Name: :

Page # Possible points Actual

points
3 6
4 8
5 8
6 7
7 9
8 6
9 9
10 5
11 10
12 6
13 11
14 10
15 5

Total:

BIOLOGY 221

FINAL EXAM FOR 2015A

1
Name: :

Penn ID #:______________________________

Directions:

• There are 19 pages to this exam. This includes the genetic code on page 17 of the exam and 2 extra
blank sheets. Make sure your exam is complete. If you choose, you may remove pages 16-19 while
working on the corresponding exam problems.

• You will have 2 hours to complete this exam.

• Do not write on the back of the exams. Answers written on the back of pages will not be graded!

• All answers must be provided in the space allotted following each question.
You may use the genetic code page and the blank pages as scrap paper, however these pages will
not be reviewed during grading.

•Please be short and concise with your answers.

Full credit will be awarded for correct answers that are not otherwise diluted with
extraneous or erroneous information.

• Write your answers in PEN. Exams completed in pencil will not be considered for regrade.

By signing my name below, I pledge my honor that I have upheld the Code of Academic Integrity of
the University of Pennsylvania in completing this examination.

Signature

2
Name: :

For all multiple choice questions choose all correct answers (2pt each)

1. You examine DNA replication in an E. coli mutant, which has a partially defective DNA polymerase.
In vitro experiments using the mutant DNA polymerase gives an error rate of 10-3, as compared to the
expected error rate of 10-6. Which of the following activities is the mutant polymerase likely to be
missing, as compared to the normal polymerase? Circle all that apply. (2 pts)

a) 5’to 3’ polymerase
b) 5’to 3’ exonuclease
c) 3’to 5’ exonuclease
d) 3’to 5’ polymerase

2. Consider the following origin of replication that is found on a chromosome. The sequence of region 1
is shown below.

a) Within Region 1, which strand will be the template for leading strand synthesis, the top or the bottom?
(1 pts)

The bottom strand

b) Given the above, if we assume that a lagging strand fragment is also made from the DNA duplex of
region 1, what will be its sequence? (1 pts)

5’ TGTCAGTCAG 3’

3. You design a summer class where you re-create experiments studying the lac operon in E coli. In your
experiments, the activity of the enzyme beta-galactosidase (beta-gal) is measured by including X-gal and
IPTG in the growth media. X-gal is a lactose analog that turns blue when metabolized by beta-gal, but it
does not induce the lac operon. IPTG is an inducer of the lac operon but is not metabolized by beta-gal.

a) Which of the following would you expect to bind the beta-gal enzyme? Circle all that apply. (1 pts)
Lactose (or allolactose)
X-gal
IPTG

b) Which of the following would you expect to bind the lac repressor? Circle all that apply. (1 pts)
Lactose (or allolactose)
X-gal
IPTG

3
Name: :

4. Meselson and Stahl performed an experiment to show that DNA replication was semi-conservative. In
density gradient centrifugation, which of the following DNA molecules will travel furthest down the tube.
(2 pts)
a) A 14N-15N duplex
b) A 15N-15N duplex
c) A 14N-14N duplex

5. Which of the following are true regarding most dominantly inherited diseases in humans. (2 pts)
a) Most confer a competitive advantage over wild-type in the heterozygous state.
b) They are the result of loss of function mutations in haploinsufficient loci.
c) Most are the result of neomorphic mutations.
d) They are co-dominant with the wild-type allele.
e) None of the above.

6. Unlike other aneuploidies in humans, X and Y aneuploids are often tolerated because (2 pts):
a) The Y chromosome contains genes largely involved in spermatogenesis and is therefore
dispensable with respect to viability.
b) Extra copies of the X chromosome are balanced by increased gene expression from the
autosomes.
c) In any cell in an otherwise wild-type human, only one X- chromosome is left active.
d) There is still some gene expression from the Berkeley bodies.
e) None of the above.

7. When Morgan set out to show that genes reside on chromosomes, he found (2 pts):
a) In the progeny of test crosses with F1 females (w/+), only males had white eyes.
b) The gene for eye color in flies resides on the Y chromosome.
c) Rare cases of non-disjunction were associated with white eyes in females
d) X-inactivation changes the eye color intensity in females.
e) XXY males were recovered at a low frequency in the F3 population of flies.

