Journal of Bioscience and Bioengineering

VOL. xx No. xx, 1e7, 2016

www.elsevier.com/locate/jbiosc

Inhibitory effect of Cinnamomum osmophloeum Kanehira ethanol extracts on

melanin synthesis via repression of tyrosinase expression

Shih-Chieh Lee,1 Chun-Hao Chen,1 Chih-Wen Yu,2 Hsiao Ling Chen,2, 3 Wei-Tung Huang,2
Yun-Shiang Chang,2 Shu-Hsien Hung,1 and Tai-Lin Lee2, *

Department of BioIndustry Technology, Da-Yeh University, Changhua 51591, Taiwan,1 Department of Molecular Biotechnology, Da-Yeh University, No. 168, University Rd., Dacun,
Changhua 51591, Taiwan,2 and Department of Bioresources, Da-Yeh University, Changhua 51591, Taiwan3

Received 5 February 2015; accepted 5 March 2016

Available online xxx
Melanin contributes to skin color, and tyrosinase is the enzyme that catalyzes the initial steps of melanin formation.
Therefore, tyrosinase inhibitors may contribute to the control of skin hyperpigmentation. The inhibition of tyrosinase
activity by Cinnamomum zeylanicum extracts was previously reported. In this report, we test the hypothesis that Cin-
namomum osmophloeum Kanehira, an endemic plant to Taiwan, contains compounds that inhibit tyrosinase activity,
similar to C. zeylanicum. The cytotoxicity of three sources of C. osmophloeum Kanehira ethanol extracts was measured in
B16-F10 cells using a methyl thiazolyl tetrazolium bromide (MTT) assay. At concentrations greater than 21.25 mg/mL, the
ethanol extracts were toxic to the cells; therefore, 21.25 mg/mL was selected to test the tyrosinase activities. At this
concentration, all three ethanol extracts decreased the melanin content by 50% in IBMX-induced B16-F10 cells. In
addition to the melanin content, greater than 20% of the tyrosinase activity was inhibited by these ethanol extracts. The
RT-PCR results showed that tyrosinase and transcription factor MITF mRNAs expression were down-regulated. Consis-
tent with the mRNA results, greater than 40% of the human tyrosinase promoter activity was inhibited based on the
reporter assay. Furthermore, our results demonstrate that the ethanol extracts protect cells from UV exposure.
C. osmophloeum Kanehira neutralized the IBMX-induced increase in melanin content in B16-F10 cells by inhibiting
tyrosinase gene expression at the level of transcription. Moreover, the ethanol extracts also partially inhibited UV-
induced cell damage and prevented cell death. Taken together, we conclude that C. osmophloeum Kanehira is a poten-
tial skin-whitening and protective agent.
Ó 2016, The Society for Biotechnology, Japan. All rights reserved.

[Key words: B16-F10 melanoma cells; Cinnamomum osmophloeum Kanehira ethanol extract; MITF; Skin whitening; Tyrosinase; Tyrosinase promoter
activity]

Melanin contributes to skin, hair and eye color in humans, and
the melanin pigment plays an important role in the prevention of
skin injury induced by sun radiation (1). However, overexposure to
sun radiation, particularly UV radiation, can lead to hyperpigmen-
tation, wrinkling, melasma, and skin cancer (2). Tyrosinase is the
enzyme that catalyzes the initial steps in the formation of melanin.
Therefore, tyrosinase is responsible for the coloring of the skin, hair
and eyes in humans (3). Any natural product or chemical that re-
presses tyrosinase activity and/or inhibits tyrosinase gene expres-
sion is a candidate whitening agent for the cosmetics industry.
Plant extracts, such as those from Acer barbinerve (4), Magnolia
grandiflora L. (5) Paeonia suffruticosa (6) and Rhodiola rosea (7), have
been reported as candidates. However, some plant extracts have
adverse effects. For example, the primary active compounds of the
roots of Panax ginseng (8) and Radix Polygoni multiflora (9) increase
the cellular melanin content and tyrosinase activity.
The expression of tyrosinase is tightly regulated and depends on
the cooperation of two DNA elements of a gene, that is, a promoter,
which is located before the transcription start site, and the locus
* Corresponding author. Tel.: þ886 4 8511888x4257; fax: þ886 4 8511326.
E-mail address: tailin@mail.dyu.edu.tw (T.-L. Lee).
control region, which is located at
15 kb upstream of the gene
(10). Hormones and several other factors also affect tyrosinase gene
expression. Tyrosinase gene expression is up-regulated by estrogen
(11), which is a female sex hormone that binds to its receptor and
increases cellular cyclic adenosine monophosphate (cAMP)
signaling. The chemical 3-isobutyl-1-methylxanthine (IBMX) elicits
cellular cAMP and increases cellular tyrosinase activity and melanin
content, whereas H89, a PKA inhibitor, reduces intracellular cAMP
levels and decreases the melanin content (12).
UV radiation from sunlight is a risk factor for skin damage and
may accelerate skin aging (13). According to the wavelength, UV
radiation has been divided into UVA (315e400 nm), UVB
(280e315 nm) and short wavelength UVC (100e280 nm) radiation.
Because the ozone in the stratospheric layer adsorbs UVB and UVC,
95% of the UV that reaches the earth is UVA (14,15). UV induces
reactive oxygen species (ROS) formation in skin cells, and ROS
interact with lipid-rich membranes, enzymes and cellular DNA,
leading to oxidative stress and, consequently, cell death. Several
plant extracts with antioxidant activities protect cells from this UV-
induced damage (8,9,14,15).
Cinnamon, that is, Cinnamomum zeylanicum, is a Chinese tradi-
tional herb that is also widely used worldwide. C. zeylanicum in-
creases the activity of antioxidant enzymes when fed to rats (16).

