Asian J.

Dairy & Food Res, 34(4) 2015:280-284 AGRICULTURAL RESEARCH COMMUNICATION CENTRE
Print ISSN:0971-4456 / Online ISSN:0976-0563 www.arccjournals.com

Isolation of exopolysaccharides producing lactic acid bacteria

from dairy products
Prasad Patil*, Akanksha Wadehra1, Kanchan Munjal and Pradip Behare
Dairy Microbiology Division,
ICAR- National Dairy Research Institute, Karnal-132 001, India.
Received: 25-08-2015 Accepted: 10-09-2015 DOI: 10.18805/ajdfr.v34i4.6878
ABSTRACT
Currently, much attention is being paid for improving the texture of food by screening the new exopolysaccharides (EPS)
producing strains. The aim of the present work was to isolate EPS producing Lactic acid bacteria (LAB) strains from raw
milk and milk products samples. Total of thirty eight dahi, lassi and raw milk samples were collected from different villages
and towns of Karnal and Delhi District. The samples were plated on milk agar and colonies showing ropy polysaccharides
production were subjected to biochemical test. After molecular identification 2 were found as S. thermophilus, 2 were Lb.
rhamnosus and 2 were confirmed as Lb. fermentum. Two S. thermophilus strains (PD7 and PD11) and Lb. fermentum
strains (AL6 and AD3) showed better curdling pattern, acidity, exopolysaccharides production, and sensory properties.
These cultures can be used for manufacture of indigenous fermented milk products.
Key words: Dahi, Exopolysaccharides, Lb. fermentum, Lb. rhamnosus, S. thermophilus.
INTRODUCTION benefits. EPSs have been proved to show important health
Lactic acid bacteria (LAB) are gram-positive benefits like antioxidant, cholesterol lowering, antitumor,
microorganisms that play an essential role in the industrial antiviral, and immunomodulatory activities (Madhuri and
production of fermented dairy products. The metabolic Prabhakar, 2014). Also, they reduce formation of pathogenic
products they generate during fermentation and ripening biofilms, help in modulation of adhesion to epithelial cells
confer the rheological and organoleptic qualities desired by and increase levels of bifidobacteria showing a prebiotic
these products (Bennama et al., 2012). Some strains are potential (Hongpattarakere et al., 2012). Hence, the choice
known to produce exopolysaccharide (EPS), which play an of EPS- producing starter cultures seems to give several
important role in the development of the texture of yoghurt advantages over non- producing ones. Also, LAB possess
and other fermented milks, cheeses and low fat dairy desserts generally regarded as safe (GRAS) status which allows them
(Hassan, 2008). EPS from LAB are divided into two groups, to be incorporated in food without labeling. Most of the EPS-
homo- and hetero-EPS. Homo-EPS are composed of one producing LAB can be isolated from different fermented
type monosaccharide, whereas hetero-EPS consist of regular foods such as dahi, lassi, yoghurt, cultured buttermilk,
repeating units of 3-8 different carbohydrate molecules. EPS cheeses, yoghurt, kefir, and other fermented dairy products
imparts highly desirable rheological changes in the food (Bunkoed and Thaniyavarn, 2014). Furthermore, EPS-
matrix such as increased viscosity, improved texture and producing strains can be also found in other environments
reduced syneresis (Badel et al., 2011). Incorporation of EPS such as gut of different animals and humans. Selection for
or EPS-producing starters in dairy foods can provide LAB strains with newer properties can be used as new,
viscosifying, stabilizing, and water-binding functions. In situ functional starter cultures may lead to improved fermentation
production of EPS is very important in the manufacture of process and an enhanced quality of the end product. As
fermented dairy products, such as yogurt, drinking yogurt, information regarding isolation of EPS producing cultures
cheese, cultured cream and milk-based desserts. EPS- from dairy products in Indian condition is scanty. The present
producing LAB has a greater ability to withstand study was undertaken to isolate EPS producing LAB from
technological stresses (Stack et al., 2010) and survive the fermented dairy food for application in fermented milk
passage through the gastrointestinal tract compared to their products.
non-producing bacteria. MATERIALS AND METHODS
In recent times, EPS produced by LAB have Collection of samples: In an attempt to isolate some
received mounting attention; mainly because of their health potential strains of EPS producing LAB, total 38 different
*Corresponding authors e-mail: patilprasad11@gmail.com; 1Dairy Technology Division, ICAR-NDRI, Karnal.
