Sunteți pe pagina 1din 30

KH4119_Unit 04 ES_E512-E541 03/16/05 11:11 AM Page 512

Genetic Information Is Stored


in Molecular Form
How might advances in DNA technologies Those events are responsible for maintaining a
affect your life? To answer that question, you species genetic continuity. The term replicate

Y
need to understand the role that DNA plays. refers to making a copy of a DNA molecule.
DNA contains information that is critical to The replication of DNA allows organisms to

P
the structure and function of your bodys cells. keep a set of genetic instructions for themselves
In fact, the instructions encoded in DNA play while passing on sets to their offspring.
a major role in determining how your body DNA is important both to a population
operates. If you have children, their lives and to each individual organism. To see why,

O
will depend on the transmission of genetic we must consider the processes by which cells
information from you and your spouse to them. use the information they contain. The use of

C
DNA instructions preserve species genetic information is known as gene
characteristics. DNA structure and the expression. The result of gene expression is
DNA copying processes are critical to that an organisms phenotype. Figure E12.1 also
transmission. DNA is responsible for the illustrates these events. Note the arrows that

T
accurate transmission of genetic information lead from the box labeled genotype to the word
from parents to offspring. The structure also is expression and to the word phenotype. These
responsible for accurately transmitting genetic arrows illustrate the flow of information

O
information from a cell to its offspring cells. during gene expression. Ultimately, the
In other words, DNA is the molecular basis of instructions stored in DNA enable all living
reproduction. organisms to build, maintain, and regulate

N
Figure E12.1 expands on the ideas of their cells. In this way, the information
Figure 11.6. It looks at the inheritance of stored in DNA is like the information stored
genotype and the production of phenotype at in the operating system of a computer. A
a molecular level. Note the arrows that lead computer cannot operate without operating

O
from the box labeled genotype to the word system instructions. Living systems cannot
replicate and back to genotype. These arrows function without the instructions for life
represent the cyclical events of reproduction. encoded in DNA.

D genotype: DNA expression phenotype:


protein

replicate

Figure E12.1 Dual role of genetic information. At the molecular level, your genotype is the
instructions encoded in your DNA. Replication allows these instructions to be transmitted to the next
generation. Gene expression allows these instructions to produce proteins that can build, maintain, and
regulate your body.

512 Unit 4 ESSAY: Genetic Information Is Stored in Molecular Form


KH4119_Unit 04 ES_E512-E541 03/16/05 11:11 AM Page 513

As you develop a deeper understanding DNA technologies to develop improvements


of how living systems rely on DNA, consider in agriculture such as disease-resistant crops.
why accurate DNA transmission from one You also may encounter DNA technologies
generation to the next is essential. That in the form of genetic fingerprinting.
understanding may help you see how Scientists use this technology to reevaluate
scientists growing knowledge of DNA historical events and establish guilt or
influences your life. For instance, DNA innocence in criminal cases. Who knows,

Y
analysis now offers hope of early diagnosis perhaps some day you will be involved in
and treatment of diseases such as cystic using DNA analysis techniques to solve a
fibrosis. Another example involves using great mystery!

Landmark Discovery:
P
O
DNA May Be the Stuff of Genes

C
New York (1944): The effort to mice had been transformed. The reported a set of experiments that
describe the molecular composi- bacteria now contained both the demonstrates that the substance
tion of those mysterious particles smooth-surfaced and harmful causing the change actually is
that scientists call genes moved characteristics. That transformation DNA. This discovery suggests
a giant step forward this week. A is the change in the phenotype of that genes are made of DNA.

T
new report indicates that a chemi- the living bacteria from rough- Genes are the particles thought to
cal called deoxyribonucleic acid surfaced to smooth-surfaced and carry the information that deter-
(DNA) may be the so-called from harmless to harmful. It seems mines the physical and chemical
transforming substance discov- to occur when some information- characteristics of a cell. Scientists

O
ered more than 10 years ago by rich substance moves from the do not know much about this
Frederick Griffith. dead bacteria to the live bacteria. powerful substance. But this
Griffith observed that mice The identity of this transform- weeks announcement is likely to
died when exposed to both live, ing substance, however, remained intensify efforts to describe DNAs

N
rough-surfaced, harmless bacteria unknown until this week. Oswald structure and function. In addi-
and dead, smooth-surfaced, harm- Avery, Colin MacLeod, and tion, scientists will work to explain
ful bacteria. He then observed that Maclyn McCarty are investigators how DNA can cause such impor-
bacteria in the tissues of the dead at the Rockefeller Institute. They tant effects in cells.

O
DNA Structure and Replication

D
DNA is required for the building, In humans (as in all eukaryotes), the
maintenance, and regulation of all living genetic material consists of long DNA
organisms cells. That means each new cell molecules. These molecules are packaged
must receive a copy of the genetic material tightly in chromosomes. In each of our cells
from its parent. How are copies made? The (except gametes and red blood cells), we have
process is called replication. This complete 23 pairs of chromosomes. Each chromosome,
process of making a copy of the cells genetic in turn, contains one long DNA molecule and
material is complex. The key to understanding many protein molecules. The DNA and
this complex process, however, is very protein molecule organization creates beadlike
straightforward. You simply have to clusters. As Figure E12.2 shows, DNA wraps
understand a few things about how a cells tightly around these clusters to form
genetic material is structured and organized. nucleosomes. These nucleosomes pack

ESSAY: DNA Structure and Replication Unit 4 513


KH4119_Unit 04 ES_E512-E541 03/16/05 11:11 AM Page 514

together to form the condensed and compact like pass the message demonstrate how
structure that we see when we look at a easily inaccurate copying can happen when
dividing cell under the microscope. there is no physical record, such as a written
The information storage capacity of note, of the transmitted message. Perhaps
genes lies ultimately in the DNA. It does you can imagine that a physical template
not reside in the protein components of also would help carry out the huge task of
chromosomes. Therefore, the question of accurately duplicating genetic information.

Y
how a cell copies its genetic information In fact, that is exactly how biological systems
during reproduction actually is a question of accomplish this task. The DNA molecule
how a cell copies its DNA. Copying DNA itself serves as a template for information

P
accurately is much like communicating a transfer. That is, the molecule that contains
message. It is easier when some form of the genetic information acts as a pattern for
physical template, or pattern, is used. Games its own replication.

CO
T
O nucleosome

N
DNA

histones histones

O
chromatin fiber

D DNA

Figure E12.2 Eukaryotic chromosome structure. Each chromosome in a eukaryotic


nucleus consists of a long molecule of DNA. This molecule is wrapped around histone
proteins to form beadlike structures called nucleosomes. Fully extended, the DNA in
one human chromosome would be about 5 centimeters (2 inches) long. Prokaryotes, in
contrast to eukaryotes, have only one chromosome. This chromosome lacks the beadlike
proteins that aid packing. What advantage might efficient packing of DNA offer a cell?

514 Unit 4 ESSAY: DNA Structure and Replication


KH4119_Unit 04 ES_E512-E541 03/16/05 11:11 AM Page 515

P Y
Figure E12.3 Human DNA. This human chromosome is seen through an electron

CO
T
microscope. The chromosone was treated with a substance that disrupted its structure,
releasing the DNA.

O
DNA can serve as its own template because different nitrogen bases. The four unique bases
its organization is specific. Look at the drawing are like the letters in a word. Consider how

N
of DNA shown in Figure E12.4a. Note that a the order of letters in a word determines the
single DNA molecule is a double-stranded information that the word conveys to someone
structure. The two strands twist together in a who understands written language. Similarly,
spiral or helical form. That aspect of DNA the order of nitrogen bases along one strand of

O
earned it its nickname: the double helix. DNA conveys information to any part of the
Examine the two DNA strands cell capable of translating that code.
more closely. Each of those two strands Do you understand that DNA stores
(Figure E12.4b) is made up of a series of genetic information in the sequence of the

D
smaller molecules called nucleotides. A long nitrogen bases along one strand of DNA? If so,
strand of nucleotides bonded together is then you already understand a great deal about
called a nucleic acid. Thus, DNA is an the structure of genes at the molecular level.
example of a nucleic acid. In fact, only one question remains to complete
A closer look at the nucleotides that make your basic knowledge of DNA structure. How
up each strand of DNA (Figure E12.4c) reveals can one DNA molecule be replicated to make
even more regularity. Each nucleotide is made another identical molecule?
up of the same three parts. These are a nitrogen The answer to this question is that there
base, a deoxyribose sugar, and a phosphate are predictable interactions between the
group. The sugar and phosphate portions are nitrogen bases. On close inspection of the
the same in all nucleotides. However, the DNA double helix, we find that the pairing
nitrogen bases vary. As Figure E12.4d shows, a between nitrogen bases on opposite strands is
DNA nucleotide may contain one of four always the same. A large base on one strand

ESSAY: DNA Structure and Replication Unit 4 515


KH4119_Unit 04 ES_E512-E541 03/16/05 11:11 AM Page 516

nitrogen base

NH2

C
H
C N

C C
H
N O
O-

O P O CH2 O

Y
O C C
H H
H H
triphosphate OH H

P
deoxyribose
c Parts of a nucleotide.

