ALGAL-00234; No of Pages 6

Algal Research xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Algal Research
journal homepage: www.elsevier.com/locate/algal

Screening and phylogenetic analysis of lipid-rich microalgae

Ling Li a,b, Jing Cui a,b, Qian Liu a,b, Yancong Ding a, Jianguo Liu a,b,⁎
a
Institute of Oceanology, Chinese Academy of Sciences, Qingdao, Shandong 266071, China
b
Nantong Branch, Institute of Oceanology, Chinese Academy of Sciences, Nantong, Jiangsu 226004, China

a r t i c l e i n f o a b s t r a c t

Article history: Microalgae are considered to be a potential alternative source for the production of biofuels, and isolation of
Received 7 July 2014 microalgae capable of high lipid concentration and high biomass production is the foundation for microalgal
Received in revised form 7 December 2014 biofuel development. To date, over 1200 microalgal clones have been isolated in our laboratory. Among them, 37
Accepted 18 February 2015
strains were identified and further compared based on total lipid content, growth rate and biomass production.
Available online xxxx
From the ITS1-5.8S-ITS2 sequences and morphological characteristics, these strains were identified as belonging
Keywords:
to the genera Scenedesmus, Chlorella, Stichococcus, Nannochloropsis, Tetraselmis, Isochrysis, Phaeodactylum and
Microalgae Cylindrotheca. The lipid content of these strains varied from 6% dry weight (dw) to 42% dw. All three Isochrysis
Lipid content galbana strains could accumulate lipid at more than 35% dw, and their average was the highest among the tested
Growth rate genera (P b 0.05), followed by genera Nannochloropsis and Chlorella. Based on the phylogenetic data, a taxonomic
Biomass pattern of lipid accumulation was found in microalgae, which suggested that a genera strategy should be considered
Phylogenetic analysis in screening for lipid-rich microalgal strains. A comprehensive consideration of growth rate, biomass production and
lipid content indicated that marine species Nannochloropsis maritima strain IOAC710S, and I. galbana strains
IOAC683S and IOAC724S could be promising candidates for biodiesel feedstock.
© 2015 Elsevier B.V. All rights reserved.

1. Introduction
Rapid depletion of fossil fuel reserves and concerns over global
warming has received worldwide attention in recent years. According
to many analysts, the world fossil oil reserves will be exhausted in less
than 50 years at the present rate of consumption [1]. Fossil fuel combus-
tion also contributes to global warming by releasing greenhouse gases
such as CO2. Thus, research on renewable, carbon neutral, economically
viable, alternative sources of energy is needed.
Biodiesel from microalgae is one promising alternative, because it is
generally comparable to diesel fuel in terms of its physical and fuel
properties [2], but contributes neither net carbon dioxide nor sulfur to
the atmosphere and emits less gaseous pollution than petrodiesel [3,
4]. Compared with terrestrial bioenergy crops, microalgae as feedstock
for biofuels have numerous advantages. Oil content of some microalgae
is much higher than that of agricultural oil crops (exceeds 80% of the dry
weight (dw) for Botryococcus braunii vs less than 5%, on a total biomass
basis, for palm and soybean) [5]. On an area basis, microalgae can produce
300 times more oil than soybean [6]. Microalgae have greater photosyn-
thetic efficiency, enjoy faster reproductive cycles, and require a limited
nutrient supply for growth [7–9]. Microalgae can be cultivated in saline
or brackish water along coasts, or on marginal lands (e.g. desert,
Abbreviations: dw, dry weight.
⁎ Corresponding author at: Institute of Oceanology, Chinese Academy of Sciences, 7
Nanhai Road, Qingdao 266071, China.
E-mail address: jgliu@qdio.ac.cn (J. Liu).
arid and semi-arid lands), and do not compete for resources with
conventional agriculture [1,8]. In addition, microalgae can assimi-
late CO2 and utilize nitrogen and phosphorus from wastewater, pro-
viding the additional benefits of greenhouse gas emission reduction
and wastewater bioremediation [8,10,11].
Based on the above advantages, biodiesel from microalgae is con-
sidered to be the only renewable biofuel having the potential to displace
petroleum-derived transport fuels without affecting the food supply
and other crop products [5]. However, the commercial production and
large-scale use of biofuel from microalgae have been hindered by its
high cost. Based on a biomass productivity of 20 g m− 2 day− 1 and
an average lipid content of 24% dw, extracted at no further cost, bio-
fuel from microalgae cost $209 US/bbl, whereas the petroleum oil
price is only around $90 US/bbl [12]. To reduce the high cost of biofuel
from microalgae, some strategies have been explored, such as selecting
productive strains [13,14], optimizing cultivation conditions [15–17], de-
veloping efficient harvesting methods [18,19], combining microalgal cul-
tivation with wastewater treatment [20,21], and so on. Among them,
isolation of microalgae with a high lipid content and high biomass pro-
ductivity is the first critical step towards the commercial production of
microalgal biofuel [22,23]. As the total number of microalgal species is
large (if the highest estimate is to be believed, the number of diatom
species alone may reach 10 million [24]), collection and isolation of
new, high-lipid-producing, microalgal strains from the natural environ-
ment presents a heavy workload challenge.
Since the 1970s, several countries have funded research programs to
screen microalgae for renewable liquid fuel production [1]. Around

http://dx.doi.org/10.1016/j.algal.2015.02.028
2211-9264/© 2015 Elsevier B.V. All rights reserved.

