Rosembach
agentes principais S. aureus, Streptococcus (Silveira Filho, 2007), que nomeou
spp. (3-60 %), Corynebacterium bovis (1,3- inicialmente S. pyogenes aureus, para as
30 %) e Staphylococcus coagulase-negativos colnias amareladas e S. pyogenes albus, para
(SCN) (16-25 %) (Silva et al.,1983; Nader as brancas. Entretanto, j sabido que a
Filho et al.,1984; Costa et al., 1995; Brito et pigmentao da colnia bastante varivel
al, 1999; Laffranchi et al., 2001; Costa 2008). (Judicial Commission, 1958).

Estima-se que, anualmente, as perdas O gnero Staphylococcus apresenta-se


mundiais devido mamite aproximam-se de morfologicamente na forma de cocos Gram
35 bilhes de dlares. Nos Estados Unidos, o positivos, isolados ou agrupados em cachos,
custo anual da mamite tem sido estimado em pares ou ttrades, so coagulase positiva,
1,5 a 2,0 bilhes de dlares, enquanto que as sendo um patgeno oportunista (Santana et
perdas de produo de leite, devido mamite al., 2006), anaerbios facultativos, no
subclnica, e custos de reposio associados esporulados, imveis e produtores usuais de
alta contagem de clulas somticas (CCS) catalase (Kloss e Lambe, 1991). O S. aureus
foram estimados em 960 milhes de dlares apresenta temperatura de crescimento na
(Silva, 2008). faixa de 7C a 48,5 C (com temperatura
Estudo realizado por Costa (2008) em 35 tima de 35 a 37 C) (Frazier e Westhoff,
rebanhos leiteiros da regio sul de Minas 2000). Esta bactria pode crescer em pH de
Gerais, verificou elevados ndices de mamite 4,0 a 9,8, sendo o pH timo para crescimento,
e de contagens de clulas somticas, sendo compreendido entre 6,0 e 7,0 (Luz, 2008).
predominantes os agentes contagiosos Estas caractersticas possibilitam que o S.
representados principalmente por aureus cresa numa grande variedade de
Staphylococcus coagulase positivos (34,29 alimentos.
%) e Streptococcus agalactiae (21,82%).
Patgenos ambientais representaram Estas bactrias so oxidase-negativa,
(18,35%) dos isolamentos. O mesmo autor fermentam glicose em anaerobiose, possuem
identificou a existncia de uma grande cido teicico como constituinte de sua
diversidade de S. aureus na populao parede celular e DNA com contedo bastante
estudada e a existncia de tipos clonais reduzido de GC (30 % a 39 %) (Luz, 2008).
predominantes entre os rebanhos, que A parede celular dos estafilococos resistente
respondem pela maioria das infeces. a lisozima e sensvel a lisostafina, que cliva
especificamente as pontes cruzadas de
2.4 Staphylococcus aureus peptidoglicano com pentaglicina. Os
estafilococos so facilmente destrudos por
Staphylococcus aureus (do grego staphyle tratamentos trmicos, como a pasteurizao,
= cacho de uvas, e cocos = gro) foi mas suas enterotoxinas (SE) so termoesteis
descrito pela primeira vez em 1880, em pus e permanecem ativas nos alimentos tornando-
de abscesso cirrgico por um mdico escocs se um risco em potencial para a sade do
Alexandre Ogston, sendo um dos consumidor e um problema para a sade
microrganismos mais comuns nas infeces pblica (Carmo, 2001).
piognicas em todo o mundo (Santos e

18
O habitat primrio de S. aureus em humanos vigilncia sanitria, uma vez que pode
a mucosa da nasofaringe onde a bactria representar srio risco potencial para a sade
existe como um membro persistente ou pblica (Lamaita et al., 2005). Programas de
transitrio da microbiota normal sem causar estudos epidemiolgicos sobre toxinfeco
quaisquer sintomas (Fueyo et al., 2005). alimentar so essenciais para a melhoria na
Portadores assintomticos constituem-se a sade coletiva em todo mundo (Veras, 2004).
principal fonte de infeco por S. aureus,
podendo causar doenas adquiridas tanto no A presena das amostras toxignicas de S.
ambiente hospitalar como na comunidade aureus no leite no implica, necessariamente
(Fueyo et al.,2005). na ocorrncia de intoxicaes em seres
humanos, porm o risco existe e maior para
2.5- Intoxicao alimentar e Enterotoxinas crianas. A percepo de risco aumentada,
principalmente, ao se considerar que esse
A contaminao microbiolgica dos microorganismo o mais envolvido nas
alimentos tem sido objeto de preocupao infeces intramamrias de rebanhos
constante em diversos pases. Estima-se que leiteiros, com prevalncia de amostras com
nos Estados Unidos ocorram cerca de 6,5 elevado potencial toxignico (S et al., 2004).
milhes de casos de infeces e 9.000 bitos
em conseqncia das enfermidades Enterotoxinas estafiloccicas (SE) so os
transmitidas por alimentos a cada ano. J no principais agentes de intoxicao de origem
Brasil, de acordo com o Sistema de bacteriana no homem e so caracterizadas por
Informao sobre Mortalidade (SIM), entre nusea, vmito, diarria, dor de cabea,
1999 e 2002 (BRASIL, 2005), ocorreram clica abdominal, cibra muscular, queda de
25.281 bitos por Doenas Transmitidas por presso sangnea e prostrao (Lamaita et
Alimentos, com uma mdia de 6.320 al., 2005). O perodo de incubao da
bitos/ano, porm sem especificar as toxinas, intoxicao estafiloccica curto, variando
os microrganismos ou as fontes envolvidas de 15 minutos a 6 horas aps a ingesto do
(Almeida et al. 2008). Estes dados, alimento contaminado (Carmo, 2001). Os
possivelmente subestimados devido falta de sintomas variam de acordo com a
notificao dos surtos, demonstram a susceptibilidade individual, sendo mais
relevncia das medidas de controle sanitrio graves em recm-nascidos, idosos e pessoas
dos alimentos destinados ao consumo acometidas de doenas crnicas
humano, particularmente das matrias primas imunossupressoras. O restabelecimento
de origem animal. ocorre geralmente em perodo de um a dois
dias (Bergdoll, 1989). Uma mesma amostra
O S. aureus ubquo na natureza, sendo os de S. aureus pode produzir mais de um tipo
humanos e os animais seus reservatrios de toxina, que em quantidades inferiores a
primrios. Esse microorganismo um dos 1g podem desencadear os sintomas de
mais freqentes agentes etiolgicos da intoxicao (Nader Filho et al., 2007).
mamite e, dessa forma, o leite e produtos
lcteos so considerados veculos comuns As SE pertencem famlia dos
deste microrganismo (Silva, 2004). Este fato, superantgenos, cujas principais
aliado ao elevado ndice de amostras caractersticas so a pirogenicidade, a
enterotoxignicas, deve merecer especial antigenicidade e a capacidade de aumentar a
ateno dos rgos oficiais de inspeo e de sensibilidade celular endotoxinas (Silva,

19
2004). As SE so consideradas Atualmente, so conhecidos 18 tipos de
superantgenos, por estimularem uma enterotoxinas estafiloccicas classificados
resposta policlonal inespecfica de clulas T e com base em suas diferenas sorolgicas em
a liberao aumentada de citocinas, causando SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI,
toxicidade sistmica e supresso da resposta SEJ, SEK, SEL, SEM, SEN, SEO, SEP, SEQ,
imune adaptativa, os quais prolongam a SER e SEU (Cunha, 2007).
infeco bacteriana. Os superantgenos ligam-
se simultaneamente s molculas do A deteco de enterotoxinas estafiloccicas
complexo de histocompatibilidade principal realizada no sobrenadante de culturas pelos
(MHC) de classe II e aos receptores de mtodos clssicos de imunodifuso,
clulas T, independentemente de suas aglutinao e ELISA demorada, e nem
especificidades de ligao a peptdeos, sempre detecta concentraes baixas de
formando um complexo trimolecular, que toxinas. Comercialmente esto disponveis
induz a proliferao demasiada de clulas apenas kit/antisoros para SEA, SEB, SEC,
(Andrade, 2008). SED e SEE (Cremonesi et al., 2005).

As SE possuem uma estrutura compacta, o A tcnica da Reao em Cadeia da


que conferem resistncia a enzimas Polimerase (PCR) tem se revelado uma
proteolticas como pepsina, tripsina, renina e alternativa rpida, sensvel e especfica na
papana (Bergdoll, 1989) resistindo dessa identificao de patgenos e seus genes de
forma hidrlise pelas enzimas gstricas e enterotoxinas (Rosec e Guiraud, 2002).
jejunais mantendo sua atividade no trato
digestivo aps ingesto (Luz, 2008). Entre Os genes que codificam as enterotoxinas j
outras propriedades, as enterotoxinas so foram estudados, e suas denominaes
estveis ao aquecimento a 100C durante 30 iniciam com as letras se (Freitas et al., 2004).
minutos, no sendo inativadas totalmente pela Os genes que codificam sed e sej so
pasteurizao e outros tratamentos trmicos carreados por plasmdios as que codificam
usuais (Bergdoll, 1989). sea e see por fagos e por cromossomo: seb,
sec, seg, seh, sei, sek, sel, sem, sen, seo, sep e
Muitos isolados de S. aureus produzem seq (Andrade, 2008).
quantidades detectveis de enterotoxinas aps
24 horas de incubao a 30 C (Luz, 2008); O gene sea que codifica a SEA composto de
condies especiais como temperatura e pH 771pb e codifica uma protena de 27,1 KDa
so as mais necessrias para a sntese de (Betley e Mekalanos, 1988). A deteco do
enterotoxinas (Veras, 2004). Segundo gene sea em isolados de S. aureus
Bergoll, (1989) a temperatura tima de importante, pois a SEA txica mesmo em
produo de enterotoxinas a 37 C, podendo baixas concentraes (Evenson et al., 1988),
ocorrer tambm em temperaturas entre 25C e sendo a enterotoxina mais envolvida em
30 C. Segundo o mesmo autor, quanto menor intoxicaes alimentares seguida por SED e
a temperatura maior o tempo necessrio para SEB (Balaban e Rasooly, 2000).
produo das enterotoxinas; sob condies de
anaerobiose so dependentes de fatores como O gene seb consiste de 798 nucleotdeos e
o pH ( 5,15 a 9,0; pH timo 6,5 a 7,5). codifica uma protena de 31,4 KDa (Johns Jr
e Khan, 1988). O gene seb cromossomal em
isolados clnicos de S. aureus envolvidos em

20
intoxicao alimentar, embora seja carreado rebanhos localizados em 23 municpios do
por um plasmdio em outros isolados estado de Minas Gerais. Foi realizado PCR
bacterianos (Shafer e Iandolo, 1978). multiplex com os iniciadores FEM A, SEA,
SEB E SEC e observou que 64 amostras
A enterotoxina SEC heterognea e contm isoladas de mamite bovina, quatro (6,3%) co-
algumas variantes, designadas SEC1, SEC2, amplificaram os genes sea e seb e 2 (3,1 %)
SEC3, SEC bovina e SEC ovina. Estas foram amplificaram o gene sec.
classificadas com base nas diferenas
antignicas e no hospedeiro animal com o Veras (2004) observou em 30 amostras de S.
qual elas esto associadas. O gene sec1 aureus provenientes de leite e derivados
contm 801 pb e codifica uma protena de envolvidos em surtos de toxinfeco
27,4 KDa (Bohach e Schlievert, 1987), o alimentar ocorridos no perodo de 1998 a
gene sec2 contm 801 pb e codifica uma 2002, em Minas Gerais, uma maior
protena de 26 KDa (Bohach e Schlievert, porcentagem de amplificao para o gene de
1989) e o gene sec3 contm 798 pb e codifica SEA (26,6 %) seguida de SEB (20 %) e
uma protena de 27,4 KDa (Couch e Betley, posteriormente SEC (3,33 %). Na associao
1989). SEC2 e SEC3 so os subtipos de SECs de SEA +SEB encontrou-se uma
mais freqentes em surtos de intoxicao porcentagem de 16,6 %.
alimentar (Chen et al., 2001). SEC a
enterotoxina mais comumente associada com Nader Filho et al. (2007) identificaram a
produo leiteira bovina, ovina e caprina maior presena do gene sea, e seb seguida do
(Hirooka et al., 1988). gene sec e o predomnio de SEA, SEB em
relao a SEC pesquisadas em 72 amostras
Cardoso et al. (1999) caracterizaram a de S. aureus isoladas no leite de vacas com
produo da toxina da sndrome do choque sinais de mamite ou que apresentavam
txico (TSST-1) e de enterotoxinas positividade no California Mastitis Test, em
estafiloccicas (SE) A, B, C e D em 127 10 propriedades rurais do Estado de So
amostras de S. aureus, isoladas de amostras Paulo.
de leite proveniente de vacas com mamite no
Estado de Minas Gerais. Das 127 amostras Luz (2008) utilizou de 94 isolados de S.
testadas, 60 (47 %) eram produtoras de aureus de amostras de leite provenientes de
TSST-1 e 54 (43 %) produtoras de SE, 38 vacas com mamite e queijo coalho em
amostras produziram SED (30 %), 24 SEB propriedades de explorao leiteira de cinco
(19%), 8 SEC (6 %) e 4 SEA (3 %). Esta foi a municpios da regio de Pernambuco, Brasil
primeira descrio da presena de TSST-1 em (So Bento do Una, Angelim, Caets,
isolados de glndula mamria de bovinos no Correntes e Gravat) e nenhum dos avaliados
Brasil. Para verificao da produo de pela PCR-Multiplex possua os genes sea, seb
toxinas foi utilizada a tcnica de sensibilidade e sec, havendo apenas a amplificao dos
tima em placa- OSP- (Robbins et al., 1974). segmentos de tamanho esperado nas amostras
de referncia (FRI) usadas como controle
Silva (2004) identificou maior presena dos positivo. Em contrapartida 88/94 (93,6%)
genes sea e seb em amostras de leite bovino, identificaram os genes responsveis pela
utilizando 100 amostras de S. aureus isoladas produo das enterotoxinas SEG, SEH, SEI e
de leite de cabra (n=36) e de vaca (n=64). SEJ, dos quais 31/88 (35,2%) amplificaram
Esses isolados bovinos eram pertencentes a apenas para um gene, 33/88 (37,5%)

