Sunteți pe pagina 1din 30

Manual de Estudo Dirigido

Profa Msc Cristiane Alves da Fonseca do Espírito Santo

Aluno:
Curso:
Ano Letivo/Semestre:

3a. edição
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

ORIENTAÇÕES QUANTO ÀS AVALIAÇÕES

1a V.A

A – Atividades (peso: 1,0 -1,5 ponto):


Estudos Dirigidos (exercícios)
Participação em Sala de Aula
B – Trabalho recombinação gênica (1,0)
C- Prova escrita (peso: 7,5 - 8,0 pontos)

2a V.A

A – Atividades (peso: 1 a 1,5 pontos):


Estudos Dirigidos (exercícios)
Participação em Sala de Aula
B – Prova escrita (peso: 7- 6,0 pontos)
C – Fluxograma do dogma central da Biologia Molecular (2,0 a 2,5)

*Os valores das avaliações podem mudar de acordo com a turma e o critério do
professor.

REGIME SEMESTRAL

(Notas de 0,0 A 10,0 - com uma casa decimal sem arredondamento: Ex: 7,7)

Cálculo:

N1x2 + N2x3 = NF (nota final)


5
O discente, além da freqüência (75%), precisa atingir nota final igual ou superior a 6,0
pontos para aprovação.

AVALIAÇÕES
1 ª V.A – Data: 2 ª V.A – Data:
Matéria: Matéria:

2
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

10 (dez) Dicas Para Ser Um Vencedor


1. Escolha seus amigos. Não ande com pessoas que não vão agregar nada à sua vida
futura;
2. Estude. Lembre-se que o século XXI é o século da inteligência. Vencerão somente os
melhores;
3. Procure ouvir as experiências dos mais velhos. Às vezes pode ser chato, mas antes de
descartar bons conselhos, pense neles;
4. Cuide de sua saúde. Pratique esportes. Beba com moderação, Não fume;
5. Encha seu tempo. Não fique desocupado. Faça alguma coisa boa – cursos rápidos,
estágios, integre-se a projetos (são boas opções);
6. Aprenda inglês e espanhol. Lembre-se que inglês será o idioma universal. Mais da
metade da população mundial estará falando inglês nos próximos anos. Espanhol é
importante porque será a Segunda língua mundial;
7. Aprenda informática. Seja amigável com um computador. O mundo está cada dia mais
eletrônico.
8. Divirta-se. Seja uma pessoa alegre. Sorria!!!
9. Seja “polido” e “educado”. Saiba dizer “com licença”, “por favor”, “obrigado”, “desculpe”.
Pessoas educadas têm mais sucesso na vida e no trabalho;
10. Resista à tentação às drogas e maneiras fáceis (e falsas) de ser feliz. Lembre-se que a
felicidade e o sucesso são construídos no dia-a-dia por atitudes e comportamento.
Acredite em você! Lembre-se que você é a pessoa mais importante do mundo! Você
merece o melhor!

Normas de boa conduta para o semestre:

1- Horários das aulas:

a) Matutino: 7:30 -11:00 hs (intervalo de 15 min.)


b) Vespertino: 13:00 -16:00 hs (sem intervalo)

Será feita a chamada no inicio e no fim da aula! Portanto, não se atrase e evite
sair da sala sem necessidade!

É EXPRESSAMENTE Proibido o uso de celular durante as


aulas.Guarde-o na mochila e se possível desligue-o!!!

3
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

1. INTRODUÇÃO: DNA – VEÍCULO DA HEREDITARIEDADE

Histórico:

-1864- Miescher isola DNA pela primeira vez Começou a investigação bioquímica do
DNA.