Please cite this article as: L. Li, et al., Screening and phylogenetic analysis of lipid-rich microalgae, Algal Res. (2015), http://dx.doi.org/10.1016/
j.algal.2015.02.028
2 L. Li et al. / Algal Research xxx (2015) xxx–xxx
30,000 species have already been identified [25], and many microalgal
species belonging to Botryococcus [26], Chaetoceros [27], Chlorella [28],
Dunaliella [29], Haematococcus [30], Isochrysis [31], Nannochloropsis
[32], Scenedesmus [33] etc. have been investigated for their lipid con-
tent. Significant differences between various species have been found;
for example, lipid content in Chlorella zofingiensis can reach 65.1%, by
weight, of dry biomass [34], while that of Chaetoceros socialis is only
2.2% dw [23]. How the lipid-rich strains distribute among clades
of microalgae, or whether the lipid content of strains with a closer
phylogenic relationship is similar is unknown. Clarification of this situ-
ation would benefit further isolation of new microalgae having a high
lipid content. Besides lipid content, growth rate and biomass production
should also be considered when isolating candidate strains for biofuel
production. In this study, 37 strains were isolated and tested for their
lipid content, and a phylogenetic tree was constructed to determine if
there were taxonomic patterns of lipid production. In addition, the
growth rate and biomass of some lipid-rich strains were also investigat-
ed and compared, so as to select potential strains for biofuel production.
2. Materials and methods
2.1. Collection of water samples
Marine and fresh water samples were collected in the four seasons
for isolation of lipid-rich microalgae. The marine water samples were
collected from the China Seas and the Western Pacific Ocean. Fresh
water samples were obtained from lakes in terrestrial areas including
mountainous regions.
The water samples were filtered soon after collection. About 300 ml
of each sample was first passed through a 60-μm plankton net to
remove protozoa, and then algae were collected using a 0.45 μm filter
membrane. The microalgae on the filter membrane were cultivated on
plates with solid medium, which consisted of 1.3% agar plus L1 medium
[35] for marine samples, or MCM medium [36] for freshwater samples.
The solid plates were incubated at 25 ± 1 °C using a 14:10 light:dark
cycle under 20 μmol photon m−2 s−1 illumination.
2.2. Isolation of microalgal clones
After 4–12 weeks, micro-colonies grown on the solid medium were
streaked onto new plates with corresponding medium, which were cul-
tivated under the same conditions as above for a further 4–8 weeks. This
process was repeated many times until axenic microalgal colonies were
obtained. Then the clonal colonies were kept as pure cultures in the
algal collection (IOAC) of the Institute of Oceanology, Chinese Academy
of Sciences (IOCAS).
2.3. Microalgal strains and culture conditions
The purified freshwater microalgal strains were transferred to MCM
liquid medium, and marine strains were transferred to L1 liquid medi-
um for further experimentation. The strains were cultured in conical
flasks (500 ml) containing 300 ml fresh medium, with three replicates
of each strain. The culture conditions were 25 ± 1 °C, and a 14 h:10 h
light:dark rhythm at a light intensity of 20 μmol photon m−2 s− 1,
with illumination provided from the top by cool-white fluorescent
lamps. During the growth periods, the microalgal cultures were manu-
ally shaken 2–3 times daily to avoid sticking.
For each strain, the cells were observed using a 37XB inverted micro-
scope (Shanghai, China) to determine their morphological characteristics.
2.4. DNA isolation and sequencing
About 40 ml of each algal culture at the logarithmic phase was
centrifuged (4000×g, 6 min), and DNA was extracted using the Univer-
sal Genomic DNA Extraction Kit Ver.3.0 (TaKaRa, Dalian). The primers
Please cite this article as: L. Li, et al., Screening and phylogenetic analysis of lipid-rich microalgae, Algal Res. (2015), http://dx.doi.org/10.1016/
j.algal.2015.02.028
used for DNA amplification of the ITS1-5.8S-ITS2 region of the ribosome
were ITS-F1 (forward): 5′ GAAGTCGTAACAAGGTTTCC 3′, and ITS-R1
(reverse): 5′ TCCTGGTTAGTTTCTTTTCC 3′ [37]. The following thermal
profile was used: 94 °C for 5 min; 35 cycles of 94 °C for 30 s, 50 °C for
30 s and 72 °C for 90 s; and a further 10 min elongation at 72 °C. The
PCR products were purified using TaKaRa MiniBEST Agarose Gel DNA
Extraction Kit Ver. 3.0 (TaKaRa, Dalian), and then sequenced by
Invitrogen Biotechnology Co., Ltd. (Shanghai) with an ABI 377 se-
quencer. The overlapping fragments were assembled using the Contig
Express program in the Vector NTI software package (Version 11).
2.5. Sequence analysis
The amplified sequences were analyzed using the Basic Local Align-
ment Search Tool (BLAST) algorithm at the National Centre for Biotech-
nology Information (http://www.ncbi.nlm.nih.gov/blast) to identify the
species of microalgae. The ribosomal ITS1-5.8S-ITS2 regions were
aligned using the ClustalW Multiple Alignment program (http://www.
ebi.ac.uk/clustalw/). A neighbor-joining (NJ) algorithm-based, [38]
unrooted, phylogenetic tree was constructed using MEGA 5.05 software
[39]. Bootstrap analysis [40] was used with 1000 replications to test the
relative support for the branches produced by NJ analysis.
2.6. Growth, biomass and total lipid measurements
Every 24 h, the optical density (OD) of each culture was determined
at 750 nm [1] using a 722 s-type spectrophotometer, and the growth
curves were drawn based on the OD750 measurements. The specific
growth rate was calculated according to the daily changes of absorbance
during the logarithmic phase (Fig. S1). For biomass determination,
200 ml of each culture was collected at stationary phase (Fig. S1), and
then centrifuged at 4000 ×g for 10 min to harvest the cells. The algal pel-
lets were rinsed with 40 ml deionized water, centrifuged again, freeze-
dried at −50 °C, and then the dry weight was determined gravimetri-
cally. The algal powders were stored at −20 °C for total lipid analysis.
Total lipid was extracted according to the protocol of Bligh and Dye
[41] with some modification. For each sample, about 25 mg algal pow-
der (W) was mixed with 2 ml chloroform and 1 ml methanol by vortex
for 2 min, and then kept at room temperature for 24 h. Then the mixture
was centrifuged at 4000 ×g for 10 min, and the supernatant was trans-
ferred into a pre-weighed vial (W1). The algal residue was mixed with
another 1 ml of chloroform/methanol (2:1, v/v) by vortex, and then cen-
trifuged as described above. After that, the supernatants were combined
and dried in an oven at 70 °C to a constant weight (W2). The lipid
content of each sample was measured gravimetrically and calculated
as follows: total lipid (% dry weight) = (W2 − W1) / W × 100.
2.7. Statistical analysis
Statistical analyses were performed using the SPSS 16.0 software.
The growth rate, biomass and lipid content data for freshwater/marine
microalgal strains belonging to different genera were analyzed using a
one-way analysis of variance (ANOVA). Correlation of growth rate and
biomass with lipid content was analyzed using bivariate correlations,
and the Pearson's correlation coefficients are given with their signifi-
cance levels. Differences are considered significant at P b 0.05. All data
throughout the paper are given as mean ± SE.
3. Results and discussion
3.1. Isolation and identification of microalgal strains
To date, over 1200 single-cell clones of unicellular microalgae have
been isolated in our laboratory. Among them, five freshwater strains
and 32 marine strains were identified and used for further analysis. By
alignment and comparison of the ITS1-5.8S-ITS2 sequences with other
 L. Li et al. / Algal Research xxx (2015) xxx–xxx 3