 Volume 34 Issue 4 (2015)
samples of milk and milk products comprising of raw milk
(12), dahi (16), and lassi (10) were collected in sterile plastic
bottles from local market and rural and urban areas near
Karnal and Delhi.
Reference strains and media: The standard cultures of
Lactobacillus fermentum NCDC-141, Lactobacillus
rhamnosus NCDC-24 and Streptococcus thermophillus
NCDC-144 were procured from National Collection of Dairy
Cultures (NCDC), National Dairy Research Institute (NDRI),
Karnal. Lactobacillus strains were isolated on Man, Rogosa
and Sharpe (MRS) agar and modified MRS agar (Messens
et al., 2002). The addition of a reducing agent such as
cysteine 0.05% to MRS improves the specificity of this
medium for Lactobacillus isolation (Shah, 2000). M17 and
skim milk agar were used for S. thermophillus strains (Birollo
et al., 2000). Skim milk agar medium was used for EPS
producing strains. All strains were stored at -20 C in their
corresponding isolation medium, containing 30% (vol/vol)
glycerol as a cryoprotectant.
Isolation of LAB: Appropriate dilutions of the samples were
plated on the MRS and M17 agar. Viable counts were
enumerated after incubation at 37 C and 42 C for 48-72 h.
The individual colonies with different morphology were
picked using tooth pick and grown in MRS and M17 broth.
Further it was plated to check for purity. A total 80
presumptive LAB were isolated.
Screening for EPS production
Capsule formation: The ability of cultures to form a capsule
was evaluated by capsule staining method (Anthony, 1931).
A thin smear was prepared from actively grown culture in
skim milk followed by air drying without hit fixing. Few
drop of crystal violet were added for 2 min and smear rinsed
with 20 % (w/v) copper sulphate solution. The slides were
air dried and examined under oil immersion lens, the capsules
could be observed layer around the cell surface.
Ropy polysaccharide production: Production of ropy
polysaccharide was observed visually. The culture were
grown in skim milk tubes and after the curdling, tubes were
vigorously shaken to break the curd. The broken curd was
picked up with sterile loop or glass rod and observed for
TABLE 1: Species-specific primers and PCR cycle of LAB isolates
Organisms Primer sequence
Lactobacillus F- 5' CTAGCGGGTGCGACTTTGTT 3'
rhamnosus R-5' GCGATGCGAATTTCTATTATT 3'
Lactobacillus F- 5' ACTAACTTGACTGATCTACGA 3'
fermentum R-5' TTCACTGCTCAAGTAATCATC 3'
Streptococcus F-5' CAC TAT GCT CAG AAT ACA 3'
thermophillus R-5' CGA ACA GCA ITG ATG ITA3'
281
formation of long, ropy and viscous strand. The symbols for
ropy polysaccharide production as observed visually was
given as less ropy (+), medium ropy (++) and highly ropy
(+++).
Identification of LAB : The isolates were streaked on MRS
and M17 with 4% sucrose medium for examination of
morphological characteristics. The mucoid and ropy
colonies on agar plate were observed by touching colonies
with a sterile loop. The ropy colonies, formed a long
filament when extended with a loop whereas the mucoid
colonies have a slimy appearance on agar plates and
were not able to produce strands by this method (Ruas-
Madiedo and De Los Reyes-Gaviln, 2005). All isolates were
tested for catalase and oxidase activity, Gram staining and
spore formation. All Gram positive and catalase negative
rods and cocci were tested for the growth in MRS and M17
broth respectively at 10, 37 and 45 C (Abbas and Mahasneh,
2014). The suspected colonies were subjected to biochemical
tests by using API 50 CH kit and CHL media ( Biomrieux,
France). Further, confirmation of Lactobacillus spp. ( Lb.
fermentum and Lb. rhamnosus) and S. thermophillus were
done by molecular methods with some modification in PCR
steps using reported primers by Song et al. (2000); Lick et
al. (1996). The sequence of primers and the corresponding
PCR cycle is given in Table 1. PCR was performed in a
Biorad PCR System (S1000 Thermal cycler,Singapore). The
amplified PCR products were then separated by agarose gel
electrophoresis, stained with ethidium bromide and were
subsequently visualized by UV transilluminator.