Três experimentos foram vitais para o estabelecimento do DNA como molécula


responsável por carregar informação genética:

-1928- O princípio transformante de Griffith:

* Descrever o experimento e suas conclusões:

1944- -Avery, McCarthy e Mac Leod Caracterização bioquímica do príncipio


transformante de Griffith

4
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

* Descrever o experimento e suas conclusões:

1952- Hershey e Chase Prova definitiva de que o DNA carrega informações


genéticas

* Descrever o experimento e suas conclusões:

5
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

Organização Gênica em procarioto e eucarioto

Procarioto Eucarioto

Cromossomos:
Espécie humana: 46 cromossomos/23pares homólogos (diplóide) células somáticas.
23 de origem paterna e 23 de origem materna.
Homens: 44 autossomos +2 sexuais (44A + XY)
Mulheres: 44 autossomos +2 sexuais (44A + XX)
Anormalidades:
Síndrome de Turner: cariótipo 44A +X
Síndrome de Klinefelter: cariótipo 44A +XXY
Síndrome de Dowm: cariótipo 45A +XY ou 45A +XX

Os cromossomos contêm os genes que por sua vez são formados por DNA (ácido
desoxirribonucleico).
Estes genes permitem a transmissão das informações genéticas de geração a
geração.
DNA é a molécula da hereditariedade em todos os organismos procarióticos e
eucarióticos.
Nos vírus, o material genético pode ser DNA ou RNA.

6
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

*Atividade complementar para ser entregue na próxima aula (em folha de papel
almaço e manuscrita):

1. A produção (%) de mRNA varia de acordo com as fases do ciclo celular. Esquematize:
a) o dogma central da biologia molecular;
b) A célula eucariótica com suas organelas e o dogma central;
c) O ciclo celular, as principais caracteristicas de cada fase, metabolismo celular e a
ploidia.
d) o Núcleo interfásico explicando o que ocorre nas regiões de heterocromatina e
eucromatina em relação ao metabolismo celular e o dogma central.

Observação: essa poderá ser a questão n.1 da sua 1ª. V.A

INSTRUÇÕES PARA O TRABALHO DE RECOMBINAÇÃO GÊNICA:

- O objetivo do trabalho é substituir um conteúdo da prova.

- Deve ter a seguinte estrutura: introdução do assunto abordado, desenvolvimento com


os três mecanismos de recombinação(recomb. Gênica ou homóloga, recomb. Sítio
específica, recom. de transposição ou transposon), conclusão, referências bibliográficas
(no mínimo 3).

-Rico em figuras (ao menos uma para cada mecanismo), pode ser desenhada ou
fotocopiadas com legendas feitas pelo próprio aluno.

- Trabalho individual e manuscrito.

- Data de entrega: ____________

-Valor:_____________________

7
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

Ácidos nucléicos

DNA: Transportador da informação genética


Hereditariedade
Regulador da expressão celular

Até 1940: era tido como substância celular de importância limitada.


Material genético: Exp. com pneumococcos e bacteriófagos

Década de 40: “regras de Chargaff”

1. Bases do DNA: varia de espécie para outra (fungo:14 milhões/humano:3 bilhões)


2. Espécimes de DNA de diferentes tecidos da mesma espécie possuem mesma
composição de bases.
3. Composição de bases não se altera com: idade, estado nutricional ou alteração
ambiental.
4. Em todos os DNAs: A=T, C=G A+G=C+T

A capacidade de informação do DNA é enorme

10-12 g Cél. Fetal 35.000 proteínas distintas.


Extensão do DNA de uma única cél. 2 metros (2x1014 m ou 2x1011Km)

GENE: Segmento do material genético que determina ou codifica uma proteína


Íntrons x Éxons
1 aminoácido = 3 nucleotídeos

Ács. Nucléicos:

- Ác. Desoxirribonucléico (DNA)


- Ác. Ribonucléico (RNA)

As informações necessárias para proteínas ou RNA são encontradas nas


seqüências nucleotídicas do DNA.