1389-1723/$ e see front matter Ó 2016, The Society for Biotechnology, Japan. All rights reserved.
http://dx.doi.org/10.1016/j.jbiosc.2016.03.002

Please cite this article in press as: Lee, S.-C., et al., Inhibitory effect of Cinnamomum osmophloeum Kanehira ethanol extracts on melanin synthesis
via repression of tyrosinase expression, J. Biosci. Bioeng., (2016), http://dx.doi.org/10.1016/j.jbiosc.2016.03.002
2 LEE ET AL. J. BIOSCI. BIOENG.,

The extract also exhibits antityrosinase activity and reduces the TABLE 1. Primer sequences for PCR.
formation of insoluble melanin flakes from tyrosine (17). Moreover, Primer name (accession no.) DNA sequence (50 /30 )
the essential oil of another member of the cinnamon family, Cin- a
Human tyrosinase promoter (U03039)
namomum cassia, inhibits a-MSH-induced melanin production (18). ProF ACACGTGTAGGCCAGAGGAG
In addition to Cinnamomum osmophloeum, Kanehira is an endemic ProR CCTCACAAGGTCTGCAGGAA
cinnamon plant of Taiwan, and its leaves are widely used as a flavor NheProF2 GCTAGCCCAGAGGAGACAGTGGCCTA
XhoProR2 CTCGAGTCTGCAGGAACTGGCTAATTG
additive substitute for C. zeylanicum (17). In the preparation of the
Human tyrosinase locus control regiona (AY180962)
report of this material, we found that Lee et al. (19) reported that LcrF CAAGCTCAGTTCAGGCATCA
C. osmophloeum Kanehira extracts have properties of tyrosinase LcrR CGCAAGTCAGTGGTTGAAAA
suppression, wound repair promotion, and antioxidant activity. In BamLcrF2 GGATCCGCATCATCTCTCTCTAGGAGG
this study, three different sources of C. osmophloeum Kanehira, SalLcrR2 GCTGACTTCTCTGGCTCAGGAGGCTA
Mouse MITF mRNA, tyrosinase mRNA and GAPDH mRNAb (NM_008601,
including two different chemical types (20) and one unidentified
NM_011661.4 and NM_001289726.1)
type, were used to evaluate the effects on tyrosinase activity and mMITFF GGAAATGCTAGAATACAGTCACTA
cell protection against UV stress. The results revealed that all three mMITFR GTCGCCAGGCTGGTTTGGACA
C. osmophloeum Kanehira ethanol extracts inhibited tyrosinase mTyrF TGGGGATGAGAACTTCACTG
mTyrR ACGTAATAGTGGTCCCTCAGGT
mRNA expression and tyrosinase activity and consequently
GAPDHF ACTCACGGCAAATTCAACGG
reduced melanin accumulation in B16-F10 murine melanoma cells. GAPDHR GACTCCACGACATACTGAGC
The ethanol extracts also protected the cells against UV-induced a
Nested PCR was used to amplify the human tyrosinase promoter and tyrosinase
cell damage. We conclude that C. osmophloeum Kanehira ethanol
locus control region sequence. The ProF, ProR and LcrF LcrR primer sets were used to
extract is a potential natural skin-whitening and protective agent. first PCR amplify, and then the amplicons were nested PCR-amplified with the
NheProF2, XhoPro2, BamLcrF2, and SalLcrR2 primers.
b
PCR primers sequences based on Kumagai et al. (26).
MATERIALS AND METHODS

Reagents and cell lines Murine melanoma B16-F10 cells were purchased
from the Bioresource Collection and Research Center (BCRC), BCRC 60031, Taiwan
ROC. Dulbecco’s modified Eagle’s medium (DMEM), glutamine, penicillin/
streptomycin solution (P/S), and fetal calf serum were purchased from Gibco. Two
different C. osmophloeum Kanehira chemical types were used (20). G2 is a
cinnamaldehyde and cinnamylacetate chemotype, and P3 is a mixed type. Both
types were collected from different counties in Taiwan and were cultivated in the
nursery of the Lienhuachih branch stations, Taiwan Forestry Research Institute,
and an additional tested sample was an un-characterized product collected by the
Taipei Farmer Association (TFA). The chemicals methyl gallate (MG), 3-isobutyl-1-
methylxanthine (IBMX), melanin, 1-(4,5-dimethylthiazol-2-yl)-3,5-
diphenylformazan, thiazolyl blue formazan (MTT), L-DOPA and ortho-nitrophenyl-
b-galactoside (ONPG) were purchased from Sigma. The reporter vector pGL3-Basic
was obtained from Promega. Linear polyethyleneimine (PEI, 25 KDa) was
purchased from Polysciences.
C. osmophloeum Kanehira ethanol extracts preparation The leaves were
collected and stored at
80 C until use. The active ingredients in the leaves were
extracted with ethanol as described by Wang et al. (21) with minor modifications.
The frozen cinnamon leaves were combined with 10 times the volume of ethanol
(v/w) and were extracted with a Waring Blender. The solution was incubated at
room temperature for three days to extract the active ingredients. The extractions
were performed three times and combined. The ethanol was removed using a
vacuum evaporator, and the ethanol-free extracts were freeze-dried. The dried
powder was weighed and dissolved in ethanol to obtain the desired experimental
concentration and sterilized by passing through a 0.2-mm filter.
Tyrosinase reporter plasmid construction The human lung cancer CL 1-
0 cell line was a kind gift from Dr. Meng-Feng Tsai, Da-Yeh University. The genomic
DNA (gDNA) extraction and restriction enzyme Bam HI digestion were performed as
described by Sambrook et al. (22). Digested gDNA (100 ng) was used as the template
for nested-PCR to amplify either the tyrosinase promoter (GenBank HSU03039) or
the 50 upstream locus control region (GenBank AY180962). The two amplified
DNA fragments were sequenced, and the confirmed sequences were cloned into
the pGL3 basic vector in which the promoter sequence is upstream of the
luciferase gene and the locus control sequence is downstream of luciferase gene.
The construct was named the pGL3-tyrosinase reporter (pGL3-TR).
B16-F10 cell culture and cell transfection Murine melanoma B16-F10 cells
were grown in DMEM medium supplemented with 10% heat-inactivated fetal
bovine serum, 1% penicillin/streptomycin, and 2 mM glutamine and were cultured
at 37 C in a humidified atmosphere of 5% CO2. IBMX with or without the
C. osmophloeum Kanehira extracts was added to the cells.
The pGL3-TR (1 mg) and 0.1 mg pCMV-LacZ plasmids were mixed and co-
transfected into B16-F10 cells using the PEI method with a NP ratio of 20. The
preparation of the PEI solution and the PEI transfection method were performed as
described by Boussif et al. (23).
Determination of cytotoxicity against mouse skin melanoma B16-F10 cell
lines Cell cytotoxicity was determined using an MTT assay as described by
Chen et al. (24) with minor changes. Briefly, 2  103 cells/well B16-F10 cells were
cultured in 96-well plates for 24 h, and 2 serial dilutions of C. osmophloeum
Kanehira ethanol extracts were added to the culture wells. Control cells were
treated with 1% ethanol. After additional 72 h incubation, the medium was
aspirated, and 20 mL of MTT solution (5 mg/mL in PBS) was added to each well.
The cells were incubated at 37 C for 4 h. Then, 200 mL DMSO and 25 mL
Sorensen’s glycine buffer (100 mM NaCl in 0.1 M glycine, pH 10.5) were added to
dissolve the crystals in each well. The optical densities were determined at
540 nm. The maximum concentration that was not toxic to the cells (safety
concentration) was used for the assays.
Melanin content assay The melanin content was determined according to
the method of Yu and Kim (25). Briefly, the cells were seeded in 6-well plates at
5
1  10 cells/well and cultured for 24 h. The IBMX and extracts were then added.
The cells were cultured for two days and collected by trypsinization. The collected
cell pellets were dissolved in 1 mL 1 M NaOH at 60 C for 1 h, and the optical
densities were determined at 405 nm and melanin was used as standard to
calculate the cellular melanin.
Cellular tyrosinase activity assay The cellular tyrosinase activity was
monitored as described previously (25) with minor modifications. B16-F10 cells
were seeded in 6-well plates (4  105 cells/well) and allowed to adhere at 37 C
for 24 h. Then, the C. osmophloeum Kanehira ethanol extracts were added to wells,
while control cells were treated with 1% ethanol. After a 24-h incubation, the cells
were washed with PBS and lysed in PBS (pH 7.5) containing 1% Triton X-100 and
0.1 mM PMSF. The lysates were centrifuged to pellet the cell debris, and the
protein concentrations were determined with the Bradford reagent according to
the manufacturer’s instructions (BioRad). The protein (30 mg) was transferred into
96-well plates, and 100 mL of freshly prepared 2 mg/mL L-3,4-
dihydroxyphenylalanine (L-DOPA) in phosphate-buffer solution was added to each
lysate. Following 1-h incubation, the optical densities were determined at
450 nm. The tyrosinase activity was expressed as a percentage of the IBMX
treated control.
MITF and tyrosinase gene expression For RNA isolation, the cells were
cultured and treated with the C. osmophloeum Kanehira ethanol extracts as
described. The cells were incubated for 2 days and then trypsinized and collected by
centrifugation. After removing the media, 1 mL Trizol (Invitrogen) was added to lyse
the cells, and the RNA was extracted as recommended by the manufacturer. The
extracted RNAs were reverse-transcribed with MMLV reverse transcriptase
(Invitrogen), and PCR was used to amplify the mouse microphthalmia-associated
transcription factor (MITF; NM_008601), tyrosinase (NM_011661.4) and
glyceraldehyde -3-phosphate dehydrogenase (GAPDH; NM_001289726.1) using
the specific primers (26) listed in Table 1. The amplified fragments were
electrophoresed, and the intensities of the bands were determined with the
AlphaDigiDOc 1201 program. The housekeeping gene GAPDH was used as the
loading control.
Luciferase and b-galactosidase assay The PGL3-TR and pCMV-LacZ
transfected cells were cultured for 24 h to express the reporter genes, and the
IBMX and C. osmophloeum Kanehira ethanol extracts were then added. After 48 h
of culture, the media were removed, and the cells were washed twice with PBS.
The cells were then lysed with 100 mL CCLR (Promega) for 10 min. The cell debris
were removed by centrifugation, 20 mL of the supernatant was used for the
luciferase assay (luciferase assay system, Promega) and 10 mL was used for the b-
galactosidase assay (b-galactosidase enzyme assay system, Promega). The
luciferase activities were normalized to the b-galactosidase levels to account for
the transfection efficiency (27). The reporter assays were performed in triplicate
in at least three independent experiments.

