General Biology 1

The Commission on Higher Education
in collaboration with the Philippine Normal University
Teaching Guide for Senior High School
GENERAL
BIOLOGY 1
SPECIALIZED SUBJECT | ACADEMIC-STEM
This Teaching Guide was collaboratively developed and reviewed by

educators from public and private schools, colleges, and universities. We
encourage teachers and other education stakeholders to email their
feedback, comments, and recommendations to the Commission on Higher
Education, K to 12 Transition Program Management Unit - Senior High School
Support Team at k12@ched.gov.ph. We value your feedback and
recommendations.
Development Team
Team Leaders: Florencia G. Claveria, Ph.D.,
Dawn T. Crisologo
Writers: Doreen D. Domingo, Ph.D., Aileen C. dela This Teaching Guide by the
Cruz, Chuckie Fer A. Calsado, Doreen D. Commission on Higher Education is
Domingo, Janet S. Estacion, Justin Ray M. Guce, licensed under a Creative
Mary Jane C. Flores, Nolasco H. Sablan Commons Attribution-
NonCommercial-ShareAlike 4.0
Technical Editors: Annalee S. Hadsall, Ph.D. International License. This means
Published by the Commission on Higher Education, 2016 Copy Reader: Caroline H. Pajaron you are free to:
Chairperson: Patricia B. Licuanan, Ph.D. Share — copy and redistribute the
Illustrator: Ma. Daniella Louise F. Borrero
material in any medium or format
Commission on Higher Education  Cover Artists: Paolo Kurtis N. Tan, Renan U. Ortiz Adapt — remix, transform, and
K to 12 Transition Program Management Unit 
build upon the material.
Office Address: 4th Floor, Commission on Higher Education, The licensor, CHED, cannot revoke
C.P. Garcia Ave., Diliman, Quezon City  Senior High School Support Team these freedoms as long as you
Telefax: (02) 441-0927 / E-mail Address: k12@ched.gov.ph CHED K to 12 Transition Program Management Unit follow the license terms. However,
Program Director: Karol Mark R. Yee under the following terms:
Attribution — You must give
Lead for Senior High School Support: appropriate credit, provide a link to
Consultants Gerson M. Abesamis the license, and indicate if changes
THIS PROJECT WAS DEVELOPED WITH THE PHILIPPINE NORMAL UNIVERSITY.  were made. You may do so in any
Lead for Policy Advocacy and Communications: reasonable manner, but not in any
University President: Ester B. Ogena, Ph.D. 
Averill M. Pizarro way that suggests the licensor
VP for Academics: Ma. Antoinette C. Montealegre, Ph.D. 
endorses you or your use.
VP for University Relations & Advancement: Rosemarievic V. Diaz, Ph.D. Course Development Officers:
NonCommercial — You may not use
John Carlo P. Fernando, Danie Son D. Gonzalvo
Ma. Cynthia Rose B. Bautista, Ph.D., CHED  the material for commercial
Bienvenido F. Nebres, S.J., Ph.D., Ateneo de Manila University  Teacher Training Officers: purposes.
Ma. Theresa C. Carlos, Mylene E. Dones ShareAlike — If you remix,
Carmela C. Oracion, Ph.D., Ateneo de Manila University 
transform, or build upon the
Minella C. Alarcon, Ph.D., CHED Monitoring and Evaluation Officer: material, you must distribute your
Gareth Price, Sheffield Hallam University  Robert Adrian N. Daulat contributions under the same license
Stuart Bevins, Ph.D., Sheffield Hallam University as the original.
Administrative Officers:
Ma. Leana Paula B. Bato, Kevin Ross D. Nera,
Allison A. Danao, Ayhen Loisse B. Dalena
Printed in the Philippines by EC-TEC Commercial, No. 32 St.
Louis Compound 7, Baesa, Quezon City,
ectec_com@yahoo.com
Table of Contents
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
DepEd General Biology 1 Curriculum Guide . . . . . . . . . . . . . 5 Chapter 3: Energy Transformation
Chapter 1: Cell Lesson 11: Photosynthesis and Cellular Respiration . . . . . . . . . . . 86
Lesson 1: The Cell: Endomembrane System, Mitochondria, Lesson 12: Forms of Energy, Laws of Energy Transformation
Chloroplasts, Cytoskeleton, and Extracellular Components . . . 9 and Role of ATP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99
Lesson 2: Mitochondria and Chloroplasts . . . . . . . . . . . . . . . . . 15 Lesson 13: Energy Transformation Part 1 . . . . . . . . . . . . . . . . . . . . 111
Lesson 3: Structure and Functions of Animal Tissues and Cell Lesson 14: Energy Transformation Part 2 . . . . . . . . . . . . . . . . . . . . 120
Modification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28 Lesson 15: Energy Transformation Part 3 . . . . . . . . . . . . . . . . . . . . 128
Lesson 4: Cell Cycle and Cell Division . . . . . . . . . . . . . . . . . . . . 36 Lesson 16: Cellular Respiration Part 1 . . . . . . . . . . . . . . . . . . . . . . 133
Lesson 5: Transport Mechanisms Part 1 . . . . . . . . . . . . . . . . . . . 46 Lesson 17: Cellular Respiration Part 2 . . . . . . . . . . . . . . . . . . . . . . 150
Lesson 6: Transport Mechanisms Part 2 . . . . . . . . . . . . . . . . . . . 50 Lesson 18: Cellular Respiration Part 3 . . . . . . . . . . . . . . . . . . . . . . 165
Chapter 2: Biological Molecules Lesson 19: ATP in Cellular Metabolism and Photosynthesis . . . . . 176
Lesson 7: Carbohydrates and Lipids . . . . . . . . . . . . . . . . . . . . . 57
Lesson 8: Amino Acids and Proteins Part 1 . . . . . . . . . . . . . . . . 70 Biographical Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 184
Lesson 9: Amino Acids and Proteins Part 2 . . . . . . . . . . . . . . . . 73
Lesson 10: Biological Molecules: Enzymes . . . . . . . . . . . . . . . . 78

Introduction
As the Commission supports DepEd’s implementation of Senior High School (SHS), it upholds the vision
and mission of the K to 12 program, stated in Section 2 of Republic Act 10533, or the Enhanced Basic
Education Act of 2013, that “every graduate of basic education be an empowered individual, through a
program rooted on...the competence to engage in work and be productive, the ability to coexist in
fruitful harmony with local and global communities, the capability to engage in creative and critical
thinking, and the capacity and willingness to transform others and oneself.”
To accomplish this, the Commission partnered with the Philippine Normal University (PNU), the National
Center for Teacher Education, to develop Teaching Guides for Courses of SHS. Together with PNU, this
Teaching Guide was studied and reviewed by education and pedagogy experts, and was enhanced with
appropriate methodologies and strategies.
Furthermore, the Commission believes that teachers are the most important partners in attaining this
goal. Incorporated in this Teaching Guide is a framework that will guide them in creating lessons and
assessment tools, support them in facilitating activities and questions, and assist them towards deeper
content areas and competencies. Thus, the introduction of the SHS for SHS Framework.
The SHS for SHS Framework, which stands for “Saysay-Husay-Sarili for Senior High School,” is at the
core of this book. The lessons, which combine high-quality content with flexible elements to
SHS for SHS accommodate diversity of teachers and environments, promote these three fundamental concepts:
Framework
SAYSAY: MEANING HUSAY: MASTERY SARILI: OWNERSHIP
Why is this important? How will I deeply understand this? What can I do with this?
Through this Teaching Guide, Given that developing mastery When teachers empower
teachers will be able to facilitate goes beyond memorization, learners to take ownership of
an understanding of the value teachers should also aim for their learning, they develop
of the lessons, for each learner deep understanding of the independence and self-
to fully engage in the content subject matter where they lead direction, learning about both
on both the cognitive and learners to analyze and the subject matter and
affective levels. synthesize knowledge. themselves.
Biology I is a Science, Technology, Engineering and Mathematics (STEM) Specialized Subject
About this  taken in the first half of Grades 11/12. Learners go on a journey geared toward the deeper
Teaching Guide understanding and appreciation of life processes at the cellular and molecular levels
previously introduced in Grades 7-10. They will also apply basic chemistry and physics
principles as they examine the transformation of energy in organisms.
Implementing this course at the senior high school level is subject to numerous challenges
with mastery of content among educators tapped to facilitate learning and a lack of
resources to deliver the necessary content and develop skills and attitudes in the learners,
being foremost among these.
In support of the SHS for SHS framework developed by CHED, these teaching guides were
crafted and refined by biologists and biology educators in partnership with educators from
focus groups all over the Philippines to provide opportunities to develop the following:
1. Saysay through meaningful, updated, and context-specific content that highlights
important points and common misconceptions so that learners can connect to their real-
world experiences and future careers;
2. Husay through diverse learning experiences that can be implemented in a resource-
poor classroom or makeshift laboratory that tap cognitive, affective, and psychomotor
domains are accompanied by field-tested teaching tips that aid in facilitating discovery and
development of higher-order thinking skills; and
3. Sarili through flexible and relevant content and performance standards allow
learners the freedom to innovate, make their own decisions, and initiate activities to fully
develop their academic and personal potential.
These ready-to-use guides are helpful to educators new to either the content or biologists
new to the experience of teaching Senior High School due to their enriched content
presented as lesson plans or guides. Veteran educators may also add ideas from these
guides to their repertoire. The Biology Team hopes that this resource may aid in easing the
transition of the different stakeholders into the new curriculum as we move towards the
constant improvement of Philippine education.
2
This Teaching Guide is mapped and aligned to the DepEd SHS Curriculum, designed to be highly
Parts of the  usable for teachers. It contains classroom activities and pedagogical notes, and is integrated with
Teaching Guide innovative pedagogies. All of these elements are presented in the following parts:
1. Introduction
• Highlight key concepts and identify the essential questions
• Show the big picture
• Connect and/or review prerequisite knowledge
• Clearly communicate learning competencies and objectives
• Motivate through applications and connections to real-life
2. Motivation
• Give local examples and applications
• Engage in a game or movement activity
• Provide a hands-on/laboratory activity
• Connect to a real-life problem
3. Instruction/Delivery
• Give a demonstration/lecture/simulation/hands-on activity
• Show step-by-step solutions to sample problems
• Give applications of the theory
• Connect to a real-life problem if applicable
4. Practice
• Discuss worked-out examples
• Provide easy-medium-hard questions
• Give time for hands-on unguided classroom work and discovery
• Use formative assessment to give feedback
5. Enrichment
• Provide additional examples and applications
• Introduce extensions or generalisations of concepts
• Engage in reflection questions
• Encourage analysis through higher order thinking prompts
6. Evaluation
• Supply a diverse question bank for written work and exercises
• Provide alternative formats for student work: written homework, journal, portfolio, group/individual
projects, student-directed research project
On DepEd Functional Skills and CHED College Readiness Standards
As Higher Education Institutions (HEIs) welcome the graduates of On the other hand, the Commission declared the College
the Senior High School program, it is of paramount importance to Readiness Standards that consist of the combination of knowledge,
align Functional Skills set by DepEd with the College Readiness skills, and reflective thinking necessary to participate and succeed -
Standards stated by CHED. without remediation - in entry-level undergraduate courses in
The DepEd articulated a set of 21st century skills that should be college.
embedded in the SHS curriculum across various subjects and tracks. The alignment of both standards, shown below, is also presented in
These skills are desired outcomes that K to 12 graduates should this Teaching Guide - prepares Senior High School graduates to the
possess in order to proceed to either higher education, revised college curriculum which will initially be implemented by AY
employment, entrepreneurship, or middle-level skills development. 2018-2019.
College Readiness Standards Foundational Skills DepEd Functional Skills
Produce all forms of texts (written, oral, visual, digital) based on:
1. Solid grounding on Philippine experience and culture;
2. An understanding of the self, community, and nation; Visual and information literacies, media literacy, critical thinking
3. Application of critical and creative thinking and doing processes; and problem solving skills, creativity, initiative and self-direction
4. Competency in formulating ideas/arguments logically, scientifically, and creatively; and
5. Clear appreciation of one’s responsibility as a citizen of a multicultural Philippines and a
diverse world;
Global awareness, scientific and economic literacy, curiosity,

Systematically apply knowledge, understanding, theory, and skills for the development of
critical thinking and problem solving skills, risk taking, flexibility
the self, local, and global communities using prior learning, inquiry, and experimentation and adaptability, initiative and self-direction
Global awareness, media literacy, technological literacy,

Work comfortably with relevant technologies and develop adaptations and innovations for
creativity, flexibility and adaptability, productivity and
significant use in local and global communities accountability
Global awareness, multicultural literacy, collaboration and

Communicate with local and global communities with proficiency, orally, in writing, and
interpersonal skills, social and cross-cultural skills, leadership
through new technologies of communication and responsibility
Interact meaningfully in a social setting and contribute to the fulfilment of individual and Media literacy, multicultural literacy, global awareness,
collaboration and interpersonal skills, social and cross-cultural
shared goals, respecting the fundamental humanity of all persons and the diversity of
skills, leadership and responsibility, ethical, moral, and spiritual
groups and communities values
4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Grade: Grade 11/12 Quarters: 1st to 2nd Quarter

Subject Title: Biology I No. of Hours: 40 hours/10 Weeks per Quarter
Subject Description: This subject is designed to enhance the understanding of the principles and concepts in the study of biology, particularly life processes at the cellular
and molecular levels. It also covers the transformation of energy in organisms.
Content Content Standard Performance Standard Learning Competencies Code
Cell The learners demonstrate an The learners shall be able The learners...
understanding of: to:
1. explain the postulates of the cell theory STEM_BIO11/12
1. construct a 3D model of
1. Cell Theory -Ia-c-1
a plant/animal/
2. Cell Structure and 2. describe the structure and function of major and STEM_BIO11/12
bacterial cell using
Functions subcellular organelles -Ia-c-2
recyclable materials
3. Prokaryotic vs Eukaryotic
3. distinguish prokaryotic and eukaryotic cells according to STEM_BIO11/12
Cells
2. construct a cell their distinguishing features -Ia-c-3
4. Cell Types
membrane model from
5. Cell Modifications 4. classify different cell types (plant/animal tissues) and STEM_BIO11/12
indigenous or recyclable
materials specify the function(s) of each -Ia-c-4
5. describe some cell modifications that lead to adaptation
to carry out specialized functions (e.g., microvilli, root STEM_BIO11/12
hair) -Ia-c-5
6. Cell Cycle 1. characterize the phases of the cell cycle and their control STEM_BIO11/12
a. Mitosis points -Id-f-6
b. Meiosis
2. describe the stages of mitosis/meiosis given 2n=6 STEM_BIO11/12
-Id-f-7
3. discuss crossing over and recombination in meiosis STEM_BIO11/12
-Id-f-8
4. explain the significance or applications of mitosis/meiosis STEM_BIO11/12
-Id-f-9
5. identify disorders and diseases that result from the STEM_BIO11/12
malfunction of the cell during the cell cycle -Id-f-10
7. Transport Mechanisms 1. describe the structural components of the cell STEM_BIO11/12
a. Simple Diffusion -Ig-h-11
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013 Page 1 of 4
b. Facilitated Transport membrane

c. Active Transport
d. Bulk/Vesicular 2. relate the structure and composition of the cell STEM_BIO11/12
Transport membrane to its function -Ig-h-12
3. explain transport mechanisms in cells (diffusion osmosis, STEM_BIO11/12
facilitated transport, active transport) -Ig-h-13
4. differentiate exocytosis and endocytosis STEM_BIO11/12
-Ig-h-14
Biological Structures and Functions of 1. categorize the biological molecules(lipids, carbohydrates,
Molecules Biological Molecules proteins, and nucleic acids) according to their structure STEM_BIO11/12
- Carbohydrates and function -Ii-j-15
- Lipids
2. explain the role of each biological molecule in specific STEM_BIO11/12
- Proteins
metabolic processes -Ii-j-16
- Enzymes
- Nucleic Acids 3. describe the components of an enzyme STEM_BIO11/12
-Ii-j-17
4. explain oxidation/reduction reactions STEM_BIO11/12
-Ii-j-18
5. determine how factors such as pH, temperature, and STEM_BIO11/12
substrate affect enzyme activity -Ii-j-19
Energy 1. ATP- ADP Cycle prepare simple fermentation 1. explain coupled reaction processes and describe the role STEM_BIO11/12
Transformation 2. Photosynthesis setup using common fruits of ATP in energy coupling and transfer -IIa-j-1
3. Respiration to produce wine or vinegar
2. describe the major features and chemical events in STEM_BIO11/12
via microorganisms
photosynthesis and respiration -IIa-j-2
3. explain the importance of chlorophyll and other STEM_BIO11/12
pigments -IIa-j-3
4. describe the patterns of electron flow through light STEM_BIO11/12
reaction events -IIa-j-4
5. describe the significant events of the Calvin cycle STEM_BIO11/12
-IIa-j-5
6. differentiate aerobic from anaerobic respiration STEM_BIO11/12

-IIa-j-6
7. explain the major features and sequence the chemical STEM_BIO11/12
events of cellular respiration -IIa-j-7
8. distinguish major features of glycolysis, Krebs cycle, STEM_BIO11/12
electron transport system, and chemiosmosis -IIa-j-8
9. describe reactions that produce and consume ATP STEM_BIO11/12
-IIa-j-9
10. describe the role of oxygen in respiration and describe STEM_BIO11/12
pathways of electron flow in the absence of oxygen -IIa-j-10
11. compute the number of ATPs needed or gained in STEM_BIO11/12
photosynthesis and respiration -IIa-j-11
12. explain the advantages and disadvantages of STEM_BIO11/12
fermentation and aerobic respiration -IIa-j-12
Code Book Legend
Sample: STEM_BIO11/12-IIa-j-12
LEGEND SAMPLE
Learning Area and Strand/ Subject or Science, Technology, Engineering and

Specialization Mathematics
First Entry
STEM_BIO11/12
Grade Level Grade 11 or 12
Domain/Content/
Uppercase Letter/s General Biology
Component/ Topic
Roman Numeral
Quarter Second Quarter II
*Zero if no specific quarter
Lowercase Letter/s
*Put a hyphen (-) in between letters to indicate Week Weeks one to ten a-j
more than a specific week
-
explain the advantages and disadvantages

Arabic Number Competency 12
of fermentation and aerobic respiration
General Biology 1 60 MINS
The Cell: Endomembrane System, Mitochondria,

Chloroplasts, Cytoskeleton, and Extracellular Components
Content Standards
The learners demonstrate an understanding of (1) Composition of the LESSON OUTLINE
endomembrane system; (2) Structure and function of organelles involved in Introduction Review on the differences between 5
energy transformation; (3) Structure and functions of the cytoskeleton; and, (4) prokaryotic and eukaryotic cells; submission
Composition and functions of the extracellular components or matrix. and discussion of responses to the pre-topic
homework assigned before the lecture.
Performance Standards
The learners shall be able to construct three-dimensional models of whole cells Motivation Brief class activity on prokaryotic and 5
using indigenous or recyclable materials. The models shall show the following eukaryotic cells.
cell parts: (1) Endomembrane System, (2) Mitochondria, and (3) Chloroplast Instruction/ Lecture. Board work on cell parts, structure, 40
Learning Competencies Practice and function. Examination of cheek cells and
The learners: (1) explain the postulates of the cell theory (STEM_BIO11/12-1a- Hydrilla cells under a microscope. Class
activity on identifying the parts and functions
c-1); (2) describe the structure and function of major and subcellular organelles
of the endomembrane system.
(STEM_BIO11/12-Ia-c-2); (3) describe the structural components of the cell
membrane (STEM_BIO11/12-Ig-h-11); and (4) relate the structure and Enrichment Class discussion on cell size and relationship 5
composition of the cell membrane to its function (STEM_BIO11/12-Ig-h-12) of surface area and volume
Specific Learning Outcomes Evaluation Assessment of learners’ knowledge; 5

At the end of the unit lesson, the learners shall be able to: assignment of homework for next lecture
• illustrate the structure of the endomembrane system, label its parts, and Materials microscope (slide, cover slip), hand-held
understand how the system works lens, work books, methylene blue, plastic
• illustrate the structure of the mitochondria, label its parts, and understand spoon/popsicle stick, Hydrilla plansts,
the importance of the enfolding of the inner mitochondrial membrane colored chalk/white board marker
• illustrate the structure of the chloroplast, label its parts, and relate these
Resources (continued at the end of Teaching Guide)
parts to photosynthesis (1) (n.d.). Retrieved from <http://www.phschool.com/science/
• understand the connection of the endomembrane system to other cell biology_place/biocoach/cells/common.html>
parts such as the lysosomes, peroxisomes, endosomes, and cell membrane (2) (n.d.). Retrieved from <http://biology.tutorvista.com/animal-and-plant-
• understand how the extracellular components or matrix determine the (3) (n.d.). Retrieved from <http://sciencenetlinks.com/lessons/cells-2-the-
appearance and function of the tissues  cell-as-a-system/>
INTRODUCTION (5 MINS) Teacher Tip
The review on the differences between

1. Ask the learners to make a recap of the differences between prokaryotic and eukaryotic cells. prokaryotic and eukaryotic cells is needed
2. Discuss the learners’ responses to the pre-topic assignment on the functions of the following cell to connect prerequisite knowledge to the
present lesson. Remind the learners that the
parts:
cell parts are found in eukaryotic cells.
• Nucleus
Remind the learners of the pre-topic
• Smooth Endoplasmic Reticulum
assignment that shall be submitted before
• Rough Endoplasmic Reticulum the lecture. This is to ensure the learners
read on the topic before the lecture.
• Golgi Apparatus
• Ribosomes Briefly discuss the structure of the cell
membrane in order to provide basic
• Lysosomes
knowledge on said structure to the learners.
• Mitochondria Do not fully elaborate on this topic since the
structure and function of the cell membrane
• Chloroplast
shall further be discussed in the succeeding
parts of the lesson.
3. Present an overview of the cell membrane, its structure, and functions.
The cell’s parts should be discussed as a
4. Define what an ‘organelle’ is and differentiate membrane-bound organelles from non-membrane- system, emphasizing on the
bound organelles. interconnectedness of each part to the
others.
5. Explain that in eukaryotic cells, the machinery of the cell is compartmentalized into organelles. The
compartmentalization of the cell into membrane-bound organelles: To clarify common misconceptions,
emphasize the following to the learners:
• allows conflicting functions (i.e., synthesis vs. breakdown) and several cellular activities to occur
simultaneously without interference from each other • Not all organelles are surrounded by a
• separates the DNA material of the nucleus, mitochondria, and chloroplast membrane.
• The plasma or cell membrane is different
• increases the surface area-volume ratio of the cell from the cell wall.
6. Encourage the learners to look at the cell as both a system and subsystem. They should develop an • Not all cell parts are present in all kinds of
cells.
understanding of how the parts of a cell interact with one another and how these parts help to do the
‘work’ of the cell (Source: (n.d.). Retrieved from <http://sciencenetlinks.com/lessons/cells-2-the-cell-as-
a-system/>)
10
MOTIVATION (5 MINS) Teacher tip
Briefly review the differences between prokaryotic and eukaryotic cells by asking questions to the
If the number of available microscopes is
learners.
limited, ask the learners to group
Sample question: What cell parts can be found in both prokaryotic and eukaryotic cells? Discuss themselves according to the number of
the function/s of each part. microscopes available or set-up a
demonstration scope for the whole class
Sample Responses: and facilitate the examination of cells so
• DNA that all the learners will get a chance to
observe the cells under the microscope.
• Cell membrane
• Protoplasm (nucleoloid region and cytosol) Orient the learners on the proper use and
care of the microscopes, particularly on
• Ribosomes focusing first on LPO before shifting to
HPO.
Compare the cell to a big city. Ask the learners what the requirements of the city would be in order for Cheek cells are very transparent. Adjust the
it to function. Relate these requirements to the parts of the cell. Relate the learners’ responses to the iris diaphragm or add a small amount of dye
functions of the different parts of a cell. (i.e., methylene blue) to the scrapings.
Sample responses: The learners will only see the cell membrane
• The city will need power. What generates power for the city? Relate this to the function of and the nucleus. Remind the learners to
draw what they observe. Students may
the mitochondria and the chloroplast.
observe cytoplasmic streaming in the plant
• The city generates waste. How does it minimize its waste? How does the city handle its cell.
garbage? Relate this to the function of the lysosome.
• The city requires raw materials to process into food, clothing, and housing materials. Where
are these raw materials processed? Relate this to the functions of the Golgi Apparatus.
Compare animal cells from plant cells. For the animal cells, scrape cheek cells using a toothpick. Ask
the learners to place the scrapings on a microscope slide and add a drop of water to the scrapings.
Tease the scrapings into a thin layer and cover with a slip. Examine under HPO. Instruct the learners to
draw the cells on their workbooks and to label the cell parts that they were able to observe under the
microscope.
For the plant cells, instruct the learners to obtain a Hydrilla leaf and place it on a microscope slide.
Examine under LPO. Ask the learners to draw the cells on their workbooks and to label the cell parts
that they were able to observe under the microscope. 
INSTRUCTION/PRACTICE (30 MINS) Teacher tip
Use chalk or white board markers with
different colors. Explain the structure and
1. Draw the cell membrane on one end of the board. function of each cell part as you draw them.
2. Draw the double membrane of the nucleus (nuclear membrane) on the other end of the board.
Explain to the learners that a more detailed
3. From the nuclear membrane, draw the reticulated structure of the endoplasmic reticulum. Ask the discussion of the structure and functions of
learners what the two types of endoplasmic reticulum are and their corresponding functions. the cell membrane, mitochondria, and
chloroplast will be given in succeeding
4. Draw the ribosomes as separate units.
lessons.
5. Draw a DNA and an mRNA. Explain that the mRNA is a copy of the DNA that will be sent to the
cytoplasm for protein synthesis.
6. Explain to the learners that the mRNA leaves the nucleus and goes to where the ribosomes are
located (i.e., mRNA + functional ribosome)
7. Explain the possible ‘pathways’ for protein synthesis (e.g., within the cytosol or the endoplasmic
reticulum)
8. Draw the mRNA + functional ribosome on the endoplasmic reticulum. With a lot of these, the
endoplasmic reticulum becomes a rough endoplasmic reticulum.
9. Draw the formed polypeptide inside the rough endoplasmic reticulum. Discuss the formation of a
cisternae and pinching off as a vesicle.
10. Draw the Golgi Apparatus and then a vesicle from the rough endoplasmic reticulum that travels to
the Golgi Apparatus and attaches to the part which is nearest the rough endoplasmic reticulum.
11. Ask the learners what the function of the Golgi Apparatus is. Synthesize their answers and compare
the Golgi Apparatus to a factory with an assembly manufacturing line.
12. Draw the polypeptide travelling along the Golgi Apparatus stack; pinching off as a vesicle to travel
to the next stack. Repeat the process while increasing the complexity of the polypeptide drawing.
13. On the last stack, explain the ‘pathways’ that the vesicle may follow: become a lysosome through
fusion with an endosome (i.e., formed by endocytosis), or travel to the cell membrane, fuse with it,
and empty its contents.
14. Present the composition of the endomembrane system and discuss how these parts are connected
to each other by structure and by function.
15. Draw the mitochondria and label its parts. Explain the importance of the enfolding (cristae) in
increasing the surface area of the inner mitochondrial membrane. Further explain to the class that
enfolding is a common structural strategy to increase surface area. As an example, you may draw a
cross-sectional structure of the small intestine.
16. Draw the chloroplast and label its parts. Explain the function that each part performs in the process
of photosynthesis.
17. Discuss the similarities of the mitochondria and chloroplast (e.g., both are involved in energy
transformation, both have DNA, high surface area, and double membranes).income accounts and
lastly, expenses accounts.  
 
Group the learners into pairs. Ask one to draw the endomembrane system as he/she explains it to
his/her partner. Reshuffle the groupings and repeat until all learners have performed the exercise.
ENRICHMENT (30 MINS)

Facilitate a class discussion on why cells are generally small in size. Explain the relationship between
surface area and volume.
EVALUATION (60 MINS

Ask questions to the learners. Sample questions can be found in the following electronic resources: Teacher tip
• (n.d.). Retrieved from< http://www.proprofs.com/quiz-school/story.php?title=cell-structure-test > Assignments should be handwritten.
• (n.d.). Retrieved from< http://study.com/academy/exam/topic/cell-biology.html> This strategy is aimed at ensuring that the
Assign a research assignment on this question: How do environmental toxins like lead and mercury learners have read the topic rather than just
affect the functions of the cell? The assignment shall be submitted one week after this lesson. copying and printing from a source.
RESOURCES (CONTINUED):
(4) (n.d.). Retrieved from <http://www.schools.manatee.k12.fl.us/072JOCONNOR/celllessonplans/
lesson_plan__cell_structure_and_function.html>
(5) (n.d.). Retrieved from <http://www.phschool.com/science/biology_place/biocoach/cells/endo.html>
(6) (n.d.). Retrieved from <http://study.com/academy/lesson/the-endomembrane-system-functions-
components.html>
(7) (n.d.). Retrieved from <http://www.ncbi.nlm.nih.gov/books/NBK26907/>
(8) (n.d.). Retrieved from <http://staff.um.edu.mt/acus1/01Compart.pdf> 
ASSESSMENT
Learning Competency Assessment Tool Exemplary Satisfactory Developing Beginnning
The learners shall be able Learner Learner was able to Learner was able to answer Learner was able to (1) Learner was not
to: participation (during answer all the question/s the main question without answer the questions able to answer the
1. describe the structure and lecture) without referring to his/ referring to his/her notes but he/she referred question/s
function of major and her notes but was not able to answer to his/her notes (2) Learner read notes
subcellular organelles follow-up question/s of his/her classmate
(STEM_BIO11/12-Ia-c-2)
Assignment Learner submitted an Learner submitted a Learner submitted a (1) Learner did not
assignment beyond the comprehensive and well- well written report submit an assignment
requirements written assignment but some responses (2) Learner submitted
lack details a partially-finished
assignment
The learners shall be able Learner Learner was able to Learner was able to answer Learner was able to (1) Learner was not
to: participation (during concisely answer all the the main question without answer the questions able to answer the
2. describe the structural practice) questions referring to his/her notes but he/she referred question/s
components of the cell but was not able to answer to his/her notes (2) Learner read notes
membrane follow-up question/s of his/her classmate
(STEM_BIO11/12-Ig-h-11)
Laboratory Learner submitted Learner submitted drawings Learner submitted (1) Learner was not
(Examination of drawings that were that fulfilled the drawings that were able to submit
Animal and Plant beyond the requirements requirements (complete incomplete drawings
Cells) and detailed) (2) Learner’s drawings
were haphazardly
done
The learners shall be able Examination Learner obtained 90% to Learner obtained 70% to Learner obtained Learner obtained less
to: 100% correct answers in 89.99% correct answers in 50% to 69.99% that 50% correct
3. relate the structure and the examination the examination correct answers in the answers in the
composition of the cell examination examination
membrane to its function Research Learner submitted a Learner submitted a Learner submitted a (1) Learner did not
(STEM_BIO11/12-Ig-h12) Assignment research assignment comprehensive and well- well written report submit an assignment
beyond the requirements written research assignment but some responses (2) Learner submitted
lack details a partially-finished
assignment
14
Mitochondria and Chloroplasts

Content Standards
The learners demonstrate an understanding of the structure and function of the
LESSON OUTLINE
mitochondria and chloroplasts, the organelles involved in energy Introduction Review of relevant terminologies and 5
transformation. definitions
Performance Standards Motivation Understanding of key concepts using real-life 5

The learners shall be able to construct three-dimensional models of whole cells situations
using indigenous or recyclable materials. These models should show the Instruction/ Discussion and lecture proper 30
mitochondria and chloroplasts. Delivery
Learning Competencies Practice Drawing (with label) activity 10
The learners describe the structure and function of major and subcellular
organelles (STEM_BIO11/12-Ia-c-2) and distinguish prokaryotic and eukaryotic Enrichment Computation of surface area vs volume 5
cells according to their distinguishing features (STEM_BIO11/12 -Ia-c-3) Evaluation Answering practice questions and homework 5

Specific Learning Outcomes (1) http://scienceaid.co.uk/biology/biochemistry/atp.html
At the end of the lesson, the learners shall be able to: (2) http://www.britannica.com/list/6-cell-organelles)
(3) http://www.nature.com/scitable/topicpage/mitochondria-14053590)
• illustrate the structure of the mitochondria, label its parts, and understand
(4) http://www.britannica.com/list/6-cell-organelles
the importance of the enfolding of the inner mitochondrial membrane
(5) http://www.nature.com/scitable/topicpage/mitochondria-14053590)
• illustrate the structure of the chloroplast, label its parts, and relate these
(6) http://biology.tutorvista.com/animal-and-plant-cells/chloroplasts.html
parts to photosynthesis
(7) ttp://www.nature.com/scitable/topicpage/mitochondria-14053590
INTRODUCTION (5 MINS)
Facilitate a review of the following concepts:
• Differences between prokaryotic and eukaryotic cells
• Definition of an ‘organelle’
• Differences between membrane-bound organelles and non-membrane-bound organelles
• Functions of the different parts of a cell
• The endomembrane system
MEMBRANE-BOUND ORGANELLES NON-MEMBRANE-BOUND ORGANELLES

Nucleus Ribosomes
Smooth ER Centrioles
Rough ER Cytoskeleton
Golgi Apparatus
Vacuoles and Vesicles
Mitochondria
Chloroplast and other plastids
Lysosomes
Peroxisomes
Explain that in eukaryotic cells, the machinery of the cell is compartmentalized into organelles. The compartmentalization of the cell into
membrane-bound organelles:
• allows conflicting functions (i.e., synthesis vs. breakdown) and several cellular activities to occur simultaneously without interference from
each other
• separates the DNA material of the nucleus, mitochondria, and chloroplast
• increases the surface area-volume ratio of the cell
16
Encourage the learners to look at the cell as both a system and subsystem. They should develop an
understanding of how the parts of a cell interact with one another and how these parts help to do the
‘work’ of the cell (Source: (n.d.). Retrieved from <http://sciencenetlinks.com/lessons/cells-2-the-cell-as-
a-system/>)
Emphasize to the learners that energy transformation is one of the characteristics of life. This refers to
the ability to obtain and use energy. This characterizes the main function of the mitochondria and the
chloroplasts.
MOTIVATION (5 MINS)
Ask the learners how they understand the concept of compartmentalization. Relate the concept to how
the cell is compartmentalized into organelles.
Compare compartmentalization to the division of a house into a receiving room or sala, kitchen, dining
room, comfort rooms, bedrooms, etc.
Teacher tip
Explain to the learner that this is how the
Ask the learners why they think a house is divided into several rooms.
cell is able to allow conflicting functions
A possible response is that partitioning of the house into different parts facilitates the simultaneous (e.g., synthesis vs breakdown) and several
occurrence of several activities without interfering with one another. Also, materials needed for each cellular activities to occur simultaneously
without interference from each other.
activity can be stored at their specific areas. For example, pots and pans are being stored in the kitchen
and not in the bedroom. Beds and pillows are found in the bedroom and not in the toilet/bath.
Explain to the learners that the mitochondria and chloroplasts have a small amount of DNA. Although
most of the proteins of these organelles are imported from the cytosol and are thus programmed by
the nuclear DNA, their DNA programs the synthesis of the proteins made on the organelles’ ribosomes
(Source: Campbell et al). Compartmentalization separates the DNA material of the nucleus,
mitochondria, and chloroplast.
Ask the learners if they have experienced going to a city/municipal hall and if they have observed that
the Mayor, Vice-Mayor, and the City/Municipal Administrator have separate offices. You can use other
examples such as the University President, VP for Academic Affairs, VP for Finance; Philippine
President, Vice President, Senators, etc.
Compare the nuclear DNA to the Mayor and the mitochondrial DNA and chloroplast DNA to the Vice  
Mayor. The Mayor runs the city/municipality but the Vice Mayor also performs functions that are Teacher tip
specific to their positions. They need different offices (or compartments) to avoid conflict in their
functions. Select a fruit that can be easily peeled like
calamansi or dalandan
Introduce the concept of surface area-volume ratio/relationship to the learners. Show a fruit to the
learners and explain that the outer surface of the fruit is the surface area. Peel the fruit and show them
what’s inside, explaining that the inside of the fruit is the volume.
Explain to the learners that surface area (SA) and volume (V) do not increase in the same manner. As an
object increases in size, its volume increases as the cube of its linear dimensions while surface area
increases as the square of its linear dimensions.
Example: If the initial starting point is the same: SA = 2; Volume = 2 (Ratio = 1:1)
A one-step increase will result to: SA = 22 = 4 while V = 23 = 8 (Ratio = 1:2)
Teacher tip
Ask questions to the learners while giving
INSTRUCTION/DELIVERY (30 MINS) the lecture.
If an LCD projector is not available, draw

Explain and discuss the nature and functions of the Adenosine Triphosphate (ATP) to the learners.
the structure of the mitochondria and
Adenosine Triphosphate (ATP)—It is the major energy currency of the cell that provides the energy for chloroplast on the board.
most of the energy-consuming activities of the cell. The ATP regulates many biochemical pathways.
Mechanism: When the third phosphate group of ATP is removed by hydrolysis, a substantial amount of
free energy is released.
ATP + H2O → ADP + Pi where ADP is adenosine diphosphate and Pi is inorganic phosphate
Group the learners into pairs. Ask one to draw the endomembrane system as he/she explains it to his/
her partner. Reshuffle the groupings and repeat until all learners have performed the exercise.
 