O
Figure E12.4 Structure of DNA.
The sequence of nucleotides along
the strand encodes the cells genetic

C
NH2 information. How many different
N sequences could be made using just
N
10 nucleotides in a DNA strand?
5'
a The double helix. OCH2 O N
N

T
adenine
3'
O
O CH3
-O P O NH

O
O 5'
CH2 O N O
thymine
3'

N
O
G -O P O N
NH
O
5'
T CH2 O N NH2
N
guanine

O
3'
NH2
O
A
-O P O N

D
5'
A CH2 O N O
cytosine
3'

G O
-O P O
C

G O

nucleic acid symbol for nucleotide


d Nucleotides may contain 1 of
4 different nitrogen bases.
b Nucleotides are The sequence of nucleotides along
covalently bonded the strand encodes the cells
to form a strand genetic information.
known as a nucleic
acid.

516 Unit 4 ESSAY: DNA Structure and Replication


KH4119_Unit 04 ES_E512-E541 03/16/05 11:11 AM Page 517

always bonds to the same small base on the be separated for replication without
opposite strand. Figure E12.5 shows this destroying the strands themselves. Once
aspect of DNA structure. Notice that the separated, the base-by-base replication
pairing that takes place between nitrogen process continues. Eventually, there are two
bases is absolutely specific in DNA strands. molecules of DNA where previously there
Adenine (A), a large base, always bonds with had been one. Once complete, each molecule
thymine (T), a small base. Guanine (G), a contains one old strand and one new

Y
large base, always bonds to cytosine (C), a complementary strand.
small base. Complementary base pairing
describes the bonding pattern that always

P
happens between base pairs. .......
G .......
....... C
Complementary base pairing explains
how it is possible for DNA to act as a

O
.......
template for its own replication. Like other T ....... A
biosynthesis reactions, specific enzymes
are required for replication to take place. .......
A ....... T

C
Replication begins when those enzymes
separate the two DNA strands. Next, .......
A ....... T
enzymes read the sequence of nucleotides on

T
one strand. Finally, enzymes facilitate the .......
synthesis of a new, complementary strand. G .......
....... C
They do this by adding one nucleotide at a .......
time to the new strand. Remember, A always C .......
....... G

O
bonds with T, and G always bonds with C.
Thus, the sequence of bases in the old strand .......
T ....... A
determines the sequence of bases in the new

N
strand. In other words, each newly added
base during replication must complement the
base in the old strand with which it will pair. A T
In this way, any DNA molecule can serve

O
adenine thymine deoxyribose
as a pattern for a new copy of the genetic
information that it encodes.
Figure E12.6 illustrates the replication G C

D
process. As shown in the figure, the double
strands of the DNA molecule first separate. guanine cytosine phosphate
That allows the replication enzymes to build
a new strand of DNA to match each of the double-ring single-ring
old strands. Separation of the double helix bases bases
is critical to replication. It is possible because
the attractive forces that hold the two strands Figure E12.5 Complementary base
together are relatively weak hydrogen bonds. pairing in DNA. Notice the pattern of
Hydrogen bonds are much weaker than the how the bases pair with each other. The
strong covalent bonds that hold neighboring dots between base pairs represent
hydrogen bonds. These bonds hold the two
nucleotides together in each strand. That strands in a double helix together. Are
difference in bond strength explains how there any differences in hydrogen bonding
the two strands of a DNA molecule can between G and C and between A and T?

ESSAY: DNA Structure and Replication Unit 4 517


KH4119_Unit 04 ES_E512-E541 03/16/05 11:11 AM Page 518

A T A T
C G
C G T
A A T
G G C
T A
a T A
A T A T
T A
T A C G
C G
A T A T

Y
T A
T
A A T
G G C
T A

P
T
C G
C
A T A T
T A
T A C G
G C

O
A T A T
T A
T
G G C
G

C
C
A T
A T
G
C
C G

T
A T
G C
T A
G C

O
T A
C G

.......
C C .............. G

N
b

A .......
A ....... T
A

AA .......
T

O
T ....... AA

....... .......
T ....... AA T ....... AA

D
.......
C .............. G G
C

.......
G ..............C C

.......
A
A ....... T T

Figure E12.6 DNA replication. (a) A replication fork at which two new DNA strands
are being synthesized. (b) Details of nucleotide addition. DNA replication enzymes add
nucleotides one at a time to each of the growing strands. In eukaryotic cells, the process
of DNA replication takes place in the nucleus. In prokaryotes, replication takes place in the
cytoplasm.

518 Unit 4 ESSAY: DNA Structure and Replication


KH4119_Unit 04 ES_E512-E541 03/16/05 11:12 AM Page 519

Replication Errors and Mutation


Templates provide a very accurate way of make new individuals by simple cell division.
transmitting information. They do this Any mutation may be passed along to new
whether it is written language or genetic individuals. Ironically, the accuracy that results
information in DNA. Even with the use of a from the template method of copying DNA

Y
template for replication, however, errors do also means that, once a mutation occurs, it
occur. In language, these errors appear as copies accurately as well.

P
misspellings in books and articles. In DNA, Think about those errors that are copied
these errors are called mutations. One type accurately during replication. Does every
of error takes place when the replication change in DNA structure give rise to a lasting

O
enzymes mistakenly skip a base. In this case, change in a species genetic information? No, it
the new strand forms with a missing base. does not. Some mutations can cause serious
When that strand is replicated, the error is developmental errors. These mutations are so

C
copied onto a new, second strand. This makes harmful that they may kill the organism long
a DNA molecule that is missing a nucleotide before it reaches reproductive maturity. In
at that position. Such an error is called a those cases, the mutation is not copied again.
deletion mutation. Less serious, but still harmful mutations, may

T
Another type of error takes place when lead to traits that are troublesome for survival
the replication enzymes mistakenly add the and reproduction. For instance, a mutation
wrong base to a position. Substituting one may result in a frog with a short tongue. This

O
small base for the other or one large base characteristic may limit the frogs success in
for the other during replication is called a catching insects. That may prevent the frog
substitution mutation. In that case, the from growing large, becoming strong, and

N
complementary pairing normally seen in mating successfully. In those cases, the forces
DNA is disrupted at the point of substitution. of natural selection will tend to reduce how
If the DNA is replicated, however, the newly often that genotype happens in the population.
synthesized strand will contain an appropriate Those mutations that give individuals an

O
base pair for the substitution mutation advantage may result in long-lasting changes
(Figure E12.7). In that way, the mutation is in a species genetic material. Also, there are
preserved and carried on in all future offspring mutations that are only mildly harmful or

D
cells. Usually, specific repair enzymes detect have no effect. These mutations may continue
and repair mutations. Despite the existence of to be passed from generation to generation.
those enzymes, some mutations become a The genetic variety that results from some
permanent part of a cells genetic material. neutral or mildly harmful mutations may
Mutations can take place in the DNA of turn out to be an advantage if the species
any cell in the body of an organism. Imagine environment changes or the individual
what could happen if mutations occur in cells relocates. In those cases, the phenotype that
that give rise to gametes (sperm and eggs, for results from the new genotype may become an
example). If those gametes become zygotes advantage for the individuals survival. For
and grow, the mutation will be passed along to example, individuals who carry one allele for
the offspring. Then the mutation may become the sickle-cell trait have an advantage if they
a lasting change in that species genetic live in parts of the world where the malaria
information. Take single-celled organisms that pathogen is present. That heterozygous

ESSAY: Replication Errors and Mutation Unit 4 519


KH4119_Unit 04 ES_E512-E541 03/16/05 11:12 AM Page 520

T T C T T
A A G G G G A A G
C C C C

T T C T T
replication

Y
A A G G G G A A G
C C C C

P
T T C T T
a A A G G G G A A G
C C C C

T
A

CO T
A G
C
G G G
T
A
T
A G

T
C C C C
C
T T G T T replication
G
A A G A A G

O
G
G
C C C
T T C C T T
b A G G G G A G

N
A A
C C C

O
Figure E12.7 Preserving a mutation. (a) Normal DNA undergoes replication to produce two identical

D
DNA molecules. (b) Mutated DNA (note that a C from the normal DNA has mutated to G) undergoes
replication to produce two new DNA molecules. But only one of those molecules is identical to the normal
DNA. In that way, replication preserves mutation (arrow).

genotype makes those individuals who have it circumstances, that genotype would be
more likely to survive malaria outbreaks. One considered rather harmful. In this way,
effect of this advantage is that the number of the wide variety of alleles that occur in a
individuals in the population who have one population, including some mutations,
sickle-cell allele increases. Under other helps species survive.

