Journal of Ethnopharmacology 146 (2013) 205–213

Contents lists available at SciVerse ScienceDirect

Journal of Ethnopharmacology
journal homepage: www.elsevier.com/locate/jep

In vitro and in vivo anti-inflammatory effect of Rhodomyrtus tomentosa

methanol extract
Deok Jeong a,1, Woo Seok Yang a,1, Yanyan Yang a,1, Gyeongsug Nam a, Ji Hye Kim a, Deok Hyo Yoon b,
Hyung Jun Noh c, Sukchan Lee a, Tae Woong Kim b, Gi-Ho Sung c,nn, Jae Youl Cho a,n
a
Department of Genetic Engineering, Sungkyunkwan University, Suwon 440-746, Republic of Korea
b
Department of Biochemistry, Kangwon National University, Chuncheon 200-701, Republic of Korea
c
Department of Herbal Crop Research, National Institutes of Horticultural and Herbal Science, Rural Development Administration, Eumseong 369-873, Republic of Korea

a r t i c l e i n f o abstract

Article history: Ethnopharmacological relevance: Rhodomyrtus tomentosa (Aiton) Hassk. is a representative Thai medic-
Received 30 August 2012 inal plant traditionally used in South Asian countries to relieve various inflammatory symptoms.
Received in revised form However, no systematic studies on its anti-inflammatory activity and mechanisms have been reported.
19 December 2012
Materials and methods: The effect of the methanol extract from the leaves of this plant (Rt-ME) on the
Accepted 25 December 2012
Available online 4 January 2013
production of inflammatory mediators [nitric oxide (NO) and prostaglandin E2 (PGE2)] and the
molecular mechanism of Rt-ME-mediated inhibition, including target enzymes, were studied with
Keywords: RAW264.7, peritoneal macrophage, and HEK293 cells. Additionally, the in vivo anti-inflammatory
Rhodomyrtus tomentosa (Aiton) Hassk. activity of this extract was evaluated with mouse gastritis and colitis models.
Myrtaceae
Results: Rt-ME clearly inhibited the production of NO and PGE2 in lipopolysaccharide (LPS)-activated
Anti-inflammatory effect
RAW264.7 cells and peritoneal macrophages in a dose-dependent manner. According to RT-PCR,
Inflammatory mediator
NF-kB immunoblotting and immunoprecipitation analyses and a kinase assay with mRNA, whole cell extract,
AP-1 and nucleus lysates from RAW264.7 cells and mice, it was revealed that Rt-ME was capable of
suppressing the activation of both nuclear factor (NF)-kB and activator protein (AP)-1 pathways by
directly targeting Syk/Src and IRAK1/IRAK4.
Conclusion: Rt-ME could have anti-inflammatory properties by suppressing Syk/Src/NF-kB and IRAK1/
IRAK4/AP-1 pathways and will be further developed as a herbal remedy for preventive and/or curative
purposes in various inflammatory diseases.
& 2013 Elsevier Ireland Ltd. All rights reserved.

1. Introduction inflammatory cells, such as macrophages, dendritic cells and

Although the inflammatory barrier is one of the most critical
defensive routes in protecting our bodies from exogenous patho-
gens (Toltl et al., 2008), exaggerated responses of innate
Abbreviations: PG, prostaglandin; NO, nitric oxide; COX, cyclooxygenase; iNOS,
inducible NO synthase; (TNF)-a, tumour necrosis factor; ERK, extracellular
signal-related kinase; TLR, Toll-like receptors (TLR); MAPK, mitogen activated
protein kinase; NF-kB, nuclear factor-kB; AP-1, activator protein-1, JNK, c-Jun
N-terminal kinase; EIA, enzyme immunoassay; ELISA, enzyme-linked immuno-
sorbent assay; MTT, (3-4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium
bromide, a tetrazole; PI3K, phosphoinositide 3-kinases; LPS, lipopolysaccharide;
RT-PCR, reverse transcriptase-polymerase chain reaction; DSS, dextran sulphate
sodium; PMA, phorbol 12-myristate 13-acetate; MyD88, myeloid differentiation
primary response gene (88); IkBa, inhibitor of kappa B alpha; Ikk, IkB kinase; Syk,
spleen tyrosine kinase; CREB, cAMP response element-binding; CMC, sodium
carboxymethylcellulose; PEI, polyethylenimine.
n
Corresponding author. Tel.: þ82 31 290 7868; fax: þ82 31 290 7870.
nn
Corresponding author. Tel.: þ 82 31 290 0366; fax: þ 82 43 871 5702.
E-mail addresses: sung97330@gmail.com (G.-H. Sung), jaecho@skku.edu,
jaecho67@gmail.com (J.Y. Cho).
1
These authors equally contributed to this work.
neutrophils, can cause serious damage in the host body, leading
to numerous diseases such as cancer, atherosclerosis, arthritis,
diabetes and septic shock (McGeer and McGeer, 2008). Thus
far, one of the strategies for preventing or curing such diseases
is to negatively modulate excessively activated inflammatory
responses (Massarotti, 2008). To do this, intracellular signalling
enzymes, such as protein tyrosine kinases (Src and Syk), mitogen
activated protein kinases [extracellular signal-regulated kinase
(ERK), p38, c-Jun N-terminal kinase (JNK)] and their connected
inflammatory transcription factors, such as nuclear factor (NF)-kB
and activator protein (AP)-1, have been regarded as target
molecules for anti-inflammatory drug development. In an effort
to develop safer and more effective drugs to prevent and/or
treat these diseases, ethnopharmacological remedies have been
explored as anti-inflammatory herbal medicine candidates
(Lukhoba et al., 2006).
Rhodomyrtus tomentosa (Aiton) Hassk. is a Thai ethnomedicinal
plant belonging to the family Myrtaceae. This plant has tradition-
ally been prescribed for inflammatory and infectious conditions
such as colitis, diarrhoea, dysentery, abscesses and haemorrhage

