Documente Academic
Documente Profesional
Documente Cultură
Analytical Biochemistry
j o u r n a l h o m e p a g e : w w w . e l s e v i e r. c o m / l o c a t e / y a b i o
a r t i c l e i n f o a b s t r a c t
Article history: Recombinant expression of the aryl hydrocarbon receptor (AhR) yields small amounts of ligand-bind
Received 1 July 2008 ing-competent AhR. Therefore, Spodoptera frugiperda (Sf9) cells and baculovirus have been evaluated for
Available online 7 October 2008 high-level and functional expression of AhR. Rat and human AhR were expressed as soluble protein in
significant amounts. Expression of ligand-binding-competent AhR was sensitive to the protein concen
tration of Sf9 extract, and coexpression of the chaperone p23 failed to affect the yield of functional ligand-
Keywords: binding AhR. The expression system yielded high levels of functional protein, with the ligand-binding
Dioxin
capacity (Bmax) typically 20-fold higher than that obtained with rat liver cytosol. Quantitative estimates
PCB
Ligand binding
of the ligand-binding affinity of human and rat AhR were obtained; the Kd for recombinant rat AhR was
Aryl hydrocarbon receptor indistinguishable from that of native rat AhR, thereby validating the expression system as a faithful model
Species difference for native AhR. The human AhR bound TCDD with significantly lower affinity than the rat AhR. These find
ings demonstrate high-level expression of ligand-binding-competent AhR, and sufficient AhR for quanti
tative analysis of ligand binding.
© 2008 Elsevier Inc. All rights reserved.
2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)2 is a ubiquitous ised the AhR as a transcription factor. The creation of AhR knock
toxin, and a prototypical representative of a series of chemicals out mice enabled a confirmation that AhR was required for dioxin
which effect toxicity through a common mechanism, binding to toxicity [5–8]. For a variety of persistent ligands, the affinity of the
the aryl hydrocarbon receptor (AhR) [1,2]. Mouse genetic studies AhR for the ligand is directly related to toxicity endpoints [1,2].
demonstrated that dioxin toxicity is mediated through the AhR Hence determining the affinity of ligands for AhR gives key infor
locus [2], and the subsequent cloning of the AhR [3,4] character mation for evaluating toxicity. The AhR ligand-binding assay is
exquisitely sensitive to minor changes in methodology, e.g., [9,10],
* Corresponding author. Fax: +44 115 951 3251.
and this leads to large differences (greater than 100-fold) in mea
E-mail address: david.bell@nottingham.ac.uk (D.R. Bell)
1
Current address: Department of Physiology, Faculty of Medicine, Umm A1-, Qura sured affinity of AhR for TCDD between different laboratories, e.g.,
University, Makkah, P.O. Box 7607, Saudi Arabia. [1,10–12]. Therefore, measured affinity constants for AhR ligands
2
Abbreviations used: TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin; AhR, aryl are not necesarily directly comparable between laboratories.
hydrocarbon receptor; GST, glutathione S-transferase; GGAG, GST-green fluorescent There are marked species differences in the toxicity of TCDD
protein-AhR-green fluorescent protein; LBD, ligand-binding domain; TEF, TCDD
toxic equivalency factors; GUS, b-glucuronidase; MDEG, 25 mM MOPS, 1 mM DTT,
[2], and it is important to determine if these differences are due to
1 mM EDTA, 10% glycerol, pH 7.5; Sf9, Spodoptera frugiperda 9 cells; ECL, enhanced binding to the AhR, and if they are common to other ligands of the
chemiluminescence; PAGE, polyacrylamide gel electrophoresis; MOI, muliplicity of AhR. The relative affinity of the human and mouse AhR for TCDD is
infection; PCDD, 1,2,3,7,8-pentachlorodibenzo-p-dioxin; TCDF, 2,3,7,8-tetrachlo known [13–15], but the affinity of the human AhR for other ligands
rodibenzofuran; PCDF, 2,3,4,7,8-pentachlorodibenzofuran; PCB126, polychlori
has not been determined [12,16]; this knowledge deficit arises
nated biphenyl 126; TCAOB, tetrachloroazoxybenzene; HAP, hydroxyapatite; BSA,
bovine serum albumin; SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel partly because of difficulties in obtaining fresh human tissue, but
electrophoresis. . also because analysis of AhR in human tissues is affected by the
0003-2697/$ - see front matter © 2008 Elsevier Inc. All rights reserved.
doi:10.1016/j.ab.2008.10.003
280 Recombinant expression of AhR / M.Q. Fan et al. / Anal. Biochem. 384 (2009) 279–287
lability and low levels of the human AhR [16,17]. Consequently, it is Table 1
Sequence of oligonucleotides used in PCR
problematic to compare the affinity of human AhR for ligands with
AhR affinity data for toxicologically relevant model species, if these Gene name primer Sequence
latter data are generated in a different laboratory. Rat AhR AAA56897
Hence a recombinant expression system would enable reliable rALB5 (forward) gtcgacatgGCAATGAATTTCCAAGGGAGGTTAAAGTATC
comparison between AhR preparations in the same laboratory under rALB3 (reverse) aagcttctagtgatggtgatggtgatgCA
AGGGATCCATTATGGGAGAGAAAGG
controlled conditions. While reticulocyte lysates are capable of pro
rA5 (forward) gtcgacatgGGCAGCCGCAAGCGGCGC
ducing AhR with ligand-binding functionality [3], the amount of AhR rABam3 (forward) CTCTCCCATAATGGATCCCTTGC
produced in this system is small and quantitative assays require con rLBD (reverse) AAGCTTCTAGTGATGGT
siderable amounts of lysate [18], effectively precluding this method GATGGTGATGCAGGAATCCGCTGGGTGTGATATCAGG
for comparison of multiple ligands in multiple species. Mammalian
Human AhR AAA16210
cells are also capable of producing small amounts of functional AhR, hA5 (forward) gtcgacatgGCCAGTCGCAAGCGGCGGAAG
but Ramadoss et al. [19] found limitations in saturation binding anal hA3 (reverse) aagcttctagtgatggtgatggtgatgCAGGAATCCACTGGATG
ysis in vitro with this system, and were unable to determine a Kd for TCAAATCAGG
ligand binding to AhR in vitro. Baculovirus infection of insect (Spo hALB5 (forward) gtcgacatgGCAATGAATTTCCAAGGGAAGTTAAAGTATC
hALB3 (reverse) aagcttctagtgatggtgatggtgatgTAAGGGATCCATTATGG
doptera frugiperda) cells is a system capable of producing high levels
CAGGAAAAGG
of recombinant protein, that has been exploited for a variety of tran V381A CCAGATTATATCATTGCAACT
scription factors. While human AhR has been expressed in this system CAGAGACCGTTAACAGATGAGGAAGGAAC
[20], there was no quantitative measurement of the amount or affin PCR Primers for cloning rat and human AhR and its ligand-binding domain.
ity of the ligand-binding AhR in this system. This is a prerequisite for Sequences based on SD rat AhR are shown in capital letters. Introduced restriction
studies on ligand binding, and for validating that the AhR is correctly sites are shown by underlining, the start codon is shown in bold, and the hexa-his
tidine sequence is also in bold font. For the mutagenesis oligo (V381A), the mutated
folded. Thus there is a pressing need for a recombinant expression
codon is in bold, and the selection restriction enzyme site is underlined. Sequences
system that can yield high levels of functional AhR, and that can be are shown 59 to 39.
used in a saturation binding analysis to give quantitative measures of
ligand affinity with AhRs from different species.
We have investigated the use of baculovirus for recombinant
expression of the AhR. We characterise the biochemical parameters Script (Stratagene) plasmid, and analysed by double-strand DNA
required for functional expression of the AhR in this system, quan sequencing. The AhR cDNA clones were then inserted into plasmid
tify the amount and ligand-binding functionality of expressed AhR, pFastBac1 between the SalI and HindIII sites.
and show that it faithfully reflects the native receptor. The high-level Human AHR cDNA, and its ligand-binding domain, were ampli
expression of functional AhR has numerous applications, and as an fied by PCR from plasmid pSporthAhr2 (Susan Moran, Mcardle
example, we use the recombinant rat and human AhR to demon Laboratory for Cancer Research, University of Wisconsin–Madsion
strate and quantify binding affinity for a number of ligands. Medical School); the primers are listed in Table 1. The human AHR-
His and hAHR-LBD-His fragments were then subcloned into SalI
Materials and methods and HindIII sites of plasmid pFastBac1.
The plasmid pFastBac1.Gus (Invitrogen) was used as a positive
Materials control to prepare recombinant b-glucuronidase (GUS) baculovirus,
using the same method as described above. Baculovirus expressing
TCDD and congeners (PCDD, 1,2,3,7,8-pentachlorodibenzo-p- human p23 was described previously [21], and was a kind gift from
dioxin; TCDF, 2,3,7,8-tetrachlorodibenzofuran; PCDF, 2,3,4,7,8-pen David O. Toft (Mayo Graduate School, Rochester, MN).
tachlorodibenzofuran; PCB126, polychlorinated biphenyl 126) were
obtained from Cambridge Isotope laboratories (MA), at high purity Site-directed mutagenes is
(99%). 2,3,7,8-Tetrachloroazoxybenzene (TCAOB) was a kind gift
from Dr. A.G. Smith (MRC Toxicology Unit, Leicester, UK). [3H]TCDD A Quick-change mutagenesis kit (Stratagene) was used to gen
was obtained from Eagle-Picher (KS), and was at 27.7 Ci mmol¡1. erate the V381A mutant of the hAhR LBD construct, according to
All other chemicals were also of the highest quality available. Rats the manufacturer’s instructions. The amino acid at 381 is variant
were obtained from Charles River Labor atories (UK). between rat and human (V/A), and mutation of this amino acid is
known to confer high-affinity binding [13,14]. The mutant primer
Subcloning of rat and human AhR cDNAs is shown in Table 1. The plasmid pFastBac1/hAhR-LBD was used
as the template. The mutation was confirmed by double-stranded
A rat (Charles River Wistar, CRL:WI) was killed, and liver DNA sequencing.
was homogen ised in TRIzol Reagent (Invitrogen). Total RNA was
extracted from liver according to the manufacturer’s manual. mRNA Expression of recombinant AhRs
was purified by Oligotex mRNA spin column (Qiagen) according
to the manufacturer’s manual. RT-PCR (Prostar Ultra HF RT-PCR The Bac-to-Bac (Invitrogen) system was used to express
kit (Stratagene)) was used to clone rat AhR and its ligand-binding recombinant AhRs in insect cells. Briefly, the plasmids pFast
domain sequences according to the manufacturer’s instructions. Bac1/hAhR-His, pFastBac1/hAhR-LBD-His, pFastBac1/V381A-His,
The PCR primers were designed based on the known Sprague– pFastBac1/rAhR-His, and pFastBac1/rAhR-LBD-His were trans
Dawley rat AhR cDNA sequence (Table 1), and the first nine amino formed into bacterial strain DH10Bac. Bacmids were prepared by
acids (leader sequence) were deleted. Rat AhR cDNA was divided Qiagen miniprep, and inserts were confirmed by PCR analysis. The
into two pieces (primers rA5 and rALB3; rABam3 and rLBDre bacmids then transfected into Sf9 cells, and baculovirus was har
verse), amplified separately, and ligated together at the BamHI site. vested after 5–7 days of incubation and then further amplified in
Rat AhR ligand-binding domain was amplified by primers rALB5 infected Sf9 cells to obtain high-titre virus. Virus was directly titred
(forward), which contains a novel SalI site, and rALB3 (reverse) in a plate assay, and high-titre virus stocks were used to infect Sf9
containing the HindIII site and a six-histidine tag. All PCR prod cells and express recombinant AhRs. Virus was added to Sf9 cell
ucts were subcloned into either pGEMT-Easy (Promega) or pPCR culture, and infected Sf9 cells were harvested by centrifugation
Recombinant expression of AhR / M.Q. Fan et al. / Anal. Biochem. 384 (2009) 279–287 281
at 500g for 10 min at 48 h after infection, or as indicated, and all was used to immunise rabbits, and antiserum harvested when the
subsequent steps were on ice or at 4 °C. Cell pellets were resus bleeds were capable of detecting <1 ng of antigen.
pended in MDEG buffer (25 mM MOPS, 1 mM DTT, 1 mM EDTA,
10% glycerol, pH 7.5) containing 20 mM molybdate. Cells were bro Statistical analysis
ken by sonic ation, and cell debris was removed by centrifugation
at 12,000g for 10 min. The supernatant was further centrifuged at Data are presented as mean and standard deviation, except
200,000g for 30 min. The final cytosolic supernatants were divided where otherwise noted. Statistical analysis used t test where appro
into small aliquots and stored at ¡80 °C. For diafiltration, cytosol priate. For calculation of confid
ence intervals from saturation, and
was diafiltered with a 10 k molecular weight cutoff membrane competition ligand binding, Graphpad 5 was used for calculation
with MDEG buffer at 4 °C. For addition of ATP/Mg2+, these were of 95% confidence limits subsequent to nonlinear curve fitting.
added in MDEG buffer with 2 mM ATP, 5 mM MgCl2.
Results
Ligand-binding assay
Generation of baculovirus constructs and expression of protein
The method for [3H]TCDD binding to AhR was previously estab
lished by [1]. Typically, rat liver cytosol was diluted to 5 mg/ml in The AhR cDNA was cloned from the liver of a CRL:WI rat, and
MDEG buffer (25 mM MOPS, 1 mM DTT, 1 mM EDTA, 10% glycerol, the sequence of the constructs (Accession Number AJ821851) was
pH 7.5) containing 20 mM molybdate. Then the sample was incu confirmed by double-stranded sequencing to be identical for that
bated with [3H]TCDD or [3H]TCDD plus a 200-fold excess of com of the Sprague–Dawley rat (AAA56897). The human and rat cDNAs
petit or 2,3,7,8-tetrachloroazoxybenzene at 4 °C overnight. After were cloned into recombinant baculovirus, used to infect Sf9 insect
incubation, 30 ll of dextran-coated charcoal suspension (67 mg/ cells, and the presence of AhR was determined using Western blot
ml, prepared in MDEG buffer) was added into a 200-ll sample of ting (Fig. 1A). Cytosol from uninfected cells showed no noticeable
the mixture. The suspension was incubated on ice for 10 min, and cross-reactivity with the antibody, and cells infected with a virus
then was centrifuged at 25,000g for 10 min. The amount of 150 ll of expressing b-glucuronidase also failed to show any cross-reac
the supernatant was removed and radioactivity was measured in a tivity, demonstrating that viral infection did not cause any cross-
scintillation counter. Specific binding was defined as the difference reacting proteins. Virus expressing rat and human AhR both gave
of radioactivity between without (total binding) and with compet rise to strong immunoreactive bands in cytosol, with the human
itor TCAOB (nonspecific binding). For recombinant rat AhR protein, AhR migrating at a slightly higher apparent molecular mass than
either 0.25 mg or 0.5 mg/ml cytosol protein was used for binding the rat AhR, consistent with previous reports [22]. This shows
assay, and supplemented with BSA to a final protein concentra that the AhR protein was specifically expressed and detected in
tion of 5 mg/ml; 1 mg/ml recombinant human AhR with 4 mg/ml Sf9 cells. The time course of expression of cytosolic AhR protein
BSA was used for assay unless otherwise stated. For competition was examined (Fig. 1B); AhR protein was maximally induced at
assay, a serial dilution of competit or was incubated with 0.5 nM 48 h after infection, and this time point was used for further stud
[3H]TCDD (except where otherwise stated), and the specific bind ies. Comparison of the amount of AhR protein in total cell lysates
ing was determined as described above. Specific binding or Ki was versus cytosol (Fig. 1C) showed that both the human and the rat
determined by using nonlinear regression, using Graphpad 4/5, fit AhR were more abundant in total cell protein, compared to cyto
ting a saturation binding isotherm, or one-site competit ive binding sol. This effect was more obvious for the human AhR, than for the
equation, to the experim ental data. Ki was derived from the IC50 rat AhR. The full-length and ligand-binding domain (LBD) con
using the Cheng–Prusoff equation, as implemented in Graphpad. structs were then expressed at an equal multiplicity of infection
with virus (MOI), to determine if there was adequate expression
Hydroxylapatite assay of the recombinant proteins in cytosol (Fig. 1D). While the expres
sion of the full-length human and rat AhR proteins was adequate,
A 200-ll sample was treated with charcoal as described above; the expression of the LBD constructs was less than that seen for
the supernatant was transferred into a fresh tube, and then 200 ll the full-length constructs. The rat LBD was present in cytosol at
50% hydroxyapatite (HAP) was added. After incubation on ice for acceptable levels, but the human AhR LBD and the LBD-Val381Ala
30 min, the HAP resin was spun down at 25,000g for 1 min at 4 °C. mutant were present at too low a level for comparison with the
The pellet was washed twice with 1 ml MDEG buffer containing rat LBD or full-length constructs (Fig. 1D). Thus the Sf9 expression
0.1% Tween 20, and then the protein was eluted into 0.5 ml ethanol. system yielded high levels of expression of both rat and human
The supernatant was assayed for radioactivity by liquid scintilla full-length AhR proteins in cytosolic extracts.
tion counting. Analysis of saturation-binding data was as described
for the charcoal assay above. Ligand-binding assay
Western blotting Given that the expression system yielded cytosolic full-length
human and rat AhR protein, it was necessary to test whether the
Protein was run on polyacrylamide gel electrophoresis (PAGE) protein was capable of specifically binding a ligand; the proto
(either SDS–PAGE, or precast gels (Invitrogen) using lithium dode typical ligand, 2,3,7,8-tetrachlorodibenzo-p-dioxin, was used,
cyl sulfate), and transferred to a blotting membrane. Signal was with rat liver cytosol as a positive control reagent. Fig. 2A and
detected using enhanced chemiluminescence (ECL; GE Healthcare) B show that uninfected Sf9 cytosol (a negative control) showed
and exposure to a film. The antibody against p23 was obtained from no specific binding to tritiated TCDD, but that rat liver cytosol
Stressgen Bioreagents Corporation (Assay Designs, Inc., 5777 Hines bound TCDD. Cytosol from Sf9 cells infected with either rat AhR
Drive, Ann Arbor, MI). The LBD of the mouse AhRb ¡ 1 allele cDNA (A) or human AhR (B) showed specific binding to TCDD, demon
[14] was amplified with oligos 282 and 416 (amino acids 282–416; strating that the recombinant AhR protein is capable of binding
Table 1), and subcloned into the BamHI site of pRSETc (Invitrogen). ligand. The binding assay was robust to the use of 2,3,7,8-tet
The AhR LBD was induced in BL21(DE3) bacteria, and the insoluble rachlorodibenzofuran or tetrachloroazoxybenzene as a compet
protein was solub ilised in 6 M guanidine HCl, 50 mM Tris, pH 8.0, itor to determine specific binding (unpublished data), and the
and purified by Ni2+-affinity chromatography. The purified protein amount of specific binding was not significantly different when
282 Recombinant expression of AhR / M.Q. Fan et al. / Anal. Biochem. 384 (2009) 279–287
Fig. 1. Recombinant expression of AhR protein in Sf9 cells. (A) Sf9 cells were uninfected (Sf9), or infected with baculovirus (at an MOI of 10) encoding b-glucuronidase (Gus),
rat AhR (rAhR), or human AhR (hAhR); cells were lysed 48 h after infection, and cytosol was prepared as described under Materials and methods. Ten micrograms of cyto
solic protein was Western-blotted, and detected with a polyclonal antibody against the AhR; signal was visualised by ECL. The position of the molecular weight markers (M)
is shown in kDa. (B) Sf9 cells were uninfected (Sf9), or infected with rat AhR virus (rAhR), and cytosol was prepared at the indicated time after infection. Ten micrograms of
cytosolic protein was Western-blotted for AhR as described in A. (C) Cytosol (C) or total protein (T) was isolated from Sf9 cells infected (MOI = 10) with rat AhR, or human
AhR, at 48 h after infection; total protein from uninfected Sf9 cells is a control lane. Ten micrograms of protein was Western-blotted for AhR as described in (A). (D) Sf9 cells
were infected at MOI = 10 and cytosol was prepared 48 h later. Cells were uninfected (Sf9), or infected with virus encoding b-glucuronidase (Gus), rat AhR (rAhR), rat AhR
ligand-binding domain (LBD) (rLBD) or human AhR (hAhR), human AhR LBD (hLBD), or the V381A mutant of the human AhR LBD (hVA); samples were Western-blotted with
an antibody against the AhR, and detected by ECL. The position of the full-length AhR and the AhR LBD proteins is shown by an arrow; a band of cross-reactive protein is
indicated by a line. The position of the molecular weight markers (M) is shown in kDa.
using a protocol with charcoal, or charcoal followed by an addi inding sites, such that the unlabeled competitor simply bound
b
tional hydroxyapat ite step (Fig. 2C). The assay showed specific to the high-affinity binding sites, but was no longer able to dis
binding to TCDD with rat liver cytosol (Fig. 2D), with saturation place [3H]TCDD since the high-affinity binding sites are in excess.
binding analysis for rat cytosol yielding an apparent Kd for TCDD However, Fig. 3B shows that dilution of the rat AhR cytosol results
of 1.0 ± 0.45 nM (mean ± standard deviation, n = 6), and a maximal in a decrease in the specific binding, and excludes the possibility
binding capacity (Bmax) of 52 fmol/mg, within the range of previ that the Sf9-mediated decrease in binding is due to an increase
ous estimates [1,10,12]. in the amount of specific binding sites. The addition of ATP and
Mg2+ to the BSA solution did not affect the specific binding of
Optimisation of recombinant expression for ligand-binding-competent the rat AhR, although these agents are known to be essential for
AhR hsp90-mediated protein interactions with AhR [23]. Extensive
diafiltration of the Sf9 cytosol failed to reduce the ability of Sf9
Protein concentration is a key variable for TCDD binding cytosol to inhibit the binding of rat AhR to TCDD, excluding the
assays, since TCDD solubility is critically dependent on protein possibility of a low molecular weight AhR ligand being present
concentration (D.R. Bell, unpublished data; [9,10]), and hence in the Sf9 cytosol (Fig. 3C). Finally, performing the ligand-binding
the binding assays were made up to 5 mg/ml final protein con assay in the presence of a high concentration of TCDD also had
centration with BSA. Although the Sf9 cytosols expressing AhR no effect on the inhibition of rat AhR by Sf9 cytosol, confirming
showed specific binding, the specific binding was dependent on that the effect is not caused by a surfeit of AhR binding sites.
the concentration of Sf9 cytosol (D.R. Bell, unpublished data). The known dependence of AhR folding on protein interactions
Fig. 3 shows that addition of uninfected Sf9 cytosol inhibited the (e.g., [23,24]) suggested that proteins in the Sf9 cytosol may be
binding of TCDD to recombinant rat AhR in a dose-dependent causing the AhR to adopt an improperly folded conformation; to
manner, and that the nonspecific protein, BSA, did not inhibit test this, the Sf9 cytosol was heat-treated, whereon it then failed
binding of TCDD to the AhR. Since the binding assay represents to inhibit the binding of rat AhR to TCDD (Fig. 3D). Reticul ocyte
the difference between total TCDD in solution and the TCDD lysates are known to be able to support the folding of AhR into
present after addition of a »200-fold molar excess of unlabeled a ligand-binding-capable form (e.g., [14,25]), and so reticulocyte
competitor (i.e., the high capacity and “nonspecific” binding), lysate protein was used to determine if the inhibitory effect of
it was possible that this result could have been caused by the Sf9 protein was specific to Sf9 cells, or a general phenomen on of
addition of the Sf9 cytosol increasing the amount of high-affinity cell lysates. Fig. 3E shows that the specific binding of rat AhR to
Recombinant expression of AhR / M.Q. Fan et al. / Anal. Biochem. 384 (2009) 279–287 283
Fig. 2. Specific binding of TCDD by recombinant bacul ovirus extracts. (A) cytosol was prepared from rat liver, Sf9 cells (Sf9), or Sf9 cells infected with rat AhR (rrAhR), as
described in Fig. 1. Cytosol was assayed for ligand binding as described under Materials and methods, with rat liver and Sf9 cytosol at 5 mg/ml, and 0.5 mg/ml rat AhR cytosol
made up to 5 mg/ml with BSA; [3H]TCDD is present in the binding assay at a concentration of 1 nM. Specific binding is shown in disintegrations per minute (DPM). Results are
shown as mean ± SD (n = 3); results are representative of multiple experiments. (B) The binding assay was carried out as for A, except that the cytosol from Sf9 cells infected
with virus encoding human AhR (rhAhR) had a protein concentration of 1 mg/ml, made up to 5 mg/ml with BSA. (C) Rat liver cytosol was subjected to a binding assay, as
described under Materials and methods. After charcoal adsorption (charcoal only), the total radioactivity in solution (total) was compared to that with a 200-fold excess of
TCAOB (nonspecific), and the specific binding (specific) is the total minus nonspecific binding. Alternatively, the postcharcoal supernatant was subjected to hydroxyapatite
treatment (charcoal + HAP), and the total, nonspecific, and specific are shown. Results are shown as mean ± SD (n = 3). (D) Rat liver cytosol (5 mg/ml) was subjected to satu
ration binding analysis, and specific binding analysed by nonlinear regression, as described under Materials and methods. For this experim ent, the Kd is 0.75 nM (95% confi
dence limits 0.54–0.96 nM), and the Bmax is 52 fmol/mg cytosolic protein.
TCDD was unaffected by reticul ocyte lysate protein over a range Determination of affinity of rat and human AhR for TCDD
of 0–5 mg/ml, thereby showing that the effect of Sf9 cytosol in
inhibiting the binding of TCDD to recombinant rat AhR is spe In view of the consistent cytosolic expression of rat and
cific to the Sf9 cytosol, as opposed to reticulocyte lysate or BSA human AhR, and qualitative determination of ligand-binding
solution. ability, saturation binding analysis was undertaken to quantitate
It has previously been shown that p23 is an essential chap the amount and affinity of binding. When cytosol containing
erone for correct folding of the glucocorticoid receptor [21], recombinant rat AhR was produced at an MOI of 0.1, the result
and it is known that p23 associates with the AhR. In order to ing AhR showed saturable binding to TCDD (Fig. 5A), with a Kd
determine if p23 could enhance the folding of AhR in Sf9 cells, of 1.34 ± 0.32 nM (n = 6 independent determinations). This value
rat AhR was coexpressed with human p23. Fig. 4A shows that was not significantly different from the values we obtained for
baculovirus expression of p23 yields sufficient solub le p23 for the AhR in rat liver cytosol (1.0 ± 0.45 nM, n = 6, Fig. 2D), dem
visual detection in a Coomassie-stained gel, and immunodetec onstrating that the baculovirus expression system yields faithful
tion confirmed that the induced band was indeed p23, and nei expression of functional rat AhR. The Bmax was 1.5 ± 0.37 pmol/
ther Sf9 cells nor AhR-encoding bacul ovirus caused any cross- mg cytosolic protein, »20-fold higher than in rat liver cyto
reactivity (Fig. 4B). AhR was coexpressed with p23 protein, and sol (Fig. 2D). Expression of rat AhR with higher MOI yielded
there was no obvious effect on the amount of AhR protein that slightly higher amounts of cytosolic AhR protein (Fig. 5B), but
was present in cytosolic extracts in the presence and absence of no increase in the amount of specific binding to TCDD (Fig. 5C).
coexpression of p23 (Fig. 4C); this was true when the rat AhR In order to confirm that the recombinant expression system
was expressed at low levels (MOI of 0.1) and at higher levels of could functionally express AhR from different organisms, the
expression (MOI = 1). The functionality of the expressed rat AhR affinity of TCDD for human AhR under optimised conditions was
protein was examined by ligand-binding assay, and there was no determined, yielding a Kd of 2.77 ± 0.94 nM (n = 6), with a Bmax of
significant difference in the amount of specific binding of TCDD 0.46 ± 0.12 pmol/mg cytosolic protein (Fig. 5D). Although we did
between cytosols containing rat AhR with and without p23 pro not determine the affinity of native human liver AhR, these data
tein (Fig. 4D). Thus the expression of p23 had no effect on the are consistent with previous reports in showing that the human
yield of cytosolic protein, nor the functionality of expressed AhR AhR has a significantly reduced affinity for TCDD compared to
under these conditions in Sf9 cells. rat [12,13,15,16].
284 Recombinant expression of AhR / M.Q. Fan et al. / Anal. Biochem. 384 (2009) 279–287
Fig. 3. Factors affecting specific binding of rat AhR in Sf9 cytosol. (A) TCDD-binding assays were performed as described in Fig. 2, with the exception that cytosol from unin
fected Sf9 cells (Sf9 cytosol) was titrated at the indicated concentration. Results are shown as mean ± SD (n = 3), and are representative of results obtained on at least two
occasions. (B) As for A, but the concentration of Sf9 cytosol containing rat AhR was varied. (C) As for A, with the exception that Sf9 cytosol from uninfected cells was diafiltered
as indicated, or the TCDD-binding assay was performed in the presence of 5 nM TCDD (instead of 1 nM) where indicated. (D) As for A, with the exception that the Sf9 cytosol
from uninfected cells was subject to heat treatment (65 °C for 10 min) prior to use in the assay, as indicated. (E) As for A, but rabbit reticulocyte lysate and BSA were used to
make the rat AhR up to 5 mg/ml protein concentration.
Determination of ligand affinity by competitive binding assay TCDD (Table 2). The Ki values for the human AhR consistently
showed the same rank order of potency as in the rat; however,
In order to determine if the expressed AhR could be used to as with the Kd values, the human AhR showed a lower affinity for
determine the affinity of other ligands, the rat AhR was used in ligands when compared with the rat. Thus these data demon
a competition binding assay for a number of congeners of TCDD strate that the recombinant AhR can be used for the determina
(Table 2). The competition assays showed good fit to a one-site tion of ligands in a competitive ligand-binding assay.
competitive binding assay equation, and were robust to replica
tion (data not shown). The rat AhR yielded a Ki for TCDD which Discussion
was not significantly different from the Kd determined from
rat liver, or recombinant rat AhR (Fig. 5A), demonstrating that Recombinant expression of ligand-binding-competent AhR would
the competitive binding assay with recombinant AhR is robust. have significant advantages for determining the ligand-binding affin
Comparison of the ability of various congeners to bind to rat AhR ity of AhR from a variety of organisms, but expression of AhR is prob
showed that TCDF and PCDD showed a simil ar affinity as TCDD, lematic. Bacterial expression of AhR yields insoluble protein [18],
but that PCDF was a »3-fold less potent ligand than PCDD, and and even in insect cells, the majority of the AhR protein produced
PCB126 was »50-fold less potent than TCDD. For the human was in an insoluble 10,000 g pellet (M.Q. Fan, T. Jiang, unpublished
AhR, TCDD and PCDF were »2-fold less potent than TCDF and data, [20]). However, the full-length AhR proteins produced cytosolic
PCDD, and PCB126 was »40-fold less potent as a ligand than AhR in insect cells, and these levels were readily detectable (Fig. 1C
Recombinant expression of AhR / M.Q. Fan et al. / Anal. Biochem. 384 (2009) 279–287 285
Fig. 4. Coexpression of p23 and rat AhR in Sf9 cells. (A) Sf9 cells were infected with p23 (at an MOI of 1; p23), and/or with rat AhR (rAhR), at the indicated MOI. Uninfected Sf9
cells (Sf9) were used as a control. Total (T) or cytosolic (C) fractions were isolated, and 10 lg of protein was electrophoresed, followed by staining of the gel with Coomassie
blue. The position of molecular weight markers (M) is indicated. (B) The samples in A were subjected to Western blotting and immunodetected with an antibody against
p23, using methodology as described in Fig. 1. (C) Cytosol was prepared from cells infected with p23 (MOI = 1), and rat AhR (rAhR) at the indicated MOI; cells infected with
p23 alone served as a control. The samples were Western-blotted with an antibody to AhR, as described in Fig. 1. (D) Samples of cytosol prepared from an infection with rat
AhR at an MOI of 0.1 (rAhR), with or without p23 at an MOI of 1 (rAhR + p23), and uninfected Sf9 cells (Sf9) were used for a TCDD-binding assay, using standard conditions as
described under Materials and methods. Results are shown as mean ± SD (n = 3).
286 Recombinant expression of AhR / M.Q. Fan et al. / Anal. Biochem. 384 (2009) 279–287
Fig. 5. Effect of expression level of AhR on AhR functionality. (A) Sf9 cytosol was prepared after infection with rat AhR-encoding baculovirus at an MOI of 0.1, and assayed for
saturation binding; a typical experim
ent is shown, with each data point representing triplicate determinations, and showing mean ± SD (n = 3). The Kd was 1.35 nM, and the
Bmax was 1.83 pmol/mg. (B) Western blotting of AhR. Sf9 cells were infected with virus encoding rat AhR at an MOI of 0.1–10 (as indicated). Cytosol samples were prepared
at 48 h after infection, and 10 lg of each sample was Western-blotted for AhR, as described in Fig. 1. (C) Cytosol samples prepared at different MOIs, as described in B, were
assayed for TCDD binding, with the addition of uninfected Sf9 cytosol (Sf9), and rat liver cytosol as a positive control. Results are shown as mean ± SD (n = 3). (D) A represen
tative saturation binding isotherm for recombinant human AhR is shown, with each data point representing triplicate determinations, and showing mean ± SD (n = 3). The Kd
was 2.6 nM, and the Bmax was 0.42 pmol/mg.
Spodoptera cells also lack a ligand-binding AhR. In agreement Since receptor-ligand binding is required for any subsequent
with this, we were unable to detect any reproducible or signifi activation of a receptor, and coupling to biological effect, it fol
cant specific binding of [3H]TCDD in Sf9 cells. However, Sf9 cells lows that the affinity of the AhR for ligand is a key determinant
are capable of folding the rat and human AhR into a ligand-bind for the subsequent biological actions. Thus the use of the baculo
ing conformation (Fig. 5) that is functionally indistinguishable virus expression system for functional expression of AhR should
from the native receptor in terms of Kd. It is apparent that there have important applications in risk assessment.
are no species-specific cofactors that are required for functional In summary, these results show that functional rat and human
reconstitution of ligand-binding functionality of the human or AhR can be expressed using the baculovirus expression vector sys
rat AhR. Given the low endogenous background of binding, and tem, and that robust and saturable ligand binding is obtained which
the ability to fold heterologous AhR, it is likely that this system is directly comparable to the native receptor. The high yield of func
will have broad applicability in functional expression of AhR tional AhR is a significant advantage for this system, and consequently
from diverse species. quantitative analysis of ligand binding can readily be performed. Our
The human and rat AhR showed robust and satur able ligand- results characterise the binding of a variety of ligands and show that
binding affinity for TCDD (Fig. 5), consistent with previous data this expression system can be readily applied for determining the
[12–14], and hence can be used for further ligand-binding analy affinity of ligands for AhR from two model species.
sis. We undertook a comparison of the ability of rat AhR to bind
TCDD, and the value in competitive binding assay was not sig Acknowledgments
nificantly different from that obtained in an equilibrium bind
ing analysis (Table 2). The rat AhR showed specific binding to a This work was funded by a contract (T01034) from the UK Food
range of dioxins and furans, in agreement with prior estimates Standards Agency. The authors thank Declan Brady for expert
[1,2]. The human AHR bound specific ligands in the same rank technical assistance, and John Fenlon for help in preparing the
order of affinity as the rat, but with lower affinity than the rat AhR antibody. We acknowledge the Food Standards Agency and
AhR (Table 2), consistent with the results in Fig. 5. The lower its expert reviewers (Professors G. Gibson, A.G. Renwick, and Dr.
affinity of the human AHR for these ligands may lead to artifac A.G. Smith) for helpful comments and guidance, and Lesa Ayl
tually high values for Ki, as the solub
ility of, e.g., TCDD in protein ward for helpful comments on the manuscript. We thank Susan
solution declines dramatic ally at concentrations much in excess Moran and Christopher Bradfield for the gift of the human AhR
of 2 nM (unpublished data). These experiments have been per cDNA, and David Toft for baculovirus containing p23.
formed under the same conditions, which enhances the reliabil
ity of the comparison, and are novel information in defining the References
affinity of human AHR for environmentally important ligands.
The congeners described account for a substantial proportion [1] A. Poland, E. Glover, A.S. Kende, Stereospecific high affinity binding of 2, 3,
7, 8-tetrachlorodibenzo-para-dioxin by hepatic cytosol—evidence that bind
(»90%) of the human dietary exposure to dioxin-like congeners, ing species is receptor for induction of aryl-hydrocarbon hydroxylase, J. Biol.
or TEQ (M. Rose, A. Fernandes, S. White, unpublished data, [36]). Chem. 251 (1976) 4936–4946.
Recombinant expression of AhR / M.Q. Fan et al. / Anal. Biochem. 384 (2009) 279–287 287
[2] A. Poland, J.C. Knutson, 2, 3, 7, 8-Tetrachlorodibenzo-para-dioxin and related [20] W.K. Chan, R.Y. Chu, S. Jain, J.K. Reddy, C.A. Bradfield, Baculovirus expression of
halogenated aromatic-hydrocarbons—examination of the mechanism of tox the Ah receptor and Ah receptor nuclear translocator—evidence for additional
icity, Annu. Rev. Pharmacol. Toxicol. 22 (1982) 517–554. dioxin-responsive element-binding species and factors required for signaling,
[3] K.M. Burbach, A. Poland, C.A. Bradfield, Cloning of the Ah-receptor Cdna J. Biol. Chem. 269 (1994) 26464–26471.
reveals a distinctive ligand-activated transcription factor, Proc. Natl. Acad. Sci. [21] Y. Morishima, K.C. Kanelakis, P.J.M. Murphy, E.R. Lowe, G.J. Jenkins, Y. Osawa,
USA 89 (1992) 8185–8189. et al., The Hsp90 cochaperone p23 is the limiting component of the multi
[4] M. Ema, K. Sogawa, N. Watanab e, Y. Chujoh, N. Matsushita, O. Gotoh, et al., protein Hsp90/Hsp70-based chaperone system in vivo where it acts to sta
Cdna cloning and structure of mouse putative Ah receptor, Biochem. Biophys. bilize the client protein center dot Hsp90 complex, J. Biol. Chem. 278 (2003)
Res. Commun. 184 (1992) 246–253. 48754–48763.
[5] P. Fernandezsalguero, T. Pineau, D.M. Hilbert, T. McPhail, S.S.T. Lee, S. Kimura, [22] J.L. Holmes, R.S. Pollenz, Determination of aryl hydrocarbon receptor nuclear
et al., Immune-system impairment and hepatic-fibrosis in mice lacking the translocator protein concentration and subcellular localization in hepatic and
dioxin-binding Ah receptor, Science 268 (1995) 722–726. nonhepatic cell culture lines: development of quantitative Western blotting
[6] P.M. FernandezSalguero, D.M. Hilbert, S. Rudikoff, J.M. Ward, F.J. Gonzalez, Aryl- protocols for calculation of aryl hydrocarbon receptor and aryl hydrocarbon
hydrocarbon receptor-deficient mice are resistant to 2, 3, 7, 8-tetrachlorodibenzo- receptor nuclear translocator protein in total cell lysates, Mol. Pharmacol. 52
p-dioxin-induced toxicity, Toxicol. Appl. Pharmacol. 140 (1996) 173–179. (1997) 202–211.
[7] J.V. Schmidt, G.H.T. Su, J.K. Reddy, M.C. Simon, C.A. Bradfield, Characterization [23] D.R. Bell, A. Poland, Binding of aryl hydrocarbon receptor (AhR) to AhR-inter
of a murine Ahr null allele: involvement of the Ah receptor in hepatic growth acting protein—the role of hsp90, J. Biol. Chem. 275 (2000) 36407–36414.
and development, Proc. Natl. Acad. Sci. USA 93 (1996) 6731–6736. [24] G. Yao, M. Craven, N. Drinkwater, C.A. Bradfield, Interaction networks in yeast
[8] Y. Shimizu, Y. Nakatsuru, M. Ichinose, Y. Takahashi, H. Kume, J. Mimura, et al., define and enumerate the signaling steps of the vertebrate aryl hydrocarbon
Benzo[a]pyrene carcinogenicity is lost in mice lacking the aryl hydrocarbon receptor, PLoS Biol. 2 (2004) e65.
receptor, Proc. Natl. Acad. Sci. USA 97 (2000) 779–782. [25] K.M. Dolwick, J.V. Schmidt, L.A. Carver, H.I. Swanson, C.A. Bradfield, Cloning
[9] C.A. Bradfield, A.S. Kende, A. Poland, Kinetic and equilibrium studies of Ah and expression of a human Ah receptor Cdna, Mol. Pharmacol. 44 (1993) 911–
receptor-ligand binding—use of (i-125)2-lodo-7, 8-dibromodibenzo-para- 917.
dioxin, Mol. Pharmacol. 34 (1988) 229–237. [26] M.B. Cox, C.A. Miller, The p23 co-chaperone facilitates dioxin receptor signal
[10] K. Farrell, S. Safe, Absence of positive cooperativity in the binding of 2, 3, 7, ing in a yeast model system, Toxicol. Lett. 129 (2002) 13–21.
8-tetrachlorodibenzo-para-dioxin to its cytosolic receptor protein, Biochem. J. [27] C.A. Miller, Two tetratricopeptide repeat proteins facilit ate human aryl hydro
244 (1987) 539–546. carbon receptor signalling in yeast, Cell. Signal. 14 (2002) 615–623.
[11] C.A. Bradfield, A. Poland, A Competitive-binding assay for 2, 3, 7, 8-tetrachlo [28] M.L. Whitelaw, J. McGuire, D. Picard, J.A. Gustafsson, L. Poellinger, Heat-shock
rodibenzo-para-dioxin and related ligands of the Ah receptor, Mol. Pharmacol. protein Hsp90 regulates dioxin receptor function in-vivo, Proc. Natl. Acad. Sci.
34 (1988) 682–688. USA 92 (1995) 4437–4441.
[12] K.T. Connor, L.L. Aylward, Human response to dioxin: aryl hydrocarbon recep [29] P.V. Shetty, B.Y. Bhagwat, W.K. Chan, P23 enhances the formation of the aryl
tor (AhR) molecular structure, function, and dose-response data for enzyme hydrocarbon receptor-DNA complex, Biochem. Pharmacol. 65 (2003) 941–
induction indicate an impaired human AhR, J. Toxicol. Environ. Health Part B 948.
9 (2006) 147–171. [30] R. Pohjanvirta, M. Viluksela, J.T. Tuomisto, M. Unkila, J. Karasinska, M.A. Franc,
[13] M. Ema, N. Ohe, M. Suzuki, J. Mimura, K. Sogawa, S. Ikawa, et al., Dioxin binding et al., Physicochemical differences in the AH receptors of the most TCDD-sus
activities of polymorphic forms of mouse and human arylhydrocarbon recep ceptible and the most TCDD-resistant rat strains, Toxicol. Appl. Pharmacol. 155
tors, J. Biol. Chem. 269 (1994) 27337–27343. (1999) 82–95.
[14] A. Poland, D. Palen, E. Glover, Analysis of the 4 alleles of the murine aryl- [31] A. Lorenzen, A.B. Okey, Detection and characterisation of Ah receptor in
hydrocarbon receptor, Mol. Pharmacol. 46 (1994) 915–921. tissue and cells from human tonsils, Toxicol. Appl. Pharmacol. 107 (1991)
[15] P.A. Harper, C.L. Golas, A.B. Okey, Characterization of the Ah receptor and aryl- 203–214.
hydrocarbon hydroxylase induction by 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin [32] A.B. Okey, J.V. Giannone, W. Smart, J.M.Y. Wong, D.K. Manchester, N.B. Parker,
and benz(a)anthracene in the human A431 squamous-cell carcinoma line, et al., Binding of 2, 3, 7–8-tetrachlorodibenzo-p-dioxin to AH receptor in pla
Cancer Res. 48 (1988) 2388–2395. centas from normal versus abnormal pregnancy outcomes, Chemosphere 34
[16] D.K. Manchester, S.K. Gordon, C.L. Golas, E.A. Roberts, A.B. Okey, Ah-receptor (1997) 1535–1547.
in human-placenta—stabilization by molybdate and characterization of bind [33] R.A. Butler, M.L. Kelley, W.H. Powell, M.E. Hahn, R.J. Van Beneden, An aryl hydro
ing of 2, 3, 7, 8-tetrachlorodibenzo-para-dioxin, 3-methylcholanthrene, and carbon receptor (AHR) homologue from the soft-shell clam, Mya arenaria: evi
benzo(a)pyrene, Cancer Res. 47 (1987) 4861–4868. dence that invertebrate AHR homologues lack 2, 3, 7, 8-tetrachlorodibenzo-p-
[17] A. Poland, E. Glover, Ca2+-dependent proteolysis of the Ah receptor, Arch. Bio dioxin and beta-naphthoflavone binding, Gene 278 (2001) 223–234.
chem. Biophys. 261 (1988) 103–111. [34] D.M. Duncan, E.A. Burgess, I. Duncan, Control of distal antennal identity and
[18] P. Coumailleau, L. Poellinger, J.A. Gustafsson, M.L. Whitelaw, Definition of a tarsal development in Drosophila by spineless-aristapedia, a homolog of the
minimal domain of the dioxin receptor that is associated with Hsp90 and mammalian dioxin receptor, Genes Dev. 12 (1998) 1290–1303.
maintains wild-type ligand-binding affinity and specificity, J. Biol. Chem. 270 [35] J.A. Powell-Coffman, C.A. Bradfield, W.B. Wood, Caenorhabditis elegans ortho
(1995) 25291–25300. logs of the aryl hydrocarbon receptor and its heterodimerization partner the
[19] P. Ramadoss, G.H. Perdew, Use of 2-azido-3-[I-125]iodo-7, 8-dibromodibenzo- aryl hydrocarbon receptor nuclear translocator, Proc. Natl. Acad. Sci. USA 95
p-dioxin as a probe to determine the relative ligand affinity of human versus (1998) 2844–2849.
mouse aryl hydrocarbon receptor in cultured cells, Mol. Pharmacol. 66 (2004) [36] A. Fernandes, S. White, K. D’Silva, M. Rose, Simultaneous determination of
129–136. PCDDs, PCDFs, PCBs and PBDEs in food, Talanta 63 (2004) 1147–1155.