known microalgae in the GenBank database, selected isolates were classi-
fied as Chlorophyta, Chrysophyta and Bacillariophyta, belonging to eight
different genera: Scenedesmus, Chlorella, Stichococcus, Nannochloropsis,
Tetraselmis, Isochrysis, Phaeodactylum and Cylindrotheca. Combined
with morphological characters, two strains of microalgae were iden-
tified as Chlorella sorokiniana, three as Isochrysis galbana, three as
Phaeodactylum tricornutum, and another six as Scenedesmus obliquus,
Chlorella protothecoides, Nannochloropsis maritima, Tetraselmis marina,
Tetraselmis striata and Cylindrotheca fusiformis. The data for these strains
are listed in Table 1.
3.2. Lipid content analysis
Lipid contents of the isolated strains were highly variable, with an
average lipid content of 20.04% dw (Table 1). The lowest lipid content
(6% dw) was found in marine Stichococcus sp. strain IOAC803S, and
the highest lipid content (42% dw) was found in the marine I. galbana
strain IOAC724S. This result is similar to the reports of a review paper,
in which the lipid contents of 54 microalgal strains were between 5%
dw and 51% dw, with an average of 23% dw [42]. The total lipid content
of approximately half of the isolated microalgal strains was greater than
or equal to 20% dw (Table 1). Among them, the total lipid content of the
marine species Chlorella sp. strain IOAC1179S, N. maritima strain
IOAC710S, I. galbana strains IOAC683S, IOAC723S and IOAC724S reached
or exceeded 30% dw.
The average lipid content of freshwater strains and marine strains
was 16.00% dw and 20.67% dw, respectively, and no significant difference
was found between them (P N 0.05), thus making strain selection depen-
dent on other factors. The lipid concentrations of three I. galbana strains
were all higher than 35% dw, which is in agreement with the values
reported by Fidalgo et al. [43]. The average lipid content of Isochrysis iso-
lates was 38.67% dw (Fig. 1), which is significantly higher than the other
genera (P b 0.05). The total lipid levels of the Nannochloropsis strains are
higher than the values reported by Pereira et al. [44], but lower than
that reported by Doan et al. [23]. Their average lipid content (26.90
dw%) was significantly higher than that of the genera Scenedesmus
(13.67 dw%), Stichococcus (16.78 dw%), Tetraselmis (17.07 dw%),
Phaeodactylum (17.92 dw%) and Cylindrotheca (17.50 dw%) (P b 0.05),
but not significantly different than Chlorella (22.34 dw%) (P N 0.05). The
lipid content range of Chlorella strains was 17% dw to 30% dw, which is
in agreement with a previously reported range of 13% dw to 31% dw
[42]. The average lipid content of genus Chlorella was significantly higher
than genera Scenedesmus and Stichococcus (P b 0.05), but not significantly
different than genera Nannochloropsis, Tetraselmis, Phaeodactylum
and Cylindrotheca (P N 0.05). No significant difference was found
for the average lipid contents of genera Scenedesmus, Stichococcus,
Tetraselmis, Phaeodactylum and Cylindrotheca (P N 0.05).