Technological screening: The milk (12% reconstituted skim
milk) was fermented with identified EPS producing LAB
strains at 37C till curd is settled down. Technological
parameters such as titratable acidity, curdling time, flavour,
body and texture were evaluated. Titratable acidity of
fermented milk was evaluated by titration method, while
curdling time, flavour, body and texture simply by sensory
method.
RESULTS AND DISCUSSION
Isolation of EPS producing LAB: Milk is the favourable
environment for secretion of extracellular polysaccharide
from several strains of LAB. In this study, total 80 isolates
Amplicon
Polymerase chain reaction cycle References
size
95C 4 min, 95C 4 min, 62C 2 min, 113 bp Song et al.
62C 2 min, 74C 5 min; 35 Cycles (2000)
95C 4 min, 95C 20 s, 60C 2 min, 192 bp Song et al.
60C 2 min, 74C 5 min; 35 Cycles (2000)
95C 4min, 95C 30 s, 54C 45 s, 72C 968 bp Lick et al.
45 s; 30 Cycles (1996)
282 ASIAN JOURNAL OF DAIRY AND FOOD RESEARCH
were obtained from milk and milk products collected from
different sources. Based on morphological evaluation, some
cocci and rod shaped isolates were selected (Fig. 1). Total
34 isolates were showed mucoid colonies on milk agar
medium. All these EPS producing bacteria were of gram
positive and catalase negative, which is a typical
characteristic of LAB. These colonies showed clean lactic
fermentation without any defects. The isolates with EPS were
able to grow in milk and gave positive litmus milk test in
24 h as illustrated in Fig. 2. Repetitive streaking method
was followed to purify all the suspected cultures. Previously,
the numbers of EPS producing LAB were isolated from milk
and milk products (Lavanya et al., 2011; Bennama et al., 2012).
Screening for EPS production: There are 2 types of EPS
i.e. capsular polysaccharides (CPS) and ropy polysaccharides FIG 2: Litmus milk test: left- control, right- positive test by
strain DP 11
(RPS). CPS formation was evaluated by the Indian ink
negative staining technique on the cells of LAB. Capsule capsular and ropy polysaccharides production greatly differs
staining revealed that around 14 isolates shown large capsule from culture to culture and certain strains were able to
surrounding the cell surface while rest exhibited small or no produce both types. Both CPS and RPS strains have been
capsule. Among the 14 isolates, PD11, AR2, AL6 produced found in lactic acid bacteria (Mozzi et al., 2009). However,
larger and thick capsule (Fig.3). Isolate AD14 and PR5 did eighteen cultures showed the ropy polysaccharides
not show capsular polysaccharides production. Generally, production although long strand formation varied from strain
to strain. Isolates AL6, AD3, AL18, AR2, PD11, PL7, PR3
shown highly ropy strand formation in curd, while isolates
AD14, PD7, PD16, PD19, AL2, PD1 shown medium ropy
strand in curd, and isolate PL5, PL6, AR5 shown less ropy
strand in curd (Table 2). Figure 4 showed the ropy
polysaccharide production by PD11 strain. As dairy industry
point of view, the RPS producing strains were found to be
more relevant as they are considered to be providing natural

FIG 1: Morphology of LAB isolates [(a) & (b) rods; (c)- cocci] FIG 3: Capsule formation by isolates (a) PD11, (b) AR2, (c) AL6.
TABLE 2: Technological Screening of EPS producing LAB strains
EPS producing Type of EPS Acidity Curdling time Flavor, body and texture
LAB strains (% Lactic Acid) (h)
CPS RPS
AL6 + +++ 0.72 7 Good body and texture, pleasant flavor
AD3 + +++ 0.78 7 Good body and texture, pleasant flavor
AL18 + +++ 0.67 9 Poor body and texture and flavor
PD7 + ++ 0.82 6 Good body and texture, pleasant flavor
AR2 + +++ 0.70 8 Good body and texture but acidic
PR5 - + 0.66 8 Good body and texture, poor flavo
PD19 + ++ 0.69 9 Good body and texture, poor flavo
PD11 + +++ 0.84 6 Good body and texture, pleasant flavor
 Volume 34 Issue 4 (2015)
biothickness to the dairy product which enhances its
technological properties. The use of yoghurt starter cultures
that contain strains that produce EPS is a promising
alternative. These polymers have been reported to improve
the rheological behavior and texture of various fermented
milk products (Badel et al., 2011). Even though both RPS
and CPS increases the viscosity of the fermented product
but only RPS can beneath a stretchable character provided
by slime polysaccharides. The same was noticed in our
isolates as well because the RPS producing cultures were
found to be giving ropiness in the fermented milk therefore
shown better technological attributes.