Please cite this article in press as: Lee, S.-C., et al., Inhibitory effect of Cinnamomum osmophloeum Kanehira ethanol extracts on melanin synthesis
via repression of tyrosinase expression, J. Biosci. Bioeng., (2016), http://dx.doi.org/10.1016/j.jbiosc.2016.03.002
VOL. xx, 2016 ANTITYROSINASE OF C. OSMOPHLOEUM KANEHIRA 3

FIG. 1. Cytotoxicity of C. osmophloeum Kanehira extracts in B16-F10 cells. The different

FIG. 2. C. osmophloeum Kanehira extract treatment suppresses IBMX-induced melanin
sources of C. osmophloeum Kanehira were ethanol-extracted and freeze-dried. The
deposition. B16-F10 cells at 4*105 cells/well were cultured in 6-well plates, and IBMX
dried extracts were dissolved in ethanol, and aliquots were transferred to 96-well
with or without ethanol extracts was added. Methyl gallate was used as the positive
plates with 1  103 cells/well. After 2 days of incubation, the cytotoxicities were
control. After a 48-h of incubation, the cells were collected and lysed to measure the
determined with MTT assays. The means  the S.E.s relative to the untreated cells from
melanin contents. Melanin was used as a standard to calculate the cellular melanin
three independent experiments are shown (each performed in quadruplicate).
with a method detection limit of 0.4 mg.

UV protection by C. osmophloeum Kanehira ethanol extracts For the UV

protection assay, the cells were cultured in 96-well plates for 24 h. Then, the media
were replaced with or without the C. osmophloeum Kanehira ethanol extracts, and
the cells were exposed to UVB irradiation as described previously (28) using a
G8T5E-UVB lamp (Sankyo Co. Ltd., Japan) with an emission spectrum of
280e360 nm and a peak of 306 nm. After the UVB radiation, the cells were
transferred into a CO2 incubator for 24 h, and the MTT assays were then
performed (24).
Statistics All data are presented as the mean  SEM. An analysis of variance
(ANOVA) was used to compare the pairs of groups.
previous report (4), MG inhibited the tyrosinase activity.
However, the inhibition of the ethanol extracts was greater than
that of the MG. From the tyrosinase inhibition and melanin
accumulation results, it seems that compounds other than MG in
ethanol extracts are more potent tyrosinase inhibitors. The three
ethanol extracts had similar tyrosinase inhibitory effects at the
same concentrations. The inhibition was likely because of the
common ingredients in the C. osmophloeum Kanehira that have
inhibitory activities.