520 Unit 4 ESSAY: Replication Errors and Mutation


KH4119_Unit 04 ES_E512-E541 03/16/05 11:12 AM Page 521

Landmark Discovery:
Why the Fuss about Watson and Crick?
London, England (1953): The most duplicates with very high accuracy.
recent issue of Nature hit It also has enough structural flexi-
scientists desks this week. This bility to produce the full range of
issue contains a landmark paper variations that we see on earth.

Y
proposing a physical structure for Then Pete pointed out that
DNA. DNA is the substance that a good model also is consistent
makes up the genetic material of with all the available experimental

P
living organisms. The paper is evidence. In the case of DNA, this
coauthored by James Watson and includes several pieces of evidence.
Francis Crick, with important DNA is shaped like a double helix.
contributions from Rosalind The nitrogen bases are stacked

O
Franklins work. This paper already inside the molecule in a regular
has the scientific world buzzing pattern. The big nitrogen bases
with enthusiasm and optimism. and the small nitrogen bases are
To be honest, though, your present in the molecule in a 1:1

C
humble science clubs Whats New? Figure E12.8 Watson, ratio. And finally, Pete insisted
correspondent didnt see what the Crick, and Franklin. that a good model is testable. He
fuss was all about. I mean, I said, Just look at all the predic-
James Watson and Francis
thought science was an experimen- tions that the new DNA model
Crick are credited with

T
tal endeavor. How could a paper makes that you could test. For
that only proposes a model be proposing the first detailed example, you could test that a
exciting? Where is the evidence description of the structure newly replicated DNA molecule
that these two scientists actually of DNA. Their work built would have one old strand and one

O
are right? Besides, I think that on the arrangements of new strand. Or you could consider
coming up with a model would be atoms suggested by the that the two strands at any point
easy. There must be hundreds of X-ray photographs taken on the molecule are complemen-
different ways to suggest how by Rosalind Franklin. tary, but not identical.

N
DNA is put together. So whats Okay, okay, I said. So Ive
the big deal with their model? learned something about model-
To get an answer to my ques- the system that you are studying. ing and science. And if Pete and
tions, I called an old friend of Take the Watson and Crick model his friends are right about where
mine, Pete, at the university. Pete as an example, he said. It explains the study of DNA is going to
how DNA can do all the things

O
is a high-level science type, though take us, this is just the beginning
you wouldnt know it from his no- the genetic material appears to be of what Im going to learn. In
pain/no-strain lifestyle. Wow, did able to do. Not only can DNA fact, all of us will be learning a lot
he set me straight! First, he point- encode information, but it also can in the next few decades. So, hats
ed out that a good model explains store that information in a stable off to model-building. . . . Got

D
all of the known characteristics of manner through time. DNA also any LEGOS?

The Expression of Genetic


Information
When an error in replication takes place, the structure (essentially a change in genotype)
nucleotide sequence of a DNA molecule is can be physically preserved, however, does not
altered. The resulting mutations may be tell us what effect the altered DNA structure
passed on during the next round of DNA has on the organism. To see that effect, we
replication. Knowing how a change in DNA must look at the organisms phenotype and

ESSAY: The Expression of Genetic Information Unit 4 521


KH4119_Unit 04 ES_E512-E541 03/16/05 11:12 AM Page 522

cells also conduct very specialized types of


activities. For example, plant leaf cells harvest

....... C
light energy. They use it to build sugars.

....... C
A ....... T

A ....... T
A ....... T

.......
G .......
.......
G .......
.......
.......

.......
Muscle cells contract to allow movement of
T ....... A

T ....... A

T ....... A

T ....... A

....... G

....... G
....... G
your limbs. Regardless of the activity involved,
.......

.......

.......
.......

.......
C .......
.......
C .......
.......
C .......
the information that a cell needs to build
proteins is contained in its DNA.

Y
The protein that is expressed is
determined by the genes nucleotide sequence
H H (A, C, T, and G). Through that sequence,

P
O H O H
C N C C N C DNA directs the formation of proteins.
N C C N C C
O Proteins are sequences of amino acids. The
H O H
H H diagram in Figure E12.9 illustrates this

O
process. Notice that there is a relationship
phenylalanine threonine arginine proline between DNA structure and protein structure.
Both nucleic acids and proteins are long

C
molecules. Both are made of repeating
Figure E12.9 Relationship between DNA sequence and
subunits arranged in a linear manner. Because
protein sequence. Each strand of DNA consists of a series
of nucleotides. These nucleotides are bonded together in a both nucleic acids and proteins are linear,

T
particular order. The protein that is specified by this DNA consists a code in the sequence of nucleotides can
of a series of amino acids. These amino acids are bonded specify the order of amino acids in the protein.
together in the order encoded by the sequence of nucleotides That is, the order of nucleotides in a gene
in the DNA. A set of three nucleotides in the DNA codes for one determines the order of amino acids in a

O
amino acid in the corresponding protein. The genetic code is
protein. This is important. The order of amino
examined in more detail in the essay Translating the Message
in mRNA (page 524). acids in a protein specifies that proteins shape.
Proteins will function properly only when they

N
discover whether it also is altered. In other have folded into a very specific shape.
words, we must look to see whether the Genetic information is first
mutation caused a change in a gene that is expressed as RNA. Lets see how this genetic
used to control some characteristic of the code determines the sequence of amino acids

O
organism. in a protein. Lets also look at how the cell
The process by which a cell uses genetic physically assembles these amino acids into a
information is called gene expression. Lets chain. To do those things, we need to look at

D
look at the first step in understanding how some of the specific steps of gene expression.
gene expression takes place. Genes contain To begin with, it makes no difference what
information that is required to build proteins. type of information a particular gene contains.
Proteins carry out critical biochemical and In most cases, the first step in making this
structural activities inside cells. Those activities information available for use in the cell is
include a number of housekeeping functions the construction of another nucleic acid,
that almost all cells continually must perform ribonucleic acid (RNA). Structurally, RNA is
to remain alive. Think about how you must almost identical to DNA. But there are several
replace burned-out lightbulbs, take out the major differences. RNA contains a ribose sugar
trash, and grocery shop to maintain a healthy instead of a deoxyribose sugar. Thymine (T),
household. Cells must also replace and repair one of the bases in DNA, does not occur in
worn out parts, eliminate wastes, and break RNA. Instead, a related base, uracil (U), is
down glucose for energy to stay healthy. In found at positions complementary to adenine
addition to those basic chores, however, most (A). In addition, RNA is single-stranded.

522 Unit 4 ESSAY: The Expression of Genetic Information


KH4119_Unit 04 ES_E512-E541 03/16/05 11:12 AM Page 523

Like DNA, RNA is built according to the production of RNA from the DNA
the information that is available in the DNA template. This is called transcription
template. The first step in gene expression is (Figure E12.10). Now you know that RNA is

template s trand
a of DNA

Y
T C
T T C
G
C
A

P
G DNA
U

O
RNA
s trand RNA polymeras e

C
T
T C
b T T
C
G
C
A G A G
A DNA

O
C
A

G U

N
RNA
s trand

O
T
C
A A
T G
G

D
A
c U
U
C
G C
DNA A
G
A
G A

RNA s trand U

Figure E12.10 Transcription. (a) An enzyme called RNA polymerase synthesizes RNA from a template
strand of DNA. The process of transcribing DNA into RNA is very similar to the process of replication. Except
only one RNA strand is made. (b) Note that as the enzyme moves along the DNA, the double helix is
unwound. Specific base-pair interactions form between the DNA and RNA. (c) The DNA strands behind the
enzyme then interact again to form the double helix. Eventually, the enzyme that is building the RNA
reaches the end of the gene. At that point, the DNA and the RNA are released. Transcription, like
replication, takes place in the nucleus of eukaryotic cells.