FIG 4: Ropy polysaccharide produced by DP11 strain in fermented
skim milk
Identification of EPS producing LAB: The tentative
isolates (n= 18) of LAB selected on the basis of microscopic
and EPS production were further subjected to biochemical
characterization. All isolates were tested for catalase and
oxidase activity, Gram staining, spore formation and growth
at 10, 37 and 45 C (Abbas and Mahasneh, 2014). After
biochemical test by using API 50 CH kit and CHL media
(Biomrieux, France), 5 cultures were identified as S.
thermophillus and 8 were Lactobacillus spp. Further,
confirmation of Lactobacillus spp. (Lb. fermentum and Lb.
rhamnosus) and S. thermophillus were done by molecular
methods. Thirteen isolates were examined for their species
specificity by using PCR reaction with reported primers
(Table 1). A quite appreciable quality and amount of
amplicons were observed in all isolates (Figure 5). The
amplicons of all the 8 isolates showed the reported PCR
product size along with the positive controls. Out of 13, 8
biochemically identified isolates were confirmed as LAB
strains. Out of 8 isolates, 4 isolates (AR2, PR5, PD19 AND
PD11) were confirmed as S. thermophillus , 2 isolates (AL6
and AD3) were confirmed as Lb. fermentum and 2 isolates
(AL18 and PD7) were confirmed as Lb. rhamnosus.
283
FIG 5: Identification of LAB by PCR
(a)Lactobacillus fermentum, Lane1: AL6, Lane 2: AD3, Lane 3:
+ ve control (Lactobacillus fermentum NCDC-141), Lane 5: ladder
; (b) Lactobacillus rhamnosus, Lane 1: ladder, Lane 2: AL18,
Lane 3: AD7, Lane 4: + ve control (Lactobacillus rhamnosus
NCDC 24), Lane 5: ladder; (c) Sreptococcus thermophillus: Lane
1: ladder, Lane 2:AR2, Lane 3: PR5, Lane 4: PD19, Lane 5: PL6
Lane 7: + ve control (Sreptococcus thermophillus NCDC 144).
Technological screening of EPS producing LAB: For the
evaluation of technological properties of selected EPS
producing LAB strains, acidity, curdling time and body and
texture were used as indicator to select best strains. Table 2
shows result of technological properties and it was observed
that four cultures AL6, AD3, PD7, and PD11 gave better
results as compared to other four cultures. EPS production
did not have effect on titratable acidity and curdling time
hence clear cut relationship could not be established. The
technological parameters which are greatly affected by EPS
were flavour, body and texture and production of EPS
improved these parameters. The effect of EPS cultures in
improvement of properties of yoghurt, cheeses, dahi, lassi
etc. are well demonstrated by rheological, sensory, and
electron microscopic studies (Awad et al., 2005; Duboc and
Mollet, 2001).
CONCLUSIONS
EPS producing LAB strains can be isolated from
milk and traditionally made fermented milk products like
dahi and lassi. These EPS producing cultures play important
role in improvement of flavour and textural attributes. EPS
also contributes to the mouth-feel, texture, and taste
perception of fermented dairy products. However, EPS
producing cultures should be initially screened for
technological properties. The increasing demand for fat-free
or reduced fat products is also raising interest in the use of
EPS-producing LAB as natural bio-thickeners. There is need
to establish specific EPS producing cultures for particular
type of indigenous fermented milk products.
ACKNOWLEDGMENTS
The authors thankfully acknowledge the financial
support from Indian Council of Agricultural Research, New
Delhi and The Director, National Dairy Research Institute
Karnal, India for providing cultures. Ms. Akanksha Wadehra
is also thankful to DST for providing fellowship in the form
of INSPIRE.
284 ASIAN JOURNAL OF DAIRY AND FOOD RESEARCH
REFERENCES
Abbas, M. M. and Mahasneh, A. M. (2014). Isolation of Lactobacillus strains with probiotic potential from camels
milk.African Journal of Microbiology Research.8:1645-1655.
