See

discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/7210657

Interleukin-31: A new cytokine involved in

inflammation of the skin

Article in International journal of immunopathology and pharmacology · December 2008

Source: PubMed

CITATIONS READS

16 109

10 authors, including:

Vincenzo Salini Stavros Frydas

Università degli Studi G. d'Annunzio Chieti e … Aristotle University of Thessaloniki
176 PUBLICATIONS 1,899 CITATIONS 93 PUBLICATIONS 1,181 CITATIONS

SEE PROFILE SEE PROFILE

Claudia Petrarca Giampiero Neri

Università degli Studi G. d'Annunzio Chieti e … Università degli Studi G. d'Annunzio Chieti e …
63 PUBLICATIONS 1,036 CITATIONS 27 PUBLICATIONS 214 CITATIONS

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Atlante di anatomia ecografica e biomeccanica muscoloscheletrica Stefano Gallett View project

Implant Dentistry and Osteointegration View project

All content following this page was uploaded by Claudia Petrarca on 16 May 2014.

The user has requested enhancement of the downloaded file.

INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 1-4 (2006)

EDITORIAL
INTERLEUKIN-31: A NEW CYTOKINE INVOLVED IN INFLAMMATION OF THE SKIN

M.L. CASTELLANI, V. SALINI, S. FRYDAS1, J. DONELAN2,

B. MADHAPPAN2, C. PETRARCA3, J. VECCHIET4, K. FALASCA4, G. NERI5 and S. TETE’6
Department of Medicine and Science of Aging, University of Chieti, Chieti, Italy;
1
Department of Parasitology, Veterinary School, Aristotelian University, Thessaloniki, Greece;
2
Department of Pharmacology and Experimental Therapeutics, Tufts University School of
Medicine, Boston, U.S.A.; 3Division of Immunology, 4Infectious Diseases 5Otolaryngology Division,
and 6Dental School, University of Chieti, Chieti, Italy

Received December 16, 2004 – Accepted January 13, 2006

Cytokines affect immune functions involved in
motility, chemotaxis, phagocytosis, cytotoxicity
and antigen presentation (1). Interleukins (IL) are
pleiotropic cytokines with diverse receptor
signaling pathways whose expression is controlled
at multiple levels (2). Interleukin receptors (ILR)
have intrinsic roles in regulating and amplifying
the inflammatory response (3-12).
Skin is the largest organ of the body with the
specific immune defense and its inflammatory
conditions include atopic dermatitis, allergies,
psoriasis etc. (13-19). Infiltrated lymphocytes
proliferate in an activated state in the skin lesion in
an autocrine and/or paracrine manner and produce
TH2-type cytokines that might evoke immunologic
abnormalities (20-23). The skin lesion is
characterized by massive infiltration of mononuclear
cells including CD4+ T helper cells and mast cells
(24-27). Several cytokines exhibit the capacity to
induce T cell response (28-30). It has been reported
that GM-CSF plays an important role in the
development and perpetuation of atopic dermatitis
(31). In addition, psoriasis is regarded as a type-1 T
cell-mediated, chronic inflammatory skin disease
where IL-15 triggers inflammatory cell recruitment,
angiogenesis and production of other inflammatory
cytokines (32-33). Interferon-gamma (IFN-gamma),
Key words: cytokine, IL-31, inflammation, dermatitis, T cell response
TNF-alpha and IL-17 are up-regulated in psoriatic
lesions. Transforming growth factor- alpha (TGF-
alpha) is also highly expressed in the suprabasal
layers of epidermis where neutrophils tend to collect
in psoriatic lesions. Moreover, increased expression
of IL-23, a cytokine which shares the p40 chain with
IL-12, is found in psoriatic lesions (34-39).
IL-31 is a newly described immunoregulatory
cytokine that is mainly produced by activated TH2 cells.
IL-31 acts through the heterodimeric receptors IL-31R
A and oncostatin receptor (OSMR) which are expressed
on IL-31 activated monocytes and expressed on
epithelial cells and keratinocytes respectively. Recently
Fig. 1. T-cell
Activation
DYSREGULATION
CYTOKINES
IMMUNE RESPONSE DISEASE

Mailing address:
Dr. M.L. Castellani
Immunology Section
Faculty of Medicine
University of Chieti 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Via deiVestini 66013 Chieti, Italy This publication and/or article is for individual use only and may not be further
Tel: +39-0871-3555293 reproduced without written permission from the copyright holder.
E-mail: mlcastellani@unich.it
1 Unauthorized reproduction may results in financial and other penalties
2 M.L. CASTELLANI ET AL.

Fig. 2. Monocyte

Activation IL-31RA mRNA

CD4+ T-cell IL-31R Oncostatin-M

Activation Epithelial Cell

IL-31RA mRNA
IL-31R Oncostatin-M
Non-activated (OSRM)
IL-31
Receptor 1 (IL-31RA)
1 2 3 4 helix

bundle
Receptor 2 (IL-31R Oncostatin-M)

IL-31 overexpression may lead to:

gp130-like receptor (GPL)
- Pruritus
- Alopecia
STAT3 Signal Transduction - Skin lesions
and - Airway hypersensitivity
STAT5 - Dermatitis
- Allergy

it has been found that IL-31 is involved in REFERENCES

dermatitis, pruritic skin lesions, allergy and airway
hypersensitivity. IL31R A is highly homologous with
the gp 30-like receptor (GPL), which mediates signal
transduction and activate the signal transducer and
activator transcription factor 3 (STAT3) and 5 (STAT5).
It has been reported that CD4+ T cells are a very
important source of IL-31. Since the development of
dermatitis is mediated by gamma delta T cells, it is
likely that IL-31 is involved in the proliferation and
activation of these cells in skin diseases.
IL-31 is an important player of T cell mediated
immune response and underlines the important
implications of this cytokine in inflammation and
degenerative skin diseases.
The involvement of IL-31 in dermatitis offers the
potential of serving as a useful tool for investigating
the immunological role of cutaneous gamma/delta T
cells. The importance of IL-31 as a mediator of the
skin inflammatory diseases is not known; however,
we believe that a single cytokine may not explain the
pathogenesis of dermatitis.
1. Oppenheim J.J and F.W. Ruscetti. 1997.
Cytokines. In Medical Immunology, 9th ed. D.P.
Stites, A.I. Terr and T.G. Parslow. Appleton and
Lange Stamford, Connecticut, p.146.
2. Abbas A.K., A.H. Lichtman and J.S. Pober. 1991.
Cells and tissues of the immune system. In Cellular
and Molecular Immunology. A.K. Abbas, ed. W.B.
Saunders Company Philadelphia, p. 14.
3. Sodin-Semrl S., A. Spagnolo, R. Mikus, B.
Barbaro, J. Varga and S. Fiore. 2004. Lipoxin A4
and serum amyloid A elicit opposite interleukin-8
and NF-κB responses via the common ALX receptor.
Int. J. Immunopathol. Pharmacol. 17:145.
4. Lo Iacono M., F. Cavallo, E. Quaglino, S. Rolla, M.
Iezzi, S. M. Pupa, C. De Giovanni, P-L. Lollini, P.
Musiani, G. Forni and R. A. Calogero. 2005. A
limited autoimmunity to p185neu elicited by DNA and
allogeneic cell vaccine hampers the progression of
preneoplastic lesions in her-2/neu transgenic mice. Int.
 Int. J. Immunopathol. Pharmacol.
J. Immunopathol. Pharmacol. 18:351.
5. Kempuraj D., J. Donelan, S. Frydas, T. Iezzi, P.
Conti, W. Boucher, N. G. Papadoopoulou, B.
Madhappan, L. Letourneau, G. Sabatino and
T.C. Theoharides. 2004. Interleukin-28 and 29 (IL-
28 and IL-29): new cytokines with anti-viral
activities. Int. J. Immunopathol. Pharmacol. 17:103.
6. Kempuraj D., S. Frydas, E. Karagouni, M.
Hatzistilianou, P. Boscolo, F. Ferro, M. Di
Giannantonio, C.M.V. Conti, D. Merlitti R.
Doyle, C. Petrarca, M.L. Castellani and T.C.
Theoharides. Cytokines and the brain. 2004. Int. J.
Immunopathol. Pharmacol. 17:229.
7. Diaco M., F. Ancarani, M. Montalto, E.
Verrecchia, A. Evoli, S. Servidei, G. Gasbarrini
and R. Manna. 2004. Association of myasthenia
gravis and antisynthetase syndrome: a case report.
Int. J. Immunopathol. Pharmacol. 17:395.
8. Marchisio M., G.M. Sabatino, A. Albanese, E.
Santavenere, R. Buonaguidi and S. Miscia. 2004.
Novel evidence of PLC d2 involvement in the
regulation of the differential evolution of human
aneurysms. Int. J. Immunopathol. Pharmacol. 17:381.
9. Peene I., L . De Rycke, D. Baeten, I. Hoffman,
E.M. Veys, and F. De Keyser. 2004. History and
diagnostic value of antibodies to citrullinated
proteins in rheumatoid arthritis. Int. J.
Immunopathol. Pharmacol. 17:107.
10. Franchi C., G. Cainelli, E. Frigerio, C. Garutti and
G.F. Altomare. 2004. Association of Cyclosporine
and 311 nm UVB in the treatment of moderate to
severe forms of psoriasis: a new strategic approach.
Int. J. Immunopathol. Pharmacol. 17:401.
11. Mastrangelo F., M. Piccirilli, M. Dolci, S. Teté, L.
Speranza, A. Patruno, F. Gizzi, M. Felaco, L. Artese
and M.A. De Lutiis. 2005. Vascular endothelial
growth factor (VEGF) in human tooth germ center. Int.
J. Immunopathol. Pharmacol. 18:587.
12. Kalogeromitros D., D. Kempuraj, A. Katsarou-
Katsari, S. Gregoriou, M. Makris, W. Boucher1
and T.C. Theoharides. 2005. Theophylline as “add-
on” therapy in patients with delayed pressure
urticaria: a prospective self-controlled study. Int. J.
Immunopathol. Pharmacol. 18:595.
13. Dillon S.R., C. Sprecher, A. Hammond, et al. 2004.
Interleukin 31, a cytokine produced by activated T
cells, induces dermatitis in mice. Nat. Immunol. 5:752.
3
14. Dreuw A., S. Radtke, S. Pflanz, et al. 2004.
Characterization of the signaling capacities of the novel
gp130-like cytokine receptor. J. Biol. Chem. 279:36112.
15. Matalon R., S. Surendran, J.D. McDonald1, A.O.
Okorodudu, S.K. Tyring, K. Michals-Matalon
and P. Harris. 2005. Abnormal expression of genes
associated with development and inflammation Int.
J. Immunopathol. Pharmacol. 18:557.
16. Liu Q. and M. R. Hamblin. 2005. Macrophage-
targeted photodynamic therapy: scavenger receptor
expression and activation state Int. J. Immunopathol.
Pharmacol. 18: 391.
17. Ottonello L., M. Bertolotto, F. Montecucco, P.
Dapino and F. Dallegri. 2005. Dexamethasone -
induced apoptosis of human monocytes exposed to
immune complexes. Intervention of CD95- and
XIAP-dependent pathways Int. J. Immunopathol.
Pharmacol. 18:403.
18. Cross M.L. 2004. Immune-signalling by orally-
delivered probiotic bacteria: effects on common
mucosal immunoresponses and protection at distal
mucosal sites. Int. J. Immunopathol. Pharmacol. 17:127
19. Marinova S., P. Nenkov, R. Markova, S.
Nikolaeva, R. Kostadinova, I. Mitov1 and M.
Vretenarska. 2005. Cellular and humoral systemic
and mucosal immune responses stimulated by an
oral polybacterial immunomodulator in patients with
chronic urinary tract infections. Int. J.
Immunopathol. Pharmacol. 18:457.
20. Moseley T.A., D.R. Haudenschild, L. Rose and
AH. Reddi. 2003. Interleukin-17 family and IL-17
receptors. Cytokine Growth Factor Rev. 14:155.
21. Montalto M., L. Santoro, M. Vastola, V.
Curigliano, R. Ricci, F.M. Vecchio, R. Manna and
G. Gasbarrini. 2005. Normalisation of high CA 19-
9 values in autoimmune hepatitis after steroidal
treatment. Int. J. Immunopathol. Pharmacol. 18:603.
22. Esposito I., F. Perna, A. Ponticiello, M. Perrella,
M. Gilli and A. Sanduzzi. 2005. Natural killer
cells in baland peripheral blood of patients with
idiopathic pulmonary fibrosis (IPF). Int. J.
Immunopathol. Pharmacol. 18:541.
23. Gorbunov N.V., S.J. McFaul, A. Januszkiewicz and
J.L. Atkins. 2005. Pro-inflammatory alterations and
status of blood plasma iron in a model of blast-induced
lung trauma. Int. J. Immunopathol. Pharmacol. 18:547.
24. Ballerini P., R. Ciccarelli, F. Caciagli, M.P. Rathbone,
4 M.L. CASTELLANI ET AL.
E.S. Werstiuk, U. Traversa, S. Buccella, P. Giuliani, S.
Jiang, E. Nargi, D. Visini, C. Santavenere and P. Di
Iorio. 2005. P2X7 receptor activation in rat brain cultured
astrocytes increases the biosynthetic release of cysteinyl
leukotrienes Int. J. Immunopathol. Pharmacol. 18:417.
25. D’Haene N., C. Maris, F. Sandras, M.-F. Dehou,
M. Remmelink, C. Decaestecker and I. Salmon.
2005. The differential expression of Galectin-1 and
Galectin-3 in normal lymphoid tissue and non-
Hodgkin’s and Hodgkin’s lymphomas Int. J.
Immunopathol. Pharmacol. 18:431.
26. Bonsi L., L. Pierdomenico, M. Biscardi, C.
Marchionni, S. Gavazzi,V. Fossati, B.Ghinassi, F.
Alviano, D. Rondelli, M. Franchina, G.P. Bagnara1
and A. Grossi. 2005. Constitutive and stimulated
production of VEGF by human megakaryoblastic cell
lines: effect on proliferation and signaling pathway
Int. J. Immunopathol. Pharmacol. 18:445.
27. Cavalieri B., M. Mosca, P. Ramadori, M.-G.
Perrelli, L. De Simone, F. Colotta, R. Bertini, G. Poli
and J.C. Cutrìn. 2005. Neutrophil recruitment in the
reperfused–injured rat liver was effectivelyattenuated
by repertaxin, a novelallosteric noncompetitive
inhibitor of CXCL8 receptors: a therapeutic approach
for the treatment of post-ischemic hepatic syndromes
Int. J. Immunopathol. Pharmacol. 18:475.
28. Petrarca C., S. Frydas, J. Donelan, W. Boucher, N.
Papadopoulou, J. Cao, M.L. Castellani, P. Conti, E.
Toniato, I. Robuffo, J. Vecchiet, T. Iezzi, B.
Madhappan and D. Kempuraj. 2005. Interleukin 27
(IL-27): a novel pleiotropic cytokine involved in T cell
differentiation and T cell response modulation. Int. J.
Immunopathol. Pharmacol. 18:191.
29. Appert-Collin A., F.H.T. Duong, P. Passilly DeGrace,
A. Bennasroune, P. Poindron, J-M. Warter and J.P.
Gies. 2005. Xaliproden (SR57746A) induces 5-HT1A
receptors-mediated Map kinase activation in PC12 cells.
Int. J. Immunopathol. Pharmacol. 18:233.
30. Brunetti L., C. Di Nisio, G. Orlando, C. Ferrante
and M. Vacca. 2005. The regulation of feeding: a
cross talk between peripheral and central signalling.
Int. J. Immunopathol. Pharmacol. 18:201.
31. Trubiani O., R. Di Primio, T. Traini, J.
Pizzicannella, A. Scarano, A. Piattelli and S.
Caputi. 2005. Morphological and cytofluorimetric
analysis of adult mesenchymal stem cells expanded
ex vivo from periodontal ligament. Int. J.
Immunopathol. Pharmacol. 18:213.
32. Riccioni G., V. Di Pietro, T. Staniscia, L. De Feudis,
G. Traisci, F. Capani, G. Ferrara, E. Di Ilio, G. Di
Tano and N. D’Orazio. 2005. Community acquired
pneumonia in internal medicine: a one-year
retrospective study based on pneumonia severity
index. Int. J. Immunopathol. Pharmacol. 18:575.
33. Martini F., C. Agrati, G. D’Offizi and F. Poccia. 2005.
HLA-E Up-regulation induced by HIV infection may
directly contribute to CD94-mediated impairment of
NK cells. Int. J. Immunopathol. Pharmacol. 18:26925.
34. Alexandrakis M.G., F.H. Passam, C.A. Pappa, J.
Damilakis, G. Tsirakis, E. Kandidaki, E.N.
Stathopoulos and D.S. Kyriakou 2005. Serum
evaluation of angiogenic cytokines basic fibroblast
growth factor, hepatocyte growth factor and TNF-?
in patients with myelodysplastic syndromes:
correlation with bone marrow microvascular density.
Int. J. Immunopathol. Pharmacol. 18:287.
35. Fioriti D., A.M. Degener, M. Mischitelli, M.
Videtta, A. Arancio, S. Sica, F. Sorà and V.
Pietropaolo. 2005. BKV infection and hemorrhagic
cystitis after allogeneic bone marrow transplant. Int.
J. Immunopathol. Pharmacol. 18:309.
36. Longhi C., M.P. Conte, S. Ranaldi, M. Penta, P.
Valenti, A. Tinari, F. Superti and L. Seganti 2005.
Apoptotic death of listeria monocytogenes-infected
human macrophages induced by lactoferricin B, a
bovine lactoferrin-derived peptide. Int. J.
Immunopathol. Pharmacol. 18:317.
37. Lesma E., E. Riva, M. Giovannini, A.M. Di Giulio
and A. Gorio. 2005. Amelioration of neutrophil
membrane function underlies granulocyte-colony
stimulating factor action in glycogen storage disease
1b. Int. J. Immunopathol. Pharmacol. 18:297.
38. Lo Iacono M., F. Cavallo, E. Quaglino, S. Rolla,
M. Iezzi, S.M. Pupa, C. De Giovanni, P-L. Lollini,
P. Musiani, G. Forni and R. A. Calogero. 2005. A
limited autoimmunity to p185neu elicited by DNA and
allogeneic cell vaccine hampers the progression of
preneoplastic lesions in her-2/neu transgenic mice.
Int. J. Immunopathol. Pharmacol. 18:351.
39. Rossi R.E. and G. Monasterolo. 2005. A pilot study
of feasibility of ultra-rush (20-25 minutes)
sublingual-swallow immunotherapy in 679 patients
(699 sessions) with allergic rhinitis and/or asthma.
Int. J. Immunopathol. Pharmacol. 18:277.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 105-110 (2006)

EXPRESSION OF HECA-452 IN PARAPSORIASIS AND MYCOSIS FUNGOIDES

R. DI TROLIO, G. DI LORENZO1, E. BARBERIO, A. IACONO2, R. FRANCO2,
M. D’ARMIENTO2, M. DELFINO and F.P. D’ARMIENTO2

Dipartimento di Patologia Sistematica-Clinica Dermatologica,

1
Cattedra di Oncologia Medica and 2Dipartimento di Scienze Biomorfologiche e Funzionali,
Università degli Studi di Napoli Federico II, Naples, Italy

Received February 2, 2005 – Accepted October 2, 2005

We have investigated the HECA-452 expression in large plaque parapsoriasis (PP) and mycosis
fungoides (MF) patients, evaluating the potential role of this biomarker in both cutaneous disorders. Skin
specimens from 72 PP and 61 MF patients were selected in this study. We compared their actual histological
diagnosis with their previous diagnosis and we found that all 72 PP patients had the same diagnosis as
before (stable PP), while 26 out of 61 MF have a previous PP histological diagnosis (evolving PP). Our
results show an increased expression of HECA-452 in MF compared to PP (p<0.01). Furthermore, evolving
PP showed a significantly higher level of HECA-452 than stable PP (p< 0.05). We conclude that HECA-452
expression increases during the natural history of Mycosis Fungoides. HECA-452 could be used as a
biomarker for MF and predict which PP evolves to MF.

The question of whether “large plaque”
parapsoriasis (PP) must be assessed as a
premalignant state of mycosis fungoides (MF) is still
a matter of intense controversy. Many authors do not
use the concept of PP and consider it a synonym of
early-stage mycosis fungoides, whereas others keep
using the term PP (1-7).
For these latter authors, PP defines a heterogeneous
group of disorders characterised clinically by
persistent erythematous scaly patches without MF
histopathological features even though 10-20% of PP
cases may eventually evolve to MF (2, 6).
The demonstration of T-cell clonality has become
important and sometimes definitive in the diagnosis
of cutaneous T-cell disorders (2, 5). However, the
utility of this technique in very early and doubtful
cases remains controversial. The application of
highly sensitive technique for T-cell clonality
evaluation may help to define, in some instances, the
nosological status of cases of PP that probably
correspond to early MF. However, the value of this
technique is not absolute and only the clinical and
histological follow-up may help to predict the
evolution of the disease.
Mycosis Fungoides is a mature T-cell lymphoma
presenting with skin patches/plaques and
characterized by epidermal and dermal infiltration
of small to medium-sized T-cells with convoluted
nuclei. The phenotypical and genotypical features
are clonal proliferation of CD4+ T lymphocytes.
The clinical progression of MF is very slow, from
the patch and plaque stage to the dermal-based
tumor stage (8). Skin disorders, including cutaneous

Key words: parapsoriasis, mycosis fungoides

Mailing address:
Dr. Francesco Paolo D’Armiento
Cattedra di Anatomia Patologica
Dipartimento di Scienze Biomorfologiche e Funzionali
Università degli studi di Napoli Federico II 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Via Pansini 5, 80131 Napoli, Italy. This publication and/or article is for individual use only and may not be further
Tel (+39) 081-7463006 reproduced without written permission from the copyright holder.
E-mail: darmient@unina.it 105 Unauthorized reproduction may results in financial and other penalties
106 R. DI TROLIO ET AL.
T-cell lymphomas, inflammatory diseases (psoriasis),
are mediated by infiltrations of skin-homing T cells
that express an antigen called cutaneous lymphocyte-
associated antigen (CLA) (9-18). CLA, recognized by
the monoclonal antibody HECA-452 is an adhesion
molecule selectivity expressed by a subset of
circulating memory T-cells, normal T-cells in
inflamed skin and by the vast majority of cutaneous T-
cell lymphomas (19-20). CLA has been shown to be
highly expressed in cutaneous T-cell lymphomas but
few studies have compared the expression between
MF and cutaneous non-lymphoma lesions (9, 13, 15).
In this study we analysed the immunohistochemical
expression of HECA-452 in 72 PP and 61 MF patients.
All considered patients have a previous
histological diagnosis of at least 10 years. When we
compared their current diagnosis with their previous
diagnosis, we found that all the 72 PP patients had
the same diagnosis as before (stable PP), while 26 of
the 61 MF patients were diagnosed as PP previously
(evolving PP).
The major aims of this study were: 1) to evaluate
the HECA-452 expression in PP and MF; 2) to
determine the differences of HECA-452 expression
between the PP and MF; 3) to assess whether
expression increases in evolving PP toward stable PP.
MATERIALS AND METHODS
We analyzed HECA-452 expression in 133 samples
from patients treated at our University Hospital from
1998 to 2003. 72 patients had a PP and 61 had an MF
diagnosis respectively.
Parapsoriasis diagnosis was made clinically and
histologically. Clinically the PP showed erythematous and
desquamative patches, variable from 10 to 20 cm in
diameter, with no infiltration. Histologically PP showed
the following morphologic criteria: a) epidermotropism
(epidermotropism of single lymphocytes; presence of at
least 4 lymphocytes; disproportionate exocytosis of
lymphocytes; b) few atypical lymphocytes (lymphocytes
larger and/or more hyperchromatic than the normal
lymphocytes); c) sub-epidermal lymphocytic infiltrate.
Inclusion criteria for MF diagnosis was based on the
histologic criteria provided with EORTC Cutaneous
Lymphoma Study Group (21).
All cases were subjected to routine hematoxylin-
eosin and immunohistochemical study.
Immunohistochemistry was performed on formalin fixed
paraffin embedded tissue. All immunostaining techniques
were performed in paraffin-embedded tissue sections,
using a previous step of heat-induced antigen retrieval
technique for all antibodies. Thus, before incubation with
the primary antibody, the slides were heated three times in
a microwave at 650 watts for 5 minutes in a solution of
0.01 mol/L sodium citrate.
After incubation with the antibody, immunodetection
was performed with biotinylated antimouse
immunoglobulins, followed by peroxidase-labelled
streptavidine (LSAB-DAKO, Denmark) with
diaminobenzidine chromogen as substrate. All
immunostaining was performed using the Dako
Aautostainer (DAKO) automatic immunostaining device.
The antibodies used for immunohistochemical study of T
lymphoid lesions were CLA (HECA 452, DBA Italia;
1:150) and CD3 (Polyclonal, DAKO; 1:150). Moreover, in
order to exclude other types of lymphoid lesions, each case
was tested to CD20 (126,DAKO; 1:50) and CD30 (Ber-H2,
DAKO; 1:100). CD4 and CD7 immunostaining was also
performed to aid in the identification of tumor cells.
Two pathologists who had no knowledge of clinical
data independently evaluated immunostaining. The
immunoreactivity were assessed by counting the positive
lymphocytes to 10 x 250 high power fields and averaging
the results. Staining pattern was correlated with tumor
cell localization in skin (epidermal and dermo-epidermal
junction). Using isotype control staining as a reference for
background levels, cell staining was scored as low (1-10
positive lymphocytes), moderate (11-20 lymphocytes)
and intense (>20 positive lymphocytes). In order to
evaluate the difference among the various groups we used
the Kruskal-Wallis test. The number of positive
lymphocytes to the HECA-452 antibody in intraepithelial
and dermoepidermal junction was compared between PP
and MF, stable PP and evolving PP.
All P values represent two-sided tests of statistical
significance. P values < 0.05 were considered significant (22).
RESULTS
We have evaluated the HECA-452 expression in two
areas: intraepithelial (area 1) and dermo-epidermal
junction (area 2) for all the patients (72 PP and 61 MF).
Our results show a progressively increasing of HECA-
452 from the parapsoriasis to the mycosis fungoides in
both tested areas (p<0.01). The median number of
positive lymphocytes in area 1 was 12 and 29 among PP
and MF respectively (Fig. 1), while in area 2 it was 7 and
16.5 among PP and MF respectively. In our study, all
patients presented a previous histological diagnosis at
least 10 years ago. When comparing their current
diagnosis with their previous diagnosis, all of 72 PP
 Int. J. Immunopathol. Pharmacol.
50
P <0.0001
Intraepidermal lymphocytes
40
30
20
10
0 (GSA) demonstrated clonality in 37.5% of all
N= 72 61
PP MF
Fig. 1. HECA 452 expression in parapsoriasis (PP) and
in mycosis fungoides (MF). In order to evaluate the
difference among the 2 groups we used the Kruskal-Wallis
test. We found a significant increase of HECA-452
expression in the MF compared to the PP. In fact the
median number of positive lymphocytes was 12 and 29
among PP and MF respectively (p<0.0001).
patients are consistent with their previous diagnosis,
while 26 out of 61 MF have been diagnosed as PP
previously. For this reason we have evaluated HECA-452
expression between the stable PP (72 patients, group 1)
and the evolving PP towards MF (26 patients, group 2).
As shown in the Fig. 2 we noticed a significant
increase of HECA-452 expression in the evolving PP
intraepidermal lymphocytes
compared to the stable PP. In fact, the median positive
lymphocytes in group 2 was 15 and 13 in both
considered areas, compared to 9 and 9.5 found in
group 1 (p<0.05 for both). Fig. 3 (a, b and c) shows
immunohistochemical expression in the three groups.
All PP patients have been treated previously with
PUVA-therapy for 3 months. We found a strong
correlation between HECA-452 expression and
resistance to treatment. Twenty four out of 26 (92%)
evolving PP were found resistant to PUVA- therapy,
while only out 72 (6%) stable PP were resistant.
DISCUSSION
The concept of parapsoriasis (PP) is confusing and
controversial. Many authors consider that “large
plaque parapsoriasis” is a synonym of early-stage
mycosis fungoides, while others still continue to use
107
the term “large-plaque PP” (1, 3-4, 6). The
demonstration of T-cell clonality has become
important and sometimes definitive in the diagnosis of
cutaneous T-cell disorders (2, 5). However, the utility
of this technique in very early and doubtful cases
remains controversial. Recently Klemke et al. (7)
studied T-cell receptor γ-chain (TCRγ) clonality in 41
patients with borderline T-cell lymphoproliferative
disorders and demonstrated the existence of a
monoclonality pattern in 19% of skin lesion specimens
of patients with PP and in 67% of samples from
patients with MF. In the Costa et al. study (23) the
TCRγ-PCR-automated sequencing system GeneScan
evaluated samples. To determine T-cell clonality, the
GSA method of analysing the PCR product is very
useful (24-26). Differences were observed when
samples were analysed by TCRγ-PCR-GSA or by
TCRγ-PCR-PAGE (polyacrylamide gel electrophoresis
stained with ethidium bromide). The analysis of the
samples with TCRγ-PCR-GSA represents a simple
and rapid test with an overall low cost and with
theoretically greater advantages than other methods
for detecting T-cell clonality. Despite improvement in
the technology used, the molecular diagnosis of MF is
50
40
30 P < 0.05
20
10
0
N= 72 26
STABLE PP PP evolving to MF
Fig. 2. HECA 452 expression in stable parapsoriasis (PP)
and in PP evolving to mycosis fungoides (MF). In order
to evaluate the difference among the 2 groups the
Kruskal-Wallis test was used. We notified a significant
increase of HECA-452 expression in the evolving PP
compared to stable PP. In fact the median positive
lymphocytes was 9 in stable PP with respect to 15 found
in the PP evolving to MF (p<0.05).
108 R. DI TROLIO ET AL.