21
amplificaram para dois genes, 17/88 (19,3%) em 1961 no Reino Unido e, em meados dos
amplificaram para trs genes e 7/88 (8%) anos 70, tornou-se endmico em muitos
amplificaram para os quatro genes, pases sendo a principal causa de infeces
permitindo classificar os fragmentos de hospitalares no mundo. A vancomicina era o
tamanho esperado dentro de 10 grupos nico antibitico efetivo contra os mesmos,
genotpicos para a presena dos genes mas, em 1997, foram descritas amostras de S.
toxignicos, dessa forma no detectando a aureus com resistncia vancomicina e
presena dos genes das enterotoxinas teicoplanina. Tais estafilococos receberam a
clssicas. sigla VISA (Staphylococcus aureus com
resistncia intermediria vancomicina) e
2.6 Staphylococcus aureus resistente atualmente so denominados simplesmente
meticilina (MRSA) de VRSA (Staphylococcus aureus resistentes
a Vancomicina) (Boyle-Vavra et al., 2001).
Nas ltimas dcadas, tem-se observado a Inicialmente, as infeces constituam-se
emergncia de microrganismos resistentes primariamente, num problema hospitalar,
aos antibiticos, dentre os quais se destaca S. recentemente, elas tm se estabelecido em
aureus resistente a meticilina (MRSA comunidades sem risco identificvel (Lee,
Methicillin-resistant Staphylococcus aureus). 2003).
Essas linhagens no so comumente relatadas
em animais, entretanto, nos ltimos anos, h Em animais o isolamento de MRSA foi
registros de aumento de casos de infeces primeiramente reportado por Devriese et al.
em animais domsticos (Rich et al., 2005; (1972) a partir de leite de vacas com mamite.
Middleton et al., 2005), sugerindo que as A sensibilidade de S. aureus aos diferentes
infeces mamrias por MRSA, em bovinos antibiticos empregados no tratamento das
leiteiros, podem ser consideradas srio doenas animais de grande importncia para
problema no campo (Lee et al., 2004). o mdico veterinrio, pois visa fornecer
subsdios para a terapia do animal acometido,
Na dcada de 1940, a grande maioria dos S. bem como para todos os animais do rebanho
aureus era sensvel penicilina. A partir de submetidos s mesmas condies de manejo
1950, quando os antibiticos passaram a ser e, portanto, sob os mesmos riscos de
amplamente utilizados, iniciou-se o fenmeno infeco. Por todo o mundo, o aumento de
de resistncia bacteriana a praticamente todos prevalncia de S. aureus multi-resistentes
os antibiticos de uso parenteral, incluindo a causadores de mamite bovina grave, com a
eritromicina e a tetraciclina (Chambers 1988). reduo da efetividade dos antimicrobianos e
A introduo das penicilinas resistentes a o aumento da morbidade e dos custos para
penicilinases, na dcada de 1960, possibilitou combater essa doena. Existe
um avano na teraputica antiestafiloccica. heterogeneidade gentica considervel em
Com o uso indiscriminado das penicilinas populaes naturais de S. aureus (Zafalon et
semi-sintticas, como a meticilina empregada al., 2008).
no tratamento de infeces estafiloccicas,
surgiram amostras resistentes a este As mamites causadas por S. aureus
antibitico, denominadas de MRSA, cujo apresentam na atualidade uma baixa resposta
padro de resistncia se estende aos outros antibioticoterapia, por isso h uma
antibiticos beta-lactmicos (Voss et al., variedade de estudos no esforo de
1994). MRSA foi primeiramente reportado determinar quais so os fatores responsveis

22
por falhas na terapia, de modo que no futuro resistncia antimicrobiana a outras bactrias
os tratamentos sejam mais efetivos (Reis et da prpria espcie ou de espcies no
al., 2003; Costa, 2008). relacionadas, patognicas ou no (Luz, 2008).

Em Minas Gerais, Cardoso et al. (2000), no Foram registrados isolamentos de


perodo de 1994 a 1997, isolaram e Staphylococcus aureus com resistncia
submeteram ao antibiograma 127 S. aureus intermediria vancomicina no Rio de
provenientes de 23 municpios. Os Janeiro, em So Paulo e Porto Alegre e de
antibiticos mais efetivos foram cefotaxima estafilococos coagulase negativos resistentes
(100%), enrofloxacina (98,4%), gentamicina vancomicina e teicoplanina em So Paulo
(98,4%), rifampicina (96,1%), cloranfenicol (Oliveira, 2002).
(90,4%), sulfazotrim (86,6%) e novobiocina
(85,8%). As drogas menos efetivas foram Os MRSA associados s infeces
Polimixina B, ampicilina e penicilina G de comunitrias (CA-MRSA) emergiram
acordo com os testes in vitro, com os recentemente como um novo patgeno.
percentuais de sensibilidade de Tradicionalmente, os MRSA eram
respectivamente 8,7%, 28,6% e 29,1%. reconhecidos como importantes patgenos
Resultado semelhante foi obtido por Donatele hospitalares (HA-MRSA, do ingls: hospital-
et al. (2002) em que foi avaliado o perfil de acquired methicillin resistant Staphylococcus
resistncia aos antimicrobianos de 180 aureus). Entretanto, recentemente, infeces
amostras de S. aureus isolados de mamite comunitrias por MRSA em pacientes que
subclinica em rebanhos do estado do Rio de no apresentam riscos clssicos para
Janeiro, verificando elevados ndices de infeces nosocomiais (CA-MRSA sem
resistncia para os antibiticos -lactmicos risco) tm sido relatadas nos Estados Unidos,
(82,9%) e tetraciclinas (24,4%). Taiwan, Nova Zelndia, Austrlia e em
diversos pases da Europa. Amostras de CA-
No que se refere resistncia antibitica de MRSA podem no ter nenhuma relao com
amostras de S. aureus envolvidas na etiologia servios de sade e afetar pacientes saudveis
da mamite bovina em rebanhos brasileiros, da comunidade que no apresentam os riscos
nota-se uma grande variao quanto nosocomiais clssicos. Desta forma, estudos
eficincia das diferentes drogas analisadas. sobre a epidemiologia e as caractersticas
No entanto, algumas tendncias so fenotpicas e genotpicas das amostras de
percebidas, como susceptibilidade da maioria MRSA envolvidas em infeces comunitrias
dos isolados de S. aureus gentamicina, sem risco so necessrias (Ribeiro, 2005).
cefalosporinas e ao cloranfenicol, e a
resistncia penicilina e ampicilina (Costa, Amostras de CA-MRSA sem risco causam,
2008). com muita freqncia, infeces envolvendo
a pele e tecidos moles, como celulite e
Segundo Rajala-Schultz et al. (2004), as abscessos. H relatos de casos fatais de
bactrias resistentes que so encontradas em pneumonia em adultos jovens e,
animais produtores de alimentos, podem aparentemente, sem riscos para infeces
contaminar os produtos alimentcios e serem nosocomiais por MRSA (Van der Flier et al.,
transferidas para humanos atravs da cadeia 2003).
alimentar. No trato gastrointestinal elas
podem transferir genes que conferem a

23
MRSA so freqentemente resistentes O teste de suscetibilidade aos antimicrobianos
maioria dos agentes antimicrobianos, para amostras de S. aureus realizado em
incluindo aminoglicosdeos, macroldeos, placas de Petri contendo Agar Mueller-
cloranfenicol, tetraciclina e fluorquinolonas Hinton (MH) acrescido de 2% de cloreto de
(Lee et al., 2004). sdio, aps incubao a 37 C durante 24
horas. A suscetibilidade verificada com a
A resistncia aos antimicrobianos em S. utilizao de antimicrobianos ativos sobre
aureus pode ser codificada estes germes e sua escolha depende do stio
cromossomicamente ou mediada por da infeco por eles causada. A leitura
plasmdios. S. aureus possui trs mecanismos realizada medindo-se os dimetros dos halos
distintos de resistncia meticilina: a) de inibio formados ao redor dos discos e a
hiperproduo de beta-lactamases; b) interpretao feita de acordo com a tabela de
presena de uma protena ligadora de halos padronizada pelo NCCLS (NCCLS,
penicilina (PBP protein binding penicilin) 2000). Em geral, o resultado assim
alterada denominada PBP 2a; c) modificaes expresso: sensvel, moderadamente resistente
na capacidade de ligao das PBPs (Tomasz (intermedirio) e resistente. No antibiograma,
et al., 1989). De Lencastre et al. (1991) possvel relacionar o dimetro do halo de
sugerem que os trs mecanismos podem estar inibio e a CIM (Murray et al., 2000).
presentes numa mesma amostra, inclusive
interagindo entre si. Uma nova tcnica est disponvel para
deteco da suscetibilidade antimicrobiana
S. aureus possui cinco PBPs. As PBPs so bastante prtica, rpida e que no requer
enzimas que catalisam a etapa terminal da equipamentos. Este recurso consiste em uma
sntese da parede bacteriana e se localizam na fita estreita de material plstico contendo
membrana celular da bactria. As PBP 1, 2 e concentraes crescentes de antibitico, que
3 so essenciais e tm alta afinidade (stios- colocada em placas de Petri contendo Agar
alvo) com os antibiticos beta-lactmicos, Mueller-Hinton de maneira semelhante ao
unindo-se a esses por ligaes covalentes. A teste de difuso em disco. A fita de E-test
resistncia meticilina em estafilococos utilizada na mesma temperatura aplicada aos
devida produo de uma PBP adicional, testes de difuso em discos e sua principal
anmala, denominada PBP 2a, que apresenta vantagem fornecer o valor da CIM
baixa afinidade com os antibiticos beta- diretamente (NCCLS, 2003). A utilizao do
lactmicos. Esta protena alterada antibiograma pela automao tambm
codificada por um gene cromossmico muito freqente, porm necessita de uma
denominado mec A, que responsvel pela observao clnica mais particularizada
resistncia intrnseca dos MRSA a todos os quanto ao emprego das drogas, cuja seleo
antibiticos beta-lactmicos (Santos, 2005). requer o conhecimento da ao
frmacocintica dos antimicrobianos.
A deteco de resistncia dos S. aureus
meticilina, entre outros antibiticos, pode ser Alguns genes, denominados genes auxiliares
realizada por mtodos tradicionais, como a ou fatores essenciais gene fem (factor
difuso em disco, ou pelo uso de essential for methicilin resistance), auxiliam
equipamentos automatizados que forneam o o gene mec A a expressar um alto nvel de
valor da concentrao inibitria mnima resistncia aos beta-lactmicos. Foram
(CIM) (Donatele et al. 2002). identificados muitos desses genes fem,