4
Name: :

8. Geneticists are homing in on a gene responsible for the scent of a rose! The drive to produce blooms
that last long in a vase has left many of the world's 18, 000 varieties with little or no scent. This study
could put fragrance back into roses and be a huge commercial success.

The rose scent gene (RST) was found by comparing two varieties of rose: one, called Fragrant Cloud,
which produces big, red, highly scented flowers and another, Golden Gate, which has smaller, almost
odorless yellow blooms. To put the gene for scent from Fragrant Cloud into Golden Gate, you have
obtained a large genomic fragment of the RST gene from Fragrant Cloud in a cosmid vector. This
genomic fragment contains the gene responsible for the rose fragrance, but is too large to put directly into
a Ti plasmid. In order to subclone this gene into the T-DNA region of a modified Ti plasmid, you have
identified four unique restriction sites outside of the RST gene, and a Ti plasmid with the indicated
unique sites in the multiple cloning region:

BclI EcoRV SacI SalI

Rose scent gene

EcoRV
XhoI BamHI
Right&border& Le-&border&

Ti plasmid

The recognition and cleavage sites for these enzymes are (only the top strand is shown; ' indicates the
cleavage position): BclI= 5’ T 'GATCA 3’ ; EcoRV= 5’ GAT 'ATC 3’; SacI= 5’ GAGCT 'C 3’; SalI=5’
G'TCGAC 3’; BamHI= 5’ G'GATCC 3’ ; XhoI=5’ C'TCGAG 3’..

a) If you cut the RST gene with Bcl I, the overhang left by the restriction fragment digestion is identical
with the overhang of one of the enzymes in the multiple cloning site of the plasmid. What is the overhang
and what is the enzyme (4 pt)?

The protruding end left by Bcl I cleavage, 'GATC (note: ' indicates the cleavage position), is
identical to that left by Bam HI cleavage of the plasmid.

b) If you cut the RST gene with Sal I, the overhang left by the restriction fragment digestion is identical
with the overhang of one of the enzymes in the multiple cloning site of the plasmid. What is the overhang
and what is the enzyme (4 pt)?

The protruding end left by Sal I cleavage, 'TCGA, is identical to that produced by cutting the
plasmid with Xho I

5
Name: :

8. The rose scent gene (RST) was found by comparing two varieties of rose: one, called Fragrant Cloud,
which produces big, red, highly scented flowers and another, Golden Gate, which has smaller, almost
odorless yellow blooms. To put the gene for scent from Fragrant Cloud into Golden Gate you have
obtained a large genomic fragment of the RST gene from Fragrant Cloud in a cosmid vector. This
genomic fragment contains the gene responsible for the rose fragrance, but is too large to put directly into
a Ti plasmid. In order to subclone this gene into the T-DNA region of a modified Ti plasmid, you have
identified four unique restriction sites outside of the RST gene, and a Ti plasmid with the indicated
unique sites in the multiple cloning region:

BclI EcoRV SacI SalI

Rose scent gene

EcoRV
XhoI BamHI
Right&border& Le-&border&

Ti plasmid

The recognition and cleavage sites for these enzymes are (only the top strand is shown; ' indicates the
cleavage position): BclI= 5’ T 'GATCA 3’ ; EcoRV= 5’ GAT 'ATC 3’; SacI= 5’ GAGCT 'C 3’; SalI=5’
G'TCGAC 3’; BamHI= 5’ G'GATCC 3’ ; XhoI=5’ C'TCGAG 3’.

c) You subclone the RST gene using the enzymes you noted in parts a) and b) Draw a map of the
resulting plasmid containing the RST gene. Note on the map all restriction sites (4pt)?

The subcloning strategy for the RST gene is to cut the cosmid DNA with Bcl I (left end) and Sal I
(right end), use gel electrophoresis to purify the Bcl I-Sal I fragment containing the RST gene on
the basis of its size, cut the vector DNA with Bam HI and Xho I, and then use standard cohesive
end ligation techniques to insert the RST gene fragment into the vector between the Bam HI and
Xho I sites.

