BIOL 221 Exam-2

Name: Suggested Answers

Penn ID: (8 digits)

BIOL 221
Exam-2
10/30/13
Instructions:
 This is a closed-book exam. We will observe the Code of Academic Integrity. Please
sign the pledge below.
 Answer all questions.
 If appropriate, show your work, but highlight your final result or conclusion
 Write all answers concisely and legibly in the space provided. If we can’t read your
answers, we can’t award you any credit for them.
 Write your answers in PEN. Exams completed in pencil cannot be considered for
regrading.
 Just a reminder. Dilution of a correct answer with erroneous text always leads to less
than full credit.
 Time: You have until 8:00 PM to complete this exam.

I pledge my honor that I have upheld the Code of Academic Integrity of the University of
Pennsylvania in completing this examination.

*** Apologies for the mistake in question 8 of the answer key originally posted. It should have
read that 3 amino acids were changed, not 3 bases. This has now been corrected.

Signature

page points
2
3
4
5
6
7
8
9
10
11
Total:

-1- S:
BIOL 221 Exam-2

1. You are studying a plant that develops beautiful orange flowers. In the course of your work,
you isolate two recessive null mutations that affect flower pigmentation. The mutations are
-/-
in two different genes, which you name crimson and canary. Plants with the crimson
-/-
single-mutant genotype have red flowers, while plants with the canary singe-mutant
genotype have yellow flowers.

In the spaces provided below, consider two possibilities:

a. The two genes exist in independent pathways.
b. The two genes operate in a single pathway in which crimson is epistatic to canary.

-/- -/-
For each possibility, state the phenotype you would expect from a crimson ; canary
double mutant plant, and draw a simple hypothetical pathway(s) for pigment biosynthesis
that includes these two genes.

a. The two genes exist in independent pathways. (6 points)

-/- -/-
1) Expected phenotype of a crimson ; canary double-mutant

White or colorless flowers (see Pathway One) or orange (red and yellow mixed) flowers
(see Pathway Two) were both acceptable answers.

2) Hypothetical pathway(s)

Either of the following pathways were acceptable.

Pathway One:
canary
precursor red pigment

crimson
precursor yellow pigment

(together red pigment and yellow pigment give the orange color)

Pathway Two:
canary
yellow pigment orange pigment

crimson
red pigment orange pigment

-2- S:
BIOL 221 Exam-2

b. The two genes exist in a single pathway in which crimson is epistatic to canary.
-/- -/-
1) Expected phenotype of a crimson ; canary double-mutant (6 points)

red flowers

2) Hypothetical pathway(s)

crimson canary
red pigment yellow pigment orange pigment

Point Breakdown: 3 points for a correct answer for each part. If the answer to 2a was
yellow, credit was given for a pathway consistent with the yellow phenotype being the
visible phenotype in the double mutant.

2. After much work over the summer, you now have three pure-breeding Drosophila stocks that
exhibit strange flight patterns. Normal Drosophila (wild-type) fly at moderate speeds using
rather straight flight paths.

 fastball (fbl) mutants fly at incredible speeds (for flies anyway).

 curveball (cur) mutants incorporate periodic vertical dips into their flight paths.
 knuckleball (knk) mutants exhibit flight paths that are quite slow and very
unpredictable.

All mutant phenotypes are recessive to the wild-type. All phenotypes are easily
distinguishable, even the double and triple mutants.

You recently completed an experiment designed to determine the linkage relationships, if

any, among these three genes. Homozygous females that exhibited the fbl and knk
phenotypes were crossed with pure-breeding males that exhibited the cur phenotype (cross-
1) to yield F1 flies with the following phenotypes:

 F1 females all had wild-type flight patterns.

 F1 males all had fbl and knk phenotypes.

You then crossed F1 females and males and produced an F2 generation with the following
phenotypes and numbers. Recall that there is NO recombination in Drosophila males.