Table 1 3.3. Phylogenetic analysis of lipid content

Genera, accession numbers of ITS1-5.8S-ITS2 sequences, and lipid contents of isolated
strains.
As significant differences for average lipid content were found
Phyla Strain Genera/Species Accession Lipid among different genera, taxonomic patterns of lipid production might
number content exist among microalgae. In order to test this hypothesis, a phylogenetic
(% dw)
tree was constructed using gene sequences of the ribosomal ITS1-5.8S-
Chlorophyta IOAC035F Scenedesmus sp. KC800950 9 ± 0.82 ITS2 regions of the isolated strains. The amplified gene sequences were
IOAC081F Scenedesmus obliquus KC800949 12 ± 1.26
deposited in GenBank, and their accession numbers are listed in Table 1.
IOAC744S Scenedesmus sp. KC800948 20 ± 1.42
IOAC038F Chlorella protothecoides KC137969 20 ± 1.53 Based on the phylogenetic tree, these strains were grouped into eight
IOAC085F Chlorella sorokiniana JX987093 17 ± 1.00 clusters, which was consistent with their taxonomic assignments
IOAC086F Chlorella sorokiniana KC137968 22 ± 0.58 (Fig. 2). The phylogenetic data showed that the strains with low lipid con-
IOAC689S Chlorella sp. KC137972 22.7 ± 1.18 tent (b 20% dw) mainly belonged to the genera Stichococcus, Scenedesmus,
IOAC1179S Chlorella sp. KC800943 30 ± 1.15
IOAC542S Stichococcus sp. KC817132 13 ± 0.82
Tetraselmis and Phaeodactylum, while no strains with high lipid content
IOAC549S Stichococcus sp. KC817133 20 ± 1.37 (N30% dw) were found in these four genera. All the strains belonging to
IOAC557S Stichococcus sp. KC817130 14 ± 1.63 genus Isochrysis had high lipid content (N 30% dw), while genera Chlorella
IOAC581S Stichococcus sp. KC817131 26 ± 1.29 and Nannochloropsis each contained one strain with a lipid content higher
IOAC621S Stichococcus sp. KC817135 28 ± 1.04
than or equal to 30% dw. This indicated that the ability to accumu-
IOAC783S Stichococcus sp. KC817136 14 ± 0.69
IOAC794S Stichococcus sp. KC817126 15 ± 0.81 late abundant lipid lay predominantly within the genera Isochrysis,
IOAC803S Stichococcus sp. KC817134 6 ± 0.58 Nannochloropsis and Chlorella.
IOAC804S Stichococcus sp. KC817124 16.67 ± 1.67
IOAC805S Stichococcus sp. KC817137 12 ± 1.53
IOAC852S Stichococcus sp. KC817127 15 ± 1.03
IOAC857S Stichococcus sp. KC817128 20 ± 0.73
IOAC873S Stichococcus sp. KC817125 16 ± 2.00
IOAC878s Stichococcus sp. KC817129 19.3 ± 1.35
IOAC710S Nannochloropsis KC800944 30.7 ± 1.18
maritima
IOAC759S Nannochloropsis sp. KC800946 22 ± 1.53
IOAC843S Nannochloropsis sp. KC800947 28 ± 0.90
IOAC331S Tetraselmis marina KC800942 14 ± 1.63
IOAC703S Tetraselmis sp. KC137976 20 ± 1.21
IOAC706S Tetraselmis striata KC800932 18.3 ± 1.30
IOAC712S Tetraselmis sp. KC800935 16 ± 2.08
Chrysophyta IOAC683S Isochrysis galbana JX393297 38 ± 1.25
IOAC723S Isochrysis galbana KC800941 36 ± 1.01
IOAC724S Isochrysis galbana JX393298 42 ± 0.80
Bacillariophyta IOAC680S Phaeodactylum KC800938 18.3 ± 1.55
tricornutum
IOAC735S Phaeodactylum KC800940 14.3 ± 1.19
tricornutum
IOAC742S Phaeodactylum KC800936 21.15 ± 0.63
tricornutum
IOAC733S Cylindrotheca fusiformis KJ019016 15 ± 1.65
Fig. 1. Comparison of average lipid content of different genera. Different letters indicate
IOAC738S Cylindrotheca sp. KJ019017 20 ± 1.15
significant differences observed using ANOVA (P b 0.05).