RST gene map: Bcl I-EcoRV— RST GENE — SacI-SalI

Plasmid vector MCS: plamid….XhoI-EcoRV-BamHI….plasmid

Final map is (circular): plasmid…[BamHI/BclI]-EcoRV—RST GENE—SacI-

[SalI/XhoI]…plasmid

d) Does your subclone of the RST gene in the plasmid vector contain EcoRV sites? If so, how many and
where are they (3pt)?

The final RST-gene-containing circular DNA molecule will contain one Eco RV site. This site is
within the RST gene on the side near the destroyed BamHI/BclI site.

6
Name: :

e) Besides the left and right border sequences shown in the Ti plasmid what other elements would be required
for amplification of this plasmid in bacteria and then selection of plants that contain the T-DNA insert (2pt)?

A resitance marker that is expressed in Agrobacterium (e.g. Kanamycin)

A resistance marker that is expressed in the plants (e.g. herbicide resistance) or a screenable marker,
like GFP.

f) You transform your Golden Gate plants with the RST Ti plasmid, which will integrate randomly into the
rose genome. You self fertilize all of the transformants and find that all of the progeny have rose scent.
Surprisingly however, some now also lack thorns (a trait entirely unrelated to flower fragrance) When you
cross true breeding rose scented, thornless plants to wild-type Golden Gate plants you get rose scented plants
with thorns. What does this tell you about the inheritance pattern of each trait (3pt).

That the rose scent is dominantly inherited; whereas the lack of thorns is recessively inherited.

g) What caused the loss of thorns, how (4 pt)?

Since the T-DNA randomly inserts, it can disrupt the function of the gene into which it inserts. In this
case the T-DNA may have inserted into a gene that promotes the formation of thorns. Another
possibility is that thornlessness is a spontaneous mutation that arose during tissue culture.

7
Name: :

9. For the following terms below (a-c; d-f) fill in the blank using the numbered statements directly below
the terms. For each group choose all statements that are correct.
(6pt)

a) Hypermethylation ______________1_____________

b) Position effect variegation __________3____________

c) Hypoactivation ___________2____________

1. Is triggered during dosage compensation in mammals.

2. Is triggered during dosage compensation in C. elegans.
3. Is a consequence of stochastic heterochromatin formation.
4. Is triggered during dosage compensation in Drosophila.
5. Increases gene expression.

d) HATs __________4,6_____________

e) HDACs _________1,5___________

f) HMTs __________2,5_____________

1. Removes acetyl groups from lysine in the tails of histones in nucleosomes.

2. Adds methyl groups to lysines in tails of histones in nucleosomes.
3. Add methyl groups to DNA.
4. Adds acetyl groups onto lysine in tails of histones in nucleosomes.
5. Generally “closes” chromatin, reducing transcription.
6. Generally“opens” chromatin for greater transcription.

8
Name: :

10. Osteopontin is a secreted protein that facilitates the attachment of osteoclasts to the extracellular
matrix during bone development. The presence of free phosphate during bone production triggers the
production of osteopontin mRNA. Using the techniques of genetic engineering, a researcher has
constructed a fusion gene containing the genomic elements (promoter +enhancers) from the Osteopontin
gene from mice and the coding region of green fluorescent protein (GFP) gene from jellyfish. This fusion
gene has been inserted into the chromosomes of living mice via microinjection into the pronuclei of
fertilized mouse oocytes

a) Under what conditions will the green fluorescent protein be synthesized in these genetically
transformed mice, and in what tissues? Explain your answer in 1-2 sentences (3 pt)

In tissues where the osteopontin gene is normally expressed during bone development

b) Would you expect mice expressing the Osteopontin:GFP fusion to have increased bone production as
compared to the untransformed mice? Explain (2pt)

No because it is expressing GFP and not osteopontin.

c) Suppose that the segment of the Osteopontin gene that was used to make the Osteopontin:GFP fusion
above had mutations in the phosphate response elements. When would the GFP encoded by the fusion
gene be synthesized in the genetically transformed mice? Explain in 1-2 sentences (2 pt)

It would not be expressed, assuming that the mutation lead to a loss of phosphate response
element function.

d) If you had such a mouse with mutations in the phosphate response element of the Osteopontin:GFP
fusion gene, how could you know if the mouse you had was transformed, that is that the mouse had the
Osteopontin:GFP fusion gene inserted into its chromosomes (2 pt)?