Fig. 3. Immunohistochemical expression of HECA-452 in stable parapsoriasis (a), in evolving parapsoriasis (b) and in
mycosis fungoides (c). The immunoreactivity were assessed by counting the positive lymphocytes in skin (epidermal and
dermo-epidermal junction) to 10 x 250 high power fields. As shown, the brown staining increases from the stable
parapsoriasis to evolving parapsoriasis. In mycosis fungoides samples the HECA-452 immunoreactivity is the most intense.

still not possible in 29% of the cases and improvement
of molecular diagnostic tools is therefore still required.
In these last cases only the follow-up was useful.
Cutaneous lymphocyte associated antigen (CLA),
recognized by HECA-452 antibody, is an inducible
carbohydrate on the P-selectin glycoprotein ligand-1.
CLA is expressed on subpopulations of human memory
T-cells and is involved in the primary step of their skin
homing. It specifically binds to E-selectin expressed by
endothelial cells. Therefore, it is believed to be responsible
for targeting lymphocytes to the skin (9, 11, 14).
Immunohistochemical analysis of HECA-452
expression on normal prostate tissue and on low and
high grade prostate cancer shows that HECA-452
expression is directly associated with prostate tumor
progression and may indicate acquisition of E-
selectin ligand expression (27).
HECA-452 has been shown to be highly
expressed in Cutaneous T-cell Lymphomas. Tumor
cells strongly expressed HECA-452 in 9 cases, were
variably expressed in 7 cases and were completely
negative for HECA-452 in single transformed MF
cases (28). Few studies have focused on the role of
HECA-452 in large plaque parapsoriasis, in
evolving PP towards MF (9,13,15).
In the present study we investigated the expression
of the HECA-452 in pre-lymphoma conditions
(evolving PP) and T-Cell lymphomas (MF). We found
that HECA-452 expression increases in MF in respect
to PP (p <0.01). We also noticed a significant HECA-
452 over-expression in the evolving PP, in respect to
the stable PP (p< 0.05). Collectively, these results
support a role for HECA-452 expression as a
biomarker for Mycosis Fungoides. Our study confirms
a recent trial that reported the expression of CLA in
MF and cutaneous lesions of adult T-cell
leukaemia/lymphoma (ATLL). CLA was expressed on
lymphoma cells in all 5 cases of erythematous stage
MF and was weakly expressed on lymphoma cells in
2 cases of plaque stage MF. In contrast, all ATLL cases
were negative for CLA expression. The authors
concluded that CLA could be used as an
immunohistochemical marker for differentiation of
MF and cutaneous lesions of ATLL (29).
Our study is relatively small and necessitates
further confirmation. It will be interesting to
compare HECA-452 to other markers such as CD25,
CD134, C-KIT and potential markers of T-cell
lymphomas (28-31). It will also be interesting to
compare HECA-452 in early stage MF and
advanced stage MF, correlating the HECA-452
expression with the response or resistance to
therapy. The analysis of T-cell receptor γ gene
rearrangements by PCR-Genescan and PCR-
Polyacrylamide gel electrophoresis in large plaque
parapsoriasis in combination with HECA-452
analysis could be very interesting.
Measurement of HECA-452 expression in
 Int. J. Immunopathol. Pharmacol.
parapsoriasis could allow the identification of
subsets of patients at a disease stage with a high risk
of developing MF. Considering that HECA-452 is
conspicuously up-regulated in lymphocytes of
patients with MF and iPP evolving to MF, targeting
the expression of HECA-452 can offer an attractive
therapeutic approach for controlling leukocyte
migration to the skin. In this respect, experimental
evidence has been recently provided about the
inhibition of HECA-452 by post-translational
glycosilations. In particular, the addition of poly-N-
acetyllactosamines could reveal a selective feature
for potential therapies targeting the synthesis of
HECA-452 epitopes, inhibiting the progression of
pre-lymphoma lesions to lymphomas (32).
ACKNOWLEDGEMENTS
The Authors are grateful for the excellent
assistance of Viviana Strazzullo.
REFERENCES
1. Haeffner A.C., B.R. Smoller, K. Zepter and G.S.
Wood. 1995. Differentiation and clonality of
lesional lymphocytes in small plaque parapsoriasis.
Arch. Dermatol. 131:321.
2. Kikuchi A., W. Naka, T. Harada, K. Sakuraoka,
R. Harada and T. Nishikawa. 1993. Parapsoriasis
in plaque: Its potential for progression in malignant
kymphoma: J Am. Acad. Dermatol. 29:419.
3. Muche M., A. Lukowsky, K. Asadullah, S.
Gellerich and W. Sterry. 1997. Demonstration of
frequent occurrence of clonal T-cells in the
peripheral blood of patients with primary cutaneous
T-cell lymphoma. Blood 4:1636.
4. Schelier U., M. Muche, W. Sterry and A.
Lukowsky. 1998. Detection of clonal T cells in
cutaneous T cell lymphoma by polimerase chain
reaction: Comparison of mutation detection
enhancement-polyacrylamide gel electrophoresis,
temperature gradient gel electrophoresis and fragment
analysis of sequencing gels. Electrophoresis 19:653.
5. Muche M., A. Lukowsky, J. Heim, H. Audring
and W. Sterry. 1999. Demonstration of frequent
occurrence of clonal T-cells in the peripheral blood
but not in the skin of patients with small plaque
109
parapsoriasis. Blood 94:1409.
6. Stachowitz S., M. Scmockel, R. Von Spanyl and
D. Abeck. 2000. Variable course of patients with
plaque psoriasis: Lack of transformation into
tumorous mycosis fungoides. Blood 95:3635.
7. Klemke CD., E. Dippel, A. Dembinski, N. Ponitz,
C. Assaf, M. Hummel, H. Stein and S. Goerdt.
2002. Clonal T cell receptor gamma-chain gene
rearrangement by PCR-based GeneScan analysis in
the skin and blood of patients with parapsoriasis and
early stage mycosis fungoides. J. Pathol. 197:348.
8. Fink-Pukes R., P. Zenahlik, B. Back, J. Smolle, H.
Kerl and L. Cerroni. 2002. Primary cutaneous
lymphomas: applicability of current classification
schemes (European Organization for Research and
Treatment of Cancer, World Health Organization)
based on clinicopathologic features observed in a
large group of patients. Blood 99:800.
9. Picker L. J., S.A. Michie, L.S. Rott and E.C.
Butcher. 1990. A unique phenotype of skin-associated
lymphocytes in humans: preferential expression of the
HECA-452 epitope by benign and malignant T cells at
cutaneous sites. Am. J. Pathol. 136:1053.
10. Berg E.L., T. Yoshino and L.S. Rott. 1991 The
cutaneous lymphocyte antigen is a skin lymphocyte
homing receptor for the vascular lectin endothelial cell-
leukocyte adhesion molecule1. J. Exp. Med. 174:1461.
11. Fuhlbrigge R.C., D. Kieffer, D. Armerding and
T.S. Kupper. 1997. Cutaneous lymphocyte antigen
is a specialized form of PSGL-1 expressed on skin-
homing T-cells. Nature 389:978.
12. Davis R.E. and B.R. Smoller. 1992. T-lymphocytes
expressing HECA-452 epitope are present in
cutaneous acute graft versus host disease and
erythema multiforme, but not in acute graft versus
host disease in gut organs. Am. J. Pathol. 141:691.
13. Borowitz M.J., A. Weidner, E.A. Olsen and L.J.
Picker. 1993. Abnormalities of circulating T cell
subpopulations in patients with cutaneous T-cell
lymphoma: cutaneous lymphocyte-associated
antigen expression on T-cells correlates with extent
of disease. Leukemia 7:859.
14. Rossiter H., F.V. Reijsen and G.C. Mudde. 1994.
Skin disease related T-cells bind to endothelial
selectins: expression of cutaneous lymphocyte
antigen (CLA) predicts E-selectin but not P-selectin
110 R. DI TROLIO ET AL.
binding. Eur. J. Immunol. 24:205.
15. Rook A.H. and P. Heald. 1995. The
immunopathogenesis of cutaneous T cell lymphoma.
Hematol. Oncol. Clin. North Am. 9: 997.
16. Santamaria Babi L.F., I. J. Picker and M.T. Perez
Soler. 1995. Circulating allergen-reactive T-cells
from patients with atopic dermatitis and allergic
contact dermatitis express the skin-selective homing
receptor, the cutaneous lymphocyte-associated
antigen. J. Exp. Med. 181:1935.
17. Robert C. and T.S. Kupper. 1999. Inflammatory
skin diseases, T cells and immune surveillance. N.
Engl. J. Med. 341:1817.
18. Sigmundssdottir H., J.E. Gudjonsson, I. Jonsdottir,
B.R. Ludviksson and H. Valdimarsson. 2001. The
frequency of CLA+ CD8+ T cells in the blood of
psoriasis patients correlates closely with the severity of
their disease. Clin. Exp. Immunol. 126:365.
19. Borges E., G. Pendl, R. Eytner, M. Steegmaier, O.
Zollner and D. Vestweber. 1997. P-selectin
glycoprotein ligand-1 (PSGL-1) on T helper 1 but not on
T helper 2 cells binds to P-selectin and supports
migration into inflamed skin. J. Biol. Chem. 272:28786.
20. Tu L., P. G. Murphy, X. Li and T.F. Tedder. 1999.
L-selectin ligands expressed by human leukocytes
are HECA-452 antibody–defined carbohydrate
epitopes preferentially displayed by P-selectin
ligand-1. J. Immunol. 163:5070.
21. Santucci M., A. Biggeri and A.C. Feller. 2000.
Efficacy of histologic criteria for diagnosing early
mycosis fungoides: An EORTC cutaneous
lymphoma study group investigation. European
Organization for Research and Treatment of Cancer.
Am. J. Surg. Pathol. 24:40.
22. Kaplan E.L. and P. Meier. 1958. Nonparametric
estimation from incomplete observation. J. Am. Stat.
Assoc. 53:457.
23. Costa C., F. Gallardo, B. Bellosillo, B. Espinet,
R. M. Pujol, C. Barranco, S. Serrano and F. Sole.
2003. Analysis of T-cell Rceptor γ Gene
rearrangements by PCR-Genescan and PCR-
Polyacrylamide Gel electrophoresis in early stage
mycosis fungoides/large plaque parapsoriasis.
Dermatology 207:418.
24. Dippel E., C. Assaf, M. Hummel, H. Schrag, H.
Stein, S. Goerdt and C. Orfanos. 1999. Clonal T-
cell receptor γ chain gene rearrangement by PCR-
Genescan analysis in advanced cutaneous T-cell
lymphoma: A critical evaluation. J. Pathol. 188:146.
25. Assaf C., M. Hummel, E. Dippel, S. Goerdt, H.
Muller, I. Anagnastopoulos, C.E. Orfanos and H.
Stein. 2000. High detection rate of T-cell receptor beta
chain rearrangement in T-cell lymphoproliferations by
family specific polymerase chain reaction in
combination with the Genescan technique and DNA
sequencing. Blood 96:640.
26. Gutzmer R., S. Mommert, P. Kiehl, M. Wittmann,
A. Kapp and T. Werfel. 2001. Detection of clonal T
cell receptor γ gene rearrangement in cutaneous T
cell lymphoma by Lightcycler-polymerase chain
reaction. J. Invest. Dermatol. 116:926.
27. Dimitroff C.J., M. Lechpammer, D.N. Woodward
and J.L. Kutok. 2004. Rolling of human bone-
metastatic prostate tumor cells on human bone
marrow endothelium under shear flow is mediated
by E-selectin. Cancer Res. 64:5261.
28. Jones D., S. Ibrahim, K. Patel, R. Luthra, M.
Duvic and L.J. Medeiros. 2004. Degree of CD25
expression in T-cell lymphoma is dependent on
tissue sites: Implications for targeted therapy. Clin.
Cancer Res. 10:5587.
29. Yamaguchi T., K. Ohshima, T. Tsuchiya, H. Suehuji,
K. Karube, J. Nakayama, J. Suzumiya, T. Yoshino
and M. Kikuchi. 2003. The comparison of expression
of cutaneous lymphocyte-associated antigen (CLA),
and Th1- and Th2-associated antigens in mycosis
fungoides and cutaneous lesions of adult T-cell
leukemia/lymphoma. Eur. J. Dermatol. 13:553.
30 Gniadecki R. and K. Rossen. 2003. Expression of
T-cell activation marker CD134 (OX40) in
lymphomatoid papulosis. Br. J. Dermatol. 148:885.
31. Brauns T.C., T. Schultewolter, J. Dissemond, J.
Maschke and M. Goos. 2004. C-Kit expression in
primary cutaneous T-cell lymphomas. J. Cutan.
Pathol. 31:577.
32. Dimitroff C.J., R.J. Bernacki and R. Sackstein.
2003. Glycosylation-dependent inhibition of
cutaneous lymphocytes-associated antigen expression:
implications in modulating lymphocyte migration to
skin. Blood 101:602.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 111-118 (2006)

CHLAMYDIA PNEUMONIAE IN ASYMPTOMATIC CAROTID ATHEROSCLEROSIS

R. SESSA, M. DI PIETRO, G. SCHIAVONI, M. GALDIERO1, P. CIPRIANI, S. ROMANO2,
C. ZAGAGLIA, I. SANTINO, S. FACCILONGO and M. DEL PIANO

Department of Public Health Sciences, “La Sapienza” University Rome; 1Department of

Experimental Medicine, Second University of Naples, Naples; 2Department of Internal Medicine,
Cardiology, University of L’Aquila, Italy

Received March 15, 2005 – Accepted April 7, 2005

We evaluated, in 415 patients with asymptomatic carotid atherosclerosis: (i) the prevalence of C.
pneumoniae DNA in atherosclerotic carotid plaques and peripheral blood mononuclear cells (PBMC); (ii)
the distribution of C. pneumoniae in atherosclerotic carotid plaques and PBMC from the same patients;
(iii) the correlation between circulating anti-chlamydial antibodies and the presence of C. pneumoniae
DNA. Overall, 160 atherosclerotic carotid plaques and 174 PBMC specimens from patients with
asymptomatic carotid atherosclerosis were examined by ompA nested touchdown PCR for presence of C.
pneumoniae. In addition, C. pneumoniae DNA was detected in 81 specimens of atherosclerotic carotid
plaque and PBMC obtained from the same patients. C. pneumoniae DNA was found in 36.9% of
atherosclerotic carotid plaques and in 40.2% of PBMC specimens examined (P=NS). With regard to 81
patients, C. pneumoniae DNA was detected in 27.2% of atherosclerotic carotid plaques and in 44.4% of
PBMC specimens (P=0.05). In 18 patients, the presence of C. pneumoniae DNA in PBMC specimens and
atherosclerotic carotid plaques coincided (P=0.005). No statistically significant association was found
between anti-C. pneumoniae antibodies (IgG and IgA) and positive PCR results. In conclusion, our results
suggest that the detection of C. pneumoniae DNA in PBMC specimens seems to be a first-choice method to
identify the patients at risk for endovascular chlamydial infection.

A number of infectious agents have been
implicated in atherosclerosis, such as Helicobacter
pylori, Cytomegalovirus and periodontal bacteria, but
by far the most studied is Chlamydia pneumoniae (1).
C. pneumoniae, a common pathogen in human
respiratory tract infections, is the sole viable pathogen
detected in atherosclerotic plaques arteries (2-4).
During the past decade the role of this organism in the
development of atherosclerosis and coronary heart
disease has been extensively explored and association
with other vascular diseases such as atherosclerotic
carotid diseases and ischemic cerebrovascular
diseases has been proposed (5).
The first suggestion that C. pneumoniae may be
associated with atherosclerosis was proposed in 1988
by Saikku et al. (6). Similar seroepidemiological
results have now been confirmed by about 38 studies
of varying designs (retrospective, cross-sectional,
case-control, or prospective) world wide (7-11).
However, reports from several studies (12-14) have
failed to demonstrate an association between

Key words: Chlamydia pneumoniae, atherosclerotic carotid disease, polymerase chain reaction

Mailing address:
Prof.ssa Rosa Sessa
Dipartimento di Scienze di Sanità Pubblica
Università di Roma “La Sapienza”
P.le Aldo Moro, 5 -00185 Rome 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Tel: 0039-06-49914635 This publication and/or article is for individual use only and may not be further
Fax: 0039-06-49914634 reproduced without written permission from the copyright holder.
E-mail: rosa.sessa@uniroma1.it 111 Unauthorized reproduction may results in financial and other penalties
112 R. SESSA ET AL.
antibodies to C. pneumoniae and atherosclerosis since
a large part of the population has pre-existing IgG
antibodies from previous exposure(s). On the other
hand, the detection of C. pneumoniae DNA in
atherosclerotic lesions of subjects with cardiovascular
diseases has strengthened the likelihood of its possible
involvement in the pathogenesis of atherosclerosis.
Evidence for the presence of the organism in the
atherosclerotic lesions has emerged from more than 40
studies using immunohistochemistry, electron
microscopy and amplification of chlamydial DNA by
polymerase chain reaction (PCR) (8, 15-17). Recently
several studies have shown the presence of C.
pneumoniae DNA in peripheral blood mononuclear
cells (PBMC) of patients with atherosclerotic
cardiovascular disease, suggesting that detection of C.
pneumoniae DNA in PBMC may be a valid surrogate
marker to identify individual risk for endovascular
chlamydial infection (18-21).
The aims of our study were to investigate, in
patients with asymptomatic carotid atherosclerosis: (i)
the prevalence of C. pneumoniae DNA in
atherosclerotic carotid plaques and peripheral blood
mononuclear cells (PBMC); (ii) the distribution of C.
pneumoniae in atherosclerotic carotid plaques and
PBMC from the same patients; (iii) the correlation
between circulating anti-chlamydial antibodies and the
presence of C. pneumoniae DNA.
MATERIALS AND METHODS
Between January 2003 and December 2004, 415
patients (303 male and 112 female; mean age 72+11
years) with asymptomatic carotid atherosclerosis were
enrolled. All patients underwent colour flow echo
Doppler imaging, and carotid angiography. One hundred
and sixty specimens of atherosclerotic carotid plaque
were obtained from 160 patients during carotid
endarterectomy. One hundred and seventy-four PBMC
specimens were obtained from 174 patients who did not
undergo a carotid endarterectomy. In addition, 81 patients
(61 male and 20 female, mean age 73+12 years) with
asymptomatic carotid atherosclerosis were included in
this study; specimens of atherosclerotic carotid plaque
and PBMC were obtained from each patient during
carotid endarterectomy. Endarterectomy involved a long
arteriotomy with dissection of the atherosclerotic lesions
in toto. The degree of carotid artery stenosis in patients
undergoing carotid endarterectomy was greater than 85%.
For serologic analysis, a serum sample was obtained
from each patient enrolled in this study.
Patients characteristics were as follows: 304 (73.2 %)
were current or past-smokers, 161 (38.8 %) had diabetes,
311 (74.9%) had hypertension, 149 (35.9%) had
dyslipidemia, 199 (47.9%) had coronary heart disease.
DNA isolation
Carotid plaques. Multiple sections of each
atherosclerotic carotid plaque, stored at –80°C, were
analyzed as described recently (22). DNA from
atherosclerotic carotid plaque was extracted by using a
QIAamp DNeasy Tissue kit (Qiagen) according to the
manufacturer’s instructions. DNA was eluted in a final
volume of 100 µl, aliquoted, and stored at –20°C.
PBMC. Blood samples (5 ml) were processed to
isolate PBMC in accordance with a method described by
Condos et al. (23), and stored at – 80°C.
DNA from PBMC specimens was extracted by using
a QIAamp DNA Mini-kit (Qiagen) according to the
manufacturer’s instructions. DNA was eluted in a final
volume of 100 µl, aliquoted, and stored at –20°C.
In order to minimise the risk of false-positive results,
negative reagent controls obtained by replacing clinical
specimens with an equal volume of ultrapure water PCR
grade were included and processed throughout the whole
extraction procedure.
Polymerase chain reaction
In order to assess the presence of possible PCR-
inhibitors human β-globin gene was amplified from all
DNA samples. Detection of C. pneumoniae DNA was
performed by ompA nested touchdown PCR as previously
described (24). All amplification reactions were carried out
in a total volume of 50 µl containing 5 µl of extracted DNA.
Four controls, consisting of one positive and three
negative controls (C. pneumoniae AR-39 and ultrapure
water PCR grade, respectively), and negative extraction
controls (as previously described) were also included. All
negative controls (extraction and PCR controls) were
exposed to air throughout specimen addition.
Each clinical specimen was analyzed in replicates of
3. A specimen was considered positive if two of the three
replicates were positive. PCR-positive specimens were
also amplified in triplicate by non-nested PCR targeting
the C. pneumoniae specific PstI fragment (25). To prevent
contamination of the samples, reagent preparation and
product analysis were performed in three separate areas
with the use of filter-tipped pipets.
Serologic analysis
C. pneumoniae antibodies (IgG, IgA) were measured
by a microimmunofluorescence test. Titers of IgG 1:32 or
higher and IgA 1:16 or higher were considered positive.
 Int. J. Immunopathol. Pharmacol. 113

Statistical analysis Table I. Pattern of distribution of C. pneumoniae among

The results were subjected to statistical analysis, using 81 patients with asymptomatic carotid atherosclerosis.
y p
the χ2 test to compare frequency distributions, with Yates’
correction. When the minimum estimated expected value PBMC Carotid Serology No. of
was <5, Fisher’s exact test was used. Furthermore, plaques findings patients
McNemar’s test was used for comparisons of paired
Positive Positive Positive* 18
results. Statistical significance was determined at an
alpha-level of 0.05. Positive Negative Positive 17

Negative Positive Positive 4

RESULTS
Negative Negative Positive 24

PCR detection of C. pneumoniae Negative Negative Negative 18

Overall, 160 atherosclerotic carotid plaques and *
174 PBMC specimens from patients with *DDefined
fi d Ias
G IgG
32 ≥32
I A or16IgA ≥16.

asymptomatic carotid atherosclerosis were

examined for presence of C. pneumoniae.
C. pneumoniae DNA was detected in 59 (36.9%)
of 160 atherosclerotic carotid plaques and in 70
(40.2%) of 174 PBMC specimens examined (P=not
significant) (Fig. 1). Prevalence of C pneumoniae
DNA in atherosclerotic carotid plaques and PBMC
obtained from each of 81 patients with
asymptomatic carotid atherosclerosis is shown in
Fig. 2. A higher positivity rate of C. pneumoniae was
found in PBMC (44.4%) than in atherosclerotic
carotid plaques (27.2%) (p=0.05).
The pattern of distribution of C. pneumoniae
among 81 patients is shown in Table I. C
pneumoniae DNA was detected in both
atherosclerotic carotid plaques and PBMC in 18
patients, in PBMC but not in atherosclerotic carotid
plaques in 17 patients, and in atherosclerotic carotid
plaques in only 4 patients. Eighteen patients were
negative by both C. pneumoniae serology and PCR
in atherosclerotic carotid plaques and PBMC.
Serologic detection of C. pneumoniae
C. pneumoniae IgG and IgA were found in 73.9%
(247/334) and in 47.3% (158/334) of patients with

100

80

60
%
40

20

0
PBMC Carotid plaques

+
PCR+ PCR--

Fig. 1. Prevalence of Chlamydia pneumoniae DNA, detected by ompA nested touchdown PCR, in PBMC and
atherosclerotic carotid plaques of patients with asymptomatic carotid atherosclerosis (PCR+, Polymerase chain reaction
positive; PCR-, Polymerase chain reaction negative).
114 R. SESSA ET AL.

Table II. Results of Chlamydia pneumoniae DNA in relation to IgG and IgA anti-Chlamydia pneumoniae in patients
with asymptomatic carotid atherosclerosis.

PCR+= polymerase chain reaction positive; PCR-= polymerase chain reaction negative.

asymptomatic carotid atherosclerosis. High IgG DISCUSSION

(≥512) and IgA (≥256) titers were found in 39.5%
(132/334) and in 20.9% (70/334) respectively of
patients examined.
As regard to patients whose specimens of
atherosclerotic carotid plaques and PBMC
specimens were analyzed, C. pneumoniae IgG and
IgA were found in 75.3% (61/81) and in 48.1%
(39/81) respectively of 81 patients; high IgG (≥512)
and IgA (≥256) titers were found in 35.8% (29/81)
and in 22.2% (18/81), respectively.
PCR findings in atherosclerotic carotid plaques,
and in PBMC specimens are compared with C.
pneumoniae IgG and IgA antibodies in Tables II and
III. No statistically significant association was found
between anti-C. pneumoniae antibody titers and
positive PCR results reported for 334 patients with
asymptomatic carotid atherosclerosis. The same
finding was observed when we examined anti-C.
pneumoniae antibody titers and positive PCR results
reported for 81 patients.
Our study provides further evidence for the
involvement of C. pneumoniae in carotid
atherosclerosis. Firstly, C. pneumoniae is able to
disseminate systemically from the lungs through
infected PBMC and to localize in arteries, where it may
infect endothelial cells, vascular smooth muscle cells,
monocytes/macrophages and promote inflammatory
atherogenous process. Indeed, in our study, C.
pneumoniae DNA was found in PBMC (40.2%) as
well as in atherosclerotic carotid plaques (36.9%).
In the literature, reported PCR detection rates of
C. pneumoniae DNA in PBMC and in
atherosclerotic carotid plaques from patients with
atherosclerotic cardiovascular diseases vary
between 6% (26) and 87% (27) and between 0%
(28) and 83% (27) respectively. However, no
standardized PCR assays are available yet and the
discordant positivity rates may be attributable to low
concentration of C. pneumoniae DNA in clinical

Table III. Results of Chlamydia pneumoniae DNA in relation to IgG and IgA anti-Chlamydia pneumoniae in 81 patients
with asymptomatic carotid atherosclerosis.
PBMC P Carotid plaques P

PCR+ (n=35) PCR- (n=46 ) Total (n=81) PCR+ (n=22) PCR- (n=59) Total (n=81)

IgG ≥ 32 28 (80.0%) 33 (71.2%) 61 (75.3%) NS 18 ( 81.8%) 43 (72.9%) 61 (75.3%) NS

IgG≥ 512 13 (37.1%) 16 (34.8%) 29 (35.8%) NS 9 (40.9%) 20 (33.8%) 29 (35.8%) NS
IgA ≥ 16 18 (51.4%) 21 (45.6%) 39 (48.1%) NS 11 (50.0 %) 28 (47.4%) 39 (48.1%) NS
IgA ≥ 256 7 (20.0%) 11 (23.9%) 18 (22.2%) NS 5 (22.7%) 17 (28.8%) 18 (22.2%) NS

PCR+= polymerase chain reaction positive; PCR-= polymerase chain reaction negative.
 Int. J. Immunopathol. Pharmacol. 115

100

80

60
%
40

20

0
PBMC Carotid plaques

+
PCR+ PCR--
Fig. 2. Prevalence of Chlamydia pneumoniae DNA, detected by ompA nested touchdown, PCR in PBMC and
atherosclerotic carotid plaques of 81 patients with asymptomatic carotid atherosclerosis (PCR+, Polymerase chain
reaction positive; PCR-, Polymerase chain reaction negative).