Please cite this article as: L. Li, et al., Screening and phylogenetic analysis of lipid-rich microalgae, Algal Res. (2015), http://dx.doi.org/10.1016/
j.algal.2015.02.028
4 L. Li et al. / Algal Research xxx (2015) xxx–xxx

Fig. 2. Unrooted phylogenetic tree of isolated strains using the ITS1-5.8S-ITS2 sequences. The lipid content (% dw) of strains is indicated after the name of each strain. Strains with a lipid
content higher than or equal to 30% dw are boxed, while those with lipid contents lower than 20% dw are underlined. The tree was constructed by the neighbor-joining (NJ) method in
MEGA 5.05 software based on the multiple sequence alignment by ClustalW. Bootstrap support values of 1000 replicates (%) are shown at the nodes. The accession numbers of the se-
quences are listed in Table 1.

The lipid concentration varied by up to 36% dw between strains from
different genera, while lipid concentration within genera varied from 5%
dw to 22% dw (Fig. 2). Within a genus, the difference in lipid content
between strains in the same clade was generally smaller than that
between different clades. In other words, phylogenetically closely relat-
ed strains had similar lipid levels. For example, the difference in lipid
level between Nannochloropsis sp. strains IOAC759S and IOAC843S,
which were in the same clade, was 6% dw, while that between
Nannochloropsis sp. strains IOAC759S and IOAC710S, which were
in different clades, was 8.7% dw. Similar observations were made
in genera Stichococcus, Scenedesmus, Tetraselmis and Phaeodactylum. Com-
bined with the significant differences found among various genera, these
results suggest that a taxonomic pattern of lipid accumulation might exist
among microalgae. Similarly, higher degrees of similarity in DHA produc-
tion and fatty acid profiles have been found within strains having closer
phylogenic relationships [45]. Future work may profit by obtaining spe-
cies from the genera with high average lipid contents (for example,
Isochrysis, Nannochloropsis and Chlorella) and testing them for their ability
to accumulate lipid.
3.4. Growth and biomass analysis
Besides lipid content, growth rate and biomass production were also
two important factors for isolation of candidate strains for biofuel pro-
duction. The specific growth rate and biomass of the strains in genera
Isochrysis, Nannochloropsis and Chlorella, which three had the highest

Please cite this article as: L. Li, et al., Screening and phylogenetic analysis of lipid-rich microalgae, Algal Res. (2015), http://dx.doi.org/10.1016/
j.algal.2015.02.028
 L. Li et al. / Algal Research xxx (2015) xxx–xxx 5

average lipid contents, were measured. The highest growth rate

was 0.190 d−1 for Nannochloropsis sp. strain IOAC759S, and the lowest
growth rate was 0.059 d−1 for Chlorella sp. strain IOAC689S (Table 2).
These data are lower than previous reports. For example, the specific
growth rate of Nannochloropsis spp. was reported to be from 0.42 d−1
to 0.62 d− 1 [23], while in this study, it varied from 0.13 d− 1 to
0.19 d−1. It is likely that the different cultivation media (L1 medium vs
f/2 medium) and lower light intensity (20 μmol photon m− 2 s−1 vs
60 μmol photon m− 2 s− 1) contributed to the lower growth rate. On
the other hand, the strains we isolated might well be different from
those in the previous study and thus might have different intrinsic growth
rates. The average growth rates of genera Chlorella, Nannochloropsis and
Isochrysis were 0.11 d−1, 0.17 d−1 and 0.14 d−1, respectively, and no sig-
nificant difference was found among them (Fig. 3). The specific growth
rate of microalgae could be affected by many factors, such as nutrients,
temperature, light intensity, light/dark cycle, CO2 enrichment and so on
[29,46]. In order to compare their growth rates directly, all of the strains
were grown under a standard condition, without individual optimization.
Fig. 3. Comparison of average specific growth rates of different genera. No significant dif-
This might decrease the growth rates of some strains, and result in the
ference exists among different genera.
small differences among them. The biomass of the 11 strains at stationary
phase ranged from 246 mg/L (Chlorella sp. strain IOAC1179S) to 608 mg/L
(C. protothecoides strain IOAC038F) (Table 2). The average biomass of
and its lipid content could increase to about 55.6% dw under nutrient
different genera was 431.60 mg/L for Chlorella, 404.43 mg/L for
deprivation conditions, with fatty acids of C14–C18 carbon chain length
Nannochloropsis, and 367.45 mg/L for Isochrysis (Fig. 4). Similar to
around 90% of the total fatty acids, indicating that it would be a very
growth rate, no significant difference in average biomass was found
promising microalgal candidate for biofuel production [48].
among different genera (P N 0.05).