18
Illustration 1: Energy release in Hydrolysis (Source: (n.d.). Retrieved from http://scienceaid.co.uk/biology/biochemistry/atp.html)
Illustration 2: Chemical Energy and ATP (Source: (n.d.). Retrieved from http://winklebiology.weebly.com/chemical-energyatp.html)
Synthesis of ATP
• ADP + Pi → ATP + H2O
• requires energy: 7.3 kcal/mole
• occurs in the cytosol by glycolysis  
• occurs in mitochondria by cellular respiration
• occurs in chloroplasts by photosynthesis
Consumption of ATP
ATP powers most energy-consuming activities of cells, such as:
• anabolic (synthesis) reactions, such as:
• joining transfer RNAs to amino acids for assembly into proteins
• synthesis of nucleoside triphosphates for assembly into DNA and RNA
• synthesis of polysaccharides
• synthesis of fats
• active transport of molecules and ions
• conduction of nerve impulses
• maintenance of cell volume by osmosis
• addition of phosphate groups (phosphorylation) to different proteins (e.g., to alter their activity in cell
signaling)
• muscle contraction
• beating of cilia and flagella (including sperm)
• bioluminescence
Extracellular ATP
In mammals, ATP also functions outside of cells. ATP is released in the following examples:
• from damaged cells to elicit inflammation and pain
• from the carotid body to signal a shortage of oxygen in the blood
• from taste receptor cells to trigger action potentials in the sensory nerves leading back to the brain
• from the stretched wall of the urinary bladder to signal when the bladder needs emptying
In eukaryotic cells, the mitochondria and chloroplasts are the organelles that convert energy to other
forms which cells can use for their functions.
Discuss the function and structure of the mitochondria.
20
Mitochondria (singular, mitochondrion)—Mitochondria are the sites of cellular respiration, the
metabolic process that uses oxygen to drive the generation of ATP by extracting energy from sugars,
fats, and other fuels.
The mitochondria are oval-shaped organelles found in most eukaryotic cells. They are considered to be
the ‘powerhouses’ of the cell. As the site of cellular respiration, mitochondria serve to transform
molecules such as glucose into an energy molecule known as adenosine triphosphate (ATP). ATP fuels
cellular processes by breaking its high-energy chemical bonds. Mitochondria are most plentiful in cells
that require significant amounts of energy to function, such as liver and muscle cells.
Figure 1: Structure of the Mitochonsdria (Source: (n.d.). Retrieved from http://www.britannica.com/list/
6-cell-organelles)
The mitochondria has two membranes that are similar in composition to the cell membrane:
• Outer membrane—is a selectively permeable membrane that surrounds the mitochondria. It is the
site of attachment for the respiratory assembly of the electron transport chain and ATP Synthase. It
has integral proteins and pores for transporting molecules just like the cell membrane
• Inner membrane—folds inward (called cristae) to increase surfaces for cellular metabolism. It
contains ribosomes and the DNA of the mitochondria. The inner membrane creates two enclosed
spaces within the mitochondria:
• intermembrane space between the outer membrane and the inner membrane; and
• matrix that is enclosed within the inner membrane.
Ask questions to the learners on the structure of the mitochondria. A sample question could be: What
is the importance of the enfolding of the mitochondria? The response would be to increase the surface
area that can be ‘packed’ into such a small space.
Discuss the purpose of the mitochondrial membranes.
22
As mentioned, the mitochondria has two membranes: the outer and inner mitochondrial membranes.
• Outer Membrane Teacher tip
• fully surrounds the inner membrane, with a small intermembrane space in between
• has many protein-based pores that are big enough to allow the passage of ions and
molecules as large as a small protein Lecture on mitochondrial membranes can
be accessed at (n.d.). Retrieved from
• Inner membrane
<http://www.nature.com/scitable/
• has restricted permeability like the plasma membrane topicpage/mitochondria-14053590>.
• is loaded with proteins involved in electron transport and ATP synthesis
• surrounds the mitochondrial matrix, where the citric acid cycle produces the electrons that
travel from one protein complex to the next in the inner membrane. At the end of this
electron transport chain, the final electron acceptor is oxygen, and this ultimately forms
water (H20). At the same time, the electron transport chain produces ATP in a process called
oxidative phosphorylation
During electron transport, the participating protein complexes push protons from the matrix out to the
intermembrane space. This creates a concentration gradient of protons that another protein complex,
called ATP synthase, uses to power synthesis of the energy carrier molecule ATP.
Figure 4: The Electrochemical Proton Gradient and the ATP Synthase (Source: (n.d.). Retrieved from
http://www.nature.com/scitable/topicpage/mitochondria-14053590)
Explain and discuss the structure and functions of the Chloroplasts.
Chloroplasts—Chloroplasts, which are found in plants and algae, are the sites of photosynthesis. This
process converts solar energy to chemical energy by absorbing sunlight and using it to drive the
synthesis of organic compounds such as sugars from carbon dioxide and water.
The word chloroplast is derived from the Greek word chloros which means ‘green’ and plastes which
means ‘the one who forms’. The chloroplasts are cellular organelles of green plants and some
eukaryotic organisms. These organelles conduct photosynthesis. They absorb sunlight and convert it
into sugar molecules. They also produce free energy stored in the form of ATP and NADPH through
photosynthesis.
Chloroplasts are double membrane-bound organelles and are the sites of photosynthesis. The  
22
chloroplast has a system of three membranes: the outer membrane, the inner membrane, and the
thylakoid system. The outer and the inner membranes of the chloroplast enclose a semi-gel-like fluid Teacher tip
known as the stroma. The stroma makes up much of the volume of the chloroplast. The thylakoid
system floats in the stroma. If an LCD projector is not available, draw
the structure of the chloroplast on the
board.
Structure of the Chloroplast
• Outer membrane—This is a semi-porous membrane and is permeable to small molecules and ions
which diffuse easily. The outer membrane is not permeable to larger proteins.
• Intermembrane Space—This is usually a thin intermembrane space about 10-20 nanometers and is
present between the outer and the inner membrane of the chloroplast.
• Inner membrane—The inner membrane of the chloroplast forms a border to the stroma. It Lecture on structure and functions of the
chloroplast can be accessed at (n.d.).
regulates passage of materials in and out of the chloroplast. In addition to the regulation activity,
Retrieved from <http://
fatty acids, lipids and carotenoids are synthesized in the inner chloroplast membrane. biology.tutorvista.com/animal-and-plant-
• Stroma—This is an alkaline, aqueous fluid that is protein-rich and is present within the inner cells/chloroplasts.html>.
membrane of the chloroplast. It is the space outside the thylakoid space. The chloroplast DNA,
chloroplast ribosomes, thylakoid system, starch granules, and other proteins are found floating
around the stroma.
• Thylakoid System 
The thylakoid system is suspended in the stroma. It is a collection of membranous sacks called
thylakoids. Thylakoids are small sacks that are interconnected. The membranes of these thylakoids are
the sites for the light reactions of the photosynthesis to take place. The chlorophyll is found in the
thylakoids. The thylakoids are arranged in stacks known as grana. Each granum contains around 10-20
thylakoids.
The word thylakoid is derived from the Greek word thylakos which means 'sack'.
Important protein complexes which carry out the light reaction of photosynthesis are embedded in the
membranes of the thylakoids.  
The Photosystem I and the Photosystem II are  

complexes that harvest light with chlorophyll and carotenoids. They
absorb the light energy and use it to energize the electrons.
The molecules present in the thylakoid membrane use the electrons

that are energized to pump hydrogen ions into the thylakoid space.
This decreases the pH and causes it to become acidic in nature. A
large protein complex known as the ATP synthase controls the

concentration gradient of the hydrogen ions in the thylakoid space
to generate ATP energy. The hydrogen ions flow back into the
stroma.
Thylakoids are of two types: granal thylakoids and stromal PRACTICE (10 MINS)
thylakoids. Granal thylakoids are arranged in the grana. These
Group the learners into pairs. Ask one to draw the mitochondria and
circular discs that are about 300-600 nanometers in diameter. The
label its parts while the other does the same for chloroplast. Once
stromal thylakoids are in contact with the stroma and are in the form
done, the partners exchange tasks (i.e., the learner that drew the
of helicoid sheets.
mitochondria now does the same for the chloroplast).
The granal thylakoids contain only Photosystem II protein complex.

Reproduce these diagrams without the labels and use these for the
This allows them to stack tightly and form many granal layers with
class activity.
granal membrane. This structure increases stability and surface area
for the capture of light.
To demonstrate how folding increases surface area, ask the learners
to trace the edges of the outer membrane with a thread and
The Photosystem I and ATP synthase protein complexes are present measure the length of the thread afterwards. Repeat the same for
in the stroma. These protein complexes act as spacers between the the inner membrane. Compare the results and discuss how the
sheets of stromal thylakoids. enfolding of the inner membrane increases surface area through
folding.
24
ENRICHMENT (30 MINS) 
1. Using the figure below, ask learners to compute surface area vs. volume.
2. Draw the table on the board and instruct the learners to write their measurements. 
Teacher tip
EVALUATION (60 MINS) Clarify to the learners the
misconception that the appearance of
Ask the learners to answer practice questions on the following electronic resources:
organelles are static and rigid.
• http://www.mcqbiology.com/2013/03/multiple-choice-questions-on_25.html#.Vl7Uq3YrLrc
• http://www.uic.edu/classes/bios/bios100/summer2004/samples02.htm
• http://www.tutorvista.com/content/science/science-i/fundamental-unit-life/question-answers-1.php
• http://www.buzzfeed.com/kellyoakes/the-mitochondria-is-the-powerhouse-of-the-cell#.fajAl0b6o
• http://global.oup.com/uk/orc/biosciences/cellbiology/wang/student/mcqs/ch10/
Possible responses to the homework (Source: Campbell et al, 10th Ed.):

Teacher tip
Check the electronic resources on
• They have double membranes and are not part of the endomembrane system. Endosymbiotic Theory:
• Their shape is changeable.
• They are autonomous (somewhat independent) organelles that grow and occasionally pinch in two, https://www.youtube.com/watch?
v=bBjD4A7R2xU (Endosymbiotic
thereby reproducing themselves.
Theory in plain English)
• They are mobile and move around the cell along tracks of the cytoskeleton, a structural network of the https://www.youtube.com/watch?v=-
cell. FQmAnmLZtE
• They contain ribosomes, as well as multiple circular DNA molecules associated with their inner
membranes. The DNA in these organelles programs the synthesis of some organelle proteins on
ribosomes that have been synthesized and assembled there as well.
2. Give out the homework for next meeting.
What are the characteristics shared by these two energy transforming organelles?
Instruct the learners to write an essay on probable reasons for these the shared characteristics of the
mitochondria and the chloroplast. Learners shall submit a handwritten essay on the Endosymbiotic Theory
and how it explains the similarity between the mitochondria and chloroplast.
26
EVALUATION
Learning Competency Assessment Tool Exemplary Satisfactory Developing Beginnning
The learners shall be Learner Learner was able to Learner was able to Learner was able to (1) Learner was not
able to describe the participation answer all the question/ answer the main question answer the able to answer the
following: (during lecture) s without referring to without referring to his/ questions but he/ question/s
his/her notes her notes but was not she referred to his/ (2) Learner read
able to answer follow-up her notes notes of his/her
1. structure and question/s classmate
function of major and
subcellular organelles Assignment Learner submitted an Learner submitted a Learner submitted a (1) Learner did not
(STEM_BIO11/12-Ia- assignment beyond the comprehensive and well- well written report submit an
c-2) requirements written assignment but some responses assignment
lack details (2) Learner
submitted a
partially-finished
assignment
Examination Learner obtained 90% Learner obtained 70% to Learner obtained Learner obtained
to 100% correct 89.99% correct answers 50% to 69.99% less that 50% correct
answers in the in the examination correct answers in answers in the
examination the examination examination
Essay Assignment Learner submitted an Learner submitted an Learner submitted a (1) Learner did not
essay beyond the essay that was well-written essay submit an essay
requirements comprehensive and well- some details are (2) Learner
written lacking submitted a
partially-finished
essay
Structure and Functions of Animal Tissues

and Cell Modification
Content Standard LESSON OUTLINE
The learners demonstrate an understanding of animal tissues and cell
Introduction Communicating learning objectives to the 5
modification.
learners.
Performance Standard
Motivation Class Activity: Pinoy Henyo Classroom 10
The learners shall be able to construct a three-dimensional model of the animal Edition
tissue by using recyclable or indigenous materials.
Instruction/ Review on the Hierarchy of Biological 95
Learning Competencies Delivery Organisation and PTSF; Lesson on Animal
The learners: Tissues and on Cell Modfication
• classify different cell types (plant/animal tissue) and specify the functions of
Practice Class Activity: Reporting on structure and 60
each (STEM_BIO11/12-Ia-c-4) function of animal tissue or showing of
• describe some cell modifications that lead to adaptation to carry out infomercial on diseases.
specialized functions (e.g., microvilli, root hair) (STEM_BIO11/12-Ia-c-5)
Evaluation Class Quiz 10
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to: Materials
microscopes, LCD Projector (if available), laptop or computer
• present a five-minute report on how the structures of different animal
(if available), manila paper, cartolina, photos, images, or
tissues define their function or show a two-minute infomercial about a
illustrations of different types of tissues, drawing materials
disease that is caused by animal tissue malfunction;
(e.g. pens, pencils, paper, color pencils, etc.)
• provide insights, offer constructive feedback, and note areas of
improvement on their classmates’ reports or infomercial 
(1) Reece JB, U. L., (2010). Campbell Biology 10th. San Francisco (CA).
28
INTRODUCTION (5 MINS) Teacher tip
Introduce the following learning objectives by flashing these on the board: For this particular lesson, start with the
Motivation first (i.e., class activity on Pinoy
• classify different cell types (plant/animal tissue) and specify the functions of each (STEM_BIO11/12- Henyo Classroom Edition). After the game,
Ia-c-4) proceed to the Introduction by
• describe some cell modifications that lead to adaptation to carry out specialized functions (e.g., communicating the learning objectives to
the learners.
microvilli, root hair) (STEM_BIO11/12-Ia-c-5)
For the part when the learners have to state
the learning objectives using their own
words, ask the learners to face their
Ask the learners to work in pairs and write the learning objectives using their own words. seatmates and work in pairs. If the learners
are more comfortable in stating the learning
objectives in Tagalog or In their local
dialect, ask them to do so.
Teacher tip
MOTIVATION (10 MINS) Prior to this lesson, assign a reading
material or chapter for this topic. This shall
aid in the facilitation of the class activity.
PINOY HENYO CLASSROOM EDITION
Divide the class into two groups. In choosing the mystery words for the
game, do not limit yourself with the four
types of animal tissues. You may choose
Explain to the learners that instead of having the typical one-on-one Pinoy Henyo, only one terms that describe the tissue type or even
body parts wherein the tissues are located.
representative from each group shall be asked to go to the front and have the mystery word card on
You may also include diseases that are
his/her forehead. Only three words shall be allowed from the groups: “Oo”, “Hindi”, or “Pwede”. caused by certain malfunctions on the
Violation of the rules of the game (e.g., communicating the mystery word to the guesser) shall merit tissues.
corresponding penalties or disqualification. Assign three representatives per group to guess the
Make sure to mention the chosen mystery
mystery words. Each guesser shall be given one minute and 30 seconds.
words in the discussion. This shall help the
learners to understand the connection of
the game with the lesson.
At the end of the activity, ask one or two learners what they think the learning objectives of the lesson
will be. Immediately proceed with the Introduction. Check how the class behaves during the
activity. If the learners get rowdy, you may
choose to stop the game. Make sure to
warn the learners of the consequences first
before the start of the activity.
INSTRUCTION/DELIVERY (95 MINS)
Teacher tip
Facilitate a five-minute review on the Hierarchy of Biological Organization and on the concept of “form
Do not use too much time for the review.
fits function”, the unifying theme in Biology. Just make sure to guide or lead the learners
in remembering past lessons. Provide clues
if necessary.
Review on Hierarchy of Biological Organization
1. Discuss that new properties arise with each step upward the hierarchy of life. These are called
emergent properties.
2. Ask the class what the levels of biological organization are. The learners should be able to answer
this since this is just a review. In case the class does not respond to the question, you may facilitate
the discussion by mentioning the first level of the hierarchy.
3. Start with the cell since it is the most basic unit of life that shows all life properties.
cells tissue organ organ system multicellular organism
Illustrate this by showing photos of the actual hierarchy using animals that are endemic in the
Philippines (e.g., pilandok, dugong, and cloud rat). Teacher tip
For the review on “form fits function”, if the
class does not respond well, start giving
your own examples for the students to
Review on the unifying theme in Biology: “form fits function”
figure out this unifying theme.
Make sure to relate structure to function.

1. Ask the class what the relation of form (structure) to function and vice versa is
Mention the role of fossils in determining
2. Ask for examples of versaingit of life that shows all life properthe torpedo shape of the body of the habits of extinct animals. By doing this,
dolphins (mammals with fishlike characteristics) and the bone structure and wing shape of birds in it shall establish a strong connection
between form and function and shall give
relation to flying.
relevance on the study of this connection in
Biology. After this, you may now proceed to
the new topic on animal tissues.
30
Facilitate a class activity (i.e., observation of cells under a microscope) to illustrate that animals are Teacher tip
made up of cells. This shall be the foundation of the definition of and discussion on animal tissues. The If microscopes are available for this activity,
whole activity and discussion shall last for 90 minutes. allot 20-30 minutes for the observation of
cells. If microscopes are not available, allot
only 10-15 minutes.
If microscopes are available for this activity, set up the equipment and the slides that were prepared
Prior to the activity, prepare the slides that
prior to the activity. Each slide should show one type of tissue (i.e., epithelial tissue, connective tissue,
will be put under the microscopes. The
muscle tissue, and nervous tissue). Make sure that the labels are covered because the learners will be slides shall contain the different types of
asked to name the tissues based on their observations during the discussion. tissue. Make sure to focus the slides so that
the learners can observe them clearly.
If there are no microscopes available for the activity, prepare cut-out images, photos, or illustrations Give the learners enough time to observe
that show the different types of tissues (i.e., epithelial tissue, connective tissue, muscle tissue, and the specimens and then ask them to draw
on their notebooks what they were able to
nervous tissue). Make sure that the images, photos, or illustrations are not labeled because the learners
observe under the microscopes. Encourage
will be asked to name them. the learners to write down the description
and function of the specific tissue type as
you go through the discussion.
Also, do not immediately identify the type of tissue based on the descriptions that you will be
presenting to the class. The learners will be asked to identify which among the slides under the If microscopes are not available and you
microscope or which image, photo, or illustration matches the description of the structure and function have shown photos, images, or illustrations
instead, ask the learners to draw them on
that will be given during the discussion.
their notebooks and encourage them to
write down the description and function of
the specific tissue type as you go through
After the class activity, proceed with the actual lecture. If a computer, laptop, or projector is available,
the discussion.
show a PowerPoint presentation that shows the description and function of tissues. If there is no
available equipment, you may use flash cards or manila paper where description of structure and
function of the different tissue types are written down. Ask the learners which among the microscope
Teacher tip
slides, image, photo, or illustration fits the given information on description and function. After the Prepare the lecture in such a way that you
learners’ responses, you can flash or show the next slide which shall reveal the image of the specimen do not immediately reveal the label of the
with the corresponding label or type of tissue. images or the terms that are being
described. The learners should first be
asked to identify the images or slides that fit
Epithelial Tissue—This type of tissue is commonly seen outside the body as coverings or as linings of the description of the structures and
functions. This will make the students more
organs and cavities. Epithelial tissues are characterized by closely-joined cells with tight junctions (i.e., a
engaged in the discussion. Always remind
type of cell modification). Being tightly packed, tight junctions serve as barriers for pathogens, the learners to take down notes while you
mechanical injuries, and fluid loss.  flash information for each tissue type.
Teacher tip
Cells that make up epithelial tissues can have distinct arrangements: Take note that the part on cell modifications
is incorporated in the discussion on the
• cuboidal—for secretion structure of the respective cells that make
• simple columnar—brick-shaped cells; for secretion and active absorption up the tissue that is being discussed. Give
• simple squamous—plate-like cells; for exchange of material through diffusion emphasis on the differences on the features
of the cells that make up the tissue type.
• stratified squamous—multilayered and regenerates quickly; for protection
• pseudo-stratified columnar—single layer of cells; may just look stacked because of varying height; For examples or illustrations of the different
for lining of respiratory tract; usually lined with cilia (i.e., a type of cell modification that sweeps the types of tissues, it is better to use an animal
mucus). that is endemic in the Philippines or in your
specific region so that the learners can
relate more in the discussion.
Figure 1: Epithelial Tissue (Source: Reece JB, U. L. (2010). Campbell Biology 10th. San Francisco (CA):.) 
32
Connective Tissue—These tissues are composed of the
following:
BLOOD —made up of plasma (i.e., liquid extracellular matrix);
contains water, salts, and dissolved proteins; erythrocytes that
carry oxygen (RBC), leukocytes for defense (WBC), and platelets
for blood clotting.
CONNECTIVE TISSUE PROPER (CTP)—made up of loose

connective tissue that is found in the skin and fibrous connective
tissue that is made up of collagenous fibers found in tendons
and ligaments. Adipose tissues are also examples of loose
connective tissues that store fats which functions to insulate the
body and store energy.
CARTILAGE —characterized by collagenous fibers embedded

in chondroitin sulfate. Chondrocytes are the cells that secrete
collagen and chondroitin sulfate. Cartilage functions as cushion
between bones.
BONE —mineralized connective tissue made by bone-forming

cells called osteoblasts which deposit collagen. The matrix of
collagen is combined with calcium, magnesium, and phosphate
ions to make the bone hard. Blood vessesl and nerves are
found at a central canal surrounded by concentric circles of
osteons.
Figure 2: Connective Tissue (Source: Reece JB, U. L. (2010).

Campbell Biology 10th. San Francisco (CA):.)
Muscle Tissue—These tissues are composed of long cells called muscle
fibers that allow the body to move voluntary or involuntary. Movement
of muscles is a response to signals coming from nerve cells. In
vertebrates, these muscles can be categorized into the following:
• skeletal—striated; voluntary movements
• cardiac—striated with intercalated disk for synchronized heart
contraction; involuntary
• smooth—not striated; involuntary
Figure 3: Muscle Tissue (Source: Reece JB, U. L. (2010). Campbell

Biology 10th. San Francisco (CA):.)
Nervous Tissue—These tissues are composed of nerve cells called

neurons and glial cells that function as support cells. These neurons
sense stimuli and transmit electrical signals throughout the animal body.
Neurons connect to other neurons to send signals. The dendrite is the
part of the neuron that receives impulses from other neurons while the
axon is the part where the impulse is transmitted to other neurons.
Figure 4: Neurons and Glial Cells (Source: Reece JB, U. L. (2010). Campbell
Biology 10th. San Francisco (CA):.) 
PRACTICE (60 MINS) Teacher tip
Group the learners before starting the
Divide the class into six groups. Four groups will be reporting on Animal Tissues while two groups will lesson. The reporting may be done the day
after finishing the discussion on Animal
be creating an infomercial on diseases caused by the malfunction of tissue types. Each infomercial Tissue Structure, Function, and Cell
group shall cover two tissue types. Modification.
The reports may be presented using a table

Each group will be given five minutes to report or show their infomercial. At the end of each which contains columns for tissue type, cell
presentation, facilitate a five-minute critiquing of the presentation. Make sure to get feedbacks from structures that characterize the tissue, part
the learners and clarify misconceptions from the reports. The report or the infomercial on diseases shall of the body where the tissue is located,
function, and importance.
not be graded. These will be a kind of formative assessment.Group the learners into pairs. Ask one to
draw the mitochondria and label its parts while the other does the same for chloroplast. Once done,
the partners exchange tasks (i.e., the learner that drew the mitochondria now does the same for the
chloroplast).
EVALUATION (10 MINS) Teacher tip

Assess if the learners are ready to answer
Ask the learners to group themselves in pairs or in groups of threes. This will allow the learners to
this individually. If they are not yet ready,
discuss and decide among themselves. However, if a learner chooses to do this activity on his or her this activity can be done in pairs or in
own, he or she should be allowed to do so. groups of threes. Make sure that you
provide enough time for the group to
discuss their responses. Remind the learners
Ask the learners to briefly and clearly answer the following questions: to answer briefly and clearly.
• What is the importance of having a tissue level in the hierarchy of biological organization? (2 points)
If you are not comfortable with this time of
• What do the varying shapes and arrangement of epithelial tissue suggests? (2 points) exam, a multiple-choice type of evaluation
• What is the general function of connective tissues? What function is common to all types of may also be prepared.
connective tissues? (1 point)
After getting the responses, you may get
• Why are there voluntary and involuntary muscle tissue functions? (2 points)
feedback from the learners to see if all
• What is the importance of glial cells in nervous tissues? (1 point) members of each group helped or
• Identify two cell modifications and describe their respective functions. (2 points) participated in their small discussions to
answer the short quiz. You may ask learners
to rate the members of their group.
Cell Cycle and Cell Division

LESSON OUTLINE
Content Standard
The learners demonstrate an understanding of the cell cycle and cell division Introduction Presentation of a simplified life cycle of a 5
human being or plant
(i.e., mitosis and meiosis).
Performance Standards Motivation Video presentation of ‘Cell Cycle and Cell 5

The learners shall be able to construct a three-dimensional model of the stages Division’
or phases involved in the cell cycle using indigenous or recyclable materials. Instruction/ Lecture-discussion on the cell through the 60
The learners shall put emphasis on the identification of possible errors that may Delivery use of a PowerPoint presentation, video, or
happen during these stages. cell diagram on a Manila paper;
Demonstration of the processes inside the
Learning Competencies
cell using model materials (e.g., beads,
The learners:
cords, yarn with different thickness, coins,
• characterize the phases of the cell cycle and their control points (STEM_BIO11/12- etc.); or, Summary of learners’ responses to
Id-f-6) questions regarding the video on ‘Cell Cycle
• describe the stages of mitosis and meiosis given 2n=6 (STEM_BIO11/12-Id-f-7) and Cell Division’
• discuss crossing over and recombination in meiosis (STEM_BIO11/12-Id-f-8)
• explain the significance or applications of mitosis/meiosis (STEM_BIO11/12-Id-f-9) Practice Class activities or games such as Amazing 10
• Race or Interphase, Mitosis, or Meiosis
identify disorders and diseases that result from the malfunction of the cell during
Puzzle
the cell cycle (STEM_BIO11/12-Id-f-10)
Specific Learning Outcomes Enrichment Video presentation or introduction on plant 5

and animal gametogenesis; Microscopic
• Identify and differentiate the phases of the cell cycle and their control
examination of an onion root tip
points
• describe and differentiate the stages of mitosis and meiosis given 2n=6 Evaluation Written or oral examination 5
• discuss and demonstrate crossing over and recombination in meiosis
Materials
• explain the significance and applications of mitosis and meiosis
photos of the life cycle or stages of eukaryotic organisms,
• construct a diagram of the various stages of mitosis and meiosis
yarns of different thickness, cords, beads, coins, pens
• identify disorders and diseases that result from malfunctions in the cell
during the cell cycle  Resources (continued at the end of Teaching Guide)
(1) Becker, W.M. (2000). The World of the Cell. Addison Wesley Longman
Inc., USA
(2) Mader, S.S. (2011).Biology 10th Ed. Mac Graw Hill Education, USA.
36
Introduce a simplified life cycle of a human being or plant. Let the learners identify the changes
Explain to the learners that these eukaryotic
throughout the different stages and how these organisms grow and develop.
organisms follow a complex sequence of
events by which their cells grow and divide.
This sequence of events is known as the Cell
Cycle.
You can show diagrams or illustrations that

demonstrate the growth or increase in the
number of organisms.
Figure 1: Life Cycle of Man and Higher Plants (Source: (n.d.). Retrieved from http://
www.vcbio.science.ru.nl/en/virtuallessons/cellcycle/postmeio/) Teacher tip
You can download the video prior to this
session or if internet connection is available
MOTIVATION (5 MINS) during class, you can just make use of the
hyperlink to play the video. To access the
video through the hyperlink, simply hold the
1. Play the video on ‘Cell Cycle and Cell Division’. This video can be accessed at http:// Control (Ctrl) Key on the keyboard and click
www.youtube.com/watch?v=Q6ucKWIIFmg.Divide the class into two groups. on the hyperlink.
You should ask the learners thought-

2. Show diagrams of cell division in multicellular or eukaryotic organisms to the class. provoking questions about the video and
relate it to the lesson.
38
INSTRUCTION/DELIVERY (30 MINS) Teacher tip
Note the learners’ responses to questions

Facilitate a lecture-discussion on the general concepts of cell division. about the video compared to the expected
responses. The expected responses are the
concepts listed in the Instruction / Delivery
Cell Division—involves the distribution of identical genetic material or DNA to two daughter cells. part.
What is most remarkable is the fidelity with which the DNA is passed along, without dilution or error,
from one generation to the next. Cell Division functions in reproduction, growth, and repair.
Core Concepts:
• All organisms consist of cells and arise from preexisting cells.
• Mitosis is the process by which new cells are generated.
• Meiosis is the process by which gametes are generated for reproduction.
• The Cell Cycle represents all phases in the life of a cell.
• DNA replication (S phase) must precede mitosis so that all daughter cells receive the same
complement of chromosomes as the parent cell.
• The gap phases separate mitosis from S phase. This is the time when molecular signals mediate the
switch in cellular activity.
• Mitosis involves the separation of copied chromosomes into separate cells.
• Unregulated cell division can lead to cancer.
• Cell cycle checkpoints normally ensure that DNA replication and mitosis occur only when conditions
are favorable and the process is working correctly.
• Mutations in genes that encode cell cycle proteins can lead to unregulated growth, resulting in
tumor formation and ultimately invasion of cancerous cells to other organs.
The Cell Cycle control system is driven by a built-in clock that can be adjusted by external stimuli (i.e.,
chemical messages).
Checkpoint—a critical control point in the Cell Cycle where ‘stop’ and ‘go-ahead’ signals can regulate
the cell cycle.
• Animal cells have built-in ‘stop’ signals that halt the cell cycles and checkpoints until
overridden by ‘go-ahead’ signals.
• Three major checkpoints are found in the G1, G2, and M phases of the Cell Cycle.
38
The G1 Checkpoint—the Restriction Point
• The G1 checkpoint ensures that the cell is large enough to divide and that enough nutrients are available to support the
resulting daughter cells.
• If a cell receives a ‘go-ahead’ signal at the G1 checkpoint, it will usually continue with the Cell Cycle.
• If the cell does not receive the ‘go-ahead’ signal, it will exit the Cell Cycle and switch to a non-dividing state called G0.
• Most cells in the human body are in the G0 phase.
The G2 Checkpoint—ensures that DNA replication in S phase has been successfully completed.
The Metaphase Checkpoint—ensures that all of the chromosomes are attached to the mitotic spindle by a kinetochore.
Kinase—a protein which activates or deactivates another protein by phosphorylating them. Kinases give the ‘go-ahead’ signals at the
G1 and G2 checkpoints. The kinases that drive these checkpoints must themselves be activated.
• The activating molecule is a cyclin, a protein that derives its name from its cyclically fluctuating concentration in the cell.
Because of this requirement, these kinases are called cyclin-dependent kinases or CDKs.
• Cyclins accumulate during the G1, S, and G2 phases of the Cell Cycle.
• By the G2 checkpoint, enough cyclin is available to form MPF complexes (aggregations of CDK and cyclin) which initiate
mitosis.
• MPF functions by phosphorylating key proteins in the mitotic sequence.
• Later in mitosis, MPF switches itself off by initiating a process which leads to the destruction of cyclin.
• CDK, the non-cyclin part of MPF, persists in the cell as an inactive form until it associates with new cyclin molecules
synthesized during the interphase of the next round of the Cell Cycle.
Discuss the stages of mitosis and meiosis.
Mitosis (apparent division)—is nuclear division; the process by which the nucleus divides to produce two new nuclei. Mitosis results in two
daughter cells that are genetically identical to each other and to the parental cell from which they came.
Cytokinesis—is the division of the cytoplasm. Both mitosis and cytokinesis last for around one to two hours.
Prophase—is the preparatory stage, During prophase, centrioles move toward opposite sides of the nucleus. 
• The initially indistinct chromosomes begin to condense into visible threads. Teacher tip
• Chromosomes first become visible during early prophase as long, thin, and
intertwined filaments but by late prophase, chromosomes are more compacted and You may show diagrams or a video
demonstrating animal and plant mitosis. The
can be clearly discerned as much shorter and rod-like structures.
video can be accessed at http://
• As the chromosomes become more distinct, the nucleoli also become more www.vcbio.science.ru.nl/en/virtuallessons/
distinct. By the end of prophase, the nucleoli become less distinct, often mitostage/
disappearing altogether.
Metaphase—is when chromosomes become arranged so that their centromeres become aligned in
one place, halfway between the two spindle poles. The long axes of the chromosomes are 90 degrees
to the spindle axis. The plane of alignment is called the metaphase plate.
Anaphase—is initiated by the separation of sister chromatids at their junction point at the centromere.
The daughter chromosomes then move toward the poles.
Telophase—is when daughter chromosomes complete their migration to the poles. The two sets of
progeny chromosomes are assembled into two-groups at opposite ends of the cell. The chromosomes
uncoil and assume their extended form during interphase. A nuclear membrane then forms around
each chromosome group and the spindle microtubules disappear. Soon, the nucleolus reforms.
Meiosis—reduces the amount of genetic information. While mitosis in diploid cells produces
daughter cells with a full diploid complement, meiosis produces haploid gametes or spores with only
one set of chromosomes. During sexual reproduction, gametes combine in fertilization to reconstitute
the diploid complement found in parental cells. The process involves two successive divisions of a
diploid nucleus.
First Meiotic Division

The first meiotic division results in reducing the number of chromosomes (reduction division). In most
cases, the division is accompanied by cytokinesis.
40
Prophase I—has been subdivided into five substages: leptonema, zygonema, pachynema, diplonema, and diakinesis.
• Leptonema—Replicated chromosomes have coiled and are already visible. The number of chromosomes present is the same
as the number in the diploid cell.
• Zygonema—Homologue chromosomes begin to pair and twist around each other in a highly specific manner. The pairing is
called synapsis. And because the pair consists of four chromatids it is referred to as bivalent tetrad.
• Pachynema—Chromosomes become much shorter and thicker. A form of physical exchange between homologues takes
place at specific regions. The process of physical exchange of a chromosome region is called crossing-over. Through the
mechanism of crossing-over, the parts of the homologous chromosomes are recombined (genetic recombination).
• Diplonema—The two pairs of sister chromatids begin to separate from each other. It is at this point where crossing-over is
shown to have taken place. The area of contact between two non-sister chromatids, called chiasma, become evident.
• Diakinesis—The four chromatids of each tetrad are even more condensed and the chiasma often terminalize or move down
the chromatids to the ends. This delays the separation of homologous chromosomes.
In addition, the nucleoli disappear, and the nuclear membrane begins to break down.
Metaphase I—The spindle apparatus is completely formed and the microtubules are attached to the centromere regions of the homologues.
The synapsed tetrads are found aligned at the metaphase plate (the equatorial plane of the cell) instead of only replicated chromosomes.
Anaphase I—Chromosomes in each tetrad separate and migrate toward the opposite poles. The sister chromatids (dyads) remain attached at
their respective centromere regions.
Telophase I—The dyads complete their migration to the poles. New nuclear membranes may form. In most species, cytokinesis follows,
producing two daughter cells. Each has a nucleus containing only one set of chromosomes (haploid level) in a replicated form.
Second Meiotic Division

The events in the second meiotic division are quite similar to mitotic division. The difference lies, however, in the number of chromosomes that
each daughter cell receives. While the original chromosome number is maintained in mitosis, the number is reduced to half in meiosis.
Prophase II—The dyads contract.
Metaphase II—The centromeres are directed to the equatorial plate and then divide.
Anaphase II—The sister chromatids (monads) move away from each other and migrate to the opposite poles of the spindle fiber.
Telophase II—The monads are at the poles, forming two groups of chromosomes. A nuclear membrane forms around each set of chromosomes
and cytokinesis follows. The chromosomes uncoil and extend. 
Cytokinesis—The telophase stage of mitosis is accompanied by cytokinesis. The two nuclei are Teacher tip
compartmentalized into separate daughter cells and complete the mitotic cell division process. In
animal cells, cytokinesis occurs by the formation of a constriction in the middle of the cell until two You can show a tabular comparison
between mitosis and meiosis to point the
daughter cells are formed. The constriction is often called cleavage, or cell furrow. However, in most
significance of the two types of division.
plant cells this constriction is not evident. Instead, a new cell membrane and cell wall are assembled Divide the class into two groups and ask
between the two nuclei to form a cell plate. Each side of the cell plate is coated with a cell wall that them about their opinions on the
eventually forms the two progeny cells. applications of mitosis and meiosis.
Meiosis Mitosis The following could be possible responses:
Significance of mitosis for sexual