Anthony, E. E. (1931). A note on capsule staining. Science. 73: 319-320.
Awad, S., Hassan, N. and Muthukumarappan, K. (2005). Application of exopolysaccharide-producing cultures in reduced
fat cheddar cheese: texture and melting properties. Journal of Dairy Science. 88: 4204-4213.
Badel, S., Bernardi, T. and Michaud, P. (2011). New perspectives for Lactobacilli exopolysaccharides. Biotechnology
Advances. 29: 54-66.
Bennama, R., Fernandez, M., Ladero, V., Alvarez, M.A., Rechidi- Sidhoum, N. and Bensoltane, A. (2012). Isolation of an
exopolysaccharide- producing Streptococcus thermophilusfrom Algerian raw cow milk. European Food Research
and Technology. 234: 119-125.
Birollo, G. A., Reinheimer, J. A. and Vinderola, C.G. (2000). Viability of lactic acid microflora in different types of yoghurt.
Food Research International. 33: 799-805.
Bunkoed, O. and Thaniyavarn, S. (2014). Isolation of exopolysaccharides producing-lactic acid bacteria for fermented
milks products. In the 26th Annual Meeting of the Thai Society for Biotechnology and International Conference
- TSB2014".2629 November 2014, Mae Fah Luang University, Chiang Rai, Thailand.
Duboc, P. and Mollet, B. (2001). Applications of exopolysaccharides in dairy industry. International Dairy Journal.
11: 759-768.
Hassan, A. N. (2008). ADSA Foundation Scholar Award: Possibilities and challenges of exopolysaccharide- producing
lactic cultures in dairy foods. Journal of Dairy Science. 91:1282-1298.
Hongpattarakere, T., Cherntong, N., Wichienchot, S., Kolida, S. and Rastall, R. A. (2012). In vitro prebiotic evaluation of
exopolysaccharides produced by marine isolated lactic acid bacteria. Carbohydrate Polymers. 87: 846-852.
Lavanya, B., Sowmiya, S., Balaji, S. and Muthuvelan, B. (2011). Screening and characterization of lactic acid bacteria
from fermented milk. British. Journal of Dairy Science.2: 5-10.
Lick, S., Keller, M., Bockelmann, W. and Heller, J. (1996). Rapid identification of Streptococcus thermophilus by primer-
specific PCR amplification based on its lacZ gene. Systematic and Applied Microbiology. 19: 74-77.
Madhuri, K. V. and Prabhakar, K. V. (2014). Microbial Exopolysaccharides: Biosynthesis and Potential
Applications.Oriental Journal of Chemistry.30: 1401-1410.
Messens, W., Neysens, P., Vansieleghem, W., Vanderhoeven, J. and De Vuyst, L. (2002). Modeling growth and bacteriocin
production by Lactobacillus amylovorus DCE 471 in response to temperature and pH values used for sourdough
fermentations. Applied and Environmental Microbiology. 68:1431-1435.
Mozzi, F., Gerbino, E., Font de Valdez, G. and Torino, M. I. (2009). Functionality of exopolysaccharides produced by
lactic acid bacteria in an in vitro gastric system. Journal of Applied Microbiology.107: 56-64.
Ruas-Madiedo, P. and De Los Reyes-Gaviln, C. G. (2005). Invited review: methods for the screening, isolation, and
characterization of exopolysaccharides produced by lactic acid bacteria. Journal of Dairy Science, 88: 843-856.
Shah, N. P. (2000). Probiotic bacteria: selective enumeration and survival in dairy foods. Journal of Dairy Science.
83 : 894-907.
Song, Y., Kato, N., Liu, C. X., Matsumiua, Y., Kato, H. and Watanabe, K. (2000). Rapid identification of 11 human
intestinal Lactobacillus species by multiplex PCR assays using group and species specific primers derived
from 16S and 23S rRNA intergenic spacer region and its flanking 23S r RNA. FEMS Microbiology Letter. 187:167-173.
Stack, H. M., Kearney, N., Stanton, C., Fitzgerald, G. F. and Ross, R. P. (2010). Association of beta-glucan endogenous
production with increased stress tolerance of intestinal Lactobacilli. Applied and Environmental Microbiology.
76: 500-507.