3.5. Correlation of growth rate and biomass with lipid content

4. Conclusions

Some researchers have suggested that biomass productivity and

Among over 1200 microalgal clones isolated from various habitats, 37
lipid content are inversely related, due to the high metabolic cost of
strains belonging to the genera Scenedesmus, Chlorella, Stichococcus,
lipid biosynthesis [1]. To test if high biomass or growth rate excluded
Nannochloropsis, Tetraselmis, Isochrysis, Phaeodactylum and Cylindrotheca
a high lipid concentration, correlation coefficients were calculated for
were compared based on their total lipid production, growth rate and
the strains in the genera Isochrysis, Nannochloropsis and Chlorella. The
final biomass production. The lipid content of isolates representing the
Pearson's correlation coefficient between growth rate and lipid content
genus Isochrysis was the highest (P b 0.05), followed by those for genera
was 0.089, and no significant correlation was found between these two
Nannochloropsis and Chlorella. Higher similarities in lipid concentration
parameters (P N 0.05). Similarly, no significant correlation was found be-
were found among the strains having closer phylogenic relation-
tween biomass and lipid content (Pearson's correlation coefficient =
ships, indicating a taxonomic pattern of lipid accumulation in
0.205, P N 0.05). This result is similar to that found by Hempel et al.,
microalgae. N. maritima and I. galbana, which showed a good combi-
who found no relationship between biomass productivity and the
nation of growth rate, biomass production and lipid content, might
amounts of lipids, fatty acids or amino acids present [47].
be suitable candidates for lipid production.
Supplementary data to this article can be found online at http://dx.
3.6. Selection of potential strains for biofuel production doi.org/10.1016/j.algal.2015.02.028.

Based on the comprehensive consideration of growth rate, biomass

and lipid content, marine species N. maritima strain IOAC710S and
I. galbana strains IOAC683S and IOAC724S seem to be the most promis-
ing lipid producers (Tables 1, 2). This is especially so because our previ-
ous research found that the growth rate of I. galbana strain IOAC724S
could reach up to 0.59 d− 1 to 1.0 d− 1 under optimized conditions,

Table 2
Biomass and growth rates of isolated microalgal strains.

Strain Species Biomass (mg/L) Growth rate (d−1)

IOAC038F Chlorella protothecoides 608 ± 10.42 0.166 ± 0.001

IOAC085F Chlorella sorokiniana 381 ± 5.51 0.118 ± 0.002
IOAC086F Chlorella sorokiniana 516 ± 19.55 0.136 ± 0.006
IOAC689S Chlorella sp. 407 ± 17.67 0.059 ± 0.002
IOAC1179S Chlorella sp. 246 ± 14.31 0.078 ± 0.002
IOAC710S Nannochloropsis maritima 502.99 ± 18.16 0.132 ± 0.003
IOAC759S Nannochloropsis sp. 423.3 ± 13.26 0.190 ± 0.001
IOAC843S Nannochloropsis sp. 287 ± 8.21 0.187 ± 0.002
IOAC683S Isochrysis galbana 392.09 ± 13.78 0.155 ± 0.005
IOAC723S Isochrysis galbana 367.19 ± 5.24 0.115 ± 0.003
Fig. 4. Comparison of average biomass of different genera. No significant difference exists
IOAC724S Isochrysis galbana 343.08 ± 6.66 0.162 ± 0.002
among different genera.