1. Requires two nuclear divisions 1. Requires one nuclear division reproduction: Mitosis is important for
sexual reproduction indirectly. It allows the
sexually reproducing organism to grow and
2. Chromosomes synapse and cross 2. Chromosomes do not synapse nor cross develop from a single cell into a sexually
over over mature individual. This allows organisms to
continue to reproduce through the
generations.
3. Centromeres survive Anaphase I 3. Centromeres dissolve in mitotic anaphase
Significance of Meiosis and Chromosome
Number: Chromosomes are the cell's way
of neatly arranging long strands of DNA.
Non-sex cells have two sets of
4. Halves chromosome number 4. Preserves chromosome number chromosomes, one set from each parent.
Meiosis makes sex cells with only one set of
chromosomes. For example, human cells
5. Produces four daughter nuclei 5. Produces two daughter nuclei have 46 chromosomes, with the exception
of sperm and eggs, which contain only 23
chromosomes each. When a sperm cell
6. Produces daughter cells genetically 6. Produces daughter cells genetically
fertilizes an egg, the 23 chromosomes from
different from parent and each other identical to parent and to each other each sex cell combine to make a zygote, a
new cell with 46 chromosomes. The zygote
7. Used only for sexual reproduction 7. Used for asexual reproduction and is the first cell in a new individual.
growth
Table 1: Comparison of Mitosis and Meiosis (Source: http://courses.washington.edu/bot113/spring/

WebReadings/PdfReadings/TABLE_COMPARING_MITOSIS_AND.pdf)
42
Meiosis I compared to Mitosis Meiosis II compared to Mitosis Teacher tip
Significance of Meiosis for Diversity:
Meiosis I Mitosis Meiosis II Mitosis One of the benefits of sexual reproduction
is the diversity it produces within a
Prophase I Prophase Prophase II Prophase population. That variety is a direct product
of meiosis. Every sex cell made from meiosis
Pairing of homologous No pairing of No pairing of No pairing of
has a unique combination of chromosomes.
chromosomes chromosomes chromosomes chromosomes This means that no two sperm or egg cells
Metaphase I Metaphase Metaphase II Metaphase are genetically identical. Every fertilization
event produces new combinations of traits.
Bivalents at metaphase Duplicated Haploid number of Diploid number This is why siblings share DNA with parents
plate chromosomes at duplicated of duplicated and each other, but are not identical to one
metaphase plate chromosomes at chromosomes at another.
metaphase plate metaphase plate
Anaphase I Anaphase Anaphase II Anaphase
Homologues of each Sister chromatids Sister chromatids Sister chromatids Teacher tip
You may show a video that demonstrates
bivalent separate and separate, becoming separate, becoming separate how crossing over and recombination of
duplicated daughter daughter becoming chromosomes occur. The video can be
chromosomes move to chromosomes that chromosomes that daughter accessed at http://
poles move to the poles move to the poles chromosomes highered.mheducation.com/sites/
that move to the 9834092339/student_view0/chapter11/
meiosis_with_crossing_over.html.s
poles
Telophase I Telophase Telophase II Telophase
Two haploid daughter Two diploid Four haploid Two diploid
cells not identical to the daughter cells, daughter cells not daughter cells,
parent cell identical to the genetically identical identical to the
parent cell parent cell
Table 2: Meiosis compared to Mitosis
Facilitate a discussion on disorders and diseases that result from the malfunction of the cell during the
cell cycle. Present some diagrams or illustrations on some errors in mitosis and allow the learners to
predict possible outcomes, diseases, or disorders that may happen:
• incorrect DNA copy (e.g., cancer)
• chromosomes are attached to string-like spindles and begin to move to the middle of the cell (e.g.,
Down Syndrome, Alzheimer’s, and Leukemia) 
Other chromosome abnormalities:
• arise from errors in meiosis, usually meiosis I;
• occur more often during egg formation (90% of the time) than during sperm formation;
• become more frequent as a woman ages.
• Aneuploidy—is the gain or loss of whole chromosomes. It is the most common chromosome
abnormality. It is caused by non-disjunction, the failure of chromosomes to correctly separate:
• homologues during meiosis I or
• sister chromatids during meiosis II
PRACTICE (10 MINS)

Facilitate games like Amazing Race, Interphase/Mitosis/Meiosis Puzzle in the class.
1. The Amazing Race follows a series of stations or stages with challenges that the learners have to
accomplish. Divide the class into groups after the discussion. The number of groups will depend on the
Teacher tip
number of stages or phases in the process (i.e., interphase, mitosis, or meiosis).
2. The groups will race to accomplish the tasks in five stations. In each station, the learners will assemble Encourage the learners to actively
participate in the challenge. You may
given materials to illustrate stages or phases of events in the specific process (i.e., interphase, mitosis,
give extra points to those who will
or meiosis). finish first.
A number of good videos have the

ENRICHMENT (5 MINS) stages or phases made into a rap or a
1. Instruct the learners to watch additional videos on cell division. song. One such example is the video
2. Introduce animal and plant gametogenesis to the learners in order for them to appreciate the entitled Cell Division Song Spongebob
that can be accessed at
significance of cell division.
http://www.youtube.com/watch?
3. Facilitate microscopic examination of onion root tip. v=9nsRufogdoI. Encourage each group
to brainstorm and point out their
perceptions of the videos.
EVALUATION (5 MINS)
Facilitate the accomplishment of a self-assessment checklist. A video on animal and plant
gametogenesis can be accessed at
http://csls-text.c.u-tokyo.ac.jp/active/
12_05.html.
44
ADDITIONAL RESOURCES:
Books:
1. Raven, P. a. (2001). Biology 6th Ed. The McGraw Hill Company, USA
2. Reece, J. B. (2013). Campbell Biology, 10th Ed. Pearson Education, Inc. United States of America. 
Electronic Resources:
3. (n.d.). Retrieved from Bright Hub Education: http://www.brighthubeducation.com/middle-school-science-lessons/94267-three-activities-for-
teaching-cell-cycles/#
4. (n.d.). Retrieved from http://www.uic.edu/classes/bios/bios100/lecturesf04am/lect16.htm
5. (n.d.). Retrieved from MH Education: http://highered.mheducation.com/sites/9834092339/student_view0/chapter11/
meiosis_with_crossing_over.html
6. (n.d.). Retrieved from http://www.vcbio.science.ru.nl/en/virtuallessons/meiostage/
7. (n.d.). Retrieved from http://csls-text.c.u-tokyo.ac.jp/active/12_05.html
8. (n.d.). Retrieved from http://education.seattlepi.com/biological-significance-mitosis-meiosis-sexual-reproduction-5259.htm
Transport Mechanisms Pt.1

LESSON OUTLINE
Content Standards
The learners demonstrate an understanding of Transport Mechanisms: Introduction Visualization of the plasma membrane and its 30
functions
Simple Diffusion, Facilitated Transport, Active Transport, and Bulk/Vesicular
Transport Motivation Simple group activity and brief reporting 60
Performance Standards
The learners shall be able to construct a cell membrane model from indigenous Instruction/ Discussion and lecture proper 120
or recyclable materials. Delivery
Practice Answering practice/guide questions 45
The learners:
• describe the structural components of the cell membrane
(STEM_BIO11/12–Ig-h-11) Enrichment Essay and concept map writing 45
• relate the structure and composition of the cell membrane to its function
(STEM_BIO11/12-Ig-h-12) Evaluation Designing a model of a plasma 180
• explain transport mechanisms in cells (diffusion, osmosis, facilitated membrane using recyclable or
transport, active transport) (STEM_BIO11/12–Ig-h-13) indigenous materials
• differentiate exocytosis and endocytosis (STEM_BIO11/12-Ig-h-14)
Materials
Specific Learning Outcomes pen, paper, salt, water, recycled or indigenous materials
At the end of the lesson, the learners shall be able to:
• describe and compare diffusion, osmosis, facilitated transport and active Resources
(1) Campbell, N. J. (n.d.).
transport
(2) Campbell, N. e. (2008). Biology 8th edition. Pearson International
• explain factors that affect the rate of diffusion across a cell membrane Edition. Pearson/Benjamin.
• predict the effects of hypertonic, isotonic, and hypotonic environments on (3) Freeman, S. (2011). Biological Science 4th edition International Edition.
osmosis in animal cells Benjamin Cummings Publishing.
• differentiate endocytosis (phagocytosis and pinocytosis) and exocytosis  (4) Hickman, C. L. (2011). Integrated Principles of Zoology 15th edition.
McGraw Hill Co., Inc.
46
1. Before this lesson, ask the learners to read about the topic on transport of materials across
membranes.
2. Introduce the topic by providing the learners with background information.  
In order for the cell to stay alive, it must meet the characteristics of life which include taking
nutrients in and eliminating wastes and other by-products of metabolism. Several mechanisms allow
cells to carry out these processes. All of the cell’s activities are in one way or another tied to the
membrane that separates its interior from the environment.
3. Ask the learners how they understand and visualize a plasma membrane and what characteristics
are essential for it to perform its function.
4. Ask the learners to identify the different mechanisms on how materials are transported in and out of
the cell.
Teacher tip
MOTIVATION (60 MINS) Different responses to the question will be
1. Divide the learners into groups and ask them the following question: “What comes to your mind drawn from students. Their responses will
when you see a 20 year old man who is 7.5 ft. tall and 3.5 ft. tall man of the same age?” Among depend on what aspect they are looking
their respective groups, let the learners discuss the similarities and differences between the two. into.
(Hint: Give students a clue by giving them the giant and pygmy as examples). Acknowledge the responses of the learners.
2. Ask a representative from each group to report the result of their discussion to the whole class. Point out and explain that the two men are
3. Before the start of the lesson on diffusion, spray an air freshener in one corner of the room and ask both abnormal. Their growths are abnormal
the learners to raise their hands if they have smelled the scent of the spray. such that one is too big in size and the
other one is too small. Both men have
4. Ask the learners what they have observed. Who smelled the scent first? Who are the last ones to defective membranes. Insufficient amount
smell the scent? How would you explain the phenomenon wherein learners in the same classroom of growth hormones pass through a
smelled the spray at different times? pygmy’s body while an excessive amount of
growth hormones is released in a giant.

1. Show an illustration of a plasma membrane to the learners.
2. Ask the learners to describe the plasma membrane.
3. Discuss the importance of the plasma membrane and how indispensable it is to the life of the cell.
4. Explain how plasma membranes are arranged in the presence of water.
5. Let the learners enumerate the structures found in a plasma membrane. 
6. Explain to the learners the structure of a phospholipid bilayer. 
 
Phospholipids are the foundation of all known biological membranes. The lipid bilayer forms as a result of the interaction between the
nonpolar phospholipid tails, the polar phospholipid heads, and the surrounding water. The nonpolar tails face toward the water.
Transmembrane proteins float within the bilayer and serve as channels through which various molecules can pass.
7. Ask the learners to enumerate the different transport interior to accommodate the natural inward movement. Most
mechanisms. plants are hypertonic with respect to their immediate
8. Differentiate between diffusion and osmosis. environment. Osmotic pressure within the cell pushes the
cytoplasm against the cell wall and makes a plant cell rigid. 
9. Compare and contrast facilitated diffusion and active transport.
 
10. Present photos of plant and animal cells immersed in an
To control the entrance and exit of particular molecules,
isotonic, hypotonic, and hypertonic solution.
selective transport of materials is necessary. One simple process
11. Describe solution and solute movement in and out of the cell is facilitated diffusion that utilizes protein transmembrane
under hypertonic, hypotonic, and isotonic conditions. channels that are specific to certain molecules. It is a passive
12. Explain the effects of the different solutions to the cells. Ask process driven by the concentration of molecules both inside
which among the three solutions is the best for plants? How and the outside of the membrane. Certain molecules are
about for animals? Explain to the learners the water requirement transported in and out of the cell, independent of concentration.
in plants.  This process requires the expenditure of energy in the form of
  ATP and is called active transport.
Diffusion is the natural tendency for molecules to move 13. Differentiate among endocytosis, phagocytosis, pinocytosis,
constantly. Their movement is random and is due to the energy receptor-mediated endocytosis, and exocytosis. 
found in the individual molecules. Net diffusion occurs when the  
materials on one side of the membrane have a different Large molecules enter the cell by generalized nonselective
concentration than the materials on the other side.  process known as endocytosis. Phagocytosis is endocytosis of a
particulate material while endocytosis of liquid material is called
Osmosis is a special type of diffusion specifically associated with pinocytosis. Exocytosis is the reverse process. Receptor-
the movement of water molecules. Many cells are isotonic to the mediated endocytosis is a complicated mechanism involving the
environment to avoid excessive inward and outward movement transport of materials via coated vesicles. 
of water. Other cells must constantly export water from their
48
PRACTICE (45 MINS) EVALUATION (180 MINS)
Ask the learners to design and a model of a plasma membrane
Ask the learners to answer the following practice or guide using recyclable or indigenous materials.
questions: Divide the learners into groups and assign different concentrations
• What is the difference between diffusion and facilitated of salt solution to be used in making salted eggs.
diffusion? Ask the learners to answer the following questions:
• How do endocytosis and exocytosis allow movement of • Why does putting salt on meat preserve it from bacterial
materials in and out of the cell? spoilage?
• What solution is best for a plant cell? How about for an animal • Compare specific transport processes (i.e., diffusion, osmosis,
cell? facilitated transport, active transport, endocytosis, and
• Explain the orientation of the phospholipid molecules in the exocytosis) in terms of the following:
presence of water. • concentration gradient
• use of channel or carrier protein
• use of energy
• types or sizes of molecules transported
Let the learners recognize the effect of a defective membrane in
normal body functioning. Ask them to write an essay about the
possible effects of a faulty plasma membrane aside from the
examples given earlier.
Ask the learners to individually submit a concept map about plasma
membrane and the different transport mechanisms.
Transport Mechanisms Pt.2 LESSON OUTLINE

Content Standard Introduction Presentation of objectives and important terms; 15
The learners shall be able to construct a cell membrane model from indigenous Discussion on the structure of the plasma
or recyclable materials. membrane; Brief discussion on the different
transport mechanisms
The learners shall be able to construct a cell membrane model from indigenous Motivation 15
Class activity to illustrate the process of diffusion;
Discussion of similarities between a giant and
or recyclable materials. pygmy; Demonstration of the principle behind the
process of making salted eggs
The learners: Instruction/ Discussions, as a class and among groups, on the 60
Delivery structure and importance of the plasma
• describe the structural components of the cell membrane membrane and on the different transport
(STEM_BIO11/12–Ig-h-11) mechanisms
• relate the structure and composition of the cell membrane to its function
Practice Answering of practice or guide questions 30
(STEM_BIO11/12-Ig-h-12)
• explain transport mechanisms in cells (diffusion, osmosis, facilitated Enrichment Essay writing or concept mapping; Class activity 60
transport, active transport) (STEM_BIO11/12–Ig-h-13) on salted egg making
• differentiate exocytosis and endocytosis (STEM_BIO11/12-Ig-h-14)

Evaluation Construction of a plasma membrane model from 60
Specific Learning Outcomes indigenous or recyclable materials; Concept
mapping on the different transport mechanisms;
Answering of questions for assessment
• describe the plasma membrane
Materials
• explain how plasma membranes are arranged in the presence of water projector, laptop (if available), visual aids, school supplies, recycled or
• understand the structure of the phospholipid bilayer indigenous materials
• describe and compare diffusion, osmosis, facilitated transport and active Resources
transport (1) Campbell, N.A. et. al. (2008). Biology 8th Edition Pearson International.
Pearson/Benjamin Cummings Publishing.
• explain factors that affect the rate of diffusion across a cell membrane
(2) Campbell, N. J. (2010). Biology 9th edition Pearson International Edition.
• predict the effects of hypertonic, isotonic, and hypotonic environments on Benjamin Cummings Publishing.
osmosis in animal cells (3) Freeman, S. (2011). Biological Science. 4th edition. International Edition.
• differentiate endocytosis (phagocytosis and pinocytosis) and exocytosis Benjamin Cummings Publishing.
(4) Hickman, C. L. (2011). Integrated Principles of Zoology. 15th edition. McGraw
Hill Co., Inc.
50
Prior to this lesson, instruct the learners to read up on the transport of materials across membranes. Ask After the learners have enumerated the
different transport mechanisms, ask them
the learners to identify the different mechanisms on how materials are transported in and out of the
why they think there is a need to have
cell. different kinds of processes that allow
Introduce the topic by providing the learners with background information. materials to be transported in and out of
the cell.
In order for the cell to stay alive, it must meet the characteristics of life which include taking nutrients in
and eliminating wastes and other by-products of metabolism. Several mechanisms allow cells to carry Learners will describe the plasma
out these processes. All of the cell’s activities are, in one way or another, tied to the membrane that membrane in different ways. Ask them how
they think the structures found within the
separates its interior from the environment.
membrane help in performing its function
Ask the learners how they visualize a plasma membrane and what characteristics do they think are and what might happen in the absence of
essential for it to perform its function. the these structures
Teacher tip
MOTIVATION (15 MINS) Allow some time for the learners to smell
Before the start of the lesson on diffusion, conduct this simple class activity. Spray an air freshener in the spray until everyone has already smelled
one corner of the room and instruct the learners to raise their hands if they have smelled the scent of the scent. Remember to instruct the
the spray. learners to raise their hand once they smell
the scent. 
Ask the learners the following questions:  
• Who among the class were able to smell the air freshener first? The learners might give varying responses
to the question depending on what aspect
• Who among the class were the last ones to smell the air freshener? they are looking into. Give hints by
• How would you explain the phenomenon wherein people in the same classroom smelled the providing the giant and pygmy as examples.
scent of the air freshener at different times?
Acknowledge the learners’ responses and
point out that the two men are similar in the
Divide the learners into groups and ask them the question: What comes to your mind when you see sense that they are both abnormal. Growth
two men who are of the same age but one is 7.5 feet tall and the other is 3.5 feet tall? in both men is abnormal such that one is
too big in size while the other one is too
Allow the learners to discuss the similarities and differences between the two among their groups. small.
Explain that both men have abnormal

Ask a representative from each group to present the results of their discussions to the whole class. growth. Both have defective membranes.
Insufficient amount of growth hormones
pass through a pygmy’s body while an
excessive amount of growth hormones is
released in a giant.
INSTRUCTION/DELIVERY (60 MINS) Teacher tip
You can ask the following questions before
Structure, function and importance of the plasma membrane starting the discussion:
1. Present an illustration of the plasma membrane to the class
2. Ask the learners to describe the plasma membrane. Have you realized how crucial the task of a
plasma membrane is in maintaining the life
3. Discuss the importance of the plasma membrane and how indispensable it is to the life of the cell.
of a cell?
4. Explain how plasma membranes are arranged in the presence of water.
5. Let students enumerate structures found in a plasma membrane. Have you thought about the ways on how
6. Make students understand the structure of a phospholipid bilayer. the materials needed by the cell and the
wastes it needs to dispose are able to move
in and out of the plasma membrane?
Plasma membranes—are made up of a phospholipid bilayer in an aqueous environment.
Phospholipids are the foundation of all known biological membranes. The lipid bilayer forms as a
result of the interaction between the non-polar (hydrophobic or water-fearing) phospholipid
tails, the polar (hydrophilic or water-loving) phospholipid heads, and the surrounding water.
The nonpolar tails face toward the water. Transmembrane proteins float within the bilayer and serve as
channels through which various molecules can pass. They function as ‘identification tags’ on cells
which enable the cell to determine if the other cells that it encounters are like itself or not. It also
permits cells of the immune system to accept and reject foreign cells such as disease-causing bacteria.
Many membrane proteins function as enzymes that speed up reactions in cells. Others act like paste or
glue-forming cell junctions where adjacent cells stick together. Membranes also contain cholesterol
which reduces the cell’s permeability to substances and make the bilayer stronger.
Transport Mechanisms
1. Ask the learners to enumerate the different transport mechanisms.
2. Differentiate between diffusion and osmosis.
52
Molecules and substances move in several ways that fall within two categories: passive transport and active transport. In passive transport,
heat energy of the cellular environment provides all of the energy, hence, this is not energy-costly to the cell. Active transport, however, requires
the cell to do work, requiring the cell to expend its energy reserves.
Diffusion is a type of passive transport described as the natural tendency for molecules to move constantly. Their movement is random and is
due to the energy found in the individual molecules. Net diffusion occurs when the materials on one side of the membrane have a different
concentration than the materials on the other side. Osmosis is a special type of diffusion specifically associated with the movement of water
molecules.
A solution with a higher concentration of solutes is said to be hypertonic while a solution with a lower concentration of solutes is hypotonic.
Water crosses the membrane until the solute concentrations are equal on both sides. Solutions of equal solution concentration are said to be
isotonic. This only occurs when the solute concentration are the same on both sides of the membrane.
Compare and contrast facilitated diffusion and active transport. Then present photos of plant and animal cells immersed in an isotonic,
hypotonic, and hypertonic solution. In addition, describe a solution and solute movement into and out of the cell under hypertonic, hypotonic
and isotonic conditions.
Explain the effects of the different solutions to the cells. Ask which among the three solutions is the best for plants? For animals? Let them
understand water requirement in plants.
Many cells are isotonic to the environment in order to avoid excessive inward and outward movement of water. Other cells must constantly
export water from their interior to accommodate the natural inward movement. Most plants are hypertonic with respect to their immediate
environment. Osmotic pressure within the cell pushes the cytoplasm against the cell wall and makes a plant cell rigid.
Ask the learners the following questions:

• How do cells behave in different solutions?
• What do you notice about the effect of different solutions to animal and plant cells?
• What solution is best for an animal cell? Does this hold true with plant cells?
When an animal cell such as red blood cell is immersed in an isotonic solution, the cell gains water at the same rate that it loses it. The cell’s
volume remains constant in this situation.
What will happen to the red blood cell when immersed in a hypotonic solution which has a lower solute concentration than the cell? The cell
gains water, swells, and may eventually burst due to excessive water intake. When placed in a hypertonic solution, an animal cell shrinks and
can die due to water loss.
Water requirement for plant cells is different due to their rigid cell walls. A plant cell placed in an isotonic solution is flaccid and a plant wilts in
this condition. In contrast with animal cells, a plant cell is turgid and healthy in a hypotonic solution. In a hypertonic solution, a plant cell loses
water, shrivels, and its plasma membrane detaches from the cell wall. This situation eventually causes death in plant cells.
Differentiate diffusion from facilitated diffusion.
To control the entrance and exit of particular molecules, selective transport of materials is necessary. One simple process is facilitated diffusion
that utilizes protein transmembrane channels that are specific to certain molecules. It is a passive process driven by the concentration of
molecules on the inside and the outside of the membrane. Certain molecules are transported in and out of the cell, independent of
concentration. This process requires the expenditure of energy in the form of ATP and is called active transport.
 
Differentiate endocytosis, phagocytosis, pinocytosis, receptor-mediated endocytosis, and exocytosis. 
Large molecules enter the cell by generalized non-selective process known as endocytosis. Phagocytosis is endocytosis of a particulate
material while pinocytosis is endocytosis of liquid material. In this process, the plasma membrane engulfs the particle or fluid droplet and
pinches off a membranous sac or vesicle with a particular fluid inside into the cytoplasm.
Exocytosis is the reverse process where a membrane-bound vesicle filled with bulky materials moves to the plasma membrane and fuses with
it. In this process, the vehicle’s contents are released out of the cell.
Receptor-mediated endocytosis is a complicated mechanism involving the transport of materials through coated vesicles. Cells take up
molecules more efficiently in this process due to the receptor proteins on their surfaces. Each receptor protein bears a binding site for a
particular molecule. If the right molecule contacts a receptor protein, it attaches to the binding site, forming a pocket and eventually pinching
off into the cytoplasm.
PRACTICE (30 MINS)

Ask the learners to answer the following questions:
• Explain the orientation of the phospholipid molecules in the presence of water.
• Enumerate the structures found in a plasma membrane and give the function of each. 
54
• How do diffusion and facilitated diffusion differ?
• How do endocytosis and exocytosis allow movement of materials in and out of the cell?
• What solution is best for a plant cell? How about for an animal cell?
• Give two ways by which one could determine whether active transport is going on.
• Compare and contrast the effects of hypertonic and hypotonic solutions on plant and animal cells.
• What role do vacuoles play in endocytosis and exocytosis?

Essay writing and concept mapping
1. Ask the learners to write an essay about the possible effects of a faulty plasma membrane aside
from the examples given in the lesson. Let the learners recognize the effects of a defective membrane
to normal bodily functions.
2. Ask the learners to individually submit a concept map about the plasma membrane. You can provide Teacher tip
For the concept mapping, you can provide
them with sample words for their concept map: the learners with key words or allow them to
• plasma membrane come up with their own key words for their
• semipermeable concept map.
• phospholipid bilayer
• hydrophilic heads
• hydrophobic tails
• cholesterol
• membrane proteins
Creating own saturated salt solution for salted egg-making

1. Divide the class into groups and assign different concentrations of salt solutions to be used in
making salted eggs.
2. Instruct the learners to make their own salt solutions and take note of the concentration that they opt Teacher tip
to use. Diffusion and osmosis are two processes
involved in making salted eggs. The salt
solution should be supersaturated in order
to produce good and delicious salted eggs.
EVALUATION (60 MINS)
Building of plasma membrane model

1. Divide the class into groups.
2. Ask the groups to design and build a model of a plasma membrane using recyclable or indigenous
materials.
 
Concept mapping Teacher tip
Ask the learners to individually submit a concept map about the different transport mechanisms. You You can provide the learners with key words
can provide them with sample words for their concept map or allow them to come up with their own:  or allow them to come up with their own
key words for their concept map.
• plasma membrane • phagocytosis
• transport mechanisms • pinocytosis
• passive transport • receptor-mediated
• active transport endocytosis
• diffusion • hypotonic
• facilitated diffusion • hypertonic
• endocytosis • isotonic  
• exocytosis
Assessment questions:
Instruct the learners to answer the following questions to assess their knowledge and understanding of
the lesson:
• Why does putting salt on meat preserve it from spoilage by bacteria?
• Compare specific transport processes (i.e., diffusion, osmosis, facilitated transport, active transport,
endocytosis, and exocytosis) in terms of the following:
• concentration gradient
• use of channel or carrier protein
• use of energy
• types or sizes of molecules transported
56
Carbohydrates and Lipids: LESSON OUTLINE

Structures and Functions Introduction Presentation of learning objectives and 10
of Biological Molecules important terms; Discussion on dehydration
reactions and hydrolysis
Content Standard Motivation Relating the lessons to real-life situations; 10
The learners demonstrate an understanding of the structures and functions of Discussion on food as sources of energy and
carbohydrates and lipids and their roles in specific metabolic processes. building blocks
The learners shall be able to explain the role and significance of carbohydrates Instruction/ Discussion, as a class and among groups, on 60
Delivery/ the structure and importance of
and lipids in biological systems.
Practice carbohydrates and lipids.
The learners:
Enrichment Laboratory activity on testing the 20
• categorize the biological molecule as a carbohydrate or lipid according to
presence of carbohydrates and lipids on
their structure and function (STEM_BIO11/12-Ii-j-15)
common food products
• explain the role of each biological molecule in specific metabolic processes
(STEM_BIO11/12-Ii-j-16)
• detect the presence of carbohydrates and lipids in food products using Evaluation Group activity on making molecular 20
simple tests models of carbohydrates and lipids
Specific Learning Outcomes Materials

At the end of the lesson, the learners shall be able to: projector, laptop (if available), sample food labels, common
food or drink products (e.g. flour, cornstarch, cooking oil,
• present simple molecular models of carbohydrates and lipids and relate the
food or drink brought by the learners
structure to the roles that these molecules play in biological systems
• perform tests for the presence of starch and reducing sugars and lipids on
common food products Resources
(1) Reece, J.U. (2011). Campbell Biology, 9th ed. San Francisco, CA:
Pearson Benjamin Cummings
Communicate learning objectives and important terms Prominently display the learning objectives
and important terms on one side of the
classroom and frequently refer to them
Introduce the following learning objectives using any of the suggested protocols (i.e., verbatim, own
during the discussion. You may place a
words, or read-aloud) check-mark beside a term in the wordlist
• I can distinguish a carbohydrate from a lipid given its chemical structure and function. after defining it so that the learners have an
idea of their progress.
• I can explain the roles played by carbohydrates and lipids in biological systems.
• I can detect the presence of carbohydrates and lipids in food products using simple chemical tests. Each learner can also illustrate or define the
term on a sheet of paper which can be
tacked beside the list of words.
Introduce the list of important terms that learners will encounter in this lesson: 
• macromolecule • cellulose Another way of incorporating lists of
• polymer • chitin important terms is to have the words placed
• monomer • lipids in a blank bingo card grid.
• dehydration reaction • fat
Learners can write a short definition or
• hydrolysis • fatty acid description of the term under the entry in
• carbohydrates • triacylglycerol the bingo card to block out a square. This
• monosaccharides • saturated fatty acid may serve as the learners’ reference guide
or method of formative assessment.
• disaccharides • unsaturated fatty acid
• glycosidic linkage • trans fat
• polysaccharide • phospholipids
• starch • steroids
• glycogen • cholesterol 
MOTIVATION (10 MINS)

1. Divide the class into groups of three.
2. Distribute sample food or nutrition labels to each group and ask them if they know how to interpret
the information written on the food labels.
58
You may ask the following questions to facilitate the Teacher tip
discussion and call on several groups to present in front of
the class: For the food labels, local products that are
familiar to the learners will make the best
•How many servings are in this container? samples. Make sure that the labels have
carbohydrates, fats, and fibers in them. If
•Would you agree that this is the reasonable amount of there are no food labels available, you may
do an image search and print some sample
food you would consume per serving? How many total
food labels from the internet.
food calories (C) are in this container?
Division into small groups of two or three
•How much fat is present in one serving? What kind of fat? may facilitate sharing. Only call on two or
three groups to present if there is limited
What is the importance of consuming fats in our diet?
time.
•How much carbohydrates are present in one serving? Expect the responses to vary depending on
What kind of carbohydrates? What is the importance of how realistic the serving sizes are. You can
also discuss about how advertisers can
consuming carbohydrates in our diet?
influence how people perceive food.
Take note that a food calorie is the same as
•Decide on whether this food sample can be eaten often 1 kcal or 1000 calories. A young adult would
or sparingly and justify. often need to take 1800-2500C per day
depending on their size and level of activity.
3.Recall that human beings, like all animals, are Responses may include saturated,
heterotrophs that need to take in energy and organic unsaturated, and trans fats. Explain to the
learners that these fats will be discussed in
molecules (carbohydrates, fats, and proteins) from plant
more detail during the lesson. Regarding its
and animal matter. importance, expect responses ranging from
energy source, insulation, for flavor, for aid
4.Explain to the learners that this lesson will describe the in cooking, for heart health, skin health, etc.
structure of carbohydrates and lipids and explain the role that these biomolecules play in important
Possible responses include sugar, fibers, etc.
biological processes. Regarding its importance, responses may
include energy source, for aid in regular
bowel movement, for provision of building
blocks for biosynthesis, etc.
Present a diagram similar to the one below.
Table 1: Abundant elements in the human body (Source: http://www.personal.psu.edu/staff/m/b/

mbt102/bisci4online/chemistry/elementsorgnsm.jpg)
Point out that the bulk (i.e., more than 90%) of the human body weight is provided by only three
elements: oxygen, carbon, and hydrogen. We get these elements primarily from the food we eat, from
the water we drink, and from the air we inhale around us.
Explain to the learners that biogeochemical cycles such as the carbon-oxygen cycle and the water cycle
play important roles in ensuring that we have access to these important elements. All forms of life, not
only that of humans, are made up of four kinds of important large molecules: carbohydrates, lipids,  
60
proteins, and nucleic acids. All of these have carbon atoms as their backbones since carbon is capable of forming up to four chemical bonds
with atoms of other elements.
Facilitate the lecture on carbohydrates and lipids.
What do humans get from food?

Heterotrophs, such as human beings, obtain energy and raw materials from food. These are important for cell growth, cell division, metabolism,
repair, and maintenance of the body. Nutrients can be classified as either organic nutrients (i.e., those that contain carbon such as
carbohydrates, fats, proteins, vitamins, and nucleic acids) or inorganic nutrients (i.e., those that do not contain carbon such as water and mineral
salts).
What are carbohydrates?

Carbohydrates are organic compounds made up of carbon, hydrogen, and oxygen. These compounds have a general formula of
CnH2mOm. This means that the hydrogen and oxygen atoms are present in a ratio of 2:1. For example, glucose has a formula of
C6H12O6 and sucrose has a formula of C12H22O11.
Carbohydrates are usually good sources of raw materials for other organic molecules and energy. One gram of carbohydrates provides
four food calories or 16 kJ of energy. In the human diet, carbohydrates mainly come from plants although they are found in all
organisms.
How are carbohydrates formed?

Carbohydrates are examples of macromolecules. These are chainlike molecules called polymers (mere means part) made from repeating units
like monomers. Polymers can be formed from covalently-bonded monomers much like a single structure can be made out of repeated building
blocks linked to each other.
These monomers, called monosaccharides, form covalent bonds when one monomer loses a hydroxyl group and the other loses a hydrogen
atom in dehydration or condensation reactions, forming disaccharides. This reaction requires energy to occur. The bond formed is called a
glycosidic linkage.
Teacher tip
Use ball and stick models or plastic blocks

to demonstrate how dehydration and
hydrolysis reactions occur. Simple reusable
Figure 2: Dehydration synthesis of disaccharides from monosaccharide components (Source: https:// ones may be constructed from toothpicks or
bealbio.wikispaces.com/file/view/disaccharides.JPG/364413582/disaccharides.JPG) clay or similar materials.
Longer polysaccharide chains are formed by monomer addition through succeeding dehydration If a projector is available, you may also use
animations like the ones found at <http://
reactions. These reactions can occur in the human liver as carbohydrates are stored as polysaccharides www.cengage.com/biology/
called glycogen or in ground tissues of plants where these are stored as starch. discipline_content/animations/
reaction_types.swfto> to help in
visualization.
Polysaccharides are broken down into simpler components through the use of water to break covalent
bonds and release energy. The process, known as hydrolysis (hydro means water and lysis means split), Correct response: 999 water molecules
is the opposite of dehydration reactions and often occurs in the digestive tract during chemical and
During the discussion, invite the learners to
mechanical digestion. Here, enzymes break bonds within polysaccharides. With the aid of water, one – find different kinds of carbohydrates in their
H group attaches to a monosaccharide while another –OH group attaches to the other. food labels.
Comprehension question: How many molecules of water are needed to completely hydrolyze a
polysaccharide that is one thousand monosaccharides long?  
62
How are carbohydrates classified?
Carbohydrates can be classified into three main categories, according to increasing complexity:
• monosaccharides (monos means single and sacchar means sugar)
• disaccharides (di means two)
• polysaccharides (poly means many)
Some notes on their structures and functions are found in the following table:
Classification Functions Structure Examples
Monosaccharide • major cellular • contains a carbonyl group • Ribose—a 5C aldose that

nutrient (C=O) and may be forms part of the
• often classified as an aldose or backbone of nucleic
incorporated ketose depending on the acids
into more position • Glucose—a 6C aldose
complex • may have three to seven that is the product of
carbohydrates carbons in the skeleton photosynthesis and the
• may be arranged in a substrate for respiration
linear form when solid that provides energy for
and is converted into a cellular activities
ring form in aqueous • Fructose—a 6C ketose
solution (α form when H is that is found in many
on top of plane of ring plants and is often
and β form when -OH is bonded to glucose
on top of plane of ring)
Classification Functions Structure Examples Teacher tip
Disaccharide • energy • forms when a • Maltose (glucose + glucose)—malt sugar often
Examples of alpha helices and beta
source glycosidic linkage found in sprouting grains, malt-based energy sheets may be created using wire for
• sweetener forms between drinks, or beer the backbone and yarn for the H-
and dietary two • Lactose (glucose + galactose)—milk sugar that bonds; invite learners to speculate on
is a source of energy for infants; an enzyme why alpha helix structures are
component monosaccharides
called lactase is required to digest this. Many associated with storage
polysaccharides and beta sheets with
adult Filipinos have low levels of this enzyme
structural polysaccharides.
leading to a condition called lactose
intolerance.
• Sucrose (glucose + fructose)—found in table
sugar processed from sugar cane, sweet fruits,
and storage roots like carrots
Polysaccharide • storage • forms when • Storage polysaccharides are large molecules

material for hundreds to thousands retained in the cell and are insoluble in water
important of monosaccharides are (formed from α 1,4 linkage monomers; with a helical
monosaccharides joined by glycosidic structure)  
Teacher tip
o Starch—amylase is unbranched starch forming a
• structural linkages Invite learners to compare the rigidity
helical structure while amylopectin is branched or structural integrity of plant matter
material for the
starch, these are present in plant parts like potato or paper, a shrimp’s shell, and a
cell or the entire
tubers, corn, and rice and serve as major sources of mushroom. Explain that all these
organism energy.  structures are formed from β sheets.
o Glycogen—found in animals and fungi; often
found in liver cells and muscle cells
• Structural polysaccharides (formed from β 1,4
linkage of monomers; strands associate to form a
sheet-like structure) 
o Cellulose—tough sheet-like structures that
make up plant and algal cell walls that may be
processed to form paper and paper-based products;
humans lack the enzymes to digest β 1,4 linkages so
is passed out of the digestive tract and aids in
regular bowel movement 
o Chitin—used for structural support in the walls
of fungi and in external skeletons of arthropods 
o Peptidoglycan—used for structural support in
bacterial cell walls
What are lipids? Teacher tip
Lipids are a class of large biomolecules that are not formed through polymerization. They have diverse Fats or triacylglycerol formation may be
explained better using a diagram such as
structures but are all non-polar and mix poorly, if at all, with water. They may have some oxygen atoms
the one below or through models patterned
in their structure but the bulk is composed of abundant nonpolar C-H bonds. They function for energy after a similar diagram. You may ask the
storage, providing nine food calories or 37 kJ of energy per gram. They also function for the cushioning learners to explain, in their own words, what
of vital organs and for insulation. Furthermore, they play important roles in plasma membrane structure they think is happening and compare the
formation of carbohydrates with that of
and serve as precursors for important reproductive hormones.
lipids.
How are lipids classified?