24
denominados fem A, fem B, fem C, fem D, fem comparativo e de filogenia entre isolados de
E e fem F (Vannuffeld et al., 1995). O gene S. aureus (Costa, 2008). A extremidade 3
fem A essencial para a expresso da desse gene possui uma regio polimrfica
resistncia dos MRSA e parece ser uma constituda por unidades repetidas de 81 pb,
caracterstica peculiar de S. aureus, no sendo as quais diferem entre os isolados em nmero
encontrado em outras espcies de e localizao de stios para a enzima AlulI
estafilococos. Os genes fem A e mec A tm sendo essa caracterstica utilizada para
sido detectados em amostras de MRSA por tipagem de S. aureus (Silva, 2004).
meio de tcnicas moleculares como a reao
de polimerase em cadeia (PCR). Esta tcnica No Brasil, foram realizados alguns estudos de
apresenta vantagens em relao s demais, diversidade populacional empregando a
pois oferece elevada eficcia e segurana, tcnica de polimorfismo dos fragmentos de
alm de ser um mtodo rpido e sensvel restrio (RFLP), aplicada ao gene da
(Oliveira et al., 2002). possvel com a PCR coagulase. Silva e Silva (2005) aplicaram a
em aproximadamente 18 horas identificar tcnica de RPLP no estudo comparativo entre
MRSA (Louie et al., 2002). 64 S. aureus isolados de bovinos leiteiros do
estado de Minas Gerais e verificaram a
2.7. PCR no diagnstico molecular ocorrncia de 27 padres de produtos de PCR
e de 49 tipos eletroforticos na RFLP,
Com a finalidade de se obter tcnicas demonstrando uma grande diversidade
acuradas, rpidas e especficas para o populacional entre as amostras estudadas.
diagnstico da mamite bovina, mtodos
moleculares, como a PCR so teis no A aplicao de tcnicas de biologia
diagnstico microbiolgico (Zschck et al., molecular, aliada s tcnicas convencionais
2005). A PCR apresenta vantagens em de bacteriologia, tem possibilitado novas
comparao aos mtodos tradicionais de abordagens na epidemiologia da mamite
diagnstico: altamente sensvel, especfica e bovina. Por meio destes testes, tem sido
rpida. Para se produzir um diagnstico demonstrado que os clones associados aos
positivo so necessrias poucas clulas e casos de mamite bovina, embora no
estas no precisam estar viveis, dessa forma, estritamente espcie-especficos, so
amostras que so inadequadamente caractersticos da espcie e que infeces
preservadas podem ser utilizadas (Phuerktes intercruzadas, embora ocorram, no se
et al., 2001; Martinez et al., 2001). A tcnica revestem de maior importncia
de PCR pode ser utilizada com grande epidemiolgica. Os testes apontam ainda a
eficincia para deteco do gene da coagulase ocorrncia de uma grande diversidade
(coa) e na deteco do gene fem A em populacional de S. aureus, com a existncia
identificao de S. aureus (Veras, 2004). de clones predominantes que so comuns
entre rebanhos (Costa, 2008).
A amplificao do gene que codifica a
protena coagulase (coa) tem sido relatada por Vrios mtodos de PCR multiplex, que
diversos pesquisadores como mtodo simples amplificam simultaneamente mais de um
e acurado para identificar e discriminar S. gene na mesma reao, tm sido descritos na
aureus. O seqenciamento desse gene da literatura para deteco de S. aureus
coagulase ou de sua poro 3 terminal tem enterotoxignicos em leite e queijos, mas
sido um recurso utilizado para o estudo freqentemente estes mtodos no so

25
reprodutveis, sendo necessrio que cada al., 2005). Ramesh et al. (2005) conseguiram
laboratrio padronize suas reaes um limite de deteco de 103UFC/mL
(Cremonesi et al., 2005). individualmente e de 104 UFC/mL
simultaneamente para S. aureus e Yersinia.
Silva (2004) obteve uma relao de 100% de enterocolitica em uma reao multiplex com
concordncia entre a deteco do gene por dois pares de iniciadores, utilizando a
PCR e a deteco da toxina correspondente combinao de solventes orgnicos,
pelos testes fenotpicos, demonstrando dessa detergentes e lcalis no mtodo de extrao.
forma que a PCR pode ser utilizada para
caracterizar e identificar tipos Silva (2008) obteve um limite de deteco de
enterotoxignicos de S. aureus isolados de microrganismos a partir da extrao
mamite. diretamente do leite de 102 UFC/mL pela
tcnica de PCR individual e 103 UFC/mL
Luz (2008) avaliou a expresso potencial dos pela tcnica de PCR multiplex.
genes produtores de enterotoxinas atravs da
RT-PCR e constatou que risco de intoxicao 3. MATERIAL E MTODOS
alimentar por S. aureus pode ser avaliado
com base na expresso do RNAm 3.1. Local de realizao do experimento
correspondente. No entanto, apenas a Os experimentos foram realizados no
deteco dos genes toxignicos em S. aureus Laboratrio Nacional Agropecurio
no implica que estes isolados produzam SEs (LANAGRO-MG) em Pedro Leopoldo/MG e
em nvel suficiente para causar quadros de no Laboratrio de Diagnstico e Pesquisa em
intoxicao alimentar ou outras doenas Doenas Infecciosas da Escola de Veterinria
associadas s enterotoxinas (Chiang et al., da Universidade Federal de Minas Gerais
2008). (UFMG).

Na rotina microbiolgica, o diagnstico para 3.2. PCR


a espcie S. aureus resistente a meticilina so
baseados nas caractersticas fenotpicas. No Utilizou-se a tcnica da PCR para deteco
entanto, no um teste fidedigno, pois muitas do gene fem A, que identifica o S. aureus.
bactrias resistentes a meticilina podem ser Esta mesma tcnica foi utilizada para a
inicialmente susceptveis a essa droga. A deteco dos genes sea, seb, sec, que esto
deteco do gene mec A considerada padro relacionados ao potencial de produo das
ouro para o diagnstico dessa espcie (Lee et enterotoxinas SEA, SEB e SEC,
al., 2004). respectivamente e do gene mec A, que
identifica MRSA. O Quadro 2 mostra a
A deteco direta de patgenos bacterianos seqncia de iniciadores referente a cada
em amostras lcteas um trabalho difcil gene pesquisado.
devido presena de substncias inibidoras
da PCR (Ramesh et al., 2005; Cremonesi et

26
Quadro 02: Iniciadores utilizados
Iniciador Seqncia de primers 5-3 Gene Tamanho do
produto (PB)
Fem A 1 AAAAAAGCACATAACAAGCG Fem A 132
Fem A 2 GATAAAGAAGAAACCAGCAG
SEA1 GGTTATCAATGTGCGGGTGG Sea 102
SEA2 CGGCACTTTTTTCTCTTCGG
SEB1 GTATGGTGGTGTAACTGAGC Seb 164
SEB2 CCAAATAGTGACGAGTTAAGG
SEC1 AGATGAAGTTAGTTGATGTGTATGG Sec 451
SEC2 CACACTTTTAGAATCAACCG
MecA1 AGT TCT GCA GTA CCG GAT TTG C mec A 533
MecA2 AAA ATC GAT GGT AAA GGT TGG C
A seqncia de nucleotdeos e a localizao gnica foi derivada de seqncias publicadas dos genes
sea (Betley e Mekalanos, 1988), seb (Jhons e Khan, 1986), sec (Bohach e Schillievert, 1987) fem A
( Berger-Bachi et al., 1989) e mec A descritos por Lee (2003).

3.3. Amostras bacterianas microrregio de Sete Lagoas, coletadas no


perodo de maro a junho de 2009. Essas
Amostras padro de S. aureus cedidas pela
amostras foram cedidas pelo Laboratrio de
FIOCRUZ (Fundao Osvaldo Cruz) e de
Anlise de Leite da Escola de Veterinria da
Staphylococcus epidermidis cedida pelo
UFMG. As amostras de leite continham
Laboratrio de Microbiologia do
azidiol, substncia bacteriosttica que possui
LANAGRO/MG (Laboratrio Nacional
como princpio ativo cloranfenicol e azida
Agropecurio do Ministrio da Agricultura,
sdica. Esse material foi congelado at a sua
Pecuria e Abastecimento) foram utilizadas
anlise.
para padronizao da tcnica, avaliao da
sensibilidade, da especificidade e como
3.4.1 Contagem Bacteriana Total (CBT)
controle positivo e negativo nas reaes de
e Contagem de Clulas Somticas (CCS)
PCR. As amostras padro de S. aureus ATCC
13565, ATCC 14458, ATCC 19095 e ATCC
A CCS e CBT foram efetuadas
33591, foram, respectivamente, utilizadas
eletronicamente por citometria de fluxo
para padronizao e controle positivo de S.
(Somacount 300- Bentley-USA), no
aureus produtor de enterotoxina A (SEA), S.
Laboratrio de Qualidade do Leite da Escola
aureus produtor de enterotoxina B (SEB), S.
de Veterinria da UFMG nas amostras de
aureus produtor de enterotoxina C (SEC), e
leite estudadas.
MRSA. O S. epidermidis (ATCC 12228) foi
utilizado para testar a especificidade da
3.5. Extrao de DNA
tcnica e como controle negativo.
A extrao de DNA foi realizada diretamente
3.4. Amostras de Leite do leite, segundo modificao do protocolo
proposto por Millar et al. (2000). As amostras
Foram utilizadas 200 amostras de leite de leite depois de descongeladas foram
obtidas em tanque de expanso de homogeneizadas em agitador de tubos e,
propriedades rurais pertencentes posteriormente, aliquotadas em volume de 0,5

27
mL, em microtubos de 1,5 mL, e adicionado a 3.6. Reao de PCR e Deteco dos genes
esta 1 mL da soluo de lavagem alcalina (0,5 fem A, sea, seb, sec e mec A
mol/L de NaOH e 0,05 mol/L de Citrato de
Sdio). Esta soluo foi homogeneizada no Foi realizada a deteco dos genes fem A, sea,
agitador de tubos e centrifugada em mini- seb, sec e mec A no DNA extrado das
centrfuga a 17.760 g por 20 minutos a amostras de leite de tanque de expanso da
temperatura de 4C. Aps descartar o microrregio de Sete Lagoas. Para controle
sobrenadante, o precipitado obtido foi positivo e negativo foram utilizadas,
homogeneizado em 1 mL de Tris-HCL (10,5 respectivamente, amostras padro de S.
mol/L pH 8,0) e novamente centrifugado a aureus e S. epidermidis, extradas conforme
17.760 g por 20 minutos a 4C. O protocolo constante do item 3.5. As reaes
sobrenadante foi descartado e o precipitado de PCR foram realizadas utilizando-se o
ressuspendido em 100 L de soluo Tris- tampo especial IVB 5x (Phoneutria, Brasil),
EDTA (TE) (pH 8) e, ento, aquecido a 96 iniciadores (Invitrogen,USA), dNTPs, Taq
C, por duas horas em banho Maria. Aps DNA polimerase (Phoneutria, Brasil) e DNA
essa etapa, adicionou-se o mesmo volume de extrado do leite. Utilizou-se um
soluo de fenol-clorofrmio e homogenizou- espectrofotmetro (NanoVue) para mensurar
se em agitador de tubos por 10 segundos. a quantidade de DNA extrado por amostra.
Posteriormente foi realizada outra As reaes foram processadas em um
centrifugao a 2.627 g por 5 minutos a 24 termociclador P x 2 Thermal Cycler (Thermo
C. O sobrenadante foi transferido para outro Electron Corporation). Os produtos de
microtubo com auxlio de uma pipeta. Essa amplificao (amplicons) foram analisados
etapa de extrao com fenol-clorofrmio foi por eletroforese, utilizando-se uma fonte de
repetida mais duas vezes sendo que na ltima energia para eletroforese (Power PAC Basic/
vez utilizou-se apenas o clorofrmio. Marca Biorad), em 40 mL gel de agarose
1,5% (p/v), corados com brometo de etdio
Aps esta etapa o sobrenadante foi (1,5 mg/mL), visualizados por um
transferido para outro microtubo, ao qual foi transiluminador com exposio luz
adicionado etanol 95% (duas vezes o volume ultravioleta e fotografados por um sistema de
inicial). Essa soluo foi refrigerada por 1 fotodocumentao (Vilber Loumart). DNA
hora a 70C, para precipitao do DNA. Ladder Invitrogen de 100pb e 1Kb foram
Aps esse perodo, a soluo foi centrifugada utilizados como marcadores.
a 17.760 g por 20 minutos a 4C e o
sobrenadante foi descartado. Ao precipitado
3.7 Otimizao da PCR
foi adicionado 500 L de etanol 70 % para
hidratao do DNA. Repetiu-se a
centrifugao e descartou-se o sobrenadante. Para definir as condies da reao de PCR,
Os microtubos foram deixados abertos dentro cada par de iniciador foi testado, avaliando-se
da cabine de segurana biolgica at a as diferentes concentraes de iniciadores
completa evaporao do lcool. O precipitado associados a diferentes temperaturas e ciclos
foi ressuspendido em 20 L de tampo TE de desnaturao, anelamento e extenso.
(10 mmol/L Tris-HCL e 1 mmol/L EDTA) e Aps vrias tentativas, amplificaes
o produto armazenado a 20 C, at a sua eficientes e reproduzveis foram padronizadas
utilizao. com um volume final de reao de 20 L,
20% de tampo especial IVB 5x (Phoneutria,