0378-8741/$ - see front matter & 2013 Elsevier Ireland Ltd. All rights reserved.
http://dx.doi.org/10.1016/j.jep.2012.12.034
206 D. Jeong et al. / Journal of Ethnopharmacology 146 (2013) 205–213
in Vietnam, Bangladesh and Thailand (Panthong et al., 1986,
1991). Based on ethnopharmacological use of this plant, it is
presently sold as a herbal supplementary product with vitamins
(called Rhodomyrtus Tomentosa Vitamin) in America. Recent
additional pharmacological investigations with this plant have
suggested that the extracts of this plant can be used for
anti-bacterial purposes and anti-hepatitis actions (Limsuwan
et al., 2011). Furthermore, this plant has been developed in
various formulations for skin-relevant products, such as skin-
whitening, anti-aging, anti-acne and skin-beautifying products
(Saising and Voravuthikunchai, 2012). So far, several types of
compounds, such as rhodomyrtone, anthocyanins, flavellagic acid
derivative and hexacyclic phloroglucinol derivatives (tomento-
sones A and B), have been isolated from the leaves of this plant
(Hiranrat et al., 2012a; 2012b; Liu et al., 2012). In spite of
numerous phytochemical studies, there has been no systematic
approach to understanding the immuno-pharmacological activity
of this plant or its components.
Therefore, in this study, we elucidated the anti-inflammatory
activity of Rhodomyrtus tomentosa methanol extract (Rt-ME) using
lipopolysaccharide (LPS)-activated macrophages and acute in vivo
inflammatory models, such as gastritis and colitis. Moreover, to
understand the ethnopharmacological mechanism of this plant,
Rhodomyrtus tomentosa leaves were chosen to explore the exact
molecular target of its anti-inflammatory action.
2. Materials and methods
2.1. Materials
The 95% methanol extract (Code no.: FBM018-083) of the
leaves of Rhodomyrtus tomentosa (Rt-ME) was purchased from
the Plant Extract Bank in the Plant Diversity Research Centre
(http://extract.pdrc.re.kr/extract/f.htm, Daejeon, Korea). Quercetin,
(3-4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide,
a tetrazole (MTT) and lipopolysaccharide (LPS, Escherichia coli
0111:B4) were purchased from Sigma Chemical Co. (St. Louis, MO,
USA). PP2, piceatannol (Picea), U0126 (U0) and SP600125 (SP)
were obtained from Calbiochem (La Jolla, CA, USA). Luciferase
constructs containing binding promoters for NF-kB and AP-1
were used as reported previously (Yu et al., 2011b). Foetal bovine
serum (FBS) and RPMI1640 were obtained from GIBCO (Grand
Island, NY, USA). RAW264.7 cells, a BALB/c-derived murine
macrophage cell line (ATCC no.: TIB-71), and HEK293 cells, a
human embryonic kidney cell line (ATCC no.: CRL-1573), were
purchased from ATCC (Rockville, MD, USA). All other chemicals
were purchased from Sigma. The phospho-specific or total anti-
bodies to p65, c-Fos, c-Jun, Akt, p85, PDK1, Src, Syk, IkBa, ERK,
JNK, p38, MKK3/6, MKK4/7, MEK1/2, TAK1, IRAK1, IRAK4, lamin
A/C and b-actin were obtained from Cell Signalling (Beverly,
MA, USA).
2.2. Treatment of Rt-ME and HPLC analysis
The stock solution (350 mg/ml) of Rt-ME was prepared with
100% dimethyl sulfoxide (DMSO) and diluted to 0–400 mg/ml
(DMSO content: 0–1.25 mg/ml) with media for in vitro assays
with cell lines or was suspended to make a treatment dose
(200 mg/kg) with 0.5% sodium carboxymethylcellulose (CMC)
for the in vivo experiments.
Phytochemical characteristics of Rt-ME and the standard
compound quercetin were identified by high performance
liquid chromatography (HPLC) analysis (Almela et al., 2006;
Starkenmann et al., 2006). The system was equipped with a
KNAUER (Wellchrom) HPLC-pump K-1001, a Wellchrom fast
scanning spectrophotometer K-2600 and a 4-channel degasser
K-500. Elution solvents were solvent A (0.1% H3PO4 in H2O) and
solvent B (acetonitrile). The gradient step of the solvent was
solvent A to solvent B/min, and a Phenomenex Gemini C18 ODS
(5 mm) column was used.
2.3. Animal experiments
Male C57BL/6 and ICR mice (6–8 weeks old, 17–21 g)
were obtained from DAEHAN BIOLINK (Chungbuk, Korea) and
maintained in plastic cages under conventional conditions. Water
and pellet diets (Samyang, Daejeon, Korea) were supplied ad
libitum. Studies (approval ID: SKKUBBI 12-6) were performed
in accordance with guidelines established by the Institutional
Animal Care and Use Committee at Sungkyunkwan University
(Suwon, Korea).
2.4. Preparation of peritoneal macrophages
Peritoneal exudates were obtained from C57BL/6 male mice by
lavage 4 days after intraperitoneal injection of 1 ml of sterile
4% thioglycollate broth (Difco Laboratories, Detroit, MI). After
washing with RPMI 1640 medium containing 2% FBS, peritoneal
macrophages (1  106 cells/ml) were plated in 100-mm tissue
culture dishes for 4 h at 37 1C in a 5% CO2 humidified atmosphere
using a CO2 incubator (Heraeus BB15, Thermo Fisher Scientific,
Waltham, MA, USA).
2.5. Cell culture
Primary macrophage, RAW 264.7 and HEK293 cells were
cultured in RPMI 1640 medium supplemented with 10% heat-
inactivated FBS, glutamine and antibiotics (penicillin and strep-
tomycin) at 37 1C under 5% CO2. For each experiment, the cells
were detached with a cell scraper. Under our experimental cell
density (2  106 cells/ml), the proportion of dead cells was less
than 1%, according to Trypan blue dye exclusion tests.
2.6. NO and PGE2 production
After pre-incubation of the RAW264.7 cells (1  106 cells/ml)
for 18 h, they were pre-treated with Rt-ME (0–200 mg/ml) for
30 min and were further incubated with LPS (1 mg/ml) for 24 h.
The inhibitory effect of Rt-ME on NO and PGE2 production was
determined by analysing the NO level with Griess reagent and the
PGE2 level with an enzyme immunoassay kit (Amersham, Little
Chalfont, Buckinghamshire, UK), as previously described (Green
et al., 1982; Cho et al., 2000).
2.7. Cell viability test
After pre-incubation of RAW264.7 cells (1  106 cells/ml) for
18 h, the Rt-ME (0–400 mg/ml) was added to the cells and
incubated for 24 h. The cytotoxic effect of the Rt-ME was then
evaluated by a conventional MTT assay, as previously reported
(Gerlier and Thomasset, 1986; Yoe et al., 2011). At 3 h prior to
culture termination, 10 ml of MTT solution (10 mg/ml in phos-
phate buffered saline (PBS), pH 7.4) was added, and the cells were
continuously cultured until termination of the experiment.
The incubation was halted by the addition of 15% sodium dodecyl
sulphate to each well, solubilising the formazan (Im et al., 2012).
The absorbance at 570 nm (OD570–630) was measured using a
Spectramax 250 microplate reader.
 D. Jeong et al. / Journal of Ethnopharmacology 146 (2013) 205–213 207

Table 1
PCR primers used in this study. NO - RAW 264.7 cells
180 NO - Peritoneal macrophages
Name Sequence (5’ to 3’)
PGE2- RAW 264.7 cells
160