specimens and, hence, to poor reproducibility of
PCR results. Secondly, we examined atherosclerotic
carotid plaques and PBMC obtained from each of 81
patients with asymptomatic carotid diseases for the
presence of C. pneumoniae DNA. A significantly
higher prevalence of C. pneumoniae DNA was
found in PBMC (44.4%) than in atherosclerotic
carotid plaques (27.2%) (P=0.05). In particular, in
18 patients the presence of C. pneumoniae DNA in
PBMC specimens and atherosclerotic carotid
plaques coincided (P=0.005). These results
supported that detection of C. pneumoniae DNA in
PBMC may be an alternative approach to identifying
subjects carrying C. pneumoniae in the vascular
wall. Indeed, in a previous study, we have
demonstrated that C. pneumoniae DNA in PBMC
may be associated with symptomatic carotid
atherosclerotic disease (29).
However, to date, only a few reports (27, 29-31)
on the presence of C. pneumoniae in atherosclerotic
lesions and PBMC obtained from the same patients
have been generated; in these studies C. pneumoniae
was more common in the PBMC than in
atherosclerotic lesions although this was not
statistically significant. A similar study was carried
out by Apfalter et al. (32). They have demonstrated,
by PCR real-time, the presence of C. pneumoniae
DNA in PBMC (5.6%) but not in atherosclerotic
carotid plaques. A higher positivity rate of C.
pneumoniae found in PBMC than in atherosclerotic
carotid plaques may be explained by the patchy
distribution of C. pneumoniae within atherosclerotic
lesions. Furthermore, the detection of C.
pneumoniae DNA in PBMC has the advantage that
the blood specimen is easily available compared
with atherosclerotic carotid plaque. Indeed, the
atherosclerotic arteries plaques are obviously
obtained too late in the course of the disease to be of
clinical use. Therefore, the detection of C.
pneumoniae DNA in PBMC seems to be a first-
choice method to evaluate the role of C. pneumoniae
in patients at risk of endovascular chlamydial
infection. When evaluating IgG and IgA antibodies
against C. pneumoniae, we, in accordance with other
authors (27, 33-34), did not observe any statistically
significant correlation between PCR detection of C.
116 R. SESSA ET AL.
pneumoniae and serology. These results confirmed
that serological tests do not appear suitable for
predicting vascular C. pneumoniae infection.
Regarding the poor reproducibility of PCR results,
we found (35), in accordance with the results of
Smieja et al. (36), that repeated testing of the same
specimen increased reproducibility of the PCR
results, providing a more accurate estimate of the
prevalence of C. pneumoniae in PBMC. However,
the replicate PCR testing requires a more complex
workflow and a careful control of product carryover
contamination and is a labour-intensive procedure
for routine clinical laboratories. These problems
may be overcome with application of the
quantitative real-time PCR technology which
combines rapid amplification and sequence-specific
detection of amplicons in an automated and
standardized format.
In conclusion, we believe that development of a
PBMC-based real-time PCR may be a promising
future diagnostic approach to detect C. pneumoniae
at low concentration in the circulation and in the
vascular wall even if further studies are needed to
evaluate whether the quantitative detection of C.
pneumoniae could be of help in clarifying the
etiology-pathogenic role of C. pneumoniae in
patients at risk of atherosclerotic carotid disease.
REFERENCES
1. O’Connor S., C. Taylor, L.A. Campbell, S.
Epstein and P. Libby. 2001. Potential infectious
etiologies of atherosclerosis: a multifactorial
perspective. Emerg. Infect. Dis. 7:780.
2. Jackson L.A., L.A. Campbell, C.C. Kuo, D.I.
Rodriguez, A. Lee and A. Grayston. 1997.
Isolation of Chlamydia pneumoniae from a carotid
endarterectomy specimen. J. Infect. Dis. 176:292.
3. Maass M., C. Bartels, P.M. Engel, U. Mamat and
H.H. Sievers. 1998. Endovascular presence of
viable Chlamydia pneumoniae is a common
phenomenon in coronary artery disease. J. Am. Coll.
Cardiol. 31:827.
4. Apfalter P., M. Loidl, R. Nadrchal, A.
Makristathis, M. Rotter, M. Bergmann, P.
Polteraurer and A.M. Hirschl. 2000. Isolation and
continuous growth of Chlamydia pneumoniae from
arterectomy specimens. Eur. J. Clin. Microbiol.
Infect. Dis. 19:305.
5. Gaydos C.A. and T.C. Quinn. 2000. The role of
Chlamydia pneumoniae in cardiovascular disease.
Adv. Intern. Med. 45:139.
6. Saikku P., M. Leinonen, K. Mattila, M.R. Ekman,
M.S. Nieminen, P.H. Makela, J.K. Huttunen and
V. Valtonen. 1988. Serological evidence of an
association of novel Chlamydia, TWAR, with
chronic coronary heart disease and acute myocardial
infarction. Lancet 2:983.
7. Sessa R., M. Di Pietro, I. Santino, M. del Piano, A.
Varveri, A. Dagianti and M. Penco. 1999.
Chlamydia pneumoniae infection and atherosclerotic
coronary disease. Am. Heart J. 137:1116.
8. Boman J. and M.R. Hammerschlag. 2002.
Chlamydia pneumoniae and atherosclerosis: critical
assessment of diagnostic methods and relevance to
treatment studies. Clin. Microbiol. Rev. 15:1.
9. Romano S., S. Fratini, M. Di Pietro, G. Schiavoni,
M. Nicoletti, F. Chiarotti, M. del Piano, M. Penco
and R. Sessa. 2004. Chlamydia pneumoniae
infection in patients with acute coronary syndrome:
a clinical and serological 1-year follow-up. Int. J.
Immunopathol. Pharmacol. 17:209.
10. Heltai K., Z. Kis, K. Burian, V. Endresz, A. Veres,
E. Ludwing, E. Gonczol and I. Valyi-Nagy. 2004.
Elevated antibodies levels against Chlamydia
pneumoniae, human HSP60 and mycobacterial
HSP65 are independent risk factors in myocardial and
ischaemic heart disease. Atherosclerosis 1732:339.
11. Yetkin G., E. Yetkin, Y. Aksoy, O.A. Gurbuz and
A. Mert. 2004. Changes in antibodies titers against
Chlamydia pneumoniae after coronary angioplasty.
Int. J. Cardiol. 95:293.
12. Nobel M., A. De Torrentè, O. Peter and D. Gennè.
1999. No serological evidence of association
between Chlamydia pneumoniae infection and acute
coronary heart disease. Scand. J. Infect. Dis. 31:261.
13. Danesh J., P. Whincup, M. Walker, L. Lennon, A.
Thomson, P. Appleby, Y.K. Wong, M. Bernardes-
Silva and M. Ward. 2000. Chlamydia pneumoniae
IgG titres and coronary heart disease: prospective
study and meta-analysis. B.M.J. 321:208.
14. Danesh J., P. Whincup, S. Lewington, M. Walker,
 Int. J. Immunopathol. Pharmacol.
L. Lennon, A. Thomson, Y.K. Wong, X. Zhou
and M. Ward. 2002. Chlamydia pneumoniae IgA
titres and coronary heart disease: prospective study
and meta-analysis. Eur. Heart J. 23:371.
15. Rassu M., S. Cazzavillan, M. Scagnelli, A. Peron,
P.A. Bevilacqua, M. Facco, G. Bertoloni, F.M.
Lauro, R. Zambello and E. Bonoldi. 2001.
Demonstration of Chlamydia pneumoniae in
atherosclerotic arteries from various vascular
regions. Atherosclerosis 158:73.
16. Sessa R., M. Di Pietro, G. Schiavoni, M. Nicoletti,
G. Soda, S. Nardoni, D. Bosco, I. Santino, P.
Cipriani and M. del Piano. 2004. Detection of
Chlamydia pneumoniae in atherosclerotic coronary
arteries. Int. J. Immunopathol. Pharmacol. 17:301.
17. Bahrmand A.R., M. Bahadori, A. Hossaini, A.A.
Velayati, S. Aghabozorgy, A. Shakoor and V.V.
Bakayev. 2004. Chlamydia pneumoniae DNA is more
frequent in advanced than in mild atherosclerosis
lesions. Scand. J. Infect. Dis. 362:119.
18. Boman J., S. Sodeberg, J. Forsberg, L. S.
Birgander, A. Allard, K. Person, E. Jidell, U.
Kumlin, P. Juto, A. Waldenstrom and G. Wadell
1998. High prevalence of Chlamydia pneumoniae
DNA in peripheral blood mononuclear cells in
patients with cardiovascular disease and middle-
aged blood donors. J. Infect. Dis. 78:274.
19. Sessa R., M. Di Pietro, G. Schiavoni, I. Santino, P.
Cipriani, S. Romano, M. Penco, A. Dagianti and
M. del Piano. 2001. Prevalence of Chlamydia
pneumoniae in peripheral blood mononuclear cells
in Italian patients with acute ischaemic heart disease.
Atherosclerosis 159:521.
20. Smieja M., J. Mahony, A. Petrich, J. Boman and
M. Chernesky. 2002. Association of circulating
Chlamydia pneumoniae DNA with cardiovascular
disease: a systematic review. B.M.C. Infect. Dis. 2:1.
21. Sessa R., M. Di Pietro, R. Ratanarat, M. Rassu
and C. Ronco. 2005. Chlamydia pneumoniae as risk
factor of cardiovascular disease in dialysis patients.
Int. J. Artif. Organs 281:37.
22. Cochrane M., A. Pospischil, P. Walker, H. Gibbs
and P. Timms. 2003. Distribution of Chlamydia
pneumoniae DNA in atherosclerotic carotid arteries:
significance for sampling procedures. J. Clin.
117
Microbiol. 414:1454.
23. Condos R., A. McClune, W.N. Rom and N.W.
Schluger. 1996. Peripheral-blood based PCR assay
to identify patients with active pulmonary
tuberculosis. Lancet 34:1082.
24. Tong C.Y.W. and M. Sillis. 1993. Detection of
Chlamydia pneumoniae and Chlamydia psittaci in
sputum samples by PCR. J. Clin. Pathol. 46:313.
25. Campbell L.A., M. Perez-Melgosa, S. Hamilton,
C. C. Kuo and J. T. h Grayston. 1992. Detection of
Chlamydia pneumoniae by the polymerase chain
reaction. J. Clin. Microbiol. 30:434.
26. Da Costa C.P., P. Ahmad-Nejad, M. Schmid, F.J.
Neumann, H. Wagner and T. Miethke. 2000. Low
prevalence of Chlamydia pneumoniae DNA in PBMCs
of coronary heart-disease patients and blood donors:
influence of treatment with roxithromycin. Proceedings
of the Fourth Meeting of the European Society for
Chlamydia Research. Helsinki, Finland, p. 248
27. Prager M., Z. Turel, S.W. Speidl, G. Zorn, C.
Kaun, A. Niessner, G. Heinze, I. Huk, G. Maurer,
K. Huber and J. Wojta. 2002. Chlamydia
pneumoniae in carotid artery atherosclerosis: a
comparison of its presence in atherosclerotic plaque,
healthy vessels, and circulating leukocytes from the
same individuals. Stroke 33:2756.
28. Bishara J., S. Pitlik, A. Kazakov, G. Sahar, M.
Haddad, A. Vojdani, S. Rosenberg and Samra.
2003. Failure to detect Chlamydia pneumoniae by
cell culture and polymerase chain reaction in major
arteries of 93 patients with atherosclerosis. Eur. J.
Clin. Microbiol. Infect. Dis. 22:300.
29. Sessa R., M. Di Pietro, G. Schiavoni, I. Santino,
F.B. Valentini, R. Perna, S. Romano and M. del
Piano. 2003. Chlamydia pneumoniae DNA in
patients with symptomatic carotid atherosclerotic
disease. J. Vasc. Surg. 37:1027.
30. Blasi F., J. Boman, G. Esposito, G. Melissano, R.
Chiesa, R. Cosentini, P. Tarsia, Y. Tshomba, M.
Betti, M. Alessi, N. Morelli and L. Allegra. 1999.
Chlamydia pneumoniae DNA detection in peripheral
blood mononuclear cells is predictive of vascular
infection. J Infect Dis 180:2074.
31. Berger M., B. Schroder, G. Daeschlein, W.
Schneider, A. Busjahn, I. Buchwalow, C. F. Luft
118 R. SESSA ET AL.
and Haller H. 2000. Chlamydia pneumoniae DNA
in non-coronary atherosclerotic plaques and
circulating leukocytes. J. Lab. Clin. Med. 136:194.
32. Apfalter P., W. Barousch, M. Nehr, B. Willinger,
Rotter M. and A.M. Hirschl. 2004. No evidence of
involvement of Chlamydia pneumoniae in severe
cerebrovascular atherosclerosis by means of
quantitative real-time polymerase chain reaction.
Stroke 35:2024.
33. Maass M., J. Gieffers, E. Krause, P.M. Engel, C.
Bartels and N. Solbach. 1998. Poor correlation
between microimmunofluorescence serology and
polymerase chain reaction for detection of vascular
Chlamydia pneumoniae infection in coronary artery
disease patients. Med. Microbiol. Immunol. 187:103.
34. Labiche R., D. Koziol, T.C. Quinn, C. Gaydos, S.
Azhar, G. Ketron, S. Sood and J.T. DeGabra.
2001. Presence of Chlamydia pneumoniae in human
symptomatic and asymptomatic carotid
atherosclerotic plaque. Stroke 32:855.
35 Sessa R., G. Schiavoni, M. Di Pietro, A. Petrucca,
P. Cipriani, C. Zagaglia, S. Fallucca and M. del
Piano. 2005. Chlamydia pneumoniae in PBMC:
reproducibility of the ompA nested touchdown PCR.
Int. J. Immunopathol. Pharmacol. 18:113.
36. Smieja M., J.B. Mahony, C.H. Goldsmith, S.
Chong, A. Petrich and M. Chernesky. 2001.
Replicate PCR testing and probit analysis for
detection and quantitation of Chlamydia pneumoniae
in clinical specimens. J. Clin. Microbiol. 39:1796.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 119-129 (2006)

T CELL ASSESSMENT IN ALLERGIC DRUG REACTIONS DURING THE ACUTE

PHASE ACCORDING TO THE TIME OF OCCURRENCE
M.J. TORRES, C. MAYORGA1, T.D. FERNÁNDEZ1, J.A. CORNEJO-GARCÍA1, C.
ANTÚNEZ1, M. VALENZUELA1, M.F. DEL PRADO2, R. RODRIGUEZ-PENA1 and M. BLANCA

Allergy Service, Carlos Haya Hospital, Málaga; 1Research Laboratory for Allergic Diseases,
Carlos Haya Hospital, Málaga; 2Emergency Unit, Carlos Haya Hospital, Málaga, Spain

Received April 11, 2005 – Accepted January l6, 2006

Allergic drug reactions can be classified as immediate, accelerated or delayed. This classification
usually correlates with the mechanism involved: immediate reactions are IgE mediated and delayed
reactions are T cell dependent. We analyzed lymphocyte involvement in patients with these reactions
by determining cell subpopulations, activation state and skin homing receptor expression (CLA) in
blood and skin. Patients with immediate, accelerated and delayed reactions were evaluated during the
acute phase and after resolution. Controls taking drugs were included. Phenotypic
immunofluorescence analysis was done by flow cytometry in peripheral blood, and by
immunohistochemistry in skin for delayed reactions. Forty-six patients were included, 17 with
immediate reactions, 10 accelerated and 19 delayed. At the acute phase CLA was significantly increased
in delayed reactions and HLA-DR in all three types of reaction. In the severest delayed reactions,
Steven-Johnson/Lyell syndromes, the CD4 subsets were increased in peripheral blood and skin
compared to maculopapular exanthemas and urticaria and HLA-DR when compared with urticaria.
In maculopapular exanthemas CLA was significantly increased in peripheral blood and skin compared
to urticaria and the severe reactions. We found that T-cells are implicated, besides delayed reactions, in
immediate and accelerated reactions. In delayed reactions there is a parallelism between results found
in skin and peripheral blood with a higher participation of CD4+ cells the more severe the reaction.

Adverse reactions to drugs, including allergy to
drugs, are an important cause of iatrogenic disease,
and the rates of death and disease, as well as
associated costs, are often underestimated (1). The
rates of drug allergy in hospitalized patients have
recently been reported at 4.2 per 1000, drug allergy
during the course of inpatient treatment at 2.7 per
1000 and death attributable to drug allergy at 0.09
per 1000 hospitalizations (2).
Depending on the interval of time between drug
intake and the onset of the reaction, allergic
reactions to drugs have been classified into three
main groups: immediate, accelerated and delayed
(3). This classification, which was originally
described for betalactams, is also applied to other
drugs and usually correlates with the mechanism
involved; immediate reactions are IgE mediated and
delayed reactions are T cell dependent (4). However,
the mechanisms involved in accelerated drug
reactions are not so well understood, although they

Keywords: drug reactions, T cells, IgE, CLA, activation markers, severity, peripheral blood, skin

Mailing address:
Maria Jose Torres Jaen, MD, PhD
Allergy Service,
Hospital Civil, pabellón 5,
sótano, 29009 Malaga, Spain 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Tel: +34 951030346 This publication and/or article is for individual use only and may not be further
Fax: +34 951030302 reproduced without written permission from the copyright holder.
E-mail: mariaj.torres.sspa@juntadeandalucia.es 119 Unauthorized reproduction may results in financial and other penalties
120 M.J. TORRES ET AL.
are thought to be T cell mediated (5). Our group has
recently shown that immunologic reactions to drugs
follow the classical Th1/Th2 paradigm in vivo, with
immediate reactions expressing a Th2 pattern and
delayed reactions a Th1 pattern (6). Most in vitro
studies, however, have shown a heterogeneous
profile of cytokine production, with lack of full
agreement with the clinical diagnosis (7-8).
The involvement of T cells in allergic drug
reactions has mainly been studied in cutaneous
delayed reactions, but sufficient information is lacking
for immediate and accelerated reactions. We have
previously found that T lymphocytes in peripheral
blood from patients with delayed reactions to drugs
express increased levels of the activation markers
CD69, CD25 and HLA-DR, as well as the cutaneous
lymphocyte antigen (CLA), during the acute response;
these levels normalize when the clinical reaction
subsides (9-10). However, different situations have
been reported concerning the T cell subpopulations.
Some authors have found a predominant HLA-DR+
activation in the CD8+ cells in circulating cells in
patients with more severe skin symptoms and
predominant HLA-DR+ activation of the CD4+
peripheral blood cells in weak maculopapular
eruptions (11), whereas skin biopsies have shown that
the majority of the T cells involved in severe reactions
are of the CD4+ phenotype (9,12). However, these
results in skin have not always been confirmed, and in
severe reactions, such as Lyell Syndrome, a
predominant infiltrate of CD4+ cells was found in the
dermis and of CD8+ in the epidermis (13-14) with a
predomination of activated CD8+CLA+ cells in blister
fluid (15-16). Therefore, in order to determine more
precisely the T cell involvement in different types of
allergic drug reactions, we performed a systematic
analysis of T cell subpopulations, their activation state
and the expression of the skin homing receptor in
blood and skin infiltration during the acute phase of a
drug reaction in relation to the clinical symptoms, the
severity and the time of occurrence of the reaction.
MATERIAL AND METHODS
Patients and controls
Patients who developed a suspected allergic drug
reaction over a three year period (2000-2003) were
evaluated. Only patients with a clinical history of confirmed
drug allergy, and having had skin testing or drug
provocation test (DPT) when required, were finally
included. The clinical entities were established as described
(17). Patients were classified in three groups depending on
the time of occurrence and the type of reactions: Immediate,
reactions appearing within one hour of drug intake,
including urticaria and anaphylaxis; Accelerated, reactions
appearing from 1-24 hours after drug intake, including
urticaria; and delayed, reactions appearing 24 hours or more
after drug intake, including delayed urticaria,
maculopapular exanthema (MPE) and Stevens-Johnson and
Lyell Syndromes (SJS-Lyell). As controls we selected 56
sex- and age-matched subjects receiving the same drugs as
those involved in the reactions (26 betalactams, 4
anticonvulsants, 22 non-steroidal anti-inflammatory drugs
(NSAIDs) and 4 benzodiazepines). None of the controls had
a history of allergic drug reactions nor did they have any
cutaneous or immunological diseases at the time of
selection. The study was approved by the institutional
review board, and informed consent for all the diagnostic
procedures was obtained from patients and controls.
Sample collection
Blood samples were obtained in each patient within
the first 24 hours after the initiation of the reaction (T1)
and one month after, when the reaction had cleared (T2).
Samples from the controls were taken at the same times.
Peripheral blood mononuclear cells (PBMC) were
isolated by density gradient centrifugation (Nycomed,
Oslo, Norway) from 6 ml of heparinized venous blood.
Serum samples for viral studies were also obtained and
stored at –20ºC until analysis.
Allergological work-up
Depending on the clinical signs and symptoms
recorded and the drug involved, and once the reaction
had cleared, the first step consisted in carrying out a skin
test using prick and/or intradermal and/or a patch-test, as
recommended by the European Network for Drug
Allergy (ENDA) (18). In immediate reactions prick and
intradermal tests were carried out, although they could
only be performed with soluble drugs. In accelerated
reactions prick and intradermal test were also made
except for insoluble drugs where patch testing was done.
In delayed reaction intradermal or patch testing was
done depending on the drug solubility. If skin testing
was negative and the reaction was not severe a DPT was
done, as recommended by the ENDA (19). When the
culprit drug was a NSAID, only those patients with
selective reactions were included, and indomethacin or
acetyl salicylic acid, provided they were not the drug
involved in the reaction, was administered to establish
selectivity (20).
 Int. J. Immunopathol. Pharmacol.
PBMC phenotype immunofluorescence analysis
The determination of lymphocyte subsets, cellular
activation markers and skin homing receptor was carried
out in PBMC with the following monoclonal antibodies:
CD3-PerCP, CD4 (PE, APC), CD8 (FITC, APC), the
skin-homing receptor expression was evaluated with
CLA-FITC and the state of activation with CD69-PE,
CD25-PE and HLA-DR-PE (all provided by Becton-
Dickinson, San Jose, CA). Six-parameter analysis was
performed on a Facscalibur flow cytometer and analyzed
with Cell Quest software using FITC, PE, PerCP and APC
as the four fluorescent parameters. Negative isotype
controls were used to verify the staining specificity of the
antibodies used.
Skin immunohistochemical studies
Four millimeter punch skin biopsies were obtained
during the acute phase of the reactions and fixed in 10%
formalin, routinely processed and paraffin-embedded.
Microtome sections (8 µm) were processed for
hematoxylin-eosin and immunohistochemical staining
with the following monoclonal antibodies: CD4, CD69
and CD25 (Novocastra Lab., Newcastle upon Tyne, UK),
CD8 and HLA-DR (Dako, Ely, Cambridgeshire, UK),
CLA (BD Pharmingen, San Diego, CA). The binding of
these primary antibodies (mouse IgG) was detected using
an anti-mouse IgG conjugated to peroxidase labeled
dextran polymer (Zymed Lab. San Francisco, CA) and 3-
3’-diaminobenzidine substrate kit (Sigma, St. Louis, MI).
Serological study
IgM and IgG antibodies specific for Parvovirus B19,
Cytomegalovirus and Epstein-Barr virus were detected by
a commercial enzymeimmunoassay (Biotrin, Dublin,
Ireland; Radim, Pomezia, Italy; and Enzygnost, Behring,
Marburg, Germany, respectively). The presence of
anti–HHV-6 IgG and IgM antibodies was determined in
the serum samples for each patient using an indirect
immunofluorescent antibody assay (HHV-6 IgM IFA, and
HHV-6 IgG IFA; Biotrin International, Dublin, Ireland).
Serological analyses for other viral infections (including
hepatitis B virus [HBV], hepatitis C virus [HCV], and
HIV) were similarly carried out in most patients.
Statistical analysis
Results are expressed in the median and interquartile
range (IR). Comparisons for quantitative variables
without normal distribution (immediate, accelerated and
delayed reactions in PBMC, and the clinical entities in
PBMC and biopsies) were made by non- parametric
analysis using the Mann-Whitney and Kruskall-Wallis
tests for non-related samples. Comparisons for
quantitative variables for related samples (T1 and T2 in
121
immediate, accelerated and delayed reactions in PBMC)
were made using the Wilcoxon test. All reported p values
represented two-tailed tests, with values of 0.05 or less
considered statistically significant. The statistical analysis
was performed using the SPSS program, version 11.5.
RESULTS
Forty-six patients, diagnosed with allergic
reactions to drugs and a negative viral serology,
were included in the study and classified as having
immediate (N=17), accelerated (N=10), or delayed
reactions (N=19). Table I shows the clinical
characteristics (age, sex, drug-involved and type of
reaction) and the results of the allergological work-
up (skin test and DPT) for the three groups of
patients. Comparison of the different cell markers
in PBMC between the three groups at the acute
stage (T1) and controls taking drugs at T1 is shown
in Fig. 1. No significant differences were detected
in the CD4 and CD8 subpopulations (Fig. 1a and
1b). The CLA were significantly increased in
delayed reactions (median: 12.43; IR: 6.96-23.66;
p=0.001) compared to controls (median: 5.67; IR:
4.6-7.2) (Fig. 1c). The expression of CD69 was
increased in accelerated (median: 9.16; IR: 5.85-
12.74; p=0.03) and delayed (median: 7.5; IR: 6.12-
12.39; p=0.039) reactions compared to controls
(median: 5.4; IR: 4.05-7.67;) (Fig. 1d). The
expression of the IL-2 receptor (CD25) was
increased in both immediate (median: 25.35; IR:
19.67-29.6; p=0.036) and accelerated (median:
31.01; IR: 23.28-40.5; p=0.003) reactions
compared to controls (median: 20.01; IR: 16.87-
24.84) (Fig 1e). The HLA-DR molecule increased
in all three categories compared to controls, with
an increasing trend from immediate to delayed
(immediate. median: 17.69; IR: 13.05-24.9;
p=0.033), (accelerated. median: 19.2; IR: 15.16-
35.18; p=0.032), (delayed. median: 31.92; IR:
27.21-37.98; p=0.001) (Fig. 1f). Other significant
differences were also detected among the three
groups of patients and are shown in Fig. 1.
The set of graphs in Fig. 2 shows the comparison
between the same markers and entities described
above but at the two time points, T1 and T2. The
statistical analysis of the different cell markers showed
a significant decrease in CLA expression between the
acute and the post-resolution phase only in delayed
122 M.J. TORRES ET AL.

Fig. 1. Box-plots of the percentage of T cells expressing different markers in immediate, accelerated and delayed
reactions and in the control group at T1: a) CD4 expression, b) CD8 expression, c) CLA expression, d) CD69 expression,
e) CD25 expression and f) HLA-DR expression. Statistical differences between the different groups are considered
significant (*) with a p<0.05.

reactions (p=0.028) and a decrease in HLA-DR layer. Immunohistochemical studies showed a

expression in all three types of reaction (immediate,
p=0.009; accelerated, p=0.001; and delayed, p=0.046;
Fig. 2f). No significant differences were detected in
the other markers analyzed.
In delayed reactions the skin symptoms are long
lasting and with different clinical entities, so skin
biopsies were only obtained from these patients.
Hematoxylin-eosin and immunohistochemical
staining of the skin biopsy from patients with urticaria,
MPE and SJS-Lyell are shown in Fig 3. Hematoxylin-
eosin staining showed a dermal perivascular
lymphocyte infiltrate in all three types of reaction,
lowest in SJS-Lyell. Skin biopsies from patients with
urticaria also showed foci of vacuolar alterations at the
dermoepidermal junction and hyperkeratosis with
parakeratosis, indicating damage in the basal cell
predominant presence of CD4+ cells in MPE, mainly
located in the perivascular dermis, with no
predominance of any T cell subsets in the dermis of
patients with urticaria. The number of CLA+ cells was
increased in both MPE and SJS-Lyell, although more
so in the former. The expression of the different
activation markers showed that CD25+ cells had the
same pattern as CLA+ cells, CD69 was not found in
any of the three types of reaction, and HLA-DR+
increased according to severity.
In immediate allergic reactions we compared
results obtained in anaphylaxis and urticaria, but
found no statistical differences for any of the
markers analyzed. Results in delayed allergic
reactions are shown in the last set of figures (Fig. 4)
where two comparisons are shown simultaneously:
 Int. J. Immunopathol. Pharmacol. 123

Fig. 2. Box-plots of the percentage of T cells expressing different markers in immediate, accelerated and delayed
reactions and controls at T1 and T2: a) CD4 expression, b) CD8 expression, c) CLA expression, d) CD69 expression,
e) CD25 expression and f) HLA-DR expression. Statistical differences between the different groups are considered
significant (*) with a p<0.05.

first, cell markers in delayed reactions according to
clinical manifestation and second, results obtained
in two different compartments, peripheral blood and
skin, at the same time point (T1). The most striking
finding was that in SJS-Lyell the CD4 subsets were
increased in both peripheral blood and skin
compared to MPE (p=0.03 and p=0.016,
respectively) and urticaria (p=0.04 and p=0.05,
respectively). HLA-DR was also increased in
peripheral blood and skin in SJS-Lyell reactions,
although this was only significant when compared
with urticaria reactions (p=0.05 and p=0.025,
respectively). Also to be noted was the fact that the
CLA marker was significantly increased in MPE, in
both peripheral blood and skin, compared to
urticaria (p=0.05 and p=0.017, respectively) and
SJS-Lyell (p=0.05 in both) (Fig. 4c and 4d). CD25
expression was increased in peripheral blood in
urticaria compared to SJS-Lyell reactions (p=0.05)
and increased in the skin in MPE reactions
compared to urticaria (p=0.017) and SJS-Lyell
reactions (p=0.017). No differences were found in
CD69 expression between the different clinical
entities in both compartments studied.
DISCUSSION
The study of allergic reactions to drugs involves
several problems that need to be faced by the
researcher before discussing the results. The first is
the adequate diagnosis and classification of the
cases. In this study we evaluated an important
number of patients with allergic reactions to drugs
during the acute phase. Although similar approaches
124 M.J. TORRES ET AL.

Table I. Clinical characteristics of the patients studied including sex, age, drug involved and type of reaction. Patients were
classified in three groups (immediate, accelerated or delayed) depending on the time interval between the drug administration
and the symptoms’ appearance. The allergological work-up included skin test and drug provocation test.