28
Brasil), 10 mol/L dos iniciadores, 200 perodo, foram realizadas diluies decimais
pmol/L de dNTPs, 5,0 U de Taq polimerase e em tubos de ensaio contendo 9 mL de leite
aproximadamente 100 ng de DNA. A UAT (Ultra Alta Temperatura) estril, onde
quantidade de DNA foi mensurada por no primeiro tubo foi colocado 1 mL da
densidade ptica em espectrofotmetro cultura crescida em meio BHI (diluio 10-1),
(NanoVue). As condies de ciclagem para e seguidamente transferidos para os demais
anlise dos genes fem a, sea e seb foram de at obter a diluio final de 10-9. Essas
94C por 5 minutos, seguidos por 40 ciclos de amostras foram distribudas em duplicata nas
30 segundos a 94C, 30 segundos a 57C e 30 placas previamente esterilizadas. Em seguida
segundos a 72 C e uma incubao final de 4 esses tubos de ensaio contendo leite com as
minutos a 72 C. Para anlise dos genes sec e sucessivas diluies decimais de S. aureus
mec a foi utilizada a seguinte programao: foram congelados para posterior extrao de
94C por 5 minutos, seguidos por 30 ciclos de DNA e realizao da PCR. Uma amostra sem
1 minuto a 94C, 1 minuto a 57C, 1 minuto a inoculao (controle negativo) foi congelada
72C e uma incubao final de 4 minutos a para verificar se esse leite UHT no possua
72C. contaminao por DNA de S. aureus.

3.8 Especificidade da tcnica de PCR A tcnica de profundidade em placa (pour


plate) para contagem do nmero de unidades
formadoras de colnia (UFC/mL de leite) de
Para verificar a especificidade da tcnica, os
S. aureus foi utilizada da seguinte forma: o
iniciadores FEM A, SEA, SEB, SEC e Mec A
meio BHI fundido e temperatura de 47C
foram observados quanto ao tamanho
foi vertido sobre a placa de Petri contendo 1
especfico do produto da PCR, ao utilizar
mL da suspenso diluda da amostra. Esse
DNA de estirpes de referncia de S. aureus e,
material foi homogeneizado girando-se a
a observao da no formao de bandas no
placa por movimentos circulares nos sentidos,
gel de agarose quando utilizado DNA
horrio e anti-horrio. Aps a solidificao do
extrado de estirpes padro de S. epidermidis
meio, as placas foram tampadas, invertidas e
que cresceram em meio BHI.
incubadas em estufa temperatura de 36 C.
Aps 24 h de incubao, as colnias foram
Nas amostras de leite analisadas utilizou-se
contadas e o resultado mdio de cada diluio
como controle positivo os S. aureus de
foi registrado e multiplicado pelo fator da
referncia (ATCC 25923, ATCC 13565,
diluio, que a recproca da diluio. Essa
ATCC 14458, ATCC 19095 e ATCC 33591)
tcnica foi utilizada com o objetivo de
e como controle negativo S. epidermidis
estimar a quantidade de colnias de S. aureus
(ATCC 12228), assegurando a especificidade
formadas nas amostras de leite contaminadas
dos testes.
e dessa forma avaliar a sensibilidade da PCR
utilizada.
3.9. Sensibilidade da tcnica de PCR
3.10 Utilizao da tcnica de PCR nas
A sensibilidade da tcnica foi avaliada aps a amostras de leite de tanque de expanso
inoculao de S. aureus (amostras de
referncia) em meio BHI (Brain Heart As amostras de leite, aps extrao do DNA,
Infusion) (marca Oxoid) e incubao a foram inicialmente processadas com o
temperatura de 36C por 24 horas. Aps este iniciador FEM A. As amostras amplificadas

29
por este iniciador foram submetidas Essa anlise estatstica foi realizada no
avaliao com os demais iniciadores (SEA, programa SAS (Statistical Analysis System),
SEB, SEC e Mec A). No foram utilizadas as SAS (1999). Para realizao dessa anlise
amostras que no amplificaram com o estatstica dois grupos de CCS e de CBT
iniciador FEM A. foram definidos. De acordo com Harmon
(1994) quando CCSLT est acima de 500.000
cl/mL ocorrem perdas na produo de leite
3.11 Anlises Estatsticas
(Tab.1). Dessa forma os grupos definidos
Utilizou-se estatstica descritiva para anlise foram as amostras de leite com CCS abaixo e
dos dados e tambm o teste de de Karl acima de 500.000 cl/mL e amostras com
Pearson para avaliar se houve relao entre a CBT abaixo e acima de 500.000 UFC/mL.
presena de S. aureus identificados nas Utilizou-se tambm estatstica descritiva.
amostras de leite com maiores CCS e CBT.

Tabela 1- Estimativas de prevalncia de quartos infectados no rebanho e de perdas de produo em


relao CCSLT.

CCSLT (1.000/mL) % de quartos % de perdas


infectados no de produo
rebanho
200 6 0
500 16 6
1.000 32 18
1.500 48 29
Fonte: Harmon (1994)

30
4- RESULTADOS ATCC19095 e 207 para a amostra ATCC
33591, todas na diluio de 10-7.
4.1 Especificidade

A especificidade de cada par de iniciador dos


genes fem a, sea, seb, sec e mec a foi
demonstrada pela presena de produto
amplificado de tamanho esperado ao utilizar
como molde, o DNA das amostras de
referncia e por no amplificar DNA de S.
epidermidis (Fig. 2).
1 2 3 M

Figura 3: Placas de BHI semeadas com leite


contaminado nas diluies 10 -5, 10 -6 e 10 -7
apresentando colnias de S. aureus.

Aps esse procedimento, os tubos de ensaio


contendo leite com as diluies de S. aureus
132 pb na base 10, foram descongelados e aps a
extrao do DNA foi realizada a reao de
Figura 2: Produtos de PCR utilizando PCR. Foram utilizados os iniciadores Fem A,
iniciador FEM A. Canaleta 1 DNA de S. SEA, SEB, SEC e MEC A com o objetivo de
aureus extrado de leite. Canaleta 2- DNA de
S. aureus extrado de meio BHI. Canaleta 3 - verificar em at qual diluio ocorreria a
DNA de S. epidermidis extrado de meio BHI formao de produtos de PCR. Os resultados
e M: Padro de tamanho molecular (DNA mostram que o limite de deteco ocorreu na
Ladder 100 pb) visualizados sob luz U.V. em
gel de agarose 1,5%, corados com brometo de diluio de 10-9 UFC/mL de leite,
etdio (1,5 mg/mL). observando-se a formao de uma banda de
132 pb, utilizando como marcador o gene fem
4.2 Sensibilidade A (Fig. 4).

O resultado da contagem bacteriana em O mesmo limite de deteco foi observado


placas foi de 120 UFC na diluio de 10-7 para os genes de sea, seb, sec e mec A com a
(Fig.3), ou seja, 1,2 x 10 -9 UFC/mL de leite, amplificao de produtos de PCR dentro dos
para a amostra ATC 25923, 190 colnias para tamanhos esperados (Figs 4 5, 6,7 e 8).
a amostra ATCC 13565, 132 para a amostra
ATCC 14458, 198 para a amostra

31
M 1 2 3 4 5 6 7 8 9

132 pb

Figura 4: Produtos de PCR obtidos com DNA extrado a partir de diluies seriadas de S. aureus,
utilizando iniciador FEM A (132 pb), M: Padro de tamanho molecular (DNA Ladder 1 Kb); 1-
Diluio 10-; 2- Diluio 10-; 3- Diluio 10-; 4- Diluio 10 -4; 5- Diluio 10 -5; 6- Diluio 10 -
6
; 7- Diluio 10 -7; 8- Diluio 10 -8; 9- Diluio 10 -9, visualizados sob luz U.V. em gel de agarose
1,5%, corados com brometo de etdio (1,5 mg/mL).

1 2 3 4 5 6 7 8 9 M

533 pb

Figura 5: Produtos de PCR obtidos com DNA extrado a partir de diluies seriadas de S. aureus,
utilizando iniciador MEC A (533 pb): Diluio 10-; 2- Diluio 10-; 3- Diluio 10-; 4- Diluio
10 -4; 5- Diluio 10 -5; 6- Diluio 10 -6; 7- Diluio 10 -7; 8- Diluio 10 -8; 9- Diluio 10 -9 ;M:
Padro de tamanho molecular (DNA Ladder 1 Kb), visualizados sob luz U.V. em gel de agarose
1,5%, corados com brometo de etdio (1,5 mg/mL).

32
M 1 2 3 4 5 6 7 8 9

102 pb

Figura 6: Produtos de PCR obtidos com DNA extrado a partir de diluies seriadas de S. aureus,
utilizando iniciador SEA (102 pb). M: Padro de tamanho molecular (DNA Ladder 1 Kb); 1-
Diluio 10-; 2- Diluio 10-; 3- Diluio 10-; 4- Diluio 10 -4; 5- Diluio 10 -5; 6- Diluio 10 -
6
; 7- Diluio 10 -7; 8- Diluio 10 -8; 9- Diluio 10 -9 visualizados sob luz U.V. em gel de agarose
1,5%, corados com brometo de etdio (1,5 mg/mL).

M 1 2 3 4 5 6 7 8 9 M

164 pb

Figura 7: Produtos de PCR obtidos com DNA extrado a partir de diluies seriadas de S. aureus,
utilizando iniciador SEB (164 pb). M: Padro de tamanho molecular (DNA Ladder 1 Kb); 1-
Diluio 10-; 2- Diluio 10-; 3- Diluio 10-; 4- Diluio 10 -4; 5- Diluio 10 -5; 6- Diluio 10 -
6
; 7- Diluio 10 -7; 8- Diluio 10 -8; 9- Diluio 10 -9, visualizados sob luz U.V. em gel de agarose
1,5%, corados com brometo de etdio (1,5 mg/mL).

33
1 2 3 4 5 6 7 8 9 M

451 pb

Figura 8: Produtos de PCR obtidos com DNA extrado a partir de diluies seriadas de S. aureus,
utilizando iniciador SEC (451 pb): 1- Diluio 10-; 2- Diluio 10-; 3- Diluio 10-; 4- Diluio
10 -4; 5- Diluio 10 -5; 6- Diluio 10 -6; 7- Diluio 10 -7; 8- Diluio 10 -8; 9- Diluio 10 -9 ; M:
Padro de tamanho molecular (DNA Ladder 1 Kb), visualizados sob luz U.V. em gel de agarose
1,5%, corados com brometo de etdio (1,5 mg/mL).

4.2.1 Resultados da avaliao da ento divididas em dois grupos: CBT (5.000 a


sensibilidade 496.000 UFC/mL) e CBT (530.000 a
9.156.000 UFC/mL), (Tab. 2). Dessas
Foi verificada a presena de produtos de PCR amostras, 125 apresentaram CBT entre 5.000
at a diluio 10 -9 para os cinco pares de a 496.000 UFC/mL, sendo que 91 (72,8%)
iniciadores utilizados. Nas amostras clinicas foram positivas quanto a presena de S.
observou-se produtos de PCR em amostras aureus, enquanto que nas 75 amostras do
com CCS de at 36.000 cl/mL e CBT de outro grupo (CBT entre 530.000 a 9.156.000
12.000 UFC/mL (ANEXO 1). UFC/mL), 54 (72%) foram positivas quanto a
presena de S. aureus.
4.3 Amostras Clnicas Com relao CCS as amostras variavam
entre 34.000 e 3.715.000 cls/mL de leite.
Das 200 amostras de leite analisadas, 145 Essas amostras tambm foram divididas em
(72,5%) foram consideradas como positivas dois grupos de CCS (34.000 a 497.000
para a presena de S. aureus por cls/mL) e CCS (500.000 a 3.715.000
apresentarem produtos que amplificaram na cls/mL) (Tab. 3). Dessas amostras, 126
reao de PCR para o gene fem A e 55 apresentaram CCS entre 34.000 a 497.000
amostras foram consideradas como negativas cels/mL, sendo que 87 (69,05%) foram
para a presena desta bactria por positivas para a presena de S. aureus,
apresentarem resultado negativo na PCR para enquanto que para as 74 amostras do outro
esse gene. grupo (CCS entre 500.000 a 3.715.000
cls/mL) constatou-se 58 (78,38 %) positivas
Foi analisado estatisticamente pelo teste do quanto presena de S. aureus.
, se houve relao entre a presena de S.
aureus identificados nas amostras de leite Utilizando o teste de constatou-se que no
com maiores CCCS e CBT. Para isso foi h diferena estatstica entre os grupos
identificado que as amostras analisadas avaliados.
possuam CBT que variavam entre 5.000 e
9.156.000 UFC/mL. Essas amostras foram

34
Tabela 2. Distribuio das amostras de leite com relao CBT e a presena de S. aureus,
identificadas pela amplificao do gene fem A , procedentes de produtores rurais da microrregio de
Sete Lagoas-MG, 2009.