Lipids can be divided into three main classes according to differences in structure and function. Some
Teacher tip
notes on their structures and functions are found in the following table:
Demonstrate the effects of the straight
chains of saturated FAs on packing by piling
together flat structures like books or
Classification Functions Structure Examples blackboard erasers and ask learners to
compare this with the stacking or packing of
Fats • energy • formed from dehydration • Saturated fat—animal products such as irregularly shaped objects like partially-
reactions between glycerol (an butter and lard have a lot of saturated fatty acids. folded sheets of cardboard.
(triacylglycerols storage alcohol with three Cs, each with The linear structure allows for the close packing of
or triglycerides) • an –OH group) forming three the fat molecules for ming solids at room
During discussion, invite the learners to find
cushioning of ester linkages with three fatty temperature, diets high in these fats may increase
different kinds of fats in their food labels
acids (16-18 Cs, with the last C as the risk of developing atherosclerosis, a condition in
vital organs and decide on whether a particular food is
part of a –COOH group) and which fatty deposits develop within the walls of
(adipose producing three molecules of blood vessels, increasing the incidence of healthier than another based on its fat
tissue) water cardiovascular disease content.
• • component fatty acids (FA) may • Unsaturated fat—plant and fish oils have
insulation be either saturated or unsaturated fatty acids. The bent structure prevents
unsaturated   close packing and results in oils or fats that are liquid
o Saturated FA (e.g., palmitic at room temperature. Homemade peanut butter has Misconception
acid) have the maximum number oils that separate out of solution for this reason. Clarify the misconception that consuming
of hydrogen atoms bonded to Industries have developed a process called fats is entirely dangerous for health. Fats are
each carbon (saturated with hydrogenation that converts unsaturated fats into an essential part of a healthy diet when
hydrogen); there are no double saturated fats to improve texture spreadability. consumed in moderation.
bonds between carbon atoms  • Trans fat—may be produced artificially
o Unsaturated FA (e.g., oleic through the process of hydrogenation described
acid) have at least one double above. The cis double bonds are converted to trans
bond, H atoms are arranged double bonds (H atoms on opposite sides) resulting
around the double bond in a cis in fats that behave like saturated fats. Studies show
configuration (same side) that trans fat are even more dangerous to health
resulting in a bend in the than saturated fats to the extent that they have been
structure banned from restaurants in some countries.
Classification Functions Structure Examples Teacher tip
Phospholipids major component • formed from dehydration Phospholipids self-assemble Phospholipid structure may be explained
of cell membranes reactions between glycerol into bilayers when better using a diagram such as the one
below or through models patterned after a
(an alcohol with three Cs, surrounded by water and similar diagram. You may ask the learners to
each with a –OH group), form the characteristic describe the diagram in their own words
forming two ester linkages structure of plasma and compare the structure of fats with that
with two fatty acids (16-18 membranes of phospholipids.
Cs, with the last C as part of

a –COOH group) and a last
linkage with a phosphate
group Teacher tip
• phosphate group is Steroid structure may be explained better
hydrophilic and is called using a diagram such as the one below or
through models patterned after a similar
the ‘head’ of the molecule diagram. You may ask the learners to
• fatty acids are hydrophobic describe the diagram in their own words
and form the ‘tails’ of the and compare the structure of cholesterol
with that of other lipids.
molecule
Steroids and • regulate • characterized by a C- • Cholesterol found in
sterols fluidity of cell skeleton with four fused rings cell membranes regulates
membranes • functional group the rigidity of the cell
• base of sex attached to the rings vary (if – membrane and are the base
hormones OH is attached to the 4th C, then material for the production
• it is called a cholesterol) of sex hormones like
emulsification of estradiol and progesterone
fats during
digestion
66
ENRICHMENT (20 MINS) Teacher tip
Divide the class into groups. Instruct the learners to prepare the following materials that are needed for This activity may be done as a class if time
does not permit for the activity to be done
the laboratory activity: 
in separate groups. If Benedict’s solution is
• eight glass droppers, medicine droppers, or caps • ethanol solution not available, you may only perform the last
• 12 test tubes • glucose solution two tests.
• test tube holders or tongs • flour or cornstarch
In the absence of laboratory grade
• beaker • cooking oil
chemicals, you may improvise with store-
• alcohol lamp • sample of student- bought chemicals like iodine and 70% ethyl
• Benedict’s solution brought food or drink alcohol for medical use. Make sure to test
• iodine solution • mortar and pestle  the procedure before performing the
activity in the class.
Explain the following processes to the learners.

Benedict’s solution, a blue solution with CuSO4(aq), can detect the presence of reducing sugars (i.e.,
any sugar with a free aldehyde or ketone group such as all monosaccharides and the disaccharides
lactose and maltose). When boiled, these sugars reduce Cu2+ in Benedict’s solution to produce a brick-
red precipitate of Cu2O(s).
Iodine test can be used to detect the presence of starch.

Emulsion test can be used to identify fats.
Learners should perform all three tests on the following samples:  

• glucose solution (available in the baking section of grocery • cooking oil
stores) •food or drink sample
• flour or cornstarch solution that the learners
brought.  
For solid samples, instruct the learners to mash a small portion of the sample in some water using the
mortar and pestle and then test the resulting solution. Ask the learners to prepare a table with
appropriate headings in which to record their results.
In discussing the results, ask the learners to conclude whether carbohydrates or lipids are present in
their samples. They may compare this with the list of ingredients for their food or drink sample. They
can also list possible sources of errors.

Divide the class into small groups. Provide the groups with different structures of lipids or
carbohydrates and ask them to create models using common or recyclable materials. Teacher tip
Prior to this lesson, instruct the learners to
Ask the learners to explain or write a short description of their models. In grading the models, check to
bring recyclable materials that they can use
see if the learners were able to create an accurate model of the assigned lipid or carbohydrate. for this activity.
Ask the learners, still in their small groups, to create a short flowchart that will allow them to distinguish
between the different kinds of carbohydrates and lipids based on their structures. They may use this
flowchart in answering the comprehension questions that follow.
Provide different molecular structures of the following and ask the learners to identify whether these
are:  
68
• monosaccharides 
• disaccharides • unsaturated fats Teacher tip
The various carbohydrate structures were
• storage polysaccharides • phospholipids obtained from the following electronic
• structural polysaccharides • steroids.   resources:
• saturated fats • commons.wikimedia.org

You may also ask the learners to give one of the associated functions or characteristics of the given • http://www.nature.com/pj/journal/v43/
carbohydrate or lipid. n12/images/pj201196f3.jpg
• http://chemwiki.ucdavis.edu/@api/deki/
files/522/260px-Cellulose_strand.jpg?
size=bestfit&width=352&height=310&r
evision=1
Images for the various lipid structures were

obtained from the following electronic
resources:
• https://upload.wikimedia.org,
• http://www.mikeblaber.org/oldwine/
BCH4053/Lecture13/triglyceride.jpg,
https://my.bpcc.edu/content/blgy225/
Biomolecules/phospholipid.gif
Amino Acids and Proteins LESSON OUTLINE

Pt. 1 of 2 Introduction Review on the Genetic Code; Translation 20
Content Standard of codons to corresponding amino acids
The learners demonstrate an understanding of the structure and function of
Motivation Class activity on the Protein or Amino 10
biomolecules (i.e., proteins).
Acid Alphabet
The learners shall be able to construct a three-dimensional model of proteins Instruction/ Lecture-discussion on the different levels 60
Delivery of protein structure (i.e., primary,
using computers (i.e., computer generated models) or recyclable materials (i.e.,
physical models). secondary, tertiary, and quaternary
Learning Competencies Practice Class activity on paper models of the 15

The learners: different protein helix types
• categorize the biological molecule (i.e., protein) according to their structure Enrichment Constructing of physical or computer- 15
and function (STEM_BIO11/12-Ii-j-15) generated protein models; Identification
• explain the role of each biological molecule in specific metabolic processes of surface features of proteins (e.g.,
(STEM_BIO11/12-Ii-j-16) hydrophobic patches, positively or
• determine how factors such as pH, temperature, and substrate affect negatively charged domains, etc.)
enzyme or protein activity (STEM_BIO11/12-Ii-j-19)
Evaluation Examination and Model Accuracy 60
Evaluation
Materials
recyclable materials for construction of protein models,
• discuss the different levels of protein structure (i.e., primary, secondary, software for molecular modelling (available for free
tertiary, and quaternary) download)
• discuss how protein structural features may influence their interactions
• discuss how protein structural features may influence their functions
Resources
(1) SwissPDB Viewer software (available for free download)
(2) Protein Data Bank (can be accessed at www.db.org
70
Communicate learning objectives and important terms Prepare a genetic code table. Teach the
1. Review the Genetic Code. In particular, have the learners translate codons to their corresponding learners how to use the genetic code table
amino acids. to translate an mRNA sequence.
2. Stress the importance of how mutations may alter the type of amino acid coded by a given
Clarify the misconception on mutations in
sequence. the mRNA sequence. Stress how not all
3. Discuss how some mutations may be ‘silent’. mutations in the mRNA sequence may lead
4. Discuss how some mutations may be considered ‘conservative’ (e.g., AA changed to another with a to changes in amino acid sequence.
similar functional group type) or ‘non-conservative’ (e.g., AA changed to another with a different
functional group type).
5. Discuss the importance of the translation reading frame. Stress how frameshift mutations may lead
to changes in the amino acid sequence translation as well as changes in the termination of the
protein.
MOTIVATION (10 MINS) Teacher tip

1. Instruct the learners to spell out their names using the amino acid single letter codes (e.g., NEIL). Prepare an Amino Acid Alphabet table.
2. Next, instruct them to spell out their names using the amino acid triple letter codes (e.g., Asn-Glu- In the table, provide respective columns for
Ile-Leu). one-letter and three-letter codes for each
3. Then have the learners find codons that can correspond to these amino acid sequences. amino acid.
Present the Genetic Code table with the

INSTRUCTION/DELIVERY (60 MINS) Amino Acid Alphabet table so that the
1. Discuss the basic amino acid structure. Discuss how these amino acids may be linked by peptide learners can use them in the translations.
bonds to form polypeptides sequences.

2. Group the amino acids in terms of their functional group properties. The amino acids may be polar
(i.e., acidic or basic) or non-polar.
3. Highlight amino acids with special properties (e.g., Cysteine for disulfide bond formation; Tyr, Trp,
and Phe for their aromatic rings and fluorescent character; Proline for its effect on the protein
backbone).
4. Discuss how the amino acid sequence is the primary structure of the protein.
5. Discuss how properties in the primary structure (e.g., placement of hydrophobic residues, charged
groups, and disulfide bridges) define the higher level structures of the protein. Show how
interactions between complementary sections of polypeptide chains may lead to the formation of
helices or sheets. 
6. Discuss the common secondary structures of proteins (i.e., helical and sheet-like structures). Teacher tip
7. Discuss the different helical types (3-10 helices, alpha helices, and pi helices). Show how these Note that signal transduction pathways
different types are based on which residues are bound by hydrogen bonds or how many atoms are commonly involve quaternary protein
structures.
included in the helices hydrogen bonding network.
8. Show how some proteins are composed of combinations of the secondary structures in differing The maintenance of proper interactions in
ratios. these structures is necessary to produce the
9. Discuss how the arrangement of the secondary structures in these proteins may lead to the desired functions.
formation of functional regions (e.g., active sites). Dysfunction in these associations is

10. Discuss how protein functions may involve the interaction of several proteins in what is known as commonly associated with disease. Some
quaternary associations (e.g., protein complexes for signal transduction). current cancer diagnostic kits target
mutations that may disrupt the proper
association of proteins in these complexes.
PRACTICE (15 MINS)
Instruct the learners to construct paper models of helical structures.
Teacher tip
Paper models may be made to represent structures such as the 3-10 helix and the alpha-helix. This A video on the discovery of the alpha helix
would require the drawing of polypeptide chains on paper, and the folding of the paper ensuring that using paper models is available on the
the peptide bonds are kept planar. The linkage of the appropriate amide protons (NH) with the internet. This video features Dr. Linus
Pauling himself describing the general steps
appropriate C=O group will create models of the proper dimensions (i.e., angle and width). This is
in creating an alpha helix paper model.
based on the classic experiment by Linus Pauling on the discovery of the alpha helix.

Prior to this lesson, the learners may generate computerized protein models and bring them to class. Teacher tip
Familiarize yourself with the features of the
Also, software on molecular viewers should be downloaded from the internet. These software, such as
molecular viewer. SwissPDB Viewer allows
the SwissPDB Viewer, can be downloaded for free. Sample protein structures may be downloaded from you to select amino acids of certain types
the Protein Data Bank that can be accessed at www.pdb.org. (e.g., hydrophobic residues).
Determine the surface features of the observed protein (e.g., hydrophobic areas, charged areas). If a
protein with an active site and a bound ligand is chosen (eg., PDBID _____),then the location of the Teacher tip
active site and the nature of the protein-ligand interaction may be explored. These may be colored or labelled to show
their positions in the protein. The position
of hydrophobic patches and charged
EVALUATION (60 MINS) surfaces in proteins can signify areas of
Conduct an examination to assess the learners’ knowledge and understanding of the discussions. potential interaction.
72
Amino Acids and Proteins LESSON OUTLINE
Pt. 2 of 2 Introduction Review on Cell and its organelles; Discussion

and illustrations of the Central Dogma of
5
Molecular Biology
Content Standard
The learners demonstrate an understanding of the structures and functions of Motivation Class activity on the important functions of 5
biological molecules (i.e., carbohydrates, lipids, nucleic acids, and proteins) biological molecules`
Performance Standard Instruction/ Lecture-discussion on the main functions and 30

The learners shall be able to identify key structural features of biological Delivery important physical properties of
biomolecules
molecules that are important for their functions (e.g., 5’ and 3’ OH of DNA, 2’
OH of RNA, complementary base pairing, N and C termini of proteins, R Practice Exercise on translating coding to non-coding 5
groups of the different amino acids, etc.). sequences
Learning Competencies Enrichment Practice exercise on translating coding 5

The learners: sequences into mRNA transcripts and mRNA
transcripts into polypeptide sequences.
• categorize the biological molecules (e.g., DNA, RNA, proteins) according
to their structure and function (STEM_BIO11/12- II-j-15) Evaluation Practice exercises on identification of 10
• explain the role of each biological molecule in specific metabolic processes biomolecules based on given chain
(STEM_BIO11/12 -II-j-16) structures, identification of important
• explain oxidation/reduction reactions (STEM_BIO11/12- II-j-18) structural features in the chain structures,
• determine how factors such as pH, temperature, and substrate affect and generating non-coding sequences
(DNA), transcripts (RNA) and polypeptides to
enzyme or protein activity (STEM_BIO11/12 -II-j-19)
assess learners’ understanding of the topics
Materials
recyclable materials for construction of models of biological
molecules, software for molecular modelling (available for
• discuss key structural features of DNA, RNA, and proteins free download)
• discuss structural and functional differences between DNA and RNA
• discuss the different levels of protein structure (i.e., primary, secondary, Resources
(1) SwissPDB Viewer software (available for free download)
tertiary, and quaternary)
(2) Protein Data Bank (can be accessed at www.db.org
• discuss how protein structural features may influence their functions 
1. Facilitate a review on the cell and its organelles. Emphasize that the specific functions for each
Relate the Central Dogma of Molecular
organelle type are compartmentalized and that the functions of each organelle are defined by its
Biology to real world situations.
physical properties.
2. Explain to the learners that the lesson will focus on understanding the important physical properties For example, in cooking, the cook book
of certain biomolecules (i.e., DNA, RNA and proteins) and how these properties allow the functions like the DNA (Genome). The
specific recipe functions like the mRNA
biomolecules to serve specific functions within the cell.
while the desired dish is the protein.
3. Discuss the Central Dogma of Molecular Biology: DNA RNA Protein
Provide two more examples of everyday life
activities that can illustrate the Central
Dogma of Molecular Biology.
Teacher tip
MOTIVATION (5 MINS) Note the following expected responses:
1. Divide the class into groups and instruct them to identify or enumerate the most important • DNA—repository of genetic
functions of DNA, RNA, and proteins. information
2. Consolidate the learners’ responses on the board. • RNA—transcripts and
regulators of expressed
INSTRUCTION/DELIVERY (30 MINS) genetic information
Elaborate on the main functions of the biomolecules: • protein—functional products
• DNA—is the repository of genetic information and executors of cellular
• RNA—serve as the transcripts and regulators of expressed genetic information functions
• Proteins—are the functional products and executors of cellular functions
Biomolecule Physical Property Functional Relevance
DNA Complementary Base Pairs Allows each strand to serve as a template for replication and
transcription
Phosphodiester bonds Essential for polynucleotide chain elongation
Deoxyribose 5’OH Start of the polynucleotide chain
Deoxyribose 3’OH “End” of the polynucleotide chain

Connection point for extending the chain
74
Biomolecule Physical Property Functional Relevance Teacher tip
Use computer modelling software like
Deoxyribose 2’H Difference between the sugar residues of DNA (deoxyribose) SwissPDB Viewer to illustrate the basic
and RNA (ribose) structures of DNA, RNA, and Proteins
(Polypeptides).
RNA Complementary Base Allows RNA to serve as transcripts (mRNA) and translators
Pairing (tRNA) of genetic information from DNA. The basic structures for these biomolecules
are available as molecular structure files
Uracil Nitrogenous base equivalent to T in RNA. (*.pdb) from the Protein Data Bank that can
be accessed at www.pdb.org.
Ribose 2’OH Difference between the sugar residues of DNA (deoxyribose)
and RNA (ribose) Focus on the important parts of the
Limits the compaction of RNA molecules. structure that provide the necessary physical
Double stranded RNA molecules are similar in structure as properties of DNA, RNA, and Proteins.
the A-form of DNA

Discuss the relevance of these physical
Protein N-Terminus Start of the polypeptide chain features for the functions of DNA, RNA, and
Proteins.
C-Terminus End of the polypeptide chain
Addition point for new amino acids during polypeptide

growth
Peptide Bond Links Amino Acids

Planar character
Phi Angle Angle between:

Ci-1-Ni-Cαi-Ci
Ci-1 : Carbonyl C of
previous AA
Ni : Amide Nitrogen of current AA
Cαi: Alpha Carbon of current AA
Ci : Carbonyl C of
current AA
Angle is observed by looking down the bond between Ni

and Cαi; coming from the N-terminus of the polypeptide
 
Biomolecule Physical Property Functional Relevance
Psi Angle Angle between

Ni+1-Ci-Cαi-Ni
Ni+1 : Amide Nitrogen of succeeding AA

Ci : Carbonyl C of
current AA
Cαi: Alpha Carbon of current AA
Ni : Amide Nitrogen of current AA
Angle is observed by looking down the bond between Ci

and Cαi; coming from the C-terminus of the polypeptide
Amino Acid R-Groups Defines Amino Acid Character
a. non-polar
i. aliphatic
(G,A,V, L, I, M)
ii. aromatic
(Y,W,F)
b. polar, uncharged (S,T,C,P,Q)
Table 1: Important Physical Properties of Biomolecules Teacher Tip:

The correct response is:
Complementary Non-coding/ sequence:

PRACTICE (5 MINS) 3’ TACGTATCTAATCCTATAGGGTCTATC 5’
Given the following coding sequence for DNA, provide the sequence of the complementary (template)
Be sure to note the antiparallel orientation
sequence.
of the coding and non-coding strands of the
DNA. Note the relative positions of the 5’
and 3’ ends.
Coding sequence: 5’ ATGCATAGATTAGGATATCCCAGATAG 3’ 
76
Convert the given coding sequence into an mRNA transcript: The correct responses are the following:
Complementary Non-coding / Template sequence: 3’ TACGTATCTAATCCTATAGGGTCTATC 5’ For no. 1, the coding sequence ~ mRNA
transcript is 5’
AUGCAUAGAUUAGGAUAUCCCAGAUAG
2. Translate the given mRNA transcript into a polypeptide sequence: 3’
Coding sequence ~ mRNA transcript: 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
For no. 2, the polypeptide sequence is
N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C
Note that the mRNA transcript has almost

the same sequence as the coding sequence
(DNA), but the Thymines are converted to
Uracil.
Teach the learners how to read the Codon

Table.
Teach the learners the single letter codes

for the amino acids (e.g., Tryptophan Trp
W).
Instruct the learners to spell their names

using the amino acid codes (e.g., N-E-I-L
EVALUATION (10 MINS) Asn – Glu – Ile – Lue).
Ask the learners to identify the type of biomolecule represented by a given chain structure:
• DNA
• RNA Teacher tip
Worksheets with partially-completed
• Protein sequences may be used to help the learners
practice the generation of complementary
sequences.
You may ask the learners to identify the important structural features in these chain structures. The
features are listed in Table 1 in the Instruction/ Delivery section of this Teaching Guide. For example:
Template sequence
A similar exercise of generating non-coding sequences (DNA), transcripts (RNA), and translated 3’ TAC_ _ _TCT_ _ _ CCTATAGGGTCT 5’
polypeptides may be performed to test the learners’ understanding of the topic. 5’ _ _ _CAUAGAUUA_ _ _UAU_ _ _AGA 3’
Biological Molecules: LESSON OUTLINE
Enzymes Introduction Presentation of objectives and terms;

Brief discussion on thermodynamics or
5
Content Standard protein structure

The learners demonstrate an understanding of enzymes and of the factors Motivation Illustration and explanation of enzymatic 5
affecting enzyme activity. browning in bananas
Performance Standard Instruction/ Small-group and class discussion on 60
The learners shall be able to explain the role and significance of enzymes in Delivery/ definition of enzymes, its structure, and
biological systems. Practice function
Learning Competencies Enrichment Laboratory activity on the work of 60
The learners:
enzymes using raw liver as a source of
• describe the components of an enzyme (STEM_BIO11/12-Ii-j-17) catalase and hydrogen peroxide as the
• determine how factors such as pH, temperature, and substrate affect substrate
enzyme activity (STEM_BIO11/12-Ii-j-19)
Evaluation Group activities on creating models of 20
enzyme-catalyzed reactions and
Specific Learning Outcomes designing of a simple experiment on
At the end of the lesson, the learners shall be able to: enzyme activity
• present a model demonstrating the components of a specific enzyme in a
Materials
biological system and the reaction it catalyzes
projector, computer, recyclable materials for making models
• design a simple experiment that illustrates how pH, temperature, or
of enzyme-catalyzed reactions.
amount of substrate affect enzyme activity (i.e., includes problem
statement, hypothesis, materials and methods) Resources
(1) Reece, J.U. (2011). Csmpbell Biology, 9th ed. San Francisco, CA:
Pearson Benjamin Cummings.
78
INTRODUCTION (5 MINS) Teacher Tip:
Introduce the following learning objectives using any of the suggested protocols (e.g., verbatim, own Prominently display the learning objectives
words, or read-aloud): and important terms prominently on one
side of the classroom and frequently refer to
• I can describe the components of an enzyme. them during discussion. You may place a
• I can determine how factors such as pH, temperature, and substrate affect enzyme activity. check-mark beside a term in the wordlist
after defining it so that the learners have an
Introduce the list of important terms that the learners will encounter: idea of their progress.
• enzyme Another way of incorporating lists of

• catalyst important terms is to have the words placed
• activation energy in a blank bingo card grid. Learners can
write a short definition or description of the
• substrate term under the entry in the bingo card to
• enzyme-substrate complex block out a square. This may serve as the
• active site learners’ reference guide or method of
• induced fit formative assessment.
• cofactor
• coenzyme
• competitive inhibitor
• noncompetitive inhibitor
MOTIVATION (5 MINS) Teacher Tip:

You may opt to divide the class into groups
Connect the lesson to a real-life problem or question.
of twos or threes to facilitate sharing of
While the learners are coming in and settling down in the classroom, show them that you are cutting a observations and insights. You may call on
banana into small pieces on a plate. After the introduction, you can show the learners the plate of two to three groups to share their
observations if there is limited time for
banana pieces. Instruct them to pass it around and share their observations.
presentations.
The following could be expected answers:
• The banana’s covering is brown.
• The banana’s texture is mushy.
• The banana looks spoiled.
• The banana is smelly
• The banana is soft.
Ask the learners if they can explain why the bananas have turned brown and mushy. Challenge the
learners to think of ways to slow down the process of browning. Expected answers could be not to cut
the banana, keep the banana cold, or keep the banana in an airtight container.
Provide the learners with the following explanation:

• Peeling, bruising, or cutting fruits cause them to release enzymes like polyphenol oxidase (PPO,
phenolase) that, with the presence of oxygen in the surrounding air, goes into chemical reactions of
plant compounds. These chemical reactions produce brown pigments through the process of
enzymatic browning.
• Enzymes—are organic substances that accelerate the rate of chemical reaction. Enzymatic
browning can be a significant problem because it limits the shelf life of fruits and vegetables.
However, enzymatic browning is not always unwanted. The browning reaction contributes to the
desirable color and flavor of raisins, prunes, coffee, tea, and cocoa. Although enzymatic browning
causes changes in flavor and taste (i.e., bitter, astringent) and may reduce quality, the browning
Teacher Tip:
agents formed are not toxic. Brown fruits are safe to eat up to a few hours after cutting.
If pressed for time, No. 1 can be done as
• Knowing the mechanism behind this, Arctic Apples, a Canadian company, produced genetically- part of the Motivation with soda crackers or
engineered apples that will not brown for 15-18 days. plain biscuits (that is mostly composed of
starch) as an example. Moisten the cracker
with water and place it in a visible area.
INSTRUCTION/DELIVERY/PRACTICE (60 MINS) Compare the time it takes for a similarly-
Recall previous lessons on the laws of thermodynamics, spontaneity of reactions, and carbohydrate sized piece of cracker to break down inside
structure through a scenario. a learner’s mouth. Remind the learner not to
chew the cracker.
• Scenario: Is the hydrolysis of starch to maltose a spontaneous reaction? What information do you
need to answer this question?
• Expected response: Question may be answered with the given information since we are familiar If available, amylase and Benedict’s solution
may be used to test for the presence of
with hydrolysis and the structures of starch and maltose. The reactants have higher levels of free
simple sugars.
energy compared to the products, making this a spontaneous reaction.
• Follow-up questions: If this is so, why will a sterile starch solution sit for years at room temperature Numerous chemical reactions support life.
without significantly hydrolyzing? Can you think of ways to hydrolyze starch more quickly? The regulation of these reactions may take
place in two major ways:
• through the use of enzymes
• through the regulation of genetic
material (This which will be discussed
later.)
80
Proceed to the lecture proper.
• Can you imagine what would happen if it takes many years for our body to hydrolyze the starch in Teacher Tip:
A visual aid may be used to show the
the food that we eat? Starchy food comprises an important part of our diet and our bodies use
contortion. For example, a string of paper
enzymes called amylase to quickly hydrolyze starch into simple sugars. clips or a bunch of keys on a key ring can
stand for starch. The contortions involved in
• What are enzymes? detaching one paper clip or removing one
key can serve as analogies for the process.
• Enzymes are organic or biological catalysts. Catalysts are substances that speed up a reaction
without being used up, destroyed, or incorporated into the end product. They are vital to the
regulation of the metabolic processes of the cell. Many enzymes are proteins. We will focus on this
type of enzymes in this discussion. RNA enzymes called ribozymes will be discussed later.
• What keeps spontaneous reactions from occurring more rapidly?

• All chemical reactions between molecules involve the breaking and forming of bonds.
Converting starch into glucose involves contorting starch into a highly unstable state before Teacher Tip:
To illustrate the concept of activation
the reaction can proceed. This unstable state is called the transition state that happens when energy, pushing a toy car or marble up a
reactants absorb energy from their surroundings and. This initial investment of energy in makeshift ramp will also help concretize the
order to start a reaction is called the activation energy. It is often supplied as thermal energy concepts of activation energy and transition
state.
or heat absorbed by reactants from their surroundings. Reactant molecules absorb heat
which causes them to collide more frequently and more forcefully. This agitates the atoms
within the molecules that results in the likely breaking of bonds.
• When the new bonds of the products form, energy is released as heat and the molecules
return to stable shapes with lower energy. This results in an overall decrease of free energy.
Figure 1 (on the right): Energy profile for a spontaneous exergonic reaction: AB+CDAC+BD (Source: Reece, J. U (2011 ).
Campbell Biology, 9th ed. . San Francisco, CA: Pearson Benjamin Cummings) 
• The reaction shown in Figure 1 is spontaneous but the activation energy provides a barrier that
determines the rate of the reaction. Reactants have to absorb enough energy from their
environment to surmount this barrier before the reaction can proceed. Teacher tip
• Knowing this, how can you cause reactants to absorb more energy from their environment? Relate the discussion with the hypothetical
reactions in Figures 1 and 2.
How do enzymes affect reactions?

Heat speeds up reactions. This is inappropriate for biological systems because it denatures proteins,
kills cells, and speeds up all reactions, not just those that are needed. Enzymes catalyze specific
reactions by lowering the activation energy barrier and allowing the reactant molecules to absorb
enough energy at moderate temperatures. Enzymes cannot change the !G for a reaction and can only
hasten reactions that would eventually occur anyway.
View Part I of the animation at http://www.sumanasinc.com/webcontent/animations/content/enzymes/

enzymes.html. Click on ‘Show Narrative’ to reinforce the aforementioned concepts on spontaneous
reactions. Ask the learners to answer the following questions and call on a small group to explain their
responses using their own words:
• What is the activation energy of a reaction?
• How do enzymes affect the activation energy of a reaction?
Enzyme structure and function

View http://highered.mcgraw-hill.com/sites/0072495855/student_view0/chapter2/
animation__how_enzymes_work.html. Click on ‘Text’. Ask the learners to answer the following question
and call on a small group to explain their responses using their own words:
On a molecular level, how does the shape of an enzyme enable it to perform its function? Use
the following terms in your responses: ‘active site’, ‘substrate’, ‘enzyme-substrate complex’, and
‘product’.
The active site and functional groups of its amino acids may lower activation energy by:
• acting as a template for substrate orientation
• stressing the substrates and stabilizing the transition state
• providing a favorable microenvironment
• participating directly in the catalytic reaction
82
View http://www.wiley.com/college/boyer/0470003790/animations/enzyme_binding/
enzyme_binding.htm. Click on ‘Binding Models’. Ask the learners to answer the following questions Teacher tip
The video links provided here may be given
and call on a small group to explain their responses using their own words:
as a pre-lecture assignment to stimulate
• How does the shape of an enzyme enable it to perform its function? prior knowledge and give the learners an
• What is the difference between Emil Fisher’s lock-and-key model and Daniel Koshland’s induced-fit idea of the topics to be discussed.
model? Describe the current model.
If a computer is not available, you may ask
the learners to answer the questions based
Factors that affect enzyme action
on your discussion. Provide constructive
Given what the learners know about enzyme action, ask them to predict how the following factors will feedback and correct misconceptions. You
affect the action of an enzyme by completing the table below. This may be done by group or by the may use models or analogies to better
class as a whole. If the entire class is involved, invite a small group to fill in each row. illustrate the concepts. Here are some
suggestions:
Table 1: Factors that affect enzyme action. • a handshake to demonstrate induced fit
• two pieces of a jigsaw puzzle to
illustrate components of a substrate
• roleplay to show the interactions
between enzymes and substrates
Clarify the misconception that enzymes only

function in catabolic reactions or breaking
down of substances. This misconception
may be due to the learners’ first encounter
of enzymes in the context of digestion.
Enzymes also catalyze other types of
reactions. For example, DNA polymerase
facilitates the addition of nucleotides to a
polynucleotide chain.
View http://moleculesoflife2010.wikispaces.com/file/view/Enzyme+Model.swf and test the hypotheses

using controlled simulations. You may need to use a timer to assess reaction rates. Do your results
agree with your predictions? How were they similar? How were they different?
Provide constructive feedback and clarify the reasons for the observed changes to reaction rates and
enzyme function. 
View http://web.biosci.utexas.edu/psaxena/MicrobiologyAnimations/Animations/Enzyme-Substrate/micro_enzyme-substrate.swf. Ask the
learners to answer the following question and call on a small group to explain their response in their own words:
What is the difference between a competitive and noncompetitive inhibitor?
The presence of non-protein helpers called co-factors and of organic molecules like co-enzymes may activate apoenzymes to produce
holoenzymes by binding to their active sites. Common examples may be found in popular supplements such as ions of iron, copper, zinc, or in
vitamins like vitamins A, C, and B-complex.
Enzyme regulation and metabolic control

View http://usmanscience.com/12bio/enzyme/enzyme_animations.htm. Click on ‘Allosteric Enzymes’ and ‘Feedback Inhibition’. Ask the learners
to answer the following questions and call on a small group to explain their responses in their own words:
What are allosteric enzymes?
Feedback inhibition regulates metabolic pathways that use more than one enzyme. How does feedback inhibition work?