RESULTS Tyrosinase gene inhibition occurs at the level of

transcription Due to the techniques used, we were unable to
Cell viability after exposure to the C. osmophloeum Kanehira exclude the possibilities that the inhibition occurred at the tyrosi-
ethanol extracts To determine the concentration that was non- nase protein activity level or at the mRNA transcription level. The
toxic to the mammalian cells, an MTT assay was performed (Fig. 1). transcription factor MITF has been recognized as an activator of
At 85 mg/mL, all three ethanol extracts were toxic to the cells. tyrosinase mRNA expression (5,26) and the inhibition of MITF
However, the G2, which was ythe cinnamaldehyde and expression may decrease tyrosinase mRNA expression and
cinnamylacetate type (20), was less toxic at concentrations less therefore reduce tyrosinase protein and activity. The cells were
than 42.5 mg/mL. At 21.5 mg/mL, the cell growth was no longer harvested, and the MITF mRNA and tyrosinase mRNA were
inhibited by the three cinnamon ethanol extracts. The evaluated using RT-PCR (Fig. 4). Panel A illustrates the RT-PCR
concentration of 21.5 mg/mL was selected for the experiments. results, and the calculated data are presented in panel B. IMBX
increased the MITF mRNA and tyrosinase mRNA expression in the
Melanin content and anti-tyrosinase activity in the extract-
treated B16-F10 cells After identifying the concentration that
was not harmful to the cells, we determined whether the tyrosinase
activity was affected at this concentration. Methyl gallate (MG), a
compound that was identified as a tyrosinase inhibitor (4) and a
component of C. osmophloeum Kanehira (29) was used as an
inhibitory control at the concentration of 25 mg/mL. Melanin
accumulation was ascertained, and the results revealed that
treatment with IBMX, a drug that increases tyrosinase mRNA
transcription, increased the melanin content in the cell, and the
cell pellets were darker than the untreated cells (Fig. 2, upper
panel, tubes 2 and 1, respectively). Regarding the MG and extract-
treated cells, the MG and three sources of C. osmophloeum
Kanehira all significantly inhibited cellular melanin accumulation
(lower panel). Again, the ethanol extracts had less melanin FIG. 3. Effects of C. osmophloeum Kanehira leaf ethanol extracts on the tyrosinase ac-
tivities of B16-F10 cells. Cells (1*105) were seeded in 6-well plates for 24 h. Then, IBMX
accumulation in the cells than the accumulation in the MG- with or without extracts was added. Methyl gallate was used as a positive control. The
treated cells. The extracts were added to the culture medium, and cells were treated for an additional 48 h. The tyrosinase activities were then analyzed
the tyrosinase activity was measured (Fig. 3). Similar to a and presented as % of IBMX-treated control cells.