Pat. Group Sex Age Drug Reaction Skin test DPT

1 Immediate Male 20 Amoxicillin Urticaria IDT + n.d.
2 Immediate Male 22 Amoxicillin Urticaria P/IDT - +
3 Immediate Female 32 Amoxicillin Urticaria P/IDT - +
4 Immediate Female 38 Cefuroxime AnaphylaxisP + n.d.
5 Immediate Male 43 Amoxicillin AnaphylaxisIDT + n.d.
6 Immediate Male 35 Amoxicillin AnaphylaxisP+ n.d.
7 Immediate Female 36 Amoxicillin AnaphylaxisP+ n.d.
8 Immediate Female 33 Amoxicillin AnaphylaxisIDT + n.d.
9 Immediate Male 56 Amoxicillin AnaphylaxisIDT + n.d.
10 Immediate Male 56 Amoxicillin AnaphylaxisP + n.d.
11 Immediate Female 33 AX-clavulanic AnaphylaxisIDT + n.d.
12 Immediate Male 24 Amoxicillin Urticaria P/IDT - +
13 Immediate Female 22 Metamizol Urticaria IDT + n.d.
14 Immediate Male 57 Metamizol Urticaria IDT + n.d.
15 Immediate Female 28 Paracetamol Urticaria n.d. +
16 Immediate Female 47 Metamizol AnaphylaxisIDT + n.d.
17 Immediate Female 43 Paracetamol Urticaria n.d. +
18 Accelerated Female 42 Cefaclor Urticaria P/IDT - +
19 Accelerated Female 37 Cephalexin Urticaria P/IDT - +
20 Accelerated Female 43 Amoxicillin Urticaria P/IDT - +
21 Accelerated Female 38 Amoxicillin Urticaria P/IDT - +
22 Accelerated Female 46 Paracetamol Urticaria PT- +
23 Accelerated Female 46 Ibuprofen Urticaria PT- +
24 Accelerated Male 50 Spiramicin Urticaria PT- +
25 Accelerated Male 21 Spiramicin Urticaria PT- +
26 Accelerated Female 44 Tetrazepam Urticaria PT- +
27 Accelerated Female 26 Ebastine Urticaria PT- +
28 Delayed Female 26 Amoxicillin MPE IDT- +
29 Delayed Female 37 Amoxicillin MPE IDT+ n.d.
30 Delayed Female 57 Amoxicillin MPE IDT + n.d.
31 Delayed Male 78 Cefuroxime MPE IDT - +
32 Delayed Female 57 Diphenylhydantoin SJS-Lyell n.d. n.d.
33 Delayed Female 73 Diphenylhydantoin SJS-Lyell n.d. n.d.
34 Delayed Female 26 Phenobarbital MPE PT + n.d.
35 Delayed Male 39 Carbamazepine MPE PT - +
36 Delayed Female 18 Diphenylhydantoin MPE PT + n.d.
37 Delayed Female 16 Diphenylhydantoin MPE PT + n.d.
38 Delayed Female 25 Diphenylhydantoin MPE PT - +
39 Delayed Female 50 Amoxicillin Urticaria IDT + n.d.
 Int. J. Immunopathol. Pharmacol. 125

40 Delayed Female 36 Diphenylhydantoin SJS-Lyell n.d. n.d.

41 Delayed Male 45 Diphenylhydantoin MPE PT - +
42 Delayed Female 56 Metamizole Urticaria IDT + n.d.
43 Delayed Female 45 Aceclofenac Urticaria PT - +
44 Delayed Female 38 Aceclofenac Urticaria PT - +
45 Delayed Male 65 Metamizole MPE IDT + n.d.
46 Delayed Female 27 Alopurinol SJS-Lyell n.d. n.d.
47 Delayed Female 44 Metronidazole Urticaria PT + n.d.
48 Delayed Female 50 Alopurinol SJS-Lyell n.d. n.d.
49 Delayed Female 41 Nimodipine MPE PT- +
50 Delayed Male 48 Carbamazepine SJS-Lyell n.d. n.d.
P: Prick test, IDT: Intradermal test, PT: Patch test, n.d.: not determined

have been used by others, the studies have not always
included patients with a final confirmed diagnosis
after an allergological work-up (11, 21). This is
particularly important because some of the entities
attributable to drug allergy can be induced by other
agents. Our confirmation of the diagnosis in all cases
by the appropriate diagnostic work-up ensured a
precise clinical classification, although it logically led
to the final inclusion of fewer cases; out of an initial
107 patients, evaluated diagnosis was only finally
confirmed in 46. The second problem is to rule out the
possibility that the immunological changes found are
not in fact induced by the drug itself. To this end,
following the same methodology as in previous
studies (22), we selected a control group composed of
subjects who were taking the same drugs as those
involved in the reaction. Additionally, previous
experience (6, 22) has shown no differences between
control subjects taking and control subjects not taking
these drugs for the variables analyzed in this study.
The third problem is related to the number of drugs
involved. The ideal situation would be to have one
drug which induces all three types of reaction.
However, it then becomes very difficult to obtain
sufficient cases with allergic reactions to the same
drug, especially when different types of reaction
are to be analyzed; for instance, betalactams are an
important cause of anaphylaxis but very rarely
induce SJS-Lyell. We are unaware of any report of
a series that satisfies these requirements. The
fourth problem is to rule out a viral disease,
especially in delayed and accelerated reactions. We
therefore performed a viral study in all cases.
Our first aim was to analyze T cell involvement in
allergic drug reactions according to the time at which
the symptoms occurred. Immediate allergic reactions
to drugs are IgE mediated and express a Th2 cytokine
pattern during the acute reaction, whereas delayed
reactions are T cell mediated and express a Th1 pattern
(6, 23). Furthermore, cytotoxic mechanisms (perforin
and granzyme B) also take part in delayed reactions,
especially in the more severe of these reactions (22).
Although accelerated reactions were originally
thought to be IgE mediated, nowadays they are
thought to be T cell mediated (5). We analysed the
expression of different T cell activation markers:
CD69 (very early), CD25 (late) and HLA-DR (very
late) (24). We found an increase in HLA-DR
expression parallel to the time of induction of the
reaction, with a higher percentage detected in delayed
reactions, and an increase in CD25 in immediate and
accelerated reactions, with no change in CD69. This
pattern is probably just a reflection of the kinetic
expression of each of these markers, ranging from
CD69, which has a maximum expression 12 hours
after antigen stimulation, to HLA-DR, which has a
maximum expression at 48 hours (24), hindering their
detection in some reactions. This late expression of
HLA-DR also indicates T cell involvement, which is
clear in delayed reactions. However, we also found
significant levels of this marker in immediate
reactions. This is because immediate reactions cannot
be considered to be exclusively antibody-mediated
because antibody induction requires the specific
recognition of the antigen by T lymphocytes (23).
CLA is involved in the trafficking of the skin T cell
126 M.J. TORRES ET AL.

Fig. 3. Skin biopsy specimens from three delayed reactions, urticaria (3a), MPE (3b) and SJS/TEN (3c), taken during
the acute phase (T1). Samples were processed for haematoxylin-eosin (200X) and for immunohistochemical stains
(200 x) of lymphocyte subpopulations, CD4, CD8, CLA, and activation markers, CD69, CD25 and HLA-DR. Arrows
indicate examples of positive cells for each marker.

subpopulation to cutaneous sites of inflammation (25).
We found that its expression was higher in delayed
reactions to drugs, which are those with most skin
involvement; these levels returned to normal values
once the reaction subsided, with marked parallelism
between CLA and HLA-DR expression. This is in
agreement with previous results from our group in
patients with allergic drug reactions, and in patients
with atopic dermatitis and psoriasis, where an
association was found between the high percentage of
activated T cells expressing the skin homing receptor
and the evolution and severity of the skin disease (26-
28). Further analysis of the CLA involvement in
delayed reactions showed an increase in MPE
compared to SJS-Lyell, probably because in MPE
reactions CLA+ cells are mainly located in the dermis
whereas in SJS-Lyell CLA+ cells have migrated to the
epidermis and blisters, where there is severe
destruction with the loss of these cells. Interestingly, no
increase in CLA was detected in accelerated or delayed
urticaria. These reactions, although affecting the skin,
are probably not sufficiently strong to induce cutaneous
T cell infiltration and subsequent CLA expression, as
we have previously shown in PBMC in viral reactions
with skin involvement (29). Moreover, accelerated
reactions, as has been suggested by others (5), are
probably induced by a rapid cell-immune response that
can activate T cells, as we detected, originating
transitory skin reactions that subside rapidly.
Because we considered that analysis of just PBMC
would only partially explain the involvement of T cells
in allergic drug reactions, we decided to compare the
results with those found in the target organ, although in
this study comparisons between the two compartments
were only done in delayed reactions. In previous
studies we have found that cell markers in peripheral
blood express later than those in the skin (9,17), but in
this study, where a larger number of cases was
evaluated, the results detected in PBMC were exactly
the same as those found in the skin, although serial
 Int. J. Immunopathol. Pharmacol.
127

Fig. 4. Box-plots of the percentage of different cell markers in peripheral blood (a-c) and in the skin (d-f) in delayed reactions
according to the clinical entities: Urticaria, MPE and SJS/Lyell. a) CD4 and CD8 expression in peripheral blood, b) CD4 and
CD8 expression in skin, c) CLA expression in peripheral blood, d) CLA expression in skin, e) CD69, CD25 and HLA-DR
expression in peripheral blood, f) CD69, CD25 and HLA-DR expression in skin. Statistical differences between the different
groups are considered significant (*) with a p<0.05.

samples performed in parallel in the skin were not
taken. It should also be recalled that these previous
reports involved few cases, with some patients being
treated with corticoids, which could affect the
expression of the different markers in PBMCs (27).
Delayed allergic reactions to drugs with cutaneous
involvement are associated with different clinical
entities with differences in the mechanisms involved,
the severity and the response to steroid therapy (17).
Results of studies of the subpopulations involved in
these types of reaction are contradictory. While a
number of studies have shown that the CD4
subpopulation is involved in MPE and the CD8
subpopulation in bullous exanthema in peripheral
blood and skin (11, 21, 30), other authors have found
that both CD4 and CD8 may be involved in SJS-Lyell,
the former mainly located in the dermis and the latter
in the epidermis (9, 12-14, 30-31). In our study we
found an increase in both skin and peripheral blood of
CD4 cells in SJS-Lyell and MPE, higher in SJS-Lyell.
Several explanations may account for these
differences; first confusion in terminology. Authors
who report that CD8 are involved in the most severe
reactions evaluate bullous exanthemas in general but
not SJS-Lyell in particular. Bullous exanthema is a
poorly defined entity which can include different types
of clinical reaction whereas SJS-Lyell is well-defined
with its own diagnostic criteria (11, 21). The second
explanation concerns the compartment evaluated. The
majority of studies in SJS-Lyell have been undertaken
in skin and blister fluid, where it is more likely to find
cytotoxic cells which express CD8; results that are
different to those found in PBMC and the dermis,
where CD4+ cells predominate (15, 32). A third reason
for the differences involves the drug inducing the
reaction. Some authors have found the CD4
subpopulation was the most frequently involved in
patients with adverse reactions to anticonvulsants (33),
and in the present study, the drugs most frequently
involved in SJS-Lyell reactions were also
128 M.J. TORRES ET AL.
anticonvulsants. However, in other studies reporting
an involvement of CD8+ cells the drugs involved
belonged to different pharmacological groups (15, 32).
Summarizing, after studying a large number of
patients with allergic reactions to drugs we found that T
cells were implicated in all three types of reaction,
highest in delayed allergic reactions, returning to
normal values when the reaction subsided. In delayed
reactions there was a parallelism between the results
found in skin and peripheral blood, with a higher
participation of CD4+ cells the more severe the reaction.
Further study of these different markers in different
subpopulations will lead to improved understanding of
the phenomena involved in allergic drug reactions.
ACKNOWLEDGEMENTS
We thank Ian Johnstone for help with the final
English version of this manuscript. This study was
partly supported by the Spanish Ministry of Health
(FIS 01/0014, FIS 01/3031 and FIS PIO20640) and
the Junta de Andalucía (14/03).
REFERENCES
1. Demoly P. and J. Bousquet. 2001. Epidemiology of
drug allergy. Curr. Opin. Allergy Clin. Immunol. 1:305.
2. Thong B.Y., K. Leong, C. Tang and H. Chang.
2003. Drug allergy in a general hospital: results of a
novel prospective inpatient reporting system. Ann.
Allergy Asthma Immunol. 90:342.
3. Levine B.B. 1966. Immunologic mechanisms of
penicillin allergy. A haptenic model system for the study
of allergic diseases of man. N. Engl. J. Med. 275:1115.
4. Blanca M., M.J. Torres, C. Mayorga, E. Perez-
Inestrosa, R. Suau, M.I. Montañez and C. Juarez.
2004. Immediate allergic reactions to betalactams:
Facts and controversies. Curr. Opin. Allergy Clin.
Immunol. 4:261.
5. Warrington R.J., F. Silviu-Dan and C. Magro. 1993.
Accelerated cell-mediated immune reactions in
penicillin allergy. J. Allergy Clin. Immunol. 92:626.
6. Posadas S.J., L. Leyva, M.J. Torres, J.L. Rodriguez,
I. Bravo, M. Rosal, J. Fernandez, C. Juarez and M.
Blanca. 2000. Subjects with allergic reactions to drugs
show in vivo polarized patterns of cytokine expression
depending on the chronology of the clinical reaction. J.
Allergy Clin. Immunol. 106:769.
7. Brander C., D. Mauri-Hellweg, H.P. Rolli, M.
Goldman and W.J. Pichler. 1995. Heterogeneus T
cell response to beta-lactam-modified self structures in
penicillin allergic individuals. J. Immunol. 155:2670.
8. Mauri-Helweg D., F. Bettens, D. Mauri, C.
Brander, T. Hunziker and W.J. Pichler. 1995.
Activation of drug-specific CD4+ and CD8+ T cells
in individuals allergic to sulfonamides, phenytoin
and carbamazepine. J. Immunol. 155:462.
9. Leyva L., M.J. Torres, S. Posadas, M. Blanca, G.
Besso, F. O’Valle, R.G. del Moral, L.F. Santamaria
and Juarez C. 2000. Anticonvulsant-induced toxic
epidermal necrolysis. Monitoring of the immunologic
response. J. Allergy Clin. Immunol. 105:157.
10. Gonzalez F.J., M.J. Carvajal, V. del Pozo and M.
Blanca. 1997. Erythema multiforme to
phenobarbital: involvement of eosinophils and T
cells expressing the skin homing receptor. J. Allergy
Clin. Immunol. 100:135.
11. Hari Y., K. Frutig-Schnyder, M. Hurni, N.
Yawalkar, M.P. Zanni, B. Schnyder, A. Kappeler,
S. von Greyerz, L.R. Braathen and W.J. Pichler.
2001. T cell involvement in cutaneous drug
eruptions. Clin. Exp. Allergy 31:1398.
12. Villada G., J.C. Roujeau, T. Clérici, I. Bourgalt
and J. Revuz. 1992. Inmunopathology of toxic
epidermal necrolysis, keratinocites, HLA-DR
expression, Langerhans cells, and mononuclear cells
: an immunopathologic study of five cases. Arch.
Dermatol. 128:50.
13. Roujeau J.C., L. Dubertret, S. Moritz, H. Jouault,
M. Heslan, J. Revuz and R. Touraine. 1985.
Involvement of macrophages in the pathology of
toxic epidermal necrolysis. Br. J. Dermatol. 113:425.
14. Friedmann P.S., I. Strickland, M. Pirmohamed
and B.K. Park. 1994. Investigation of mechanisms
in toxic epidermal necrolysis induced by
carbamazepine. Arch. Dermatol. 130:598.
15. Nassif A., A. Bensussan, L. Boumsell, A. Deniaud,
H. Moslehi, P. Wolkenstein, M. Bagot and J.C.
Roujeau. 2004. Toxic epidermal necrolysis: Effector
cells are drug-specific cytotoxic T cells. J. Allergy
Clin. Immunol. 114:1209.
16. Mayorga C., M.J. Torres, J.L. Corzo, E. Sanchez-
 Int. J. Immunopathol. Pharmacol.
Sabate, J. Alvarez, A. Vera, S. Posadas, A. Jurado
and M. Blanca. 2003. Improvement of Toxic
Epidermal Necrolysis after the Early Administration of
a Single High Dose of Intravenous Immunoglobulin.
Ann. Allergy Asthma Immunol. 91:86.
17. Roujeau J.C. and R.S. Stern. 1994. Severe adverse
cutaneous reactions to drugs. N. Engl. J. Med. 331:1272.
18. Brockow K., A. Romano, M. Blanca, J. Ring, W.
Pichler and P. Demoly. 2002. General
considerations for skin test procedures in the
diagnosis of drug hypersensitivity. Allergy 57:45.
19. Aberer W., A. Bircher, A. Romano, M. Blanca, P.
Campi, J. Fernandez, K. Brockow, W.J. Pichler,
P. Demoly and European Network for Drug
Allergy (ENDA); EAACI interest group on drug
hypersensitivity. 2003. Drug provocation testing in
the diagnosis of drug hypersensitivity reactions:
general considerations. Allergy 58:854.
20. Stevenson D.D., R.A. Simon and B.L. Zuraw. 2003.
Sensitivity to aspirin and nonsteroidal anti-
inflammatory drugs. In Allergy: principles and
practice. N.F. Adkinson, J.W. Yunginger, W.W. Busse,
B.S. Bochner, S.T. Holgate, F.E. Simons, ed.
Middleton´s. Vol. 2: Mosby, Inc, Philadelphia p. 1695.
21. N. Yawalkar, F. Egli, Y. Hari, H. Nievergelt, L.R.
Braathen and W.J. Pichler. 2000. Infiltration of
cytotoxic T cells in drug-induced cutaneous
eruptions. Clin. Exp. Allergy 30:847.
22. Posadas S.J., A. Padial, M.J. Torres, C. Mayorga,
L. Leyva, E. Sanchez, J. Alvarez, A. Romano, C.
Juarez and M. Blanca. 2002. Delayed reactions to
drugs show a Th1 profile and levels of perforin,
granzyme B and Fas-L related to disease severity. J.
Allergy Clin. Immunol. 109:155.
23. Descotes J. and G. Choquet-Kastylevsky. 2001.
Gell and Coombs’s classification: is it still valid?
Toxicology 158:43.
24. Reddy M., E. Eirikis, C. Davis, H.M. Davis and U.
Prabhakar. 2004. Comparative analysis of
lymphocyte activation marker expression and
cytokine secretion profile in stimulated human
peripheral blood mononuclear cell cultures: an in
vitro model to monitor cellular immune function. J.
Immunol. Methods 293:127.
25. Picker L.J., J.R. Treer, B. Ferguson-Darnell, P.A.
Collins, P.R. Bergstresser and L.W. Terstappen.
129
1993. II. Differential regulation of the cutaneous
lymphocyte-associated antigen, a tissue-selective
homing receptor for skin-homing T cells. J.
Immunol. 150:1122.
26. Dworzak M.N., G. Froschl, D. Printz, C. Fleischer,
U. Potschger and G. Fritsch. 1999. Skin-associated
lymphocytes in the peripheral blood of patients with
atopic dermatitis: signs of subset expansion and
stimulation. J. Allergy Clin. Immunol. 103:901.
27. Blanca M., S. Posadas, M.J. Torres, L. Leyva, C.
Mayorga, L. Gonzalez, C. Juarez, J. Fernandez
and L.F. Santamaria. 2000. Expression of the skin-
homing receptor in peripheral blood lymphocytes
from subjects with non-immediate cutaneous allergic
drug reactions. Allergy 55:998.
28. Antunez C., M.J. Torres, C. Mayorga, J.A. Cornejo-
Garcia, L.F. Santamaria-Babi and M. Blanca. 2004.
Different cytokine production and activation marker
profiles in circulating cutaneous-lymphocyte-
associated antigen T cells from patients with acute or
chronic atopic dermatitis. Clin. Exp. Allergy 34:559.
29. Torres M.J., J.L. Corzo, L. Leyva, C. Mayorga,
F.J. Garcia-Martin, C. Antunez, S. Posadas, A.
Jurado and M. Blanca. 2003. Differences in the
immunological responses in drug- and virus-
induced cutaneous reactions in children. Blood
Cells Mol. Dis. 30:124.
30. Naisbitt D.J. 2004. Drug hypersensitivity reactions
in skin: understanding mechanisms and the
development of diagnostic and predictive tests.
Toxicology 194:179.
31. Friedmann P.S., M.S. Lee, A.C. Friedmann and
R.C. Barnetson. 2003. Mechanisms in cutaneous drug
hypersensitivity reactions. Clin. Exp. Allergy 33:861.
32. Nassif A., H. Moslehi, S. Le Gouvello, M. Bagot,
L. Lyonnet, L. Michel, L. Boumsell, A. Bensussan
and J.C. Roujeau. 2004. Evaluation of the potential
role of cytokines in Toxic Epidermal Necrolysis. J.
Invest. Dermatol. 123:850.
33. Naisbitt D.J., M. Britschgi, G. Wong, J. Farrell,
J.P. Depta, D.W. Chadwick, W.J. Pichler, M.
Pirmohamed and B.K. Park. 2003.
Hypersensitivity reactions to carbamazepine:
characterization of the specificity, phenotype,
cytokine profile of drug specific T cell clones. Mol.
Pharmacol. 63:732.
134 A. VARRICCHIO ET AL.

Table I. Evaluated parameters in Group A (inhaled tobramycin) and in Group B

(amoxicillin/clavulanate) at baseline.

Baseline parameters Group A (156pts) Group B

(155pts)
Nasal obstruction 156 155
Continuous 135 132
Periodic 21 23
Rhinorrhea 153 149
Post-nasal drip 156 155
Adenoidal hypertrophy
Small 22 19
Moderate 33 31
Large 101 105
Tympanic 140 148
inflammation
Tympanogram
Type A 13 15
Type C1 25 27
Type C2/B 118 113
Rhinomanometry 152 152
(impaired)
Cultures (positive) 156 155

Rhinorrhea
It was considered recovered if absent after
treatment. 68.6% of patients of group A obtained
complete recovery versus 61.8% of group B(p=
0.26).
Post nasal drip
It was considered recovered if absent after
treatment. The patients recovered from post-nasal drip
were 68.6% in group A and 56.8% in group B(p=0.05).
Adenoid hypertrophy
It was considered recovered if small after
treatment. Considering patients with large or
moderate adenoid hypertrophy at baseline, 74.6% of
group A obtained a recovery versus 58.8 % of group
, with significant difference (p=0.006).
B group A (114 children) obtained complete recovery
Tympanic Inflammation
It was considered recovered if absent after
treatment. The patients who recovered from
tympanic inflammation were 75% in group A and
59.5% in group B(p=
0.006).
Tympanogram
It was considered recovered if tympanogram was
“type A” after treatment. Considering patients with
baseline type C2/Bor C1 tympanogram, 75.5% of
group A obtained a complete recovery versus 65 %
of group B(p=
0.05).
Rhinomanometry
It was considered recovered if unilateral resistance at
150 aPwas less than 1.2 aP/mL/sec after treatment. 76.3%
of group A recovered versus 61.8% of group B (p=
0.006).
Cultures
They were considered recovered if bacterial
eradication was achieved after treatment. 73.1% of
versus 60.6% of group B(94 children) (p= 0.02).
In patients with microbiological failure, persistence
of the responsible pathogen was observed. However,
there was no significant difference concerning type
and freq uency both of persistent and eradicated
pathogens between the two groups.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 141-148 (2006)

SUBLINGUAL REACTIVITY TO rBET V1 AND rPHL P1 IN PATIENTS WITH ORAL

ALLERGY SYNDROME
F. MARCUCCI, L. SENSI, G. DI CARA, G. GIDARO1, C. INCORVAIA2 and F. FRATI

Department of Obstetric, Gynaecologic and Pediatric Sciences, University of Perugia;

1
Scientific Department, Stallergénes, Milan; 2Allergy/Rheumatology Unit, ICP Hospital, Milan, Italy

Received September 9, 2004 – Accepted June 6, 2005

Oral Allergy Syndrome (OAS) in patients with pollen-induced rhinoconjunctivitis is caused by specific
IgE recognizing cross-reacting epitopes of fruits and plants, which were clearly shown in vitro, but failed
to be demonstrated in vivo by cross-challenges in the target organs. Considering the hypothesis of
degradation of such epitopes in natural extracts, challenges with recombinant pollen allergens were done
to evaluate the reactivity of the oral mucosa in OAS patients. Seventeen patients with OAS and rhinitis
from birch (10) and grass pollen (7) and 10 non-atopic controls were studied by skin prick tests (SPT),
allergen specific nasal challenges (ASNC) and allergen specific sublingual challenges (ASSC) with birch
and timothy extracts and with rBet v1 and rPhl p1 at increasing concentrations from 1 to 1000 mcg/ml.
None of the healthy subjects in the control group had any positive test for birch and timothy extracts or
for recombinant allergens. In the OAS group the following results were observed: SPTs with recombinant
allergens were positive in all patients, mostly at 10 mcg/ml concentration; ASNC with rBet v1 were
positive in all patients, mostly at 100 mcg/ml; ASSC with natural pollen extracts were positive in only 2
of 17 patients, but in 15 of 17 with rBet v1 and rPhl p1, mostly at 500 mcg/ml and 1000 mcg/ml. ASSC
with rBet v1 and rPhl p1 were positive with a mean concentration of 677 and 533 mcg/ml, respectively.
The results of sublingual challenges with rBet v1 and rPhl p1 showed the in vivo cross-reactivity between
pollens and foods in patients with OAS, but high concentrations of the recombinant allergens were needed
to reproduce oral symptoms, thus explaining the failure of challenges performed with natural extracts,
which have concentrations of major allergens lower than 50 mcg/ml. This indicates that sublingual
mucosa is much less reactive to allergens than other surfaces, such as skin and nasal mucosa, probably
because of its anatomic and immunologic peculiarity.

Oral allergy syndrome (OAS) is a condition is generally attributed to cross-reactivity between

characterized by oral swelling and itching after the
contact of specific foods with the oral mucosa (1). In
most cases this syndrome occurs in patients with
pollen-induced rhinoconjunctivitis when eating
fresh fruits or vegetables (2-4). The etiology of OAS
some food allergens and some inhalant allergens.
The contact with the inhaled allergen leads to
sensitization of upper and lower airways, with a
production of specific IgE cross-reactive to food
allergens, which, in turn, are responsible for the oral

Key words: oral allergy syndrome, rBet v1, rPhl p1, sublingual challenge

Mailing address:
Francesco Marcucci, M.D.
Department of Obstetric, Gynaecologic and Pediatric Sciences
University of Perugia - Policlinico Monteluce
Via Brunamonti 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
06122 Perugia, Italy This publication and/or article is for individual use only and may not be further
Tel: +39 075 578 3621 - Fax: +39 075 573 3802 reproduced without written permission from the copyright holder.
E-mail : marcucci@unipg.it 141 Unauthorized reproduction may results in financial and other penalties
142 F. MARCUCCI ET AL.
symptoms (5). Some authors have also described the
occurrence of OAS preceding respiratory symptoms
or even without them (6). RAST-inhibition
experiments have confirmed that IgE can recognize
cross-reacting epitopes of fruits and plants (7) and
molecular biology techniques allowed the detection
of allergens considered responsible for the cross-
reactions (8-10).
In the attempt to confirm the cross-reactivity
between foods and pollens in an in vivo study, in a
previous work we performed a series of cross-
challenges in patients with OAS, but both oral
challenges with pollen extracts and nasal challenges
with homogenized foods were negative (11). Taking
into consideration the instability of cross-reacting
allergens (12) this result could be attributed to the
insufficient presence of such allergens, caused by
degradation during the method of commercial
extraction, or to cleavage of the endogenous
proteases. In vitro high sensitivity and specificity of
recombinant pollen allergens were described by
several authors (13-16), and in vivo evaluation thus
far includes skin prick tests with rBet v1 and rBet v2
(17), conjunctival provocation tests with rBet v1
isoform (18), and recently also specific nasal
challenges with rBet v1 (19-20).
We evaluated the reactivity of the oral mucosa to
pollen allergens in patients with allergic rhinitis and
OAS using recombinant allergens, which are stable
and standardized, in order to overcome the
possibility of natural pollen degradation.
MATERIALS AND METHODS
Study design
We studied 17 patients with allergic rhinitis (9 males,
8 females, mean age 23.1 years), 10 with birch pollen
rhinitis and a history of oral symptoms due to apple or
celery and 7 with grass pollen rhinitis and a history of oral
symptoms due to tomato or kiwi, and 10 healthy controls
(6 males, 4 females, mean age 23.4 years). Diagnosis of
allergic rhinitis was based on typical clinical history
(lasting at least 2 years), skin prick test (SPT) positivity
and RAST positivity to pollen allergens. The
characteristics of the patients are summarized in Table I.
Diagnosis of OAS was based on clinical history, prick +
prick test positivity to the fresh food and oral open
provocation test (20). During the study, patients were not
allowed to use either antihistamines or topical and
systemic steroids for at least one month before the
investigation. The study was approved by the Ethical
Committee of the University of Perugia, all patients and
controls gave oral and written informed consent.
SPTs with pollen extracts and recombinant allergens
SPTs were performed, according to international
guidelines (21), with commercial extracts from birch and
timothy pollen (Stallergénes, Milan, Italy) standardized in
IR (Index of Reactivity). rBet v1 and rPhl p1 (Biomay,
Wien, Austria) were diluted in 0.9% sterile sodium
chloride solutions in concentrations of 1, 10 and 100 mcg
/mL. Tests were carried out on the forearm, using positive
(histamine 1%) and negative (saline) controls for
comparison and were read after 20 minutes. A minimal
distance of 3 cm between each test field was applied.
Wheal and flares were pen-marked and then transferred
by cellotape onto a sheet of paper; the results were
calculated as the mean of the major diameter of the wheal
plus its orthogonal and expressed as class 0 to ++++. SPT
was considered positive if the wheal was greater than 3
mm and with a diameter similar or larger than the
histamine wheal. SPT with recombinant allergens were
considered positive when the wheal achieved the diameter
of the respective commercial allergen extract.
Prick + prick with fresh food
All patients with positive history of reactions to foods
were also studied with the prick + prick technique. The
test was performed using fresh fruits or vegetables and
compared with histamine and negative control wheal,
with the same method of SPT.
Allergen-specific serum IgE
From all patients and controls, specific IgE to birch,
timothy, rBet v1 and rPhl p1 were determined by the
Immuno-CAP System (UniCap IgE, Pharmacia,
Uppsala, Sweden).
Allergen Specific Nasal Challenge (ASNC) with
natural pollen extracts and recombinant allergens
Patients were required to be completely symptom-free at
the time of the study. They took no medication (topical or
systemic antihistamines, topical or systemic corticosteroids,
topical cromolyn) in the month preceding the study. On the
first day a specific nasal challenge with the causative pollen
was done (22). The ASNC was performed by spraying into
a nostril the allergen extract of timothy or birch
(Stallergénes, Milan, Italy) at increasing concentrations of
1, 10 and 100 IR, starting with the lower one. If no symptom
appeared after 10 minutes, the subsequent concentration
was administered. The challenge was preceded by the
administration of the vehicle alone as negative control. The
severity of symptoms (itching, sneezing, rhinorrhea and
 Int. J. Immunopathol. Pharmacol.
obstruction) was graded as follows: 0= absent, 1= mild, 2=
moderate, 3= severe.
After at least one week, the same patients underwent a
second series of nasal challenges. In this occasion an
ASNC with the recombinant allergen (rBet v1 or rPhl p1)
was performed using the same method. The
concentrations used for recombinant allergens were 1, 10,
and 100 mcg /ml.
Allergen specific sublingual challenge (ASSC) with
fresh foods
At the same visit of the prick + prick testing, a
sublingual challenge with fresh foods was performed in
mg/ml
all patients with a clinical history suggestive of OAS. A
small amount of the fresh food had to be kept under the
tongue until symptoms appeared (usually less than 1
minute). The severity of symptoms (itching, oedema and
feeling of foreign body) was graded from 0 (absent) to 3
(severe).
Allergen Specific Sublingual Challenge (ASSC) with
natural pollen extracts and recombinant allergens
The double blind placebo-controlled ASSC was
performed with 250 mcl of control solution, followed by
the pollen extracts at increasing concentrations of 1, 10,
and 100 IR. The allergen had to be kept under the tongue
until symptoms appeared (usually less than 1 minute).
After at least one week, together with the ASSC with
recombinant allergens, the same patients underwent a
second series of sublingual challenges with 250 mcl of
recombinant extracts (rBet v1 or rPhl p1) at increasing
concentrations of 10, 100, 500 and 1000 mcg /ml.
RESULTS
Prick + prick with fresh food
In patients allergic to birch pollen the prick + prick
with fresh foods showed a positive result to apple in 8
cases and to celery in 2 cases. Prick + prick with tomato
and kiwi were positive, respectively, in 6 and one
patient who was also allergic to grass pollen (Table I).
Allergen-specific serum IgE
Serum specific IgE to foods, birch, timothy, rBet
v1, and rPhl p1 were negative in all control patients
(data not reported) and positive in all patients for the
same allergen evaluated by prick tests (Table I).
SPTs
SPT with birch, timothy, rBet v1 and rPhl p1 were
negative in all control patients (data not reported). rBet
143
1000
900 rBet v1
rPhl p1
800
700
600
500
150
100
50
0
SPT ASNC ASSC
Fig. 1. Comparison of the mean response to recombinant
allergens of the oral mucosa with the mean response of
skin and nasal mucosa. The mean concentrations of rBet
v1 and rPhl p1 eliciting a positive response were
respectively 18.1 ± 28.9 and 8.7 ± 3.40 mcg for SPT, 64 ±
46.5 and 48.5 ± 48.1 mcg for ASNC, and 677 ± 320.8 and
533 ± 403.3 mcg for ASSC, with significantly higher
concentration for ASSC compared to ASNC (p<0.01) and
to SPT (p<0.005).
v1 showed a similar response to birch extract at 1
mcg/ml in one patient, at 10 mcg/ml in 8 patients and
at 100 mcg/ml in one patient, corresponding to a mean
concentration of 18.1 mcg/ml.. rPhl p1 showed a
similar response to timothy extract at 1 mcg/ml in one
patient and at 10 mcg/ml in 6 patients, corresponding
to a mean concentration of 8.7 mcg/ml. This is
illustrated in Table II and Fig. 1.
Allergen Specific Nasal Challenge (ASNC) with
natural extracts and recombinant allergens
All subjects in the control group showed no
response to nasal challenges with natural extracts and
144 F. MARCUCCI ET AL.