ESSAY: The Expression of Genetic Information Unit 4 523


KH4119_Unit 04 ES_E512-E541 03/16/05 11:12 AM Page 524

gene for gene for gene for


protein tRNA rRNA

DNA

mRNA tRNA

P Y rRNA

O
Figure E12.11 Types of RNA. DNA encodes three types of RNA. The information encoded in mRNA will be
translated directly into protein. The tRNA and the rRNA participate in the reactions that assemble proteins.

C
chemically similar to DNA. Can you imagine of RNA logically is called messenger RNA.
how DNA serves as a template to make a This is because its only role is to carry a
strand of complementary RNA? The new

T
transcript (or message) of the DNA-encoded
RNA nucleotides are arranged through base- information. It carries this message to the
pairing interactions in an order that matches place in the cell where that information can be
the DNA template. This is the same way new translated (or read).

O
DNA nucleotides are arranged during DNA The second and third types of RNA are
replication. In fact, the process of transcription called tRNA (transfer RNA) and rRNA
is, in many ways, very similar to the process (ribosomal RNA). In contrast, they function in

N
of replication. the actual process of assembling amino acids to
As Figure E12.11 shows, cells can make make proteins. These two forms of RNA are
three types of RNA. The first type is called transcribed from genes that are not expressed
mRNA (messenger RNA). It has the crucial as proteins. Instead, as Figure E12.11 shows,

O
role of carrying information from the DNA in the final product of these genes is RNA. These
the cells nucleus to the cells cytoplasm. This RNAs play a key role in converting the
is where the protein will be made. This form information in mRNA into protein.

D Translating the Message in mRNA


To express a gene for a protein, the cell first
makes a molecule of mRNA. This mRNA
then acts like a blueprint for building a house
or a machine. Cells translate the mRNA
Figure E12.12). The name given to the
process of converting the genetic code in an
mRNA sequence into an amino acid sequence
is translation. Think about how you would
blueprints into specific sequences of amino have to translate information in a message
acids that make up proteins. These mRNA that was written in an unfamiliar language. In
blueprints are written in the language of the same way, your cells must translate the
nucleic acids. Those proteins are the cellular information encoded in mRNA into proteins
equivalent of structures and machines (refer to for it to be useful.

524 Unit 4 ESSAY: Translating the Message in mRNA


KH4119_Unit 04 ES_E512-E541 03/16/05 11:12 AM Page 525

mRNA

starch

muscle filament
(actin)

P Y
O
enzyme
(amylase)
transport protein

Figure E12.12 Translating mRNA into protein. The information encoded in mRNA

C
is translated into proteins. Proteins then can function in the cell as enzymes, structural

T
components, or a variety of transport molecules. Translation takes place in the cytoplasm.
In eukaryotes, this means that the mRNA first must be transported out of the nucleus.

O
Next, we will look at the actual steps of Unraveling the details of the genetic code
protein synthesis (translation). Before we involved determining exactly which amino

N
do that, lets examine some of the basic acid is specified by which codon. This was one
characteristics of the code that links a of the most exciting series of discoveries ever
nucleotide sequence to the amino acid made in the field of biology. Now, humans
sequence in a protein. This code is called the actually can read the information encoded in

O
genetic code. Proteins are built from some the genetic material of each species.
20 different amino acids. Each amino acid Study Figure E12.13 carefully. Did
must be identified specifically by a coding you notice that using all four bases, three

D
system within the mRNA. The code cannot at a time, results in 64 possible codon
be a simple one-to-one pairing of nucleotides combinations (64  43)? Remember, there are
to amino acids. If it were, the code could only only 20 amino acids. The early genetic code
specify (code for) four different amino acids researchers discovered that some amino acids
(one for each of the four different nucleotides). have more than one codon. Figure E12.13
Likewise, the code cannot involve a two-to- lists the triplet codes for each amino acid.
one correlation (two nucleotides encoding one Study the table again. You will notice
amino acid). In that instance, the code could that some of the possible triplet base
specify only 16 amino acids. Instead, the code combinations do not correspond to any
involves a three-to-one correlation. In other amino acid. Several triplet base combinations
words, the genetic code uses three sequential begin with U. These signal a stop in
mRNA bases to identify each amino acid. translation (that is, the end of the protein).
Each triplet (three-nucleotide combination) Another special codon is AUG. This codon
is called a codon. specifies the amino acid methionine. It

ESSAY: Translating the Message in mRNA Unit 4 525


KH4119_Unit 04 ES_E512-E541 03/16/05 11:12 AM Page 526

First Second letter Third


letter letter
U C A G
phenylalanine serine tyrosine cysteine U

Y
C
U
phenylalanine serine tyrosine cysteine

leucine serine stop stop A

P
leucine serine stop tryptophan G
leucine proline histidine arginine U

O
C
C
leucine proline histidine arginine
leucine proline glutamine arginine A

C
leucine proline glutamine arginine G
isoleucine threonine asparagine serine U
C
A isoleucine threonine asparagine serine

T
isoleucine threonine lysine arginine A
(start) G
methionine threonine lysine arginine

O
valine alanine aspartate glycine U
C
G valine alanine aspartate glycine

N
valine alanine glutamate glycine A
valine alanine glutamate glycine G

O
Figure E12.13 The genetic code. The code letters represent bases in mRNA. The words in the
boxes are the names of the 20 amino acids most commonly found in proteins. To use the code,
follow a codons three nucleotides to arrive at the corresponding amino acid. You do this by using
the rows and columns labeled First, Second, Third Letter. For example, GGA codes for glycine. How

D
many of the amino acids have more than one codon?

also is a signal to start translation (to begin have many basic structural differences,
building the protein). they use the same genetic code. That basic
One of the most remarkable aspects of the similarity is an important piece of evidence
genetic code is that it is nearly universal. For that supports the theory of a common origin
example, although prokaryotes and eukaryotes of all life-forms.

526 Unit 4 ESSAY: Translating the Message in mRNA


KH4119_Unit 04 ES_E512-E541 03/16/05 11:12 AM Page 527

Landmark Discovery:
White-Coated Sleuths Decipher
Genetic Code
Bethesda, Maryland (1961): It looks of bases in an organisms DNA contained molecules of rRNA and

Y
as though one of the greatest chal- has been known since the mid- of tRNA. Both of these molecules
lenges in scientific decoding soon 1950s. But until now scientists had are known to be central to the
will be conquered. Hats off to the no idea how to read it. To decipher assembly process. In addition,
pioneering work of two modern- the genetic code, Nirenberg and Nirenberg and Matthaei had to

P
day detectives from the National Matthaei built an artificial protein- build a set of artificial mRNAs.
Institutes of HealthMarshall making system in a test tube. They Those mRNAs had to contain
Nirenberg and Heinrich Matthaei. then gave it an artificial message. known nucleotide sequences. Only
Nirenberg and Matthaei were By knowing the message that they after both of those tasks had been

O
intent on cracking the genetic code. gave the system and analyzing the accomplished were they able to
They announced last week the first protein made, they were able to start deciphering.
decoded results from their land- decode the code. What does all of this mean to

C
mark research. The results showed Although the process sounds you? Well, if you have any UUUs or
that three mRNA nucleotides in simple, its execution represents an CCCs in your genetic information
the sequence UUU correspond to amazing feat. To read even those (and you do), it means that we now
the amino acid phenylalanine, and first two words (UUU and CCC), know what those codons mean to
the mRNA triplet CCC corre- Nirenberg and Matthaei had to your cells. We now can read them.

T
sponds to the amino acid proline. create a test-tube system that actu- As we break more and more of the
The genetic code lies at the ally built proteins to order. To do code, who knows? One day we may
heart of all living systems. Thus, that, they extracted enzymes and be able to pull all of the mRNAs
this breakthrough truly is a other necessary protein-assembly out of your cells and read your

O
remarkable accomplishment. The components from dead bacteria. genes. What would our molecular
existence of a codethe sequence For example, their test-tube system sleuths say about that?