Please cite this article in press as: Lee, S.-C., et al., Inhibitory effect of Cinnamomum osmophloeum Kanehira ethanol extracts on melanin synthesis
via repression of tyrosinase expression, J. Biosci. Bioeng., (2016), http://dx.doi.org/10.1016/j.jbiosc.2016.03.002
4 LEE ET AL.
FIG. 4. Inhibition of MITF mRNA, tyrosinase mRNA expression and promoter activities
by the C. osmophloeum Kanehira ethanol extracts. (A) Inhibition of tyrosinase mRNA
expression. B16-F10 cells (5  105) were cultured in 6-cm petri dishes and treated with
IBMX and C. osmophloeum Kanehira. After incubation, the RNA was extracted. The RT-
PCR products were resolved in an agarose gel (upper panel), and the band intensities
were quantified with the ImageJ program (lower panel). The relative amounts of
tyrosinase mRNA were normalized to the GAPDH mRNA. (B) The inhibition of human
tyrosinase promoter activities. B16-F10 cells were seeded in 6-well plates, and the
pGL3-TR and pCMV-LacZ plasmids were transfected into the cells. After 16 h, the cells
were treated with IBMX and C. osmophloeum Kanehira ethanol extracts and methyl
gallate for 48 h, and luciferase and b-galactosidase were assayed. The luciferase ac-
tivities were normalized to the internal b-galactosidase activities.
cells, and similar to the tyrosinase activity results, the MG and
ethanol extracts inhibited IBMX and induced MITF mRNA and
tyrosinase mRNA expression (Fig. 4A). The ethanol extracts
exhibited greater inhibition of the MITF mRNA and tyrosinase
mRNA expressions compared to the inhibition of MG.
There were less MITF mRNA and tyrosinase mRNA in the three
C. osmophloeum Kanehira extract-treated cells, and we determined
whether this down-regulation of tyrosinase also occurred in hu-
man cells. The human tyrosinase promoter sequences were inser-
ted into the pGL3 vector upstream of luciferase, and the locus
control region sequences were inserted downstream of the lucif-
erase gene. The constructed plasmid was named pGL3-TR. The
pGL3-TR plasmids were transfected into B16-F10 cells and then
treated with IBMX, MG and C. osmophloeum Kanehira ethanol ex-
tracts. IBMX increased the reporter activity by approximately 2.5-
fold, and MG and the three ethanol extracts all significantly
inhibited the induction by IBMX (Fig. 4B). As illustrated in Fig. 4A
and B, the down-regulation of tyrosinase activity was the result of
transcriptional inhibition by the C. osmophloeum Kanehira ethanol
extracts in the B16-F10 cells, and this inhibition might occur with
human tyrosinase as suggested by the reporter assay. The analysis
of variance (ANOVA) results indicated that the reporter activity was
the same for the treatments with the three ethanol extracts (data
not shown). These findings suggest that common ingredients are
present in C. osmophloeum Kanehira ethanol extracts other than the
primary components of each chemical type and that these in-
gredients corresponding to tyrosinase inhibition.
Please cite this article in press as: Lee, S.-C., et al., Inhibitory effect of Cinnamomum osmophloeum Kanehira ethanol extracts on melanin synthesis
via repression of tyrosinase expression, J. Biosci. Bioeng., (2016), http://dx.doi.org/10.1016/j.jbiosc.2016.03.002
J. BIOSCI. BIOENG.,
FIG. 5. Administration of C. osmophloeum Kanehira protects B16-F10 cells from damage
caused by UVB. B16-F10 cells (2  104) were cultured in 96-well plates; the next day,
C. osmophloeum Kanehira ethanol extracts, cinnamaldehyde and methyl gallate were
added to the cells before exposure to UVB light. Ascorbic acid and a-tocopherol, were
used as protection controls. After 48 h, MTT assays were performed.
Cinnamon protects cells from UV-induced damage Because
the cinnamon family has high antioxidant activity (16), we
determined whether this antioxidant activity reduces UV-induced
cell damage (Fig. 5). Ascorbic acid and a-tocorpherol have been
reported to protect against UV-induced DNA damage through oral
administration (30) and through sunburn cell formation via
topical application (31). Fifty microliters of ascorbic acid or a-
tocorpherol were used as the protection control. As expected, the
exposure of cells to UV radiation damaged the cells, and only 20%
of the cell population survived. More than 40% of the cells
survived under the protection of ascorbic acid or a-tocorpherol.
Cinnamaldehyde (6 mg/mL; 21.5 mg/mL was toxic to the cells, data
not shown), MG and the C. osmophloeum Kanehira ethanol
extracts protected the cells from the damage caused by UV
radiation by increasing the cell population to 30% of the dark
control experiments. Changes in cell morphology were not
observed with these treatments. This finding indicated that
although the components of C. osmophloeum Kanehira protected
the cells from UV exposure, this protection was less potent than
that from either ascorbic acid or a-tocorpherol.
DISCUSSION
Cinnamon is used worldwide and has many benefits to human
health. There are several species in this genus, and their ethanol
extracts have different functions. For example, cinnamon extracts
have antihypertensive effects (32), induce tumor cell death (33) and
protect the liver against alcohol-induced acute liver steatosis (34).
Among these extracts, C. cassia essential oil (35), the supercritical
CO2 extract of C. zeylanicum (17) and the ethanol extract of
C. osmophloeum Kanehira (19) inhibit tyrosinase activity. In the
search for compounds that inhibit tyrosinase activity, two charac-
terized chemical types, i.e., G2, which is a cinnamyl acetate type
(20), P3, which is a mixed type (20), and an uncharacterized TFA
ethanol extract of C. osmophloeum Kanehira were used to evaluate
the tyrosinase inhibition activities in this report. Consistent with
previous reports (19), all three different chemical types of
C. osmophloeum Kanehira were used to demonstrate the reduction
in the melanin accumulation in B16-F10 cells and the inhibition of
tyrosinase activities at the concentration of 21.5 mg/mL. However,
the different preservations of raw materials with similar extraction
methods may affect the inhibition efficacy. Lee et al. (19) used dried
leaves to prepare ethanol extracts; whereas, freeze-dried leaves
VOL. xx, 2016
were used for TFA and frozen leaves were used for G2 and P3 in this
report. When 25 mg/mL ethanol extracts were used, Lee and col-
leagues (19) found no inhibition of tyrosinase activities and no
reduction of melanin in B16-F10 cells. The maintenance of the
leaves at low temperature is important for maintaining the com-
pound in ethanol extracts for tyrosinase inhibition.
Several compounds that are found in the essential oil of
C. osmophloeum Kanehira have been reported to inhibit tyrosinase
activity, and these compounds include cinnamaldehyde (35),
eugenol (36, 37), kaempferol (38), and MG (4). Cinnamaldehyde
(35), eugenol (37) and kaempferol (38) are three compounds that
directly inhibit mushroom tyrosinase at concentrations of 4.04 mg/
mL, 0.23 mM (equivalent to 6.6 mg/mL) and 8.2 mg/mL, respectively.
Moreover, MG (4) has been reported to reduce the expressions of
the transcription factor MITF mRNA and tyrosinase mRNA by
approximately 20% at the concentration of 50 mM (equivalent to
9.2 mg/mL). Among these compounds, a major component of cin-
namon plant extracts is cinnamaldehyde. Cinnamaldehyde has
been found at high concentrations in C. cassia essential oil, which is