Table I. Characteristics of the patients.

negative (11). Taking into consideration the instability of cross-reacting allergens (12) this

result could be attributed to the insufficient presence of such allergens, caused by degradation

during the method of commercial extraction, or to cleavage of the endogenous proteases. In

vitro high sensitivity and specificity of recombinant pollen allergens were described by

several authors (13-16), and in vivo evaluation thus far includes skin prick tests with rBet v1

and rBet v2 (17), conjunctival provocation tests with rBet v1 isoform (18), and recently also

specific nasal challenges with rBet v1 (19-20).

We evaluated the reactivity of the oral mucosa to pollen allergens in patients with allergic

rhinitis and OAS using recombinant allergens, which are stable and standardized, in order to

overcome the possibility of natural pollen degradation.

recombinant allergens (data not reported). ASNC with
rBet v1 were positive at 10 mcg/ml in 4 patients and at
100 mcg/ml in 6 patients, and ASNC with rPhl p1
were positive at 10 mcg/ml in 4 patients and at 100
mcg/ml in 3. Specific nasal challenges with
recombinant allergens rBet v1 and rPhl p1 showed a
similar response to natural extracts of birch and
timothy with a mean concentration of 64 and 48.5
mcg/ml, respectively (Table III, Fig. 1).
Allergen Specific Sublingual Challenge (ASSC)
with natural extracts and recombinant allergens
All subjects in the control group showed no
response to sublingual challenges with natural extracts
and recombinant allergens (data not reported). All
patients had positive ASSC with fresh foods and
negative ASSC with natural pollen extracts, except in
2 cases, one positive to birch and one positive to
timothy (Table IV). ASSC with rBet v1 and rPhl p1
were positive in 15 of 17 patients: rBet v1 was positive
at 100 mcg/ml in one patient, at 500 mcg/ml in 4
patients and at 1000 mcg/ml in 4 patients, while one
patient was negative even to the maximum
concentration of 1000 mcg/ml; rPhl p1 was positive at
100 mcg/ml in 2 patients, at 500 mcg/ml in 2 patients
and at 1000 mcg/ml in 2 patients, one patient was
negative to the maximum concentration of 1000
mcg/ml (Table IV). ASSC with rBet v1 and rPhl p1
were positive with a mean concentration of,
respectively, 677 and 533 mcg/ml, significantly more
elevated than SPTs (p<0.005) and ASNC (p<0.01)
(Fig. 1).
DISCUSSION
Recognizing that symptoms arising at the contact
between given fruits and vegetables and the oral and
gastrointestinal mucosa are caused by sensitization
to cross-reacting allergens naturally occurring in
such foods and in pollens was a major advance in the
understanding of the pathophysiology of allergy. In
particular, one of the most common associations
between pollinosis and food allergy – the so-called
birch-apple syndrome – was clearly correlated to
sensitization to the major allergen of birch, Bet v 1,
which showed a 90% homology with the major
allergen of apple Mal d 1 (23). Subsequently, a
number of other cross-reactions involving pollens and
 Int. J. Immunopathol. Pharmacol. 145

Table II. Results of skin prick test.

Patient Skin prick test with Skin prick test with recombinant allergens
commercial extract (IR) (mcg/ml)
100 1 10 100
1 Birch ++++ Bet v1 +--- ++-- ++++
2 Birch ++-- Bet v1 ---- ++-- +++-
3 Birch ++++ Bet v1 +++- ++++ ++++
4 Birch ++++ Bet v1 ++-- ++++ ++++
5 Birch ++++ Bet v1 ++-- ++++ ++++
6 Birch ++++ Bet v1 ++++ ++++ ++++
7 Birch +++- Bet v1 +--- +++- ++++
8 Birch +++- Bet v1 +--- +++- ++++
9 Birch ++++ Bet v1 +-- ++++ ++++
10 Birch ++++ Bet v1 ++-- ++++ ++++
11 Timothy ++++ Phl p1 ++-- ++++ ++++
12 Timothy +++- Phl p1 +--- +++- ++++
13 Timothy +++- Phl p1 +--- +++- ++++
14 Timothy +++- Phl p1 +++- ++++ ++++
15 Timothy ++-- Phl p1 ---- ++-- +++-
16 Timothy ++++ Phl p1 +++- ++++ ++++
17 Timothy ++++ Phl p1 ++-- ++++ ++++

Table III. Results of nasal challenges

Patient Nasal challenge with commercial extract Nasal challenge with recombinant allergens
(IR) (mcg/ml)
1 10 100 1 10 100
1 Birch Neg Neg +5 Bet v1 Neg Neg +4
2 Birch Neg Neg +4 Bet v1 Neg Neg +5
3 Birch Neg +3 Bet v1 Neg +4
4 Birch Neg +4 Bet v1 Neg +3
5 Birch Neg Neg +3 Bet v1 Neg Neg +3
6 Birch Neg +4 Bet v1 Neg +4
7 Birch Neg Neg +3 Bet v1 Neg Neg +3
8 Birch Neg Neg +4 Bet v1 Neg Neg +3
9 Birch Neg +4 Bet v1 Neg Neg +3
10 Birch Neg Neg +3 Bet v1 Neg +3
11 Timothy Neg Neg +4 Phl p1 Neg Neg +3
12 Timothy Neg +4 Phl p1 Neg +3
13 Timothy Neg Neg +4 Phl p1 Neg Neg +3
14 Timothy Neg +4 Phl p1 Neg +3
15 Timothy Neg Neg +3 Phl p1 Neg +4
16 Timothy Neg +3 Phl p1 Neg Neg +3
17 Timothy Neg +3 Phl p1 Neg +3
146 F. MARCUCCI ET AL.

Table IV. Results of oral challenge.

Patient Oral challenge with commercial extract Oral challenge with recombinant allergens
(IR) (mcg/ml)
1 10 100 10 100 500 1000
1 Birch Neg Neg +2 Bet v1 Neg Neg +3
2 Birch Neg Neg Neg Bet v1 Neg Neg Neg +3
3 Birch Neg Neg Neg Bet v1 Neg Neg Neg +4
4 Birch Neg Neg Neg Bet v1 Neg Neg +4
5 Birch Neg Neg Neg Bet v1 Neg +3
6 Birch Neg Neg Neg Bet v1 Neg Neg +4
7 Birch Neg Neg Neg Bet v1 Neg Neg Neg Neg
8 Birch Neg Neg Neg Bet v1 Neg Neg Neg +3
9 Birch Neg Neg Neg Bet v1 Neg Neg Neg +3
10 Birch Neg Neg Neg Bet v1 Neg Neg +3
11 Timothy Neg Neg Neg Phl p1 Neg Neg +3
12 Timothy Neg Neg Neg Phl p1 Neg Neg +3
13 Timothy Neg Neg Neg Phl p1 Neg Neg Neg +4
14 Timothy Neg Neg Neg Phl p1 Neg +3
15 Timothy Neg Neg Neg Phl p1 Neg Neg Neg +3
16 Timothy Neg Neg Neg Phl p1 Neg Neg Neg Neg
17 Timothy Neg Neg +3 Phl p1 Neg +3

foods was identified (24). One may reasonably
suppose that the in vitro cross-reactivity may be
reproduced in vivo using pollen extracts, but when we
tested this hypothesis by performing oral challenges
with birch and grass pollen extracts in patients with
pollen-induced rhinoconjunctivitis and OAS from
apple, celery, and tomato, the patients did not react to
the challenge (11).
The availability of recombinant Bet v 1 to be
used for SPT achieved a high diagnostic value in
patients with the birch-apple syndrome and other
related food allergies as well (25). Thus, in order to
verify whether a low concentration of epitopes
cross-reacting with foods may account for the lack
of response to oral challenge with pollen extracts,
we repeated the challenges in patients with
pollinosis and OAS, and in healthy controls, using,
along with commercial extracts, the recombinant
allergens rBet v1 and rPhl p1, which served as
material also for SPTs and nasal challenges.
In agreement with the results of a previous study
(17), we found that SPT and nasal challenge with
rBet v 1 and rPhl p 1 were negative in nonatopic
controls and showed positive results in allergic
patients, comparable to commercial extracts at
concentrations of respectively 18.1 and 64 mcg/ml.
Sublingual challenges with natural extracts were
positive only in 2/17 patients, while sublingual
challenges with recombinant allergens were positive
in 15/17 patients with OAS, but with a mean
threshold concentration of 677 mcg/ml for rBet v1
and 533 mcg/ml for rPhl p1, significantly more
elevated compared with the mean concentrations
needed to achieve positive SPT (18.1 and 8.7
mcg/ml) and nasal challenges (64 and 48.5 mcg/ml).
This confirms the hypothesis that the use of
recombinant allergens in place of natural pollen
extracts directly in the target organ would be able to
demonstrate an in vivo cross-reactivity between
pollens and foods in patients with OAS. The higher
amount of recombinant allergen needed to reproduce
the typical symptoms of OAS, when compared with
SPTs and nasal challenges, leads us to define that the
oral mucosa has a higher threshold response than
skin and nasal mucosa. Moreover, we should
consider that the concentration of commercial
extracts (100 IR) had an amount of natural major
allergen lower than 50 mcg/ml (26, 27) and that the
 Int. J. Immunopathol. Pharmacol.
negativity of oral challenges was probably due to the
insufficient amount of natural allergen, lower than
the oral threshold response. These low
concentrations may also be secondary to the
demonstrated degradation of allergens during the
preparation of commercial extracts (28).
Another aspect to consider deals with SPTs in
patients with OAS, who often show positive tests for
several foods which are not commonly confirmed by
the patients as really responsible for oral symptoms. In
this situation oral challenges with fresh foods are
usually carried out, but they are not standardized and
sometimes difficult to perform. The data we obtained
using rBet v1 and r Phl p1 show that sublingual
challenges with these allergens, stable and
standardized, may be used in the diagnosis of OAS
related to birch and grass pollen allergy. Sublingual
challenges with recombinant allergens, in fact,
induced oral symptoms in 15/17 patients with OAS
and no symptoms in 10 healthy controls, showing high
sensitivity (88%) and specificity (100%).
Thanks to its safety, sublingual mucosa is an
important site of administration for specific
immunotherapy, which was used also in patients
with pollinosis and OAS without important adverse
reactions (29). The most common side effects
reported during sublingual immunotherapy (SLIT)
are oral and gastrointestinal symptoms (30). The
high concentration of allergen needed to reproduce
oral symptoms in the patients with OAS we
observed, supports the safety of SLIT with
recombinant allergens, nowadays used only in
animal models (31).
In conclusion, this study clearly shows the in vivo
cross-reactivity between pollens and foods in patients
with OAS and indicates that sublingual mucosa is
much less reactive to allergens than other surfaces,
such as skin and nasal mucosa, probably due to
anatomic and immunologic peculiarities. The low
reactivity of sublingual mucosa to allergens adds new
data to support the safety of oral mucosa as a site to
obtain the immunological tolerance to allergens.
REFERENCES
1. Ortolani C., M. Ispano, E. Pastorello, A. Bigi and
R. Ansaloni. 1988. The oral allergy syndrome. Ann.
Allergy 61:47.
147
2. Andersen K. and H. Lowenstein. 1970. An
investigation of the possible immunological
relationship between allergen extracts of birch
pollen, hazelnut, potato and apple. Contact
Dermatitis 4:73.
3. Anderson L., E. Dreyfuss and J. Logan. 1970.
Melon and banana sensitivity coincident with birch
pollinosis. J. Allergy Clin. Immunol. 45:310.
4. de Groot H., N.W. de Jong, M.H. Vuijk and R.
Gerth van Wijk. 1996. Birch pollinosis and atopy
caused by apple, peach, and hazelnut; comparison of
three extraction procedures with two apple strains.
Allergy 51:712.
5. Valenta R. and D. Kraft. 1996. Type I allergic
reactions to plant-derived food: a consequence of
primary sensitization to pollen allergens. J. Allergy
Clin. Immunol. 97:893.
6. Pastorello E.A., V. Pravettoni, L. Farioli, F.
Rivolta, C. Conti, M. Ispano, et al. 2002.
Hypersensitivity to mugwort (Artemisia vulgaris) in
patients with peach allergy is due to a common lipid
transfer protein allergen and is often without clinical
expression. J. Allergy Clin. Immunol. 110:310.
7. Kazemi-Shirazi L. G. Pauli, A. Purohit, S.
Spitzauer, R. Froschl, K. Hoffmann-
Sommergruber, et al. 2000. Quantitative IgE
inhibition experiments with purified recombinant
allergens indicate pollen-derived allergens as the
sensitizing agents responsible for many forms of plant
food allergy. J. Allergy Clin. Immunol. 105:116.
8. Sanchez-Monge R., M. Lombardero, F.J. Garcia-
Selles, D. Barber and G. Salcedo. 1999. Lipid
transfer proteins are relevant in fruit allergy. J.
Allergy Clin. Immunol. 103:514.
9. Midoro-Horiuti T., E.G. Brooks and R.M. Goldblum.
2001. Pathogenesis-related proteins of plants as
allergens. Ann. Allergy Asthma Immunol. 87:261.
10. Breiteneder H. and C. Ebner. 2000. Molecular and
biochemical classification of plant-derived food
allergens. J. Allergy Clin. Immunol. 106:27.
11. Marcucci F., F. Frati, L. Sensi, G. Di Cara, E.
Novembre, R. Bernardini, et al. 2005. Evaluation
of food-pollen cross reactivity by nose-mouth cross
challenge in pollinosis with oral allergy syndrome.
Allergy 60:501.
148 F. MARCUCCI ET AL.
12. Bjorksten F., L. Halmepuro, M. Hannuksela and
A. Lahti. 1980. Extraction and properties of apple
antigens. Allergy 35:671.
13. Valenta R., M. Duchene, S. Vrtala, T. Birkner, C.
Ebner, R. Hirschwehr, et al. 1991. Recombinant
allergens for immunoblot diagnosis of tree-pollen
allergy. J. Allergy Clin. Immunol. 88:889.
14. Valenta R., W.R. Sperr, F. Ferreira, P. Valent, C.
Sillaber, M. Tejkl, et al. 1993. Induction of specific
istamine release from basophils with purified natural
and recombinant birch pollen allergens. J. Allergy
Clin. Immunol. 91:88.
15. Ferreira F., K. Hoffmann-Sommergruber, H.
Breiteneder, K. Pettemburger, C. Ebner, W.
Sommergruber, et al. 1993. Purification and
characterization of recombinant Bet v1, the major
birch pollen allergen. J. Biol. Chem. 268:19574.
16. Niederberger V., S. Laffer, R. Froschl, D. Kraft, H.
Rumpold, S. Kapiotis, et al. 1998. IgE antibodies to
recombinant allergens (Phl p 1, Phl p 2, Phl p 5 and Bet
v 2) account for a high percentage of grass pollen-
specific IgE. J. Allergy Clin. Immunol. 101:258.
17. Tresch S., D. Holzmann, S. Baumann, K. Blaser,
B. Wuthrich, R. Crameri, et al. 2003. In vitro and
in vivo allergenicity of recombinant Bet v 1
compared to the reactivity of natural birch pollen
extract. Clin. Exp. Allergy 33:1153.
18. Arquint O., A. Helbling, R. Crameri, F. Ferreira, M.
Breitenbach and W.J. Pichler. 1999. Reduced in vivo
allergenicity of Bet v 1d isoform, a natural component
of birch pollen. J. Allergy Clin. Immunol. 104:1239.
19. van Hage-Hamsten M. , E. Johansson, A. Roquet,
C. Peterson, M. Andersson, L. Greiff L, et al.
2002. Nasal challenges with recombinant derivatives
of the major birch pollen allergen Bet v 1 induce
fewer symptoms and lower mediator release than
rBet v 1 wild-type in patients with allergic rhinitis.
Clin. Exp. Allergy 32:1448.
20. Anhoej C., V. Backer and H. Nolte. 2001.
Diagnostic evaluation of grass- and birch-allergic
patients with oral allergy syndrome. Allergy 56:548.
21. Dreborg S. and A. Frew. 1993. Position paper: Allergen
standardization and skin tests. Allergy 48(S):49.
22. Ciprandi G., V. Ricca, M. Landi, G. Passalacqua,
M. Bagnasco and G.W. Canonica. 1998. Allergen-
specific nasal challenge: response kinetics of clinical
and inflammatory events to rechallenge. Int. Arch.
Allergy Immunol. 115:157.
23. Ebner C., T. Birkner, R. Valenta, H. Rumpold, M.
Breitenbach, O. Scheiner, et al. 1991. Common
epitopes of birch pollen and apples. Studies by Western
and Northern blot. J. Allergy Clin. Immunol. 88:61.
24. Ortolani C., M. Ispano, R. Ansaloni, F. Rotondo,
C. Incorvaia and E.A. Pastorello. 1998. Diagnostic
problems due to cross-reactions in food allergy.
Allergy 53(S):58.
25. Pauli G., J.P. Oster, P. Deviller, S. Heiss, J.C. Bessot,
M. Susani, et al. 1996. Skin testing with recombinant
allergens rBet v1 and birch profillin, rBet v2:
diagnostic value for birch pollen and associated
allergies. J. Allergy Clin. Immunol. 97:1100.
26. Andrè C., C. Vatrinet, S. Galvain, F. Carat and H.
Sicard. 2000. Safety of sublingual-swallow
immunotherapy in children and adults. Int. Arch.
Allergy Immunol. 121:229.
27. Khinchi M.S., L.K. Poulsen, F. Carat, C. Andrè,
A.B. Hansen and H.J. Malling. 2004. Clinical
efficacy of sublingual and subcutaneous birch pollen
allergen-specific immunotherapy: a randomized,
placebo-controlled, double-blind, double-dummy
study. Allergy 59:45.
28. Mayer A.M. and E. Harel. 1979. Polyphenol
oxidases in plants. Phytochemistry 18:193.
29. Lombardi C., G.W. Canonica and G. Passalacqua.
2000. Sublingual IT in OAS. Allergy 55:677.
30. Passalacqua G., F. Fumagalli, L. Guerra and
G.W. Canonica. 2003. Safety of allergen-specific
sublingual immunotherapy and nasal
immunotherapy. Chem. Immunol. Allergy. 82:109.
31. Mahler V., S. Vrtala, O. Kuss, T. Diepgen, R.
Suck, O. Cromwell, et al. 2004. Vaccines for birch
pollen allergy based on genetically engineered
hypoallergenic derivatives of the major birch pollen
allergen, Bet v 1. Clin. Exp. Allergy 34:115.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 149-160 (2006)

THYROID HORMONE AND THYROTROPIN REGULATE INTRACELLULAR FREE

CALCIUM CONCENTRATIONS IN HUMAN POLYMORPHONUCLEAR
LEUKOCYTES: IN VIVO AND IN VITRO STUDIES

F. MARINO, L. GUASTI, M. COSENTINO, D. DE PIAZZA, C. SIMONI, V. BIANCHI, E.

PIANTANIDA, F. SAPORITI, M.G. CIMPANELLI, C. CRESPI, P.VANOLI1, D. DE PALMA1,
C. KLERSY2, G.M. FRIGO3, L. BARTALENA, A.VENCO and S. LECCHINI

Department of Clinical Medicine, University of Insubria, Varese; 1Section of Nuclear Medicine

and Radiotherapy, Ospedale “Di Circolo” e Fondazione Macchi, Varese; 2Biometry and Clinical
Epidemiology, IRCCS Policlinico S. Matteo, Pavia; 3Department of Internal Medicine and
Therapeutics, University of Pavia, Pavia, Italy

Received February 25, 2005 – Accepted November 15, 2005

Intracellular free calcium concentrations ([Ca++]i) were studied in polymorphonuclear leukocytes

(PMNs) from 13 athyreotic patients who had been previously treated by total thyroidectomy and
radioiodine therapy for differentiated thyroid carcinoma, and from age- and sex-matched euthyroid
healthy controls. Patients were studied twice, when hypothyroid (visit 1) and after restoration of
euthyroidism by L-T4 TSH-suppressive therapy (visit 2). PMNs from patients at visit 1 had significantly
lower resting [Ca++]i levels compared to both visit 2 and controls. Values at visit 2 did not differ from
those of the controls. Stimulus-induced [Ca++]i rise was also significantly blunted at visit 1 and
normalized at visit 2, possibly through a differential contribution of distinct intracellular Ca++ stores, as
suggested by the response pattern to the chemotactic agent, N-formyl-Met-Leu-Phe (fMLP), to the
selective SERCA pump inhibitor, thapsigargine, and to the mitochondrial uncoupler, carbonyl cyanide
p-trifluoromethoxyphenyl-hydrazone (FCCP). In vitro treatment of PMNs from healthy subjects with
high TSH concentrations impaired intracellular Ca++ store function. Both resting [Ca++]i levels and
fMLP-induced [Ca++]i rise increased in the presence either of low-concentration TSH or of T4, but
effects of TSH and T4 were not additive. T3, rT3, and TRIAC had no effect. In conclusion, this study
provides evidence for a direct relationship between thyroid status and [Ca++]i homeostasis in human
PMNs, mainly related to direct actions of TSH and T4 on these cells.

Human leukocytes express both nuclear hormone (TSH; 1-3), but effects of thyroid
receptors for triiodothyronine (T3) and plasma hormones and TSH on these cells are poorly
membrane receptors for thyroid-stimulating documented at present. In particular, available data