Facilitate a laboratory activity on investigating the work of enzymes using raw liver as a source of This activity may be done as a class if there
catalase and hydrogen peroxide as the substrate. Learners may be provided with the following: is not enough time to perform the
laboratory work individually or in groups.
• temperature as a factor: ice water bath, water bath at room temperature, warm water bath You may perform the test on all three
• pH as a factor: acid solution, alkaline solution, and litmus paper factors or you may choose only one or two.
• amount of substrate: droppers
• small test tubes or medicine caps
Explain that many living tissues contain catalase or peroxidase that catalyzes the reaction conversion of
H2O2 → H2O + O2.
Cut the liver into equal-sized cubes and demonstrate the effect of placing the liver in a 2mL solution of
hydrogen peroxide. Evolution of gas (i.e., bubbling) will be observed. Groups of learners may prepare
solutions that they can test using the different factors.
Instruct the learners to rank the different solutions based on the rates of reactions.
84
Making models of enzyme-catalyzed reactions Teacher tip
Before this session, inform the learners that
they will be making models of enzyme-
1. Divide the class into small groups. catalyzed reactions next meeting and ask
them bring recyclable materials that they
2. Distribute different examples of important enzyme-catalyzed reactions to the groups. can use for this activity.
3. Ask the groups to create models using common or recyclable materials and label the following
In grading the models, check to see if the
components: enzyme, substrate, product, and active site. learners were able to label the parts
4. Ask the learners to demonstrate how this enzyme works. correctly. Demonstrate that the substrate
goes into the active site, gets contorted and
moves out as a product. Check if the
Written Task substrate and the products are consistent
with the reaction being modeled (e.g.,
1. Divide the class into small groups. anabolic, catabolic, or recombination)
2. List the materials for Enrichment (See previous section).
3. Ask the learners to design their own experiment in order to explore the effect of one factor on
enzyme activity. Explain that the experimental design should include:
• a testable hypothesis
• complete list of dependent and independent variables
• complete list of controlled variables
• logical procedure in a flowchart format
• short and accurate explanation of what you expect to happen and why
• sufficient replicates
Photosynthesis and LESSON OUTLINE
Cellular Respiration Introduction Communicate to the class the oxidation-

reduction and the flow of energy
5
Content Standard Motivation Post questions on the board and ask the 5
The learners demonstrate an understanding of photosynthesis and cellular students to identify the processes involved in
respiration energy transformation
Learning Competency Instruction/ Show the overall equations of photosynthesis 145

The learners: Delivery and cellular respiration
• Describe the major features and chemical events in photosynthesis and Enrichment Similarity of photosynthesis and cellular 25
cellular respiration (STEM_Bio11/12-IIa-j-1) respiration and connecting the concepts with
the biological systems
Specific Learning Outcomes Evaluation Summary of the major events of 60

At the end of the lesson, the learners shall be able to: photosynthesis and cellular respiration
• functionally define photosynthesis and cellular respiration; Resources

(1) Alumaga, Maria Jessica B. et al., (2014). Science and Technology 9. Quezon
• identify the reactants and products of photosynthesis and cellular
City: Vibal Publishing House
respiration; (2) Mader, Sylvia S. (2010). Biology 10th Edition. USA: McGraw-Hill
• differentiate the major chemical events of photosynthesis and cellular (3) Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson Brooks/
respiration; and Cole
• summarize in a form of illustration or diagram the similarity in the (4) www.biologycorner.com accessed July 19, 2015
organization of chloroplast and mitochondrion in carrying out Suggested Media Tools

photosynthesis and cellular respiration, respectively. • www.mhhe.com/maderbiology11
• www.masteringbiology.com
• www.biologycorner.com
For animations, video, learning outcomes, chapter outline, image PowerPoint,

essay quiz, thinking critically, practice test and concept maps:
• http://highered.mheducation.com/sites/0073403466/student_view0/
chapter7/image_powerpoint.html
• http://highered.mheducation.com/sites/0073525502/student_view0/
chapter7/index.html
86
Review with the class that oxidation-reduction (redox) reactions involve electrons passing from one Note: This lesson merely describes the
major features of (or an overview)
molecule to another. Oxidation (also splitting) is the loss of electrons while reduction is the gain of
photosynthesis and cellular respiration. A
electrons. You can show this picture to your students and try to ask questions so that you can generate more detailed concept and deeper
critical-thinking skills from them. To help them visualize the concept, a diagram of redox reactions is explanation will be presented in another set
also shown below. Ask your students which organisms (in the picture below) photosynthesize and which of learning competencies.
respire (take note that plants both photosynthesize ad respire at the same time). Then show the
Emphasize that the flow of energy starts
equation of redox reactions after your students have given their responses. You may also ask examples with the sun. There are two organelles that
of oxidation reactions (e.g., browning of peeled potato, banana, and eggplant). For redox reactions participate in the energy flow from the sun
examples are rusting of iron, burning of combustible material (e.g., wood, coal, etc.) through living things. You can now motivate
your students by posting two questions
relating to energy transformation. Redox
NOTE: Energy transformation (e.g., photosynthesis and cellular respiration is one of the difficult topics reactions is one type of chemical reaction.
in biology. To capture the general picture of the topic, students have to be encouraged to read and re-
Emphasize to students the importance of
read the key concept, write and re-write, outline and re-outline, draw and re-draw, and to recite orally if understanding the processes rather than
they want the ideas to sink in their system. Patience and steadfastness are important virtues that should memorizing all the various reactions.
be included as you study this concept. 
Remember that plants both
photosynthesize and do on aerobic
respiration.
The following are some of the practical

examples of photosynthesis:
1. Photosynthesis helps create food chains

or food web (Note: Most modern scientists
prefer the latter because it portrays the
accurate interactions of several organisms in
the environment. The interactions make
possible the production and perpetuations
of the living creatures. Most life forms
directly or indirectly depend on plants for
their basic metabolism. Ultimately, materials
from producers, herbivores, omnivores and
carnivores will be consumed by
decomposers (e.g., bacteria). These bacteria
produce waste products that increase the
nutrient content of the soil.
Thus, plants are able to produce
macromolecules (e.g., carbohydrates,
proteins, fats and nucleic acids) and sustain
other cellular activities because of the
participation of the soil, nutrients, water,
carbon dioxide, chlorophyll and sunlight as
preparatory materials for the synthesis of
carbohydrates and oxygen.
Photosynthesis and bioenergy. The plant

Countless chemical reactions are occurring in cells to do essential life functions with the help of ATP as materials and animal wastes are used
especially as a source of fuel.
the energy currency of the cells. Ask your students what are the tasks of ATP. The following are the
answers:
1. Chemical work: ATP is used for building macromolecules
2. Transport work: ATP is used for transporting ions membranes
3. Mechanical work: ATP is used for mechanical processes such as muscle contraction, cilia movement
For additional information, tell the class that ATP is also involved in rigor mortis—a temporary stiffness
of the body that happens soon after death of a person.
Teacher tip
MOTIVATION (5 MINS) Suggested answers:
1. Through photosynthesis
2. Through cellular respiration
Post these two questions on the board. Ask them to identify the process involved in each question so
that food is manufactured and energy is released. A.
1. Components that are utilized: Carbon
dioxide, water, sunlight (and chlorophyll can
• How do plants harness light energy to manufacture food? be mentioned)
• How do living organisms harness energy from food? 2. Groups that come out: Carbohydrate
(glucose) and oxygen
Then show to them the overall equation for each process as follows: B.
• Chemical reactions for photosynthesis: 1. Groups that go in: Carbohydrate, oxygen
and 38 ADP molecules
6 CO2 + 6 H20 + sunlight C6H12O6 + 6 O2 2. Groups that are released: Carbon
• Which groups participate in the reaction?  dioxide, water and 38 ATP molecules
88
• Which groups are released?
• Chemical reactions for cellular respiration:
C6H12O6 + 6 O2 + about 38 molecules of ADP 6 CO2 + 6 H20 + about 38 molecules of ATP
• Which groups participate in the reaction?
• Which groups are released?

1. You can draw pictures of photosynthesis and cellular respiration in Manila paper if LCD is not
available. You can also go to computer/printing shop and make these pictures into tarpaulin for
long use.
• Sample picture of Overview of Photosynthesis, Overview of the Stages of the Calvin
Cycle in Photosynthesis, Overview of Glucose Breakdown, and Overview of ATP Yield
per Glucose Molecule may be viewed at Biology 10th Edition by Mader, Sylvia S. (2010)
(Retrieved July 20, 2015)
2. Group your students into triad according to their learning skills. Give each member accountability
task to promote mutual cooperation.
3. Give them questions to answer for discussions. Tell them to prepare and bring out their Manila
paper and markers.
4. Have them report orally to the class.
5. Alternatively, if the class will not be able to report reliably, roleplaying, laboratory activities, or
simulations involving computer-aided activities such as the ones found in the following sites:
• http://www.reading.ac.uk/virtualexperiments/ves/preloader-photosynthesis-full.html
• http://www.pbs.org/wgbh/nova/nature/photosynthesis.html
Processing Questions:
1. What are the two kinds of reactions in photosynthesis?
2. What are the basic stages of the Calvin cycle?
3. What are the reactants and products of photosynthesis?
4. In which part of the cell glycolysis happens? What about the citric acid cycle and electron transport
chain?
5. How many metabolic pathways are there in cellular aerobic respiration? In anaerobic respiration?
6. What are the reactants and products of cellular respiration? 
7. About how many ATP molecules does a cell obtain from the breakdown of one molecule of glucose
in cellular respiration?
8. Given the glucose, carbon dioxide and water, which one(s) is/are called high-energy molecule and
which one(s) is/are called low-energy molecule?
Suggested Answers:
1. Light-dependent reaction and light-independent reaction (also known as Calvin cycle reaction or
carbon fixation reaction).
2. The basic stages of Calvin cycle reaction are: carbon dioxide fixation, carbon dioxide reduction,
RuBP regeneration.
3. Reactants: carbon dioxide and water; products: carbohydrates and oxygen
4. Glycolysis happens in the cytoplasm of the cell; citric acid cycle (Krebs cycle) and ETC are in the
mitochondrion of the eukaryotic cell.
5. In cellular aerobic respiration: three; in anaerobic respiration: one
6. Reactants: carbohydrates, oxygen, and about 38 ADP molecules; products: carbon dioxide, water
and about 38 ATP molecules
7. About 36 to 38 ATP molecules (NOTE: This number is just a ratio. Some biology authors say there
are 30, 32 or 34 ATP molecules produced depending on the shuttle used to transport the electrons
and on the kind of species.)
8. High-energy molecules: glucose; low-energy molecules: carbon dioxide and water
Directions:
Fill-in the two tables below for the major events and features of photosynthesis and cellular respiration,
respectively. The option tables are given for you to answer the needed materials and end products of
photosynthesis and cellular respiration.
90
Major Events and Features of Photosynthesis
Reaction Series Needed Materials End Products
1. Light-dependent reactions (take a. a.

place in the thylakoid membrane)
b. b.
a. Photochemical reactions
b. Electron transport c. c.
c. Chemiosmosis
2. Carbon fixation reactions (take 2 2

place in stroma)
Available Choices
a. Electrons b. NADPH, O2 c. Light energy; d. ATP

pigments (chlorophyll)
e. Electrons, NADP f. Proton gradient, g. Carbohydrates, h. Ribulose bisphosphate,
+, H O, electron ADP + P, ATP ADP + P, NADP+ CO2, ATP, NADPH,
2
acceptors synthase necessary enzymes
Major Events and Features of Cellular Respiration
Stage Starting Materials End Products

1. Glycolysis ( in cytosol)
2. Preparatory reaction
3. Citric acid cycle
4. Electron transport and

chemiosmosis
Available Choices 
a. Pyruvate, ATP, NADH b. NADH, FADH2, c. Glucose, ATP, NAD d. Pyruvate, Coenzyme
O2, ADP Pi +, ADP P
i A, NAD+
e. Acetyl CoA, H2O, f. Acetyl CoA, CO2, g. CO2, NADH, h. ATP, H2O, NAD+,
NAD+, FAD, ADP Pi NADH FADH2, ATP FAD
Suggested Answers:
Major Events and Features of Photosynthesis

Reaction Series Needed Materials End Products
Light-dependent reactions
(take place in the thylakoid a. Light-energy; pigments (chlorophyll) a. Electrons
membrane) b. NADPH, O2
b. Electrons, NADP+, H2O, electron acceptors
a. Photochemical reactions
c. Proton gradient, ADP + P, ATP synthase c. ATP
b. Electron transport
Carbon fixation reactions 2. Ribulose bisphosphate, CO2, ATP, NADPH, 2.

(take place in stroma) necessary enzymes Carbohydrates,
ADP + P, NADP+
Major Events and Features of Cellular Respiration
Stage Starting Materials End Products
1. Glycolysis (in cytosol) Glucose, ATP, NAD+, ADP Pi Pyruvate, ATP, NADH
2. Preparatory reaction Pyruvate, Coenzyme A, NAD+ Acetyl CoA, CO2, NADH
3. Citric acid cycle Acetyl CoA, H2O, NAD+, FAD, CO2, NADH, FADH2, ATP
ADP Pi
4. Electron transport and NADH, FADH2, O2, ADP Pi ATP, H2O, NAD+, FAD
chemiosmosis
92
Activity: Gaseous Products of Photosynthesis
NOTE: If there is enough time and the materials are available, let the class do this activity.
Materials needed:
1000 mL beaker, 3 grams of sodium bicarbonate, Hydrilla or Elodea, funnel, test tube
Procedure:
1. Half-fill a 1000 mL beaker with tap water.
2. Add 3 grams of sodium bicarbonate.
3. Place Hydrilla or Elodea in the bottom of the beaker.
4. Put a funnel over the plant.
5. Fill the test tube with water up to the brim. Secure the mouth of the test tube with your thumb. Invert
the tube and place it on top of the funnel.
6. Place the beaker under direct sunlight. Count the bubbles that appear in the test tube after 30, 60,
90, 120, 150, 180, and 210 seconds.
7. After several minutes, slowly remove the test tube from the funnel. Place your thumb over its mouth.
Turn the tube right up and insert a glowing match to the test the presence of the oxygen in the tube.
Adapted from: Science and Technology II for the Modern World. (2003). Makati City: Diwa Scholastic
Press, Inc.
Note: An illustration of the set-up will help teachers and students to visualize how the experiment
should be performed.
Directions: Show the basic similarity and differences between photosynthesis and cellular respiration.
The options are provided for in the other table below.
PART I
Photosynthesis Cellular Respiration
1. Raw materials
2. End products
3. Electron transfer compound
4. Location of electron transport chain
5. Organelle involved
6. ATP production
7. Source of electron for ETC
8. Type of metabolic reaction
9. Terminal electron acceptor for
electron transport chain
Available Choices
a) O2 b) Anabolism
c) Glucose, oxygen d) Carbon dioxide, water
e) NADP+ is turned to NADPH f) NAD+ is turned to NADH+
g) Phosphorylation and oxidative h) Mitochondrial inner membrane

phosphorylation (cristae)
i) Chloroplast j) Mitochondrion
k) Photophosphorylation l) Thylakoid membrane
m) In noncyclic electron n) Immediate source: NADH and
transport :H2O FADH2
o) Glucose, oxygen p) Catabolism
q) In noncyclic electron transport: r) Carbon dioxide, water
NADP+
94
Suggested Answers
Photosynthesis Cellular Respiration
1.Raw materials Carbon dioxide, water Glucose, oxygen
2.End products Glucose, oxygen Carbon dioxide, water
3.Electron transfer NADP+ is turned to NADPH NAD+ is turned to NADH+

compound
4.Location of electron Thylakoid membrane Mitochondrial inner membrane
transport chain (cristae)
5.Organelle involved Chloroplast Mitochondrion
6.ATP production Photophosphorylation Phosphorylation and oxidative

phosphorylation
7.Source of electron for ETC In noncyclic electron Immediate source: NADH and
transport :H2O (undergoes FADH2, Ultimate source: glucose
photolysis to yield electrons,
protons, and oxygen)
8.Type of metabolic reaction Anabolism Catabolism
9.Terminal electron acceptor In noncyclic electron transport: O2 (becomes reduced to form

for electron transport chain NADP+ (becomes reduced to H2O)
form NADPH)
Connecting the Concepts with the Biological Systems

• Chloroplasts and mitochondria play a significant role in metabolism and their enzyme-requiring
pathways permit a flow of energy through all living things.
• The energy transformations that take place in these organelles results in a loss of energy in the form
of heat. Therefore, all organisms are in need of a constant supply of energy, which they get from
their food.
• Food is ultimately produced by plants, which have the ability to capture solar energy.
Photosynthesizing organisms form the basis of most food chains on Earth. 
EVALUATION (60 MINS) Suggested Answers:
Directions: Summarize the similarity of the two organelles as they carry out opposite processes. Use of Membrane:
In chloroplast
PART II • An inner membrane forms the thylakoid of
the grana.
In mitochondrion
SET A: Revisit of Energy Organelles • An inner membrane forms the cristae.
Structure Chloroplast Mitochondrion
1. Use of Membrane
Electron Transport Chain
In chloroplast
2. Electron Transport Chain • An ETC is located on the thylakoid
membrane. Electrons passed down the ETC
3. Enzyme have been energized by the sun; The ETC
establishes an electrochemical gradient of H
+ with subsequent ATP production by
SET B: Photosynthesis versus cellular respiration
chemiosmosis.
Directions: Using the following descriptions for photosynthesis and cellular respiration, bring out your In mitochondrion
long bond paper or Oslo paper, pencil, ruler, ballpen and coloring materials. Show an illustration/ • An ETC is located on the cristae of
mitochondrion. Energized electrons have
diagram comparing the structure and function of chloroplasts and mitochondria. Label the parts of the
been removed from glucose and glucose
organelles. The rubric for the drawing is given below. products. The ETC establishes an
electrochemical gradient of H+ with
subsequent ATP production by
In Photosynthesis: chemiosmosis.
• Water is oxidized and oxygen is released
Enzymes
• Has electron transport chain located within the grana of chloroplasts, where ATP is produced by In chloroplast
chemiosmosis • The stroma contains the enzymes
• Has enzyme-catalyzed reactions within the semi-fluid interior of the Calvin cycle. In the Calvin cycle,
NADPH and ATP are used to reduce carbon
• Carbon dioxide is reduced to a carbohydrate
dioxide to carbohydrate.
In mitochondrion
In Cellular respiration: • The matrix contains the enzymes of
the citric acid cycle. In citric acid cycle, the
• Oxygen is reduced to water oxidation of glucose products occurs as
• Has electron transport chain located within the cristae of the mitochondria, where ATP is produced NADH and ATP are produced.
by chemiosmosis
• Has enzyme-catalyzed reactions within the semi-fluid interior
• A carbohydrate is oxidized to carbon dioxide 
96
Rubrics for the Drawing
Standard Excellent (7 points) Good (5 points) Fair (3 points)
Contrast and Shows exceptional artistic and skillful Shows generally acceptable artistic Shows generally vague color contrasts;
intensity of drawing color contrast; and meaningful color and skillful color contrasts; and and indiscernible sense of color
concentration meaningful color concentration concentration
Blending of colors Color mix is exceptionally creative, Color mix is generally creative, Color mix needs improvement
appropriate and meaningful appropriate and meaningful
Neatness Completely free from mess Almost free from mess Too messy
PART III
Directions: Group the class into triad. Make each group construct a concept map to help them develop their understanding of photosynthesis
and cellular respiration. Prepare a rubric for easy scoring.
Content knowledge Information is complete and Information is mostly complete and Information is mostly incomplete and
accurate accurate inaccurate
Originality in Exceptionally well organized and Generally well-organized and Fairly understandable
organization of ideas understandable understandable
Neatness Completely free from mess Almost free from mess Too messy
PART IV
Directions: Arrange the following to get the right energy flow sequence in aerobic respiration.
NADH Electron Transport Chain Glucose ATP
Suggested Answers:
1. Glucose 2. NADH 3. Electron Transport Chain 4. ATP
Directions: Identify the following statements as photosynthesis or cellular respiration.
_______________1. Energy-releasing pathways

_______________2. Energy-acquiring pathways
Suggested Answers:
1. Cellular respiration
2. Photosynthesis
98
Forms of Energy, Laws of

Energy Transformation LESSON OUTLINE
Introduction Communicate the learning objectives 5
and Role of ATP Motivation The “Nanay” Analogy 10
Content Standard
The learners demonstrate an understanding on the forms of energy, laws on Instruction/ a. Review on the idea of organisms as OPEN 60
energy transformation, ATP Structure and Function and the ATP- ADP Cycle. Delivery SYSTEMS 
b. Lesson Proper
Learning Competency
The learners: Practice a. Hugot “Lines” 10
b. ATP in everyday life
• Explain coupled reaction processes and describe the role of ATP in energy
coupling and transfer STEM-bio11/12-IIa-j-2 Enrichment Small-group discussion (SGD) 15
Evaluation Quiz 20
Reflection End of topic question
• Identify different forms of energy in their surroundings.
• Present and explain a real life analogy of the ATP=ADP cycle.
• Relate the experiment done and the game to free energy and equilibrium; Materials Laboratory equipment needed, raw
and ATP cycle respectively. materials, school supplies
• Explain the topics discussed in their small groups (peer learning). Resources
• Reece JB, Urry LA, Cain ML. 2010. Campbell Biology

10th. San Francisco(CA):Pearson Benjamin Cummings;
2010. pp. 141-151.
A. Communicate Learning Objectives Through this introduction, you will have an
idea where to start or how you will
(NOTE: PLEASE DO THE MOTIVATION BEFORE DOING THE INTRODUCTION) approach your discussion. You may also ask
your students which topic would interest
them the most and what would interest
1. Introduce the learning objective by writing it on the board, then give the students 5 minutes (to work them the least.
in pairs) to write down on a piece of paper what they already know or what they expect to learn under
the specified topics:
• Forms of energy
• Laws of energy transformation
• Free energy and metabolism
MOTIVATION (10 MINS) Teacher Tip:

Start the motivation by reviewing/introducing the terms Metabolism, Anabolism, Catabolism, The teacher can also encourage the
students to think of other analogies that will
Bioenergetics, free energy, Entropy, Equilibrium, Digestion, Cellular Respiration, Photosynthesis and help them relate the lesson to their
ATP. After refreshing the students with the terms and processes, group your students into groups of 3’s everyday lives. Please make sure that you
and allow them to think of how they can relate their mom (“NANAY”) to these processes. Have at least look for the meaning of the terms
3 groups of students share their analogy in front of the class. mentioned and read about the topic to
facilitate and make the discussion more
interesting
“Nanay” analogy example:
As long as the analogy relates to the
Metabolism manages materials and energy resources of the cell. We can relate it to our mom/ Nanay concepts being discussed, give credits to
because our mom is responsible most of the time in budgeting the finances and cooks food for the your students.
family.Entropy is the measure of disorder or randomness, Nanay makes sure that all the things inside
the house are well organized especially after the kids played. Nanay lessens the house’s entropy after
the increase in entropy done by the kids after playing by placing all the things in their proper places.
Another set of analogies may include putting together the ingredients of a dish to create a palatable
viand as an example of anabolism. Or removing one by one the parts of an engine to fix a broken car
as an example of catabolism.
100
INSTRUCTION/DELIVERY (60 MINS)  Teacher tip
In the start of the lesson, since the terms
Start the discussion by establishing that living organisms are open systems (energy and matter can be metabolism, catabolism, anabolism were
already used in the motivation, the teacher
transferred between the system and its surroundings). Remind the students that this was already
can explain it further by the use of the
mentioned in one of the characteristics of living organisms. Obtain and use materials for Energy, and in downhill and uphill metabolic avenues.
the unifying theme- interaction with the environment. This way students will clearly understand that Downhill avenue (Catabolism)- releases
processes (Bioenergetics) that happen within a living organism is still influenced and affects the energy that will be used, enabling energy
be stored. While Uphill avenue (Anabolism)
surroundings. The teacher may directly involve students by pointing out that humans breath the carbon
uses energy to build complex materials.
dioxide needed by plants as raw materials to produce food via photosynthesis, the teacher may use the
figure below. Solicit other examples from your students.
Engage your students by giving examples
Emphasize as well the role of oxygen as final electron acceptor in cellular respiration. Students should
first.
appreciate why they need to breathe in oxygen and not other form of gases.
If computers/laptops or lcd projectors are
not available, the teacher may adjust the
discussion by preparing materials written on
a manila paper. The teacher may pave the
discussion in such a way that the students
will be answering or completing tables or
having the students research (homework)
about the topic. This will ensure that the
students have something in line with the
topic that will be discussed. Instead of
pictures, the teacher can ask the students to
do actual processes that will depict the
different forms of energy
Teacher tip
Make sure that for every form of energy,
you will be able to show a solid example in
living systems how energy forms exists and
transformed.
Energy Flow and Chemical Recycling in Ecosystems
Energy flows into ecosystem as sunlight and ultimately leaves as heat, while the chemical elements
essential to life are recycled.
Forms of Energy Teacher Tip
Energy is the capacity to cause change. It is also the ability to rearrange a collection of matter. In the This part of the topic will really be the least
of interest of the students. That’s why
environment different forms of energy exist: Kinetic, Light and Potential energy.
exploring the trend in terms of the “hugot-
• Kinetic- energy associated with relative motion of objects lines” may help you in engaging students.
• Thermal energy-type of kinetic energy associated with random movement of atoms. When thermal Inform your students that at the end of the
discussion you will be having the “hugot
energy is transferred in the form of heat.
line” activity that will be based on the laws
• Light Energy- main energy source is the sun and powers photosynthesis (anabolic process). of thermodynamics. So they can start
• Potential Energy- possessed energy of a matter at rest (non- moving form) preparing for their “hugots” as you discuss
• Chemical energy- potential energy released in a chemical reaction the laws of thermodynamics.
Laws of Energy Transformation

Thermodynamics is the study of energy transformations that occurs in a
system (collection of matter). Living systems are considered as open
systems because energy and matter are transferred between systems and
the surroundings.
1st Law: The energy of the universe is constant: Energy can be
transferred and transformed but it cannot be created nor destroyed.
Plants do not produce energy, but transforms energy from the sun. Some
energy becomes unavailable to do work because most is lost as heat.
Transfer of energy and transformation makes the matter more
disordered. Disorder of matter is measured through entropy.
The teacher may also incorporate the concept on pyramid of energy,

where energy availability per trophic level decreases as one goes from
produces to the top consumer. Only the energy stored by herbivores as
biomass will be available to 1st order carnivores.
102
Laws of Energy Transformation Teacher Tip
Thermodynamics is the study of energy transformations that occurs in a system (collection of matter). Use the figure used, but make sure to note
that an individuals’ contribution to the
Living systems are considered as open systems because energy and matter are transferred between
disorder in surrounding is not obviously felt,
systems and the surroundings. but as a group it is. Use the idea of having
lots of people inside the room compared to
an individual inside the room.
1st Law: The energy of the universe is constant: Energy can be transferred and transformed but it
cannot be created nor destroyed. Plants do not produce energy, but transforms energy from the sun. The teacher must take note that there is
Some energy becomes unavailable to do work because most is lost as heat. Transfer of energy and unstoppable trend towards randomization
of the universe as a whole.
transformation makes the matter more disordered. Disorder of matter is measured through entropy.
∆G = ∆H – T∆S, where ∆H is enthalpy (total
energy), T is absolute temperature and ∆S is
2nd Law: Every energy transfer or transformation increases the energy of the universe.
the change in entropy.
• i.e In a room full of people, breathing increases entropy since all are exhaling carbon dioxide.
• Organisms as open system increase order as long as the order in their surroundings decreases. This If it is possible to show the concentrated
dye experiment (diffusion of dye in water), it
shows that as living organism transfers/transforms energy to its surroundings, the disorder
will be a big help. But before asking the
increases, thus increases entropy. students to do it, make sure that you
prepare questions that will be answered to
lead the students in the discussion of free
Free Energy
energy.
• Energy that can do work under cellular conditions
• Gibbs free energy is the energy in the system that can perform work when temperature and NOTE: You may have the first two bullets
answered by the students before doing your
pressure are uniform throughout the system: ∆G = ∆H – T∆S
discussion. Then after the discussion have
• Also known as free energy change the last 3 bullets answered.
• Measure of system’s instability (trend: tendency to change to a more stable state) • Describe the free energy (G) of the
concentrated dye? Does it have high or low
• Increase in G: UNSTABLE i.e. concentrated dye
free energy? Is it stable or unstable?
• Decrease in G: STABLE i.e. dye dispersed in water • When do we say that the dye reached the
• In chemical reactions: as reaction precedes equilibrium, the free energy of reactants and products stable state?
• Is there a way for the diffused dye system to
decreases (decreases free energy). If products will be removed free energy will increase
undergo spontaneous change? How will you
• When systems reach maximum stability, the system reaches the state of equilibrium. If equilibrium is do it?
reached there is NO WORK. In chemical reactions proceeding equilibrium NO NET CHANGE in the • How will you relate the closed hydroelectric
system to the set up of the dye diffusion
relative concentration of reactants and products. experiment?
• • How will you relate the multistep
hydroelectric system to the dye diffusion
experiment?
Free Energy and Metabolism
Teacher Tip:
It will be really helpful if you use the

example of an isolated/closed hydroelectric
system and an open hydroelectric system. A
• Exergonic reactions- energy is released (energy outward), more decrease in free energy= more work closed hydroelectric dam will reach
done equilibrium while the open hydroelectric
system will not since the overspill will be
• Endergonic reactions- energy is absorbed (energy inward). Plants stores energy in the form of used by another system. You may also think
glucose (from carbon dioxide and water of other examples that are parallel to the
hydroelectric system example.
Equilibrium and Metabolism
You may also use the dye diffusion
• Equilibrium = NO WORK. This usually happened in isolated systems that reach equilibrium. experiment that you did in explaining the
• A cell that reaches the state of equilibrium is DEAD isolated hydroelectric system as example.
• A normal cell is not in equilibrium, because its products are not accumulated within its system, Add a drop of concentrated dye to a glass
of water. Since it is a closed hydroelectric
INSTEAD the products becomes a reactant in the next step. system, the procedure stops there, where
the dye already reached the state of
equilibrium
104
Adenosine Triphosphate (ATP) Teacher Tip:
• Structure composed of: sugar ribose, nitrogen base adenine and a chain of 3-phosphate groups The multistep hydroelectric system can be
explained through the dye diffusion
• Mediates most energy coupling in cells
experiment by using more than one glass or
• Powers cellular work water. You may show this by having the
• 3 main kinds of work of a cell: chemical work, transport work and mechanical work. These are concentrated dye dropped to the first glass.
possible through energy coupling, where the cells use and exergonic process to drive an Describe how the dye decreases free
energy and how it becomes more stable by
endergonic reactions.
diffusing. But this doesn’t end with this set
• chemical work: synthesis of polymers from monomers (pushing of endergonic reactions) up, get another dropper and obtain a
• transport work: pumping of substances across membranes (against the direction of spontaneous sample of the colored water from glass 1
movement) then drop it into the clear water in glass 2.
This way you are showing that the dye that
• mechanical work: beating of cilia, contraction of muscles
had decreased its free energy and improved
• also used to make RNA (since ATP is used as one of the nucleoside triphosphate) to be more stable can still undergo
spontaneous change. Then repeat the
procedure from glass 1 to glass 2 for the
ACTIVITY: Calamansi Relay ala ATP cycle
succeeding glasses. With this, you were able
Materials: Calamansi, plastic spoons (30) to show that a multi-step open hydroelectric
system will not reach equilibrium because
the product becomes the reactant for the
In an oval (if there is any in your area) or a lot where students can play the relay next reaction.
divide the class into 3 groups (10 members per group) assuming that there are 30
Teacher tip:
students in a class. Define who’s going to be number 1-10 (refer to the figure The phosphate bonds of the ATP must not
below). At your mark they will start the relay. Student 1 must be able to successfully be termed as high-energy phosphate
pass the calamansi (calamansi on a plastic spoon bitten by student 1) to the bonds. The bonds of the phosphate groups
of the ATP are not strong bonds but
students 2’s plastic spoon (must be bitten). The student’s hand must be at their back,
instead, the reactants (ATP and water)
NO USING OF HANDS. If the calamansi falls from the spoon the student has to go possess high energy compared to the
back to his/her starting point before proceeding in passing the calamansi to the next product.
player. The group that will finish first will be the winner. The winner will be awarded
with bonus points.
Do the game before discussing the ATP hydrolysis and ATP cycle. Make sure that you read the game
mechanics and do the adjustments to fit your classes. At the end of the activity discuss how it is related
to ATP hydrolysis and ATP cycle.
• Calamansi: water (for hydrolysis)
• Students: phosphates that is cleaved 
• Students exerting effort to reach the other end: energy releasing process to allow ADP + P to Teacher Tip
produce ATP (phosphorylation) As for supplementary resource, you may
look for videos that clearly explains the
• Bonus/incentive for the winner: energy
hydrolysis of ATP and the ATP Cycle. You
• 2 groups: ATP and ADP may ask your students to view it before the
class (HW) or have it shown in class as you
discuss it.
Hydrolysis of ATP
• process of breaking down bonds between the phosphate groups Teacher Tip
Look for videos showing the 3 cellular work
• this happens when a water molecule breaks the terminal phosphate bond
powered by ATP. For the students to
• HOPO32-, abbreviated P I leaves ATP appreciate these processes more and for
• Forming Adenosine diphosphate (ADP) them to clearly see that its really happening
• Energy is released. This comes from the chemical change of the system state of lower free energy in living systems.
and NOT from the phosphate bonds.

You may also use the lessons they had in
• Hydrolysis relases so much energy because of the lnegative charges of the phosphate groups. endomembrane system and transport
These charges are crowded together and their mutual repulsion contributes to the instability of that mechanisms to facilitate the discussion in
region of the ATP. The energy equivalent of the triphosphate tail of ATP is compared to a this part of the topic.
compressed spring. 
106
How the Hydrolysis of ATP Perform Work
• Proof that ATP releases heat: in a test set up, the hydrolysis of ATP releases energy in the form of heat in the surrounding water.
• Most of the time when an animal is exposed in a cold environment, the reaction of the body is through shivering. In this reaction of the
organism, shivering uses ATP during muscle contraction to warm the body. Since it will also be a disadvantage for organisms to generate
heat during ATP hydrolysis, in order to maintin the living conditions inside the cell, the energy released during ATP hydrolysis is used by
proteins to perform work: chemical, transport and mechanical
• Hydrolysis of ATP leads to change in the shape of protein and in its ability to bind to another molecule. Phosphorylation (ADP to
ATP) and dephosphorylation (ATP to ADP) promote crucial protein shape changes during important cellular process 
The Regeneration of ATP
• ATP is a renewable it can be regenerated by the addition of phosphate to ADP
• Catabolism (exergonic) provides the free energy to phosphorylate ADP.
• ATP formation is not spontaneous, so there is a need to use free energy for the process to work.
• ATP cycle is the shuttling of inorganic phosphate and energy.
• It couples the cell’s energy yielding processes (exergonic) to energy consuming process (endergonic)
• ATP regeneration happens very fast (10M molecules of ATP used ad regenerated per second)
• If ATP could not be regenerated by phosphorylation of ADP, HUMANS would use nearly their body weight in ATP each day.
108
PRACTICE (10 MINS)
A. “Hugot-lines”. Create “hugot-lines” based on the laws of transformation of energy. Ask your
students to create 3 “hugot-lines” per law under the transformation of energy. The student must give
justification for each “hugot-line” they’ll create. Make sure that the “hugot-lines” are in tune with the
scientific concepts of the law of thermodynamics.
B. ATP in everyday life. Ask your students to make an analogy relating the concepts under ATP (ATP
cycle, ATP hydrolysis, How ATP allows organisms to do work) or the relevance of ATP in our lives. After
listing the analogies or the relevance of ATP in our lives, ask the students to write their reflection/
realization regarding the topic.

Small Group Discussion. Allow your students to meet in groups (5 students per group) Assign each
students to a topic below:
• Forms of energy
• Transformation of energy
• Free energy and metabolism
• ATP- structure and function
This is to see how much the students understood the lesson. Encourage your students to explain the
concepts in their own words. You may allow you students to use their notes in this small discussion. If
they have an access to internet and can bring their gadgets, you may also encourage them to save
videos that will help them explain their topic.