the supercritical CO2 extract of C. zeylanicum, and in the essential oil
of C. osmophloeum Kanehira G2 at 42%, 77% and 26.85% in C. cassia
(18), C. zeylanicum (17) and C. osmophloeum Kanehira G2 (20),
respectively. However, the compound in ethanol extract that in-
hibits tyrosinase activity may be a compound other than cinna-
maldehyde that synergizes with the cinnamaldehyde effect. Our
hypothesis is discussed below. First, the P3 extract, which is
grouped as a mixed type and contains only 2.55% cinnamaldehyde,
also inhibits tyrosinase activity. Second, the water solubility of
cinnamaldehyde is different from that of the ethanol extract. The
solubility of cinnamaldehyde in water is 1.1 g/L (CAS no 14371-10-
9), but the ethanol extract mixes well with water at a 1:1 ratio (data
not shown). Third, the extract concentrations used in this study
(21.5 mg/mL) are approximately 200 times less than the reported
IC50 of cinnamaldehyde. For the G2 and P3 ethanol extracts, the
cinnamaldehyde concentration may be much lower than the
inhibitory concentration. Compared with cinnamaldehyde,
eugenol, kaempferol and MG are more potent inhibitors of tyrosi-
nase (4,37,38). Nevertheless, eugenol and MG may not be the main
compounds that correspond to the inhibitory activities in our
ethanol extracts, and kaempferol remains to be verified. These
suppositions are discussed below. According to a previous report,
eugenol was not detected in either C. osmophloeum Kanehira G2 or
P3 essential oils, whereas it existed in other sources of essential oils
that were assayed at concentrations of approximately 0.4% (20). It is
likely that eugenol was present at very low levels in these two
plants, and consequently, at very low levels in their ethanol ex-
tracts. As mentioned earlier, eugenol inhibits mushroom tyrosinase
at a concentration of 6.6 mg/mL (37), which indicates that 26.6% of
the 25-mg ethanol extracts used was eugenol. These high concen-
trations of eugenol in the G2 and P3 ethanol extracts may not have
occurred. MG was used as a tyrosinase inhibitory control in this
report at the concentration of 25 mg/mL, and all three ethanol ex-
tracts inhibited greater tyrosinase activities and reduced the
melanin accumulation in the B16-F10 cells and decreased the MG.
Kaempferol exists in C. osmophloeum Kanehira leaves as a
glycoside-conjugate (39) and was extracted with either 100 C
boiling water (39) or with 70% acetone (40). The kaempferol-3-O-b-
D-glucoside inhibits tyrosinase activity and simultaneously reduces
MITF and tyrosinase mRNA expression at the concentration of
10 mg/mL. Because the concentration of kaempferol-3-O-b-D-
glucoside in the C. osmophloeum Kanehira ethanol extract remains
to be clarified, the role it played in the ethanol extract requires
further study. Of course, we cannot rule out the notion that all of
these compounds or the compounds in the ethanol extracts that are
yet to be identified synergistically reduced the melanin in the B16-
F10 cells.
Please cite this article in press as: Lee, S.-C., et al., Inhibitory effect of Cinnamomum osmophloeum Kanehira ethanol extracts on melanin synthesis
via repression of tyrosinase expression, J. Biosci. Bioeng., (2016), http://dx.doi.org/10.1016/j.jbiosc.2016.03.002
ANTITYROSINASE OF C. OSMOPHLOEUM KANEHIRA 5
UV radiation induces oxidative stress in cells and generates
reactive oxygen species (ROS), such as H2O2 and free radicals (41).
ROS cause oxidation damage to cellular DNA, proteins, and mem-
branes and eventually cell death. These processes are important
initial steps of photoaging and UV-induced skin cancer (42). It
seems that any compound that reduces the ROS will reduce the
photoaging process. Therefore, ascorbic acid and a-tocopherol,
which are well known antioxidants, protect against UV-induced
sunburn and DNA damage following either oral intake (30) or
topical application (31). Both chemicals were used to protect
against UV exposure in the experiment. In accordance with the
results of Lee and colleague (19), who described C. osmophloeum
Kanehira ethanol extracts as wound repair promoters and antiox-
idants, all of the ethanol extracts protected the cells against UV
radiation. Although the surviving cells were less than the ascorbic
acid-treated cells, these results may indicate that ethanol extracts
of C. osmophloeum Kanehira are weaker ROS scavengers than to
ascorbic acid (19). Recipes for ascorbic acid and a-tocopherol mixed
with C. osmophloeum Kanehira ethanol extracts may be worth
examining.
The majority of the solar UV radiation on the earth is UVA and
UVB. Compared to UVB, UVA is a longer wavelength with lower
energy; therefore, higher doses are necessary to cause cell dam-
age. To obtain these higher dosages, the cells must be exposed to
UVA/B radiation for longer periods of time, or a powerful radia-
tion sources must be used to produces heat and damage the cell.
Additionally, the pH of the culture medium is maintained by the
balance of bicarbonate and CO2, and longer exposure may induce
pH changes in the medium. To avoid pH changes or heating of the
culture medium during radiation treatment, UVB was used as the
radiation source in this study. UVB induces the formation of some
cyclobutane pyrimidine dimers (CPDs) and (6e4) photoproducts
[(6e4)PPs], whereas UVA induces low level of these compounds
(43). Additionally, both UVA and UVB promote the formation of
oxidized DNA bases, such as 8-oxo-7, 8-dihydro-20 -deoxy-
guanosine (8-oxodG) (44). Accordingly, this report may not fully
represent the actual conditions that people experience with
outdoor activities.
Based on our results, the ethanol extracts indirectly inhibit
tyrosinase activity, whereas another cinnamon essential oil has
been reported to directly inhibit tyrosinase activity (17e19). Why is
the ethanol extract functionally different from the essential oil? It
appears that the extraction solvent and the method affect the
extract yield and also the chemical composition; therefore, their
functions are different. Tabak et al. reported that ethanol and
methylene chloride C. cassia extractions have different potencies in
terms of the inhibition of the growth of Helicobacter pylori and
urease activity (45). These authors found that methylene chloride
extracts elicit greater growth inhibitions and that ethanol extracts
have greater adverse effects on urease activity. Yang et al. reported
that C. cassia extracted with ethanol generated more product than
extracts based on supercritical fluid extraction (SFE) (46). The
ethanol product also had higher contents of total phenolics (TPC),
which contributes to the greater antioxidant activity compared
with flavonoids (TFC), whereas the SFE had approximately similar
levels of TPC and TFC (46). It is possible that the phenolic com-
pound(s) correspond to the antityrosinase activity. However, we
cannot rule out the possibility that TFC or other chemicals may
contribute to the inhibition.
In this study, three sources of C. osmophloeum Kanehira ethanol
extracts were used to investigate the tyrosinase activities in B16-
F10 cells. Regardless of the chemical types, all of the ethanol ex-
tracts effectively decreased melanin formation in the B16-F10
melanoma cells. The down-regulation of the tyrosinase activities
was correlated with the inhibition of the tyrosinase promoter ac-
tivities. We also demonstrated that C. osmophloeum Kanehira
6 LEE ET AL. J. BIOSCI. BIOENG.,