Key words: intracellular free calcium concentrations; polymorphonuclear leukocytes; thyroid hormones;
hypothyroidism; L-thyroxine replacement
Mailing address:
Marco Cosentino, MD PhD,
Department of Clinical Medicine,
Section of Experimental and Clinical Pharmacology,
University of Insubria, 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Via Ottorino Rossi n. 9, This publication and/or article is for individual use only and may not be further
21100 Varese VA – Italy, reproduced without written permission from the copyright holder.
Tel: +39 0332 217410, -Fax +39 0332 217409, 149 Unauthorized reproduction may results in financial and other penalties
E-mail: marco.cosentino@uninsubria.it
150 F. MARINO ET AL.
concerning polymorphonuclear leukocytes (PMNs),
which represent the first line of defense against
bacterial and fungine infections (4), is scant, and
relates only to changes in plasma membrane
potential induced by in vitro treatment with TSH or
TSH-receptor antibody (5), or stimulation of
phagocytosis and enhancement of IL-2 receptor
expression following incubation with T3 (6-7).
Circumstantial evidence in patients with thyroid
disorders supports the possibility of a relationship
between thyroid status and PMN function: indeed,
hyperthyroidism has been associated with a reduced
number of circulating PMNs, increased index of
spontaneous nitroblue tetrazolium reduction,
decreased phagocytosis index and lisozyme activity
(8), and increased opsonized zymosan-stimulated
O - consumption (9). On the other hand, PMNs from
2
patients with severe hypothyroidism may have
reduced bactericidal capacity (10) or oxidative
metabolism (11).
The present study was undertaken to investigate
mechanisms involved in functional modulation of
human PMNs by thyroid hormone and TSH. To this
purpose, we studied the effects of thyroid hormone
and TSH variations on the regulation of intracellular
free calcium concentrations ([Ca++]i) in these cells.
Several different stimuli may indeed activate different
response patterns in immune cells (12-14). Ca++
however plays a crucial role as a second messenger in
human PMNs (12) and [Ca++]i changes are of key
relevance for their activation sequence (15-18).
Investigations were carried out in athyreotic
patients further to thyroid ablation by total
thyroidectomy and radioiodine therapy for
differentiated thyroid cancer, either in euthyroidism
under L-thyroxine (T4) TSH-suppressive therapy or in
short-term hypothyroidism following L-T4 withdrawal
to perform whole body scan. In vitro experiments on
PMNs obtained from healthy subjects were also
performed, to assess the direct effects of TSH and
thyroid hormones on [Ca++]i in these cells.
MATERIALS AND METHODS
Subjects and experimental design
Twenty-one consecutive patients were enrolled after
total thyroidectomy and radioiodine therapy for papillary
thyroid cancer. Surgery had been performed 18±4 months
before the study. After excluding patients with diseases
other than thyroid cancer or taking drugs other than L-T4,
13 patients were finally enrolled [10 women, 3 men;
mean (±SD) age: 49±16 yr, range: 24-75 yr]. At clinical
examination, systolic and diastolic blood pressure were
135±22/77±11 mm Hg, body weight 65±13 Kg, and
body-mass index 24.4±4.4 Kg/m2.
Patients were studied twice. First evaluation (visit 1:
hypothyroidism) was carried out after L-T4
discontinuation for 1 month to perform whole body scan.
Second evaluation (visit 2: euthyroidism under TSH-
suppressive L-T4 replacement therapy) was performed
7±2 weeks after reinstitution of L-T4 treatment.
In each occasion, venous blood samples were obtained
by use of heparinized tubes between 08.00 and 09.00 h,
after an overnight fast. No subject had taken coffee, tea,
chocolate, or cola-containing substances. None of the
subjects were smokers, or was involved in competitive
physical exercise. Blood sampling was obtained to
perform routine laboratory exams (including TSH, FT3,
FT4, and, at visit 1, thyroglobulin and anti-thyroglobulin
antibodies) and to isolate circulating PMNs for
subsequent studies.
FT4, FT3 and antithyroglobulin antibodies were
assayed by means of a highly sensitive RIA method
(BRAHMS, Henningsdorf, Germany), while highly
sensitive IRMA assays were used for thyroglobulin
(BRAHMS) and TSH (DiaSorin, Saluggia, VC, Italy).
Normal values in our laboratory were as follows: FT4 7.5-
19.0 pg/ml (9.7-24.5 pmol/l), FT3 1.5-5.3 pg/ml (2.3-8.2
pmol/l), TSH 0.3-4.5 µU/ml (milliU/l), thyroglobulin <1
ng/ml (µg/l) (after total thyroidectomy), and anti-
thyroglobulin antibodies <60 U/ml.
Age- and sex-matched euthyroid healthy controls (10
women, 3 men, mean age: 45±13 yr, range: 24-58) were
enrolled, selected from a population evaluated for a general
clinical check-up at the University Department of Clinical
Medicine (Ospedale di Circolo, Varese, Italy). All control
subjects had negative anti-thyroperoxidase anti-
thyroglobulin antibody tests. The study protocol was
approved by the local Ethics Committee and all enrolled
subjects gave informed consent before inclusion in the study.
Cell preparation
Whole blood was allowed to sediment on dextran at
37°C for 30 min. Supernatant was recovered and PMNs
were isolated by standard density-gradient centrifugation
according to established procedures (19). Contaminating
erythrocytes were eliminated by 10 min hypotonic lysis in
distilled water with added NH4Cl 8.2 g/l, KHCO3 1.0 g/l,
and EDTA 37.0 mg/l. Cells were then washed three times
 Int. J. Immunopathol. Pharmacol.
in NaCl 0.15 M. Purity and viability of PMNs
preparations were always >95% and no platelets or
erythrocytes could be detected either by light microscopic
examination or by flow cytometric analysis. In some
experiments devised to study the effects of long-term (up
to 24 h) exposure of PMNs to thyroid hormones, cells
were cultured at the concentration of 1x106 cells/ml in
RPMI 1640 medium supplemented with heath-inactivated
fetal calf serum 10%, glutamine 2 mM and
penicillin/streptomycin 100 U/ml, at 37°C in a moist
atmosphere of 5% CO2. After 24-h culture, cell viability
was always >95%.
Measurement of [Ca++]i
PMNs were resuspended at the concentration of
2x106/ml in Ca++/Mg++-free PBS [composition as follows
(g/l): NaCl 8.0, KCl 0.2, Na2HPO4xH2O 1.3, KH2PO4 0.2]
with added bovine serum albumin (BSA) 0.25%. Cells
were incubated at 37°C for 30 min with the fluorescent
probe Fura-2/AM (Calbiochem-Novabiochem Corp., La
Jolla, CA, USA; stock solution: 1 mM in dimethyl
sulfoxide) at the concentration of 5 µM, and subsequently
washed twice by gentle centrifugation (5 min, 300 g),
resuspended in PBS supplemented with HEPES 10 mM,
glucose 10 mM, BSA 0.25%, and CaCl2 1 mM, and
finally placed at 37°C in a thermostatically controlled
cuvette equipped with a cuvette stirrer. Fluorescence
measurements were performed using a spectrofluorimeter
(Perkin-Elmer LS-50B, Perkin Elmer Instruments,
Bridgeport, CT, USA). Excitation of Fura-2 was
performed at 340 and 380 nm, with excitation band
widths set at 5 nm. Calibration of the fluorescence signals
to quantitate [Ca++]i was performed by the addition of
Triton X 100 0.5% and CaCl2 1 mM (max) or TRIS 45
mM and EGTA/TRIS 50 mM (min). The ratio of
fluorescence signals emitted at 510 nm was finally used to
calculate the [Ca++]i, according to Grynkiewicz et al. (20).
For all subjects included in the study, 3 samples were
prepared and assayed for [Ca++]i changes induced by use
of each of the following pharmacological agents:
0.1 µM N-formyl-Met-Leu-Phe (fMLP; Sigma St.
Louis, MO, USA), a chemotactic peptide acting on
membrane receptors, which triggers [Ca++]i rise through
both Ca++ influx from the extracellular space and Ca++
mobilization from intracellular stores (21);
2 µM thapsigargine (Sigma), which is a selective
inhibitor of the SERCA pump and therefore mobilizes
Ca++ from the endoplasmic reticulum (22);
5 µM carbonyl cyanide p-trifluoromethoxyphenyl-
hydrazone (FCCP, Sigma), which is a protonophore and
151
induces [Ca++]i rise through depletion of mitochondrial
stores (23).
In each experiment drugs were added to the cells after
a 60-s resting period and the following parameters were
evaluated:
resting [Ca++]i levels, calculated as the mean 1-min
pretreatment values;
[Ca++]i changes, calculated as:
the time required to reach the highest [Ca++]i values;
the difference (∆) between the highest [Ca++]i values
reached after addition of each agent and the resting levels;
the area under the [Ca++]i-vs-time curve (AUC),
calculated over a 3-min period for the response to fMLP
and over a 5-min period for the responses to thapsigargine
and FCCP.
In vitro studies
In vitro studies were performed on PMNs obtained
from healthy donors. Briefly, cells were exposed to
different concentrations of bovine TSH (Sigma), T4 (L-
thyroxine sodium pentahydrate, Sigma), or T3 (3,3’,5-
triiodothyronine sodium, Sigma). Duration of exposure
ranged from 60 s (short-term exposure) up to 24 h (long-
term exposure). Appropriate control experiments were
performed by use of rT3 (3,3’,5’-triiodo-L-thyronine,
Sigma), TRIAC (3,3’,5-triiodotyracetic acid, Sigma) and
FSH (follicle stimulating hormone from human pituitary,
Sigma), a glycoprotein which shares with TSH a common
α subunit, the biological specificity of these proteins
residing in the different β subunits. In short-term
experiments the cells were directly placed into a cuvette
for spectrofluorimetric assay, added to a given
concentration of either TSH (0.1-150 µU/106 cell), T3 (1-
10 ng/106 cell)or L-T4 (0.1-5 ng/106 cell), and
subsequently treated with either fMLP, thapsigargine or
FCCP, according to the same experimental design used
for PMNs from patients. In long-term experiments, cells
were cultured under standard conditions in the presence
of a given concentration of either TSH, T3 or L-T4. Cells
were then harvested, prepared for [Ca++]i measurement,
and subsequently placed into a cuvette and treated with
the various pharmacological agents. In each experiment,
any given concentration of TSH, T3 or L-T4 was added to
three different samples, in order to test the effects of
fMLP, thapsigargine or FCCP on distinct cell
preparations.
Statistical analysis
Data were expressed as mean and standard deviation.
In experiments on PMNs obtained from patients and their
152 F. MARINO ET AL.
matched controls, general linear models were used to
compare variables measuring [Ca++]i changes over time or
between groups. Robust standard errors were calculated
to account for intra-patient correlation over time. Both
unadjusted models and models adjusted for age were
fitted. Due to the low sample size, confounders were
fitted separately into the models. Changes in time or
differences between groups were estimated together with
their 95% confidence intervals (C.I.). Log transformation
was performed to obtain zero-skewed variables for model
fitting. In in vitro experiments devised to study the direct
effects of thyroid hormones on PMNs, statistical
significance of the differences between values obtained in
each treatment group were evaluated by one-way analysis
of variance followed by Bonferroni or Dunnet post test, as
appropriate. Stata 8 (StataCorp, College Station, TX,
USA) was used for computation, and a 2-sided P-value at
least <0.05 was considered statistically significant.
RESULTS
Subjects
At visit 1, serum hormone concentrations were
the following: TSH 82.0±19.7 mU/ml (mU/l), FT3
1.3±0.2 pg/ml (2.0±0.3 pmol/l), and FT4 1.0±2.0
pg/ml (1.3±2.6 pmol/l). At visit 2, in all patients
serum TSH was suppressed by L-T4 replacement
below 0.1 mU/ml (mU/l), FT3 was 4.1±0.2 pg/ml
(6.3±0.3 pmol/l) and FT4 18.0±3.0 pg/ml (23.2±3.9
pmol/l). At visit 1, in all patients serum
thyroglobulin was <0.1 ng/ml (mg/l) and anti-
thyroglobulin antibodies were <60 U/ml, indicating
that they were disease-free.
[Ca++]i
Typical tracings obtained in isolated PMNs from
a patient and from a matched control, representative
of the general pattern observed in the whole group,
are shown in Fig. 1, while [Ca++]i values obtained in
PMNs from all patients at visit 1 and visit 2, and
from euthyroid controls are summarized in Table I.
PMNs from patients at visit 1 had significantly
lower resting [Ca++]i levels, and significantly slower
and lower fMLP-induced [Ca++]i rise (in terms of
both ∆[Ca++]i and AUC) with respect to PMNs from
the same subjects at visit 2 (both in unadjusted
analysis and after adjusting for age). Moreover, at
visit 1, resting [Ca++]i levels were lower than values
obtained from controls and response to fMLP was
also slower. Values in PMNs from patients increased
at visit 2, up to values observed in controls.
At visit 1, both thapsigargine- and FCCP-induced
[Ca++]i increases were significantly slower and
∆[Ca++]i was significantly lower with respect to
control values. For thapsigargine, even AUC was
significantly lower than in controls, while for FCCP
this parameter did not differ from control values. At
visit 2, the time required to reach the highest [Ca++]i
values significantly decreased for both agents, down
to values observed in controls. After exposure to
thapsigargine, ∆[Ca++]i remained unchanged (and
therefore significantly lower than control values),
while AUC increased to control values. After
exposure to FCCP, both ∆[Ca++]i and AUC showed a
huge increase. In particular, FCCP-induced AUC
reached values which were even significantly higher
than those found in controls (Table I).
In vitro effects of TSH, T3 and L-T4 on [Ca++]i
Short-term (60 s) incubation of PMNs from healthy
subjects with TSH (0.1-150 µU/ml) was associated
with an increase in resting [Ca++]i levels (Fig. 2, panel
A). Moreover, TSH exposure enhanced fMLP-induced
[Ca++]i rise (in terms of both ∆[Ca++]i and AUC) with a
bell-shaped pattern of the concentration-response
curves (as observed in the presence of TSH 10 µU/ml),
whereas the time to reach the highest [Ca++]i values was
unaffected (Fig. 2, panel B). At variance, ∆[Ca++]i and
AUC (but not time) of thapsigargine- or FCCP-induced
[Ca++]i rise were reduced by TSH at concentrations
ranging from 100-150 µU/ml (Fig. 2, panels C and
D). Short-term incubation of PMNs with L-T4 (0.1-5
ng/ml) had no significant effect on either resting
[Ca++]i levels or stimulated [Ca++]i rise (data not
shown). To assess the specificity of TSH-induced
effects, the same parameters were tested in the
presence of equimolar concentrations of human
FSH. At variance with TSH, incubation with FSH
(in the 0.15-22.50 ng/ml concentration range,
corresponding to 1.05-157.50 mU/ml) did not affect
to any significant extent either resting or stimulated
[Ca++]i responses (data not shown).
Long-term (24 h) incubation with TSH had the
same effects as 60-s incubation on all the parameters
investigated (data not shown). However, 24-h
incubation increased resting [Ca++]i levels in a
 Int. J. Immunopathol. Pharmacol. 153

500
fMLP
concentration-dependent manner (Fig. 3, panel A)
and fMLP-induced [Ca++]i rise, in terms of both
400 ∆[Ca++]i and AUC (Fig. 3, panel B). L-T4 0.1 ng/ml
(but not higher concentrations) also increased the
] i (nM)

300
time required to reach the highest [Ca++]i values after
fMLP stimulation (Fig. 3, panel B). L-T4 had no
++

200
[Ca

effect on thapsigargine-induced [Ca++]i rise (Fig. 3,

panel C), and decreased ∆[Ca++]i and AUC (but not
100
time) of FCCP-induced [Ca++]i rise also in a
0
concentration-dependent manner (Fig. 3, panel D).
Up to 24 h-incubation of PMNs with T3 (1-10
0 60 120 180 240
time (s) ng/ml), rT3 (1-10 ng/ml), or TRIAC (1-10 ng/ml)
had no effect whatsoever (data not shown).
TSH and T4 do not reciprocally influence their
effects: indeed, coincubation with both hormones
250
thapsigargine did not affect to any significant extent either resting
[Ca++]i levels or fMLP-induced [Ca++]i rise (Fig. 4).
200

DISCUSSION
[Ca ++ ] i (nM)

150

The results of the present study performed in

100
athyreotic patients after total thyroidectomy and
radioiodine therapy for differentiated thyroid cancer
50
provide evidence that regulation of [Ca++]i in human
PMNs is closely related to thyroid status, and that
0
such a correlation may be explained at least in part
0 60 120 180 240 300
on the basis of direct effects of TSH and T4 on these
time (s)
cells. Patients were evaluated longitudinally when
hypothyroid (visit 1) and after restoration of
euthyroidism by TSH-suppressive L-T4 treatment
300
FCCP
(visit 2). Such an experimental design made it
possible not only to compare data obtained in
hypothyroid patients with those of healthy controls,
200
but also to correlate [Ca++]i modifications with
[Ca ++] i (nM)

variations in thyroid status in individual patients. In

addition, the comparison of modifications observed
100
in cells from patients with the results of in vitro
experiments on isolated PMNs allowed us to
speculate about the relative importance of direct
cellular effects of thyroid hormone and TSH in
0
modulating PMN function. In order to investigate
0 60 120 180 240 300
regulation of [Ca++]i in PMNs at several levels, we
time (s)
used different pharmacological tools. Thus, the
response to fMLP can be considered an index of the
Fig. 1. Effect of pharmacological treatments (added at
overall ability of the cell to react to external stimuli,
arrowhead) on [Ca++]i in PMNs obtained from a patient
while those to thapsigargine and FCCP are a
at visit 1 (empty triangles) and at visit 2 (filled triangles),
and from her matched control (empty circles).
measure of functional status of defined intracellular
154 F. MARINO ET AL.

200

A 175
** **
150

125
]i (nM)

100
++
[Ca

75

50

25

0
0 0,1 1 10 50 100 150

30

B
400
40000
** **

300
*
30000
20
*
? [Ca ++ ] (nM)

AUC (nmol/s)
time (s)

200 20000

10
µ

100 10000

0 0 0
0 0,1 1 10 50 100 150 0 0,1 1 10 50 100 150 0 0,1 1 10 50 100 150

250

C
150
12500

125
200 10000

100
]i (nM)

150
AUC (nmol/s)

7500
time (s)

75 *
*
++
? [Ca

100 5000
50 * *
µ

50 2500
25

0 0 0
0 0,1 1 10 50 100 150 0 0,1 1 10 50 100 150 0 0,1 1 10 50 100 150

250

D 350

300
15000

200
12000
250
(nM)

150
AUC (nmol/s)

9000
200
time (s)

*
++]

150
* *
? [Ca

100 6000
*
µ

100
50 3000
50

0 0 0
0 0.1 1 10 50 100 150 0 0.1 1 10 50 100 150 0 0.1 1 10 50 100 150

TSH (µ
TSH ( ?Ul/ml)
UI/ml) TSH(µ
TSH ( ?Ul/ml)
UI/ml) TSH (µ Ul/ml)
TSH ( ? UI/ml)

Fig. 2 Concentration-response relationships for the in vitro effects of short-term (60 s) exposure to TSH on resting
[Ca++]i levels (panel A) and on the [Ca++]i rise induced by fMLP (panel B), thapsigargine (panel C), or FCCP (panel D)
in isolated, FURA-2 loaded PMNs obtained from healthy donors. Each bar represents the mean±SD of 5-7 experiments.
* = P< 0.05; ** = P< 0.01 vs control values. For further details see Materials and Methods section.
 Int. J. Immunopathol. Pharmacol. 155

Table I. [Ca++]i levels and [Ca++]i to different stimuli in PMNs from patients and from healthy controls. [Ca++]i values
obtained in PMNs from athyreotic patients when hypothyroid (visit 1) and after restoration of euthyroidism by TSH-
suppressive T4 treatment (visit 2), and from age- and sex-matched euthyroid controls.
Patients Controls
(mean±SD) (mean±SD)
visit 1 visit 2 P (visit 1 vs visit 2) P (controls vs patients)
(unadj.) (age-adj.) (visit 1) (visit 2)

resting (nM) 42.9±47.5 175.0±121.2 0.002 0.002 139.8±63.9 0.000 n.s.

fMLP
- time (s) 17.1±5.1 10.6±4.7 0.007 0.008 10.5±7.7 0.004 n.s.
- [Ca++]i (nM) 138.4±65.1 198.6±85.8 0.036 0.040 238.6±154.7 0.045 n.s.
- AUC (nM x min) 182.1±102.8 273.3±177.3 0.025 0.028 288.3±112.6 0.018 n.s.

thapsigargine
- time (s) 237.4±9.1 214.1±37.3 0.011 0.013 196.9±46.6 0.000 n.s.
- [Ca++]i (nM) 154.0±77.8 164.9±80.2 n.s.* n.s. 258.3±98.4 0.011 0.022
- AUC (nM x min) 189.9±110.27 332.5±223.9 n.s. n.s. 254.8±115.2 n.s. n.s.

FCCP
- time (s) 223.1±52.7 199.1±40.7 n.s. n.s. 171.6±46.4 0.004 n.s.
- [Ca++]i (nM) 98.6±63.0 217.3±117.7 0.007 0.008 174.7±103.1 0.016 n.s.
- AUC (nM x min) 271.9±226.6 697.0±520.1 0.009 0.011 296.5±95.7 n.s. 0.039

*n.s. = not significant

compartments (endoplasmic reticulum stores and
mithocondrial stores, respectively) (21-23).
Cells from hypothyroid patients (visit 1) had
lower resting [Ca++]i levels and showed a weaker
response to pharmacological stimuli. This suggests
that “hypothyroid” PMNs are less reactive to
activating stimuli, possibly due to diminished
intracellular storage of Ca++ in both endoplasmic
reticulum and mitochondria. This is in keeping with
the observation that restoration of euthyroidism by
L-T4 (visit 2) was associated with normalization of
both resting [Ca++]i and its response to fMLP.
However, the finding that restoration of
euthyroidism was accompanied by a normal or even
excessive [Ca++]i response to FCCP and a blunted
response to thapsigargine seems to indicate that
functional recovery of various subcellular
compartments may be different, earlier in the
mitochondrial system, slower and later in
endoplasmic reticulum. The occurrence of a
preferential recovery of mitochondrial stores is
indirectly supported by the reported ability of thyroid
status to affect mitochondrial function (24-25).
Primary hypothyroidism is associated with a
decrease in serum thyroid hormone levels and an
increase in serum TSH concentrations. To verify
whether these changes can account for the observed
variations in [Ca++]i regulation in hypothyroid patients,
in vitro we further in vitro exposed PMNs from
euthyroid healthy subjects to increasing
concentrations of TSH and L-T4. Short-term treatment
of PMNs with TSH at high concentrations, similar to
those observed in primary hypothyroidism,
profoundly reduced the [Ca++]i response to both
thapsigargine and FCCP, whereas lower
concentrations of the hormone, in the euthyroid range
or even lower, induced a significant increase in both
resting [Ca++]i levels as well as in fMLP-induced
[Ca++]i rise. The specificity of TSH-induced effects are
indirectly supported by the inability of human FSH (a
glycoprotein which shares with TSH a common α
subunit, the biological specificity of the proteins
residing, however, in their different β subunits) to
affect any of the parameters tested.
Resting [Ca++]i levels and fMLP-induced [Ca++]i
rise were increased by long-term (24 h) cell exposure
to T4 also in a concentration-dependent manner.
Caution must obviously be exerted when trying to
infer any conclusions from in vitro experiments, since
isolated PMNs from healthy subjects clearly differ in
many instances from cells obtained from patients,
especially in terms of duration of exposure to a milieu
containing high TSH and low T4. Nevertheless, both
156 F. MARINO ET AL.

A
50

*
40 *
[Ca ++ ] i (nM)

30

20

10

0
0 0.1 0.5 1 5

*
B
15.0
120 5000
** **
*
12.5 *
4000
90 **
10.0 **
**
? [Ca ++ ] i (nM)

AUC (nmol/s)
3000
time (s)

7.5 60

2000
5.0

30
1000
2.5

0.0 0 0
0 0,1 0,5 1 5 0 0,1 0,5 1 5 0 0,1 0,5 1 5

7500

C
250 50

200 40

5000
] i (nM)

AUC (nmol/s)

150 30
time (s)

++
? [Ca

100 20
2500

50 10

0 0 0
0 0.1 0.5 1 5 0 0.1 0.5 1 5 0 0.1 0.5 1 5

D
250 60
7500

200

40
5000
*
] i (nM)

150 *
AUC (nmol/s)

* **
time (s)

++
? [Ca

100

20 2500

50

0 0 0
0 0.1 0.5 1 5 0 0.1 0.5 1 5 0 0.1 0.5 1 5

L-T 4 (ng/ml) L-T (ng/ml) L-T 4 (ng/ml)

4

Fig. 3. Concentration-response relationships for the in vitro effects of long-term (24 h) exposure to T4 on resting [Ca++]i
levels (panel A) and on the [Ca++]i rise induced by fMLP (panel B), thapsigargine (panel C), or FCCP (panel D) in
isolated, FURA-2 loaded PMNs obtained from healthy donors. Each bar represents the mean±SD of 5-7 experiments. *
= P< 0.05; ** = P< 0.01 vs control values. For further details see Materials and Methods section.
 Int. J. Immunopathol. Pharmacol.
experimental approaches may lead to propose that
both TSH and T4 play a physiological role in vivo in
the functional modulation of PMNs, possibly through
a direct action on these cells. However, the observation
that L-T4 reduced the response to FCCP seems at
variance with the increased response to FCCP
observed in patients at visit 2. Admittedly, we have no
definite explanation for these findings, but it cannot be
excluded that the discrepancies between in vitro and
clinical observations underline the occurrence in vivo
of additional mechanisms, eventually due to the action
of thyroid hormones on other cells and tissues, in turn
affecting PMN function.
Since low-concentration TSH and high-
concentration L-T4 exerted similar effects on PMNs,
we performed some experiments to assess whether
TSH and T4 reciprocally influence their effects. To this
purpose, PMNs were incubated with both hormones,
at concentrations which may well mimick T4-induced
TSH suppression. Under such conditions, however,
the consequences on resting [Ca++]i levels and on
fMLP-induced [Ca++]i rise were completely
superimposable to those observed in the presence of
either hormones alone, suggesting that TSH- and T4-
induced effects on [Ca++]i in PMNs are not additive.
Interestingly enough, in our in vitro experiments
T3 or its metabolite TRIAC failed to affect to any
significant extent [Ca++]i levels and [Ca++]iresponses
of PMNs. This finding may somehow be surprising,
since it is generally acknowledged that most effects
of thyroid hormones are mediated by T3: this is the
active hormone binding to intracellular receptors
and inducing the typical pattern of genomic effects,
while T4 is mainly considered the pro-hormone from
which T3 is generated by intracellular deiodination
(26). Nonetheless, it is unlikely that the effects of T4
depend upon a non-specific action of this
compound, as rT3 had no effect in the same
experimental model. There are several reports
describing numerous nongenomic effects by T3 and
T4, which occur through the activation of membrane-
signalling pathways other than nuclear receptors
(reviewed in 26 and 27). For instance, in HeLa cells
T4 potentiates the antiviral activity of interferon-γ,
an effect which does not depend on deiodination or
traditional nuclear receptors, and occurs through
activation of several intracellular kinases (28).
157
Therefore, it cannot be excluded that in human
PMNs the effects of T4 depend on the direct
activation of putative membrane receptors. An
alternative explanation could be that in our in vitro
model T3 is rapidly inactivated, eventually limiting
its intracellular penetration.
In human PMNs, [Ca++]i signalling plays a
fundamental role in the regulation of cell function
(15-18). The finding that [Ca++]i signalling is
impaired in PMNs from hypothyroid patients may
well account for the reduced PMN function reported
in this kind of subjects (10-11), and it could be
therefore proposed, at least as a working hypothesis,
that in hypothyroid state possibly all [Ca++]i -
operated functions of PMNs may be depressed. As a
further support to this possibility, effective T4
replacement treatment in hypothyroid patients
reverts both the impairment of [Ca++]i signalling
(present study) as well as the reduced oxidative
metabolism of these cells (11).
Extensive experimental evidence supports the
ability of thyroid hormones to affect [Ca++]i in
several cell types. The vast majority of the studies,
however, addressed the effects of such hormones
on [Ca++]i homeostasis in cardiac muscle (29).
Thyroid hormone-induced [Ca++]i changes are also
well characterized in skeletal muscle, where they
upregulate the expression of [Ca++]i channels (30),
activate the intracellular [Ca++]i release channels of
the endoplasmic reticulum (31), induce SERCA
enzyme gene expression and activity (32-33), and
affect SERCA enzyme mRNA levels (34). In
addition, thyroid hormones have been shown to
affect [Ca++]i in rat pancreatic acini (35) and
embryonic intestinal epithelial cells (36), and to
act on the Ca++ pump expressed on the membrane
of human red blood cells (37). This is, however,
the first study documenting the ability of thyroid
hormones to affect [Ca++]i responses in human
PMNs. In particular, our results provide evidence
for a direct relationship between thyroid status and
[Ca++]i responses, which may involve a differential
sensitivity of intracellular Ca++ stores to thyroid
hormones and TSH. Impairment of Ca++ signalling
may contribute in explaining the reduction of
PMN function which has been reported in
hypothyroid state.
158 F. MARINO ET AL.

A
50
* *
40 *
]i (nM)

30
++

20
[Ca

10

TSH (1 - + - +
?U/ml)
T 4 (5 - - + +
ng/ml)

B
150 6000
20
* * * *
* 5000

15

100 4000
*
? [Ca ++ ] (nM)

AUC (nmol/s)
time (s)

10 3000
µ

50 2000

5
1000

0 0 0

TSH(1(µ?U/ml)
TSH Ul/ml) - + - + TSH
TSH(µ
(1 Ul/ml)
? U/ml) - + - + TSH (1
TSH (µ ?U/ml)
Ul/ml) - + - +
T4 (5 ng/ml) - - + + T 4 (5 ng/ml) - - + + T4 (5 ng/ml) - - + +

++
Fig. 4. In vitro effect of 24-h exposure to TSH, T4 and TSH together with T4 on resting [Ca ]i levels (panel A) and on fMLP-
induced [Ca++]i rise (panel B) in isolated, FURA-2 loaded PMNs obtained from healthy donors. Each bar represents the
mean±SD of 3-6 experiments. * = P< 0.01 vs control values. For further details see Materials and Methods section.

ACKNOWLEDGEMENTS isolated from normal human polynuclear

The helpful assistance of Dr. Marco Ferrari in
performing some experiments is gratefully
acknowledged. The Authors are grateful to Prof.
Giovanni Chelazzi, Dr. Davide Rossi and Dr.
Simona Cattaneo, Immunohematology and
Transfusional Service, Ospedale di Circolo (Varese,
Italy) who collaborated in providing human blood.
This work was supported in part by grants from
the University of Insubria (Fondi d’Ateneo per la
Ricerca) to MC, LG, LB, and from the Ministry for
Education, University and Research (MIUR,
Rome, Project “Studies on the relationship between
fetal microchimerism and thyroid autoimmune
diseases”) to LB.
REFERENCES
1. Pekonen F. and B.D. Weintraub. 1978.
Thyrotropin binding to cultured lymphocytes and
thyroid cells. Endocrinology 103:1668.
2. Brisson-Lougarre A. and C.J. Blum. 1985.
Specific receptors for triiodothyronine in nuclei
neutrophils. CR Acad. Sci. III. 300:287.
3. Chaboud P. and S. Lissitztky. 1977. Thyrotropin-
specific binding to human peripehral blood monocytes
and polymorphonuclear leukocytes. Mol. Cell.
Endocrinol. 7:79.
4. Fujishima S. and N. Aikawa. 1995. Neutrophil-
mediated tissue injury and its modulation. Intensive
Care Med 21:277.
5. Kiss E., C. Balazs, L. Bene, S. Damjanovich and
J. Matko. 1997. Effect of TSH and anti-TSH
receptor antibodies on the plasma membrane
potential of polymorphonuclear granulocytes.
Immunol. Lett. 55:173.
6. Balazs C., A. Leövey, M. Szabó and G. Bakó.
1980. Stimulating effect of triiodothyronine on cell-
mediated immunity. Eur. J. Clin. Pharmacol. 17:19.
7. Nakanishi K., Y. Taniguchi and M. Onji. 1999.
Triiodothyronine enhances expression on the interleukin-
2 receptor alpha chain. Endocrinol. J. 46:437.
8. Hrycek A. 1995. Functional characterization of
peripheral blood neutrophils in patients with
 Int. J. Immunopathol. Pharmacol.
hypothyroidism. Folia Biol. 41:79.
9. Szabó J., G. Fóris, E. Mezösi, E.V. Nagy, G.Y.
Paragh, I. Sztojka and A. Leövey. 1996. Parameters of
respiratory burst and arachidonic acid metabolism in
polymorphonuclear granulocytes from patients with
various thyroid diseases. Exp. Clin. Endocrinol.
Diabetes 104:172.
10. Palmblad J., U. Adamson, U. Rosenquist, A.M.
Uden and N. Vednizelos. 1981. Neutrophil function
in hypothyroid patients. Acta Med. Scand. 210:287.
11. Farid N.R., G. Woodford, B. Au and R.K.
Chandra. 1976. Polymorphonuclear leucocyte
function in hypothyroidism. Horm. Res. 7:247.
12. Weissmann G., J.E. Smolen and H.M. Korchak.
1980. Release of inflammatory mediators from
stimulated neutrophils. New Engl. J. Med. 303:27.
13. Shrivastava P., S.M. Singh and N. Singh. 2004.
Activation of tumor-associated macrophages by
thymosin alpha 1. Int. J. Immunopathol.
Pharmacol. 17:39.
14. Ghoneum M. and M. Matsuura. 2004.
Augmentation of macrophage phagocytosis by
modified aravbinoxylan rice bran (MGN-3/biobran).
Int. J. Immunopathol. Pharmacol. 17:283.
15. Appert-Collin A., F.H. Duong, P. Passilly-Degrace, J.P.
Gies, J.M. Warter and P. Poindron. 2004. Quantification
of neurotrophin mRNA expression in PMN mouse:
modulation by Xaliproden. Int. J. Immunopathol.
Pharmacol. 17:157.
16. Korchak H.M., K. Vienne, L.E. Rutherford, C.
Wilkenfeld, M.C. Finkelstein and G. Weissmann.
1984. Stimulus response coupling in the human
neutrophil. II. Temporal analysis of changes in cytosolic
calcium and calcium efflux. J. Biol. Chem. 259:4076.
17. Baggiolini M., A. Walz and S.L. Kunkel. 1989.
Neutrophil-activating peptide-1/interleukin 8, a
novel cytokine that activates neutrophils. J. Clin.
Invest. 84:1045.
18. Ehrengruber M.U., T. Geiser and D.A.
Deranleau. 1994. Activation of human neutrophils
by C3a and C5a. Comparison of the effects on shape
changes, chemotaxis, secretion, and respiratory
burst. FEBS Letters 346:181.
19. Boyum A. 1968. Isolation of mononuclear cells and
granulocytes from human blood. Isolation of
159
mononuclear cells by one centrifugation, and of
granulocytes by combining centrifugation and
sedimentation at 1 g. Scand. J. Clin. Lab. Invest. 97(s):77.
20. Grynkiewicz G., M. Poenie and R.Y. Tsien. 1985.
A new generation of calcium indicators with greatly
improved fluorescence properties. J. Biol. Chem.
260:3440.
21. Chen L.W. and C.R. Jan. 2001. Mechanisms and
modulation of formyl-methyonyl-leucyl-phenylalanine
(fMLP)-induced Ca2+ mobilization in human
neutrophils. Int. J. Immunol. 1:1341.
22. Geiszt M., K. Kaldi, J.B. Szeberenyi and E. Ligeti.
1995. Thapsigargin inhibits Ca2+ entry into human
neutrophil granulocytes. Biochem. J. 305:525.
23. Fossati G., D.A. Moulding, D.G. Spiller, R.J.
Moots, M.R.H. White and S.W. Edwards. 2003.
The mitochondrial network of human neutrophils:
role in chemotaxis, phagocytosis, respiratory burst
activation, and commitment to apoptosis. J.
Immunol. 170:1964.
24. Brand M.D., D. Steverding, B. Kadenbach, P.M.
Stevenson and R.P. Hafner. 1992. The mechanism
of the increase in mithocondrial proton
permeability induced by thyroid hormones. Eur. J.
Biochem. 206:775.
25. Wrutniak-Cabello C., F. Casas and G. Cabello.
2001. Thyroid hormone action in mithocondria. J.
Mol. Endocrinol. 26:67.
26. Yen P. 2001. Physiological and molecular basis of
thyroid hormone action. Physiol. Rev. 81:1097.
27. Bassett J.H.D., C.B. Harvey and G.R. Williams.
2003. Mechanisms of thyroid hormone receptor-
specific nuclear and extra nuclear actions. Mol. Cell.
Endocrinol. 213:1.
28. Lin H.Y., P.M. Yen, F.B. Davis and P.J. Davis.
1997. Protein synthesis-dependent potentiation by
thyroxine of antiviral activity of interferon-γ. Am. J.
Physiol. 273:1225.
29. Carr A.N. and E.G. Kranias. 2002. Thyroid
hormone regulation of calcium cycling proteins.
Thyroid 12:453
30. Brodie C. and S.R. Sampson. 1990. Thyroid hormones
up-regulate Ca-channels in cultured skeletal muscle of
the rat. Neurosci. Lett. 117:325.
31. Connelly T.J., R. el-Hayek, M. Sukhareva and R.
 F. MARINO ET AL.
160
Coronado. 1994. L-thyroxine activates the intracellular
Ca2+ release channel of skeletal muscle sarcoplasmic
reticulum. Biochem. Mol. Biol. Int. 32:441.
32. Muller A., C. van Hardeveld, W.S. Simonides and
J. van Rijn. 1992. Ca2+ homeostasis and fast-type
sarcoplasmic reticulum Ca(2+)-ATPase expression in
L6 muscle cells. Role of thyroid hormone. Biochem.
J. 283:713.
33. Simonides W.S., M.H. Thele, C.G. van der
Linden, A. Muller and C. van Hardeveld. 2001.
Mechanism of thyroid hormone regulated expression
of the SERCA genes in skeletal muscle: implications
for thermogenesis. Biosci. Rep. 21:139.
34. Sayen M.R., D.K. Rohrer and W.H. Dillmann.
1992. Thyroid hormone response of slow and fast
sarcoplasmic reticulum Ca2+ ATPase mRNA in
striated muscle. Mol. Cell. Endocrinol. 87:87.
35. Dho S., T.A. Ansah and R.M. Case. 1989. Influence
of thyroid status on Ca2+ mobilization and amylase
secretion in rat pancreatic acini. Cell. Calcium 10:551.
36. Rogers J.O. and B.L. Black. 1996. The effect of
hydrocortisone and thyroxine on development of
calcium homeostasis in embryonic intestinal
epithelium. Experientia 52:558.
37. Rubinacci A., P. Divietti, S. Lodigiani, A. De Ponti
and M. Samara. 1992. Thyroid hormones and
active calcium transport of inside-out cell membrane
vescicles. Biochem. Med. Metab. Biol. 48:235.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 161-170 (2006)