Please cite this article as: L. Li, et al., Screening and phylogenetic analysis of lipid-rich microalgae, Algal Res. (2015), http://dx.doi.org/10.1016/
j.algal.2015.02.028
6 L. Li et al. / Algal Research xxx (2015) xxx–xxx
Acknowledgments
We thank Wei Lin, Yuan Huang, Zhen Zhang, Xuefei Fang and
Chunmei Han for their work in water sampling, algal isolation, purifica-
tion and preservation of pure strains. Special respect is paid to Dr. John
Van Der Meer (Pan-American Marine Biotechnology Association) for his
assistance with proofreading. This work was financially supported by
the National Basic Research Program of China (973 Program, No.
2011CB200900), the Key Project of the Jiangsu Natural Science Founda-
tion (BK2011009), the Marine Renewable Energy Project of the State
Oceanic Administration (GHME2011SW03), and the Chinese National
High-Tech Research and Development Program (863 Program, No.
2008AA09Z403).
References
[1] L. Rodolfi, G. Chini Zittelli, N. Bassi, G. Padovani, N. Biondi, G. Bonini, M.R. Tredici,
Microalgae for oil: strain selection, induction of lipid synthesis and outdoor mass
cultivation in a low-cost photobioreactor, Biotechnol. Bioeng. 102 (2009) 100–112.
[2] H. Xu, X. Miao, Q. Wu, High quality biodiesel production from a microalga Chlorella
protothecoides by heterotrophic growth in fermenters, J. Biotechnol. 126 (2006)
499–507.
[3] G. Vicente, M. Martınez, J. Aracil, Integrated biodiesel production: a comparison of
different homogeneous catalysts systems, Bioresour. Technol. 92 (2004) 297–305.
[4] X. Lang, A. Dalai, N. Bakhshi, M. Reaney, P. Hertz, Preparation and characterization of
bio-diesels from various bio-oils, Bioresour. Technol. 80 (2001) 53–62.
[5] Y. Chisti, Biodiesel from microalgae beats bioethanol, Trends Biotechnol. 26 (2008)
126–131.
[6] Y. Chisti, Biodiesel from microalgae, Biotechnol. Adv. 25 (2007) 294–306.
[7] J.M. Gordon, J.E. Polle, Ultrahigh bioproductivity from algae, Appl. Microbiol.
Biotechnol. 76 (2007) 969–975.
[8] Q. Hu, M. Sommerfeld, E. Jarvis, M. Ghirardi, M. Posewitz, M. Seibert, A. Darzins,
Microalgal triacylglycerols as feedstocks for biofuel production: perspectives and
advances, Plant J. 54 (2008) 621–639.
[9] E.G. Shay, Diesel fuel from vegetable oils: status and opportunities, Biomass
Bioenergy 4 (1993) 227–242.
[10] Y.S. Yun, S.B. Lee, J.M. Park, C.I. Lee, J.W. Yang, Carbon dioxide fixation by algal
cultivation using wastewater nutrients, J. Chem. Technol. Biotechnol. 69 (1997)
451–455.
[11] A. Converti, A.A. Casazza, E.Y. Ortiz, P. Perego, M. Del Borghi, Effect of temperature
and nitrogen concentration on the growth and lipid content of Nannochloropsis
oculata and Chlorella vulgaris for biodiesel production, Chem. Eng. Process. 48
(2009) 1146–1151.
[12] P.M. Schenk, S.R. Thomas-Hall, E. Stephens, U.C. Marx, J.H. Mussgnug, C. Posten, O.
Kruse, B. Hankamer, Second generation biofuels: high-efficiency microalgae for bio-
diesel production, Bioenergy Res. 1 (2008) 20–43.
[13] E. Sydney, T. Da Silva, A. Tokarski, A. Novak, J. De Carvalho, A. Woiciecohwski, C.
Larroche, C. Soccol, Screening of microalgae with potential for biodiesel production
and nutrient removal from treated domestic sewage, Appl. Energy 88 (2011)
3291–3294.
[14] C. Yoo, S.Y. Jun, J.Y. Lee, C.Y. Ahn, H.M. Oh, Selection of microalgae for lipid production
under high levels carbon dioxide, Bioresour. Technol. 101 (2010) S71–S74.
[15] F. Han, J. Huang, Y. Li, W. Wang, J. Wang, J. Fan, G. Shen, Enhancement of microalgal
biomass and lipid productivities by a model of photoautotrophic culture with
heterotrophic cells as seed, Bioresour. Technol. 118 (2012) 431–437.
[16] T. Wang, S. Liu, J. Liu, J. Liu, Y. Yi, Effects of exogenous carbon sources and salinity
on the growth and oil accumulation of Nannochloropsis sp. QA2, Plant Physiol. J.
49 (2013) 909–916.
[17] Y. Ding, Q. Gao, J. Liu, Y. Yi, J. Liu, W. Lin, Effect of environmental factors on growth of
Chlorella sp. and optimization of culture conditions for high oil production, Acta
Ecol. Sin. 31 (2011) 5307–5315.
[18] Y.R. Hu, F. Wang, S.K. Wang, C.Z. Liu, C. Guo, Efficient harvesting of marine
microalgae Nannochloropsis maritima using magnetic nanoparticles, Bioresour.
Technol. 138 (2013) 387–390.
[19] W. Farooq, Y.C. Lee, J.I. Han, C.H. Darpito, M. Choi, J.W. Yang, Efficient microalgae
harvesting by organo-building blocks of nanoclays, Green Chem. 15 (2013)
749–755.
[20] M.K. Ji, R.A.I. Abou-Shanab, S.H. Kim, E. Salama, S.H. Lee, A.N. Kabra, Y.S. Lee, S. Hong, B.H.
Jeon, Cultivation of microalgae species in tertiary municipal wastewater supplemented
with CO2 for nutrient removal and biomass production, Ecol. Eng. 58 (2013) 142–148.
Please cite this article as: L. Li, et al., Screening and phylogenetic analysis of lipid-rich microalgae, Algal Res. (2015), http://dx.doi.org/10.1016/
j.algal.2015.02.028
[21] B. Hu, W.G. Zhou, M. Min, Z.Y. Du, P. Chen, X.C. Ma, Y.H. Liu, H.W. Lei, J. Shi, R. Ruan,
Development of an effective acidogenically digested swine manure-based algal
system for improved wastewater treatment and biofuel and feed production,