8
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

Replicação DNA RNA Proteínas

ESTRUTURA DOS ÁCIDOS NUCLÉICOS


- Unidades constituintes:

A molécula de DNA é constituída por uma sequência de nucleotídeos:

nucleotídeo

que por sua vez é formado por três diferentes tipos de moléculas:

Um açúcar (pentose), um grupo fosfato - - e uma base nitrogenada.

açúcar que compõe o DNA é a pentose desoxirribose. No RNA a pentose é a


ribose.

9
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

As bases nitrogenadas são derivadas de compostos heterocíclicos que são as


purinas ou pirimidinas.

No DNA existem quatro tipos de bases: Adenina, Timina, Citosina e Guanina.

No RNA também existem quatro bases porém no lugar da Timina existe a


Uracila.

Ligações entre as moléculas:

10
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

*A ligação entre a base nitrogenada e a pentose:

-Esta ligação é feita covalentemente através de uma ligação N-glicosídica com a


hidroxila ligada ao carbono-1’ da pentose.

* A ligação entre o grupo fosfato e a pentose:

Esta ligação é feita através de uma ligação fosfodiéster com a hidroxila ligada ao
carbono-5’ da pentose.

11
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

Ligações entre os nucleotídeos

Os nucleotídeos estão ligados covalentemente por ligações fosfodiéster formando entre


si “pontes” de fosfato.
O grupo hidroxila do carbono-3’ da pentose do primeiro nucleotídeo se liga ao grupo
fosfato ligado ao carbono-5’ da pentose do segundo nucleotídeo através de uma ligação
fosfodiéster.

Devido a esta formação a cadeia de DNA fica com uma direção determinada, isto é, em
uma extremidade temos livre o grupamento fosfato do carbono-5’ da primeira pentose e
na outra temos livre a hidroxila do carbono-3’ da última pentose.

Isto determina que o crescimento do DNA se faça na direção de 5' para 3'.

12
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

Estrutura tridimensional do DNA

*James Watson e Francis Crick postularam um modelo tridimensional para a estrutura do


DNA baseando-se em estudos de difração de raio-X.

O DNA consiste de duas cadeias helicoidais de DNA, enroladas ao longo de um mesmo


eixo, formando uma dupla hélice de sentido rotacional à direita.

-As duas fitas de DNA estão em direção opostas, isto significa que são anti-paralelas. O
termo anti-paralelas deve-se ao fato de que uma das fitas tem a direção exata da sua
síntese (5' 3') enquanto que a outra está invertida (3' 5').

Esta conformação em fitas anti-paralelas levará à necessidade de mecanismos


especiais para a replicação do DNA.
Com base na estrutura de dupla hélice do DNA e nas características de
hidrofobicidade das moléculas, a estrutura do DNA fica da seguinte forma:

13
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

* O grupo fosfato e o açúcar (parte hidrofílica) - estão localizados na parte externa da


molécula.

* As bases nitrogenadas (parte hidrofóbica) - estão localizadas na parte interna da


molécula.

*A relação espacial entre as duas fitas cria um sulco principal e um sulco


secundário.

*O pareamento das bases de cada fita se dá de maneira padronizada, sempre uma purina com
uma pirimidina, especificamente: adenina com timina e citosina com guanina.

*A proximidade destas bases possibilita a formação de ligações de hidrogênio, sendo que


adenina forma duas pontes de hidrogênio com a timina e a citosina forma três pontes com a
guanina.

Os grupamentos responsáveis pela formação das ligações de hidrogênio são o ceto (C=O) e o
amino (-NH2).

14
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

*A dupla hélice é mantida unida por duas forças:

Por ligações de hidrogênio formadas pelas bases complementares,

Por interações hidrofóbicas, que forçam as bases a se "esconderem" dentro da dupla


hélice.

Estrutura tridimensional do DNA:


Estudos recentes mostram que existem três formas de DNA :

com a hélice girando para a direita: A-DNA e B-DNA


Forma que gira para a esquerda : Z-DNA.