NO and PGE2 production

iNOS F CCCTTCCGAAGTTTCTGGCAGCAG
R GGCTGTCAGAGCCTCGTGGCTTTGG 140
COX-2 F CACTACATCCTGACCCACTT

(% of control)
R ATGCTCCTGCTTGAGTATGT
120
GAPDH F CACTCACGGCAAATTCAACGGCA 100
R GACTCCACGACATACTCAGCAC
80 *
60 *
2.8. mRNA analysis by semi-quantitative reverse transcriptase- **
polymerase chain reaction (RT-PCR) 40 **
20 **
To evaluate cytokine mRNA expression levels, RAW264.7 cells
pre-treated with Rt-ME (0–400 mg/ml) for 30 min were incubated 0
with LPS (1 mg/ml) for 6 h. Then, the total RNA from the cells was LPS (1 μg/ml) + + + +
isolated with TRIzol Reagent (Gibco BRL), according to the Rt-ME (μg/ml) - 50 100 200
manufacturer’s instructions. The total RNA was stored at  70 1C
for later use. Semi-quantitative RT reactions were conducted as
previously reported (Shim and Lee, 2012). The primers (Bioneer, RAW264.7 cells
160 Peritoneal macrophages
Seoul, Korea) used are listed in Table 1.

Cell viability (% of control)

140 HEK293 cells

2.9. Luciferase reporter gene assay
HEK293 cells (1  106 cells/ml) were transfected with NF-kB-Luc
or AP-1-Luc (each 1 mg/ml), as well as b-galactosidase (0.25 mg/ml),
using the polyethylenimine (PEI) method in a 12-well plate as
previously reported (Shen et al., 2011). After 24 h, the transfected
cells were treated with Rt-ME in the presence or absence of
PMA (100 nM) or forskolin (2 mM), and 18 h later, the cells were
harvested and lysed to determine luciferase activity. Luciferase
assays were performed using the Luciferase Assay System (Pro-
mega) as reported previously (Song et al., 2012). Luciferase
activity was normalised to b-galactosidase activity.
2.10. Preparation of total lysates and nuclear extracts, and
immunoblotting analysis
Stomach tissue or RAW264.7 cells (5  106 cells/ml) were
washed three times in cold PBS with 1 mM sodium orthovanadate
and lysed using a sonicator (Thermo Fisher Scientific, Waltham,
MA, USA) or a Tissuemizer (Qiagen, Germantown, MD, USA) in
lysis buffer (Yu et al., 2011a) for 30 min with rotation at 4 1C.
The lysates were clarified by centrifugation at 16,000  g for
10 min at 4 1C and stored at  20 1C until needed. Nuclear lysates
were prepared in a three-step procedure as reported previously
(Yu et al., 2010). After treatment, the cells were collected with a
rubber policeman, washed with 1  PBS, and lysed in 500 ml lysis
buffer on ice for 4 min. Cell or tissue lysates were then centri-
fuged at 19,326  g for 1 min in a microcentrifuge. In the second
step, the pellet (the nuclear fraction) was washed once in washing
buffer, which was the same as the lysis buffer but without
Nonidet P-40. In the final step, nuclei were treated with an
extraction buffer (lysis buffer containing 500 mM KCl and 10%
glycerol). The nuclei/extraction buffer mixture was frozen at
80 1C, then thawed on ice and centrifuged at 19,326  g
for 5 min. The supernatant was collected as a nuclear extract.
Soluble lysates or extracts (30 mg/lane) were immunoblotted and
phosphorylated, or total levels of transcription factors (p65, c-Jun
and c-Fos), ERK, p38, JNK, MEK1/2, MKK3/6, MKK4/7, c-Raf, TAK1,
IRAK1, IRAK4, p85/PI3K, IKKa/b, IkBa, PDK1, Syk, Src and b-actin
were visualised according to a previously published method (Park
et al., 2011).
120
100
80
60
40
20
0
0 50 100 200 400
Rt-ME (μg/ml)
Fig. 1. Effect of Rt-ME on the release of inflammatory mediators. (A) The enhanced
levels of PGE2 and NO were analysed by EIA and Griess assay from culture
supernatants of RAW264.7 cells or peritoneal macrophages treated with Rt-ME
and LPS (1 mg/ml) for 24 h. (B) Cell viability of peritoneal macrophages, RAW264.7
cells and HEK293 cells was determined by MTT assay. *Po 0.05 and **Po 0.01
compared to control.
2.11. Syk, Src, IRAK1, and IRAK4 kinase assay
To evaluate the ability of extracts to inhibit Syk, Src, IRAK1 and
IRAK4 enzyme activities using purified enzymes, a kinase profiler
service from Millipore, was used. In a final reaction volume of
25 ml, IRAK1, IRAK4, Src or Syk (human) (1–5 mU) was incubated
with the reaction buffer. The reaction was initiated by the
addition of MgATP. After incubation for 40 min at room tempera-
ture, the reaction was stopped by the addition of 5 ml of 3%
phosphoric acid solution. Ten microliters of the reaction product
was then spotted onto a P30 filtermat and washed three times for
5 min in 75 mM phosphoric acid and once in methanol prior to
drying and scintillation counting.
2.12. EtOH/HCl-induced gastritis
Inflammation of the stomach was induced with EtOH/HCl
according to a published method (Yang. et al., 2012a, 2012b).
Briefly, six fasted ICR mice for each group were orally treated
with Rt-ME (200 mg/kg) or ranitidine (40 mg/kg) twice per day
for 3 days. The in vivo dosage of Rt-ME was selected based
on previous in vivo tests in which 50–300 mg/kg doses were
administered to mice (Abu-Ghefreh et al., 2009). Thirty minutes
208 D. Jeong et al. / Journal of Ethnopharmacology 146 (2013) 205–213

HEK 293 cells

NF-κB-mediated luciferase
activity (Fold Increase)
RAW 264.7 Cell

6h *
LPS (1 μg/ml) - + + + + +
Rt-ME (μg/ml) - - 50 100 200 400
COX-2 ** **
iNOS
PMA (100 nM)
GAPDH Rt-ME (μg/ml)

HEK 293 cells

AP-1-mediated luciferase

15 min 30 min 60 min

activity (Fold Increase)

LPS (1 μg/ml) - + + + + + +
Rt-ME (200 μg/ml) - - + - + - +

p65
**
Lamin A/C

**
c-Jun
c-Fos
PMA (100 nM)
Rt-ME (μg/ml) Lamin A/C

Fig. 2. Effect of Rt-ME on the transcriptional activation of pro-inflammatory genes. (A) The mRNA levels of iNOS and COX-2 were determined by semiquantitative PCR. (B
and C) The promoter binding activity of transcriptional factors was analysed by a reporter gene assay with HEK293 cells transfected with plasmid constructs NF-kB-Luc or
AP-1-Luc (each 1 mg/ml) and b-gal (as a transfection control) in the presence of Rt-ME and stimulus [PMA (100 nM) or forskolin (2 mM)]. Luciferase activity was measured
by luminometer. (D) Levels of p65/NF-kB and AP-1 (c-Jun and c-Fos) in nuclear fractions were determined by immunoblotting analysis with antibodies against the total
protein. *P o 0.05 and **Po 0.01 compared to control.