ANGIOGENIC MOLECULES IN HODGKIN’S DISEASE: RESULTS FROM

SEQUENTIAL SERUM ANALYSIS
F.H. PASSAM, M.G. ALEXANDRAKIS1, J. MOSCHANDREA3, A. SFIRIDAKI4, P.A. ROUSSOU
and N.M. SIAFAKAS2

III Dept of Internal Medicine, Sotiria Hospital, Medical School of Athens, University of Athens;
1
Departments of Hematology and 2Thoracic Medicine, University Hospital of Heraklion, Crete;
3
Dept of Social Medicine, Medical School of Crete, University of Crete; 4Dept of Hematology,
Venizelion General Hospital, Heraklion, Crete, Greece

Received March 7, 2005 - Accepted November 15, 2005

Increased angiogenic activity has been demonstrated in lymphoproliferative diseases including

Hodgkin’s disease. In the current study, the levels of circulating angiogenic molecules in 60
Hodgkin’s patients were determined prior to and after treatment and correlated to disease stage and
prognostic score. Hepatocyte growth factor (HGF), vascular endothelial growth factor (VEGF),
interleukin-6 (IL-6) and tumor necrosis factor-αα (TNF-α α) were increased in Hodgkin’s patients in
comparison to healthy controls (p<0.001). Angiogenin and angiopoietin-2 levels did not differ from
controls. HGF, VEGF, TNF-α α and angiogenin decreased significantly in Hodgkin’s patients after
standard treatment (p<0.001 for HGF, p<0.05 for VEGF, TNF-α α and angiogenin). Furthermore,
HGF and TNF-α α increased with advancing stage of disease (p<0.05). HGF and VEGF correlated
significantly with IL-6 (r=0.56, p<0.0005 and r=0.57, p<0.001 respectively). In conclusion, Hodgkin’s
disease displays an angiogenic activity as depicted by the increased serum levels of a number of
angiogenic cytokines. HGF seems to be the prominent molecule in Hodgkin’s disease, which may be
used to monitor the disease status and the response to treatment.

The induction of new vasculature from pre-existing
vessels, termed angiogenesis, is a prerequisite for
tumor growth and metastasis (1-2). This
neovascularization is controlled by a complex network
of angiogenic enhancers and inhibitors. Although first
described in solid tumours, angiogenesis has recently
gained importance in hematological malignancies,
including lymphoproliferative diseases (3-6). Studies
on malignant lymphomas have produced conflicting
results regarding the significance of angiogenesis.
Histological examination of the microvessel density
in lymph nodes has shown no difference between
Key words : Hodgkin’s lymphoma, angiogenesis, hepatocyte growth factor, vascular endothelial growth factor
lymphoma and reactive nodes and no correlation
with response to chemotherapy (7). On the contrary,
other studies found an increase in lymph node
microvessel density in aggressive non Hodgkin’s
lymphomas (NHL) in comparison to low grade NHL
(8-9). Furthermore, the percentage of immature
vessels in large B cell NHL is increased in
comparison with follicular lymphomas (10). Other
studies measuring angiogenic cytokines in the serum
showed that basic fibroblast growth factor was an
adverse prognostic factor in NHL patients (11).
Interest stems from the fact that angiogenesis

Mailing address:
Mailing address: F. Passam, M.D.
3rd Dept of Internal Medicine,
Medical School of Athens - Sotiria Hospital,
Mesogeion 152, 11527, 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Athens, Greece This publication and/or article is for individual use only and may not be further
Tel: +302810 392426 - Fax: +302810 244883 reproduced without written permission from the copyright holder.
E-mail: freda@med.uoc.gr 161 Unauthorized reproduction may results in financial and other penalties
162 F.H. PASSAM ET AL.
may become an alternative target in antineoplastic
treatment with the development of antiangiogenic
agents (12). However, the issue is further complicated
by very recent evidence that lymphoma specific
aberrations are present in the microvascular
endothelial cells in B-lymphomas, implying that
microvessels may be part of the lymphomatic clone
(13). So, the precise role of angiogenesis in
lymphoma nature and disease progression remains
obscure.
In addition, few data are available for the role of
angiogenesis in Hodgkin’s disease although
evidence that Hodgkin’s tissue is a potent inducer of
angiogenesis on the chorioallantoic membrane was
reported as early as 1980 (14).
In the present study, we measured the serum levels
of various angiogenic molecules and cytokines of
prognostic significance in Hodgkin’s disease. The
aims were to examine whether these molecules
correlate with other disease characteristics and their
variation in response to treatment.
MATERIALS AND METHODS
Patients
Sixty patients with newly diagnosed Hodgkin’s
disease from a single hematology department were
included in the study. Thirty-five men and 25 women
aged between 16 and 80 years (mean±SD: 41 ± 19 years)
were included. Nineteen healthy individuals (14 men and
5 women aged between 22 and 58 years) (mean ± SD: 39
± 10 years) were used as controls. Consecutive sampling
was performed between May 2001 and May 2004. Serum
samples were obtained from all patients prior to the
initiation of treatment and from 43 within 6 months of
completion of therapy. For 12 patients no serum samples
were available as treatment had not been completed by
the end of the study, and there were 5 losses at follow up.
Standard treatment consisted of 6 cycles ABVD
(adriamycin, bleomycin, vinblastine, dacrabazine) plus
involved field irradiation for 24 patients, 8 cycles ABVD
for 20, 6 cycles ABVD for 13, and other modalities
(COPP (cyclophosphamide, vincristine, procarbazine,
prednisone)/ABVD for 2, BEACOPP (bleomycin,
etoposide, adriamycin, cyclophosphamide, vincristine,
procarbazine, prednisone) for 1. Three patients underwent
autologous bone marrow transplantation after the first
relapse. Forty-seven patients were full responders and 8
patients were partial responders. Six patients relapsed in
less than 6 months and 5 died (2 due to resistant disease,
2 to treatment related toxicity and 1 due to non-disease
related causes). Histology classification was based on the
1999 World Health Organization classification of
lymphomas for Nodular lymphocyte predominant
Hodgkin’s lymphoma and Classical Hodgkin’s lymphoma
(CHL) with its subdivisions: nodular sclerosis CHL,
mixed cellularity CHL, lymphocyte rich CHL,
lymphocyte depleted CHL. Staging was performed
according to the Ann-Arbor criteria (15). Prognostic
scoring was performed according to the International
Prognostic Factors (for advanced Hodgkin’s lymphoma),
which includes seven factors: male sex, age greater than
or equal to 45 years, stage IV, white blood count greater
than or equal to 15000/µl, lymphocyte count less than 6
percent or less than 800/µl, hemoglobin less than 10.5
g/dl and albumin less than 4 g/dl (16). Other parameters
taken into account included the presence of extra-nodular
disease, the presence of systemic symptoms (fever, night
sweats, weight loss >10% in 6 months), platelet count and
LDH levels. Informed consent was obtained from all
individuals included in the study.
Methods
Elisa measurements were performed using the
Quantikine, R&D kits (Minneapolis, MN, USA) for
human Hepatocyte growth factor (HGF), Vascular
endothelial growth factor (VEGF), Angiogenin,
Angiopoietin-2, tumor necrosis factor-α (TNF-α) and
interleukin-6 (IL-6).
Fifteen patient samples were analysed in duplicates in
every Elisa assay. The intra-assay variability was within
the manufacturer’s limits (2-6%).
Statistical analysis
Non-parametric univariate tests were applied, using
each of the angiogenic variables. The sign test was
applied to assess the extent to which concentrations of the
angiogenic molecules measured in Hodgkin’s patients
changed following treatment. The Mann-Whitney test
was used to examine differences between pre-treatment
Hodgkin’s patients and controls, to examine possible
differences in pre-treatment molecule concentrations
according to sex and age (grouped using a median split)
and also to examine possible differences in concentrations
following treatment.
Non-parametric correlation (Spearman’s rho)
techniques were applied to assess the extent of
correlations between pre-treatment HGF, VEGF, TNF and
IL-6 concentrations.
Pairwise deletion of missing values was used in all
statistical procedures. The SPSS program was used for
the analysis of the results. A p value <0.05 was
considered as significant.
 Int. J. Immunopathol. Pharmacol. 163

RESULTS Table I. Baseline characteristics of the 60 Hodgkin’s

patients.
The baseline characteristics of the 60 Hodgkin’s Characteristic n %
patients are shown in Table I. Two of the 60 patients
were diagnosed as Hodgkin’s stage I, 42 stage II, 5 Sex
stage III, 10 stage IV. Staging was grouped further as Male 35 58
Female 25 42
stage I and II (44 patients) versus stage III and IV
(15 patients). International Prognostic Scores (IPS) Presence of systemic symptoms
of 0, 1, 2, 3, 4 and 5 were recorded for 14, 15, 18, Yes 45 76
No 14 24
5, 1 and 3 patients, respectively (3 patients had
incomplete data to define the score). The IPS was Disease stage
regrouped into two categories, a score of 0 or 1 (29 I 2 3
II 42 72
patients) versus a score of at least 2 (27 patients).
III 5 8
The median concentrations of angiogenic IV 10 17
molecules in Hodgkin’s patients prior to treatment
and controls are given in Table II. Using the non- Extranodal extension
No 35 59
parametric Mann-Whitney test, there was strong Yes 24 41
evidence of a difference in median concentrations
between the pre-treatment group and the control Histological type
Nodular lymphocyte predominant 1 2
Lymphocyte rich classical HL 2 3
Nodular Sclerosis (NS) 46 77
Fig. 1. Levels of HGF, TNF-α and VEGF in stages 1 & 2 Mixed Cellularity (MC) 11 18
and stages 3 & 4 in Hodgkin’s patients and controls (- Lymphocyte depleted HL 0 0
represents the median value and - 25-75% of values).
IPS
0 14 25
1 15 27
2 18 32
3 5 9
4 1 2
5 3 5

group for TNF-α (20.8 versus 14.9 pg/ml, p<0.001),

HGF (1958.8 versus 744.1 pg/ml, p<0.001), IL-6
(14.1 versus 3.1 pg/ml, p<0.0001) and VEGF (794.4
versus 297.4 pg/ml, p=0.001), with higher values for
all four variables in the pre-treatment group
compared to the control group. The comparisons
involving angiogenin and angiopoietin were not
statistically significant at the 5% level.
The concentrations for each haematological
/angiogenic variable prior to treatment were
compared between stage I/II and III/IV patients.
Evidence of a difference in concentration according
to disease stage was found for TNF (19.4 pg/ml in
stages I/II versus 29.5 pg/ml in stages III/IV,
p=0.004) and HGF (1853.6 pg/ml in stages I/II
versus 3870.8 pg/ml in stages III/IV, p=0.02) (Fig. 1).
164 F.H. PASSAM ET AL.
Fig. 2. Levels of HGF, VEGF and angiogenin
concentrations before and after treatment in the total
group of Hodgkin’s patients (- represents the median
→
value and 25-75% of values).
No statistically significant differences between
patients with low and high prognostic score were
detected (Table III).
There was a statistically significant positive
correlation between IL-6 and HGF (p<0.0005,
r=0.56, n=35), IL-6 and VEGF (p<0.001 r=0.57,
n=23) and VEGF and HGF (p<0.001 r=0.47, n=40).
There was no evidence of a difference in pre-
treatment molecule concentrations according to the
patient’s age or gender.
For angiogenin and HGF there was evidence of a
difference in average change following treatment,
according to the presence of extranodular extension
and histological type respectively. The median
difference for angiogenin between pre- and post
treatment values was 7 µg/ml in patients without
extranodular extension of their lymphoma and 21
µg/ml in those with extranodular extension (p=0.039).
The median difference between pre- and post
treatment values for HGF was 1637 pg/ml in patients
with the mixed cellularity histological type and 721
pg/ml in the nodular sclerosis type (p=0.046).
In Table IV, summaries of pre-treatment and post-
treatment concentrations are presented. There was
strong evidence of a decrease in concentrations of the
molecules HGF (Fig. 2), TNF-α and angiogenin
following treatment (p<0.0001, p=0.003, and p=0.004
respectively) and some evidence of a change in VEGF
Table II. Median values and range of TNF-α, HGF, VEGF,
angiogenin, angiopoietin and IL-6 blood concentrations in
Hodgkin’s patients prior to treatment and controls.
NS=not-significant
(p=0.01) following treatment. The change for IL-6 and
angiopoietin did not reach statistical significance.
DISCUSSION
The main features of the current study are that
Hodgkin’s patients express an angiogenic profile as
reflected by the serum concentrations of a number of
angiogenic cytokines.
HGF, VEGF, IL-6 and TNF-α are higher in
untreated Hodgkin’s patients in comparison to healthy
individuals. HGF and TNF-α increase with advancing
stage of disease. Moreover, HGF, TNF-α, VEGF and
angiogenin decrease after treatment, showing that these
angiogenic molecules follow the disease status. HGF
and VEGF correlated with each other and with IL-6.
The role of angiogenesis in Hodgkin’s disease is
interesting due to the particularity of the disease in
terms of the very small percentage of malignant
cells (1-2% of the lymph node cellularity) and the
dependence on an interaction with the surrounding
microenvironment.
One of the molecules implicated in this
 Int. J. Immunopathol. Pharmacol. 165

Table III. Median concentrations and range of pre-treatment concentrations of TNF-α, HGF,
VEGF, angiogenin, angiopoietin and IL-6 blood by stage and IPS.

interaction is HGF. HGF is a growth factor with
multiple (mitogenic, morphogenic, motogenic)
actions on a variety of cells including endothelial,
mesenchymal and hemopoietic cells. The biological
activities of HGF are mediated by the membrane
receptor c met. In 1994 it was shown that the HGF
receptor gene is overexpressed in tumour samples
derived from patients with Hodgkin’s disease (17).
Another option for the function of HGF is the
finding that pretreatment of Burkitt’s lymphoma cell
lines, expressing the c-met protoncogene, with HGF
protected them from death induced by DNA
damaging agents, suggesting that the accumulation
of HGF within the microenvironment of neoplastic
cells may contribute to the development of a
chemoresistant phenotype (18).
Teofili et al demonstrated that Reed Sternberg
(RS) cells express the HGF receptor, whereas the
surrounding dentritic-reticulum cells express HGF
(19). This supports the theory of a HGF/cmet
signaling pathway between RS cells and the reactive
microenvironment in Hodgkin’s disease. In the same
study, HGF serum levels were increased at diagnosis
(at levels comparable to our results) and decreased at
remission. HGF was significantly related to the
presence of systemic-symptoms and the authors
implied that it might have prognostic significance in
patients with Hodgkin’s disease. This was not
confirmed by Giles et al who did not find HGF to
have prognostic influence in Hodgkin’s patients.
Their results introduced pretreatment VEGF levels
as a prognostic factor for Hodgkin’s patients (20).
However, it must be noted that it is difficult to
determine a prognostic factor for Hodgkin’s as the
majority of patients has a good prognosis with a long
term survival of >75%. Even the introduced IPS
score has limited applicability to a small percentage
with advanced Hodgkin’s disease (21).
VEGF is a potent endothelial cell mitogen. In vivo
it can induce angiogenesis and increase microvascular
permeability. It has been examined in a number of
hematological diseases including Hodgkin’s
166 F.H. PASSAM ET AL.

Table IV. Median values and range of TNF-α, HGF, VEGF, serum levels of VEGF in patients with active RA. In
angiogenin, angiopoietin and IL-6 blood concentrations in that study the mean value of VEGF in the disease
Hodgkin’s patients prior to and following treatment. state was 568 pg/ml which is lower than in our
n Before treatment After treatment p patients (794 pg/ml).
median median There is a degree of discrepancy in the literature
(min, max) (min, max)
regarding the measurement of VEGF. Sone et al (31)
measured mean ± SD VEGF=104.8 ± 65.7 pg/ml in
TNF-_α 16.60 0.003
29 19.76 (14.29,51.73) healthy controls, whereas Niitsu et al, (27) measured
(pg/ml) (12.90,30.21)
VEGF=11.8 ± 6.7 pg/ml, however in both studies
2023.9 1225.7 <0.0001 the ELISA assay was different from the one used in
HGF (pg/ml) 43
(547.0,7500.0) (346.3, 3669.9) the current study. Furthermore, the processing of the
671.9 425.5 0.01 samples was different in the second study (the
VEGF (pg/ml) 34
(62.0,2200.0) (72.2,1255.1)
samples were placed on ice and centrifuged at 4°C).
In another study (30) using the same commercial kit
angiogenin 483.5 337.6 0.004
31 as in ours, controls had a mean ± sd VEGF of 189 ±
(_g/ml)
µ (212.9, 1058.2) (60.1, 587.6)
130 pg/ml (versus 297 pg/ml in our controls). There
angiopoietin 2526.4 2530.2 NS are numerous articles in the literature referring to the
26
(pg/ml) (628.2,15792.0) (1059.6, 9187.5) particularities of VEGF measurement. VEGF is
14.1 6.8 0.08 found in white blood cells and platelets and platelet
IL-6 (pg/ml) 28
(3.4, 150.0) (3.0,44.1)
degranulation during clotting releases VEGF into the
serum increasing the levels of VEGF. Furthermore, the
duration of clotting time affects the concentration of
lymphoma and NHL (4). In Hodgkin’s lymphoma, VEGF (32-33) thus explaining the wide range of
vascular endothelial growth factor is expressed by normal values. However, in the current study, the same
neoplastic Hodgkin’s Reed-Stenberg cells (22-24). In procedure of blood clotting and processing was
patients with NHL, microvessel density and VEGF, applied for patient and control samples so the
examined immunohistochemically, were not related relative increase of VEGF in patients’ samples was
to clinical or prognostic parameters (25). However, evident. This has also been noted by other authors
others have found that c-Myc overexpression and using blood samples from cancer patients with
high serum VEGF at diagnosis have an adverse matched numbers of WBC and platelets to controls.
influence on survival in diffuse large B cell Tumour samples still had higher VEGF than
lymphoma (26). Furthermore, high serum VEGF controls, reaching the conclusion that serum VEGF
and IL-6 have been associated with a poor prognosis reflects tumour production (34-35).
in aggressive NHLs (27). The association of VEGF Angiogenin is another potent angiogenic factor,
with IL-6 was also supported in our study by a which also exhibits RNAase function. It is interesting
positive correlation found between these two that angiogenin increases in myeloid disorders (36-
molecules. On a physiological basis, a paracrine 37). However, in NHL serum levels of angiogenin
loop has been demonstrated between IL-6 and could not differentiate patients with relapse versus
VEGF in multiple myeloma implying that these complete remission (38), and in untreated Hodgkin’s
molecules are interrelated (28). However, even in disease angiogenin levels were lower than normal
non-malignant conditions, such as rheumatoid (20). It is interesting that angiogenin also acts in vivo
arthritis (RA), IL-6 has been associated with VEGF as an acute phase protein and rises during the
production. In a recent study, VEGF directly inflammatory response (39). Therefore, it is difficult to
increased the production of IL-6 from synovial fluid explain the suppressed levels of angiogenin described
monocytes of patients with RA (29). In a study by by us and others in Hodgkin’s which shows an
Nakahara et al (30), it was shown that IL-6 induced increase in other inflammatory cytokines. Serum
the production of VEGF in the synovium. levels may not reflect the levels of angiogenin in the
Furthermore, administration of anti-IL-6 reduced the lymph node microenvironment or alternatively its
 Int. J. Immunopathol. Pharmacol.
production may be suppressed by other factors.
Angiopoietin-2 (Ang-2) has a complex role in
vascular development. It plays a proangiogenic role by
destabilizing mature vessels enhancing the effect of
VEGF. It has been found elevated in a variety of
tumors (colon (40), gastric (41), non-small cell lung
(42)) and increases with advanced stage and
prognosis. This does not agree with our findings where
there was a trend towards lower values in stage 3, 4 in
comparison to stages 1, 2. This implies that Ang-2 may
not play the same role in the angiogenic network in
Hodgkin’s as in other malignancies.
By contrast, TNF- α and IL-6 are both
increased in the serum of Hodgkin’s patients and
correlate with worse prognosis. They have also
been attributed proangiogenic properties (3). TNF-
α has been correlated with the presence of
systemic symptoms, tumour bulk and outcome in
Hodgkin’s patients, which is in accordance with
our findings of increased levels in advanced
Hodgkin’s disease (43-45).
IL-6 expression has been demonstrated in Reed-
Stenberg cells (46) and in cells from the surrounding
environment. IL-6 expression by RS cells has been
associated with an increased prevalence of systemic
symptoms and a decreased likelihood of achieving a
complete response (47-49). However, the levels of
IL-6 in Hodgkin’s patients (14 pg/ml) is lower than
levels described in inflammatory disease such as
active rheumatoid arthritis, e.g. 52 pg/ml (50) and
37.5 pg/ml (51), which may reflect the different
extent of the inflammatory response.
In conclusion, there is increased angiogenic
activity in Hodgkin’s disease as reflected by the
levels of serum angiogenic molecules. However,
the pattern in Hodgkin’s differs from that in solid
tumors and other hematological malignancies
implying that a different angiogenic network exists
for separate hematological entities. HGF seems to
be the prevalent angiogenic molecule for
Hodgkin’s disease. It is questionable whether it
has prognostic significance. Current prognostic
scoring systems do not incorporate information
regarding the angiogenic potential of tumors.
Further studies are awaited to delineate the critical
angiogenic molecules in Hodgkin’s disease, which
could aid in the development of targeted anti-
angiogenic treatment.
167
REFERENCES
1. Folkman J. 1971. Tumor angiogenesis: therapeutic
implications. N. Engl. J. Med. 285:1182.
2. Folkman J., K. Watson, D. Ingher and D. Hanahan.
1989. Induction of angiogenesis during the transition
from hyperplasia to neoplasia. Nature 339:58.
3. Manghi M. 2000. Angiogenesis and angiogenic
mediators in hematological malignancies. Br. J.
Haematol. 111:43.
4. Salven P. 2001. Angiogenesis in lymphoproliferative
disorders. Acta Haematol. 106:184.
5. Aguayo A., H. Kantarjian, T. Manshouri, C.
Gidel, E. Estey, D. Thomas, C. Kolle, Z. Estrov, S.
O’Brien, M. Keating, E. Freireich and M. Albitar.
2000. Angiogenesis in acute and chronic leukemias
and myelodysplastic syndromes. Blood 96:2240.
6. Alexandrakis M., F. Passam, C. Pappa, J. Damilakis,
G. Tsirakis, E. Kandidaki, E. Stathopoulos and D.
Kyriakou. 2005. Serum evaluation of angiogenic
cytokines basic fibroblast growth factor, hepatocyte
growth factor and tumor necrosis factor-α in patients
with myelodysplastic syndromes: correlation with bone
marrow microvascular density. Int. J. Immunopathol.
Pharmacol. 18:287.
7. Bairey O., Y. Zimra, E. Kaganovsky, M. Shaklai, E.
Okon and E. Rabizadeh. 2000. Microvessel density
in chemosensitive and chemoresistant diffuse large B-
cell lymphomas. Med. Oncol. 17:314.
8. Ribatti D., A. Vacca, B. Nico, M. Fanelli, L.
Roncali and F. Dammacco. 1996. Angiogenesis
spectrum in the stroma of B-cell non Hodgkin’s
lymphomas. An immunohistochemical and
ultrastructural study. Eur. J. Haematol. 56:45.
9. Vacca A., D. Ribatti, L. Ruco, F. Giacchetta, B.
Nico, F. Quondamatteo, R. Ria, M. Iurlaro and F.
Dammacco. 1999. Angiogenesis extent and
macrophage density increase simultaneously with
pathological progression in B-cell non-Hodgkin’s
lymphomas. Br. J. Cancer 79:965.
10. Passalidou E., M. Stewart, M. Trivella, G. Steers,
G. Pillai, A. Dogan, I. Leigh, C. Hatton, A. Harris,
K. Gatter and F. Pessella. 2003. Vascular patterns
in reactive lymphoid tissue and in non-Hodgkin’s
lymphoma. Br. J. Cancer 88:553.
168 F.H. PASSAM ET AL.
11. Salven P., A. Orpana, L. Teerenhovi and H.
Joensuu. 2000. Simultaneous elevation in the serum
concentrations of the angiogenic growth factors
VEGF and bFGF is an independent predictor of poor
prognosis in non-Hodgkin lymphoma: a single-
institution study of 200 patients. Blood 96:3712.
12. Yao L., S. Pike, J. Setsuda, J. Parekh, G. Gupta, M.
Raffeld, E. Jaffe and G. Tosato. 2000. Effective
targeting of tumor vasculature by the angiogenesis
inhibitors vasostatin and interleukin-12. Blood 96:1900.
13. Streubel B., A. Chott, D. Huber, M. Exner, U. Jager,
O. Wagner and I. Schwarzinger. 2004. Lymphoma-
specific genetic aberrations in microvascular endothelial
cells in B-cell lymphomas. N. Engl. J. Med. 351:250.
14. Mostafa L., D. Jones and D. Wright. 1980.
Mechanism of the induction of angiogenesis by
human neoplastic lymphoid tissue: studies on the
chorioallantoic membrane (CAM) of the chick
embryo. J. Pathol. 132:191.
15. Lister T., D. Crowther, S. Sutcliffe, E. Glatstein,
G. Canellos, R. Young, S. Rosenberg, C. Coltman
and M. Tubiana. 1989. Report of a committee
convened to discuss the evaluation and staging of
patients with Hodgkin’s disease: Costwold meeting.
J. Clin. Oncol. 7:1630.
16. Hasenclever D. and V. Diehl. 1998. A prognostic
score for advanced Hodgkin’s diseases. International
Prognostic Factors Project on Advanced Hodgkin’s
Disease. N. Engl. J. Med. 339:1506.
17. Jucker M., A. Gunther, G. Gradl, C. Fonatsch, G.
Krueger, V. Diehl and H. Tesch. 1994. The
Met/hepatocyte growth factor receptor (HGFR) gene
is overexpressed in some cases of human leukemia
and lymphoma. Leuk. Res. 18:7.
18. Skibinski G., A. Skibinska and K. James. 2001.
Hepatocyte growth factor (HGF) protects c-met-
expressing Burkitt’s lymphoma cell lines from
apoptotic death induced by DNA damaging agents.
Eur. J. Cancer 37:1562.
19. Teofili L., A. Di Febo, F. Pierconti, N. Maggianao,
M. Bendandi, S. Rutella, A. Cingolani, N. Di
Renzo, P. Musto, S. Pileri, G. Leone and L.
Larocca. 2001. Expression of the c-met proto-
oncogene and its ligand, hepatocyte growth factor,
in Hodgkin’s disease. Blood 97:1063.
20. Giles F., J. Vose, K. Do, M. Johnson, T.
Manshouri, G. Bociek, P. Bierman, S. O’Brien, H.
Kantarjian, J. Armitage and M. Albitar. 2004.
Clinical relevance of circulating angiogenic factors
in patients with non-Hodgkin’s lymphoma or
Hodgkin’s lymphoma. Leuk. Res. 28:595.
21. Bierman P., J. Lynch, R. Bociek, V. Whalen, A.
Kessinger, J. Vose and J. Armitage. 2002. The
international prognostic factors project score for
advanced Hodgkin’s disease is useful for predicting
outcome of autologous hematopoietic stem cell
transplantation. Ann. Oncol. 13:1370.
22. Doussis-Anagnostopoulou I., K. Talks, H. Turley,
P. Debnam, D. Tan, G. Mariatos, V. Gorgoulis, C.
Kittas and K. Katter. 2002. Vascular endothelial
growth factor (VEGF) is expressed by neoplastic
Hodgkin –Reed-Stenberg cells in Hodgkin’s disease.
J. Pathol. 197:677.
23. Yokote T., T. Akioka, S. Oka, S. Nakayama, T.
Yamano, S. Hara, M. Tsuji and T. Hanafusa.
2004. Vascular endothelial growth factor and
interleukin 6 expression by Hodgkin/Reed Stenberg
cells. Br. J. Haematol. 125:1.
24. Foss H., I. Araujo, G. Demel, H. Klotzbach, M.
Hummel and H. Stein. 1997. Expression of
vascular endothelial growth factor in lymphomas
and Castleman disease. J. Pathol. 183:44.
25. Hazar B., S. Paydas, S. Zorludemir, B. Sahin and
I. Tuncer. 2003. Prognostic significance of
microvessel density and vascular endothelial growth
factor (VEGF) expression in non-Hodgkin’s
lymphoma. Leuk. Lymphoma 44:2089.
26. Aref S., M. Mabed, K. Zalata, M. Sakrana and H.
El Askalany. 2004. The interplay between c-Myc
oncogene expression and circulating vascular
endothelial growth factor (sVEGF), its antagonist
receptor, soluble Flt-1 in diffuse large B cell
lymphoma (DLBCL): relationship to patient
outcome. Leuk. Lymphoma 45:499.
27. Niitsu N., M. Okamoto, H. Nakamine, T. Yoshino,
J.Tamaru, S. Nakamura, M. Higashihara and M.
Hirano. 2002. Simultaneous elevation of the serum
concentrations of vascular endothelial growth factor
and interleukin-6 as independent predictors of
prognosis in aggressive non-Hodgkin’s lymphoma.
Eur. J. Haematol. 68:91.
28. Dankbar B., T. Padro, R. Leo, B. Feldmann, M.
 Int. J. Immunopathol. Pharmacol.
Kropff, R. Mesters, H. Serve, W. Berdel and J.
Kienast. 2000. Vascular endothelial growth factor
and interleukin-6 in paracrine tumor-stromal cell
interactions in multiple myeloma. Blood 95:2630.
29. Yoo S., D. Bae , J. Ryoo, H. Kim, G. Park, C. Cho,
C. Chae and W. Kim. 2005. Arginine-rich anti-
vascular endothelial growth factor (anti-VEGF)
hexapeptide inhibits collagen-induced arthritis and
VEGF-stimulated productions of TNF-alpha and IL-
6 by human monocytes. J. Immunol. 174:5846.
30. Nakahara H., J. Song, M. Sugimoto, K. Hagihara,
T. Kishimoto, K. Yoshizaki and N. Nishimoto. 2003.
Anti-interleukin-6 receptor antibody therapy reduces
vascular endothelial growth factor production in
rheumatoid arthritis. Arthritis Rheum. 48:1521.
31. Sone H., M. Sakauchi, A. Takahashi, H. Suzuki,
N. Inoue, K. Iida, H. Shimano, H. Toyoshima, Y.
Kawakami, Y. Okuda, K. Matsuo and N. Yamada.
2001. Elevated levels of vascular endothelial growth
factor in the sera of patients with rheumatoid arthritis
correlation with disease activity. Life Sci. 96:1861.
32. Webb N., M. Bottomley, C. Watson and P.
Brenchley. 1998. Vascular endothelial growth factor
(VEGF) is released from platelets during blood
clotting: implications for measurement of circulating
VEGF in clinical disease. Clin Sci. 94:395.
33. Hormbrey E., P. Gillespie, K. Turner, C. Han, A.
Roberts, D. Mc-Grouther and A. Harris. 2002. A
critical review of vascular endothelial growth factor
(VEGF) analysis in peripheral blood: is the current
literature meaningful? Clin. Exp. Metastasis. 19:651.
34. Banks R., M. Forbes, S. Kinsey, A. Stanley, E.
Ingham, C. Walters and P. Selby. 1998. Release of the
angiogenic cytokine vascular endothelial growth factor
from platelets: significance for VEGF measurements
and cancer biology. Br. J. Cancer 77:956.
35. Salven P, A. Orpana and H. Joensuu. 1999.
Leukocytes and platelets of patients with cancer
contain high levels of vascular endothelial growth
factor. Clin. Cancer Res. 5:487.
36. Musolino C., A. Alonci, G. Bellomo, B. Loteta, E.
Quartarone, D. Gangemi, E. Massara and L.
Calabro. 2004. Levels of soluble angiogenin in
chronic myeloid malignancies: clinical implications.
Eur. J. Haematol. 72:416.
169
37. Verstovsek S., H. Kantarjian, A. Aguayo, T.
Manshouri, E. Freireich, M. Keating, E. Estey
and M. Albitar. 2001. Significance of angiogenin
plasma concentrations in patients with acute myeloid
leukemia and advanced myelodysplastic syndrome.
Br. J. Haematol. 114:290.
38. Bertolini F., M. Paolucci, F. Peccatori, S. Cinieri,
A. Agazzi, P. Ferrucci, E. Cocorocchio, A.
Goldhirsch and G. Martinelli. 1999. Angiogenic
growth factors and endostatin in non-Hodgkin’s
lymphoma. Br. J. Haematol. 106:504.
39. Olson K., S. Verselis and J. Fett. 1998.Angiogenin
is regulated in vivo as an acute phase protein.
Biochem. Biophys. Res. Comm. 242:480.
40. Ahmad S., W. Liu, Y. Jung, F. Fan, N. Reinmuth,
C. Bucana and L. Ellis. 2001. Differential
expression of angiopoietin-1 and angiopoietin-2 in
colon carcinoma. A possible mechanism for the
initiation of angiogenesis. Cancer 92:1138.
41. Etoh T., H. Inoue, S. Tanaka, G. Barnard, S.
Kitano and M. Mori. 2001. Angiopoietin-2 is
related to tumor angiogenesis in gastric carcinoma:
possible in vivo regulation via induction of
proteases. Cancer Res. 61:2145.
42. Tanaka F., S. Ishikawa, K. Yanagihara, R.
Miyahara, Y. Kawano, M. Li, Y. Otake and H.
Wada. 2002. Expression of angiopoietins and its
clinical significance in non-small cell lung cancer.
Cancer Res. 62:7124.
43. Benharroch D., I. Prinsloo, R. Apte, T. Yermiahu,
D. Geffen, I. Yanai-Inbar and J. Gopas. 1996.
Interleukin-1 and tumor necrosis factor-alpha in the
Reed-Sternberg cells of Hodgkin’s disease.
Correlation with clinical and morphological
“inflammatory” features. Eur. Cytokine Netw. 7:51.
44. Metkar S., K. Naresh, P. Manna, V. Srinivas, S.
Advani and J. Nadkarni. 2000. Circulating levels of
TNF alpha and TNF receptor superfamily members in
lymphoid neoplasia. Am. J. Hematol. 65:105.
45. Warzocha K., J. Bienvenu, P. Ribeiro, I. Moullet,
C. Dumontet, E. Neidhardt-Berard, B. Coiffier
and G. Salles. 1998. Plasma levels of tumour
necrosis factor and its soluble receptors correlate
with clinical features and outcome of Hodgkin’s
disease patients. Br. J. Cancer 77:2357.
170 F.H. PASSAM ET AL.
46. Jucker M., H. Abts, W. Li, R. Schindler, H. Merz,
A. Gunther, C. von Kalle, M. Schaadt, T.
Diamantstein and A. Feller. 1991. Expression of
interleukin-6 and interleukin-6 receptor in Hodgkin’s
disease. Blood 77:2413.
47. Reynolds G., L. Billingham, L. Gray, J. Flavell, S.
Najafipour, J. Crocker, P. Nelson, L. Young and P.
Murray. 2002. Interleukin 6 expression by
Hodgkin/Reed-Stenberg cells is associated with the
presence of B symptoms and failure to achieve
complete remission in patients with advanced
Hodgkin’s disease. Br. J. Haematol. 118:195.
48. Kurzrock R., J. Redman, F. Cabanillas, D. Jones, J.
Rothberg and M. Talpaz. 1993. Serum interleukin 6
levels are elevated in lymphoma patients and correlate
with survival in advanced Hodgkin’s disease and with
B symptoms. Cancer Res. 53:2118.
49. Seymour J., M. Talpaz, F. Hagemeister, F.
Cabanillas and B. Kurzrock. 1997. Clinical correlates
of elevated serum levels of interleukin 6 in patients with
untreated Hodgkin’s disease. Am. J. Med. 102:21.
50. Robak T., A. Gladalska, H. Stepien and E. Robak.
1998. Serum levels of interleukin-6 type cytokines
and soluble interleukin-6 receptor in patients with
rheumatoid arthritis. Mediators Inflamm. 7:347.
51. Wellby M., J. Kennedy, K. Pile, B. True and P.
Barreau. 2001. Serum interleukin-6 and thyroid
hormones in rheumatoid arthritis. Metabolism 50:463.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 171-179 (2006)