Presena do gene CBT x 1.000 CBT x 1.000 TOTAL


femA (5 a 496 UFC/mL) (530 a 9.156/ UFC/mL)
NEGATIVO 34 ( 17%) 21 ( 10,5 %) 55 ( 27,5 %)
POSITIVO 91( 45,5 %) 54 ( 27 %) 145 ( 72,5 %)
TOTAL 125 ( 62,5 %) 75 ( 37,5 %) 200 (100%)

Tabela 3: Distribuio das amostras de leite com relao CCS e a presena de S. aureus,
identificadas pela amplificao do gen fem a, procedentes de produtores rurais da microrregio de
Sete Lagoas-MG, 2009.

Presena do gene CCS x 1.000 CCS x 1.000 TOTAL


femA (34 a 497 cels/mL) (500 a 3715 cels/mL)
NEGATIVO 39 (19,5%) 16 (8 %) 55 (27,5 %)
POSITIVO 87 (43,5 %) 58 (29 %) 145 (72,5 %)
TOTAL 126 (63 %) 74 (37 %) 200 (100%)

145 amostras foram analisadas quanto amostras amplificadas e, posteriormente sec


presena de enterotoxinas A, B e C e que apresentou 10 (6,9%) amostras
resistncia aos antibiticos pela amplificao amplificadas. Foi verificada tambm co-
de genes especficos. amplificao dos genes sea e seb em 42
(28,9%) amostras, sea e sec em 9 (6,2%)
Das 145 amostras de leite que amplificaram o amostras, seb e sec em 3 (2,11%) amostras e
gene fem A, 87 (60%) amplificaram sea, co-amplificao dos trs genes sea, seb e, sec
sendo este o gene mais prevalente, seguido em 3 (2,11%) amostras, demonstradas na Fig
por seb que apresentou 55 (37,91 %) 9.

35
60
sea
50
seb
40 sec
sea + seb
% 30
sea + sec
20
seb + sec
10 sea + seb + sec

0
sea seb sec sea + sea + seb + sea +
seb sec sec seb +
sec
Genes

Figura 9: Distribuio dos genes produtores de enterotoxinas das 145 amostras de S. aureus
identificadas pela presena do gene fem A em amostras de leite da microrregio de Sete Lagoas-
MG, 2009.

5- DISCUSSO negativas tambm podem ocorrer quando


resduos de antibiticos esto presentes na
A correta identificao das espcies amostra, inibindo crescimento microbiano.
bacterianas que causam a mamite bovina de Por outro lado, a presena de leuccitos e alta
importncia no apenas no aspecto clnico, contagem de clulas somticas no leite
mas tambm no biotecnolgico, tambm tm um potencial de inibio do
epidemiolgico e em estudos ambientais. crescimento (Phuektes et al., 2001;
Esses conhecimentos podem ajudar no Cremonesi et al., 2005). Por este motivo
desenvolvimento de estratgias preventivas, mtodos moleculares utilizados para deteco
indicando formas de tratamento do animal de microrganismos em amostras de leite de
durante a lactao, descarte ou servir de base grande relevncia. Neste trabalho a
para a administrao do tratamento seletivo especificidade foi constada pela presena de
no perodo seco, segundo afirmaes de Reis produto amplificado de tamanho esperado ao
et al. (2003) e Zschck et al. (2005), utilizar como molde, o DNA das amostras de
justificando um diagnstico mais preciso. referncia e por no amplificar DNA de S.
epidermidis. A especificidade dessa tcnica
Os mtodos comumente utilizados para foi tambm estudada por Costa (2008) ao
diagnstico etiolgico dos casos de mamite submeter 360 amostras de bactrias isoladas
baseiam-se na cultura bacteriolgica, atravs de casos de mamite clnica e subclnica,
do isolamento e identificao das bactrias identificadas fenotipicamente como S. aureus
por tcnicas bioqumicas, sendo limitados e pela PCR, constatou a amplificao do gene
pela baixa sensibilidade e crescimento lento fem A em 97,77 % destas amostras.
ou invivel do microrganismo. Culturas

36
A utilizao do gene fem A, como marcador diagnsticos microbiolgicos (Zschck et al.,
epidemiolgico para deteco e identificao 2005), entre eles a reao em cadeia da
de S. aureus, a partir de amostras de leite, polimerase. Apesar destes aspectos, a
mostrou-se til em estudos populacionais utilizao da PCR em amostras clnicas,
sobre a dinmica das infeces intramamrias como o leite, pode ser comprometida em
(Veras, 2004; Costa, 2008). Constatou-se a termos de sensibilidade, posto que no leite
presena deste microrganismo em 72,5% das substncias como Ca2+, gordura e protenas
amostras de leite estudadas nos rebanhos podem diminuir a sensibilidade da tcnica ou
bovinos leiteiros da microrregio de Sete at mesmo inibi-la, conforme relataram
Lagoas-MG, mostrando ser este um dos Cremonesi et al. (2005) e Ramesh et al.
principais agentes causadores de casos de (2005). Entre elas, destaca-se a casena, um
mamite naquela regio, considerando que das dos principais inibidores presentes no leite,
145 amostras que amplificaram o gene fem A, que em associao com o clcio formam
123 (84,83%) amostras possuam CCS acima micelas. A adio de solues com altas
de 200.000 cl/mL e, segundo Harmon concentraes de EDTA quelam o clcio
(1994), CCSLT superiores a 200.000 dissolvendo as micelas de casena (Silva,
constituem um forte indcio da mamite 2008). Neste experimento utilizou-se tampo
subclnica. Este fato tambm foi constatado TE e soluo de lavagem alcalina durante a
em levantamentos realizados em diversas extrao de DNA para diminuir esses
regies do Brasil que apontaram a mamite inibidores.
contagiosa como a mais freqente, tendo
como agente principal o S. aureus (Silva et Assim os limites de deteco de S. aureus de
al.,1983; Nader Filho et al.,1984; Costa et al., 10 UFC/mL de leite, alcanados neste
1995; Brito et al., 1999; Donatele et al., trabalho foram menores que os obtidos por
2002; Costa, 2008). A frequncia de S. Ramesh et al. (2005) e Silva (2008) ao
aureus identificados em amostras de leite detectarem, por PCR, concentraes entre 10
neste trabalho de 72,5% foi intermediria a 100 vezes maiores deste patgeno no leite.
entre os diferentes registros encontrados na Essa diferena de sensibilidade pode ser
literatura, entre 9,1% a 85% (Langenegger et explicada pela metodologia empregada na
al., 1986; Costa, 1986; Vianni e Nader Filho, extrao de DNA de S. aureus diretamente do
1989; Trinidad et al., 1990; Langoni et al. leite e tambm pela diferena dos iniciadores
1991; Wilson et al., 1997). Segundo Pinheiro utilizados para a reao de PCR, entre os
de S et al. (2004), estas diferenas so trabalhos. Neste trabalho foram utilizados
devidas aos aspectos multivariveis referentes iniciadores descritos por Betley e Mekalanos
s raas, idade, ambiente e os de manejo na (1988) (sea), Jones e Khan (1986) (seb),
criao, alm de que muitos casos tratam de Bohach e Schillievert (1987) (sec) e Berger-
estudos retrospectivos com nmeros de Bachi et al. (1989) (fem A) e Lee (2003) (mec
amostras diferentes, o que deve influenciar na A) que foram especficos para os genes
variao dos resultados. desejados, no havendo amplificao de
nenhum DNA de outro microrganismo
Com a finalidade de se obter tcnicas testado.
acuradas, rpidas e especficas para o
diagnstico e estudos epidemiolgicos da Entre as amostras analisadas, 16 (11,0 %)
mamite bovina, mtodos moleculares tm delas amplificaram o gene mec A,
sido crescentemente utilizados em identificando a existncia de amostras de

37
MRSA, no leite produzido na microrregio de processos inflamatrios, que passa de 50.000
Sete Lagoas. O primeiro trabalho a analisar cels/mL de leite para milhes de clulas por
diretamente do leite os MRSA, a partir da mililitro (Silveira Filho, 2007). Costa (2008)
deteco do gene mec A, foi o realizado por observou elevados ndices de mamite clnica
Silva (2008), identificando uma (3,3%) entre e de mamite subclnica causados por S.
30 amostras de leite de tanque de expanso aureus, associados com elevadas CCS no
procedentes de outras regies produtoras de leite de tanque de expanso, entre rebanhos
leite de Minas Gerais. O maior nmero de bovinos leiteiros no Sul de Minas Gerais,
amostras utilizadas neste trabalho, todas entretanto, no encontrou correlao entre as
procedentes de uma mesma microrregio, taxas de isolamento de S. aureus e altas
torna-se mais representativo, evidenciando a CCSLT e CBT. Os resultados encontrados
disseminao deste tipo de microrganismo nesta pesquisa, realizada na microrregio de
entre rebanhos produtores de leite o que Sete Lagoas-MG, so semelhantes aos
sugere serem as infeces mamrias por apresentados por Costa (2008), mesmo no se
MRSA, em bovinos leiteiros, um srio estabelecendo os ndices de mamite clnica ou
problema no campo, como afirmaram Lee et subclnica entre os rebanhos trabalhados.
al. (2004). Esse resultado pode ser atribudo a alta
sensibilidade da tcnica utilizada.
A identificao de MRSA em 11,03% das
amostras de leite nesse trabalho pode ter
correlao com outros estudos em nosso Pas, Pinheiro de S et al. (2004) verificaram uma
como o observado por Cardoso et al. (2000) correlao entre a produo de enterotoxinas
que constataram atravs de antibiograma a e a resposta celular verificada pela CCS,
baixa eficincia de ampicilina e penicilina G revelando que nos casos de deteco de
entre isolados de S. aureus provenientes de enterotoxinas as amostras eram provenientes
leite de 23 municpios do estado de Minas de quartos mamrios com CCS superior a
Gerais, e por Donatele et al. (2002) que 1000 x 103 clulas por mL de leite, o que
verificaram elevados ndices de resistncia pode sugerir possvel fator de virulncia para
para os antibiticos -lactmicos (82,9%) e este agente. Neste trabalho no foi possvel
tetraciclinas (24,4%) em 180 amostras de S. avaliar o leite proveniente diretamente dos
aureus isolados de casos de mamite quartos mamrios de vacas, porm, das 145
subclnica em rebanhos do estado do Rio de amostras analisadas para a presena do gene
Janeiro. de enterotoxinas, somente 17 amostras
(11,72%) apresentaram CCS maior do que
S. aureus geralmente est associado com a 1000 x 103 clulas por mL de leite, dessa
mamite subclnica, subaguda ou crnica, mas forma no foi possvel relacionar a
eventualmente pode determinar casos severos importncia da produo de enterotoxinas e o
de mamite. Nos casos de infeces grau de resposta celular da glndula mamria.
intramamrias, a presena desta bactria ou
de seus produtos estimula a formao de Mesmo assim, vale discutir os resultados das
mediadores inflamatrios endgenos que CCS e CBT observadas entre as 145 amostras
disparam o recrutamento de polimorfo de leite positivas para presena de S. aureus.
nucleados (PMN) do sangue e estimulam a As contagens de clulas somticas variavam
diapedese. Os PMN podem ento justificar a entre 34.000 e 3.715.000 cls/mL de leite,
elevao significativa na CCS durante os enquanto que as contagens do nmero de