O DNA pode adotar várias estruturas secundárias diferentes. Estas estruturas dependem
da seqüência de bases do DNA e das condições sob as quais elas são colocadas.

B-DNA: Tem a dupla hélice mais longa e mais fina. Para completar uma volta na hélice
são necessários 10 pares de bases.

-Em solução, geralmente o DNA assume a conformação B.

A-DNA: Tem a forma mais curta e mais grossa. Para completar uma volta na hélice são
necessários 11 pares de bases.

-Quando há pouca água disponível para interagir com a dupla hélice, o DNA assume a
conformação A-DNA.

Z-DNA: Esta conformação é mais alongada e mais fina do que o B-DNA.

-Para completar uma volta na hélice são necessários 12 pares de bases.

15
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

-O DNA, em solução com altas concentrações de cátions, assume a conformação Z-DNA.

Comparando....

- Metilação do DNA

Em procariotos, adenina metilada é mais comum que citosina metilada. Em eucariotos,


quase todos os resíduos de citosina são metilados.

Quando as citosinas são metiladas, o equilíbrio das três formas de DNA (A-DNA, B-DNA e
Z-DNA) se desloca em favor do Z-DNA, influenciando na função gênica.

*OBSERVAÇÕES IMPORTANTES PARA SEREM RESPONDIDAS:

1- Quais são os grupamentos nas bases responsáveis pela formação das ligações de
hidrogênio?

2- Quais são as forças que agem em conjunto para a estabilização da dupla hélice?

16
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

Classes de RNAs encontradas nas células:

RNA mensageiro (RNAm): transfere a informação genética do DNA aos ribossomos,


sítio da síntese de proteínas. Representa 1 a 5% do RNA total.

RNA transportador (RNAt): carrega os resíduos de aminoácidos até os ribossomos


para a síntese de proteínas (10 a 15%)

RNA ribossomal (RNAr): componentes estruturais dos ribossomos, grandes


complexos que realizam a síntese protéica (75%).

Ribozimas: RNA com atividade catalítica.

RNA (ácido ribonucleico) é o ácido nucleico formado a partir de um modelo de DNA.

DNA não é molde direto da síntese de proteínas. Os moldes para síntese de proteínas
são moléculas de RNA.

17
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

18
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

19
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

“Supercoil" – compactação do DNA


O DNA celular é extremamente compactado com alto grau de organização estrutural.

A supertorção do DNA (estresse topológico) é um processo regulado com precisão. Cada


célula tem enzimas cuja função é desenrolar e/ou relaxar o DNA.

As enzimas que aumentam ou diminuem o grau de subenrolamento do DNA são as


topoisomerases, e a propriedade que elas modificam no DNA é o número de ligação (Lk).

O estado superenrolado é menos estável que o estado relaxado. Para desfazer o "supercoil" é
necessário uma quebra em uma das cadeias de DNA.

Em Procariotos, o superenrolamento é feito por um grupo de enzimas denominadas


"topoisomerases II", enquanto que o relaxamento é feito pela "topoisomerase I".

Ambas topoisomerases catalizam a quebra e a religação de ligações fosfodiéster do DNA.

20
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

PROPRIEDADES FÍSICAS E QUÍMICAS DO DNA:

Soluções de DNA, em pH = 7,0 e temperatura ambiente, são altamente viscosas;

A altas temperaturas ou pH extremos o DNA sofre desnaturação, isto porque ocorre


ruptura das ligações de hidrogênio entre os pares de bases. Esta desnaturação faz com que
diminua a viscosidade da solução de DNA;

Durante a desnaturação nenhuma ligação covalente é desfeita, ficando portanto as duas fitas
de DNA separadas;

Quando o pH e a temperatura voltam ao normal, as duas fitas de DNA espontâneamente se


enrolam formando novamente o DNA dupla fita. Este processo envolve duas etapas:

* A primeira é mais lenta pois envolve o encontro casual das fitas complementares de DNA,
formando um curto segmento de dupla hélice.