Number of
phenotype males females
fbl + knk 242 310
+ cur + 238 0
fbl cur + 157 0
+ + knk 163 190

-3- S:
BIOL 221 Exam-2

fbl cur knk 59 0

+ + + 61 295
fbl + + 38 205
+ cur knk 42 0
Total 1000 1000

a. Give the genotypes of the flies crossed in cross-1. (2 points)

male: + cur +/ Y

female: fbl + knk / fbl + knk

Point Breakdown:
Males must be hemizygous (i.e. X chromosome over Y) to get credit. Points deducted for
erroneous notation (i.e. splitting gene names with semi colons when genes are on the
same chromosome).

b. Give the genotypes of the progeny from cross-1 (F1 generation). (2 points)

male: fbl + knk / Y

female: fbl + knk / + cur +

Point Breakdown:
Males must be hemizygous (i.e. X chromosome over Y) to get credit. Points deducted for
erroneous notation (i.e. splitting gene names with semi colons when genes are on the
same chromosome).

c. Draw a genetic map showing the order of the genes and the distances between them.
(8 points)

fbl knk cur

40 cM 20 cM

You will never see the curveball phenotype in the female progeny of the F1 cross
because they all will have inherited the dominant + allele on the X chromosome from
their fathers. This prevents us from determining whether or not female flies carry a cur
allele on the X chromosome inherited from their mothers. Therefore, we should not use
the data from female flies to determine the linkage relationship of these genes.

Male flies, in contrast, all will have inherited the Y chromosome from their father and
therefore will express the phenotype of all recessive alleles they carry on the X
chromosome inherited from their mothers. Therefore, we can use the phenotype of

-4- S:
BIOL 221 Exam-2

male flies to deduce what X chromosome alleles these flies inherited from their
mothers.

The double recombinant chromosomes (least frequent combination of phenotypes among

males) are fbl + + and + cur knk. This information, combined with the information we
have about the genotype of the parents, tells us that knk is in the middle of fbl and cur.

To calculate the distance between fbl and knk:

(157 + 163 + 42 + 38) / 1000 = 0.40 = 40 map units

To calculate the distance between knk and cur:

(59 + 61 + 42 + 38) / 1000 = 0.40 = 20 map units

Point Breakdown:
4 points for having genes in correct order
4 points for accurate map distance

-5- S:
BIOL 221 Exam-2

3. Shown below is a diagram of the nucleic acid strands in a replication fork. (9 points)
a. Carefully label ALL of the 5’- and 3’-ends indicated by circles. One 5’-end is specified
in the figure below.
b. Carefully label the newly synthesized leading strand.
c. Carefully label the newly synthesized lagging strand.
d. Carefully label one Okazaki fragment.
e. Indicate the location of one RNA primer.
f. Indicate the location of DNA polymerase III.
g. Indicate the location of DNA polymerase I.

3
’

3 3 5

5’

-6- S:
BIOL 221 Exam-2

Point Breakdown: One point for each molecule labeled. Half a point for each 5’ / 3’ end.

There was a little latitude in labeling with Pol I and primers because these were a little
ambiguous without color. (However, labeling finished Okazaki fragments as primers, or labeling
primers as Okazaki fragments, or switching Pol I and Pol III are still incorrect answers.)

4. Consider one round of replication in a cell that has no telomerase activity. Imagine this cell
has a chromosome with flush ends (no 5’ or 3’ overhangs), and that these ends are stable and
not detrimental to the cell. Draw both strands of the parent chromosome and both strands of
-7- S:
BIOL 221 Exam-2

the daughter chromosomes following one round of DNA replication and clearly label the
nature and position of any differences in length. Label the 5’ and 3’ ends of all DNA strands.
(12 points)

Getting this right hinges on understanding the end replication problem. Explanation:
DNA synthesis A) runs 5’ to 3’ and B) has to start from some kind of nucleotide primer.
Most of the time, DNA is synthesized off of an RNA primer. When RNA primers are
removed, the gap is filled by a specialized polymerase that starts DNA synthesis off of the
DNA fragment that now precedes the space where the primer was. Essentially, in this case,
the preceding DNA fragment is acting as a primer.

At the extreme 3’ end of a parent DNA strand, however, the RNA primer cannot be replaced
by DNA because there is no new DNA fragment that precedes primer. This causes the
newly synthesized strand to be slightly shorter resulting in a 3’ overhang. At the 5’ end of
the parent strand, this problem does not exist because DNA synthesis is running in the
opposite direction.