38
bactrias presentes variaram entre 5.000 e de S. aureus de amostras de leite provenientes
9.156.000 UFC/mL. Por estes achados, pode- de vacas com mamite e queijo coalho,
se deduzir que as infeces subclnicas nenhum apresentava os genes sea, seb e sec,
predominaram entre os rebanhos que havendo apenas a amplificao dos
compuseram essas amostras de leite, posto segmentos de tamanho esperado nas amostras
que os valores mdios de CCS e CBT para de referncia (FRI) usadas como controle
leite de tanque se enquadram nas estimativas positivo. Os genes identificados foram os
de contedos celulares e bacterianos responsveis pela produo das enterotoxinas
apresentados em rebanhos com mamite SEG, SEH, SEI e SEJ.
estafilococica subclnica (Silveira Filho,
2007; Costa, 2008). Segundo Pinheiro de S et al (2004), as SEB
predominaram em estudo realizado em
Quanto pesquisa do potencial toxignico, do amostras de S. aureus isoladas de rebanhos
total de 145 amostras de S. aureus, 87 (60%) com infeces subclnicas. Para estes autores
amplificaram o gene sea, sendo este mais os resultados apresentados diferem em sua
prevalente, 55 (37,93%) das amostras com o grande maioria, o que deve refletir a
gene seb e, posteriormente, 10 (6,9%) com o importncia da genotipagem de amostras de
gene sec. A co-amplificao dos genes sea + S. aureus para uma melhor interpretao. As
seb por 42 amostras (28,9%), sea + sec por 9 variaes observadas na distribuio dos
amostras (6,2%) , seb + sec por 3 amostras genes toxignicos neste e em outros estudos
(2,06%) e co-amplificao dos trs genes sea, realizados podem estar relacionadas s
seb, sec por 3 amostras (2,06%). Os diferenas geogrficas, devido a diferentes
resultados observados nesse estudo foram condies ambientais, bem como natureza
coerentes aos encontrados por Veras (2004), dos isolados de S. aureus.
Silva (2004) e Nader Filho et al. (2007), que
tambm utilizaram a tcnica de PCR, com 6- CONCLUSES
predominncia de amostras de S. aureus que
possuam o gene de SEA, seguida de SEB e De acordo com os resultados pode-se
posteriormente SEC. A associao de concluir:
SEA+SEB tambm predominou entre os
achados destes autores. - O alto percentual de amostras de leite que
amplificaram o gene fem A sugere que o S.
Resultados divergentes so apresentados por aureus constitue um dos principais agentes
Cardoso et al. (1999) ao caracterizarem a causadores de infeces intramamrias na
produo de enterotoxinas estafiloccicas por microrregio de Sete Lagoas-MG;
127 amostras de S. aureus, isoladas de leite
proveniente de vacas com mamite em Minas - A tcnica de PCR utilizada neste estudo
Gerais, pela tcnica de OSP, observaram o apresentou alta sensibilidade e especificidade
predomnio de amostras produtoras de SED, para diagnstico de S. aureus, enterotoxinas
seguida de SEB, SEC e SEA. Estes autores estafiloccicas e MRSA no leite;
ainda descrevem a presena da TSST-1 entre
as amostras de S. aureus. J Luz (2008) - O gene sea foi o mais prevalente nas
tambm obteve resultado divergente ao deste amostras analisadas, seguidos dos genes seb e
trabalho no que se refere presena das sec;
enterotoxinas clssicas, pois nos 94 isolados

39
- Em uma mesma amostra constatou-se a BERGDOLL, M.S. Staphylococcus aureus.
presena de mais de um gene para In: Foodborne bacterial pathogens. New
enterotoxinas; York: Marcel Dekker, 1989, p.463-523.

- No houve correlao entre as taxas de BETLEY; M. J.; MEKALANOS, J. J.


identificao de S. aureus e altas taxas Nucleotide sequence of type A
CCSLT e CBT; staphylococcal enterotoxin gene. Journal of
Bacteriology, v. 170, p. 34-41, 1988.
- A tcnica de PCR, utilizando DNA de
extraes realizadas diretamente do leite, para BOHACH, G. A.; SCHLIEVERT, P. M.
identificao de S. aureus e determinao do Nucleotide sequence of the staphylococcal
seu potencial enterotoxignico, mostrou-se enterotoxin C1 gene and relatedness to other
til para estudos epidemiolgicos sobre as pyrogenic toxins. Molecular and General
infeces intramamrias causadas por S. Genetics, v. 209, p. 15-20, 1987.
aureus.
BOHACH, G. A.; SCHLIEVERT, P. M.
7- REFERNCIAS BIBLIOGRFICAS: Conservation of the Biologically Active
Portions of Staphylococcal Enterotoxins C1
ALMEIDA, C.F.; ARAJO E. S.; SOARES and C2. Infection and Immunity, v. 57, p.
Y.C.; et.al . Perfil epidemiolgico das 2249-2252, 1989.
intoxicaes alimentares notificadas no
Centro de Atendimento Toxicolgico de BOYLE-VAVRA S, LABISCHINSKI H,
Campina Grande, Paraba. Rev. Bras. EBERT CC, EHLERT K, DAUM RS. A
Epidemiol., v.11, n.1, p.139-146, 2008. spectrum of changes occurs in peptidoglycan
composition of glycopeptide-intermediate
ANDRADE, M. A. Tipagem molecular e clinical Staphylococcus aureus isolates.
investigao dos genes toxignicos em Antimicrob Agents Chemother, v. 45, p. 280-
Staphylococcus aureus isolados de amostras 287, 2001.
clnicas. 2008. 124f. (Mestrado em Sade
Pblica) Centro de Pesquisas Aggeu BRASIL. Instruo Normativa SDA/n.51 de
Magalhes, Fundao Oswaldo Cruz, Recife. 18 de Setembro de 2002. Estabelece os
parmetros tcnicos de produo, identidade
BALABAN, N.; RASOOLY, A. Review: e qualidade do leite tipo A, do leite tipo B, do
Staphylococcal enterotoxins. International leite tipo C, do leite pasteurizado e do leite
Journal of Food Microbiology, v. 61, p. 1-10, cru refrigerado e seu transporte a granel, em
2000. conformidade com os Anexos a esta Instruo
Normativa. Dirio Oficial da Unio,
BERGER-BACHI, B.; BARBERIS-MAINO, 18/09/2002.
L.; STRASSLE, A. et al. FemA, a
hostmediated factor essential for methicillin BRANT, L.M.F.; FONSECA L.M.; SILVA
resistance in Staphylococcus aureus: M.C.C. Avaliao da qualidade
molecular cloning and characterization. microbiolgica do queijo-de-minas artesanal
Molecular and General Genetics, v. 219, n. do Serro-MG. Arq. Bras. Med. Vet. Zootec.,
1-2, p. 263-269, 1989. vol.59, n.6, 2007

40
BRITO, M.A.V.P.; BRITO, J.R.F.; CHEN, T.R.; HSIAO, M.H.; CHIOU, C.S. et
RIBEIRO, M.T. et al. Padro de infeco al. Development and use of PCR primers for
intramamria em rebanhos leiteiros: exame de the investigation of C1, C2 and C3
todos os quartos mamrios de vacas em enterotoxins types of Staphylococcus aureus
lactao. Arquivo Brasileiro de Medicina strains isolated from food-borne outbreaks.
Veterinria e Zootecnia., v. 51, n 2, p. 129- International Journal of Microbiology, v. 71,
135, 1999. n. 1, p. 63-70, 2001.

CARDOSO, H.F.T.; COSTA, G.M.; SILVA, CHIANG, Y-C., LIAO, W-W., FAN, C-M.,
N. Susceptibilidade a antimicrobianos de PAI, W-Y., CHIOU, C-S., TSEN, H-Y.,
Staphylococcus aureus isolados de leite 2008. PCR detection of Staphylococcal
bovino no Estado de Minas Gerais. Revista enterotoxins (SEs) types in Staphylococcus
Brasileira de Medicina Veterinria, v. 22, n. aureus isolates from food-poisoning cases in
5, p. 199-206, 2000. Taiwan. International Journal of Food
Microbiology., v.121, p. 66-73.
CARDOSO, H.F.T.; SILVA, N.; SENA, M.J.
et al. Production of enterotoxin and toxic COSTA, E. O. Etiologia bacteriana da mastite
shock syndrome toxin by Staphylococcus bovina no Estado de So Paulo, Brasil.
aureus isolated from bovine mastitis in Revista de Microbiologia, v. 17, p. 107-112,
Brazil. Letters in Applied Microbiology, v. 1986.
29, p. 347-349, 1999.
COSTA, E.O.; MELVILLE, P.A.; RIBEIRO,
CARMO, L.S. Produo e purificao em A.R. et al. ndices de mastite bovina clnica e
grande escala das enterotoxinas subclnica nos estados de So Paulo e Minas
estafiloccicas SEA, SEB, SEC2, SED e Gerais. Revista Brasileira de Medicina
TSST-1 para uso em ensaios imuno- Veterinria, v. 17, n. 5, p. 215-217, 1995.
enzimticos. 2001. 254f. Tese (Doutorado em
Microbiologia) - Instituto de Cincias COSTA, G. M. Mamite bovina em rebanhos
Biolgicas, Universidade Federal de Minas leiteiros da regio sul do estado de Minas
Gerais, Belo Horizonte. Gerais.- 2008. 123 p. Tese (doutorado)
Escola de Veterinria, Universidade Federal
CASSOLI, L.D.; MACHADO, P.F. Impacto de Minas Gerais, Belo Horizonte.
da Instruo Normativa 51 na qualidade do
leite. In: ENCONTRO DE PESQUISADORES COUCH, J. L.; BETLEY, M. J. Nucleotide
EM MASTITES, 4, 2007, Botucatu. Anais... sequence of the type C3 staphylococcal
Botucatu: FMVZ UNESP, 2007, p.30-37. enterotoxin gene suggests that intergenic
recombination causes antigenic variation.
CHAMBERS HF. Methicillin-resistant Journal of Bacteriology, Washington, v. 171,
staphylococci. Clin Microbiol Rev., v1, p. 4507-4510, 1989.
p.173-186, 1988.

41
CREMONESI, P.; LUZZANA, M.; EMPRESA BRASILEIRA DE PESQUISA
BRASCA, M. et al. Development of a AGROPECUARIA (EMBRAPA), 2009 b.
multiplex PCR assay for the identification of Disponvel em www.cnpgl.embrapa.br/nova/
Staphylococcus aureus enterotoxigenic informacoes/estatisticas/producao/tabela0244.
strains isolated from milk and dairy products. php, acessado em 15/06/2009.
Mol. Cel. Probes, v. 19, p. 299-305, 2005.
EVENSON, M. L. Estimation of human dose
CUNHA, M.L.R.S. Staphylococcus aureus: of staphylococcal enterotoxin A from a large
toxinas e sade pblica. In: ENCONTRO DE outbreak of staphylococcal food poisoning
PESQUISADORES EM MASTITES, 4, 2007, involving chocolate milk. International
Botucatu. Anais... Botucatu: FMVZ Journal of Food Microbiology, Amsterdam,
UNESP, 2007. p.56-63. v. 7, p. 311-316, 1988.

DE LENCASTRE, H.S.A.; FIGUEIREDO, FAGUNDES, H.; OLIVEIRA, C. A. F.


A. S, URBAN, C., TOMASZ, A. Multiple Infeces intramamrias causadas por
mechanisms of methicillinresistance and Staphylococcus aureus e suas implicaes em
improved methods for detection in clinical sade pblica. Cin. Rural, v. 34, n. 4, p.
isolates of S. aureus. Antimicrob Agents 1315-1320, 2004.
Chemother, p. 632-639, 1991.
FITZGERALD, J.R.; MEANEY, W.J.;
DEVRIESE, L.A.; VANDAMME, L. R.; HARTIGAN, P.J. et al. Fine-structure
FAMEREE, L. Methicilin (cloxacillin)- molecular epidemiological analysis of
resistant Staphylococcus aureus strain Staphylococcus aureus recovered from cows.
isolated from bovine mastitis cases. Zbl. Vet. Epidemiology and Infection, v. 119, p. 261-
B., v. 19, p. 598-605, 1972. 269, 1997.

DONATELE, D.M.; MOTTA, O.V.; FOLLY, FRAZIER, W. C.; WESTHOFF, D. C.


M.M. Perfil antimicrobiano de linhagens de Microbiologia de los Alimentos. 4. ed.
Staphylococcus spp. coagulase positiva na Zaragoza: Acribia, 2000. 681 p.
mastite subclnica de vacas leiteiras nas
regies norte e noroeste do Estado do Rio de FOOD AGRICULTURE ORGANIZATION -
Janeiro. Revista do Ncleo de Apoio FAO. Statistical data please, Disponvel
Pesquisa em Glndula Mamria e Produo em:<http://faostat.fao.org> Acesso em
Leiteira, v. 5, n. 2, p. 3-6, 2002. 20/01/2010.