ethanol extracts protected the against UV-induced cell damage. 18. Chou, S. T., Chang, W. L., Chang, C. T., Hsu, S. L., Lin, Y. C., and Shih, Y.:
Also, the using of C. osmophloeum Kanehira ethanol extracts was Cinnamomum cassia essential oil inhibits a-MSH-induced melanin production
and oxidative stress in murine B16 melanoma cells, Int. J. Mol. Sci., 14,
proved to be safe in terms of wound healing power and non-toxic to 19186e19201 (2013).
experimental animals by other group (18). We propose that 19. Lee, M. G., Kuo, S. Y., Yen, S. Y., Hsu, H. F., Leung, C. H., Ma, D. L., Wen, Z. H.,
C. osmophloeum Kanehira is a potential whitening and aging pre- and Wang, H. M. D.: Evaluation of Cinnamomum osmophloeum Kanehira ex-
vention agent for the cosmetic industry. tracts on tyrosinases uppressor, wound repair promoter, and antioxidant, Sci.
World J., 2015, 303415 (2015).
20. Lee, S. C., Chiou, S. J., Yen, J. H., Lin, T. Y., Hsieh, K. T., and Yang, J. C.: DNA
ACKNOWLEDGMENTS barcoding Cinnamomum osmophloeum Kanehira based on the partial non-
coding ITS2 region of ribosomal genes, J. Food Drug Anal., 18, 128e135 (2010).
This work was supported by National Science Council grant, 21. Wang, K. H., Lin, R. D., Hsu, F. L., Huang, Y. H., Chang, H. C., Huang, C. Y., and
Lee, M. H.: Cosmetic applications of selected traditional Chinese herbal med-
Taiwan, ROC (91-2311-B-212-001-NU) and research grants from
icines, J. Ethnopharmacol., 106, 353e359 (2006).
Da-Yeh University (ORD-10055) Changhua, Taiwan. 22. Sambrook, J., Fritsch, E. F., and Maniatis, T.: Molecular cloning: a laboratory
manual, 3rd ed. Cold Spring Harbor Laboratory Press, New York (2001).
References 23. Boussif, O., Lezoualc’h, F., Zanta, M. A., Mergny, M. D., Scherman, D.,
Demeneix, B., and Behr, J. P.: A versatile vector for gene and oligonucleotide
transfer into cells in culture and in vivo: polyethylenimine, Proc. Natl. Acad. Sci.
1. Miyamura, Y., Coelho, S. G., Wolber, R., Miller, S. A., Wakamatsu, K.,
USA., 92, 7297e7301 (1995).
Zmudzka, B. Z., Ito, S., Smuda, C., Passeron, T., Choi, W., and other 4 authors:
24. Chen, Y. S., Lee, S. M., Lin, C. C., Liu, C. Y., Wu, M. C., and Shi, W. L.: Kinetic
Regulation of human skin pigmentation and responses to ultraviolet radiation,
study on the tyrosinase and melanin formation inhibitory activities of car-
Pigment. Cell Res., 20, 2e13 (2006).
thamus yellow isolated from Carthamu stinctorius L, J. Biosci. Bioeng., 115,
2. Gilchrest, B. A. and Eller, M. S.: DNA photodamage stimulates melanogenesis
242e245 (2013).
and other photoprotective responses, J. Invest. Dermatol. Symp. Proc., 4, 35e40
25. Yu, J. S. and Kim, A. K.: Effect of combination of taurine and azelaic acid on
(1999).
antimelanogenesis in murine melanoma cells, J. Biomed. Sci., 17(Suppl. 1), S45
3. Wang, H. M., Chen, C. Y., Chen, C. Y., Ho, M. L., Chou, Y. T., Chang, H. C.,
(2010).
Lee, C. H., Wang, C. Z., and Chu, I. M.: (-)-N-Formylanonaine from Michelia alba
26. Kumagai, A., Horike, N., Satoh, Y., Uebi, T., Sasaki, T., Itoh, Y., Hirata, Y.,
as a human tyrosinase inhibitor and antioxidant, Bioorg. Med. Chem., 18,
Uchio-Yamada, K., Kitagawa, K., Uesato, S., and other 3 authors: A potent
5241e5247 (2010).
inhibitor of SIK2, 3, 30 , 7-trihydroxy-40 -methoxyflavon (40 -O-methylfisetin),
4. Kim, I. W., Jeong, H. S., Kim, J. K., Lee, J. K., Kim, H. R., Yun, H. Y., Baek, K. J.,
promotes melanogenesis in B16F10 melanoma cells, PLoS One, 6, e26148
Kwon, N. S., Park, K. C., and Kim, D. S.: Methyl gallate from Acer barbinerve
(2011).
decreases melanin synthesis in Mel-Ab cells, Pharmazie, 70, 55e59 (2015).
27. Nagarajan, P. and Sinha, S.: Development of an inducible gene expression
5. Huang, H. C., Hsieh, W. Y., Niu, Y. L., and Chang, T. M.: Inhibition of mela-
system for primary murine keratinocytes, J. Dermatol. Sci., 49, 73e84 (2008).
nogenesis and antioxidant properties of Magnolia grandiflora L. flower extract,
28. Shin, S. W., Jung, E., Kim, S., Kim, J. H., Kim, E. G., Lee, J., and Park, D.:
BMC Complement. Altern. Med., 12, 72 (2012).
Antagonizing effects and mechanisms of afzelin against UVB-induced cell
6. Liang, C.-H., Chou, T.-H., Tseng, Y.-P., and Ding, H.-Y.: trans-Caffeic acid
damage, PLoS One, 8, e61971 (2013).
stearylester from Paeonia suffruticosa inhibits melanin synthesis by cAMP-
29. Chuang, W. Y.: Analysis of composition of Cinnamomum osmophloeum Kane-
mediating down-regulation of a-melanocyte-stimulating hormone-stimulated
hira, Master’s thesis, Department of plant industry, National Pingtung Uni-
melanogenesis signaling pathway in B16 cells, Biol. Pharm. Bull., 35,
versity of Science and Technology (2004).
2198e2203 (2012).
30. Placzek, M., Gaube, S., Kerkmann, U., Gilbertz, K. P., Herzinger, T., Haen, E.,
7. Peng, L. H., Liu, S., Xu, S. Y., Chen, L., Shan, Y. H., Wei, W., Liang, W. Q., and
and Przybilla, B.: Ultraviolet B-induced DNA damage in human epidermis is
Gao, J. Q.: Inhibitory effects of salidroside and paeonol on tyrosinase activity
modified by the antioxidants ascorbic acid and D-a-tocopherol, J. Invest. Der-
and melanin synthesis in mouse B16-F10 melanoma cells and ultraviolet B-
matol., 124, 304e307 (2005).
induced pigmentation in guinea pig skin, Phytomedicine, 20, 1082e1087
31. Lin, J. Y., Selim, M. A., Shea, C. R., Grichnik, J. M., Omar, M. M., Monteiro-
(2013).
Riviere, N. A., and Pinnell, S. R.: UV photoprotection by combination topical
8. Guan, S., Su, W., Wang, N., Li, P., and Wang, Y. A.: A potent tyrosinase acti-
antioxidants vitamin C and vitamin E, J. Am. Acad. Dermatol., 48, 866e874
vator from Radix Polygoni multiflori and its melanogenesis stimulatory effect in
(2003).
B16 melanoma cells, Phytother. Res., 22, 660e663 (2008).
32. Nyadjeu, P., Nguelefack-Mbuyo, E. P., Atsamo, A. D., Nguelefack, T. B.,
9. Lin, M., Zhang, B. X., Zhang, C., Shen, N., Zhang, Y. Y., Wang, A. X., and
Dongmo, A. B., and Kamanyi, A.: Acute and chronic antihypertensive effects of
Tu, C. X.: Ginsenosides Rb1 and Rg1 stimulate melanogenesis in human
Cinnamomum zeylanicum stem bark methanol extract in L-NAME-induced hy-
epidermal melanocytes via PKA/CREB/MITF signaling, Evid. Based Complement.
pertensive rats, BMC Complement. Altern. Med., 13, 27 (2013).
Altern. Med., 2014, 892073 (2014).
33. Kwon, H. K., Hwang, J. S., So, J. S., Lee, C. G., Sahoo, A., Ryu, J. H., Jeon, W. K.,
10. Regales, L., Giraldo, P., García-Díaz, A., Lavado, A., and Montoliu, L.: Identi-
Ko, B. S., Im, C. R., Lee, S. H., Park, Z. Y., and Im, S. H.: Cinnamon extract
fication and functional validation of a 50 upstream regulatory sequence in the
induces tumor cell death through inhibition of NF kappa B and AP1, BMC
human tyrosinase gene homologous to the locus control region of the mouse
Cancer, 10, 392 (2010).
tyrosinase gene, Pigment. Cell Res., 16, 685e692 (2003).
34. Kanuri, G., Weber, S., Volynets, V., Spruss, A., Bischoff, S. C., and Bergheim, I.:
11. Jian, D., Jiang, D., Su, J., Chen, W., Hu, X., Kuang, Y., Xie, H., Li, J., and Chen, X.:
Cinnamon extract protects against acute alcohol-induced liver steatosis in
Diethylstilbestrol enhances melanogenesis via cAMP-PKA-mediating up-regu-
mice, J. Nutr., 139, 482e487 (2009).
lation of tyrosinase and MITF in mouse B16 melanoma cells, Steroids, 76,
35. Chang, C. T., Chang, W. L., Hsu, J. C., Shih, Y., and Chou, S. T.: Chemical
1297e1304 (2011).
composition and tyrosinase inhibitory activity of Cinnamomum cassia essential
12. Cheli, Y., Luciani, F., Khaled, M., Beuret, L., Bille, K., Gounon, P., Ortonne, J.-
oil, Bot. Stud., 54, 10 (2013).
P., Bertolotto, C., and Ballotti, C. R.: a-MSH and cyclic AMP elevating agents
36. Panich, U., Kongtaphan, K., Onkoksoong, T., Jaemsak, K.,
control melanosome pH through a protein kinase A-independent mechanism,
Phadungrakwittaya, R., Thaworn, A., Akarasereenont, P., and
J. Biol. Chem., 284, 18699e18706 (2009).
Wongkajornsilp, A.: Modulation of antioxidant defense by Alpinia galanga and
13. Ayala, F., Palla, M., Di Trolio, R., Mozzillo, N., and Ascierto, P. A.: The role of
Curcuma aromatica extracts correlates with their inhibition of UVA-induced
optical radiations in skin cancer, ISRN Dermatol., 2013, 842359 (2013).
melanogenesis, Cell Biol. Toxicol, 26, 103e116 (2010).
14. Jaszewska, E., Soin, M., Filipek, A., and Naruszewicz, M.: UVA-induced ROS
37. Khunkitti, W., Veerapan, P., and Hahnvajanawong, C.: In vitro bioactivities of
generation inhibition by Oenothera paradoxa defatted seeds extract and sub-
clove bud oil (Eugenia caryophyllata) and its effect on dermal fibroblast, Int. J.
sequent cell death in human dermal fibroblasts, J. Photochem. Photobiol. B,
Pharm. Pharm. Sci., 4(Suppl. 3), 556e560 (2012).
126, 42e46 (2013).
38. Kubo, I., Kinst-Hori, I., Chaudhuri, S. K., Kubo, Y., Sánchez, Y., and Ogura, T.:
15. Svobodová, A., Zdarilová, A., Malisková, J., Mikulková, H., Walterová, D., and
Flavonols from heterothecainuloides: tyrosinase inhibitory activity and struc-
Vostalová, J.: Attenuation of UVA-induced damage to human keratinocytes by
tural criteria, Bioorg. Med. Chem., 8, 1749e1755 (2000).
silymarin, J. Dermatol. Sci., 46, 21e30 (2007).
39. Wu, C. L., Chang, H. T., Hsui, Y. R., Hsu, Y. W., Liu, J. Y., Wang, S. Y., and
16. Amin, K. A. and Abd El-Twab, T. M.: Oxidative markers, nitric oxide and ho-
Chang, S. T.: Antioxidant-enriched leaf water extracts of Cinnamomum osmo-
mocysteine alteration in hypercholesterolimic rats: role of atorvastatine and
phloeum from eleven provenances and their bioactive flavonoid glycosides, Bio.
cinnamon, Int. J. Clin. Exp. Med., 2, 254e265 (2009).
Resour., 8, 571e580 (2013).
17. Marongiu, B., Piras, A., Porcedda, S., Tuveri, E., Sanjust, E., Meli, M., Sollai, F.,
40. Lee, J. Y.: Down-regulation of MITF, TRP-1, TRP-2, and tyrosinase expressions
Zucca, P., and Rescigno, A.: Supercritical CO2 extract of Cinnamomum zeyla-
by compounds isolated from Pruni persicae Flos in murine B16F10 melanoma,
nicum: chemical characterization and antityrosinase activity, J. Agric. Food.
J. Korean Soc. Appl. Biol. Chem., 57, 827e883 (2014).
Chem., 55, 10022e10027 (2007).