5 min 10 min 30 min 60 min

LPS (1 μg/ml) - + + + + + + + +
Rt-ME (200 μg/ml) - - + - + - + - +
2 min 3 min
p-IκBα LPS (1 μg/ml) - + + + +
p-IKKα/β Rt-ME (200 μg/ml) - - + - +

IKKβ p-Syk
p-AKT Syk
AKT
p-Src
p-PDK1
PDK Src
p-p85
β-Actin
p85
β-actin

120 120
kinase activity (% of control)

NO and PGE2 production

100 100
(% of control)

80 80

60 60

40 40 **
**
20 20
**
**
** **
0 0
Rt-ME (μg/ml) 0 200 0 200 Picea (40 μM) - + - - + -
Src Syk PP2 (40 μM) - - + - - +
NO PGE2

Fig. 3. Effect of Rt-ME on the activation of upstream signalling enzymes for NF-kB translocation. (A and B) Phospho-protein or total protein levels of IkBa, Akt, PDK1, p85/
PI3K, Src, Syk and b-actin from cell lysates were determined by phospho-specific or total protein antibodies. (C) Kinase activities of Syk and Src were determined by a direct
kinase assay using purified enzymes. The control was set as 100%, with each enzyme (Src or Syk) activity only obtained with vehicle treatment. (D) The culture
supernatants prepared from LPS-treated RAW264.7 cells pre-treated with standard Src and Syk inhibitors (PP2 and piceatannol) were assayed for NO and PGE2. **Po 0.01
compared to control.
 D. Jeong et al. / Journal of Ethnopharmacology 146 (2013) 205–213 209

5 min 10 min 30 min 60 min 5 min 10 min 30 min 60 min

LPS (1 μg/ml) - + + + + + + + + LPS (1 μg/ml) - + + + + + + + +
Rt-ME (200 μg/ml) - - + - + - + - + Rt-ME (200 μg/ml) - - + - + - + - +

p-ERK p-MEK 1/2

ERK p-c-Raf
p-MKK 3/6
p-p38
MKK 3
p38
p-MKK 4/7
p-JNK
MKK 4/7
JNK2
β−actin

120
2 min 3 min 5 min 15 min 100
LPS (1 μg/ml) - + + + + + + + +

kinase activity
(% of control)
Rt-ME (200μg/ml) - - + - + - + - + 80
p-TAK1
60
**
TAK1 **
40
IRAK1
IRAK4 20
β-Actin 0
Rt-ME (μg/ml) 0 200 0 200
IRAK1 IRAK4

140
NO and PGE2 production

120
(% of control)

100
80
60 **
**
40
20
0
U0 (10 μM) - + - - + -
SP (10 μM) - - + - - +
NO PGE2

Fig. 4. Effect of Rt-ME on the activation of upstream signalling enzymes for AP-1 translocation. (A–C) Phospho-protein or total protein levels of p38, ERK, JNK, MEK1/2,
MKK3/6, MKK4/7, TAK1, IRAK1, IRAK4 and b-actin from cell lysates were determined by phospho-specific or total protein antibodies. (D) Kinase activities of IRAK1 and
IRAK4 were determined by a direct kinase assay using purified enzymes. The control was set as 100%, with each enzyme (IRAK1 or IRAK4) activity only obtained with
vehicle treatment. (E) The culture supernatants prepared from LPS-treated RAW264.7 cells pre-treated with standard ERK and JNK inhibitors [U0126 (U0) and SP600125
(SP)] were assayed for NO and PGE2. **P o 0.01 compared to control.

after the final injection, 400 ml of 60% ethanol in 150 mM HCl was
administered orally. Each animal was anaesthetised and sacrificed
with an overdose of urethane 1 h after the administration of the
necrotising agents. The stomach was then excised and gently
rinsed under running tap water. After opening the stomach along
the greater curvature and spreading it out on a board, the
area (mm2) of the mucosal erosive lesions was measured using a
pixel-counter by a technician blinded to the treatment condition.
(gastritis and colitis) mice for in vivo tests. For statistical compar-
isons, these results were analysed using ANOVA/Scheffe’s post
hoc test and Kruskal–Wallis/Mann–Whitney test. A P-value
o0.05 was considered statistically significant. All statistical tests
were carried out using the computer programme SPSS (SPSS Inc.,
Chicago, IL). Similar experimental data were also observed by an
additional independent set of in vitro and in vivo experiments
performed with the same numbers of samples or mice.

2.13. Induction of acute ulcerative colitis

Acute colitis was induced through oral administration of 3%
dextran sulphate sodium (DSS) (w/v) in fresh tap water ad libitum
for 7 days with C57BL/6 mice as reported previously (Han et al.,
2011; Lee et al., 2011). Water consumption was controlled for
all groups, and no major differences were detected. Rt-ME
(200 mg/kg) dissolved in 0.5% Na CMC was orally administered
by gavage twice a day for 7 days. The curative activity of Rt-ME
was determined by measuring the length of the colonic tissues. This
same protocol was carried out twice in independent experiments.
2.14. Statistical analysis
All data presented in this paper are the mean 7SD of an
experiment performed with six (Figs. 1, 2B–D, 3D, 4E, and 6B)
or three (Figs. 3C and 4D) samples for in vitro experiments and 10
3. Results and discussion
Rhodomyrtus tomentosa is widely distributed throughout
Southeast Asia, in places such as Vietnam and Thailand
(Panthong et al., 1986, 1991). Although numerous biological
activities of this plant, such as skin-whitening, anti-bacterial,
anti-aging and anti-hepatic effects, are known, no reports have
explained its anti-inflammatory activities and the associated
mechanism. Conversely, some traditional knowledge and experi-
ences regarding diseases, such as colic, diarrhoea, dysentery,
abscesses and haemorrhage in Vietnam, Bangladesh and Thailand,
have encouraged us to demonstrate the possible biological role of
this plant in inflammatory and immunological diseases. In this
study, therefore, we aimed to understand the anti-inflammatory
activity of the plant and its molecular mechanism.
210 D. Jeong et al. / Journal of Ethnopharmacology 146 (2013) 205–213