EMPRESA BRASILEIRA DE PESQUISA FREITAS, M. F. L. Exotoxinas


AGROPECUARIA (EMBRAPA), 2009 a. Estafiloccicas. Cincia Veterinria Tropical,
Disponvel em Recife, v.7, p. 63-74, 2004.
http://www.agencia.cnptia.embrapa.br/Agenc
ia8/AG01/Abertura.html, acessado em
25/08/2009 .

42
FUEYO, J. M. Relationships between toxin JUDICIAL COMMISSION. Conservation of
gene content and genetic background in nasal the generis name Staphylococcus Rosembach,
carried isolates of Staphylococcus aureus designation of Staphylococcus aureus
from Asturias, Spain. FEMS Microbiology Rosembach and designation of a neotype
Letters, Amsterdam, v. 243, p. 447-454, culture of Staphylococcus aureus Rosembach.
2005. Opinion 17. International Bulletin of
Bacteriological Nomenclature and
GALTON, D. M.; ADKINSON, R. W.; Taxonomy., v. 8, p. 153-154, 1958.
THOMAS, C. V. et al. Effects of premilking
udder preparation on environmental bacterial KLOSS, W. E.; LAMBE, J. R.
contamination of milk. Journal of Dairy Staphylococcus. In: BALOWS, A. Manual of
Science, v 65, p.1540, 1982. Clinical Microbiology. 5. ed. Washington:
American Society for Microbiology, 1991,
GUIMARES, F.F. Modificao da 1500 p.
geografia da produo mundial de leite.
Revista do Ncleo de Apoio Pesquisa em LAFFRANCHI, A.; MULLER, E.E.;
Glndula Mamria e Produo Leiteira, v. 9, FREITAS, J.C. et al.. Etiologia das infeces
n. 1, p. 19-23, 2006. intramamrias em vacas primparas ao longo
dos primeiros quatro meses de lactao.
HARMON, R.J. Physiology of mastitis and Cincia Rural, v. 31, n. 6, p. 1027- 1032,
factors affecting somatic cell counts. Journal 2001.
of Dairy Sciences, v. 77, n. 7, p. 2103-2112,
1994. LAMAITA H. C., CERQUEIRA M. M.O.P.,
CARMO L.S. et al. Contagem de
HIROOKA, E. Y. et al. Enterotoxigenicity of Staphylococcus sp. e deteco de
Staphylococcus intermedius of canine origin. enterotoxinas estafiloccicas e toxina da
International Journal Food Microbiology. v. sndrome do choque txico em amostras de
7, p. 185-191, 1988. leite cru refrigerado. Arq. Bras. Med. Vet.
Zootec., v.57, n.5, p.702-709, 2005.
INSTITUTO BRASILEIRO DE
GEOGRAFIA E ESTATSTICAS (IBGE), LANGONI, H., SILVA, A.V., CABRAL,
2009. Disponvel em www.ibge.gov.br, K.G. et al. Etiologic aspects on bovine
acessado em 25 ago. 2009. mastitis: aerobic bacterial flora. In:
PANAMERICAN CONGRESS ON MASTITIS
JOHNS JR, M. B.; KHAN, A. Staphylococcal CONTROL AND MILK QUALITY, 1, 1998,
enterotoxin B gene is associated with discrete Mrida. Proc... Mxico: 1998. p. 468-480. en
genetic element. Journal of Bacteriology., v. Ciencias Veterinarias, v. 9, n. 1, p. 49-55,
170, p. 4033-4039, 1988. 1994.

43
LANGONI, H. et al. Etiologia e sensibilidde LOUIE, L.; GOODFELLOW, J.; MATHIEU,
bacteriana da mastite bovina subclnica. P. et al. Rapid detection of
Arquivo Brasileiro de Medicina Veterinria e methicillinresistant staphylococci from blood
Zootecnia, v. 43, p. 507-515, 1991. culture bottles by using a multiplex PCR
assay. J Clin Microbiol, v. 40, p. 2786-2790,
LANGENEGGER, J.; FIGUEIREDO, M. P.; 2002.
REZENDE, E. F. Eficcia teraputica do
cefacetril frente aos microrganismos dos LUZ, I. S.. Caracterizao molecular das
gneros Staphylococcus e Streptococcus toxinas em Staphylococcus aureus isolados
isolados de mastites subclnicas. Hora de leite e queijo de coalho em municpios da
Veterinria, v. 30, p. 24-27, 1986. Regio Agreste de Pernambuco. 2008. 125f.
Dissertao (Mestrado em Sade Pblica) -
LANGONI, H., PINTO, M.P., Centro de Pesquisas Aggeu Magalhes,
DOMINGUES, P.F. et al. Etiologia e Fundao Oswaldo Cruz, Recife.
sensibilidade bacteriana da mastite bovina
subclnica. Arquivo Brasileiro de Medicina MARTINEZ, G.; HAREL, J.;
Veterinria e Zootecnia, v. 43, n. 6, p. 507- GOTTSCHALK, M. Specific detection by
515, 1991. PCR of Streptococcus agalactiae in milk.
Can. J. Vet. Res., v. 65, p. 68-72, 2001.
LANGONI, H., SILVA, A.V., CABRAL,
K.G. et al. Etiologic aspects on bovine MIDDLETON, J. R.; FALES, W. H.; LUBY,
mastitis: aerobic bacterial flora. In: C. D. et al. Surveillance of Staphylococcus
PANAMERICAN CONGRESS ON MASTITIS aureus in veterinary teaching hospitals. J.
CONTROL AND MILK QUALITY, 1, 1998, Clin. Microbiol., v. 43, n. 6, p. 2916-2918,
Mrida. Proc... Mxico: 1998. p. 468-480. 2005.

LEE, J. H.; JEONG, J. M.; PARK, Y. H. et MILLAR, B. C.; JIRU, X.; MOORE, J. E. et
al. Evaluation of the Methicillin-Resistant al. A simple and sensitive method to extrat
Staphylococcus aureus (MRSA)-Screen latex bacterial, yeast and fungal DNA from blood
agglutination test for detection of MRSA of culture material. J. Microbiol. Methods, v. 42,
animal origin. J. Clin. Microbial., Jun., v. 42, p. 139-147, 2000.
n. 6, p. 2780-2782, 2004.
MURRAY, P.R.; ROSENTHAL, K.S.;
LEE, J. H. Methicillin (Oxacillin)-Resistant KOBAYASHI, G.S. et al. Microbiologia
Staphylococcus aureus strains isolated from Mdica. Rio de Janeiro: Guanabara Koogan,
major food animals and their potencial 2000.
transmission to humans. Appl. Environ.
Microbial., Nov., v. 69, n. 11, p. 6489-6494,
2003.

44
NADER FILHO, A.; FERREIRA, L.M.; RAMESH, A.; PADMAPRIYA, B. P.;
AMARAL, L.A. et al. Enterotoxins and toxic CHANDRASHEKAR, A. et al. Application
shock syndrome toxin by Staphylococcus of a convenient DNA extraction method and
aureus strains isolated from bovine mastitis multiplex PCR for the direct detection of
Arq. Bras. Med. Vet. Zootec., v.59, n.5, Staphylococcus aureus and Yersinia
p.2007. enterocolitica in milk samples. Mol Cel
Probes.,v. 16, p. 307-314, 2005.
NADER FILHO, A.N.; ITURRINO, R.P.S.;
ROSSI-JUNIOR, O.D. Mastite subclnica em REIS, S.R., SILVA, N., BRESCIA, M.V.
rebanhos produtores de leite gordura 3,2%. Antibioticoterapia para controle da mastite
Arquivo Brasileiro de Medicina Veterinria e subclnica de vacas em lactao Arq. Bras.
Zootecnia, v. 36, n. 5, p. 549-58, 1984. Med. Vet. Zootec., v.55, n.6, p.651-658, 2003

OLIVEIRA, A. M.; RAMOS, M. C. PCR- RIBEIRO, J.; BOYCE, J. M.;


based ribotyping of Staphylococcus aureus. ZANCANARO, P. Q. Prevalence of
Bras. J. Med. Biol. Res., v. 35, p. 175-180, methicillin-resistant Staphylococcus aureus
2002. (MRSA) among patients visiting the
emergency room at a tertiary hospital in
OLIVEIRA, D.C.; LENCASTRE, H. Brazil. Brazilian Journal of Infectious
Multiplex PCR strategy for rapid Diseases, v.9, p.52-55, 2005.
identification of structural types and variants
of the mec element in methicillin-resistant RICH, M.; DEIGHTON, L.; ROBERTS, L.
Staphylococcus aureus. Antimicrob Agents Clindamycin resistence in Methicillin-
Chemother, v. 46, p. 2155-2161, 2002. resistant Staphylococcus aureus isolated from
animals. Vet. Microbiol., v. 111, p. 237-240,
PINHEIRO de S, M.E.; CUNHA, M.L.R.S; 2005.
ELIAS, A. O. et al. Importncia do
Staphylococcus aureus nas mastites ROBBINS, R., GOULD, S., BERGDOLL,
subclnicas: pesquisa de enterotoxinas e M.S. Detecting the enterotogenicity of
toxina do choque txico, e a relao com a Staphylococcus aureus strains. Appl.
contagem de clulas somticas. Braz. J. Vet. Microbiol., v.28, p.946-950, 1974.
Res. Anim. Sci., v.41, n.5, So Paulo
Sep./Oct. 2004. ROSEC, J. P.; GIGAUD, O. Staphylococcal
enterotoxin genes of classical and new
PHUERKTES, P.; MANSELL, P. D.; types detected by PCR in France.
BROWNING, G. F. Multiplex Polimerase International Journal of Food Microbiology,
Chain Reaction assay for simultaneous v. 25, p. 61-67, 2002.
detection of Staphylococcus aureus and
Streptococcal causes of bovine mastitis. J. RUEGG, P. L.; REINEMANN, D. J. Milk
Dairy Sci., n. 84, p. 1140-1148, 2001. quality and mastitis test. Bovine Practitioner,
Stillwater, v. 36, p. 41-54, 2002.
RAJALA-SCHULTZ, P. J. Antimicrobial
susceptibility of mastitis pathogens from first
actation and older cows. Veterinary
Microbiology, p. 33-42, 2004.

45
S, M.E.P.; CUNHA, M.S.R.S.; ELIAS, SILVA, N. Doena da glndula mamria. In:
A.O.; et al. Importncia do Staphylococcus MARQUES, D. C. Criao de Bovinos. 7. ed.
aureus nas mastites subclnicas: pesquisa de Belo Horizonte: CVP Consultoria
enterotoxinas e toxina do choque txico e a Veterinria e Publicaes, 2003. p. 435-451.
relao com a contagem de clulas somticas.
Braz. J. Vet. Res. Anim. Sci., v.41, p.321-326, SILVA, E. R. Genotipagem e avaliao do
2004. potencial enterotoxignico de amostras de
Staphylococcus aureus isoladas de mastite
SANTANA, E. H. W.; BELOTI, V.; caprina e bovina. 2004. 57f. Tese (doutorado)
OLIVEIRA, T. C. R. M.; et al. Staphylococci: Escola de Veterinria, Universidade Federal de
colonies morphological caracteristics, Minas Gerais, Belo Horizonte.
coagulase and EEA production colected from
cooled raw milk samples. Seminrio: SILVA, E. R.; SILVA, N. Coagulase gene
Cincias Agrrias, Londrina, v. 27, n. 4, p. typing of Staphylococcus aureus isolated
639-646, 2006. from cows with mastitis in southeastern
Brazil. Can. J. Vet. Res., v. 69, n. 4, p. 260-
SANTOS, F. G. B.; OLIVEIRA, W. L. M.; 264, 2005.
GARINO JNIOR, F. et al. Investigao dos
mecanismos de resistncia oxacilina em SILVA, M.A. Utilizao de PCR Multiplex
Staphylococcus aureus isolados de casos de para o diagnstico etiolgico da mastite
mastite bovina. Rev. Napgama, v. 8, n. 2, p. bovina. 2008. 35 f. Dissertao (Mestrado em
14-18, 2005. Cincia Animal) Escola de Veterinria,
Universidade Federal de Minas Gerais, Belo
SANTOS, M.V; FONSECA, L.F.L. Horizonte.
Estratgias para controle da mastite e
melhoria da qualidade do leite. So Paulo: SILVEIRA-FILHO, V. M. Tipagem
Manole Ltda, 2007, 314p. molecular de Staphylococcus aureus isolados
de casos de mastite bovina no Estado de
SAS INSTITUTE (1999). SAS User s Guide: Pernambuco, 2007. Dissertao (Mestrado) -
Statistics. V 8, SAS Institute, Inc., Cary , Universidade Federal de Pernambuco,
North Carolina. Departamento de Gentica, Recife, 2007.