The teacher can make his/her own list of questions that will allow students to practice critical thinking
skills. Having this short quiz done by group of 2s or 3s will allow students to discuss and decide among
themselves. If a student opts to answer individually, allow him/her. The teacher can prepare a multiple-
choice type of evaluation if he/she is not comfortable with this type of exam 
1. Explain metabolism through creating an appropriate analogy.
2. What is the difference between Catabolic and Anabolic reaction? How do each process compliment
one another?
3. What is the importance of having exergonic reactions in the body?
4. What is the disadvantage if there are not enough endergonic reactions in the body? Relate this to
the ATP cycle.
5. What happens when energy transforms to another form? Is the yield unchanging for every
transformation? Why or Why not?
6. Which law of thermodynamics states that energy transfer or transformation increases the state of
disorder of the universe?
7. Why do we consider living organisms as open systems?
8. If free energy is higher, does it mean that the system is more stable (Y/N) N? What does this imply
in the amount of work that can be done?
9. If free energy is lower,does it mean that there is greater work capacity? (Y/N) N What does this
imply about the systems stability?
10. How can you tell that a cell has reached equilibrium? What properties does it display?
11. (Y/N) Is the hydrolysis of ATP reversible? If Yes, explain your answer.
12. Describe how phosphorylation works (what drives it)?
13. How does the cell go about the continuous release of heat during ATP hydrolysis?
14. What will happen to the body if the regeneration of ATP is very slow?
15. How does the multi-step open hydroelectric system explain cellular respiration?
Teacher Tip
Encourage your students to answer this
REFLECTION (HOMEWORK FOR THE NEXT MEETING) section truthfully as it will also help you
• Which of the topics interest you the most? Why? improve the lesson and your approach.
• Which of the topics interest you the least? Why?
• Did the activities help you understand the topic (Y/N)? Explain your answer.
• Did you see the significance/ connection of the topic in your life?
110
Energy Transformation Pt.1

Content Standard LESSON OUTLINE
The learners demonstrate an understanding of photosynthesis. Introduction Assess prior knowledge through a class 10
Learning Competency activity on word clustering
The learners explain the importance of chlorophyll and other pigments Motivation Laboratory activity on separating plant 50
(STEM_BIO11/12 – IIa-j-3) pigments through paper
chromatography
Specific Learning Outcomes Instruction/ Discussion on chlorophyll, 120
At the end of the lesson, the learners shall be able to: Delivery photoexcitation of chlorophyll, and the
• separate and identify the different pigments present in plants through a photosystem
simple paper chromatography experiment
Practice Formative assessment through summary 20
• discuss the role of pigments in photosynthesis
reporting
• illustrate how chlorophyll absorbs and transforms light energy
• define and describe a photosystem Enrichment Answering of critical thinking questions 20
Evaluation Short quiz on topics discussed in the 20
lesson
Materials
• laboratory materials and supplies for the chromatography
experiment (i.e., chromatography or filter paper,
glassware, acetone/solvent, spinach leaf, coleus leaf, coin,
pencil, aluminum foil, ruler, and coffee stirrer)
• prism
Resources
(1) Reece JB, U. L. (2010). Campbell Biology 10th. pp. 190 – 194. San
Francisco(CA): Pearson Benjamin Cummings.
(2) Starr, C. (2003). Biology: Concepts and Applications 5th edition. Pp.92
– 98. Belmont, California: Brooks/Cole-Tomson Learning.
1. Assess the learners’ prior knowledge of the topic by facilitating a class activity on clustering or word By assessing the learners’ prior knowledge,
you will be able to gauge what they already
webbing. Write the word CHLOROPHYLL on the board. This will serve as the ‘nucleus word’.
know and what they still need to learn from
2. Ask the learners to think of words or images associated with the ‘nucleus word’ and let them write the lesson. This will help you design and
the words or sketch the images around the ‘nucleus word’. determine the topics that you need to
3. Encircle each word or image and draw a line from each item to the ‘nucleus word’. include and those that you need to reiterate
and emphasize in your discussions.
4. Ask the learners to write how each word or image is related to the ‘nucleus word’ CHLOROPHYLL
and have them write the relation above or below the line that you drew. Posing essential questions at the start of a
5. Ask the learners to summarize the word web formed by the class. lesson helps stimulate thoughts, promotes
6. After the summary, present the following questions to the class: inquiry, and motivates the learners to find
and formulate ways to be able to come up
• Why are chlorophyll and other plant pigments important?
with the correct responses.
• How do chlorophyll and other plant pigments help in carrying out photosynthesis?
These essential questions shall help the learners focus in finding the correct responses.
Teacher Tip:
Use the following guidelines in performing
MOTIVATION (50 MINS) the laboratory activity:
To help the learners acquaint themselves with different plant pigments, instruct them to perform a
• Make sure that the learners have
laboratory activity on chromatography of plant pigments. This activity will allow them to visually knowledge of safety practices in the
demonstrate that leaves contain different colored pigments. laboratory.
• Let the learners work in groups in order
Before performing the experiment, provide a brief description of chromatography.
to smoothly carry out the experiment.
Chromatography—is a separation technique used to identify various components of mixtures based • Prepare the materials a day before the
on the differences in their structure and/or composition. It involves a stationary phase (e.g., paper or activity.
any thin layer of an absorbent surface) and a mobile phase (i.e., solvent containing the dissolved
substances). The solvent will move up the paper through capillary action carrying with it the dissolved
substances. These substances will be carried along at different rates because they are not equally
soluble in the solvent and they will be attracted in different degrees to the paper.
Provide the learners with a copy of the instructions for the activity. Guide them as they perform the
experiment.
112
Extracting Plant Pigments through Chromatography
Objective: Perform chromatography to separate a mixture of pigments from plants

Materials per group:
• Chromatography paper strips or filter paper about 1cm x 15cm in size
• Acetone (solvent)
• 150 ml beaker or a tall glass jar
• aluminum foil to serve as cover for the beaker
• fresh spinach leaf
• Coleus leaf or other leaf that is red in color
• coin
• pencil
• ruler
• coffee stirrer or plastic stick
Procedure (Adapted with modifications from
<http://www.dal.ca/content/dam/dalhousie/pdf/faculty/science/imhotep/9.2-Discovering-Plant-
Pigments.pdf>):
1. Using a pencil, draw a base line that is 2cm from the bottom of the paper strip. Be careful in
handling the chromatography paper as oil from the human skin can alter the results. Lift the paper
only by its sides and be careful not to touch its front.
2. Place the spinach leaf over the paper. Pressing hard, roll the edge of the coin, and rub the leaf onto
the paper, following the path of the line. Repeat until the line turns very dark.
3. Repeat the same process for the Coleus leaf using a second strip of chromatography paper.
4. Add enough acetone to cover the bottom of the beaker or glass jar (no more than 1cm high).
5. Attach the top of the paper strips to a pencil or a coffee stir stick. This can be done by making a
loop with the top of the paper and fastening it with a paper clip or tape.
6. Lay the pencil or stick across the top of the beaker so that it suspends the paper above the liquid.
The bottom of the paper strip must be dipped in the solvent but the solvent should not surpass the
2cm baseline that is the point of origin. 
7. Cover the beaker and allow 15–30 minutes for the solvent to rise through the strips.
8. Remove the paper strips just before the solvent reaches the top.
9. Lay the paper strip face up. Using the pencil, immediately mark the line where the solvent stopped
before it evaporates. This is called the solvent front.
10. Allow the strips to dry.
11. Before the pigments fade, mark the top of each color that you can identify.
12. Measure the distance (in mm) travelled by each pigment from the point of origin.
13. Tabulate your data. Show the following information in your table: color observed, distance
travelled, and probable pigment.
INSTRUCTION/DELIVERY/PRACTICE (120 MINS)

Teacher Tip:
The learners’ discussion of the experiment’s
Using the learners’ observations from the experiment and the data they have gathered, have them result, analysis, and conclusion will
discuss their analysis and conclusion among their groups with the help of these guide questions: jumpstart the lecture and discussion on
pigments and their role in photosynthesis.
• Which pigments were you able to observe in your chromatogram?

• Why do the pigments move at different rates through the chromatogram?
• How do the spinach leaf and Coleus leaf differ from each other in terms of their pigments?
• Which of the two leaves can carry out photosynthesis better? Why?
• Why is it an advantage for plants to have different colored pigments?
Let the groups share their analysis and conclusion in class.
Discuss the following concepts:
Pigments Teacher Tip:

If a prism is available, you may use it to
demonstrate the various colors of visible
Pigments are substances that absorb visible light. Different pigments absorb light of different light.
wavelengths.
114
Light, as it encounters an object, is either reflected, transmitted, or absorbed. Visible light, with a Teacher Tip:
wavelength of 380–750nm, is the segment in the entire range of electromagnetic spectrum that is most Encourage participation from the students
important to life on earth. It is detected as various colors by the human eye. The color that is not while discussing these concepts.
absorbed by pigments of objects is transmitted or reflected and that is the color of the object that we
see.
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Figure'1:!The!Electromagnetic!Spectrum!
Pigments are the means by which plants capture sun’s energy to be used in photosynthesis. However,
since each pigment absorbs only a narrow range of wavelength, there is usually a need to produce
several kinds of pigments of different colors to capture more of sun’s energy.
Chlorophyll
Chlorophyll is the greenish pigment found in the thylakoid membrane inside the chloroplast of a plant
cell. The figure below shows the location and structure of a chloroplast.
Chlorophyll absorbs blue and red light while it transmits and reflects green light. This is why leaves Teacher tip
appear green. For this part, you may ask some learners to
volunteer to show the location of
chlorophyll in a leaf of a plant. They may do
There are several kinds of chlorophyll. Among these, chlorophyll a plays the most important role in this through drawings or sketches in the
photosynthesis. It directly participates in converting solar energy to chemical energy. board.
Other pigments in the chloroplast play the part of accessory pigments. These pigments can absorb
light and transfer the energy to chlorophyll a. One of these accessory pigments is chlorophyll b. Some
carotenoids also contribute energy to chlorophyll a. Other carotenoids, however, serve as protection for
chlorophyll by dissipating excessive energy that will otherwise be destructive to chlorophyll.
Structure of chlorophyll
• Head—a flat hydrophilic head called porphyrin ring. It has a magnesium atom at its center. Different
chlorophylls differ on the side groups attached to the porphyrin.
• Tail—a lipid-soluble hydrocarbon tail.
How does photoexcitation of chlorophyll happen?

1. A chlorophyll molecule absorbs photon or light energy.
2. An electron of the molecule in its normal orbital, said to be in its ground state, will be elevated to
an orbital of a higher energy. The molecule is now in an excited state. The molecule only absorbs
photon that has the energy that is equal to the energy needed for it to be able to elevate from the
ground state to the excited state.
3. The excited state is unstable. Hence, excited electrons drop back down to the ground state
immediately after, releasing energy in the form of heat and photon. This happens in isolated
chlorophyll molecules. However, chlorophyll molecule that is found in its natural environment in the
thylakoid membrane forms a photosystem together with proteins and other organic molecules to
prevent the loss of energy from the electrons.
116
Teacher tip
Reiterate the importance of the formation
of photosystem. The formation of the
photosystem prevents the excited electrons
from going back to the ground state, thus
preventing the loss of energy which is
essential for photosynthesis to occur.
Figure 4: Photoexcitation of Chlorophyll
Photosystem
A photosystem is an aggregate of pigments and proteins in the thylakoid membrane responsible for
the absorption of photons and the transfer of energy and electrons. It is composed of:
• Light-harvesting complex— is also called the ‘antenna’ complex and is consisted of several different
pigments (chlorophyll a, chlorophyll b, and carotenoids) bounded with proteins. When a pigment
molecule absorbs a photon, energy is passed on from one pigment molecule to another pigment
molecule until the energy reaches the reaction center.
• Reaction-center complex—is composed of a pair of chlorophyll a and a primary electron acceptor.

The primary electron acceptor is a specialized molecule that is able to accept electrons from the
pair of chlorophyll a. The pair of chlorophyll a in the reaction-center is also specialized because they
are capable of transferring an electron to the primary electron acceptor and not just boosting the
electron to a higher energy level.
There are two types of photosystem:
• Photosystem II—was discovered later after the discovery of Photosystem I, but functions first in the
light reaction of photosynthesis. The chlorophyll a in the reaction-center of Photosystem II
effectively absorbs light with a wavelength of 680nm and thus called P680.
• Photosystem I—was discovered first. Its reaction-center has a chlorophyll a called P700 because it is
effective in absorbing light with a wavelength of 700nm.

1. Divide the class into three groups. Assign each topic you discussed to each group: chlorophyll and This activity will serve as a formative
assessment to evaluate the learners’
other pigments, photoexcitation of chlorophyll, and photosystem. understanding of the lesson. This will also
2. Instruct each group to perform a Summary Report of the topic assigned to them. Each member of provide you an opportunity to reinforce
the group will have to say something about the topic without consulting their notes. concepts that are not clearly understood
3. Give the groups enough time to organize and consolidate their report before asking them to and to rectify misconceptions, if there are
any.
present in class.

• In places where there are four seasons (i.e., winter, spring, summer, and fall), how do plants
cope with the change in season? Give a detailed description and explanation.
• Chlorophyll-enriched products and supplements are now being sold in the market. Find out
what benefits these products claim. With your knowledge about chlorophyll, do you think
these claims are valid? Support your answer.
Ask the learners to share their answers in class.
118
Give the students a short quiz to assess their understanding of the topics discussed in the lesson.
You may formulate other questions that can gauge their learning.
1. What happens to light when it hits an object.

2. What wavelength of light is most important to life on earth?
3. How do plants capture the sun’s energy?
4. In what cell organelle can we find chlorophyll? In what structure
of this organelle is chlorophyll located?
5. What color/s of light does chlorophyll absorb? What color does
it reflect?
6. What might be the advantage of accessory pigments?
7. What happens to a chlorophyll molecule when it absorbs
photons?
8. How do chlorophyll molecules prevent the loss of energy when
electrons go back to the ground state?
9. What composes a photosystem?
10. In what part of the photosystem does the first step of light
reaction takes place?
11. Differentiate the two types of photosystem.

Content Standard
The learners demonstrate an understanding of photosynthesis. LESSON OUTLINE
Learning Competency Introduction Communicating learning competencies 20
The learners describe the patterns of electron flow through light reaction and outcomes; Familiarization with key
events (STEM_BIO11/12–IIa-j-4) terms
Motivation Establishing the importance of 10

Specific Learning Outcomes photosynthesis to all organisms by using
At the end of the lesson, the learners shall be able to: plant samples
• differentiate the two stages of photosynthesis Instruction/ Discussion on the events of light 60
• identify the important molecules involved in the light reactions Delivery reactions.
• describe the events and processes happening during light reactions
Practice Role-playing activity 60
Enrichment Think-pair-share class activity 10

Evaluation Quiz on the light reactions events 20
diagram
Materials
• samples and photos of plant products (e.g. fruits and
vegetables)
• materials for the role-playing activity (e.g. tennis balls or
soft balls, lids, and labels)
Resources
(1) Reece JB, U. L. (2010). Campbell Biology 10th. pp. 190 – 194. San
Francisco(CA): Pearson Benjamin Cummings.
(2) Starr, C. (2003 ). Biology: Concepts and Applications 5th edition. Pp.98
- 100. Belmont, California: Brooks/Cole-Tomson Learning.
120
1. Communicate the learning competencies and learning outcomes of this lesson to the class. Communicating the learning competencies
and learning outcomes shall give the
2. Give the learners enough time to research on the definition and description of the following
learners an idea on what they can expect to
keywords: learn from the lesson.
• light reactions
• noncyclic electron flow You may also opt to establish prior
understanding of the topic or lesson. You
• cyclic electron flow
can ask the learners to show specific hand
• plastoquinone (Pq) signals depending on how familiar they are
• plastocyanin (Pc) on the topics to be discussed. For example,
• ATP they can do a ‘thumbs up’ to indicate
extensive understanding of the specific
• photophosphorylation
topic, a ‘thumb to the side’ to signify
• ferredoxin enough understanding of the topic, and a
• NADP+ ‘thumbs down’ to show little or no
• NADPH understanding at all.
• chemiosmosis

1. Establish to the learners that photosynthesis is important not only to plants but also to other living
organisms such as humans.
2. Show pictures of food with vegetables or fruits to the class. You may also bring real fruits and
vegetables to the class. Let the learners identify them.
3. Ask the learners what percentage of their diet consisted of fruits and vegetables.
Ask learners to make conclusions on the role played by plants in converting the sun’s energy to a
form of energy that the human body can use.Using a pencil, draw a base line that is 2cm from the
bottom of the paper strip. Be careful in handling the chromatography paper as oil from the human
skin can alter the results. Lift the paper only by its sides and be careful not to touch its front. 
INSTRUCTION/DELIVERY (60 MINS) Teacher Tip:
You may the students to write on the board
the chemical reaction for photosynthesis.
Review the chemical reaction for photosynthesis:
6 CO2 + 6 H20 + sunlight C6H12O6 + 6 O2

Using a diagram showing an overview of
photosynthesis, have the students figure out
Ask the learners to identify which among the reactants is/are used in the light reactions and the Calvin differences between the two stages
cycle. involved.
Give an overview and further differentiate the two stages of photosynthesis.
• Light reactions—use sunlight to initiate electron transfer, thereby reducing NADP+ to NADPH and
splitting water to give off oxygen as a by-product.
• form ATP through phosphorylation
• take place in the thylakoids of the chloroplast
• Calvin Cycle—sometimes referred to as ‘dark reactions’ because it does not require light energy for
its processes to take place
• incorporates CO2 into organic molecules through carbon fixation
• uses NADPH and ATP to produce carbohydrate from the fixed carbon
• takes place in the stroma of chloroplast
• returns ADP, inorganic phosphate, and NADP+ to the light reactions
Show an image of the light reactions similar to the one shown in Figure 2 below:
122
Teacher Tip:
While discussing the events in the light
reaction, make sure to engage the learners
and encourage them to participate by
asking questions before proceeding with
the discussion on each step or event.
The following could be sample questions:

• What happens to electrons when they
encounter light energy?
• How is oxygen formed in the first phase
of light reaction?
• What happens to the hydrogen ions
formed from the splitting of water
molecules?
Teacher Tip:
You may review the concept of redox
reaction in this part.
In an oxidation reaction, a molecule loses
one or more electrons and becomes more
positively charged.
In a reduction reaction, a molecule gains
one or more electrons and becomes more
Figure 2: The Light Reactions negatively charged.
Oxidation and reduction reactions are most
often paired, resulting to a redox reaction.
From the image or diagram of the light reactions, ask the learners to identify the key players involved in As a molecule is oxidized, the molecule that
the process. accepts the electrons is reduced.
Teacher Tip:
Proceed to an in-depth discussion of the steps or events in light reactions. Integrate the First Law of Thermodynamics
which states that energy can be transferred
or transformed from one form into another
but cannot be created nor destroyed. Ask
Light Reactions Events  the students how the First Law of
Thermodynamics is applied in
1. Light energy or photon is absorbed by a pigment molecule of the light-harvesting complex of Photosynthesis. Ask the learners to cite
Photosystem II and is passed on to other pigment molecules nearby until the energy makes it to the specific events in the process that illustrates
the law.
reaction center. In the reaction center, it is absorbed by the P680 pair of chlorophyll a.
2. The electron in this pair of chlorophyll a is raised to an excited state and is transferred to the
primary electron acceptor. P680 loses its electron and becomes positively charged (P680+).
3. The positively charged molecule attracts electrons from a water molecule, resulting to the splitting
up of H20 into two electrons, two hydrogen ions (H+), and an oxygen atom with the provision of
light energy. The oxygen atom immediately combines with another oxygen atom to form an oxygen
molecule (O2) which is then released outside the leaf through the stomata.
4. The excited electrons are then passed on from the primary electron acceptor to the electron carrier
molecules through the electron transport chain until they reach Photosystem I. The electron carrier
molecules involved here are plastoquinone (Pq), a cytochrome complex, and plastocyanin (Pc).
5. At each transfer, the electrons release small amounts of energy. This energy is used to pump
hydrogen ions across the membrane. The splitting up of water molecules results to an uneven
distribution of hydrogen ions in the stroma and the lumen. The H+ ions tries to equalize their
distribution by moving from the lumen to the stroma through the aid of a membrane protein called
ATP synthase. This is referred to as chemiosmosis. The movement of hydrogen ions through the
ATP synthase channel triggers the synthesis of ATP from ADP. The ATP contains high-energy
phosphate bonds.
6. Meanwhile, photon is also absorbed and energy is passed on from one pigment molecule to
another until the energy reaches the reaction center complex of Photosystem I. The energy excites
the electron present in the pair of P700 chlorophyll a located here. The excited electron is then
transferred to a primary electron acceptor, making the P700 positively charged and now seeking
electrons to fill up the missing ones. This is filled up by the electrons from Photosystem II that are
passed on through the electron transport chain.
7. The photo-excited electron from the primary electron acceptor of Photosystem I enters another
electron transfer chain, passing the electron to an iron-containing protein called ferredoxin (Fd).
8. An enzyme, the NADP+ reductase, then transfers the electron to NADP+ and stabilizes it by adding
a proton (H+) to form NADPH. NADPH is then released to the stroma and becomes part of the
Calvin Cycle.
Cyclic Electron Flow

Aside from the usual route of electron flow as described in the events of the light reactions (i.e.,
noncyclic or linear electron flow), photo-excited electrons may take a short-circuited route which utilizes
Photosystem I but not Photosystem II. The ferrodoxin goes back to the cycle and passes the electron
124
to the cytochrome complex and to the Pc until it reaches P700 chlorophyll instead of transferring the
electron to NADP+reductase. Due to this event, no NADPH is produced but ATP is still synthesized.
Figure 3: Cyclic Electron Flow

For this part of the lesson, the learners shall
LIGHTS, Camera, ReACTIONS! take on roles and act out the events that
1. Take the class outside the classroom and look for a wide area that will allow the learners to move happen during light reactions. This shall be
around. a class effort and shall need each learner’s
cooperation to be able to accurately act out
2. Ask the learners to pick a role as players in light reaction events (e.g., hydrogen ions, oxygen atoms, the events. Learners who are not directly
etc.). involved in the performance shall serve as
director and scriptwriters to ensure the
3. Let the learners plan how they are going to act out the process.
smooth flow of the ‘play’.
4. You may provide the following information and materials to assist them in planning and performing
the roleplaying activity. This activity shall help the learners process
the information that they acquired. This
Materials: shall ensure that the learners acquire a
• balls (tennis balls or soft balls) that will serve as electrons deeper understanding of the concepts.
• lids or any material that will serve as light energy or photon Through this activity, you shall have an idea
• labeled cards for the following roles: of how well the learners understood the
topics you discussed. It shall give you the
• sun chance to correct any misunderstandings
• pigment molecules (several learners) and misconceptions they might have
regarding the lesson.
• water molecule (i.e., oxygen atom and hydrogen ions)
• P680
• primary electron acceptors
• electron carriers (i.e., Pq, cytochrome complex, Pc, and Fd)
• ADP
• P700
• NADP+ reductase
• NADP+
5. Ask the class present their simulation of the light reactions.
6. After the presentation, provide feedback, if there is any.
126
You may also opt to formulate questions to
Think-Pair-Share be answered as a quiz. The quiz may be
1. First, instruct the learners to determine what event/s in the light reactions they consider to be the done individually or in pairs.
most significant to humans.
2. Next, ask the learners to look for a partner and share their response.
3. Then, ask the pairs to share their responses to the whole class. Pair: Look for a partner and discuss
your answers.

Assess the learners’ understanding of the lesson by having them accomplish the diagram below. They need to fill in the empty shapes with the
names of the molecules involved in the processes. This activity may serve as a quiz.
Assign a homework to the class. Ask the learners to conduct a research and answer this question: What do you think is the importance of the
Cyclic Electron Flow to the process of photosynthesis and to the cell?

Content Standards
The learners demonstrate an understanding of photosynthesis. LESSON OUTLINE
Learning Competency Introduction Communicating learning competency 10
The learners describe the significant events of the Calvin Cycle and learning outcomes; Description of
(STEM_BIO11/12-IIa-j5) the stages of the Calvin Cycle
Motivation Familiarization with key words and 20

Specific Learning Outcomes researching for their meanings or
At the end of the lesson, the learners shall be able to: definitions
• describe the phases of the Calvin cycle Instruction/ Discussion on the three phases of Calvin 60
• identify the important molecules needed in the Calvin cycle Delivery cycle
• identify the molecules produced in the cycle
Practice Building of a three-dimensional model of 60
the Calvin Cycle
Enrichment Researching and reporting on the 60

photosynthetic adaptations of C3, C4,
and CAM plants
Evaluation Class quiz 30
Materials
• materials for making three-dimensional models of the
Calvin Cycle (e.g., clay, Styrofoam balls, beads, and art
materials)
Resources
(1) Reece JB, U. L. (2010). Campbell Biology 10th. San Francisco(CA):
Pearson Benjamin Cummings.
(2) Starr, C. (2003). Biology: Concepts and Applications 5th edition.
Belmont, California: Brooks/Cole-Tomson Learning.
128
1. Present the learning competency and learning outcomes for this lesson. Let the learners provide the overview or
description of the Calvin cycle.
2. Describe the significant events of the Calvin cycle.
You may refer to the equation of
3. Review the basic features of the Calvin cycle. photosynthesis in introducing the topic.
The Calvin Cycle

• also referred to as light-independent reactions or “dark reactions”
• takes place in the stroma of the chloroplast
• second stage of photosynthesis that is involved in the formation of sugar from CO2 using chemical
energy stored in ATP and NADPH, the products of light reactions

1. Write the following terms on the board: CO2 
• RuBP • ATP
• Rubisco • NADPH
• 3-phosphoglycerate (PGA) • G3P 
• 1,3-biphosphoglycerate
2. Explain to the learners that these terms are the key players in the Calvin cycle that they need to
familiarize themselves with.
3. Instruct the learners to research the meaning and description of the molecules involved in Calvin
cycle.
Give a lecture-discussion on Calvin cycle.
The Calvin Cycle

Important points to know:
• The sugar that is produced in the Calvin Cycle is not the six-carbon glucose that we are
familiar with. This is formed later on. What is produced in the Calvin Cycle is a three-carbon
sugar known as G3P or glyceraldehyde-3-phosphate.
• The Calvin Cycle needs to ‘spin’ three times to make one molecule of G3P from three
molecules of CO2. Teacher Tip:
You may also opt to have the learners make
a graphic organizer that shows the three
phases of the Calvin Cycle.
Three Phases of Calvin Cycle:
Carbon Fixation
• Carbon fixation is a process of incorporating an inorganic carbon molecule, CO2, into an
organic material.
• In this phase, the CO2 molecule is attached to a five-carbon sugar molecule named ribulose
biphosphate (RuBP) aided by an enzyme named rubisco or RuBP carboxylase. Rubisco is
believed to be the most abundant protein in the chloroplast and maybe on Earth.
• The resulting product, a six-carbon sugar, is extremely unstable and immediately splits in
half. The split forms two molecules of a 3-phosphoglycerate (3-carbon).
Reduction
• A phosphate group (from ATP) is then attached to each 3-phosphoglycerate by an enzyme,
forming 1,3-phosphoglycerate.
• NADPH swoops in and reduces 1,3-biphosphogycerate to G3P.
• For every six G3Ps produced by the Calvin Cycle, five are recycled to regenerate three
molecules of RuBP. Only one G3P leaves the cycle to be packaged for use by the cell.
• It will take two molecules of G3P to make one molecule of glucose.
• The ADP and NADP+ that is formed during the Calvin Cycle will be transported back to the
thylakoid membrane and will enter the light reactions. Here, they will be ‘recharged’ with
energy and become ATP and NADPH.
130
Regeneration of RuBP
• Five molecules of G3P undergo a series of complex enzymatic reactions to form three molecules of RuBP. This costs the cell another
three molecules of AT, but also provides another set of RuBP to continue the cycle.
What happens to G3P after its release from the cycle?

• Two G3Ps can combine together to form either glucose or fructose which are both are six-carbon sugar.
• Glucose and fructose can be combined to form sucrose.
• Glucose can be connected in chains to form starch.
• G3Ps can also be used in lipid and protein synthesis.
The cost of making carbohydrate:

To make one molecule of G3P, the chloroplast needs:
• 3 molecules of CO2
• 9 molecules of ATP
• 6 molecules of NADPH
PRACTICE (60 MINS)

Divide the learners into five or six groups. Orient the class on the nature of the activity, as described below:
Calvin Cycle 3-D Model Building

For this activity, each group has to gather materials that will help them build a three-dimensional model that represents the events or phases of
the Calvin Cycle. You may use clay, Styrofoam balls, beads, or recyclable materials. The outputs will be presented in class.
• Ask the learners to work in groups for this activity.
• Instruct them to research on photosynthetic adaptations of plants found in desert environments.
• Assign the following topics for their research outputs: C3 plants, C4 plants, and CAM plants.
• The groups may choose any method of presenting their outputs. They can opt for oral
presentations, role-playing, poem or song making, or using visual arts and media.

• Temperature and light intensity are two of the factors that may affect the rate of photosynthesis.
Explain how the said factors affect photosynthesis. Which of the two would you expect to have
more effect on the rate at which the Calvin Cycle proceeds? Why?
• Many urban areas in our country are becoming less eco-friendly in exchange for new buildings and
commercialization. What do you think is the implication of this in relation to photosynthesis?
• With your knowledge on photosynthesis, correlate the process in helping curb the effects of climate
change.
132
Energy Transformation - Cellular

Respiration (Part 1 of 3) LESSON OUTLINE
Content Standard Introduction As part of understanding by design, engage 5
The learners demonstrate an understanding of cellular respiration. the students in learning exploring and
firming up.
The learners: Motivation To extend and refine your students’ 10
understanding on energy transformation,
• Differentiate aerobic from anaerobic respiration (STEM_BIO11/12-IIa-j-6) you may ask them regarding the function
• Describe the role of oxygen in cellular respiration and describe pathways of and structure of the mitochondrion
electron flow in the absence of oxygen (STEM_BIO11/12-IIa-j-10)
Instruction/ A series of activities with directions are 15
Delivery indicated below.
Practice Post guide questions 240
At the end of this lesson, the students must be able to;
1. determine the functional definition of cellular respiration;
2. compare fermentation with anaerobic and aerobic respiration; Enrichment Answer the modified true or false, make a 60
3. explain how cells can produce ATP in the presence or absence of oxygen; graphic organizer on aerobic and aerobic
4. identify the metabolic pathways where aerobic respiration specifically respiration and accomplish the Venn diagram
occurs; and Evaluation Answer the multiple-choice questions and a 30
5. explain how the lack of oxygen in the body results in eventual death of an diagram that shows a comparison among
organism. fermentation, aerobic and anaerobic
respiration
Resources
• Enger, Eldon D. et. al., (2012). Concepts in Biology 14th Edition. USA:
McGraw-Hill
• Mader, Sylvia S. (2010). Biology 10th Edition. USA: McGraw-Hill
• Reece, Jane B. et al., (2011). Campbell Biology 9th Edition. San
Francisco USA: Pearson Education, Inc.
• Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson
Brooks/Cole
As part of learning exploration, let your students define cellular respiration. You may also ask students to describe process happening when
they respire using their respiratory system then connect this process of respiration to what is happening inside the cell (cellular respiration).
Cellular respiration by technical definition includes both aerobic and anaerobic respiration processes. But today cellular respiration is often used
to refer to aerobic processes.

To help your students analyze and identify attributes and components of the mitochondrion, ask them the following questions:
1. What are the major parts of the mitochondrion?
2. What is the function of each part?
3. What would happen if each part were missing?
4. What is your conclusion?
Give examples of answers from students and what conclusion you expect to give a good motivation to students

Procedure
1. Determine and list the molecules that enter and the molecules that leave the metabolic pathways of aerobic cellular respiration.
2. The pictures below can be redrawn or printed so that the students can visualize the metabolic pathways of the glucose molecule.
3. Post the redrawn visual learning materials on the board. Tell the students to work this out individually.
Metabolic Pathways Reactants and Products
Glycosis Molecules that enter:
Molecules that leave:
Krebs cycle Molecules that enter:
Molecules that leave:
Electron Transport Molecules that enter:

Chain Molecules that leave:
Provide expected answers to the table
134
Teacher tip
Teacher Tip:
To fill-out the table above, you may opt to

give hint to your students:
Glycolysis: three molecules

Krebs cycle: three molecules those that
enter and four those that leave
ETC: three molecules
ergy forms exists and transformed.
Courtesy: Enger, Eldon D. et. al., (2012). Concepts in Biology 14th Edition. USA: McGraw-Hill
(Retrieved August 13, 2015.)
PROCEDURE
1. To extend and refine your students’ knowledge on cellular respiration, tell them to do the sample
graphic organizer below.
2. Fill-out the table and distinguish how the two types of respiration are alike and different. Then tell
them to write their conclusion based on the similarities and differences they have listed.
3. You may form three groups for this activity. Each group has to present the output(s) to the class
using any kind of visual learning materials. 
Comparing Graphic Organizer
AEROBIC RESPIRATION ANAEROBIC RESPIRATION
How alike?
How different?
Summary and Conclusion
136
How alike?
Both undergo glycolysis in the cytoplasm of the cell
Both undergo substrate-level phosphorylation and oxidative phosphorylation and chemiosmosis in producing ATP molecules
Both split the 6-carbon glucose into two molecules of pyruvate, the three-carbon molecule
Both involve a series of enzyme-controlled reactions that take place in the cytoplasm
Both use NAD+ (nicotinamide adenine dinucleotide), a redox coenzyme that accepts two electrons plus a hydrogen (H+) that becomes NADH
Both performed by eukaryotic and prokaryotic cells
How different?
Maximum yield of 36 to 38 ATP molecules per glucose Maximum yield of 2 ATP molecules per glucose for obligate anaerobes
Complete breakdown of glucose to carbon dioxide and water with the use of Partial degradation of glucose without the use of oxygen (obligate
oxygen anaerobes)
Multiple metabolic pathways Single metabolic pathway (in fermentation)
Pyruvate proceeds to acetyl formation in the mitochondrion Pyruvate is broken down to ethanol and carbon dioxide or lactate (in
fermentation)
The presence of enough oxygen in the cell makes the cell perform its job Cause burning sensation in the muscle during strenuous exercise
smoothly without burning sensation (in fermentation)
More efficient in harvesting energy from glucose with estimated 39% energy Less efficient in harvesting energy from glucose with 2% energy efficiency
efficiency (36-38 ATP) in eukaryotic organisms but much higher ATP (for obligate anaerobes)
production (38 to 40 ATP) in prokaryotic organisms
Outputs are carbon dioxide, water and ATP Outputs are lactate, alcohol and carbon dioxide (in fermentation); but
reduced inorganic compound in anaerobic respiration
Products produce are for biochemical cycling and for the cellular processes Produce numerous products with economic and industrial importance
that require energy through fermentation
Slow glucose breakdown Rapid breakdown of glucose
Electrons in NADH are transferred to electron transport chain Electrons in NADH are transferred to electron transport chain; but in
fermentation electrons in NADH are transferred to organic molecule
Mechanism of ATP synthesis is by substrate-level and oxidative Mechanism of ATP synthesis is by substrate-level and oxidative
phosphorylation/chemiosmosis phosphorylation/chemiosmosis; but in fermentation substrate-level
phosphorylation only during glycolysis
O2 is the final electron acceptor of the electron transport system In anaerobic respiration, inorganic substances like NO3- or SO42- are
the final acceptor of the electron transport system; but in
fermentation, there is no electron acceptor because it has no
electron transport system.
Brain cells in the human body can only live aerobically. They die if Some organisms like yeasts (eukaryotic), many bacteria (prokaryotic)
molecular oxygen is absent. and the human muscle cells (eukaryotic) can make enough ATP to
survive in facultative anaerobes (can live in the absence or presence
of oxygen). But under anaerobic conditions lactic acid fermentation
occurs. A facultative anaerobe needs to consume the nutrient at a
much faster rate when doing the fermentation or anaerobic process.
Summary and/or Conclusion
Aerobic respiration requires molecular oxygen to happen in the cells of most eukaryotes and prokaryotes. Here, nutrients are split into a series
of enzyme-controlled reactions producing an estimated 36 to 38 ATP per glucose complete breakdown. Molecular oxygen is the final
acceptor of the low-energy level electron at the end of the electron transport system that results in the production of water. In anaerobic
respiration on the other hand does not require oxygen in splitting nutrients. Some prokaryotes that live in oxygen-free environments such as
water logged soil, in ponds where water does not flow, and in the intestines of animals transfer glucose to NADH and then pass the electrons
down the electron transport chain that is joined to ATP synthesis by chemiosmosis. Nitrate and sulfate are the final acceptors of electrons. The
end products are carbon dioxide, reduced inorganic substances and ATP. In fermentation (as type of anaerobic respiration) there is no
electron acceptor because it has no electron transport chain. Its products are either alcohol (and carbon dioxide) or lactate.
Note: Clarify how many minutes should be allotted for this activity
ETC: A Metaphor
PROCEDURE
1. To describe how the electron transport system performs its function along the cristae (folds) of the mitochondrion, the students will prepare
the following materials: coloring materials, Manila paper(s), color papers, markers, pencil, and ruler.
2. The learners will make an analogy or a metaphor on how the electrons are being passed on to electron transport chain that result in the
release of water.
3. In their drawing, they have to illustrate the participation of NADH, FADH2, hydrogen proton ion, electrons and oxygen along the electron
transport system. Review your students that the simultaneous cooperation of these carrier molecules and hydrogen atoms are being used to
run ATP production by chemiosmosis. They have to show that ATP and water are two of the products of ETC.  
138
4. To facilitate their understanding, you can give them metaphoric examples such as bucket relay for ETC and a stair. A sample illustration is
given below for your reference.
5. Form four groups for this activity. You may form rubric for this part focusing on appropriateness of illustration with all key ideas and elements
are put together correctly.
Stair image courtesy of: Mader, Sylvia S. (2013). Biology 10th Edition. USA: McGraw-Hill (Retrieved August 15, 2015.)
Directions: The pictures below describe the pathways of electron in the absence of oxygen. Analyze it by arranging the seven metabolic
pathways from numbers 1 to 7 provided for you in the opposite table. The same procedure is followed in another table for fermentation with
numbers 1 to 6.
Images courtesy of: Mader, Sylvia S. (2013). Biology 11th Edition. USA: McGraw-Hill (Retrieved August 17, 2015.)
140
Metabolic Pathways Outside the Mitochondria: Glycolysis Metabolic Pathways Outside the Mitochondria: Glycolysis
(Note: This is not sequenced.) (Note: Arrange the pathways in order from 1 to 7.)
1 Water is released as 3PG is oxidized. 1
2 G3P is oxidized as NAD receives high energy-electrons

+
2
coming from the hydrogen atoms of C6H12O6.
3 Substrate-level ATP synthesis occurs. 3
4 Two Pyruvate molecules (3-carbon) are produced as the 4

end products of glycolysis.
5 Splitting of the 6-carbon sugar produces 3-carbon 5
molecules.
6 Substrate-level ATP synthesis occurs (also called as 6
substrate-level phosphorylation).
7 Two ATP molecules are used to start glycolysis. 7
Metabolic Pathways Outside the mitochondria: Metabolic Pathways Outside the Mitochondria:
Fermentation (Note: This is not sequenced.) Fermentation (Note: Arrange the pathways in order from
1 to 6.)
G3P is oxidized as NAD+ receives high energy-electrons
coming from the hydrogen atoms of C6H12O6.
NAD+ is “freed” to return to the glycolytic pathway to
pick up more electrons.
Two ATP molecules are used to start glycolysis.
Two molecules of pyruvate are converted to ethanol (with

CO2 as by-product) and lactate.
Splitting of BPG into two molecules of pyruvate is couple
to substrate-level ATP synthesis.
Splitting of the 6-carbon sugar produces 3-carbon
molecules.
PRACTICE (240 MINS)
1. Explain how NAD+, pyruvate, oxygen and ATP are involved in aerobic cellular respiration.
2. What is the role of oxygen in cellular respiration.
3. What are the members of the chain in the electron transport system?
4. What do the cristae (or folds) in the mitochondrion contain?
5. What happens to the hydrogen ions (H+) carried by NADH and FADH2?
6. Contrast the energy-investment step with the energy-payoff step of glycolysis.
7. How is aerobic cellular respiration different between prokaryotic and eukaryotic organisms?
8. What happens during electron transport and what it has to do with a proton pump?
9. Using arrows show in simple diagram the metabolic for glycolysis.
10. Explain how ATP can continue to be produced in the absence of oxygen.
Suggested Answers:
1. NAD+ accepts electrons and delivers them to the ETS. Pyruvate is the product of glycolysis. It is converted to acetyl-CoA and transferred to
the Krebs cycle. Oxygen is the final electron acceptor of the ETS and combines with hydrogen to form water. ATP is used in glycolysis to get
the process going but ultimately it is the most valuable molecule produced by aerobic respiration. All parts of aerobic respiration result in a
net yield of ATP.
2. Oxygen molecule is the final acceptor of electrons from ETC. It receives the low energy electron from the last of the carriers (that is,
cytochrome oxidase). After receiving electrons, the oxygen molecule combines with hydrogen ions, and water is formed.
3. The members of the chain in sequence are the following: NADH-Q reductase, coenzyme Q, cytochrome reductase, cytochrome c,
cytochrome oxidase. These are the members of the chain which accept high-energy level electrons which they pass from one molecule to
another.
4. The cristae contain the chain members (carrier molecules and protein complexes, ATP synthase complex and ATP channel protein (bulk of
ATP is produced by chemiosmosis).
5. The complexes of the ETC use the released energy to pump these hydrogen ions from the matrix into the intermembrane space of
mitochondria.
6. If you want to earn, you really need to invest, and therefore you need a capital of some amount. During the energy-investment step, 2 ATPs
are used to split glucose into 2 pyruvate molecules. The split of glucose produces a gross of 4 ATPs and 2 NADH. 4 ATP- 2 ATP = 2 ATP net
in the glycolysis.
7. Prokaryotic organisms do not have mitochondria. These organisms use a slightly different way to perform the Krebs cycle and ETC that
results in slightly more ATP than is produced by eukaryotic organisms. 
142
8. The electron transport chain consists of a series of molecules which accept electrons and transfer them from one molecule to another. As
electron is passed on along the series, energy is released to run ATP production. As this happens, protons are pumped from one location to
another in the mitochondrion. Protons begin to build up in their new location. This creates a chemical gradient producing a bulk of ATP by
chemiosmosis. These ATP molecules can be used by the cell to do work.
9. Glucose G3P BPG 3PG PEP pyruvate
10. ATP can still be produced without oxygen. This can be done through anaerobic fermentation. A net of 2 ATP molecules are produced
during glycolysis. Glucose proceeds through the glycolysis pathway, producing pyruvate. This process “frees” NAD+ and it returns to the
glycolytic pathway to up more electrons to become NADH again.