Please cite this article in press as: Lee, S.-C., et al., Inhibitory effect of Cinnamomum osmophloeum Kanehira ethanol extracts on melanin synthesis
via repression of tyrosinase expression, J. Biosci. Bioeng., (2016), http://dx.doi.org/10.1016/j.jbiosc.2016.03.002
VOL. xx, 2016 ANTITYROSINASE OF C. OSMOPHLOEUM KANEHIRA 7

41. Brugè, F., Tiano, L., Astolfi, P., Emanuelli, M., and Damiani, E.: Prevention of
UVA-induced oxidative damage in human dermal fibroblasts by new UV filters,
assessed using a novel in vitro experimental system, PLoS One, 9, e83401
(2014).
42. Merwald, H., Klosner, G., Kokesch, C., Der-Petrossian, M., Honigsmann, H.,
and Trautinger, F.: UVA-induced oxidative damage and cytotoxicity depend
on the mode of exposure, J. Photochem. Photobiol. B, 79, 197e207 (2005).
43. Besaratinia, A., Yoo, J. I., Schroeder, C., Bradforth, S. E., Cockburn, M., and
Pfeifer, G. P.: Wavelength dependence of ultraviolet radiation-induced DNA
damage as determined by laser irradiation suggests that cyclobutane
pyrimidine dimers are the principal DNA lesions produced by terrestrial sun-
light, FASEB J., 25, 3079e3091 (2011).
44. Pfeifer, G. P. and Besaratinia, A.: UV wavelength-dependent DNA damage and
human nonmelanoma and melanoma skin cancer, Photochem. Photobiol. Sci.,
11, 90e97 (2012).
45. Tabak, M., Armon, R., and Neeman, I.: Cinnamon extracts’ inhibitory effect on
Helicobacter pylori, J. Ethnopharmacol., 67, 269e277 (1999).
46. Yang, C. H., Li, R. X., and Chuang, L. Y.: Antioxidant activity of various parts of
Cinnamomum cassia extracted with different extraction methods, Molecules,
17, 7294e7304 (2012).

Please cite this article in press as: Lee, S.-C., et al., Inhibitory effect of Cinnamomum osmophloeum Kanehira ethanol extracts on melanin synthesis
via repression of tyrosinase expression, J. Biosci. Bioeng., (2016), http://dx.doi.org/10.1016/j.jbiosc.2016.03.002