Sunteți pe pagina 1din 2

SERIE DE EJERCICIOS # 1. Entrega por equipo para 21/02/18.

Introducción a la Genómica. Gpo 05.


FACULTAD DE QUÍMICA, UNAM

1. El análisis químico del DNA extraído por primera vez de un virus desconocido indica la siguiente
composición: 40% A, 20% T, 15% G, 25% C. ¿Qué implicaciones tiene este resultado con relación a la
estructura del DNA vírico?

2. Haga una tabla con los distintos tipos de genomas de virus que se conocen e incluya un ejemplo
de virus para cada tipo de genoma.

3. ¿Cuál es la secuencia de aminoácidos codificada por la secuencia


5´- AUGAUUUACACUUGUCACCGAGAUAAGAACUGU-3´?

4. A partir del siguiente polipéptido escriba la secuencia del RNAm del cual se tradujo.
Arg- his-lys-leu-val-asp-trp

5. En clase se comentó que la tasa de mutación del genoma mitocondrial es 10 veces mayor que la del
nuclear en humanos; ¿por qué es mayor? y ¿qué es la tasa de mutación?

6-7. En clase revisamos como a partir de un segmento de DNA pueden generarse varios productos
funcionales. Para ilustrar ésto, visite NCBI:
https://www.ncbi.nlm.nih.gov/gene/1756

Revise el apartado de las secuencias de referencia (Reference Sequences*) y vea cómo a través del uso de
promotores alternativos y del splicing alternativo resultan numerosas variantes de transcritos e isoformas
de proteínas distintas para el gen de la distrofina, el gen más grande en nuestro genoma.
(*RefSeq: Archivo de secuencia de nt o aa “curado”, completo, integrado, no redundante con
anotaciones).
Conteste:
a) Localización cromosómica
b) Brevemente, describa la función del producto proteico para el que codifica.
c) Tamaño del gen y la proteína.
d) A partir de un solo segmento de DNA, ¿Cuántas isoformas tiene, dónde se expresan y por qué
mecanismos se producen?
Dp427, Dp260, Dp140, Dp116, y Dp71

8-10. La siguiente secuencia corresponde a un gen hipotético de un organismo cuyo genoma es de DNA doble
cadena.
• Las direcciones de las secuencias son 5’-3’.
• Conteste las siguientes preguntas:
• ¿Cuántos exones e intrones posee este gen?
• Sobre la secuencia de DNA, encierre en un círculo los sitios donadores y aceptores de splicing.
• Sobre la secuencia del RNA, señale el ORF y con un color diferente marque las secuencias que
corresponden a 5’UTR, 3’UTR.
DNA genómico
.......gaaagtggcggtaggcgggagggagaggaacgcgggccctgagccgcccgCGCGCGCGCCTCCCTACGGGCGCCTCCG
GCAGCCCTTCCCGCGTGCGCAGGGCTCAGAGCCGTTCCGAGATCTTGGAGGTCCGGGTGGGAGTGGGGGTGGGGTGGGGGTGGGG
GTGAAGGTGGGGGGCGGGCGCGCTCAGGGAAGGCGGGTGCGCGCCTGCGGGGCGGAGATGGGCAGGGGGCGGTGCGTGGGTCCCA
GTCTGCAGTTAAGGGGGCAGGAGTGGCGCTGCTCACCTCTGGTGCCAAAGGGCGGCGCAGCGGCTGCCGAGCTCGGCCCTGGAGG
CGGCGAGAACATGGTGCGCAGGTTCTTGGTGACCCTCCGGATTCGGCGCGCGTGCGGCCCGCCGCGAGTGAGGGTTTTCGTGGTT
CACATCCCGCGGCTCACGGGGGAGTGGGCAGCGCCAGGGGCGCCCGCCGCTGTGGCCCTCGTGCTGATGCTACTGAGGAGCCAGC
GTCTAGGGCAGCAGCCGCTTCCTAGAAGACCAGGTAGGAAAGGCCCTCGAAAAGTCCGCTGACCATTCTGTTCTCTCTGGCAGGT
CATGATGATGGGCAGCGCCCGAGTGGCGGAGCTGCTGCTGCTCCACGGCGCGGAGCCCAACTGCGCCGACCCCGCCACTCTCACC
CGACCCGTGCACGACGCTGCCCGGGAGGGCTTCCTGGACACGCTGGTGGTGCTGCACCGGGCCGGGGCGCGGCTGGACGTGCGCG
ATGCCTGGGGCCGTCTGCCCGTGGACCTGGCTGAGGAGCTGGGCCATCGCGATGTCGCACGGTACCTGCGCGCGGCTGCGGGGGG
CACCAGAGGCAGTAACCATGCCCGCATAGATGCCGCGGAAGGTCCCTCAGatttattgtcaacatttattgagcacctattacaa
caatttcatcgcatg..........

RNA complementario

CGCGCGCGCCUCCCUACGGGCGCCUCCGGCAGCCCUUCCCGCGUGCGCAGGGCUCAGAGCCGUUCCGAGAUCUUGGAGGUCCGGG
UGGGAGUGGGGGUGGGGUGGGGGUGGGGGUGAAGGUGGGGGGCGGGCGCGCUCAGGGAAGGCGGGUGCGCGCCUGCGGGGCGGAG
AUGGGCAGGGGGCGGUGCGUGGGUCCCAGUCUGCAGUUAAGGGGGCAGGAGUGGCGCUGCUCACCUCUGGUGCCAAAGGGCGGCG
CAGCGGCUGCCGAGCUCGGCCCUGGAGGCGGCGAGAACAUGGUGCGCAGGUUCUUGGUGACCCUCCGGAUUCGGCGCGCGUGCGG
CCCGCCGCGAGUGAGGGUUUUCGUGGUUCACAUCCCGCGGCUCACGGGGGAGUGGGCAGCGCCAGGGGCGCCCGCCGCUGUGGCC
CUCGUGCUGAUGCUACUGAGGAGCCAGCGUCUAGGGCAGCAGCCGCUUCCUAGAAGACCAGGUCAUGAUGAUGGGCAGCGCCCGA
GUGGCGGAGCUGCUGCUGCUCCACGGCGCGGAGCCCAACUGCGCCGACCCCGCCACUCUCACCCGACCCGUGCACGACGCUGCCC
GGGAGGGCUUCCUGGACACGCUGGUGGUGCUGCACCGGGCCGGGGCGCGGCUGGACGUGCGCGAUGCCUGGGGCCGUCUGCCCGU
GGACCUGGCUGAGGAGCUGGGCCAUCGCGAUGUCGCACGGUACCUGCGCGCGGCUGCGGGGGGCACCAGAGGCAGUAACCAUGCC
CGCAUAGAUGCCGCGGAAGGUCCCUCAG

PROTEÍNA

MVRRFLVTLRIRRACGPPRVRVFVVHIPRLTGEWAAPGAPAAVALVLMLLRSQRLGQQPLPRRPGHDDGQRPSGGAAAAPRRGAQ
LRRPRHSHPTRARRCPGGLPGHAGGAAPGRGAAGRARCLGPSARGPG

11-12.- Investigue, cuántos genes conforman la familia de los genes HOX en el humano, chimpancé y
en la mosca de la fruta?

13. Diga el tamaño, número de genes y año en que fue secuenciado el genoma de:
E. coli
D. melanogaster
C. elegans
A. mexicanum

14. Anexo artículo de pseudogenes. Después de leerlo, explique en sus propias palabras, dos ejemplos
de pseudogenes en el humano

Recuerde verificar la ortografía, la redacción e incluir la bibliografía completa que haya consultado.