140
Gastritis index (Relative unit)

120 HCl/EtOH

100 Normal Vehicle Drug

80 *
60 * Rt-ME
(200 mg/kg)
40

20

0
Ranitidine
Normal Vehicle Rt-ME Ranitidine (50 mg/kg)
(200 mg/kg) (50 mg/kg)

HCl/EtOH

6
Colon length (mm)

0
Normal Vehicle Rt-ME Normal Vehicle Rt-ME
(200 mg/kg) (200 mg/kg)

DSS DSS

HCL/EtOH - + +
Rt-ME (200 mg/kg) - - +

p-JNK

β-Actin

p-IκBα
IκBα
β-Actin

Fig. 5. Effect of Rt-ME on the inflammatory lesions of HCl/EtOH-treated stomachs and DSS-treated colons in mice. (A) Gastritic symptoms of mice treated with HCl/EtOH
under Rt-ME-treated conditions were measured with a pixel-counter (Left panel), and photos of these were taken (Right panel). The gastritis index of the control group
(inducer alone) is represented by 100%. (B) Colitic symptoms of mice treated with 3% DSS solution under oral administration of Rt-ME (200 mg/kg) were evaluated by
measuring the lengths of colon (Left panel). Photographs were taken using a digital camera (Right panel). (C) Phospho-protein or total protein levels of JNK, IkBa and
b-actin from stomach lysates were determined by phospho-specific or total protein antibodies. *Po 0.05 compared to control.

Interestingly, this extract dose-dependently suppressed the
production of NO and PGE2 from RAW264.7 cells and peritoneal
macrophages treated with LPS (1 mg/ml) for 24 h up to 300 mg/ml
(Fig. 1A), without altering the viability of these cells under the
same conditions up to 400 mg/ml (Fig. 1B). Furthermore, the
inhibition of inflammatory mediator production by this extract
was similarly seen at the transcriptional level at which the
upregulated mRNA levels of iNOS and COX-2 in RAW264.7 cells
under treatment of LPS (1 mg/ml) for 6 h were strongly
suppressed by Rt-ME at 200 and 300 lg/ml (Fig. 2A). Promoter
activities of NF-kB and AP-1, but not CREB (data not shown), in
HEK293 cells were also diminished by Rt-ME in a dose-dependent
manner (Fig. 2B and C), implying that the transcriptional activa-
tion of NF-kB and AP-1 under LPS treatment could be targeted
by this extract, although different cells and stimuli were used.
To confirm these inhibitory patterns, the levels of these transcrip-
tion factors in the nucleus were investigated by immunoblotting
analysis, since measuring the nuclear levels of transcription
 D. Jeong et al. / Journal of Ethnopharmacology 146 (2013) 205–213 211

13.5 min
(3.0) Quercetin

Absorbance (370 nm)

13.5 min Rt-ME

(1.5)

13.5 min
(4.5) Quercetin + Rt-ME

Retention Time
(Peak area)

120
NO and PGE2 production

100
(% of control)

80

60

40 **
**
20

0
Quercetin
- + - +
(40 μM)
NO PGE2

Fig. 6. The phytochemical profile of Rt-ME and the inhibitory activity of quercetin on NO and PGE2 production in LPS-treated RAW264.7 cells. (A) Phytochemical
characteristics of Rt-ME and quercetin were analysed by HPLC. (B) The inhibitory effect of quercetin on NO and PGE2 production in LPS-treated RAW264.7 cells was
examined by Griess assay and EIA. **P o 0.01 compared to control.