Cellular Components
in Protein Synthesis N
O
Understanding that mRNA codons correspond a strand of mRNA and read the triplet codons

D
to amino acids is important to understanding (Figure E12.14a). Ribosomes can read any
gene expression. The process, however, is mRNA. As a result, they can produce an
complex. It involves identifying the appropriate unlimited number of different proteins. For
amino acids, aligning them properly, and joining each mRNA strand, however, the specific
them together. It also involves a number of order in which the amino acids are put
cellular components, or cellular structures, as together is dictated by that mRNAs particular
Figure E12.13 illustrates. Ribosomes are the codon sequence.
primary cellular component. This component is A second important component of protein
responsible for translating the information synthesis is the cells population of tRNA
encoded in mRNA into a protein. molecules (see Figure E12.14b). Those
Ribosomes are large structures. They are molecules are important. They recognize both
made of rRNA and protein. They travel along specific mRNA codons and the amino acids

ESSAY: Cellular Components in Protein Synthesis Unit 4 527


KH4119_Unit 04 ES_E512-E541 03/16/05 11:12 AM Page 528

b amino
a In eukaryotes, ribosome subunits are acid
a mature rRNA assembled in the nucleus and
proteins large transported to the cytoplasm. The
subunits join together to form complete
ribosomes. This is where translation takes
small place.

ribosomal
n u cl G A C
eus subunits
cytop b A tRNA molecule has an anticodon.
lasm

Y
An anticodon consists of three nucleotides
that recognize a specific codon on mRNA.
At the other end of the molecule is the
amino acid specified by that tRNA molecule.

P
mRNA
c met

COUAC
AUGGCACUGUUCUGGUAGAGA

T
met

c Translation begins at an AUG codon on the mRNA.


The tRNA that interacts with this codon always carries
a methionine. This amino acid becomes the first amino

O
acid of the new protein chain.

d
AAGACC

N
met
CUGUUCUGGUACAGA

met

O
step 2

D
AAGACC
CUGUUCUGGUACAGA

AU step 3
G
G
AA ACC d As the ribosome reaches each codon, the ribosome pauses. It waits for another
CUGUUCUGGUACAGA molecule of tRNA to temporarily join the translation complex. The two amino acids
are brought side by side as a result of being linked to their corresponding tRNAs.
When that happens, a reaction takes place. This reaction results in the formation of
a covalent bond between the two amino acids. The bond is called a peptide bond.
The chain of newly linked amino acids is called a peptide. As the bond forms, the
ribosome travels down the mRNA template a distance of one codon. The first tRNA
step 1 is released. The ribosome then pauses for another amino acid linked to tRNA.

Figure E12.14 Protein synthesis.

528 Unit 4 ESSAY: Cellular Components in Protein Synthesis


KH4119_Unit 04 ES_E512-E541 03/16/05 11:13 AM Page 529

Landmark Discovery:
Extraordinary New Technique
Changes Biology Forever
San Francisco, California (1973): Isolating DNA ligase allows scien- plants. (Bigger cucumbers? frost-

Y
Both the study and practice of tists to use it to fasten back togeth- resistant strawberries? sweeter
biology were radically and irre- er DNA fragments that restriction corn?) Who knows? One day, we
versibly changed today. Stanley enzymes have cut. In addition, the may even be able to remove partic-
Cohen of Stanford University and DNA that scientists stitch together ular genes from peoples bodies

P
Herbert Boyer of the University of can come from different organisms. and replace them with other genes.
California San Francisco reported For instance, scientists can combine
the first successful attempt to build bacterial DNA with yeast DNA to
and to clone a recombinant DNA create recombinant molecules.

O
molecule. What makes this accom- The idea behind Cohen and
plishment so remarkable? The Boyers technique is straightfor-
recombinant DNA molecule ward. They cut DNA from two

C
made by joining together (or different sources with the same
recombining) pieces of DNA from restriction enzyme. They then
two completely different sources mixed the DNA together with
never existed before. Today, it DNA ligase. The DNA ligase
exists. It exists in many thousands caused the cut pieces to stitch

T
of copies, and researchers can make together. Then Cohen and Boyer
thousands more at will. inserted the new, recombinant
When congratulated on their molecules into living bacteria. As
accomplishment, Cohen and the bacteria reproduced, the tiny

O
Boyer quickly acknowledged their recombinant DNA molecules also
debt to many other scientists multiplied. Within hours, their
whose hard work and important technique produced a colony of
discoveries made creating and reproducing bacteria. They could

N
cloning a recombinant molecule then extract as many copies of the Of course, new technologies
possible. One key advance in just recombinant molecule as they come with potential problems as
the last few years was the 1970 wanted. well. Scientists already are point-
discovery of the first restriction Recombinant DNA tech- ing out the need to regulate the
enzyme. This discovery was made niques are revolutionizing scientif- technology to allow for only ben-

O
by Werner Arbor of the University ic research and technology. eficial and safe DNA transfers.
in Basel, and Daniel Nathans and Scientists around the world are The deliberate combining of
Hamilton Smith of Johns isolating and inserting a wide genes from different species, how-
Hopkins University. Restriction range of human genes into bacte- ever, involves controlling genes

D
enzymes are proteins that can rec- ria. By doing this, they can both and evolution in a different way
ognize and cut perfectly a specific study gene expression and harvest than has ever been done before.
sequence of nucleotides in DNA. the products that the genes code We may not be able to predict
Another key advance took for. Such techniques may lead to exactly the impact that those
place in several research labs at the an unlimited supply of human changes will have. Our world is a
same time. That discovery involves insulin to use in treating diabetes. different place today from what it
isolating another important pro- Or, it could produce unrestricted was yesterday. It is important that
tein. That protein is the enzyme quantities of human growth hor- all of usscientists and nonscien-
DNA ligase. DNA ligase functions mone to use in treating dwarfism. tists alikebe knowledgeable.
during the replication and repair of Imagine the benefits of inserting We must all take part in deciding
DNA molecules. It repairs nicks the genes for a wide range of how we will use our new genetic
that occur in one DNA strand. desirable characteristics into crop abilities.

that match those codons. One portion of a Another portion of the tRNA molecule then
tRNA molecule interacts with the amino acid interacts with the codons in the mRNA. That
that corresponds to a particular codon. interaction is a base-pairing association. It

ESSAY: Landmark Discovery: Extraordinary New Technique Changes Biology Forever Unit 4 529
KH4119_Unit 04 ES_E512-E541 03/16/05 11:13 AM Page 530

takes place between the nucleotides of the (inactive) or only partially functional. That
tRNA and the nucleotides of the mRNA. is how a single amino acid mutation in
The base pairs form according to the same hemoglobin can result in sickle-cell disease.
rules of complementary pairing that take Think about the change that this mutation
place between nucleotides in DNA. Look at causes at the molecular level. Perhaps then
Figure E12.14cd. The tRNA molecules bring you can see why genotype is so important in
about the translation of the language of nucleic determining phenotype.

Y
acids into the language of proteins. Protein synthesis is a highly regulated
Translation continues until the ribosome process. The amount and type of protein
reaches a special codon. This special codon produced in cells vary. For example, the life

P
does not specify an amino acid. These codons stage of an organism, the time of day, and
are called stop codons. Stop codons cause the the particular cell types are all factors that
ribosome to pause indefinitely because there determine protein production. That regulation

O
are no matching tRNAs. At this point, a can be accomplished by changing rates of
release factorwhich is itself a protein translation and transcription in cells.
binds to the ribosome. The release factor Scientists use a variety of techniques to

C
causes the ribosome to separate from the learn more about the role of specific proteins in
mRNA. The completed protein folds into a organisms. They can conduct experiments to
shape determined by its amino acid sequence. investigate what role a protein plays. They can

T
It is now ready to function. study how the cell regulates the amount of
Each protein that is produced by protein that is produced. But first, scientists
translation plays some role in the function often need to separate a specific protein
of a cell, tissue, organ, or organ system. For from other proteins produced in the cells.

O
instance, there are particular alleles that One technique that scientists use is
encode the information for producing the chromatography. Chromatography is a set
protein hemoglobin. The protein produced of techniques that scientists use to separate

N
through the translation of the corresponding mixtures of molecules, such as proteins.
mRNA for that allele transports oxygen in Molecules separate based on their mass, charge,
red blood cells. The ability of any protein to or ability to bind to other molecules. Scientists
function properly, however, depends on also use procedures such as electrophoresis to

O
whether the protein is folded properly. learn about the composition, expression, and
A proteins final folded form can be altered properties of proteins. By understanding more
by mutations. Mutations can alter one or about specific proteins, scientists can learn how

D
several amino acids. This can cause the protein organisms respond to changing conditions and
to fold into a form that is nonfunctional maintain homeostasis.