* A segunda etapa é mais rápida e envolve a formação das ligações de hidrogênio entre as
bases complementares reconstruindo a conformação tridimensional.

21
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

Mas a final o que é o Tm (Tmelt)?

A compactação do DNA requer uma forma especial de superespiralamento:

-Envolve espiras sobre espiras...

22
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

CROMATINA E ESTRUTURA NUCLEÓIDE

- Cromossomos: corpos densamente corados vistos nos núcleos das células eucariontes em
divisão celular.

- Cromatina: consiste de fibras que contêm proteína (histonas) e DNA em massas


aproximadamente iguais, mais uma pequena quantidade de RNA.

O DNA, na cromatina, está fortemente associado a proteínas chamadas de histonas, que

empacotam e ordenam o DNA em unidades estruturais chamadas de nucleossomos.

23
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

Formação da Fibra de cromatina:

O DNA bacteriano também é altamente organizado:

-Estrutura de Nucleóide;
- Estrutura tipo andaime que organiza o cromossomo circular em uma série de domínios de
alças.
- Proteínas histonas são abundantes especialmente a HU (19KDa).
- Cromossomo bacteriano é extremamente dinâmico – ciclo de divisão de 15 minutos,
portanto não forma estrutura estável como em eucariotos.

24
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

Responda:

O que são plasmídeos e pra que servem?

Eucariontes:

25
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

*Compactação do cromossomo eucariótico:

26
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

LEITURA OBRIGATÓRIA:

Este livro deve ser lido pelo estudante para que possa ser discutido em sala de aula na
forma de um tribunal.
Parte da sala deverá acusar/condenar Watson e Crick e a outra irá defende-los.
Terá mais êxito a equipe que conseguir argumentar melhor, baseado nos fatos que o livro
traz. Pode-se utilizar outras fontes para complementar.
Esta atividade vale nota e todos devem participar. Na ausência do aluno por qualquer
motivo, essa nota é perdida e não tem como ser substituída.

Exercícios de fixação : Ácidos nucléicos

2. Desenhe a estrutura de um nucleotídeo, coloque as ligações existentes na molécula e


explique como eles se juntam para formar um polinucleotídeo.

2- Por que Hershey e Chase escolheram P32 e S35 para usar em seu experimento? Eles
poderiam ter optado por isótopos radioativos de carbono (C) e oxigênio (O)? Por que?

3- Quais as diferenças de composição e estrutura entre RNA e DNA. Como se distingue entre a
uracila e a timina, e entre a ribose e a desoxirribose?

27
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

4-Escreva a sequência de bases da fita complementar do DNA dupla fita que apresenta uma fita
com a sequência:

(5') ATGCCGTATGCATTGCATTC (3')

Exprima, em porcentagem, a composição de bases do DNA de fita dupla.

5-Uma molécula de ácido nucleico tem a seguinte composição de bases: C = 24,1%; G = 18,5%;
T= 24,6% e A = 32,8%. O que se pode afirmar sobre a natureza desta molécula? DNA OU RNA?
Unifilamentar ou bifilamentar?

6- Explique por que os ácidos nucleicos são desnaturados quando submetidos a alta temperatura
o pHs extremos. Como estas moléculas podem ser renaturadas?

7-Defina Temperatura de fusão (Tm) e efeito hipercrômico.

Use a figura abaixo para responder ás questões 8 e 9.

8) A, B e C representam conformações em diferentes temperaturas. Qual delas representa a temperatura


mais alta? Justifique.

9) Que parte, D ou E, tem o maior conteúdo de guanina e citosina? Justifique.

10) Se uma proteína tem 350 aminoácidos, o mRNA que codifica a produção de tal proteína deverá ter pelo
menos quantos nucleotídeos?