factors is regarded as one of the best methods for judging its
inhibition (Jung et al., 2012; Yang et al., 2012a, 2012b; Yu et al.,
2012). As was expected, the nuclear level of p65, a major NF-kB
subunit (Magnani et al., 2000), in LPS-treated RAW264.7 cells was
reduced at 15–60 min, while the levels of the translocated c-Jun
and c-Fos were also clearly diminished in the nucleus from 30 to
60 min (Fig. 2D), strongly suggesting that the nuclear transloca-
tion pathway of NF-kB and AP-1 for the transcriptional activation
of inflammatory genes could be targeted by Rt-ME.
One of the valuable issues in the ethnopharmacological
evaluation of traditional plants is to gain an understanding of
the molecular mechanisms. Therefore, we next focused on explor-
ing the molecular inhibitory mechanism of Rt-ME-mediated
ethnopharmacological action using immunoblotting analysis and
direct kinase assay. Because Rt-ME clearly blocked the functional
activation of NF-kB and AP-1, the molecular target of Rt-ME was
elucidated in terms of the activation pathways of these two
factors. The first approach was to identify the target protein of
Rt-ME involved in the NF-kB activation route. To do this, a series
of NF-kB activation signalling pathways composed of IkBa and its
upstream kinases were determined. Intriguingly, Rt-ME strongly
reduced the phospho-forms of IkBa, IKK, Akt, PDK1 and p85/PI3K
in LPS-treated RAW264.7 cells from 5 min to 60 min without
altering the total levels of these proteins (Fig. 3A). Since the
inhibition of IkBa at 5 min strongly indicated a possibility that
early signalling enzymes, such as non-receptor type tyrosine
kinases (Syk and Src), could be targeted according to our previous
papers (Lee et al., 2009), we explored whether Rt-ME could block
the phosphorylation of these proteins. As we expected, Rt-ME
clearly reduced the phospho-forms of Src and Syk, upregulated in
212 D. Jeong et al. / Journal of Ethnopharmacology 146 (2013) 205–213
LPS-treated RAW264.7 cells, at 2 and 3 min (Fig. 3B), suggesting
that this extract can block the activation of these tyrosine kinases,
as is the cases of other extracts prepared from Aralia continentalis,
Archidendron clypearia, Cinnamomum cassia, Polygonum hydropiper
and Phaseolus angularis (Yu et al., 2011b, 2012; Oh et al., 2012;
Yang et al., 2012a, 2012b; Yoon Jeong et al., 2012). Indeed, a direct
kinase assay strongly supported this possibility. Thus,
Rt-ME blocked the kinase activities of purified Src or Syk up to
95% (Fig. 3C). The involvement of these enzymes in the produc-
tion of NO and PGE2 from LPS-treated RAW264.7 cells incubated
for 24 h was also confirmed by treating the inhibitors of Src and
Syk (PP2 and piceatannol). Namely, these compounds also
strongly suppressed the release of NO and PGE2 from RAW264.7
cells in response to LPS (Fig. 3D). In addition, numerous papers
have reported the regulatory roles of these proteins in TLR4
signalling in macrophages and neutrophils (Chaudhary et al.,
2007; Gong et al., 2008). Furthermore, over-expression of these
proteins in HEK293 cells with NF-kB luciferase construct clearly
enhanced luciferase activity as well (data not shown), distinctly
indicating the pivotal role of these enzymes in LPS-induced
inflammatory responses.
Secondly, the target enzymes of Rt-ME in the AP-1 inhibitory
pathway were further explored based on the inhibitory activity of
this extract in AP-1 signalling. As Fig. 4A indicates, Rt-ME blocked
the phosphorylation of ERK and JNK but not p38 in LPS-treated
RAW264.7 cells. Similar to this result, the extract also suppressed
the phosphorylation of the upstream signalling enzymes, MEK1/2,
c-Raf-1 and MKK4/7 (Fig. 4B), responsible for the activation of
ERK and JNK (O’Neill, 2000), and their upstream kinase TAK1
(Fig. 4C) in LPS-exposed RAW264.7 cells. In contrast, there was no
inhibition of IRAK1 or IRAK4 under the same conditions (Fig. 4C),
as assessed by measuring the total levels of these proteins
(Gottipati et al., 2008), indicating that these enzymes could be
directly inhibited by Rt-ME. Indeed, using direct kinase assay, it
was revealed that Rt-ME is capable of blocking the purified
enzyme activity of these proteins by up to 60% (Fig. 4D). In
agreement with these inhibitory patterns, the inhibitors [U0126
(U0) and SP600125 (SP)] of ERK and JNK strongly suppressed the
release of PGE2 but not NO from LPS-treated RAW264.7 cells
(Fig. 4E), implying that the PGE2 inhibitory activity of Rt-ME could
be derived by inhibition of the ERK/JNK/AP-1 pathway. Further-
more, it has been previously reported that ERK and JNK play a
critical role in COX-2 expression under LPS-treated conditions
using RAW264.7 cells and peritoneal macrophages (Raymond
et al., 2011). The functional importance of IRAK1 and IRAK4 was
also proved in TLR4-mediated signalling cascades (Dunne et al.,
2010). Therefore, the inhibition of the AP-1 pathway via suppres-
sion of IRAK1 and IRAK4 could be exerted in Rt-ME-mediated
inhibition of PGE2 production.
Even though this plant has been in use for many years,
whether the extract is able to suppress in vivo inflammatory
symptoms had not been examined. To do this, we employed
two different acute in vivo models, HCl/EtOH-induced gastritis
and DSS-induced colitis. As we expected, this extract strongly
ameliorated both gastritis (Fig. 5A) and colitis (Fig. 5B) symptoms.
Interestingly, the phospho-form levels of JNK and IkBa were also
reduced in stomach with gastritis, implying that JNK/AP-1 and
IkBa/NF-kB seem to be involved in the in vivo anti-inflammatory
action of Rt-ME.
Which components of this extract can participate in multi-
functional inhibition of inflammatory signalling is not yet verified.
To gain a better understanding, we first analysed the peak
patterns of Rt-ME by HPLC analysis using several standard
compounds, including resveratrol, quercetin and curcumin, which
are known as multi-potential anti-inflammatory drugs (Bischoff,
2008; Gautam and Jachak, 2009). Interestingly, a similar peak
LPS
TLR4
Rt-ME Syk Sr
c
c-Raf TAK1
p85/PI3K
MEK 1/2 MKK 4/7
PDK1
AKT ERK JNK
IKK c-fos c- Jun
IκBα NF-κB
AP-1 iNOS
COX-2
NO
PGE
2
Fig. 7. Putative inhibitory pathway of Rt-ME-mediated anti-inflammatory
responses.
with standard quercetin was found in Rt-ME at 13.5 min, and
addition of quercetin in Rt-ME increased the peak area at the
same retention time (Fig. 6A), while the other two compounds
were not detected (data not shown). These results strongly
indicate that quercetin is included in this extract. Indeed, through