Manipulating Genetic Material


In the last 40 years, science has greatly ways that scientists conduct research. That, in
increased our understanding of the structure turn, has changed how pharmaceutical firms
and function of genetic material. Also make medicines and how many industries
changed is our ability to work with it in the conduct their day-to-day business.
laboratory. In fact, our increasing ability to The technologies are new. But our
study and manipulate molecular processes in a fundamental interest in studying and
variety of species has led to a revolution in the manipulating genetic information is not new.

530 Unit 4 ESSAY: Manipulating Genetic Material


KH4119_Unit 04 ES_E512-E541 03/16/05 11:13 AM Page 531

For centuries, humans have selectively bred bacterium called Bacillus thuringiensis. (B.t. for
plants and animals to produce organisms with short.) A protein that the bacteria produce is
desirable combinations of characteristics. partially digested in the worms gut and
Traditional methods of agricultural breeding poisons the worm. Because that protein is so
were the earliest forms of genetic engineering. effective, for years farmers have sprayed B.t.
Genetic engineering is a process designed to bacteria on their cotton crops to discourage
artificially control the genetic makeup of an the bollworms from eating them. That

Y
organism. In selective breeding, humans cross protective measure has its drawbacks, though.
plants or animals that have desirable traits Sunlight breaks down B.t., and rainfall easily
to produce new generations. For example, a washes it off the plants.

P
golden retriever is the product of selectively Through genetic engineering, however,
breeding various Labradors and spaniels. As researchers have overcome those drawbacks.
a result, future generations show more of the Figure E12.16 shows how scientists isolated

O
desired traits. Less desirable traits sometimes the gene that codes for the poisonous bacterial
can be eliminated. Selective breeding also can protein. They then transferred the gene into
produce new, less desirable traits. For instance, the cotton plant. The new cotton plants thus

C
a greater tendency for developing hip dysplasia contain recombinant DNA. They can produce
came out of many selective dog breeding
programs. (Hip dysplasia is a common cause

T
of osteoarthritis or degenerative joint disease.)
In recent years, scientists have developed DNA removed
more powerful techniques for examining from organism 2
genetic material at the molecular level. These DNA vector from

O
techniques make it possible to selectively organism 1
change the genotypes of organisms. Many
other new techniques allow scientists to alter

N
+
the genetic information of a species in much
ligation reaction
more direct and extensive ways than the older
methods of selective breeding. It is now
possible to introduce genes into an organism

O
that neither parent possessed. It is even
possible for scientists to remove genes from
one organism and introduce them into an

D
unrelated organismone that does not
normally possess those genes. The new DNA
formed through that process is called
recombinant DNA (see Figure E12.15). recombinant
DNA
One example of how scientists are using
recombinant DNA technologies to address a Figure E12.15 Recombinant DNA. Molecular biologists
specific practical problem involves the cotton isolate DNA from separate sources and combine them in unique
plant. Cotton plants often are attacked by combinations. DNA from Organism 2 can be joined to a small
a pest called a bollworm. The bollworm circular molecule of DNA from Organism 1. This takes place in an
enzyme reaction called ligation. The circular DNA molecules are
damages cotton crops and costs millions of
called plasmids or vectors. They are found in many bacteria. Because
dollars each year to control. Researchers have scientists can move vectors in and out of bacterial cells relatively
known for a long time, however, that a easily, they serve as convenient carriers of DNA. As a result, they
bollworm will die if it eats the common allow for the production of recombinant DNA molecules.

ESSAY: Manipulating Genetic Material Unit 4 531


KH4119_Unit 04 ES_E512-E541 03/16/05 11:13 AM Page 532

bacterial gene for ins ect-


chromos ome control protein

Bacillus
thuringiensis
bacterium
vector
DNA

Y
C ut with Is olate bacterial DNA.
res triction enzyme. C ut with res triction
enzyme.

P
gene for
ins ect-control
protein

CO
recombinant vector
containing the ins ect-
control protein
gene

T
Ins ert recombinant
vector into
plant cells .

O
nucleus plant cell

N
Ins ect-control plant
protein gene chromos ome
is now part of
plant cell
chromos ome.

O
ins ect-control
gene

D
A whole cotton plant is
Figure E12.16 Genetic
engineering of cotton. The toxic
insect-control protein gene Bacillus
thuringiensis is isolated. This is done
with the same DNA-cutting restriction
enzyme that is used to cut the DNA
vector. Scientists combine these
grown from 1 altered cell. two pieces of DNA. They then insert
Every cell in the plant the recombinant DNA into a plant cell.
produces the ins ect-control
protein. The plant can now An entire plant regenerates from that
protect its elf from bollworm one cell. The plant can now protect
attack. itself from the bollworm.

532 Unit 4 ESSAY: Manipulating Genetic Material


KH4119_Unit 04 ES_E512-E541 03/16/05 11:13 AM Page 533

a bacterial protein, B.t. toxin, in their leaves. same, a new alternative for farmers emerged.
Those plants are engineered to protect Different genes (and thus different biochemical
themselves from damage. When a bollworm pathways) regulate the two processes. As a
begins nibbling on the leaves, it eats the B.t. result, scientists could target the softening
protein and dies. Food crop plants also can be process and modify it. The result was a
engineered to produce the B.t. protein because genetically engineered separation of the
it is not toxic to humans. Farmers can use less ripening and softening pathways. This allows

Y
insecticide, thereby decreasing the amount of tomatoes to be ripened on the vine, preserving
toxic chemicals that enter the water supply their flavor. Yet they can be transported to the
and food web. The technology, however, has market without damage and rotting. Farmers

P
not been completely effective. Farmers using and consumers alike benefit from that new
the engineered cotton in 1996 reported that technology. Some questions remain, however.
many bollworms survived in the new crop. What might be the potential effects if a

O
Additional pesticides had to be applied, genetically engineered crop interbreeds with
though the total amount was reduced. The a wild type of crop? These concerns cause
surviving bollworms raise concerns, however. scientists, politicians, and citizens to weigh

C
What might prolonged exposure to B.t. do to the benefits and the drawbacks for the
the bollworms resistance to its toxicity? There technologies carefully.
also are concerns for the other organisms that Genetic engineering also has a great effect

T
will encounter B.t. through this technique. on human health. Insulin is the peptide
Current tests show that the B.t. toxin is hormone that diabetics require. At one time,
nontoxic for most animals, including beneficial it could only be obtained from the pancreases
insects. But the toxin has the potential to harm of cattle and hogs. Insulin produced from

O
endangered and threatened species of moths these animals was available in limited
and butterflies. supplies, and it was expensive. Furthermore,
Plants or animals that contain genes insulin from other animals was not very

N
from unrelated species, such as cotton plants effective for some individuals because it was
containing bacterial genes, are called not similar enough to human insulin. By
transgenic. Transgenic organisms are used recombining the human insulin gene with
widely in research and industry. Other bacterial genes, however, researchers have

O
organisms altered by genetic engineering been able to produce human insulin in large
techniques can be just as important, however, bacterial fermentation systems. This process is
even if they are not transgenic. Consider the an economical method for producing

D
genetically engineered tomato, which recently authentic human insulin (Figure E12.17).
was approved for sale in the United States. Researchers currently are working on ways
Tomatoes normally ripen and soften at the to treat certain human genetic disorders.
same time. That situation encourages farmers They use recombinant DNA that has been
to pick the tomatoes while they are still green constructed from harmless forms of viruses and
and ship them to stores before they soften. functional copies of human genes. Introducing
The less desirable alternative is to ship ripe genetically engineered human cells into a
tomatoes that are easily damaged in transit. human body for the purpose of curing a
Unfortunately, green tomatoes do not ripen genetic defect is called gene therapy. The first
well after they are picked. They often have successful attempt to accomplish gene therapy
little flavor even after they have turned red. began on September 14, 1990. Genetically
When scientists discovered that the altered white blood cells were introduced into
ripening and softening processes were not the the circulatory system of a 4-year-old girl

ESSAY: Manipulating Genetic Material Unit 4 533


KH4119_Unit 04 ES_E534 3/24/05 2:00 PM Page 534

vector nucleus

bacterium
Isolate vector.
Cut with restriction
enzyme at a specific human cell

Y
site. Isolate human DNA.
Cut into pieces with
restriction enzymes.

P
O
Human insulin gene
Insulin gene is isolated.
is ligated
into vector.

C
recombinant vector

T
Recombinant vector is
taken up by bacterium.

O Bacterium with recombinant

N
vector reproduces. This creates
clones capable of producing
human insulin.