11) Uma enzima presente no fígado de rato possui uma cadeia polipeptídica de 192 resíduos de
aminoácidos. Ela é codificada por um gene contendo 1.440 pares de bases. Explique a relação entre o
número de resíduos de aminoácidos nesta enzima e o número de pares de nucleotídeos no seu gene.

12) Nas amostras de DNA isoladas de duas espécies não identificadas de bactéria a adenina perfez 32% e
17% do total das bases, respectivamente. Quais proporções relativas de adenina, guanina, timina e
citosina você esperaria encontrar nas duas amostras de DNA? Uma dessas bactérias foi isolada de uma
fonte quente (64 C). Qual DNA veio desta bactéria termofílica? Qual foi a base para sua resposta?

13) Usar a figura para responder ás questões abaixo:

28
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

Em A representa um: ________________e em B um: ___________________________


Que letra representa o DNA? ____________________
Classe de histonas H1: ___________
Octâmero de histonas:_______________

14) O ADN é um polímero constituído por vários nucleotídeos e as proteínas são polímeros
constituídos por vários aminoácidos. Um gene é constituído por um número N de nucleotídeos
que codifica uma proteína constituída por P aminoácidos. Por que sempre encontramos N >
P?

15) Como o DNA bacteriano é organizado/compactado? As histonas estão presentes?

16- Quais as classes de RNAs encontrados nas células e quais as suas funções?

17- Se uma proteína possui 100 aminoácidos, quantos códons, que especificam esses
aminoácidos, devem estar presentes no seu mRNA?

18- Observe o esquema dos diferentes níveis de organização do material genético.

a) nomes que correspondem às indicações I e VI:

I-

II-

III-

IV-

V-

VI-

b) o número que corresponde ao nível mais básico de organização da cromatina: ______________

29
Manual de Estudo Dirigido em Biologia Molecular- Prof ª Cristiane Alves da Fonseca do Espírito Santo.

c) o nome das sequências que são transcritas a partir de II e que não codificam peptídeos:________
________________________
d) a partir de III necessita do grupo de enzimas do tipo: ___________________________________

e) Principal característica das bases nitrogenadas_______________________________________

f) histonas que formam os nucleossomos:_____________________________________________

g) histona que organiza os nucleossomos na fibra 30nm:___________________________________

h) Grupamentos responsáveis pelo pareamento das hélices em I: _____________________________


i) O DNA tem caráter:________________________________________________________________
j) Para o pareamento das hélices as fitas devem ser:_______________________________________

19- Uma célula pode controlar as proteínas controlando quando e como um determinado _____ é
transcrito, controlando como o transcrito de _______ é submetido a splicing ou é processado,
selecionando quais _______ completos ou maduros são exportados do núcleo para o citoplasma
e determinando onde no citoplasma eles ficam localizados, selecionando quais mRNAs no
citoplasma são traduzidos pelos _________, desestabilizando seletivamente certas moléculas de
mRNA no ________, ou ativando, inativando , degradando ou compartimentalizando
seletivamente moléculas de ___________ após sua produção.

Assinale a alternativa que completa corretamente o texto. (0,5)

a) gene - RNA - mRNA - citoplasma - proteínas específicas - ribossomos.


b) RNA - mRNA - ribossomos - gene - citoplasma - proteínas específicas.
c) gene - RNA - mRNA - ribossomos - citoplasma - proteínas específicas.
d) mRNA - gene- RNA – ribossomos - citoplasma - proteínas específicas.
e) gene - RNA - ribossomos - citoplasma - proteínas específicas - mRNA.

20- Esquematize a estrutura do nucleossomo. Qual a característica bioquímica principal


das histonas e qual o seu papel na organização da cromatina?

Observações:

Essa atividade deve ser entregue na semana seguinte após término do conteúdo
deste assunto! Não serão aceitas atividades atrasadas! Caso irá faltar a aula,
envie por um colega ou entregue com antecedência!

30