Directions: This is a modified true or false activity. Write the word TRUE if the underlined word/phrase being referred to is correct. If it is false,
change the word/phrase to make the whole statement correct based on the concept of cellular respiration. Write your answer on the space
provided before each number.
_________1. Fermentation and anaerobic respiration enable the cells to produce ATP without the use of oxygen.
_________2. The term cellular respiration includes both aerobic and anaerobic processes.
_________3. Fermentation is a complete degradation of sugars or other fuel that occurs without the use of
oxygen.
_________4. An electron transport system consists of a number of molecules, majority are proteins, located in the
matrix of the mitochondria of eukaryotic cells and the plasma membrane of aerobic prokaryotes.
_________5. Pyruvate oxidation and the citric acid cycle, oxidative phosphorylation: electron transport chain and
chemiosmosis are the metabolic stages reserved for cellular respiration.
_________6. The breakdown of glucose to carbon dioxide is completed in the electron transport chain.
_________7. ATP synthase is the enzyme that makes the bulk of the ATP from ADP and Pi by chemiosmosis
_________8. ATP synthase uses the energy of an existing hydrogen ion gradient to power ATP synthesis.
_________9. Phosphorylation of ADP to form ATP stores at least 14.6 kcal per molecule of ATP.
________10. Citric acid cycle generates 2 ATP whether oxygen is present or not, whether the conditions are
aerobic or anaerobic.
Suggested Answers:
1) True 2) True 3) Partial or incomplete 4) Cristae or folds 5) True 6) Krebs cycle 7) True 8) True 9) 7.3 kcal 10) glycolysis
Directions: Accomplish the table below by comparing aerobic and anaerobic respiration
Factors Aerobic Respiration Anaerobic Respiration
Main function
Site of Reaction
Production of ATP
Sustainability
Production of lactic acid
Oxygen requirement
Recycling of NADH
Participating cells
Suggested Answers:
Factors Aerobic Respiration Anaerobic Respiration
Main function Production of ATP from food such as Production of ATP without the use of oxygen
carbohydrate, lipid and protein
Site of Reaction Cytoplasm and mitochondrion Cytoplasm
Production of ATP 36 to 38 ATP per glucose molecule 2 ATP per glucose molecule
Sustainability Long-term Short-term
Production of lactic acid Does not produce Produces
Oxygen requirement Yes No
Recycling of NADH Through the electron transport system In lactic acid fermentation (i.e., muscle cells;
in alcohol fermentation (pyruvate is
converted to carbon dioxide and ethanol)
Participating cells Most cells Yeast, other fungi, prokaryotes, muscle cells
144
Directions: Compare aerobic and anaerobic respiration by accomplishing the Venn diagram below.
Venn Diagram of Aerobic and Anaerobic Respiration

 
Directions: Compare fermentation with anaerobic and aerobic respiration by analyzing the diagram below.
Diagram courtesy of: Enger, Eldon D. et. al., (2012). Concepts in Biology 14th Edition. USA: McGraw-Hill (Retrieved August 13, 2015)
1. What are the three kinds of enzyme-controlled reactions so that the chemical-bond energy from a certain nutrient is released to the cell in
the form of ATP?
2. What are the hydrogen electron acceptors for aerobic and anaerobic respiration as well as in fermentation?
3. These are the by-products of aerobic respiration that are considered low-energy molecules.
4. What are the outputs produced by anaerobic respiration? What about in fermentation?
5. What are two general metabolic mechanisms by which certain cells can oxidize organic fuel and generate ATP without the use of oxygen?
146
Suggested Answers:
1. Aerobic respiration, anaerobic respiration, and fermentation
2. aerobic respiration — molecular oxygen, anaerobic respiration — nitrate or sulfate, fermentation – pyruvate
3. Water and carbon dioxide
4. Anaerobic respiration—ATP, water reduced acceptor (nitrate or sulfate), fermentation, ATP, carbon dioxide, alcohol or lactate
5. Anaerobic respiration and fermentation
Directions: This is a multiple-choice task. Encircle the letter of the correct answer.
1. Majority of the CO2 is released during

a. Glycolysis
b. Citric acid cycle
c. Electron transport chain
d. Oxidative phosphorylation
2. Cellular respiration processes that do not use O2 are called

a. heterotrophic organism.
b. anaerobic organism.
c. aerobic organism.
d. anabolic
3. The positively charged hydrogen ions that are released from the glucose during cellular respiration eventually
combine with _________ ion to form ______
a. another hydrogen, a gas
b. a carbon, carbon dioxide
c. an oxygen, water
d. a pyruvic acid, lactic acid
4. The Krebs cycle (also known as citric acid cycle or tricarboxylic acid) and ETC are biochemical pathways
performed in which eukaryotic organelle?
a. nucleus
b. ribosome
c. chloroplast
d. mitochondrion
5. Anaerobic pathways that oxidize glucose to generate ATP energy by using an organic molecule as the ultimate
hydrogen acceptor are called
a. fermentation.
b. reduction.
c. Krebs cycle.
d. Electron pumps
6. When skeletal muscle cells function anaerobically, they accumulate the compound________, which causes
muscle soreness.
a. pyruvic acid
b. malic acid
c. carbon dioxide
d. lactic acid
7. Each molecule of fat can release ______ of ATP, compared with a molecule of glucose.
a. smaller amounts
b. the same amount
c. larger amount
d. only twice the amount.
148
8. In complete accounting of all ATPs produced in aerobic respiration, there a total of ________ATPs: ______
from the ETC, _____ from glycolysis, and _______ from the Krebs cycle.
a. 36, 32, 2, 2
b. 38, 34, 2, 2
c. 36, 30, 2, 4
d. 38, 30, 4, 4
9. The chemical activities that remove electrons from glucose result in the glucose being
a. reduced.
b. oxidized.
c. phosphorylated.
d. hydrolyzed.
10. Which of the following is NOT true of the citric acid cycle? The citric acid cycle
a. includes the preparatory reaction
b. produces ATP by substrate-level ATP synthesis
c. occurs in the mitochondria
d. is a metabolic pathway, as is glycolysis
Suggested Answers:
1. b 2.b 3.c 4.d 5.a 6.d 7.c 8.a 9.b 10. a

Energy Transformation - LESSON OUTLINE
Cellular Respiration (Part 2 Introduction Communicate to the class the learning

competencies. Review the reactants and
5
of 3) Motivation
products of cellular respiration
Show a picture of students eating at the 15

Content Standard school canteen, then show questions
The learners demonstrate an understanding of cellular respiration.
Instruction/ A 3-D model of a mitochondrion made 250
Learning Competencies Delivery from re-usable materials
The learners:
Enrichment Do the jigsaw activity and people 90
• Explain the features and sequence the chemical events of cellular
hunting and applying knowledge of
respiration (STEM_Bio11/12-IIa-j-7)
biochemical pathways
• Distinguish major features of glycolysis, Krebs cycle, electron transport
system, and chemiosmosis (STEM_Bio11/12-IIa-j-8) Evaluation Fill-in the necessary information for 60
cellular respiration and the 3-2-1 Closing
Specific Learning Outcomes Resources

At the end of this lesson, the students must be able to: • Mader, Sylvia S. (2010). Biology 10th Edition. USA: McGraw-Hill
• Reece, Jane B. et al., (2011). Campbell Biology 9th Edition. San
1. Identify the major stages of cellular respiration; Francisco USA: Pearson Education, Inc.
2. Identify the organelles involved for each stage of cellular respiration. • Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson
3. Describe the following for each stage of cellular respiration: process, Brooks/Cole
starting materials, and end products of aerobic respiration. Suggested Media Tools:
• www.mhhe.com/maderbiology11
• www.masteringbiology.com
• www.biologycorner.com
For animations, video, learning outcomes, chapter outline, image
PowerPoint, essay quiz, thinking critically, practice test and concept maps
http://highered.mheducation.com/sites/0073403466/student_view0/
chapter7/image_powerpoint.html
http://highered.mheducation.com/sites/0073525502/student_view0/
chapter7/index.html
150
Communicate to the class the learning competencies. Then go over the reactants and products of Emphasize that both prokaryotic and
cellular respiration. eukaryotic organisms need food in order to
get the energy needed to adapt to many
things in the environment and to perform
bodily processes such as growth, repair,
reproduction, maintenance of homeostasis,
You may ask them the following questions: etc.
1. How many molecules of ADP as reactant are needed to produce about 38 molecules of ATP for
eukaryotic organisms?
2. Which groups in the cellular respiration equation go in?
3. Which groups are released?
Suggested Answers:
1. About 36 to 38 ADP molecules (NOTE: This number is just a ratio. Some biology authors say there
are 30, 32 or 34 ADP (or ATP) molecules depending on the shuttle used to transport the electrons
and on the kind of species.)
2. Groups that go in: carbohydrate and molecular oxygen
3. Groups that are released: carbon dioxide, water and energy (ATP)
NOTE: Cellular respiration is one of the more difficult topics in biology. To capture the general picture
of the topic, students have to be encouraged to read and re-read the key concept, write and re-write,
outline and re-outline, draw and re-draw, and to recite orally if they want the ideas to sink in their
system. Patience and steadfastness are important virtues that should be included as you study this
concept.
MOTIVATION (15 MINS) Suggested Answers:

1. No
Post a color picture of a group of students eating at the school canteen. To establish healthy academic
2. Encash the 1000-peso cheque first at the
atmosphere and camaraderie, ask them if they know one who is a friend of them. Then ask the bank.
following questions: 3. Convert the US dollar bill to Philippine
Peso and encash the 1000-peso bill cheque
at the bank.
1. If one of the students who ate would pay to the cashier a bill in US dollar, would the cashier accept 4. ATP or Adenosine Triphosphate, a form
the money as a form of payment for the food ordered?  of nucleic acid
2. If one of the students ate combo meal and the amount of the food eaten is P49.00 and he gave out
5. The complex food molecules are broken
1000-peso money cheque to the cashier, what do you think the cashier would ask to the student? down by digestion into simpler substances
(Assuming that the student is the first customer of the day). that are absorbed by the body through the
3. What should the students do (one with a US dollar bill and one with a 1000-peso money cheque) to bloodstream. These food molecules will
then be transported to all their cells.
make their money more functional?
Breaking down of food is a catabolic
4. Just like the US dollar bill and the 1000-peso money cheque, the glucose (carbohydrate) in the food process that converts the energy in the
that we eat is a principal high-energy molecule that has to be digested into smaller molecules in chemical bonds of nutrients to chemical
order to release the high energy molecule that is highly recognized by the cell. What do you call energy stored in ATP that occur inside the
cells of these students. This process in
this molecule that serves as the “energy currency of the cell”?
known as cellular respiration.
5. After this group of students ate the food at their school canteen, how do they obtain energy from
these food (protein, carbohydrate, fat) molecules? NOTE: The US dollar currency is not directly
used in everyday transaction. It has to be
converted into usable form such as the
Process the answers of the students related to the US dollar bill. Give the relationship of this analogy
Philippine money.
to the current topic.
Cellular respiration is different from
organismic respiration. The latter refers to
INSTRUCTION/DELIVERY (250 MINS) the exchange of gases such as oxygen and
Activity 1: 3-D Mitochondrion Model carbon dioxide with the environment by
living organisms, particularly animals with
1. Let your class form triad. Give a model color picture of a mitochondrion that will serve as their
special organs such as lungs and gills, for
guide for the 3-D mitochondrion. Print color pictures of a mitochondrion and give one to each gas exchange.)
group.
2. To make a 3-D model of a mitochondrion, prepare the following materials: Old newspapers, metal
Teacher Tip
wires, starch (serves as paste), vinegar, acrylic paint, and paintbrush. Inform the groups of students one week
3. The sizes of the 3-D model mitochondrion are: Length — 24 inches, width — 14 inches, height — 8 prior to this topic to give way to the
inches. preparation and designing of a 3-D model
of a mitochondrion. You may form three
4. From the metal wire, mold a mitochondrion based on the sizes given. The cristae of the
groups. Give each group a model color
mitochondrion can be formed through the metal wire. picture of a mitochondrion that will serve as
5. Prepare a mixture for the starch (this will serve as your paste) as follows: 2 cups water, 2 cups starch, their template for the 3-D.
1 cup vinegar. Mix the materials together under normal fire for 3-5 minutes.
6. With the old newspapers collected from the students’ neighbors, tell your students to wet the
newspapers with paste and glue them on to the metal wire.
7. Let the model dry up before they paint the 3-D model mitochondrionProvide expected answers to
the table
152
Activity 2: Drawing, Coloring and Labeling
Teacher tip
1. Inform your students to bring the following materials: Oslo paper (or long bond paper), coloring
̌For the drawing, coloring and labeling of
materials, pencil and a ballpen. the parts of a mitochondrion, you may print
2. Let them draw and color, and label the model picture of a mitochondrion below. the picture in color and post it on the board
3. The rubric for the drawing and coloring is given to help in the objective scoring of the output for everyone to see.
coming from your students.

4. The students will proceed to labeling. There are 10 blanks to be filled-in.
5. Then proceed to discussion by giving them processing questions.
Rubrics for Drawing and Coloring

Contrast and intensity Shows exceptional artistic Shows generally acceptable Shows generally vague
of drawing and skillful color contrast; artistic and skillful color color contrasts; and
and meaningful color contrasts; and meaningful indiscernible sense of
concentration color concentration color concentration
Blending of colors Color mix is exceptionally Color mix is generally Color mix needs
creative, appropriate and creative, appropriate and improvement
meaningful meaningful
Neatness Completely free from Almost free from mess Too messy
mess
Model Picture of a Mitochondrion
Courtesy: Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson Brooks/Cole
(Retrieved July 20, 2015)
Activity 3: Sequencing Cellular Respiration

Teacher tip
Procedure: Insight:
1. Group the class into three. Fill-in the missing information to make the graphic organizer complete.
The reason why we humans breathe is to
Few examples are given. get the oxygen into our cells. Recall that at
2. Report the output to the class. You will be graded according to the following rubric. the end of the electron transport chain,
  hydrogen ions are being welcomed by the
NOTE: Students might find this difficult to accomplish. To facilitate better understanding for this   oxygen molecules to produce a by-product
called water.
154
activity, tell them to research on the major events of cellular respiration (e.g. how glucose gets into the cell and how it becomes converted into
ATP). Your students should be able to see the major events (though the events are happening simultaneously). You may also prepare a set of
reading materials (including diagrams and/or pictures) given to each group and let every member of the group analyze the text and be able to
sequence and narrate the major events of cellular respiration.
Suggested Rubrics
Content knowledge Information is complete Information is mostly Information is mostly

and accurate complete and accurate incomplete and
inaccurate
Originality in Exceptionally well Generally well-organized Fairly understandable
organization of ideas organized and and understandable
understandable
STAGE 1: Glycolysis
This is what happens:
During this stage, glucose (the six-carbon molecule) is split into two
molecules of pyruvate (which contains three carbons). A net of two ATP
molecules is produced by substrate-level phosphorylation during glycolysis.
In addition, there are four hydrogen atoms are removed and are used to
produce two NADH (an electron-carrier molecule that enters mitochondrion
Note: You can say more at this stage.
Courtesy: Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson Brooks/Cole (Retrieved August 2, 2015) 
STAGE 2: ____________________
STAGE 3: ____________________
156
STAGE 4: ______________________
Activity 4: Watch Summary Video for Aerobic Respiration (If materials are available)
Cellular Respiration Video\www.youtube.comwatchv=00jbG_cfGuQ.mp4 (Retrieved August 3, 2015)
Cellular Respiration Video\www.youtube.comwatchv=-Gb2EzF_XqA.mp4 (Retrieved August 3, 2015)
Directions: With the help of your instructional materials (e.g. in tarpaulin form, PowerPoint Presentation or even simple pictures that are visually
attractive and accurate) ask the following processing questions. Allow the pictures and the boardwalk to speak to your students.
Processing Questions:
1. How many metabolic pathways are present in aerobic respiration?
2. Where in the cell part does glycolysis take place? What about the formation of Acetyl CoA, Krebs cycle and the electron transport chain and
chemiosmosis?
3. How many reduced NADH molecules are produced after the glucose has been completely broken down to ATP? And what stage of the
aerobic respiration is glucose completely broken down to carbon dioxide?
4. As glucose is split in the cytosol of the cell, is there a release of carbon dioxide as by-product of the reaction?
5. What molecule accepts the hydrogen atoms at the end of electron transport chain?
6. What is the major goal of NADH and FADH2 in aerobic respiration?
7. Why do you think the cell needs to digest glucose or any other nutrients such as protein and fats?
8. Among the metabolic pathways of cellular respiration, which phase is the major contributor of ATP?
9. What happens to pyruvate if oxygen is not available in the cell?
10. How many acetyl-CoAs are produced from each glucose molecule?
Suggested Answers:
1. Three metabolic pathways
2. Glycolysis takes place in the cytoplasm or cytosol; formation of acetyl CoA, Krebs cycle, ETC and chemiosmosis all take place in the
mitochondrion
3. 10 NADH molecules; glucose is completely broken down carbon dioxide at the Krebs cycle
4. No
5. Oxygen molecule
6. The goal of NADH and FADH2 is to transport the electrons coming from the hydrogen atoms (in glucose) to the electron transport chain
7. The cell has to digest glucose, fat, and protein in order to convert them into usable form of energy molecule called adenosine triphosphate.
This ATP is the only molecule that is recognized by the cell for all of its cellular activities.
8. Among the metabolic pathways in aerobic respiration, the electron transport chain (or oxidative phosphorylation) makes about 90 per cent
of ATP per glucose molecule.
9. The pyruvate will not proceed to the formation of acetyl CoA. The pyruvate will become lactic acid in animal and alcohol in plant.
10. Two
158
Directions: Read the procedures below on how the jigsaw and expert groups are formed. • Encourage each member to ask
PART I: Jigsaw Activity question(s) for clarifications.
• Provide cellular respiration handouts/
Procedure: diagrams for each group to discuss.
• For this part, provide a rubric for the
1. Form a group having four members. Each student-member in the group will be assigned to a
presentation that each group has to
certain phase of cellular respiration (1. glycolysis, 2. preparatory reaction, 3. citric acid cycle, make.
4.electron transport chain). Each group will be called “jigsaw group”. • Writing the definitions of the terms can
2. Each group will be given handouts (with texts and pictures/diagrams—samples of these pictures are help your students better understand
the concept.
shown below) with the help of its leader and distribute them to his/her group mates. The handouts • Glycolysis – means “sugar-
contain information about cellular respiration. Other helpful tools such as biology textbook, Internet splitting” that occurs in the
can be used to facilitate their learning of the topic. cytosol of the cell. It does not
require oxygen to breakdown
3. All the members in each group will be given enough time to read over their assigned topic for them glucose into pyruvate.
to become familiar with it. • Krebs cycle – completes the
4. From the “jigsaw group” previously formed, the so-called “expert group” will then be formed. metabolic breakdown of glucose
to carbon dioxide and produces
Those assigned in glycolysis from each group will be grouped as “expert group” in glycolysis. The 2 ATP.
same procedure will be done to preparatory reaction, citric acid cycle and electron transport chain • Oxidative phosphorylation – a
— “expert groups” will be formed from these remaining topics. process occurring in
mitochondria and accounts for
5. These “expert groups” will be given enough time to discuss the main points of their assigned topic majority of the ATP production.
and to rehearse for the presentation. • Electron Transport Chain –
6. After a certain amount of time, each student from the “expert group” will go back to his/her contains the chain members
(carrier and protein complexes,
“jigsaw group”. ATP synthase complex and ATP
7. Each member from the “jigsaw group” will this time begin to present his/her topic to the whole channel protein. These
class. membrane proteins shuttle
electrons during the redox
reactions. The electrons will be
used to produce ATP by
chemiosmosis.
• NADH and FADH2 – these are
electron acceptor molecules
that contain high-energy
electrons. They transport the
electrons to ETC to produce
many more ATPs by oxidative
phosphorylations.
• ATP synthase – is an enzyme
that is responsible for the great
production of ATPs. This
happens when it uses the
energy coming from H+ ions to
bind ADP and phosphate group
together to produce ATP.
Teacher Tip
The diagram on the left shows the total
energy produced from the complete
breakdown of glucose by aerobic
respiration.
Rubric for the Report
Content Information is Information is mostly Information is mostly

knowledge complete and accurate complete and incomplete and
accurate inaccurate
Originality in Exceptionally well Generally well- Fairly understandable
organization of organized and organized and
ideas understandable understandable
160
PART II
People Hunt
1. Prepare four sets of paper strips. Set A contains the four stages of cellular respiration. Set B contains the summary for each stage. Set C
contains starting materials for each stage. Set D contains end products for each stage.
2. Twelve students will be asked to volunteer. Randomly, each of these volunteers will be given strips of paper
(NOTE: tell them not to read yet the information written on the strip of paper).
3.Student-volunteers will be asked to scatter around the room. After this, instruct them that there are four stages of cellular respiration (please
refer back to the procedure number 1). The student-volunteers will be given time to find their group mates correctly for each specific stage
based on the paper strip(s) they are holding.
4. Tell each group for each stage to line up at the four corners of the room (north, south, east, west side of the room) and check if each
member has found their group mates correctly.
Summary of Cellular Respiration
Stage Summary Some Starting Materials Some End Products
1. Glycolysis (in cytosol) Series of reactions in which glucose is degraded to pyruvate; net Glucose, ATP, NAD+, Pi Pyruvate, ATP, NADH
profit of 2 ATPs; hydrogen atoms are transferred to carriers; can
proceed anaerobically
2. Formation of acetyl CoA Pyruvate is degraded and combined with coenzyme A to form Pyruvate, coenzyme A, Acetyl CoA, CO2,
(in mitochondria) acetyl CoA; hydrogen atoms are transferred to carriers; CO2 is NAD+ NADH
released
3. Citric acid cycle (in Series of reactions in which the acetyl portion of acetyl CoA is Acetyl CoA, H2O, NAD+, CO2, NADH, FADH2,
mitochondria) degraded to CO2; hydrogen atoms are transferred to carriers; ATP FAD, ADP, Pi ATP
is synthesized
4. Electron transport and Chain of several electron transport molecules; electrons are passed NADH, FADH2, O2, ADP, Pi ATP, H2O, NAD+, FAD
chemiosmosis (in along chain; released energy is used to form a proton gradient; ATP
mitochondria) is synthesized as protons diffuse down the gradient; oxygen is final
electron acceptor
Applying Knowledge of Biochemical Pathways
As scientists have developed a better understanding of the processes of aerobic cellular respiration and anaerobic cellular respiration, several
practical applications of this knowledge have developed:
• Although for centuries people have fermented beverages such as beer and wine, they have often plagued by sour products that were
undrinkable. Once people understood that there were yeasts that produce alcohol under anaerobic conditions and bacteria that converted
alcohol to acetic acid under aerobic conditions, it was a simple task to prevent acetic acid production by preventing oxygen from getting to
the fermenting mixture.
• When it was discovered that the bacterium that causes gas gangrene uses anaerobic respiration and is, in fact, poisoned by the presence of
oxygen, various oxygen therapies were developed to help cure patients with gangrene. Some persons with gangrene are placed in
hyperbaric chambers, with high oxygen levels under high pressure. In other patients, only the affected part of the body is enclosed. Under
such conditions, the gangrene-causing bacteria die or are inhibited.
• Spoilage, or putrefaction, is the anaerobic respiration of proteins with the release of nitrogen and sulfur-containing organic compounds as
products. Protein fermentation by the bacterium Clostridium produces foul-smelling chemicals such as putrescine, cadavarine, hydrogen
sulfide, and methyl mercaptan. Clostridium perfringens and C. sporogenes are the two anaerobic bacteria associated with the disease gas
gangrene. A gangrenous wound is a foul-smelling infection resulting from the fermentation activities of those two bacteria.
• Because many disease-causing organisms are prokaryotic and have somewhat different pathways and enzymes than do eukaryotic
organisms, it is possible to develop molecules, antibiotics that selectively interfere with the enzymes of prokaryotes without affecting
eukaryotes, such as us humans.
• When physicians recognized that the breakdown of fats releases ketone bodies, they were able to diagnose diseases such as diabetes and
anorexia more easily, because people with these illnesses have bad breath.
• In starvation and severe diabetes mellitus, the body does not metabolize sugars properly, and it shifts to using fats as its main source of
energy. When this occurs, the Krebs cycle is unable to perform as efficiently and the acetyl CoA does not move into the mitochondria. It
accumulates in the blood. To handle this problem, the liver converts acetyl CoA to ketone bodies (e.g., acetoacetic acid). As ketone bodies
accumulate in the blood, the pH decreases and the person experiences ketosis, or ketoacidosis, with symptoms such as an increased
breathing rate; in untreated cases, it can lead to depression of the central nervous system, coma, and death.
Adapted from: Enger, Eldon D. et al., Concepts in Biology 14th edition. USA: McGraw-Hill 
162
EVALUATION (60 MINS) Teacher tip
  Table 1 Suggested Answers:
Directions: Complete the tables below by filling-in the necessary information for aerobic respiration.
Glycolysis outputs:
• 2 pyruvate
Table 1: Inputs and Outputs of Glycosis • 2 NADH
• 2 ADP
• 4 ATP total
Glycosis • 2 ATP net gain
Inputs Outputs Table 2 Suggested Answers:
1. Glucose 1 Citric Acid Cycle inputs:

• 2 acetyl groups
2. 2 NAD+ 2 • 6 NAD+
• 2 FAD
3. 2 ATP 3 • 2 ADP + 2 P
4. 4 ADP + 4 P 4
Table 3 Suggested Answers:
Total: First Column

Glycolysis-ATP-SLP= 2 ATP net
Krebs-ATP-SLP= 2 ATP
Table 2: Inputs and Outputs of Citric Acid Cycle Total-ATP-SLP= 4 ATP
Citric Acid Cycle

Second Column
Inputs Outputs Glycolysis-HEA= 2 NADH
Prep-HEA= 2 NADH
1 1. 4 CO2 Krebs-HEA= 6 NADH and 2 FADH2
2 2. 6 NADH Third Column

Glycolysis-ATP-OP= 4-6 ATP
3 3. 2 FADH2 Prep-OP= 6 ATP
Krebs-ATP-OP= 18 ATP and 4 ATP
4 4. 2 ATP
Table 3: ATP Harvest from Aerobic Respiration
Teacher tip
Total-ATP-OP=32-34
Phases in ATP produced by High-energy ATP produced Fourth Column

Aerobic Substrate-Level Electron by Oxidative Sub-total Glycolysis-S= 6-8 ATP
Respiration Phosphorylation Acceptors Phosphorylation Prep-S= 6 ATP
Krebs-S= 24 ATP
Glycolysis
Total-S= 36-38 ATP
Preparatory --
Reaction Table 4 Suggested Answers:
Krebs cycle
Starting materials
Total -- G: Glucose, ATP, NAD+, ADP, P
F: Pyruvate, CoA, NAD+
Table 4: Starting Materials and End Products of Aerobic Respiration K: Acetyl CoA, H2O, NAD+, FAD, ADP, P
E: NADH, FADH2, O2, ADP, P
Stage Starting Materials End Products End Products

G: Pyruvate, ATP, NADH
Glycolysis (in cytosol)
F: Acetyl CoA, CO2, NADH
Formation of Acetyl CoA (in -- K: CO2, NADH, FADH2, ATP
E: ATP, H2O, NAD+, FAD
mitochondria)
Krebs cycle (in mitochondria)
Electron Transport Chain and --

Chemiosmosis (in mitochondria
Directions: As part of performance assessment, let the students do the 3-2-1 Closing. On their ½
crosswise
paper, they write
3 things/concepts/key ideas they have learned in the lesson(s);

2 things/concepts/key ideas they have questions about the lesson(s); and
1 thing/concept/key idea they want the teacher to know about in connection to the lesson(s) discussed.
164
Energy Transformation - LESSON OUTLINE
Cellular Respiration (Part 3 Introduction Discuss the nature of science with regard
to cellular respiration. Raise several
15
of 3) Motivation
questions for the students to think about
Show a diagram of metabolic pool 5
Content Standard concept and ask few questions
The learners demonstrate an understanding of cellular respiration.
Instruction/ Let the students do activities on 15
Performance Standard Delivery advantages and disadvantages of
The leaners prepare simple fermentation setups using common fruits to aerobic and anaerobic respiration and
produce wine or vinegar via microorganisms fermentation together with their
Learning Competency similarities and differences; prepare
The learners: homemade virgin coconut oil and
fermentation
• 1. Explain the advantages and disadvantages of fermentation and aerobic
respiration (STEM_Bio11/12-IIa-j-12) Practice Answer the guide questions 160
Enrichment Prepare materials for vinegar making 5
Evaluation Compare and explain aerobic 40
At the end of this lesson, the students must be able to:
respiration, anaerobic respiration and
1. Tabulate and explain the advantages and disadvantages of fermentation, fermentation, their advantage and
anaerobic respiration and aerobic respiration; disadvantage
2. Show the similarities and differences of fermentation, anaerobic respiration
and aerobic respiration; Resources
• Alumaga, Maria Jessica B. et al., (2014). Science and Technology 9.
3. Compare the pathways of carbohydrate, fat, and protein catabolism.
Quezon City: Vibal Publishing House
• Bawalan, Divina D. and Chapman, Keith R. (2006). Virgin Coconut Oil:
Production Manual for Micro- and Village-scale Processing. Thailand:
FAO Regional Office for Asia and the Pacific
• Rabago, Lilia M. et al., (2014). Science and Technology Laboratory
Manual and Workbook for Grade 9 Quezon City: Vibal Group, Inc.
• Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson
Brooks/Cole
Communicate the learning competencies for this topic. You can enumerate some products (or show
pictures) of fermentation. You may opt to insert and discuss the nature of science with regard to cellular
respiration. For instance, athletes and trainers today are constantly finding ways to improve their
performance in a particular event such as in triathlon by boosting cellular respiration. Why is meant by
carbo-loading?
Or as you go to the supermarket, you will see several kinds of energy drinks, are they safe to drink?
What are the health implications if a person drinks them excessively? What about energy-boosting
vitamins, are they really beneficial for the body? Or is it safe to drink an energy-boosting fluid rich in
vitamin B-complex and other related substances when your stomach is empty? If you want to jump-start
your mitochondria, would you rely on alternative medicine? These are interesting issues to discuss and
bring to the whole class to think about.
MOTIVATION (5 MINS)
Show a metabolic pool concept to the class and ask the following questions:
1. What are the three kinds of food that provide the building blocks for the cells, and that all can
provide energy?
2. What are the basic metabolic pathways organisms use to extract energy from carbohydrates in
aerobic respiration? What about for proteins and fats? Are the pathways the same or not?
3. To which pathway do glycerol and fatty acids of fat enter?
Suggested Answers:
1. Carbohydrates, proteins, and fats.
2. Glycolysis, Krebs cycle, electron transport chain—for carbohydrates, proteins and fats. The
metabolic pathways for these three kinds of food are the same except that for proteins and fats,
there are additional steps to get fats and proteins ready to enter the specific pathway as shown in
the diagram.
3. Glycerol enters glycolysis; fatty acids enter preparatory reaction.
166
Directions: Tabulate and explain the advantages and disadvantages of fermentation, anaerobic respiration and aerobic respiration. Show their
similarities and differences.
Procedure:
1. Form five groups. Each group has an assigned topic to work on. The following groups are as follows:
• GROUP 1: To work on the differences among aerobic, anaerobic and fermenting organisms. List all the possible answers as they can
as long as the description written fits for the particular organism.
• GROUP 2: To work on the similarities among aerobic, anaerobic and fermenting organisms. List all the possible answers as they can
as long as the description written fits for the particular organism.
• GROUP 3: To work on and explain the advantages and disadvantages of aerobic respiration.
• GROUP 4: To work on and explain the advantages and disadvantages of anaerobic respiration.
• GROUP 5: To work on and explain the advantages and disadvantages of fermentation.
2. Show to the class a sample table on how you want them to display, outline and report the information to the whole class.
3. Tell them to prepare Manila papers, marker, or any visual materials.
Table 1: Activity: Differences and Similarities of Aerobic, Anaerobic and Fermenting Organisms 
Differences Similarity
Aerobic, Anaerobic and

Aerobic Organisms Anaerobic Organisms Fermenting Organisms Fermenting Organisms
Table 2: Activity: Advantages and Disadvantages of Aerobic Respiration, Anaerobic Respiration and Fermentation
Advantages of Aerobic Respiration Advantages of Anaerobic Respiration Advantages of Fermentation
Disadvantages of Aerobic Organisms Disadvantages of Anaerobic Organisms Disadvantages of Fermenting Organisms
Suggested Answers:
Table 1: Activity: Differences and Similarities of Aerobic, Anaerobic and Fermenting Organisms
Table 2: Activity: Advantages and Disadvantages of Aerobic Respiration, Anaerobic Respiration and Fermentation 
Differences Similarity
Aerobic Organisms Anaerobic Organisms Fermenting Organisms Aerobic, Anaerobic and