Point breakdown: 4 points for showing a 3’ overhang, 4 points for having the other side of
the daughter chromosome flush, and 4 points for showing that opposite ends of each daughter
chromosome are shortened. Points deducted for any erroneous information.

5’ 3’
3’ 5’

5’ 3’
3’ 5’

3’ 5’
5’ 3’

-8- S:
BIOL 221 Exam-2

5. Use the line below to arrange the eukaryotic gene elements (listed below) in the order they
would appear in the genome and in the direction traveled by RNA polymerase along the
DNA (left to right). Assume that the gene’s single intron interrupts the encoded open reading
frame. Note that some of the names are abbreviated and thus do not distinguish between
elements found in DNA and those that function as an RNA element. For example, “splice
donor site” is shorthand for “DNA sequences transcribed into the splice donor site.” The
promoter has been placed on the map for you. Simply arrange the letters (A-K) in the
appropriate order on the line below. (10 points)

a. 3’-UTR
b. 5’-UTR
c. poly(A) addition site
d. promoter
e. splice acceptor site
f. splice branch site
g. splice donor site
h. start codon (AUG)
i. stop codon (UAG)
j. TATA box
k. transcription start site

promoter

d/j kbh gfe iac

Point breakdown:
-1 for incorrect placement of d, j, b, or a.
-1 for any other obvious misplacements (i.e. polyA tail at the beginning of transcript)
-2 for switching g and e.
-3 for any other arrangement of g, f, and e.
-2 for having k and h out of order.
-2 for having i and c out of order.

-9- S:
BIOL 221 Exam-2

6. During the 1970s Jeffrey Miller at UCLA used elegant genetic techniques to produce more
than 4000 different missense mutations in the lacI coding region. Thus, he made an average
of 11 amino acid substitutions for each amino acid position in this 360 amino acid protein! A
small subset of these mutant proteins (we’ll call them lacIX proteins) had three interesting
biochemical properties.

 They did not bind the operator sequence in the absence of the IPTG inducer.
 They did bind the operator sequence in the presence of the IPTG inducer.
 The lacIX protein activity was dominant to the normal lacI protein activity.

You’ve decided to test these biochemical results genetically by analyzing partial diploids.
Using the Table below, provide the expected -galactosidase (lacZ) and permease (lacY)
expression results for the genotypes listed if lacIX has all three properties listed above.

expression: 0 = little or no expression

+ = significant expression

Read the genotypes carefully. The wild-type control is done for you. As usual for these
assays, the cells are grown in the absence of glucose and lactose (using glycerol as the carbon
source) so they contain significant amounts of cAMP. All lac operons contain wild-type
promoters (p+) and wild-type operators (o+).
(12 points)

lacZ lacY
Genotype no inducer inducer no inducer inducer
I+ p+ o+ Z+ Y+ 0 + 0 +
IX p+ o+ Z+ Y- + 0 0 0
IX p+ o+ Z- Y-/ I+ p+ o+ Z+ Y+ + 0 + 0
I+ p+ o+ Z- Y-/ IX p+ o+ Z+ Y+ + 0 + 0

Point Breakdown: 1 pt for each cell.

-10- S:
BIOL 221 Exam-2

7. How many reading frames can extend through the following sequence without a stop codon?
How many reading frames cannot extend through the sequence due to a stop codon? (Assume
start codons are upstream.) Provide a brief rationale for your answer. (9 points)

5'…CTTACAGTTTATTGATACGGAGAAGG…3'
3'…GAATGTCAAATAACTATGCCTCTTCC…5'

a. Number of reading frames that extend through the sequence: 3

b. Number of reading frames that do not extend through the sequence: 3

c. Provide a brief rationale for (a and b).

The 5’ to 3’ direction of both the top and bottom strands can be a coding strand for an
RNA transcript. (You can look at this the opposite way too: the 3’ to 5’ direction of both
the top and bottom strands could be the template strand for an RNA transcript.)

Either way you look at it, there are 3 reading frames per strand = 6 reading frames total.

Scan each reading frame for stop codons.