measuring the peak area of standard compound, the content of
quercetin in this extract was calculated to be 0.132%. Although
there was no report that quercetin is contained in this plant,
several flavonoid compounds, such as combretol with a quercetin
backbone, were isolated from this plant (Dachriyanus et al., 2004).
The anti-inflammatory and multi-targeted inhibitory activities of
quercetin were also confirmed in our lab. Thus, we also found that
this compound is able to directly block Src, Syk and IKAK-1
according to direct enzyme assay (data not shown), so that it
strongly suppresses the release of NO and PGE2 from LPS-treated
RAW264.7 cells (Fig. 6B). Nonetheless, since rhodomyrtone
(Limsuwan et al., 2009), anthocyanins, flavellagic acid derivatives
and hexacyclic phloroglucinol derivatives (Tung et al., 2009;
Hiranrat et al., 2012a) have been identified from this plant, it is
important for us to prove whether these compounds contribute to
the anti-inflammatory activity of Rt-ME. Therefore, we are cur-
rently attempting to purify these compounds and will test their
anti-inflammatory activity.
In conclusion, we have demonstrated that Rt-ME is able
to negatively modulate the production of NO and PGE2 in
LPS-treated RAW264.7 cells and peritoneal macrophages in a
dose-dependent manner. It was also found that Rt-ME is capable
of blocking the activation of the pathways of both nuclear factor
(NF)-kB and activator protein (AP)-1 by direct suppression of
their upstream enzymes, including Syk/Src and IRAK1/IRAK4, as
summarised in Fig. 7. Therefore, our data strongly suggest that
Rt-ME could have anti-inflammatory properties and will be
further developed as an herbal remedy for preventive or curative
purposes in various inflammatory diseases. Additional systematic
evaluation of Rt-ME on several inflammatory models, such as
collagen type II-induced arthritis and LPS/D-galactosamine-
induced hepatitis, will be performed in the near future.
Acknowledgements
This work was supported by a grant from the Next Generation
BioGreen 21 Programme (PJ008321 and PJ008321), Rural Devel-
opment Administration, Republic of Korea.
 D. Jeong et al. / Journal of Ethnopharmacology 146 (2013) 205–213
References
Abu-Ghefreh, A.A., Canatan, H., Ezeamuzie, C.I., 2009. In vitro and in vivo anti-
inflammatory effects of andrographolide. International Immunopharmacology
9, 313–318.
Almela, L., Sanchez-Munoz, B., Fernandez-Lopez, J.A., Roca, M.J., Rabe, V., 2006.
Liquid chromatograpic-mass spectrometric analysis of phenolics and free
radical scavenging activity of rosemary extract from different raw material.
Journal of Chromatography A 1120, 221–229.
Bischoff, S.C., 2008. Quercetin: potentials in the prevention and therapy of disease.
Current Opinion in Clinical Nutrition and Metabolic Care 11, 733–740.
Chaudhary, A., Fresquez, T.M., Naranjo, M.J., 2007. Tyrosine kinase Syk associates
with toll-like receptor 4 and regulates signalling in human monocytic cells.
Immunology and Cell Biology 85, 249–256.
Cho, J.Y., Baik, K.U., Jung, J.H., Park, M.H., 2000. In vitro anti-inflammatory effects of
cynaropicrin, a sesquiterpene lactone, from Saussurea lappa. European Journal
of Pharmacology 398, 399–407.
Dachriyanus, Fahmi, R., Sargent, M.V., Skelton, B.W., White, A.H., 2004. 5-Hydroxy-
3,3’,4’,5’,7-pentamethoxyflavone (combretol). Acta Crystallographica E60,
86–88.
Dunne, A., Carpenter, S., Brikos, C., Gray, P., Strelow, A., Wesche, H., Morrice, N.,
O’Neill, L.A., 2010. IRAK1 and IRAK4 promote phosphorylation, ubiquitination,
and degradation of MyD88 adaptor-like (Mal). Journal of Biological Chemistry
285, 18276–18282.
Gautam, R., Jachak, S.M., 2009. Recent developments in anti-inflammatory natural
products. Medicinal Research Reviews 29, 767–820.
Gerlier, D., Thomasset, N., 1986. Use of MTT colorimetric assay to measure cell
activation. Journal of Immunological Methods 94, 57–63.
Gong, P., Angelini, D.J., Yang, S., Xia, G., Cross, A.S., Mann, D., Bannerman, D.D.,
Vogel, S.N., Goldblum, S.E., 2008. TLR4 signalling is coupled to SRC family
kinase activation, tyrosine phosphorylation of zonula adherens proteins, and
opening of the paracellular pathway in human lung microvascular endothelia.
Journal of Biological Chemistry 283, 13437–13449.
Gottipati, S., Rao, N.L., Fung-Leung, W.P., 2008. IRAK1: a critical signalling
mediator of innate immunity. Cellular Signalling 20, 269–276.
Green, L.C., Wagner, D.A., Glogowski, J., Skipper, P.L., Wishnok, J.S., Tannenbaum, S.R.,
1982. Analysis of nitrate, nitrite, and [15N] nitrate in biological fluids. Analytical
Biochemistry 126, 131–138.
Han, E.S., Oh, J.Y., Park, H.J., 2011. Cordyceps militaris extract suppresses dextran
sodium sulphate-induced acute colitis in mice and production of inflammatory
mediators from macrophages and mast cells. Journal of Ethnopharmacology 134,
703–710.
Hiranrat, A., Chitbankluoi, W., Mahabusarakam, W., Limsuwan, S., Voravuthi-
kunchai, S.P., 2012a. A new flavellagic acid derivative and phloroglucinol from
Rhodomyrtus tomentosa. Natural Product Research 26, 1904–1909.
Hiranrat, A., Mahabusarakam, W., Carroll, A.R., Duffy, S., Avery, V.M., 2012b.
Tomentosones A and B, hexacyclic phloroglucinol derivatives from the Thai
shrub Rhodomyrtus tomentosa. Journal of Organic Chemistry 77, 680–683.
Im, W., Chung, J.Y., Bhan, J., Lim, J., Lee, S.T., Chu, K., Kim, M., 2012. Sun ginseng
protects endothelial progenitor cells from senescence associated apoptosis.
Journal of Ginseng Research 36, 78–85.
Jung, Y., Byeon, S.E., Yoo, D.S., Lee, Y.G., Yu, T., Yang, Y., Kim, J.H., Kim, E., Jeong, D.,
Rhee, M.H., Choung, E.S., Hong, S., Cho, J.Y., 2012. 8-(Tosylamino)quinoline
inhibits macrophage-mediated inflammation by suppressing NF-kappaB
signalling. Acta Pharmacologica Sinica 33, 1037–1046.
Lee, H., Ahn, Y.T., Park, S.H., Ahn, Y.M., Shim, J.J., Lee, J.H., Lee, J.S., Surh, Y.J.,
Huh, C.S., Kim, D.H., 2011. Evaluation of anti-colitic effect of chung-jang-hwan
(C-mix) in mice. Biomolecules and Therapeutics 19, 52–58.
Lee, Y.G., Chain, B.M., Cho, J.Y., 2009. Distinct role of spleen tyrosine kinase in the
early phosphorylation of inhibitor of kappaB alpha via activation of the
phosphoinositide-3-kinase and Akt pathways. International Journal of Bio-
chemistry and Cell Biology 41, 811–821.
Limsuwan, S., Hesseling-Meinders, A., Voravuthikunchai, S.P., van Dijl, J.M.,
Kayser, O., 2011. Potential antibiotic and anti-infective effects of rhodomyr-
tone from Rhodomyrtus tomentosa (Aiton) Hassk. on Streptococcus pyogenes as