SHAFER, W. M.; IANDOLO, J. J. TOMASZ, A.; DRUGEON, H.B;


Chromossomal locus for staphylococcal LENCASTRE, H.M; et al. New mechanism
enterotoxin B. Infection and Immunity, for methicillin-resistance in S. aureus:
Washington, v. 20, p. 273-278, 1978. clinical isolates that lack the PBP2a gene and
contain normal penicilin-bindig proteins with
SILVA, N., FIGUEIREDO, J.B., OLIVEIRA, modi.ed penicilin-binding capacity.
M. Mamite no Rebanho Bovino da Escola Antimicrob Agents Chemother, v.33, p. 1869-
Mdia de Agricultura de Florestal-UFV-MG. 1874, 1989.
Parte II. Freqncia e Etiologia. Arquivo
Brasileiro de Medicina Veterinria e
Zootecnia, v. 35, n. 1, p. 85-91, 1983.

46
TRINIDAD, P., NICKERSON, S. C., subclnica. Cincia Veterinria, v. 3, p. 5-6,
ALLEY, T. K. Prevalence of intramammary 1989.
infection and teat canal colonization in
unbred and primigravid dairy heifers. J. of VOSS, A.; MILATOVIC, D.;
Dairy Sci., v. 73, p. 107-114, 1990. WALLRAUCH, S.C.; et al. Methicillin-
resistant Staphylococcus aureus in Europe.
VAN DER FLIER, M.; VAN DIJK, N.B.; Eur J Clin Microbiol Infect Dis., v.13, p. 50-
FLUIT, A.C. et al. Fatal pneumonia in an 55, 1994.
adolescent due to community- acquired
methicillin-resistant Staphylococcus aureus WILSON, D. J.; GONZALES, R. N.; DAS,
positive for Panton- Valentine-leukocidin. H. H. Bovine mastitis pathogens in New York
Ned. Tijdschr Geneeskd, v. 147, p. 1076- and Pennsylvania: Prevalence and effects on
1079, 2003. somatic cell count and milk production. J. of
Dairy Sci., v. 80, p. 2592-2598, 1997.
VANNUFFELD, P.; GIGI, J.; EZZEDINE,
H. et al. Specific detection of ZAFALON, L.F.; AMARAL, L.A.; NADER
methicillinresistant Staphylococcus species FILHO, A. et al. Influncia de bactrias do
by multiplex PCR. Journal of Clinical gnero Corynebacterium e estafilococos
Microbiology, v. 33, p. 2864-67, 1995. coagulase positivos e negativos sobre a
contagem de clulas somticas e a produo
VASUDEVAN, P.; NAIR, M.K.M.; lctea de quartos mamrios com mastite
ANNAMALAI, T.A. et al. Phenotypic and subclnica. Revista do Ncleo de Apoio
genotypic characterization of bovine mastitis Pesquisa em Glndula Mamria e Produo
isolates of Staphylococcus aureus for biofilm Leiteira, v. 2, n. 6, p. 4-6, 1999.
formation. Vet. Microbiology., v. 92, p.179-
185, 2003. ZAFALON, L.F.; ARCARO, J.R.P; NADER
FILHO, A.; et al. Investigao de perfis de
VERAS, J.F. Identificao por PCR de genes resistncia aos antimicrobianos em
para produo de SEA, SEB, SEC e SED em Staphylococcus aureus isolados na ordenha
linhagens de Staphylococcus sp. Isolados de de vacas em lactao. Rev. Inst. Adolfo
surtos de toxinfeco alimentar por leite e Lutz,v. 67, n.2, p.118-125, 2008.
derivados. 2004. 82f. Dissertao (Mestrado
em Medicina Veterinria) Escola de ZSCHCK, M.; MANHOLD-MAURER, S.;
Veterinria, Universidade Federal de Minas WESCHER, A. et al. Evalution of tRNA
Gerais, Belo Horizonte. intergenic spacer length polymorphism
analysis as a molecular method for species
VIANNI, M. C. E., NADER FILHO, A. identification of streptococcal isolates from
Determinao do nmero de bactrias dos bovine mastitis. J. Dairy Sci., v. 72, p. 333-
gneros Staphylococcus e Streptococcus em 337, 2005.
amostras de leite de vacas com mastite

47
Anexo 01 Resultados das amostras analisadas.

CCS CBT
X 1000 X 1000 FEM A MEC A SEA SEB SEC
556 5794 NEGATIVO - - - -
115 395 NEGATIVO - - - -
412 313 NEGATIVO - - - -
393 107 NEGATIVO - - - -
129 25 NEGATIVO - - - -
382 11 NEGATIVO - - - -
1267 5845 NEGATIVO - - - -
497 984 NEGATIVO - - - -
412 429 NEGATIVO - - - -
941 4559 NEGATIVO - - - -
223 1855 NEGATIVO - - - -
1416 327 NEGATIVO - - - -
262 1762 NEGATIVO - - - -
180 6106 NEGATIVO - - - -
512 3536 NEGATIVO - - - -
174 3228 NEGATIVO - - - -
608 206 NEGATIVO - - - -
743 276 NEGATIVO - - - -
478 3897 NEGATIVO - - - -
220 1202 NEGATIVO - - - -
431 137 NEGATIVO - - - -
384 42 NEGATIVO - - - -
331 1025 NEGATIVO - - - -
762 898 NEGATIVO - - - -
1091 6807 NEGATIVO - - - -
801 187 NEGATIVO - - - -
774 44 NEGATIVO - - - -
148 1366 NEGATIVO - - - -
185 119 NEGATIVO - - - -
475 137 NEGATIVO - - - -
235 254 NEGATIVO - - - -
148 307 NEGATIVO - - - -
135 309 NEGATIVO - - - -
409 2928 NEGATIVO - - - -
34 139 NEGATIVO - - - -
174 331 NEGATIVO - - - -
408 185 NEGATIVO - - - -
264 809 NEGATIVO - - - -

48
CCS CBT
X 1000 X 1000 FEM A MEC A SEA SEB SEC
364 5871 NEGATIVO - - - -
114 383 NEGATIVO - - - -
761 7020 NEGATIVO - - - -
316 756 NEGATIVO - - - -
746 129 NEGATIVO - - - -
251 20 NEGATIVO - - - -
394 14 NEGATIVO - - - -
1520 975 NEGATIVO - - - -
309 479 NEGATIVO - - - -
1234 275 NEGATIVO - - - -
293 441 NEGATIVO - - - -
110 27 NEGATIVO - - - -
428 23 NEGATIVO - - - -
798 68 NEGATIVO - - - -
75 5 NEGATIVO - - - -
221 167 NEGATIVO - - - -
426 34 NEGATIVO - - - -
3038 5691 POSITIVO NEGATIVO NEGATIVO POSITIVO NEGATIVO
732 107 POSITIVO NEGATIVO NEGATIVO POSITIVO NEGATIVO
223 2119 POSITIVO POSITIVO NEGATIVO NEGATIVO POSITIVO
405 369 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
513 3591 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
1207 266 POSITIVO POSITIVO NEGATIVO POSITIVO NEGATIVO
497 2104 POSITIVO POSITIVO POSITIVO POSITIVO NEGATIVO
377 214 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
76 246 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
285 562 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
452 543 POSITIVO NEGATIVO POSITIVO POSITIVO POSITIVO
507 302 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
133 3827 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
462 8485 POSITIVO POSITIVO POSITIVO NEGATIVO NEGATIVO
1552 1316 POSITIVO NEGATIVO NEGATIVO POSITIVO NEGATIVO
153 118 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
491 1540 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
36 1080 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
458 180 POSITIVO NEGATIVO NEGATIVO POSITIVO NEGATIVO
741 164 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
131 6646 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
386 366 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO

49
CCS CBT
X 1000 X 1000 FEM A MEC A SEA SEB SEC
729 148 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
516 259 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
653 592 POSITIVO POSITIVO POSITIVO POSITIVO NEGATIVO
135 120 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
753 853 POSITIVO POSITIVO POSITIVO POSITIVO NEGATIVO
679 9156 POSITIVO POSITIVO POSITIVO POSITIVO NEGATIVO
388 215 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
462 3120 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
411 2540 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
565 257 POSITIVO NEGATIVO NEGATIVO POSITIVO NEGATIVO
2658 2111 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
212 2610 POSITIVO POSITIVO POSITIVO NEGATIVO NEGATIVO
296 1864 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
573 249 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
229 1816 POSITIVO NEGATIVO NEGATIVO POSITIVO NEGATIVO
138 138 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
210 4129 POSITIVO NEGATIVO POSITIVO POSITIVO POSITIVO
283 2362 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
467 4055 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
649 392 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
119 416 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
490 2576 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
3715 3817 POSITIVO POSITIVO NEGATIVO NEGATIVO NEGATIVO
585 216 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
259 107 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
458 24 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
1893 413 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
984 242 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
500 184 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
1380 327 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
2593 1698 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
232 1795 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
210 240 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
849 4514 POSITIVO POSITIVO NEGATIVO POSITIVO NEGATIVO
225 217 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
207 404 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
122 454 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
408 190 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
847 274 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO

50
CCS CBT
X 1000 X 1000 FEM A MEC A SEA SEB SEC
323 215 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
190 117 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
432 879 POSITIVO POSITIVO POSITIVO NEGATIVO NEGATIVO
1214 171 POSITIVO NEGATIVO NEGATIVO POSITIVO NEGATIVO
215 1365 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
230 104 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
520 191 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
157 103 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
441 366 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
432 614 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
732 854 POSITIVO NEGATIVO POSITIVO NEGATIVO POSITIVO
979 53 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
1134 226 POSITIVO NEGATIVO NEGATIVO POSITIVO NEGATIVO
1218 172 POSITIVO POSITIVO POSITIVO NEGATIVO NEGATIVO
98 182 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
555 530 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
557 477 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
301 269 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
620 4761 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
70 354 POSITIVO POSITIVO POSITIVO NEGATIVO NEGATIVO
504 899 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
254 309 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
475 182 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
258 5359 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
346 164 POSITIVO POSITIVO POSITIVO NEGATIVO NEGATIVO
779 590 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
650 264 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
388 476 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
2800 666 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
534 492 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
1969 974 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
237 295 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
339 330 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
333 418 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
1203 121 POSITIVO NEGATIVO NEGATIVO POSITIVO NEGATIVO
289 558 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
53 219 POSITIVO NEGATIVO POSITIVO NEGATIVO POSITIVO
324 157 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
441 100 POSITIVO NEGATIVO POSITIVO POSITIVO POSITIVO

51
CCS CBT
X 1000 X 1000 FEM A MEC A SEA SEB SEC
907 182 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
401 246 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
672 383 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
419 321 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
632 17 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
504 1163 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
527 214 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
985 683 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
282 483 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
286 192 POSITIVO NEGATIVO NEGATIVO POSITIVO NEGATIVO
283 981 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
184 308 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
524 2525 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
546 174 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
526 466 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
224 7411 POSITIVO NEGATIVO POSITIVO NEGATIVO POSITIVO
87 765 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
143 644 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
720 416 POSITIVO NEGATIVO POSITIVO NEGATIVO POSITIVO
140 346 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
201 240 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
174 4197 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
196 192 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
802 216 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
238 305 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
651 100 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
326 4653 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
257 6297 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
1182 1045 POSITIVO POSITIVO POSITIVO NEGATIVO NEGATIVO
281 1325 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
456 105 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
328 303 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
465 116 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
1090 207 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
374 185 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
63 228 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
182 7091 POSITIVO NEGATIVO NEGATIVO NEGATIVO NEGATIVO
2525 496 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO
201 26 POSITIVO NEGATIVO POSITIVO NEGATIVO POSITIVO

52
CCS CBT
X 1000 X 1000 FEM A MEC A SEA SEB SEC
647 36 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
465 12 POSITIVO NEGATIVO POSITIVO NEGATIVO POSITIVO
634 432 POSITIVO NEGATIVO POSITIVO POSITIVO NEGATIVO
456 85 POSITIVO POSITIVO NEGATIVO NEGATIVO NEGATIVO
286 36 POSITIVO NEGATIVO NEGATIVO POSITIVO NEGATIVO
464 26 POSITIVO NEGATIVO POSITIVO NEGATIVO NEGATIVO

53