Appl. Energy 107 (2013) 255–263.
[22] I. Rawat, R. Ranjith Kumar, T. Mutanda, F. Bux, Biodiesel from microalgae: a critical
evaluation from laboratory to large scale production, Appl. Energy 103 (2012)
444–467.
[23] T.T.Y. Doan, B. Sivaloganathan, J.P. Obbard, Screening of marine microalgae for
biodiesel feedstock, Biomass Bioenergy 35 (2011) 2534–2544.
[24] T.A. Norton, M. Melkonian, R.A. Andersen, Algal biodiversity, Phycologia 35 (1996)
308–326.
[25] T.M. Mata, A.A. Martins, N.S. Caetano, Microalgae for biodiesel production and other
applications: a review, Renew. Sust. Energ. Rev. 14 (2010) 217–232.
[26] P.F. Cheng, B. Ji, L.L. Gao, W. Zhang, J.F. Wang, T.Z. Liu, The growth, lipid and hydro-
carbon production of Botryococcus braunii with attached cultivation, Bioresour.
Technol. 138 (2013) 95–100.
[27] K.M. McGinnis, T.A. Dempster, M.R. Sommerfeld, Characterization of the growth and
lipid content of the diatom Chaetoceros muelleri, J. Appl. Phycol. 9 (1997) 19–24.
[28] A.M. Aguirre, A. Bassi, Investigation of biomass concentration, lipid production, and
cellulose content in Chlorella vulgaris cultures using response surface methodology,
Biotechnol. Bioeng. 110 (2013) 2114–2122.
[29] M. Chen, H.Y. Tang, H.Z. Ma, T.C. Holland, K.Y.S. Ng, S.O. Salley, Effect of nutrients on
growth and lipid accumulation in the green algae Dunaliella tertiolecta, Bioresour.
Technol. 102 (2011) 1649–1655.
[30] S.K. Saha, E. McHugh, J. Hayes, S. Moane, D. Walsh, P. Murray, Effect of various stress-
regulatory factors on biomass and lipid production in microalga Haematococcus
pluvialis, Bioresour. Technol. 128 (2013) 118–124.
[31] P.P. Song, L. Li, J.G. Liu, Proteomic analysis in nitrogen-deprived Isochrysis galbana
during lipid accumulation, PLoS One 8 (2013).
[32] M.L. Bartley, W.J. Boeing, A.A. Corcoran, F.O. Holguin, T. Schaub, Effects of salinity
on growth and lipid accumulation of biofuel microalga Nannochloropsis salina and
invading organisms, Biomass Bioenergy 54 (2013) 83–88.
[33] M.T. Arias-Penaranda, E. Cristiani-Urbina, C. Montes-Horcasitas, F. Esparza-Garcia, G.
Torzillo, R. Canizares-Villanueva, Scenedesmus incrassatulus CLHE-Si01: a potential
source of renewable lipid for high quality biodiesel production, Bioresour. Technol.
140 (2013) 158–164.
[34] P.Z. Feng, Z.Y. Deng, L. Fan, Z.Y. Hu, Lipid accumulation and growth characteristics of
Chlorella zofingiensis under different nitrate and phosphate concentrations, J. Biosci.
Bioeng. 114 (2012) 405–410.
[35] R.R.L. Guillard, P.E. Hargraves, Stichochrysis immobilis is a diatom, not a chrysophyte,
Phycologia 32 (1993) 234–236.
[36] Y. Sun, J. Liu, X. Zhang, W. Lin, Strain H2-419-4 of Haematococcus pluvialis induced
by ethyl methanesulphonate and ultraviolet radiation, Chin. J. Oceanol. Limnol. 26
(2008) 152–156.
[37] M. Timmins, S.R. Thomas-Hall, A. Darling, E. Zhang, B. Hankamer, U.C. Marx, P.M.
Schenk, Phylogenetic and molecular analysis of hydrogen-producing green algae,
J. Exp. Bot. 60 (2009) 1691–1702.
[38] N. Saitou, M. Nei, The neighbor-joining method — a new method for reconstructing
phylogenetic trees, Mol. Biol. Evol. 4 (1987) 406–425.
[39] K. Tamura, D. Peterson, N. Peterson, G. Stecher, M. Nei, S. Kumar, MEGA5: molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance,
and maximum parsimony methods, Mol. Biol. Evol. 28 (2011) 2731–2739.
[40] J. Felsenstein, Confidence-limits on phylogenies — an approach using the bootstrap,
Evolution 39 (1985) 783–791.
[41] E.G. Bligh, W.J. Dyer, A rapid method of total lipid extraction and purification, Can.
J. Biochem. Physiol. 37 (1959) 911–917.
[42] M.J. Griffiths, S.T.L. Harrison, Lipid productivity as a key characteristic for choosing
algal species for biodiesel production, J. Appl. Phycol. 21 (2009) 493–507.
[43] J.P. Fidalgo, A. Cid, E. Torres, A. Sukenik, C. Herrero, Effects of nitrogen source and
growth phase on proximate biochemical composition, lipid classes and fatty acid
profile of the marine microalga Isochrysis galbana, Aquaculture 166 (1998) 105–116.
[44] H. Pereira, L. Barreira, L. Custódio, S. Alrokayan, F. Mouffouk, J. Varela, K.M.
Abu-Salah, R. Ben-Hamadou, Isolation and fatty acid profile of selected microalgae
strains from the red sea for biofuel production, Energies 6 (2013) 2773–2783.
[45] H.L. Yang, C.K. Lu, S.F. Chen, Y.M. Chen, Y.M. Chen, Isolation and characterization of
Taiwanese heterotrophic microalgae: screening of strains for docosahexaenoic acid
(DHA) production, Mar. Biotechnol. 12 (2010) 173–185.
[46] J.L. Csavina, B.J. Stuart, R.G. Riefler, M.L. Vis, Growth optimization of algae for biodiesel
production, J. Appl. Microbiol. 111 (2011) 312–318.
[47] N. Hempel, I. Petrick, F. Behrendt, Biomass productivity and productivity of fatty
acids and amino acids of microalgae strains as key characteristics of suitability for
biodiesel production, J. Appl. Phycol. 24 (2012) 1407–1418.
[48] Q. Liu, T. Pang, L. Li, J. Liu, W. Lin, Isochrysis sp. IOAC724S, a newly isolated, lipid-
enriched, marine microalga for lipid production, and optimized cultivation conditions,
Biomass Bioenergy 60 (2014) 32–40.