revealed by proteomics. Phytomedicine: International Journal of Phytotherapy
and Phytopharmacology 18, 934–940.
Limsuwan, S., Trip, E.N., Kouwen, T.R., Piersma, S., Hiranrat, A., Mahabusarakam, W.,
Voravuthikunchai, S.P., van Dijl, J.M., Kayser, O., 2009. Rhodomyrtone: a new
candidate as natural antibacterial drug from Rhodomyrtus tomentosa. Phytomedi-
cine 16, 645–651.
Liu, G.L., Guo, H.H., Sun, Y.M., 2012. Optimization of the extraction of anthocyanins
from the fruit skin of Rhodomyrtus tomentosa (Ait.) Hassk and identification of
anthocyanins in the extract using high-performance liquid chromatography-
electrospray ionization-mass spectrometry (HPLC-ESI-MS). International Journal
of Molecular Sciences 13, 6292–6302.
Lukhoba, C.W., Simmonds, M.S.J., Paton, A.J., 2006. Plectranthus: a review of
ethnobotanical uses. Journal of Ethnopharmacology 103, 1–24.
Magnani, M., Crinelli, R., Bianchi, M., Antonelli, A., 2000. The ubiquitin-dependent
proteolytic system and other potential targets for the modulation of nuclear
factor-kB (NF-kB). Current Drug Targets 1, 387–399.
213
Massarotti, E.M., 2008. Clinical and patient-reported outcomes in clinical trials of
abatacept in the treatment of rheumatoid arthritis. Clinical Therapeutics 30,
429–442.
McGeer, P.L., McGeer, E.G., 2008. Glial reactions in Parkinson’s disease. Movement
Disorders 23, 474–483.
O’Neill, L.A., 2000. The interleukin-1 receptor/Toll-like receptor superfamily:
signal transduction during inflammation and host defense. Science’s STKE:
signal transduction knowledge environment 2000, re1.
Oh, J., Yu, T., Choi, S.J., Yang, Y., Baek, H.S., An, S.A., Kwon, L.K., Kim, J., Rho, H.S.,
Shin, S.S., Choi, W.S., Hong, S., Cho, J.Y., 2012. Syk/Src pathway-targeted
inhibition of skin inflammatory responses by carnosic acid. Mediators of
Inflammation 2012, 781375.
Panthong, A., Kanjanapothi, D., Taesotikul, T., Taylor, W.C., 1991. Ethnobotanical
review of medicinal plants from Thai traditional books, Part II: Plants with
antidiarrheal, laxative and carminative properties. Journal of Ethnopharma-
cology 31, 121–156.
Panthong, A., Kanjanapothi, D., Taylor, W.C., 1986. Ethnobotanical review of
medicinal plants from Thai traditional books, Part I: Plants with anti-inflam-
matory, anti-asthmatic and antihypertensive properties. Journal of Ethnophar-
macology 18, 213–228.
Park, P.H., Hur, J., Lee, D.S., Kim, Y.C., Jeong, G.S., Sohn, D.H., 2011. Inhibition of
nitric oxide production by ethyl digallates isolated from Gal la Rhois in RAW
264.7 macrophages. Biomolecules and Therapy 19, 419–424.
Raymond, B., Crepin, V.F., Collins, J.W., Frankel, G., 2011. The WxxxE effector EspT
triggers expression of immune mediators in an Erk/JNK and NF-kappaB-
dependent manner. Cellular Microbiology 13, 1881–1893.
Saising, J., Voravuthikunchai, S.P., 2012. Anti-propionibacterium acnes activity of
rhodomyrtone, an effective compound from Rhodomyrtus tomentosa (Aiton)
Hassk. leaves. Anaerobe 18, 400–404.
Shen, T., Lee, J., Park, M.H., Lee, Y.G., Rho, H.S., Kwak, Y.S., Rhee, M.H., Park, Y.C.,
Cho, J.Y., 2011. Ginsenoside Rp(1), a ginsenoside derivative, blocks promoter
activation of iNOS and COX-2 genes by suppression of an IKK beta-mediated
NF-kappa B pathway in HEK293 cells. Journal of Ginseng Research 35,
200–208.
Shim, M.K., Lee, Y.J., 2012. Estrogen receptor is activated by Korean red ginseng
in vitro but not in vivo. Journal of Ginseng Research 36, 169–175.
Song, S.B., Tung, N.H., Quang, T.H., Ngan, N.T., Kim, K.E., Kim, Y.H., 2012. Inhibition
of TNF-a-mediated NF-kB transcriptional activity in HepG2 cells by
dammarane-type saponins from Panax ginseng leaves. Journal of Ginseng
Research 36, 146–152.
Starkenmann, C., Luca, L., Niclass, Y., Praz, E., Roguet, D., 2006. Comparison of
volatile constituents of Persicaria odorata (Lour.) Sojak (Polygonum odoratum
Lour.) and Persicaria hydropiper L. Spach (Polygonum hydropiper L.). Journal of
Agricultural and Food Chemistry 54, 3067–3071.
Toltl, L.J., Swystun, L.L., Pepler, L., Liaw, P.C., 2008. Protective effects of activated
protein C in sepsis. Thrombosis and Haemostasis 100, 582–592.
Tung, N.H., Ding, Y., Choi, E.M., Van Kiem, P., Van Minh, C., Kim, Y.H., 2009. New
anthracene glycosides from Rhodomyrtus tomentosa stimulate osteoblastic
differentiation of MC3T3-E1 cells. Archives of Pharmacal Research 32,
515–520.
Yang, Y., Hyun Moh, S., Yu, T., Gwang Park, J., Hyo Yoon, D., Woong Kim, T.,
Hwan Kim, S., Lee, S., Hong, S., Cho, J.Y., 2012a. Methanol extract of Osbeckia
stellata suppresses lipopolysaccharide- and HCl/ethanol-induced inflamma-
tory responses by inhibiting Src/Syk and IRAK1. Journal of Ethnopharmacology
143, 876–883.
Yang, Y., Yu, T., Jang, H.J., Byeon, S.E., Song, S.Y., Lee, B.H., Rhee, M.H., Kim, T.W.,
Lee, J., Hong, S., Cho, J.Y., 2012b. In vitro and in vivo anti-inflammatory
activities of Polygonum hydropiper methanol extract. Journal of Ethnopharma-
cology 139, 616–625.
Yoe, D.S., Rho, H.S., Lee, Y.G., Yeom, M.H., Kim, D.H., Lee, S.J., Hong, S., Lee, J.,
Cho, J.Y., 2011. Ginsenoside F1 modulates cellular responses of skin melanoma
cells. Journal of Ginseng Research 35, 86–91.
Yoon Jeong, H., Hyun Moh, S., Yang, Y., Yu, T., Oh, J., Jeong, D., Hyo Yoon, D., Myun
Park, K., Lee, S., Woong Kim, T., Hong, S., Young Kim, S., Youl Cho, J., 2012. Src
and Syk are targeted to an anti-inflammatory ethanol extract of Aralia
continentalis. Journal of Ethnopharmacology 143, 746–753.
Yu, T., Ahn, H.M., Shen, T., Yoon, K., Jang, H.J., Lee, Y.J., Yang, H.M., Kim, J.H., Kim, C.,
Han, M.H., Cha, S.H., Kim, T.W., Kim, S.Y., Lee, J., Cho, J.Y., 2011a.
Anti-inflammatory activity of ethanol extract derived from Phaseolus angularis
beans. Journal of Ethnopharmacology 137, 1197–1206.
Yu, T., Ahn, H.M., Shen, T., Yoon, K., Jang, H.J., Lee, Y.J., Yang, H.M., Kim, J.H., Kim, C.,
Han, M.H., Cha, S.H., Kim, T.W., Kim, S.Y., Lee, J., Cho, J.Y., 2011b.
Anti-inflammatory activity of ethanol extract derived from Phaseolus angularis
beans. Journal of Ethnopharmacology 137, 1197–1206.
Yu, T., Lee, J., Lee, Y.G., Byeon, S.E., Kim, M.H., Sohn, E.H., Lee, Y.J., Lee, S.G., Cho, J.Y.,
2010. In vitro and in vivo anti-inflammatory effects of ethanol extract from
Acer tegmentosum. Journal of Ethnopharmacology 128, 139–147.
Yu, T., Lee, S., Yang, W.S., Jang, H.J., Lee, Y.J., Kim, T.W., Kim, S.Y., Lee, J., Cho, J.Y.,
2012. The ability of an ethanol extract of Cinnamomum cassia to inhibit Src and
spleen tyrosine kinase activity contributes to its anti-inflammatory action.
Journal of Ethnopharmacology 139, 566–573.