O
insulin

Figure E12.17 Producing a recombinant DNA molecule containing the human

D
insulin gene for expression in bacteria.

named Ashanti De Silva. Ashanti was born that would scarcely trouble other children.
with adenosine deaminase (ADA) deficiency. Physicians treated Ashanti by genetically
In this condition, an abnormal allele of the engineering some of her cells to produce
ADA gene fails to make a key protein. This the missing protein. First, they removed
key protein is required for the correct T-lymphocytes from her body. They then used
functioning of T-lymphocytes. These are cells genetic engineering techniques to insert copies
that are critical to an individuals immune of the normal allele of the ADA gene into
response. The absence of this protein meant them. Next, they allowed cells that started to
that Ashanti, like other children who inherit use the inserted gene (thus producing the
ADA deficiency, could easily die of infections normal protein) to undergo mitosis and make

534 Unit 4 ESSAY: Manipulating Genetic Material


KH4119_Unit 04 ES_E512-E541 03/16/05 11:13 AM Page 535

many more functional cells. Finally, they treat a range of genetic disorders that are
inserted all of these genetically engineered resistant to existing treatments.
cells back into Ashantis body. As you might expect, gene therapy brings
The scientists hoped that once back with it a whole series of ethical and legal
inside her body, those cells would continue to questions. Some of the most troubling of those
produce the normal protein. Thus, they would questions involve whether such techniques
function normally to defend her body from should be used to replace defective genes in a

Y
disease. The engineered cells did, in fact, persons reproductive cellsher or his so-called
produce normal ADA. Ashantis function germ line. Placing normal genes into a persons
improved. This procedure was repeated a T-lymphocytes or lung cells (or other body

P
dozen times over the next 2 years. The level cells) affects only these cells and the cells
of the normal ADA protein finally remained offspring, should they divide. That type of
at 2025 percent of that found in most gene therapy does not affect cells in the

O
people. That was enough to protect her. gonads. These cells produce the eggs or sperm
Today, Ashanti is a healthy, active teenager. that may carry the defective form of the gene.
Despite the early promise of gene therapy, On the other hand, replacing genes

C
most such treatments are only in experimental in a persons germ line is tinkering with
stages of development. Like Ashanti De Silva, that persons genetic legacy, as well as
some individuals who have participated in with the genetic legacy of the human

T
gene therapy trials have experienced dramatic species. Suppose that type of gene therapy
health improvements. However, most have is successful one day. The result will be a
shown only modest improvements. More than permanent change in genotype. And this
300 gene therapy trials have been conducted. change will affect all following generations

O
But, with the possible exception of one study produced from an individual who
whose participants are still toddlers, none experienced the gene therapy.
have cured the underlying genetic disorder. Not surprisingly, the prospect of germ line

N
Even those who have had dramatic health gene therapy has triggered a great deal of
improvements require readministration of controversy. Questions abound. For example,
the normal gene. And the 1999 death of a do children have a right to inherit an
participant in a gene therapy experiment has unmanipulated set of genes? Should they be

O
heightened awareness that gene therapy is not allowed to inherit a set of corrected genes?
risk free. The experiment used a modified Who will decide which genes need to be
cold virus to insert a corrective gene into the corrected and which genes do not? Say we

D
patients DNA. The modified virus caused discover the set of genes that control human
an unusual but deadly immune response in height. Should parents be allowed to
the patient. This led to multiple organ failure manipulate those genes in their germ lines in
and death. an effort to conceive children who will be
Nevertheless, the potential promise and shorter or taller than the parents natural
excitement of these techniques are causing genetic legacy might dictate? What, after all,
significant activity in the pharmaceutical is normal or preferred? Who should
industry. Drug companies are investing billions decide, not only for people today, but for
of dollars into identifying genes associated people who are yet unborn? These are difficult
with human disease. Discovering these genes issues. The rapid growth in our understanding
may lead to the development of commercially of the human genome and in our ability to
produced gene products. It could also result in manipulate DNA will only raise the stakes
techniques for gene therapy that effectively involved in resolving them.

ESSAY: Manipulating Genetic Material Unit 4 535


KH4119_Unit 04 ES_E512-E541 03/16/05 11:13 AM Page 536

Landmark Discovery: New Technique Discovered


While Driving 1993 Nobel Prize for Chemistry. Since the An automatic temperature-control device
development of PCR, as little as a single repeatedly warms and cools the reaction mix-
molecule of DNA can be copied many times ture. This device repeats the procedure shown
to provide sufficient amounts for sequence in Figure E12.18 about 3040 times. First,

Y
or mutation analysis. This technique is called heating separates the double-stranded DNA
polymerase chain reaction. It uses a DNA molecules. Next, DNA polymerase acts at a
polymerase to produce exact copies of a lower temperature to synthesize matching

P
DNA sequence. The term chain reaction strands for the single-stranded DNA. The
refers to the fact that the DNA it produces cycle then repeats. The result of all this DNA
becomes the template for additional DNA synthesis is several million copies of the start-
synthesis in the next cycle of reactions. ing DNA.

O
California (1983): A young scientist was dri- sample DNA (double-stranded)
ving at night to his cabin in northern
California. He found his mind moving back

C
and forth between the road and a problem he
was dealing with in biochemistry. A tentative 95C
solution to his problem was soon replaced by a
new problem. Suddenly, a flash of insight

T
caused him to pull to the side of the road and
stop. He awakened his passenger and excitedly Strands separate.
explained to her that he had hit upon a solu-
tion. It was not a solution to his original prob-
lem, but to one of even greater significance.

O
Kary Mullis, a scientist working for the Cetus
Corporation, had just conceived of a simple 60C
method of producing nearly unlimited copies Primers bind to

N
of a specific DNA sequence in a test tube. sample DNA.
Back at Cetus, Mullis asked a librarian
primers
to run a literature search on the enzyme
DNA polymerase and its role, if any, in his
idea of DNA amplification. Nothing relevant
turned up. For the next several weeks, he

O
72C
described his idea to anyone who would lis-
ten. No one had heard of its ever being tried. DNA polymerase
No one saw any good reason why it would not extends primers.
work. For a year, he studied and refined his

D
idea. In the spring of 1984, he presented a
poster describing his idea at a scientific meet-
ing. Joshua Lederberg, president of
Rockefeller University and a Nobel Prize
winner in 1946, expressed great interest in
what he had proposed. After a long conversa-
tion, Dr. Lederberg saw the utter simplicity of double-stranded DNA
the proposed idea. His response was, Why
didnt I think of that? Mullis responded,
Nobody really knows why; surely I dont. I
just ran into it one night.
What did Dr. Kary Mullis run into that
spring night in northern California? It is a
process called polymerase chain reaction
(PCR). This technique revolutionized the way Figure E12.18 Polymerase chain reaction (PCR). Each cycle
scientists analyze DNA and earned Mullis the roughly doubles the number of DNA molecules.

536 Unit 4 ESSAY: Landmark Discovery: New Technique Discovered While Driving
KH4119_Unit 04 ES_E512-E541 03/16/05 11:13 AM Page 537

Landmark Discovery: New Technique


Discovered While Driving (continued)
Each cycle requires only 34 rates the DNA. But this does not ily described in A Royal Tragedy.
minutes. So the entire procedure damage the DNA polymerase. The This is one example of how PCR
can usually be completed in a few use of DNA polymerase from can be used to amplify a small
hours. The success of PCR requires Thermus aquaticus in PCR is a good sample of DNA enough to make

Y
use of DNA polymerase from example of the practical application analysis possible. Similar tests also
Thermus aquaticus. This is a bacteri- of biological knowledge. can be used to exclude or implicate
um that lives in hot springs. Unlike How might PCR affect your criminal suspects by amplifying

P
the enzymes of most organisms, its life? It has accelerated the study of DNA obtained from small samples
DNA polymerase is stable at the gene function, gene mapping, and of blood, semen, skin, or hair left
high temperatures needed to sepa- evolution. In medicine, PCR is at a crime scene.
rate double-stranded DNA. Even particularly useful in prenatal test- During his midnight ride,

O
moderate heating destroys the sec- ing for genetic diseases. Other Dr. Kary Mullis was wrestling
ondary structure of most proteins. medical applications of PCR with a biochemistry problem. He
For example, think of the changes include identifying viruses, bacte- developed a remarkable solution.
that you see in an egg when it is ria, and cancerous cells in human While it may sound like Dr.