• Use oxygen. • Do not use oxygen. • Do not use oxygen. Fermenting Organisms
• H2O is the by-product. • H2O and potassium • Lactate (lactate fermentation) or ethyl • ATP is produced.
nitrite are the by- alcohol (alcoholic fermentation) is the by- • CO2 is the waste product.
• Electron acceptor is O2
products. product.
and is reduced to • Electrons are transferred from
• Final acceptors of electrons are pyruvate
water. • With electron transport glucose to NADH.
reduced to lactate, and acetaldehyde
• With electron transport chain.
reduced to ethyl alcohol.
chain. • Electron acceptor is
• No electron transport chain.
• Occur in prokaryotes nitrate or sulfate.
• Occur in prokaryotes and eukaryotes.
and eukaryotes. • Occur in prokaryotes. • Simple and faster alternative to cellular
• Requires no special respiration
organelles • Requires no special organelles
• Glycolysis and waste product formation
are two sets of reactions that occur.
168
Advantages of Aerobic Respiration Advantages of Anaerobic Advantages of Fermentation
Respiration
• All available energy extracted from • All available energy extracted from • All available energy extracted from glucose is 2
glucose is 36 to 38 ATP. glucose is 40 ATP (because ATP.
• 39% energy transferred from glucose to prokaryotes have no • Certain bacteria produce chemicals of industrial
ATP. mitochondria). importance such as isopropanol, butyric acid,
• Slow breakdown of glucose into ATP. • 43% energy transferred from acetic acid when bacteria ferment—breakdown of
glucose to ATP. sugars in the absence of oxygen.
• Organisms can do more work for a
longer time with the slow and efficient • Complete breakdown of glucose. • Foods that are fermented last longer because
breakdown of ATP. these fermenting organisms have removed many
of the nutrients that would attract other
• Animals and the human muscle cells can
microorganisms.
adapt and perform lactic acid
fermentation for a rapid burst of energy. • Yeasts ferment fruits and wine is produced. Grain
is also fermented to produce beer. They also
• Can breathe heavily to refill the cells
cause the bread to rise due to CO2, a by-product,
with oxygen so that lactate is removed
and alcohol is lost in the bread.
from the muscle cells.
• Yeasts and lactobacillus together produce sour
• Lactate is returned to the liver to
taste in wheat beer.
become pyruvate or glucose again.
• Yeasts and Acetobacter aceti spoil wine to
• Complete breakdown of glucose.
become vinegar.
• Bacterial fermentation produces yogurt (due to
Streptococcus thermophilus and Lactobacillus
bulgaricus), sour cream, cheese, brine cucumber
pickles, sauerkraut, and kimchi.
• Clostridium bacteria can produce nail polish
remover and rubbing alcohol from the acetone
and isopropanol they make
• Soy sauce is produced by adding mold
(Aspergillus), yeasts and fermenting bacteria.
Disadvantages of Aerobic Organisms Disadvantages of Anaerobic Organisms Disadvantages of Fermenting Organisms
• 61% of glucose metabolism becomes • 57% of glucose metabolism becomes heat • Consumption of 2 ATP is fast.
heat and enters the environment. and enters the environment. • Ethanol and lactate, the by-products of
• Human brain cells cannot perform lactic fermentation, have a lot of energy
acid fermentation. reserves—prokaryotes and eukaryotes
• Human muscle cells feel the burning cannot extract the energy in lactate and
sensations and pain when lactate ethanol using anaerobic method.
accumulates in the cell and experience • Needs a large supply of glucose to
oxygen debt. perform the same work as in aerobic
respiration.
• Glucose is partially oxidized.
Directions: Compare aerobic respiration, anaerobic respiration and fermentation in terms of the following factors
listed in the first column.
Activity Title: Comparison of Aerobic and Anaerobic Respiration and Fermentation
Factors Aerobic Respiration Anaerobic Respiration Fermentation
Immediate fate of electrons in

NADH
Terminal electron acceptor of

electron transport chain
Reduced Product(s) formed
Mechanism of ATP synthesis
170
Suggested Answers:
Factors Aerobic Respiration Anaerobic Respiration Fermentation
Transferred to Transferred to electron Transferred to organic

Immediate fate of electron transport transport chain molecule
electrons in NADH chain
O2 Inorganic substances No electron transport
Terminal electron such as NO3-- or SO4 2- chain
acceptor of electron
transport chain
Reduced Product(s) Water Relatively reduced Relatively reduced
formed inorganic substances organic compounds
(e.g., alcohol or lactate)
Oxidative Oxidative Substrate-level
Mechanism of ATP phosphorylation/ phosphorylation/ phosphorylation only
synthesis chemiosmosis; also chemiosmosis; also (during glycolysis)
substrate-level substrate-level
phosphorylation phosphorylation
Teacher Tip:
Activity Title: Homemade Virgin Coconut Oil and Fermentation
Fermentation refers to the addition of yeast
or a specific microorganism or enzyme to a
Materials needed: raw material to produce a desired product.
But for the so-called natural fermentation
Fermentation containers (food-grade transparent plastics), basin or stainless stock pots, ladle (long method, we will produce VCO that does not
require any addition of microorganisms or
spoon with deep bowl), cheesecloth (katsa), five fully matured nuts and coconut water, funnel, hand
substance. When the coconut milk mixture
soap, water, cotton wool, glass bottle or PET bottle is allowed to stand for at least 10 hours, the
VCO will naturally separate from water and
Procedures: protein. Several theories say that the
separation of these substances is due to the
presence of airborne acetic acid bacteria
• The natural fermentation method has two parts: (1) extraction and preparation of coconut milk and (Acetobacter aceti). A. aceti breaks the
(2) processing of VCO from the milk protein bonds in the coconut milk causing
• The process for extracting, preparing and processing of VCO from the coconut milk are as follows: the mixture to separate distinctively.
1.
1. a. Selecting nuts — select fully five matured nuts (12 to 13 months) and de-husk; the husk should
Another theory says that the enzyme
be turning brown. present in the coconut makes the
2. Splitting and grating — split the de-husked nut into two manually and grate. Place the separation of substances to occur. The so-
3. First milk extraction — extract the milk from the grated coconut meat by hand using cheesecloth called ‘fermentation method’ happens when
after 16 to 24 hours of settling, the water
(katsa). Mix the grated coconut milk and the coconut water. Materials to be used such as
smells and tastes sour. The so-called
fermentation containers, basin, ladle, and cheese cloth should be prepared neat and clean to avoid ‘natural’ explains that there is no addition of
contamination. Wash your hands vigorously with water and soap.to kill and remove the presence of any other substance or microorganism in
microorganisms that may alter the quality of VCO. Press the coconut meat thoroughly using your fermenting the virgin coconut oil.
cheese cloth. Set aside the milk obtained using your clean fermentation container(s). Prepare the
Also the ‘virgin’ in the virgin coconut oil
coconut residue (sapal) for the second round of milk extraction. implies that there is no substance added to
4. Second milk extraction — the ratio of mixing is 2 cups of milk residue (sapal) is to 1 cup of water make the oil.
coming from the first milk extraction.
5. Mixing of first and second milk extracts — mix well the first and second coconut milk extracts for 10
minutes.
6. Preparing for the fermentation containers — place the coconut milk extract in clean fermentation
container(s). Cover the container(s) loosely as shown below. Place the container(s) in a place where
temperature is 35 to 40oC. Allow the coconut milk mixture to settle for 16 to 24 hours for natural
fermentation of the coconut milk extract to occur.
7. Separating the oil and fermented curd layers — separate the oil from the fermented curd by using
ladle to scoop the oil off the top. Note: dispose of the water phase and gummy portion by diluting
with water before draining into a grease trap. The fermented curd can be heated to remove the
residual class B oil that can be used for making skin care and herbal soap products. The toasted
curd can also be mixed with other compost material and use as organic fertilizer.
8. Filtering the oil — filter the VCO to remove adhering particles of fermented curd.
9. Packaging and storage — the recommended packaging material for VCO is glass. PET bottles can
be used in cases where the VCO is immediately consumed. Note: Class A VCO is always water-
clear. Class B VCO is yellow. The latter happens when the process of coconut milk extraction is
invaded by unwanted microorganisms or sanitary protocols are not followed strictly such as washing
the hands with antibacterial soap or washing the materials with antibacterial detergent soap.
10. Tell them to report their output to the class.
172
Modified Natural Fermentation Method

Directions: Read the procedures below on how the jigsaw and expert
PRACTICE (160 MINS)

Procedure:
Directions:
1. Explain why cells of most multicellular organisms cannot live long without oxygen.
2. How does poison like cyanide interfere with activity of electron transport chain in the mitochondrion?
3. Why is it beneficial for pyruvate to be reduced when oxygen in not available during the fermentation process?
4. If fermentation is a fast easy way to get ATP without oxygen and without requiring complex organelles, then why is there a slow more
complex process involving oxygen?
Suggested Answers:
1. The ATP produced during glycolysis is insufficient to sustain life processes. As a result, molecular oxygen has to appear to supply a bulk of
ATP (almost 90%) to the body cells. And hence, most cells of multicellular organisms cannot live long without oxygen, especially the human
brain cells which cannot undergo glycolysis.  
2. Lack of oxygen is not the only factor that interferes with the electron transport system. Some
poisons like cyanide inhibit the normal activity of the cytochrome found in the ETC. Cyanide binds
tightly to the iron in the last cytochrome, making it unable to transport electrons to oxygen. This
cyanide also blocks the passage of electron through the ETC. As this happens the production of
ATP stops — and death ensues.
3. The reduction of pyruvate into lactate and alcohol ensures that NAD+ is regenerated, which is
required for the first step in the energy-harvesting step of glycolysis. As NAD+ returns to the earlier
reaction, it becomes reduced to NADH. In this way, glycolysis and substrate-level ATP synthesis
continue to occur even without the presence of oxygen.
4. In aerobic respiration, the molecules are broken down slowly to get much more of that energy out
and the left over products have useful energy left in them. Imagine a racing car were to get instantly
all the energy from fuel. If this happened, the racing car could not run longer mileage.
ENRICHMENT (5 MINS)
  Teacher Tip:
Activity Title: Vinegar Making This can be done at home as group
assignment. Just give your students
precautionary measures. Instructions can be
Materials needed: given for five minutes. Tell them to
document their output and submit it via
YouTube or Facebook.
9 cups of coconut water, 2 cups of brown sugar, ½ teaspoon yeast, 2 clean cheesecloth, transparent
Vinegar is a sour-tasting condiment and
bottles for transferring the mixture, gas stove, rubber bands, cooking pan, funnel, 2 cups of mother preservative. It can be prepared by two
vinegar, jar(s) spoon for mixing successive microbial processes. The first
phase is done through alcoholic
fermentation by a eukaryotic organism
Procedure: called yeast. The second phase is by
oxidation of alcohol by a prokaryotic
organism called Acetobacter aceti. This
SET A: Preparation and alcoholic fermentation bacterium is responsible for converting the
1. Using cheesecloth, filter the coconut water and place it a clean cooking pan. Then add 2 cups of alcohol in wine to acetic acid or vinegar.
Since coconut is abundant in our country,
brown sugar. Mix thoroughly using a spoon until the sugar crystals are dissolved completely. use this example to show the principle of
2. Heat the mixture at low fire for 20 minutes. As you do this, do not cover the cooking pan and do fermentation process involving
not boil the mixture. After 20 minutes, let the mixture cool for 30 minutes to 1 hour. microorganisms and the series of reactions
that take place as coconut water is
3. Add ½ teaspoon of yeast. Mix very well. Afterwards, transfer the mixture to clean transparent   converted into vinegar.
174
4. bottle(s). Cover the bottle(s) with cheesecloth. The small pores in the cheesecloth will allow the gas from inside the bottle to exit.
5. Place the mixture in a safe place to allow the process of fermentation.
Note: From the day you added yeasts to the mixture you will observe alcoholic fermentation that is characterized by the release of bubbles.
The bubbles indicate the presence of carbon dioxide. When bubbles no longer appear in the mixture, then alcoholic fermentation has ceased
already. The formation of bubbles will be observed for approximately one week. To ferment means to break the sugar in the absence of oxygen.
SET B: Acetous Fermentation
After one week, transfer the mixture to a jar. Then add 2 cups of mother vinegar to a jar. Cover the jar with cheesecloth to allow oxygen to enter
into the jar. Place the jar in a safe place. Wait for one month to allow acetous fermentation.
Directions: Compare and explain aerobic respiration, anaerobic respiration and fermentation in terms of the following:
1. Immediate fate of electron transfer
2. Terminal electron acceptor of electron transport chain
3. Reduced product(s) formed
4. Mechanism of ATP synthesis
Tabulate your answers. Then give at least three advantages and at one disadvantage for aerobic respiration, anaerobic respiration and
fermentation.
ATP in Cellular Metabolism and

Photosynthesis
Content Standards LESSON OUTLINE
The learners demonstrate an understanding of: Introduction Review of prerequisite and related topics 30
1. ATP-ADP Cycle
2. Photosynthesis
Motivation Engage students with questions of 5
3. Respiration
purpose
The learners shall be able to prepare simple fermentation setup using common Instruction/ Lecture on Photosynthesis, ATP 60
fruits to produce wine or vinegar via microorganisms. Delivery/ Production, and Cellular Metabolism
Practice
• The learners describe reactions that produce and consume ATP Practice Group Activity 15
(STEM_BIO11/12-IIa-j-9)
• The learners compute the number of ATPs needed or gained in Evaluation Quiz 10
photosynthesis and respiration (STEM_BIO11/12_IIa-j-11)
Resources
Specific Learning Outcome Shown/presented on the different parts of the Teaching
At the end of the lesson, the learners shall be able to compute the number of Guide
ATPs needed or gained in photosynthesis and respiration
176
Clearly communicate learning competencies and objectives. At the end of the session, the learners shall be able to compute the number of
ATPs needed or gained in photosynthesis and respiration. Also, allow the readers to connect and/or review prerequisite knowledge. Review
structure of ATP (Adenosine Triphosphate) and how it is used as the energy currency of the cell.
During PHOTOSYNTHESIS:
• Energy from sunlight is harvested and used to drive the synthesis of glucose from CO2 and H2O. By converting the energy of sunlight to a
usable form of potential chemical energy, photosynthesis is the ultimate source of metabolic energy for all biological systems.
• Photosynthesis takes place in two distinct stages.
(A) In the light reactions, energy from sunlight drives the synthesis of ATP and NADPH, coupled to the formation of O2 from H2O.
(B) In the dark reactions (named because they do not require sunlight), the ATP and NADPH produced by the light reactions drive
glucose synthesis.
• In eukaryotic cells, both the light and dark reactions of photosynthesis occur within chloroplasts—the light reactions in the thylakoid
membrane and the dark reactions within the stroma.
Stages of Cellular Metabolism:

1. Glycosis
2. Pyruvate grooming (between Glycolysis and Citric acid cycle
3. Kreb’s Cycle/Citric Acid Cycle/Acid Cycle
4. Electron Transport Chain and Oxidality
Compare and Contrast Cellular Respiration and Photosynthesis
Cellular Respiration Photosynthesis
Production of ATP Yes; theoretical yield is 38 ATP molecules per Yes

glucose but actual yield is only about 30-32.
Reactants C6H12O6 and 6O2 6O2 and 12H2O and light energy
Requirement of sunlight Sunlight not required; cellular respiration occurs at Can occur only in presence of sunlight
all times.
Chemical Equation (formula) 6O2 + C6H12O6 --> 6CO2 +6H2O + ATP (energy) 6CO2 + 12H2O + light --> C6H12O6 + 6O2 + 6H20
Process Production of ATP via oxidation of organic sugar The production of organic carbon (glucose and
compounds. [1] glycolosis: breaking down of starch) from inorganic carbon (carbon dioxide) with
sugars; occurs in cytoplasm [2] Krebs Cycle: occurs the use of ATP and NADPH produced in the light
in mitochondria; requires energy [3] Electron dependent reaction
Transport Chain-- in mitochondria; converts O2 to
water.
Fate of oxygen and carbon dioxide Oxygen is absorbed and carbon dioxide is Carbon dioxide is absorbed and oxygen is
released. released.
Energy required or released? Releases energy in a step wise manner as ATP Requires energy
molecules
Main function Breakdown of food. Energy release. Production of food. Energy Capture.
Chemical reaction Glucose is broken down into water and carbon Carbon dioxide and water combine in presence of
dioxide (and energy). sunlight to produce glucose and oxygen.
Stages 4 stages: Glycolysis, Linking Reaction (pyruvate 2 stages: The light dependent reaction, light
oxidation), Krebs cycle, Electron Transport Chain independent reaction. (AKA light cycle & calvin
(oxidative phosphorylation). cycle)
What powers ATP synthase H+ proton gradient across the inner mitochondria H+ gradient across thylakoid membrane into
membrane into matrix. High H+ concentration in stroma. High H+ concentration in the thylakoid
the intermembrane space. lumen
Products 6CO2 and 6H20 and energy(ATP) C6H12O6 (or G3P) and 6O2 and 6H2O
Cellular Respiration Photosynthesis
What pumps protons across the membrane Electron transport chain. Electrochemical gradient Electron transport chain
creates energy that the protons use to flow
passively synthesizing ATP.
Occurs in which organelle? Mitochondria Glycolysis (cytoplasm) Chloroplasts
Final electron receptor O2 (Oxygen gas) NADP+ (forms NADPH )
Occurs in which organisms? Occurs in all living organisms (plants and animals). Occurs in plants, protista (algae), and some
bacteria.
Electron source Glucose, NADH + , FADH2 Oxidation H2O at PSII
Catalyst - A substance that increases the rate of No catalyst is required for respiration reaction. Reaction takes places in presence of chlorophyll.
a chemical reaction
High electron potential energy From breaking bonds From light photons.
Photosynthesis (source: http://www.diffen.com/difference/Cellular_Respiration_vs_Photosynthesis)
MOTIVATION (5 MINS)
Teacher asks students “Why study photosynthesis and cellular respiration?”
Photosynthesis - Lead discussion into the importance of
1. Photosynthesis in selection of plants/trees for reforestation, agriculture and biodiversity conservation. (http://bioenergy.asu.edu/photosyn/
study.html)
2. Cellular Respiration in food production (pretzels, beer, soy sauce, pickles, vinegar, yeast-risen bread, or any other product that requires
fermentation or microbial breakdown of compounds in food), athletics (sports nutrition and event-specific training) and others.
INSTRUCTION/DELIVERY/PRACTICE (60 MINS)
Lecture on Photosynthesis and ATP Production
ATP is formed by the addition of a phosphate group to a molecule of adenosine diphosphate (ADP); or to state it in chemical terms, by the
phosphorylation of ADP. This reaction requires a substantial input of energy, much of which is captured in the bond that links the added
phosphate group to ADP. Because light energy powers this reaction in the chloroplasts, the production of ATP during photosynthesis is referred
to as photophosphorylation.
The light reaction uses the energy from photons to create ATP and NADPH, which are both forms of chemical energy used in the dark reaction
(=Calvin Cycle). Calvin Cycle, through a series of chemical reactions, takes the carbon from carbon dioxide and turns it into glucose, which is a
sugar that cells use as energy.
Carbon dioxide is a fully oxidized molecule. What that means is basically it does not have a lot of chemical energy. The Calvin Cycle turns
carbon dioxide into the much more reduced molecule, glucose, which has much more energy.
Where ATP comes into play is that it functions as a reduced molecule that provides the chemical energy that transforms the carbons in the
carbon dioxide molecules into progressively more reduced molecules until you get glucose. Thus, ATP is used to power the change from 3-
phosphoglycerate to 1,3-bisphosphoglycerate, which is then turned into 2 glyceraldehyde 3-phosphate (G3P) molecules with NADPH (an
energy source similar to ATP). One of these G3P molecules gets turned into glucose. The other one is transformed by ATP into ribulose
bisphosphate (RuBP), which then picks up carbon dioxide and the cycle begins again.
Lecture on Cellular Metabolism and ATP Production

What is the difference between substrate-level phosphorylation and oxidative phosphorylation?
Substrate-level phosphorylation – is the formation of ATP by the direct transfer of a PO3 group to ADP.
(Source: https://quizlet.com/11951424/metabolism-final-exam-flash-cards/)
Oxidative phosphorylation – is the process that explains how molecules of FADH2 and NADH are used to make ATP. The term “oxidative” is
used because oxygen accepts an electron while the gradient made by the movement of electrons powers the creation ATP. 
(Source: http://www.dbriers.com/tutorials/2012/04/substrate-level-vs-oxidative-phosphorylation/)
Other references that can be used: https://online.science.psu.edu/biol110_sandbox_8862/node/8924
http://www.neshaminy.k12.pa.us/Page/20741
180
Review Stages of Cellular Metabolism and the products produced at each stage (ATP by substrate level phosphorylation, CO2, NADH and
FADH2)
 
Four Major Reaction Pathways
1. Glycolysis
2. Conversion of Pyruvate to Acetyl CoA (also called Oxidation of Pyruvate, Pyruvate Processing, Pyruvate Grooming)
3. Kreb’s Cycle (Citric Acid Cycle, Tricarboxylic Acid Cycle)
4. Electron Transport Chain (Chemiosmosis)
Other references that can be used:  

• https://courses.candelalearning.com/ap2x1/chapter/carbohydrate-metabolism/
• http://www.uic.edu/classes/bios/bios100/lectures/respiration.htm
• http://www.neshaminy.k12.pa.us/Page/20741
• http://sp.uconn.edu/~bi102vc/1102fall11/ATP.html
• http://biology.tutorvista.com/cell/cellular-respiration.html
• https://en.wikibooks.org/wiki/Biology,_Answering_the_Big_Questions_of_Life/Metabolism/Metabolism3
• http://people.ucalgary.ca/~rosenber/CellularRespirationSummary.html
• http://antranik.org/intro-to-cellular-respiration-the-production-of-atp/
• http://sandwalk.blogspot.com/2007/12/how-cells-make-atp-substrate-level.html
• http://study.com/academy/lesson/substrate-level-phosphorylation-and-oxidative-phosphorylation.html
• http://www.diffen.com/difference/Cellular_Respiration_vs_Photosynthesis 
Stage of Cellular Metabolism Substrate-Level Phosphorylation Oxidative Phosphorylation through ETC Total
NADH Subtotal1 FADH2 Subtotal1 36-38
Glycolysis 2 2 4-6 2
Pyruvate Grooming 0 2 6
(Decarboxylation of Pyruvate)(x2)3
Citric acid cycle ( x 2)3 2 6 18 2 4
Subtotal 4 28-30 4
SUMMARY TABLE – Number of ATP molecules formed from 1 molecule of glucose
The amount of ATP produced is estimated from the number of protons than passes through the inner mitochondrial membrane (via the electron
acceptors of the electron transport chain (ETC) and the number of ATP produced by ATP Synthase.
1. Assumption = Each NADH will generate 3 ATPs while FADHs will generate 2 ATPs.
2. The number of ATP produced depends on the acceptor that receives the hydrogen ions and electrons from the NADH formed during
glycolysis in the cytoplasm.
3. Glycolysis results in formation of 2 molecules of pyruvic acid/pyruvate thus values are multiplied by 2.
STAGE LOCATION WHAT REACTANT (What PRODUCTS (What ATP PRODUCED BY

HAPPENS? goes in) comes out)
Substrate Level Oxidative Phosphorylation
Phosphorylation NADH FADH2
Glycolysis
Pyruvate Processing/
Grooming
Citric Acid Cycle
Oxidative
Phosphorylation
PRACTICE (15 MINS)

Using previous lessons and this lecture, students grouped into 2-3 are asked to answer the table below. Teacher provides the initial number of
glucose molecules that will undergo cellular metabolism.
Practice Questions 
(Available at the following sites: Students are asked to watch a video and answer questions after watching the video).
Photosynthetic Electron Transport and ATP Synthesis
• https://highered.mheducation.com/sites/9834092339/student_view0/chapter39/photosynthetic_electron_transport_and_atp_synthesis.html  
182
Calvin Cycle
• https://highered.mheducation.com/sites/9834092339/student_view0/chapter39/calvin_cycle.html

Questions for Exam/Quiz
• https://quizlet.com/11951424/metabolism-final-exam-flash-cards/
• https://quizlet.com/17507853/biochemistry-ii-practice-questions-oxidative-phosphorylation-flash-cards/
• http://faculty.une.edu/com/courses/bionut/distbio/obj-512/Chap21-practice%20questions.htm
• http://web.mnstate.edu/provost/Chem410ETSOxPhosQuest.pdf
• https://www.khanacademy.org/test-prep/mcat/biomolecules/krebs-citric-acid-cycle-and-oxidative-phosphorylation/e/oxidative-
phosphorylation-questions
• https://mcb.berkeley.edu/labs/krantz/mcb102/MCB102-SPRING2008-EXAM-KEY_v3.pdf
RUBRICS/ASSESSMENT GUIDE
LEARNING ASSESSMENT TOOL Exemplary Satisfactory Developing Beginning

COMPETENCY (8-10) (5-7) (3-4) (1-2)
The learners shall be Student participation Student was able to Student was able to Student was able to (1) Student was not able
able to describe the (During lecture) answer the question answer the question answer the question but to answer the question.
following: without referring to his/her without referring to his/ read from his/her notes. (2) Student read from
notes plus the follow-up her notes; Was not able notes of his/her
Compute the number
question. to answer follow up classmate..
of ATPs needed or
question.
gained in
photosynthesis and Student participation Students in the team Student listened to the Student was a passive Student was interested
respiration (During Practice) equally contributed to the discussion but participant and in other matters not
discussion and the contribution to the team contribution was related to the exercise.
answering of the table was lesser than the minimal.
provided other members
Examination Obtained 90-100% correct Obtained 70-80.99% Obtained 50-69.99% Obtained percentile
answers in the exam correct answers in the correct answers in the <50% correct answers in
exam exam the exam
Biographical Notes
FLORENCIA G. CLAVERIA, Ph.D. DAWN T. CRISOLOGO
Team Leader Team Leader
Ms. Dawn Crisologo is a Special Science Teacher at the
Dr. Florencia G. Claveria is the current Chair of the CHED Philippine Science High School-Main Campus in Diliman, Quezon
Technical Panel for Biology and Molecular Biology. She is also City and specializes in advanced topics in Ecology, Evolution and
member of the Commission’s Technical Panel for Math and Biodiversity, Anatomy, Physiology, and Methods in Science and
Science. She is currently Vice Chancellor for Academics, Technology Research. She is a member of the Asian Association
Research, and Operations at the De La Salle Araneta University. of Biology Educators, Wildlife Conservation Society of the
Philippines, and Biology Teachers Association of the Philippines.
She is a full professor at the De La Salle University-Manila Her works are included in The Philippine BIOTA Journal and
where she served as Dean of the College of Science for 6 three editions of the Science Blast textbook. Ms. Crisologo is
academic years. Dr Claveria finished her doctorate in Biological currently finishing her master’s in Environmental Science at the
Sciences at the University of Cincinnati, through a Fulbright-Hays University of the Philippines Diliman. She completed her
grant. She completed her master’s in Zoology at the Ghen State bachelor’s degree in Biology at the same university.
University, through a grant from the Government of Belgium. She
earned her bachelor’s degree in Biology at St. Louis University. CHUCKIE FER CALSADO
Her written scholarly works include contributions to academic Writer
publications such as the Philippine Textbook of Medical Mr. Chuckie Fer Calsado is Special Science Teacher IV at
Parasitology, Journal of Protozoology Research, and The Journal the Philippine Science High School Main Campus where he has
of Veterinary Medical Science. been teaching for 8 years. He is a member of biological
organisations like the Biology Teachers Association of the
Philippines, the Asian Association for Biology Education, and
Concerned Artists of the Philippines among many others. He has
published academic papers such as Implication of Students’
Cognitive Style, Personal Demographics, Values and Decision
Making in Environmental Education and the Role of Education in
the Prevention of Child Trafficking in Nepal. Mr. Calsado finished
his Master’s in Bioethics at the Monash University and his
bachelor’s degree in Biology at the University of the Philippines
DIliman.
184
AILEEN C. DELA CRUZ JANET S. ESTACION, Ph.D.
Writer Writer
Ms. Aileen Dela Cruz has been serving as the Science Dr. Janet Estacion is current Officer-in-Charge at the
Research Analyst at the Philippine Science High School - Main Institute of Marine and Environmental Science in Silliman Unive
Campus since 2004. Her academic interests range from rsity where she has been teaching for 30 years now. She headed
microbiology, food safety and nutrition, and laboratory safety and researches on marine conservation and the recovery of reefs. Her
she has been involved in trainings and conferences on the same scholarly works appeared on different publications such as the
fields of study. Her published scholarly works include series of Philippine Science Letters and the Silliman Journal. Dr. Estacion
textbooks on 21st Century Learning. Ms. Dela Cruz earned her earned her doctorate degree in Zoology at the James Cook
bachelor’s degree in Biology at the University of the Philippines University of North Queensland. She completed her master’s
Baguio. degree in Marine Biology at the University of the Philippines
Diliman and her bachelor’s degree in Biology at the Silliman
DOREEN D. DOMINGO, PH.D. University.
Writer
Dr. Doreen D. Domingo is a Professor at the Mariano MARY JANE C. FLORES, Ph.D.
Marcos State University where she teaches both in the graduate Writer
and undergraduate levels. She is currently the Chief of Alumni
Relations for the university. Dr. Domingo finished her doctorate in Dr. Mary Jane C. Flores is Assistant Professor 3 at the
Biology (magna cum laude) at St. Louis University through a College of Science in the De La Salle University where she has
research grant from CHED and the Microbial Forensics and been teaching for 20 years now. Her published works include
Biodefense Laboratory, Indiana University. She completed her researches on parasitology, climatology, and community
Doctor of Education on Educational Management, her master’s nutrition. Dr Flores has conducted and attended seminars on
degree in Education major in Biology, and her bachelor’s degree Biology in the country and abroad, including the Training on
in Biology at the Mariano Marcos State University. Dr. Domingo’s Biological Control at the US Department of Agriculture-
scholarly works were published on the International Referred Agricultural Research Service and Congress meetings on
Journal and the National Referred Journal. Parasitology. She is a two-time recipient of the Don Ramon J.
Araneta Chair in Ecology among other citations. Dr. Flores
earned her Doctorate, Master’s, and Bachelor’s degrees in
Biology at the De La Salle University.
JUSTIN RAY M. GUCE JOHN DONNIE RAMOS, Ph.D.
Writer Technical Editor
Mr. Justin Ray Guce is a Special Science Teacher I at the
Dr. John Donnie Ramos is a Member of CHED’s Technical
Philippine Science High School Main Campus in DIliman, Quezon
Panel for Biology and Microbiology and Board Member of the
City where he teaches for 9 years. He has served as a Trainer of
Philippine Society for Biochemistry and Molecular Biology. He is
student representatives for Science Olympiad competitions and
currently the Dean of the College of Science at the University of
has delivered presentations in a number of Biology workshops
Santo Tomas where he teaches molecular biology, immunology
and conventions. Mr Guce is a member of the Wildlife
and genetics, and allergology. Dr. Ramos completed his
Conservation Society of the Philippines and the Biology Teachers
doctorate in Molecular Biology at the National University of
Association of the Philippines. Mr Guce is currently finishing his
Singapore. He finished his master’s degree in Biological Sciences
master’s in Biology Education at the University of the Philippines
at the University of Santo Tomas and his bachelor’s degree in
Diliman where he also graduated his bachelor’s degree in
Biology at the Philippine Normal University. Dr. Ramos is
Biology.
recipient of the NAST-TWAS Prize for Young Scientist in the
Philippines in 2010, and Outstanding Young Scientist by the
NOLASCO H. SABLAN National Academy of Science and Technology in 2005.
Writer
Mr. Nolasco Sablan is Teacher III at the Parada National JOY R. JIMENA
High School and is a DepEd teacher for 11 years now. He has Copyreader
worked as resource speaker, trainer, and writer for different
Ms. Joy Jimena is currently Planning Officer II at the
institutions in the education sector, including the Ateneo de
Information Management Bureau of the Department of Social
Manila University, Metrobank Foundation Inc., and the
Welfare and Development. She also previously worked with other
Department of Education. Mr. Nolasco Sablan earned his
government agencies such as the Department of National
master’s degree in Biology Education at the Ateneo de Manila
Defense and Philippine Commission on Women, and Social
University and completed his bachelor’s degree in Education
Security System. Ms. Jimena graduated at the University of the
major in General Science at the Philippine Normal University.
Philippines Diliman with a degree in Public Administration.
186
RENAN U. ORTIZ
Illustrator
Mr. Renan Ortiz is a teacher and visual artist who has
collaborated in local and international art exhibitions such as the
SENSORIUM at the Ayala Museum, Populus in Singapore,
Censorship_2013 Move On Asia in South Korea, and the Triumph
of Philippine Art in New Jersey, USA. Mr. Ortiz’s solo exhibitions
include versereverse at the Republikha Art Gallery. He first
completed his bachelor’s degree in Political Science at the
University of the Philippines Manila before finishing his bachelor’s
degree in Fine Arts major in Painting at the University of the
Philippines Diliman. Mr. Ortiz is an awardee of the Cultural
Center of the Philippines’ CCP Thirteen Artists Awards in 2012.
DANIELA LOUISE B. GO
Illustrator
Ms Daniela Louise Go is a freelance illustrator and graphic
designer, specializing on graphic design, brand and campaign
design, and copywriting. She has worked as illustrator for Stache
Magazine, Philippine Daily Inquirer, and Summit Media Digital.
Ms Go is a member of organisations such as the UP Graphic and
UP Grail in which she also served as designer and illustrator. Her
works have been part of art exhibitions including Freshly Brewed,
Wanton Hypermaterialism, and Syntheses 2014: Graduate
Exhibit. Ms. Go graduated her bachelor’s degree in Fine Arts
Major in Visual Communication at the University of the Philippine
Diliman.

General Biology 1

Încărcat de

Informații document

Drepturi de autor

Formate disponibile

Partajați acest document

Partajați sau inserați document

Opțiuni de partajare

Vi se pare util acest document?

Este necorespunzător acest conținut?

Drepturi de autor:

Formate disponibile

General Biology 1

Încărcat de

Drepturi de autor:

Formate disponibile

The Commission on Higher Education

in collaboration with the Philippine Normal University

Teaching Guide for Senior High School

This Teaching Guide was collaboratively developed and reviewed by

DepEd General Biology 1 Curriculum Guide . . . . . . . . . . . . . 5 Chapter 3: Energy Transformation

Chapter 1: Cell Lesson 11: Photosynthesis and Cellular Respiration . . . . . . . . . . . 86

Lesson 7: Carbohydrates and Lipids . . . . . . . . . . . . . . . . . . . . . 57

Lesson 8: Amino Acids and Proteins Part 1 . . . . . . . . . . . . . . . . 70 Biographical Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 184

Lesson 9: Amino Acids and Proteins Part 2 . . . . . . . . . . . . . . . . 73

Lesson 10: Biological Molecules: Enzymes . . . . . . . . . . . . . . . . 78

College Readiness Standards Foundational Skills DepEd Functional Skills

Global awareness, scientific and economic literacy, curiosity,

Global awareness, media literacy, technological literacy,

Global awareness, multicultural literacy, collaboration and

Grade: Grade 11/12 Quarters: 1st to 2nd Quarter

Content Content Standard Performance Standard Learning Competencies Code

Content Content Standard Performance Standard Learning Competencies Code

b. Facilitated Transport membrane

Content Content Standard Performance Standard Learning Competencies Code

6. differentiate aerobic from anaerobic respiration STEM_BIO11/12

Code Book Legend

Learning Area and Strand/ Subject or Science, Technology, Engineering and

explain the advantages and disadvantages

The Cell: Endomembrane System, Mitochondria,

Specific Learning Outcomes Evaluation Assessment of learners’ knowledge; 5

The review on the differences between

ENRICHMENT (30 MINS)

EVALUATION (60 MINS

Mitochondria and Chloroplasts

Performance Standards Motivation Understanding of key concepts using real-life 5

Resources (continued at the end of Teaching Guide)

MEMBRANE-BOUND ORGANELLES NON-MEMBRANE-BOUND ORGANELLES

Vacuoles and Vesicles

Chloroplast and other plastids

If an LCD projector is not available, draw

Discuss the function and structure of the mitochondria.

Discuss the purpose of the mitochondrial membranes.

Explain and discuss the structure and functions of the Chloroplasts.

The Photosystem I and the Photosystem II are

The molecules present in the thylakoid membrane use the electrons

large protein complex known as the ATP synthase controls the

The granal thylakoids contain only Photosystem II protein complex.

Possible responses to the homework (Source: Campbell et al, 10th Ed.):

Learning Competency Assessment Tool Exemplary Satisfactory Developing Beginnning

Structure and Functions of Animal Tissues

cells tissue organ organ system multicellular organism

Make sure to relate structure to function.

CONNECTIVE TISSUE PROPER (CTP)—made up of loose

CARTILAGE —characterized by collagenous fibers embedded

BONE —mineralized connective tissue made by bone-forming

Figure 2: Connective Tissue (Source: Reece JB, U. L. (2010).

Figure 3: Muscle Tissue (Source: Reece JB, U. L. (2010). Campbell

Nervous Tissue—These tissues are composed of nerve cells called

The reports may be presented using a table

EVALUATION (10 MINS) Teacher tip

Cell Cycle and Cell Division

Performance Standards Motivation Video presentation of ‘Cell Cycle and Cell 5

Specific Learning Outcomes Enrichment Video presentation or introduction on plant 5

You can show diagrams or illustrations that

You should ask the learners thought-

Note the learners’ responses to questions

Discuss the stages of mitosis and meiosis.

First Meiotic Division

Second Meiotic Division

The Photosystem I and the Photosystem II are  

Learners should perform all three tests on the following samples:  