Stop codons in RNA 5’ to 3’ are: UAA, UAG, UGA

If you are searching DNA 5’ to 3’ (“coding”) look for: TAA, TAG, TGA
Or, if you are searching DNA 3’ to 5’ (“template”) look for : ATT, ATC, ACT

Of the 6 reading frames, 3 reading frames will not encounter stop codons and 3 reading
frames will. The position of the stop codons is highlighted.

Point Breakdown: 3 points for getting the total number of reading frames correct.
3 points for the correct logic for finding stops.
3 points for actually getting the number right.

Answers that were only considering one strand, but otherwise got the problem correct got
6 points. Answers that got the right numbers but applied the wrong (or unclear) logic got
6 points.

Answers where students applied the appropriate logic to successfully find stops but had
some bizarre total number of reading frames (between 1 and 6) got 3 points. Answers that
were looking for start codons (the problem states to assume start codons are upstream of
the sequence given) correctly got 3 points. Answers that were looking for start codons
incorrectly got 0 points. Answers where students had more than 6 total reading frames
got 0 points.
-11- S:
BIOL 221 Exam-2

-12- S:
BIOL 221 Exam-2

8. Some of the best early evidence to support a non-overlapping genetic code came from work
Sydney Brenner and Francis Crick did with the rII FCO single-base insertion mutation and
additional mutations in the rII gene that did or did not suppress the FCO phenotype.

Consider a fictional scenario in which the opposite hypothesis, an overlapping genetic code,
was true.
(12 points)

a. What effect would the FCO mutation have had on the rII primary structure in this
scenario?

Two amino acids would be changed, and one would be added in the area where the insertion
occurred. There would be no frameshift.

Full credit for saying three amino acids would be changed. Partial credit for indicating that
the change would be local (i.e. not a frameshift) but either being incorrect or vague about the
precise nature of the change.

b. What about one of the single-base deletions identified by Brenner and Crick as a
suppressor of FCO?

Two amino acids would be changed, and one would be deleted in the area where the insertion
occurred. There would be no frameshift.

Full credit for saying three amino acids would be changed. Full credit for small
errors/vagueness in part a that were repeated in part b. Partial credit for larger, more
fundamental errors in part a that were repeated in part b.

c. Why would it have been unlikely for this additional single-base deletion to act as a
suppressor of the FCO phenotype if the genetic code was overlapping?

The deletion would not suppress the FCO phenotype because if the genetic code was
overlapping, the FCO mutation would not cause a frameshift that could be corrected by a
deletion. Rather, the deletion would be expected to introduce additional erroneous amino
acids into the protein.

-13- S:
BIOL 221 Exam-2

Full credit for answers that are clear, coherent and logical, and make it obvious that students
understand what an overlapping code is, what a suppressor is, and why the mutation was a
suppressor in the real-life experiment. Partial credit for answers that were on the right track
but were unclear or used terminology incorrectly. No credit for “because the deletion will not
cause a frameshift” because this does not make it clear that you understand what a suppressor
is and does not answer the question.

-14- S:
BIOL 221 Exam-2

9. a. Write the DNA sequence of the portion of the tRNATrp gene that codes for the anticodon.
Show both DNA strands and label the 5’ and 3’ ends. (4 points)

5’ TGG 3’
3’ ACC 5’

Partial credit for correct sequence but incorrect 5’ and 3’ ends.

Partial credit for only showing one strand.

b. Write the RNA sequence of the anticodon segment of tRNATrp. Label the 5’ and 3’ ends.
(4 points)

3’ ACC 5’

Partial credit for correct sequence but incorrect 5’ and 3’ ends.

c. You isolate a set of tRNATrp mutants in which any C residue in the tRNATrp anticodon
might be converted to a T. How would polypeptide synthesis be affected by these mutations?
(4 points)

The anticodon will recognize stop codons in a transcript. This will cause the mutated
tRNA compete with release factors for binding to the stop codon. When the mutated
tRNA binds the stop codon, instead of terminating, Trp will be incorporated to the amino
acid, allowing translation to continue and resulting in longer proteins.

-15- S:
BIOL 221 Exam-2

-16- S: