Effect of 5-azacytidine on Global DNA Methylation

Amanda Davis

ASSIGNMENT PARTIALLY FULFILLS REQUIREMENT FOR UW COURSE FISH499

Introduction
Environmental changes, such as a water contamination, can be detrimental to marine
invertebrates. This is particularly a problem for those that rely on filter feeding as their
only source of nutrient uptake, as the case with the Pacific oyster (Crassostrea gigas). By
ingesting toxins from the water, these organisms undergo changes in physiology in
attempt to maintain homeostasis.

Environmental epigenetics is the study of how environmental changes can lead to

changes in gene expression without altering DNA sequence (Esteller, 2008). The changes
in gene expression can continue even once the stimulus or stress is removed, thus
allowing these changes to be heritable across generations. One effective mechanism in
epigenetic control is DNA methylation, which is defined as an addition of a methyl group
on the five position of cytosine. It has been well studied in mammals, and is usually
associated with reduction of gene transcription (Clark et al., 1994; Oakeley, 1999; Bird,
2002; Watson and Goodman, 2002)

Global methylation can be measured using restriction digests. Site specific methylation
can be determined using restriction enzymes, which cut DNA at specific restriction sites.
Methylation sensitive enzymes can be used as a way to measure DNA methylation (Liu et
al. 2003).

5-azacytidine is a chemical compound that is known to cause de-methylation in

vertebrates and other organisms. This occurs because the chemical causes rapid depletion
of the methyltransferase DNMT1, an enzyme responsible for adding a methyl group to
the DNA strand, resulting in demethylation (Ghoshal et. al 2005). The lack of a methyl
group results in activation of certain genes in normal cells. CpG dinucleotides in gene
transcriptional promoter regions are generally unmethylated (Liu et al. 2003). In a study
using 5-azacytidine on multiple generations of Daphnia, researchers found that de-
methylation occurred across generations (Vandegehchte et al. 2009). The effect of this
chemical compound has yet to be studied in oysters and other invertebrates.

The objective of the current study was to determine the effect of 5-azacytidine on DNA
methylation in the Pacific oyster. To do this, the oysters were exposed to 5-azacytidine
and methylation sensitive restriction enzymes were used to determine methylation and
further quantified using Real time PCR. The hypothesis was that the oysters exposed to
5-azacytidine would have less DNA methylation than unexposed control oysters.

1
Methods and Materials

Oyster collection
Twenty juvenile Pacific oysters (Crassostrea gigas), approximately one year in age were
gathered from Willapa Bay in April 2010. The juveniles were outplanted at the site in
June of 2009. The juveniles were full-siblings (therefore having more genetic similarity
than the wild stock). Average size measurements are as follows height=43mm,
length=32mm, depth=12.3mm.
As a control condition, 5 oysters were placed in a beaker filled with 1L sterile seawater.
The treated condition contained 5 oysters in a beaker with 1L of sterile seawater and an
addition of 7.4mg/L of 5-azacytidine (Arcos Organics, Morris Plains, NJ, USA), which
was the nominal condition found in the Daphnia study (Vandegehuchte et al. 2009). An
air stone was added to both and temperature was controlled at 6 degrees Celsius for three
days

At the end of the third day all oysters were removed. Gill tissue was extracted from each
and stored immediately at -80° C.

DNA isolation
For the first analysis, DNA was isolated following the protocol of the DNeasy Blood and
Tissue kit (Qiagen, Valencia, CA, USA). 20 µl of genomic DNA (gDNA) was run
out onto a 1.2% Agarose gel. Two more isolations were done using the DNAzol protocol
(Molecular Research Center Inc, Cincinnati, Ohio, USA), which involved 60 mg of tissue
being lysed over night in a 500µL solution of DNAzol and proteinase k (Qiagen,
Valencia, CA, USA). Hepes (20 ul) was added to maintain a neutral pH that DNA would
not degrade in (about 7.0 according to mrci). The following steps of the protocol
remained the same.

DNA concentration was determined using a NanoDrop 1000 spectrophotometer

(NanoDrop Technologies, Wilmington, DE, USA). All isolated samples were first
qualified with a 1.2% Agarose gel before restriction enzymes were introduced.

Restriction Enzyme Digests

Two enzymes were used in this study. HpaII cuts at the CpG restriction site CCGG only
if the internal cytosine is unmethylated (Vandegehuchte et al. 2009). The other enzyme,
MspI, cuts at the same restriction site regardless of methylation. Together, these enzymes
can be used to determine if a strand of DNA is methylated, and whether methylation
changes after exposure to certain environmental conditions. See Table 1. Expected
Results Below.

2
 Methylated Unmethylated
CH3
Undigested | + -CCGG- +
-CCGG-
CH3
HpaII | + -CC _
-CCGG- GG-

MspI CH3 _ _
| -CC GG-
-CC GG-
Table 1. Expected Results

The isolated DNA was digested using restriction enzymes HpaII or MspI (New England
BioLabs, Ipswich, MA, USA). Buffers complimentary to each enzyme were used, HpaII
was paired with buffer #1 and MspII paired with buffer #4 (New England BioLabs,
Ipswich, MA, USA). The samples were incubated at 37 °C for 24 hours. HpaII reaction
was stopped 65°C for 20 min and MspI at 80°C for 20 min.
Samples were again visualized on a 1.2 % Agarose gel using 5x Loading dye. 5µl of
DNA hyperladder I was used (BioLine, Taunton, MA, USA)

Heat shock 70 (hsp70) methylation: qPCR

In order to determine if the enzyme cut a specific DNA fragment, corresponding to
HSP70, Real Time PCR was used.

HSP70 cds with Accession number AJ318882 was between 884 and 1260 base pairs
long. EW778441 is a 377 base pair amplicon in HSP70 gene exon region. There were
two restriction sites, either of which could be methylated. (see Figure 4 in Supplemental
Data)

The 25 µl qPCR volume consisted of 1 µl gDNA, 1µl primer (forward and reverse were
combined), 12.5 µl of 2.0x Apex TaqRED Mastermix (1.5mM MgCl2,Genesee
Scientific, San Diego, Ca, USA), 1 µl of 50uM SYTO13 (Invitrogen, Carlsbad, CA,
USA) and 9.5µl of H20 (see Table 2. PCR Concentrations). The primer was determined
to overlap the methylated CpG site (unpublished material) and amplifies HSP70 at an
exon (protein coding region) where we're looking for methylation. The forward/reverse
sequence is 5' TTTGAGAGATGTTAAGTTGGATAAG 3' and
5'CAATACCCAAAAACAAAAAAATAAC 3' respectively.

3
 Master Mix
µL Volume
For 9 Rxn in
µL

2x immomix 12.5 112.5

Pf/Pr 1.0 9.0

50~Syto13 1.0 9.0

H2O 9.5 85.5

Total Volume 24 216

Table 2. PCR concentrations

The PCR settings were as follows the gDNA was denatured at 95°C for 10 minutes
followed by 40 cycles of 95°C for 10 min, 95° for 15s, 55°C for 1s, and 72°C for 30s.
The PCR was then held at 72°C for 10 min.

This experiment was repeated 3 times.

Results

Global Methylation Pattern:

For this study, global methylation was measured by analyzing the gel and comparing the
size of the band in undigested and the enzyme digested samples. In the untreated samples
(sterile seawater), we expect to see high molecular weight band in undigested, a smaller
sized band in HpaII (on gel, this would be a downward "shift" of the smear) and even
smaller in MspI. The reason for this is that HpaII cuts only the sequences that are not
methylated whereas MspI cuts at the restriction site regardless of methylation. The
undigested DNA serves as a control to determine the quality of the uncut gDNA.

In the treated oysters, we expected to see a high molecular band in undigested and an
equal downward shift in the HpaII and MspI enzymes. This would indicate removal of all
methyl groups in the DNA, thus allowing both enzymes ability to cut at the restriction
site.

4
With the DNeasy kit, an unexplained 900 base pair band was seen in all gDNA
undigested samples (See Figures 1, 2, 3 Below). There was a significant shift between
HpaII and MspI in the control group and perhaps an equal shift in the HpaII and MspI
bands for the treated, it is difficult to make an objective judgment because a gel provides
qualitative, not quantitative, data.

Figure 1. Isolated with DNeasy kit Control Samples 3,4

and Treated Samples 3,4,5.

Fig2. Isolated with with DNeasy kit2 using Sample 3
for each. The same 900 bp band is seen
U=undigested (no enzyme),H=HPAI, M=MspII. Note
the 900 bp sized band on each of the undigested.
samples and on some of the H samples
Fig3. Isolated with DNeasy kit3 using sample 3.
Again, a 900 bp band is seen. gDNA only, all
undigested

5
The DNAzol kit produced gel results that did not include a 900bp band. The spec results
showed the yield to be very high, 900ng/ml in the control group and 700ng/ml in the
treated (See Attached Table 5. And Table 6. Spec Results). The gel confirmed this result,
both bands were large and bright.
In both the 5-azacytidine exposed and seawater control samples there was increased
digestion with MspI, indicating detectable methylation was present in both samples.
There did not appear to be a difference between MspI and HpaII across groups,
suggesting the absence of dramatic alteration of global methylation from 5-azacytidine.

Fig.4 The smear produced by the

DNAzol kit was clean of the 900 base
pair band. Both treated and
control

Fig.5 Smears from one control and one

treated that were either undigested or
digested with HpaII or MspI.

6
HSP specific Methylation

PCR results were seen in both digested and undigested, untreated and treated samples
(See Table 3. PCR Results). Methylation status was determined by whether or not a PCR
product was present in the methylation sensitive HpaII digest. A positive result was seen
in HpaII for both the treated and the untreated. Since it is unlikely that an untreated
sample caused demethylation, the results suggest another reason. This is confirmed with
the results of MspI, which is also positive in both conditions.

Table 3. PCR Results

Undigested HpaII MspI

Control + + +

Treated + + +

Efficiency C(t) C(t) values are all between 25-32 which is

relatively normal for the undigested and HpaII
that is not methylated. Because MspI can cut at
Undigested 17.27% 31.07
the restriction site regardless of methylation,
Control

the fluorescence should pass threshold at a later

HpaII 27.74 % 30.59 cycle.

The efficiencies for all samples was very low,

MspI 23.76% 33.84 between 17% and 35% (see Table 4. PCR
Results- Efficiencies and C(t))
Undigested 27.64 27.55
Treated

HpaII 35.02% 29.34

MspI 30.99% 35.55

Table 4. PCR results- Efficiency and C(t)

7
Discussion
In this study, the results did not support the hypothesis that 5-azacytidine causes global
demethylation, however it is possible that partial demethylation occured. The data
indicate the use of spin column kits might not be compatible with restriction enzyme
based methylation analysis in C. gigas. The 900 bp was consistent on all gels where DNA
was isolated with the Qiagen kit. This could be explained by the procedure used being
incompatible with this particular species. The tissue may not have been fully lysed
during isolation or the DNA may not have been fully digested by enzymes.

Had demethylation occurred, we would have seen an equal downward shift in both HpaII
and MspI (of the treated samples) in comparison to the undigested,. This would have told
us that both enzymes were cutting at the CpG cutsite. Because HpaII can only cut if the
DNA is unmethylated, we could have determined that demethylation occurred because of
5-azacytidine. If there was a shift, it was minimal and therefore difficult to make a
conclusion. A shift between the undigested and the enzymes indicates that both enzymes
are cutting at the restriction site. The possibility remains that 5-azacytidine caused partial,
not complete demethylation

In order to examine methylation in a specific gene, HSP70, qPCR was used. The qPCR
was no further conclusive, the first qPCR showed higher amplification for all treated
samples compared to control. This can be attributed to an unknown amount of DNA in
each tube, which is consistent with the bands on the agarose gel. MspI should not have
amplification because it should cut at the restriction site regardless of methylation, the
amplification can be explained by incomplete digestion. The C(t) values are all relatively
normal, with the exception of the samples cut with MspI, which should not have
fluoresced until a later cycle. The low efficiency can be explained by poorly designed
primers, pipetting errors or primer dimers.

Furthermore, other studies have determined that acute tests were inconclusive due to the
instability of such chemicals in aqueous solutions (Lin et al., 1981; Szeto et al., 1989;
Zhao et al., 2004). A more in depth study would have a higher dosing of 5-azacytidine as
well as a longer dosing trial, with the possibility of monitoring concentration levels and
switching the water out. It is also difficult to tell because if de-methylation occurred by
only looking at this generation. A multi-generational study would give more information
about the change that occurred because of the chemical.
Because the results are unclear, it is difficult to tell what effects 5-azacytidine have on a
large scale.

8
Supplementary Data.
Table 5. Spec Results for 10 oysters gDNA isolated by DNeasy kit. Control refers to the untreated by 5-azacytidine.

Spec results showing the quantity of all control and treated conditions

Table 6. Spec results showing untreated and treated gDNA isolated with DNAzol

Figure 4.

9
References
Clark, S.J., Harrison, J., Paul, C.L., Frommer, M., 1994. High-sensitivity mapping of

methylated cytosines. Nucleic Acids Res. 22, 2990–2997.

Esteller, M., 2008b. Epigenetics in evolution and disease. Lancet 372, S90–S96.

Ghoshal, K, J Datta, S Majumder, S Bai, H Kutay, T Motiwala, and S T. Jacob. "5-aza-deoxycytidine

Induces Selective Degradation of Dna Methyltransferase 1 by a Proteasomal Pathway That Requires the
Ken Box, Bromo-Adjacent Homology Domain, and Nuclear Localization Signal." Molecular and Cellular
Biology. 25.11 (2005): 4727-4741. Print.

Li, L-C, and R Dahiya. "Methprimer: Designing Primers for Methylation Pcrs." Bioinformatics. 18.11
(2002): 1427-1431. Print.

Lin, K.-T., Momparler, R.L., Rivard, G.E., 1981. High-performance liquid chromtographic analysis of
chemical stability of 5-aza-2′-deoxycytidine. J. Pharm. Sci. 70, 1228–1232.

Oakeley, E.J., 1999. DNA methylation analysis: a review of current methodologies. Pharmacol. Ther. 84,
389–400.

Szeto, S.Y., Burlinson, N.E., Rahe, J.E., Oloffs, P.C., 1989. Kinetics of hydrolysis of the
dicarboximide fungicide vinclozolin. J. Agric. Food Chem. 37, 523–529.

Vandegehuchte, M B, F Lemiere, L Vanhaecke, Berghe W. Vanden, and C R. Janssen. "Direct and

Transgenerational Impact on Daphnia Magna of Chemicals with a Known Effect on Dna Methylation."
Comparative Biochemistry and Physiology Part C Toxicology and Pharmacology. 151.3 (2010): 278-285.
Print.

Vandegehuchte, M B, T Kyndt, B Vanholme, A Haegeman, G Gheysen, and C R. Janssen. "Occurrence of

Dna Methylation in Daphnia Magna and Influence of Multigeneration Cd Exposure." Environment
International. 35.4 (2009): 700-706. Print.

Watson, R.E., Goodman, J.I., 2002. Epigenetics and DNA methylation come of age in
toxicology. Toxicol. Sci. 67, 11–16.

Zhao, M., Rudek, M.A., He, P., Hartke, C., Gore, S., Carducci, M.A., Baker, S.D., 2004. Quantification of
5-azacytidine in plasma by electrospray tandem mass spectrom- etry coupled with high-performance liquid
chromatography. J. Chromatogr. B 813,
81–88.

10