You could use PCR to detect the GFP gene, which is not endogenous to the mouse.

9
Name: :

11. Given below is a region of DNA where a 21bp transposable element has been inserted, and left a 5bp
target site duplication.

5’ TCGGCCAATTAATAGCGATTCATTTAATGGCCACG 3’
3’ AGCCGGTTAATTATCGCTAAGTAAATTACCGGTGC 5’

a) Label the 5bp target site duplications and the transposable element by drawing boxes around them.
What characteristic feature does the transposable element contain? (3pt)

5’ TCGGCCAATTAATAGCGATTCATTTAATGGCCACG 3’
3’ AGCCGGTTAATTATCGCTAAGTAAATTACCGGTGC 5’

Target site duplication labeled in red

The transposable element has 5bp inverted terminal repeats

b) What is the sequence of the top strand of the original target site BEFORE insertion of the transposable
element? ’ indicates the site of cleavage (2pt).

a) 5’ GGCCAAT’TA 3’
b) 5’ TC’GGCCACG 3’
c) 5’ GGCCA’GGCC 3’
d) 5’ AGCCGGT’GC 3’
e) 5’ CG’TGGCCAT 3’

10
Name: :

12. On page 16 of this exam, is a pedigree showing the inheritance of Friedreich ataxia (FRDA), which is
caused by a rare mutation in the FRDA gene. Disease symptoms include ataxia, dysarthria, sensory
loss, muscle weakness, scoliosis, foot deformity and cardiac symptoms.

The gel below the pedigree shows the presence of a moderately polymorphic simple sequence length
(SSLP) marker that is linked to the FRDA gene. Lane numbers in the gel correspond to individual
numbers in the pedigree.

a) Assuming complete penetrance, what is the most likely mode of inheritance (2pt)?

Autosomal recessive

b) Which one of the five SSLP variants (A-E) is most highly associated with the disease causing FRDA
allele (2pt)?

c) Which individuals must have seen recombination between the disease causing FRDA allele and the
highly associated SSLP variant. List their ID numbers below (2pt):

a) 14, 22, and 23

b) 3, 14 and 18
c) 20, 22 and 29
d) 1, 5 and 7
e) none of the above

d) Suppose that you are told that the SSLP marker is 15.0 cM from FRDA, what is the probability that
individual II-6 is a carrier of the disease causing allele? Explain (2pt).

85% I-1 had the disease allele associated with SSLP C. There is 85% chance that this did not
recombine with SSLP B. Based upon the pedigree (and outsider rules) I-2 is wild-type so no
possibility of II-6 inheriting a disease allele from the mother.

e) If Individuals IV-27 and IV-24 were to have a child, what is the probability that this child would have
the disease? Although these individuals are 2nd cousins, you may assume that inbreeding effects are
negligible (2pt).
a) 100%
b) 75%
c) 66%
d) 50%
e) 25%

11
Name: :

13. Forward genetic screens for mutations that affect vein formation during wing development in
Drosophila melanogaster yield mutations in several different genes. Flies homozygous for recessive
mutations in Top1 (top1; panel G), Rho (rhove; panel C) or Vn1 (vn1; panel B) all show a partial loss of
vein structures. Recessive mutations in Ash2 (panel D) however, result in loss of wing margins. Double
mutants between Rho and Vn1 (panel E; rhove/rhove; vn1/vn1) completely lack wing veins. Triple mutants
between Rho, Vn1 and Ash2 (panel F; F rhove/rhove; vn1/vn1; ash2/ash2) have a partial loss of vein
structures and defects in the wing margin. Double mutants between Top1 and Ash2 (panel H; top1/top1;
ash2/ash2) look wildtype.

B!

A wt

C! D!

ash2/ash2

E rhove/rhove; vn1/vn1 F rhove/rhove; vn1/vn1; ash2/ash2

G top1/top1 H top1/top1; ash2/ash2

!

a) Based upon the above results, are the Rho, Vn1 and Top1 genes positive or negative regulators of vein
development (2pt)?