C
fried. The albumin protein that tissues. In forensic science, PCR Mullis made a chance discovery, it
makes up most of the egg white has revolutionized the process of is actually a good example of the
quickly congeals into a rubbery criminal identification. Remember creativity, imagination, and critical
mass well before the fat-rich yolk is the DNA fingerprinting that was thinking that characterize most

T
cooked. In PCR, the heating sepa- used to identify the Romanov fam- scientific discoveries.

O
Informatics: Mapping and
Sequencing the Human Genome

N
Informatics is the use of complex databases and genomes of several other well-studied
electronic techniques to sort and analyze genetic organisms. These included a bacterium, yeast,

O
information. Informatics has opened up a nematode, fruit fly, mouse, and a rapidly
wide range of new research opportunities. growing plant with a small genome, Arabidopsis
Increasingly, the electronic management of thaliana. Dr. Mulliss PCR technique was one
information is becoming a central, indispensable of the key genetic techniques that sped the pace

D
feature of science. This is because research of research involved in mapping genomes. The
produces ever more data that must be accessible second objective was to determine the complete
to scientists. The accurate storage and rapid nucleotide sequences of these genomes. But a
retrieval of scientific data are nowhere more written record of the human genome sequences
critical than in the Human Genome Project. would require the equivalent of 200 telephone
The purpose of the Human Genome Project books of 1,000 pages each. So, one important
was to map and sequence the estimated part of the project was to develop systems for
35,000 genes, containing approximately electronically storing and managing databases.
3 billion nucleotide pairs of DNA, and store The findings from the Human Genome
the information in electronic databases. Project have the potential to increase
The Human Genome Project had our understanding of human variation,
two major objectives. The first was to develop development, gene regulation, and evolution.
detailed maps of the human genome and the The knowledge gained will help advance the

ESSAY: Informatics: Mapping and Sequencing the Human Genome Unit 4 537
KH4119_Unit 04 ES_E512-E541 03/16/05 11:13 AM Page 538

P Y
b

CO
T
O
N
O
D
Figure E12.19 (a) False colors identify the different chemical structures that make up
this model of a DNA molecule. (b) Researchers study the sequence of the nucleotides in
DNA. One method for reading the sequences is by using a technique that converts the
sequence of nucleotides into a series of bands on a piece of X-ray film. Knowing the
nucleotide sequence of a gene allows the scientist to predict what kind of protein is coded
for by the gene.

practice of medicine by uncovering new ways have applications far beyond the project. The
of diagnosing and treating inherited disorders. development of electronic databases has been
New technologies, especially those that help a great advantage to the Human Genome
manage the enormous amounts of data Project. But it also has raised important
generated by the Human Genome Project, will questions about using such information.

538 Unit 4 ESSAY: Informatics: Mapping and Sequencing the Human Genome
KH4119_Unit 04 ES_E512-E541 03/16/05 11:14 AM Page 539

Genetic Screening: A Dilemma


for All of Us
Finding the gene for cystic fibrosis was a major Genetic screening is the ability to screen
breakthrough in biomedicine. There is new an individual or a population for a variety of

Y
hope that research will produce a cure for the genetic disorders. This screening allows for early
disorder. The CF gene can be detected through detection and prevention. It also raises many

P
DNA analysis. DNA analysis could help difficult questions about ethics and public
identify people who carry the gene policy. Dorothy Nelkin and Laurence Tancredi
(heterozygotes). Once recognized, these are sociologists who study the social impact of
people could be advised of the risk of having medicine. They agree that DNA analysis in

O
a child with CF. They could choose alternative genetic screening has shifted the focus of the
methods of having a child such as adoption, health care system from looking for actual
artificial insemination, or in vitro fertilization disease in individuals to looking for tendencies

C
and embryo transfer. Any gametes used in to develop disease. As a result, there is a danger
these methods could be screened for the that people who have no symptoms of disease
CF gene. DNA analysis also permits the may be labeled as disabled. These people may be

T
detection of the disorder in developing discriminated against by health or life insurance
fetuses (homozygotes). The parents of a fetus companies. Potential employers, for example,
diagnosed with CF could choose to abort the may refuse to hire such individuals. They do not

O
pregnancy or to carry it to term. want to risk increased costs for medical benefits.
They also do not want to spend time and
money training an employee whose life
expectancy might be limited.

N
Neil A. Holtzman, a pediatrician/
geneticist at Johns Hopkins University raises
another concern about DNA analysis. The
tests may not always predict with certainty

O
whether a person will develop a particular
disorder. This is especially true for
multifactorial disorders such as heart disease,

D
cancer, and schizophrenia. These disorders are
due to a complex interaction of genes and
environmental conditions. Furthermore, says
Holtzman, there are too few laboratories that
can perform DNA analysis with precision and
not enough trained genetic counselors to
interpret the results.
Holtzman, Nelkin, and Tancredi
recommend the development of new
regulations to control how genetic screening is
done and what is done with the results.
Without regulation and greater public

ESSAY: Genetic Screening: A Dilemma for All of Us Unit 4 539


KH4119_Unit 04 ES_E512-E541 03/16/05 11:14 AM Page 540

education about genetics, there is danger that budget for the Human Genome Project
some individuals may lose some control of supported research, discussion, and public
their lives. Carried to extremes, some people education about the ethical, legal, and social
might be forbidden to marry, to have children, implications of human genome research.
or to do certain kinds of work. Scientists, ethicists, philosophers, legislators,
The ethical, legal, and policy issues raised and a variety of other people are still involved
by DNA analysis and genetic screening must in these discussions. Challenging and value-

Y
be considered along with the potential laden questions often accompany advances in
benefits to society. Approximately 5 percent science and technology and affect individuals,
(several million dollars per year) of the annual families, and society.

P
O
Shaping the Future

C
Near the end of his book The Firmament of terrible and feared beings, passed
Time, the late paleoanthropologist and science quickly out of view. . . . Over the next
philosopher Loren Eiseley described an ridge, where he could do no more

T
interesting incident. While walking in the damage, I let the snake, whose anger
desert, he came upon a hen pheasant and a had subsided, slowly uncoil and slither
blacksnake locked in struggle. The bird from my arm. He flowed away into a
evidently had seen the snake attempting to little patch of bunch grassaloof,

O
steal some of her eggs and attacked it. In forgetting, unaware of the journey he
defending itself, the snake had coiled itself had made upon my wrist, which
around the bird. When Eiseley came upon throbbed from his expert constriction.

N
them, the snake was being severely battered The bird had contended for birds
against the stones by the bird. But the bird against the oncoming future; the
was weakening rapidly as she struggled to free serpent writhing into the bunch of grass
herself from the snakes coils. had contended just as desperately for

O
Here is Eiseleys description of how he serpents. And I, the apparition in that
responded to this sight and the deep questions valleyfor what had I contended?I
that were raised by his action. who contained the serpent and the bird

D
and who read the past long written in
I suppose I could have waited there
their bodies (pages 174175).
to see what happened; . . . I suppose it
would have been worth scientifically One aspect of Eiseleys story is of special
recording. But I could not stand that concern for us here. Until the evolution of
ceaseless, bloody pounding in the gravel humans, all organisms on earth were roughly
. . . so . . . I unwound the serpent from equal in the face of natural selection. The
the bird and let him hiss and wrap his individual success or failure of each member
battered coils around my arm. The bird, of a species in one generation shaped the
her wings flung out, rocked on her legs genetic legacy that gave rise to the next
and gasped repeatedly. I moved away in generation.
order not to drive her further from her In humans, however, a species emerged
nest. Thus the serpent and I, two that came to understand evolution and genetic

540 Unit 4 ESSAY: Shaping the Future


KH4119_Unit 04 ES_E512-E541 03/16/05 11:14 AM Page 541

this may affect our own species. But human


intervention has the power to affect the fate of
many other species in addition to our own.
Sometimes that intervention occurs through
active genetic manipulation of domesticated
organisms. Sometimes it happens merely as a
by-product of our immense impact on the

Y
environments that support wild organisms.
In either case, humans have become a major
factor in determining the genetic futures of

P
a huge range of other species. Today, that
impact equals or even exceeds the force of
natural selection itself.

O
But Eiseley suggests that this power,
which comes to us through our large
brains and conscious mindsthe legacy

C
of our own evolutionary historycarries
with it a responsibility. It is the responsibility
to employ those same conscious minds to

T
systems, and eventually began to reshape them examine what we do and to look beyond its
consciously. We have looked briefly at how immediate impact, as other species cannot.

O
N
O
D
ESSAY: Shaping the Future Unit 4 541

S-ar putea să vă placă și