Positive

b) Using what you know about epistasis, how do you explain the phenotype of the flies in panel E (4pt)?

This is a non-additive phenotype, suggesting synthetic interactions. Rho and Vn have both
essential and redundant functions in the formation of veins. They must act redundantly in the
formation of the veins in the upper portion of the wing. When both genes are lost, these veins are
lost and their redundancy is revealed.

12
Name: :

c) Is it more likely that the Rho and Vn1 genes act in the same pathway or different pathways? Why (3pt)?

In different pathways that may converge; If they acted in the same pathway then we would expect
epistasis – the double mutant phenotype to look like one of the single mutant phenotypes.

d) Based upon the flies in panels F and H, what role does Ash2 play in vein formation (2pt)?

It is an inhibitor

e) Is the ash2 mutation acting as an enhancer or suppressor of the rhove, vn1 and top1 mutations? Is top
acting as an enhancer or suppressor of ash2 (3pt)?

Suppressor

f) Assuming that the Top1, Rho and Vn1 loci are all happlosufficient, what vein phenotype would you
expect in the F1 if flies in panel E were crossed to flies in panel G? Why (3pt)?

Wild-type. They would complement.

13
Name: :

14. Indicate (in no more than two sentences each) the essential (i.e. most important) difference between
the two terms or techniques in the following sets (2pt each):

a) penetrance versus expressivity:

Penetrance is the fraction of individuals with a phenotype, who are all of the same genotype. It is
the extent to which a particular gene or set of genes is expressed in the phenotypes of individuals
carrying it, measured by the proportion of carriers showing the characteristic phenotype.
Expressivity is the variation in the strength of phenotype among individuals who all have the
same genotype.

b) synthetic lethality versus recessive lethality:

Synthetic lethality is revealed in a double mutant (two genes); each single mutant alone is viable
but the double is dead. Recessive lethality occurs when the heterozygous recessive individuals
are alive (may be altered) and the homozygous recessive individuals are dead.

c) genetically modified versus genetically engineered

Genetically modified refers to any (usually human) intervention that causes a change in the
genome of the organism. Genetically engineered refers to the inclusion of recombinant DNA into
an organism.

d) shotgun cloning vs hierarchical shotgun cloning

Shotgun cloning means breaking genome into random fragments and cloning for sequencing,
whereas hierarchical shotgun means doing the same but with localized smaller pieces of the
genome due to the presence of repetitive elements that would prevent non-anchored hierarchical
cloning from being successful.

e) genetic map vs physical map

A genetic map is a map generated by meiotic recombination and is in map units or centi-
morgans whereas a physical map is a DNA map of restriction sites or DNA markers.

14
Name: :

15. The rugose (ru) gene affects cone cells formation in Drosophila ommatidia (eye cells) You suspect
that the rugose gene is on the small telocentric 4th chromosome in Drosophila (shown below; numbers
indicate cM).

a) If you were to do traditional mapping of rugose using the markers on this chromosome, which two
markers would you be least likely to choose? Why (2pt)?

Sparkling eyes and eyeless, as they will make assessing whether the progeny are normal or
mutant for rugose difficult or impossible.

b) Suppose that you decide to use ci (Cubitus interruptus) and sa (Speckled abdomen, which is located at
the tip of the long arm of the 4th chromosome at 6.0 cM) as two of your markers for mapping of rugose.
You mate your heterozygous females to the tester males and get the following results:

ci sa + 237
ci sa ru 233
+ + ru 236
+++ 234
+ sa ru 14
+ sa + 16
ci + + 15
ci + ru 15

What can you conclude based upon the above results? (3pt)
a) Rugose is 3.75 cM from Speckled abdomen
b) Rugose is 7.5 cM from Speckled abdomen
c) Rugose is 3.75 cM from Cubitus interruptus
d) Rugose is 7.5 cM from Cubitus interruptus
e) Rugose is not linked to either Speckled abdomen or Cubitus interruptus .

15
Name: :

FRDA pedigree

I 1 2

II 3 4 5 9

III 0
10 11 12 13 14 15 16 17 18

IV 19 20 21 22 23 24 25 26 27

V 28 29 30 31

16
Name: :

17
Name: :

18
Name: :

19