TUMOR INFILTRATING LYMPHOCYTES IN UVEAL MELANOMA: A LINK WITH

CLINICAL BEHAVIOR?
S. STAIBANO, M. MASCOLO, F. TRANFA1, G. SALVATORE2, C. MIGNOGNA, P. BUFO3, L.
NUGNES, G. BONAVOLONTÀ1 and G. DE ROSA

Department of Biomorphological and Functional Sciences, Pathology Section, 1Department of

Ophthalmology, 2Department of Medicine, University of Naples “Federico II”, Naples;
3
Department of Surgical Sciences, University of Foggia, Foggia, Italy

Received April 11, 2005 - Accepted January 12, 2006

Experimental and clinical evidence indicate that immunological mechanisms might be important in
the clinical course of uveal malignant melanoma (UMM). We analyzed the amount and phenotype of
tumor infiltrating lymphocytes (TIL) and the expression of the apoptosis-inducing molecule Fas and its
ligand, FasL, on tumor cells and TIL in a selected series of UMM with the aim to establish if a correlation
between their expression and the clinical behavior of UMM exists. TIL phenotype and Fas/FasL
expression were evaluated by immunohistochemistry in 61 cases of formalin-fixed, paraffin-embedded
UMM. Results were compared with the follow-up data of patients. Most of the UMM showed a prevalence
of CD8+ CD3+ T lymphocytes, or CD4+ and CD8+ cells in equal amounts. UMM showed a variable
expression of FasL, ranging from 0 to > 40% of neoplastic cells. Fas was always expressed in TIL,
although with a variable extent. A subgroup of UMM showed in TIL a strongly reduced or even absent
expression of TCR ζ-chain, involved in activation of T-lymphocytes. This subgroup was characterized by
a worse outcome. We hypothesized that an impaired cytotoxic immune response due to the loss of the ζ-
chain expression plays a primary role in the biological course of UMM. Our results indicate that the
overcoming of the impairment of TCR function may represent a prerequisite for the development of new
therapeutic strategies for managing UMM, suggesting that elimination of tumor cells may be possible by
activation of cytotoxic cells present within ocular melanomas.

Uveal malignant melanoma (UMM) is the most
common malignant primary intra-ocular tumor in
adults (1-4). It accounts for 70-88% of all ocular
tumors, with an annual incidence of approximately 6
cases per million per year (1-4). The therapy of
UMM is problematic due to the high rate of
metastatic dissemination (5). Treatment therapies for
this tumor warrant further studies. To date,
enucleation remains as effective as the recent eye-
sparing approaches (6-7). When metastatic disease
is diagnosed, patient survival is generally less than 7
months (8-11). During the “dormant” period from
diagnosis of primitive tumor and the occurrence of
metastasis, chemo- and immunotherapy have also
been considered (12).
UMM arises in the immune-privileged ocular

Key words: Uveal melanoma, TIL, TCR ζ-chain, Fas-linked apoptosis, prognosis

Mailing address:
Stefania Staibano, MD, PhD,
Department of Biomorphological and Functional Sciences,
Pathology Section
University of Naples 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Via A. Falcone, 56, 80127, Naples, Italy. This publication and/or article is for individual use only and may not be further
Tel. and Fax: +39 081 5560466 reproduced without written permission from the copyright holder.
E-mail: staibano@unina.it 171 Unauthorized reproduction may results in financial and other penalties
172
environment, in which both adaptive and innate
immune systems are selectively suppressed (3, 13-
14). Nevertheless, the occurrence of spontaneous
regression and/or the delayed appearance of
metastasis, sometimes decades after enucleation,
supports the idea that the eye possesses
immunological mechanisms able to control the
growth of intraocular neoplasms (15-16).
However, as reported also in patients with
advanced malignancies (17), in UMM most
cytotoxic T-lymphocytes (CTL) are ineffective
against tumor cells and, in some cases, CTL
precursors infiltrate the intraocular tumor but fail to
differentiate into mature cytolytic effector cells (13).
The cytoplasmatic domain of the CD3-ζ subunit of
the T-cell receptor (TCR) complex is involved in
signal transduction and in activation of T
lymphocytes (17-19). An impaired or reduced CD 3-
ζ chain expression on TIL and in peripheral blood
lymphocytes, hampering cytoplasmatic signaling in
activating T cells (20), has been observed in patients
with several types of malignancies (17, 20-26). A
decrease in T-cell receptor ζ-chain (TCR ζ-chain)
expression has been reported to lead to an
ineffectiveness in immune response to autologous
tumors (21). The effective role of tumor-infiltrating
lymphocytes (TIL) in biological behavior of UMM
is still far from being clarified (3,13,15, 27-29).
There is, to date, no convincing evidence that a
better prognosis is associated with lymphocytic
infiltration in UMM (15, 30-31).
We characterized the immunophenotype of TIL
in a selected series of 61 UMM, with particular
attention to the expression of TCR-ζ-chain and
Fas/FasL on tumor cells and TIL. The results were
correlated with the clinicopathological features and
with the follow-up data of patients to evaluate the
role of the intratumoral cellular immune response in
defining the biological course of UMM.
MATERIALS AND METHODS
Study population
From the archives of the Pathology Section of the
Department of Biomorphological and Functional Sciences,
University “Federico II” of Naples, Italy, 61 cases of paraffin
blocks of tumors of patients diagnosed with UMM (iris
melanoma excluded) between January 1988 and December
2000 were retrieved. The criterion of selection was the
S. STAIBANO ET AL.
absence of further post-surgical therapies and the availability
of follow-up data. These latter were constituted by clinical
examination findings plus evaluation of serum LDH level
(every 3 months), chest RX and hepatic ultrasound
examination (every 6 months for the first year following
surgery); from the second year after surgery, data concerning
hepatic ultrasound and total body computed tomography
(CT) examination were collected respectively every 6
months and yearly, for each patient. Patients with coexisting
disease that could compromise survival or those on
immunosuppressive therapy were considered ineligible for
the study. As a common closing date of follow-up, 31 July
2004 was chosen. The follow-up time ranged from 36 to 115
months (average value: 66.38 months). The final study
population consisted of 29 females and 32 males (age range:
21-84 years, mean: 58.7 years). All the patients had been
treated with primary enucleation without further therapies.
At the end of the follow-up time 50 patients were alive
without evidence of disease and 11 patients showed tumor
progression and/or death for disease. All the patients agreed
to and signed a consent for the treatment of clinical data and
tissue for diagnostic and research purposes, according to the
guidelines of the institutional Ethics Committee.
Histology
For each case, a paraffin block from a representative
area of the tumor was selected, and 4 µm-thick serial
sections were cut. A hematoxylin-eosin section of each
tumor was re-examined to confirm the original diagnosis.
Bleaching of melanin was achieved by incubating the
sections in a solution of 0.25% potassium permanganate,
5% oxalic acid, for 60 minutes at room temperature.
Immunohistochemistry
Serial sections of each case were dewaxed, rehydrated
through decreasing alcohols and treated with 3% hydrogen
peroxide for 5 minutes to inactivate endogenous
peroxidases, and then washed in distilled water. The slides
were then pre-incubated in a microwave oven three times
for 5 minutes in 10 mM, 6 pH buffer citrate. After the
quenching of endogenous peroxidase, antigen retrieval was
achieved by boiling sections at 120°C at 3.4 atm for 10
minutes, in 1% citrate buffer; the sections were then blocked
for 2 hours at room temperature with 1.5% blocking serum
(Santa Cruz). Incubation with primary antibodies was
carried out overnight, at room temperature, with the
following antibodies: anti TCR CD3-ζ monoclonal
antibody, sc-1239, Santa Cruz Biochemistry, Santa Cruz,
CA, recognizing the cytoplasmatic epitope of CD3-ζ, 1:800
dilution; anti CD4, DK 25, DAKO, Hamburg, Germany,
1:20 diluition; anti CD8, MT 310, DAKO, 1:50 diluition;
anti CD3, UCHT-1, DAKO, 1:50 diluition; anti CD56 (NK
cells), 1B6, Novocastra Laboratories, UK, 1:50 diluition;
 Int. J. Immunopathol. Pharmacol. 173

anti-Fas (C-20), polyclonal antibody, SC-715, Santa Cruz Table I. Sixty-one cases of Uveal Malignant Melanoma:
Biochemistry, Santa Cruz, CA, 1:100 diluition, anti-FasL immunohistochemical findings stratified by follow-up data.
(N-20), polyclonal antibody, SC-834, Santa Cruz
Biochemistry, Santa Cruz, CA, 1:100 diluition. Finally, TCR FasL Fas
(Tumor (CD3+ FOLLOW UP***
bounding of primary antibodies was detected by the ζ_ chain cells) lymphocytes)

conventional streptavidin-biotin linked horseradish Cases

peroxidase (LSAB-HRP) procedure, using 3,3’-
diaminobenzidine (DAB) as chromogen (32).
For each run, sections from reactive lymph node and
palatine tonsil blocks were enclosed as positive controls for
Fas, CD3+, CD8+, CD4+, NK and TCR ζ-chain and sections
from non-Hodgkin lymphoma were used as a positive
control for FasL. Negative controls were performed on
serial sections of the same tissues, substituting primary
antibodies with non immune serum. Slight nuclear
counterstaining was performed with Harris’ haematoxylin;
slides were then coverslipped using a synthetic mounting
medium. The results of the immunohistochemical staining
were evaluated separately by two observers, both blind to
the histological typing and to the follow-up data of the
single cases of UMM. At least 10 high-power fields from
each section were randomly selected for microscopic
examination at the border of the tumor and within
intratumoral areas. Staining intensity in TIL was judged
relative to lymphocytes adjacent to normal tonsil and lymph
nodes, used as controls. Only cells with a definite brown
staining were judged as positive for each antibody.
The immunohistochemical expression was quantified
semiquantitatively, as percentage of positive tumor cells
or TIL among the total neoplastic or inflammatory cells
present in all the 10 selected fields. Then, tumors and TIL
were assigned to one of the following arbitrary categories:
a) -, <5%; b) +, from 5% to < 10%; c) ++, from 10 to <
40%; d) +++, >40%.
Statistical analysis
The data were analyzed utilizing the one-way
Analysis of Variance (ANOVA) and Student-Newman-
Keuls Multiple Comparisons Test (SPSS statistical
software, version 6.1 for Windows. For the categorical
parameters the Chi-square test was used; the non
parametric Mann-Whitney U-test was utilized for
continuous variables). Only values of P < 0.05 were
considered as being significant.
RESULTS
Histology
The original histological diagnosis of malignant
melanoma was confirmed for all the cases
examined. Tumors were sub-classified according to
the Collaborative Ocular Melanoma Studies, 1998,
A&W R/M
(n.° = 61)
11 - +++ +++/++ 0 11
16 + ++ ++/+ 16 0
9 + + + 9 0
25 + - + 25 0
*Follow-up: A&W: Alive and well, without evidence of local
or metastatic disease; R: Local Recurrence; M: Metastasis.
as: spindle (20 cases), epithelioid (18 cases) and
mixed (consisting of spindle and epithelioid cells in
variable percentage; 23 cases) (33-34). For each case
the largest tumor diameter (LTD) was recorded (22
UMM were < 10 mm LTD; in 29 cases the LTD was
comprised between 10 and 15 mm; 10 cases showed
an LTD > 15 mm).
Immunohistochemistry
Only three cases of UMM showed a prevalence
of CD56+ NK cells (Fig. 1a). Infiltrating immune T
(CD3+) cells were observed in all the cases. The
prevalent population was composed by CD3+ T
lymphocytes with a predominance of CD8+ cells in
respect to CD4+ lymphocytes (Fig. 1b-c; b=CD4,
c=CD8). FasL showed a cytoplasmatic and/or cell
surface expression in tumor cells of all the cases of
UMM. In 25 cases, the percentage of positive cells
ranged from 0 to < 5% (score: -), from 5 to < 10% in
9 cases (score: +), from 10 to < 40% in 15 cases
(score: ++) and > 40% in 12 cases (score: +++)
(Fig.1d). Expression of Fas was found in all the
tumor-infiltrating lymphocytes with a score ranging
from + (5 to < 10% of lymphocytes, 40 cases) to ++
(10% to < 40%, 15 cases) and +++ (>40%, 6 cases).
The TCR ζ-chain was found expressed in the major
part of CD3+/CD8+ lymphocytes (levels > 40% of the
CD8+ lymphocytes) in 50 cases of UMM (13
epithelioid, 20 spindle and 17 mixed; Fig. 1e). In
these cases, LTD ranged from < 10 mm (19 cases),
from 10 to 15 mm (25 cases) and > 15 mm (6 cases).
174 S. STAIBANO ET AL.

Fig. 1. a) Prevalence of NK (CD 56+) cells among infiltrating immune cells in a case of Uveal Malignant Melanoma (UMM)
(LSAB- HRP, 250x); b) CD4+/CD3 infiltrating lymphocytes in a case of UMM (LSAB, HRP, 250x); c) The same case,
showing a prevalence of CD3+/CD8+ lymphocytes (LSAB, HRP, 250x); d) Strong immunostaining for Fas-L in tumor cells
of a case of UMM with a poor prognosis (LSAB, HRP, 400x); e) Appreciable immunostaining for TCR ζ-chain in TIL of a
case of UMM. (LSAB, HRP, 250x); f) Dramatically reduced expression of the TCR ζ-chain (LSAB, HRP, 250x).
 Int. J. Immunopathol. Pharmacol.
On the contrary, 11 cases of UMM (5 epithelioid
and 6 mixed) showed a reduced or absent expression
of the TCR ζ-chain (from 0% to <10% of the whole
CD3+ lymphocyte population) (Fig.1f). Among this
group, LTD was < 10 mm (3 cases), from 10 to < 15
mm (4 cases) and >15 mm (4 cases).
The statistical analysis of the results, compared
with the follow up data, showed a significant
correlation between the occurrence of
recurrence/metastases, the absent or reduced
expression of TCR ζ-chain on T lymphocytes (P <
0.01) and extensive FasL expression by tumor cells
(P< 0.05). No significant correlation was found
between the extent of expression of Fas on TIL and
clinical behavior of UMM (p> 0.05). No statistical
correlation was found between the follow up data of
patients, sex and age of patients (P>0.05) and LTD
of tumors (P>0.05).
In the group of lesions characterized by a worse
prognosis, a negative statistical correlation with the
spindle cytotype (P<0.01) was found; the correlation
between the presence of epithelioid or mixed cytotype
and the clinical behavior of UMM did not reach statistical
significance (P>0.05). The immunohistochemical
findings were summarized in Table I.
DISCUSSION
UMM reside within an immunological privileged
“sanctuary”, preserved from most immunological
defenses (3, 13-14, 29, 35-36). This may explain, at
least in part, the paradox of an ineffective immune
response against an otherwise immunostimulating
tumor, as demonstrated by the appearance of serum
antibodies directed against melanoma-associated
antigens in over 70% of patients (13). The literature
reports, in addition, that UMM are highly resistant to
antibody-mediated lysis: as a result, antibodies play
a minor role in controlling these tumors (13).
Human melanoma cells maintain a find evidence of restricted TCR utilization in TIL
microenvironment of immune privilege also by
secreting active macrophage migration-inhibitory
factor (MIF), allowing the survival of NK-susceptible
UMM outside of the immune-privileged environment
of the eye. In addition, MIF protein is secreted at a
greater level by UMM cell metastases, as compared
with primary tumors (3).
It has been hypothesized that a possible way for
175
elimination of UMM cells could be the activation of
cytotoxic cells present within progressively growing
ocular tumors. Tumor infiltrating lymphocytes have
been detected in variable proportions in UMM (30,
37), with either a predominance of CD3+/CD8+ cells or
CD4+ and CD8+ cells present in equal amounts (27, 30)
or a predominance of CD16+ NK cells (29). Ma and
co-workers (38) showed that, during the early stage of
tumor growth, CD4+ cells were the dominant T cell
population. However, by day 21 a predominance of
CD8+ cells was registered, which coincided with the
development of potent cytolytic activity.
The data of literature concerning the correlation
between TIL and biological behavior of UMM are
very difficult to understand. TIL have been reported
in cases of intraocular tumor resolution, but some
authors conclude that their presence in intraocular
neoplasms does not guarantee a favorable outcome
or even might exacerbate, rather than mitigate,
tumor progression (16, 39-40). Ksander et al. (29)
found that large ocular melanomas accumulate
tumor-specific and non-specific cytotoxic cells. This
may explain the apparent absence of linear
correlation between the amount of TIL and
prognosis of UMM (28), at least in part, due to the
ability of melanomas that develop within the ocular
microenvironment to inhibit responding
lymphocytes (14, 29, 41). In some cases, in fact,
CTL precursor infiltrate the intraocular tumor but
fail to differentiate into mature cytolytic effector
cells (13, 29). For this reason, the analysis of the
expression of T cell receptor ζ-chain may be of
importance for the correct interpretation of the
functional status of TIL in UMM.
To date, the analysis of TCR has been equivocal.
Nitta et al. detected oligoclonality of TCR
expression in UMM, which suggests the presence of
an antigen-specific T-cell-mediated immune
response (42). On the contrary, Durie et al. failed to
isolated from UMM (27). Thus, it appears that in
some circumstances, antigen-specific T cells can
enter the eye and presumably act to control UMM
progression, while in other cases TIL are incapable
of controlling the intraocular neoplasm.
Experiments performed in situ on cutaneous
malignant melanoma and on biopsies of other solid
tumors (26, 43) indicated that TIL often had low or
176 S. STAIBANO ET AL.
undetectable expression of ζ-chain. This decreased
expression was found to be biologically significant,
as patients with advanced oral carcinoma whose TIL
were defective in expression of ζ-chain had a
significantly shorter 5-year survival (26). The ζ-
chain contains motifs recognized by caspase-3 and -
7 and thus can serve as a substrate for these caspases
(44). As suggested by Dworacki, the ζ-chain down-
regulation may be induced during the direct tumor
cell-T cell interactions (23). Human tumor cells
frequently express apoptosis-inducing factors, such
as membrane-associated FasL, TNF-related
apoptosis-inducing ligand (TRAIL), or TNF-ζ,
which are able to induce death in activated T
lymphocytes (23, 42, 44-45). In particular, the cross-
linking of the Fas receptors on activated T cells
either by an agonistic or by the tumor expressing
FasL, is able to down-regulate the ζ chain
expression (23). These phenomena may emphasize
what occurs in a normal ocular environment.
Fas ligand is expressed, in fact, throughout the
eye and is responsible for the induction of apoptosis
in lymphocytes bearing its receptor, Fas (46). When
antigen recognition takes place in the anterior
chamber, a deviant immune response ensues, which
down-regulates delayed-type hypersensitivity and
preserves the integrity of non regenerating ocular
tissue (47-48). Conflicting data exist on the
expression of Fas/FasL in UMM. It has been
recently demonstrated that UMM cells produce
soluble FasL that binds to the surface of neoplastic
cells, protecting them from Fas-induced cell death
(49). Anastiassiou et al. (12) showed FasL
expression in most of 103 clinically well-
characterized cases of UMM. These authors,
however, did not find a decreased number of TIL in
FasL expressing tumors, as had been expected based
on the data published on other FasL positive tumors
inducing apoptosis of the Fas-positive leukocytes
(50). For these reasons, they concluded that their
data did not support the hypothesis of FasL as a
possible immune escape mechanism in UMM.
Probably, it is necessary to re-consider the role of
tumor-expressed FasL in light of recent studies on
the T-cell receptor in cancer patients.
The presence of signaling defects in the TCR
pathway of peripheral blood T cells in patients with
melanoma and other solid tumors has been reported
by several investigators (13, 19, 21-24, 51-52).
These defects, which included decreased expression
of the ζ-chain and the down-stream proteins, p56lck
or ZAP-70, were reported to be associated with poor
survival. We found that all the cases of UMM of our
study contained various amounts of TIL, ranging
from isolate T lymphocytes interspersed among the
neoplastic population to appreciable aggregates of
intratumoral T cells. In these cases, the CD8+
(suppressor/cytotoxic) was the prevalent phenotype,
with insignificant levels of NK-cells in the immune
infiltrate. The expression of the TCR ζ-chain was
reduced or absent in a sub-group of 11 UMM, all
characterized by local recurrence and/or metastasis.
In this sub-group of cases, a hyperexpression of
FasL by tumor cells was found. These findings lead
to some considerations:
Most cases of UMM show a considerable amount
of TIL expressing the TCR ζ-chain. These cases were
characterized by the absence of local recurrence,
metastasis or death from disease. This concurs with
reports that under certain conditions the immune
system is capable of perceiving and eliminating
intraocular tumors. Neoplasms that express highly
immunogenic tumor-specific antigens can abort the
immune privilege of the eye and provoke an immune
response that may lead to the complete eradication of
the intraocular tumor (13);
In a subgroup of our cases, UMM cells produce
high amounts of FasL, which may protect them from
Fas-induced cell death;
All the cases of the study that showed a worse
prognosis were characterized by hypo- or absent
expression of TCR ζ-chain. This is fully in
agreement with the reports indicating that CD3-ζ
impairment in cancer patients leads to an
ineffectiveness in immune response (21). This
finding may have a significant impact on new
therapeutic strategies. Reversal of the impaired
function of TILs by restoring the expression of zeta-
chain, in fact, could lead to an efficient TIL-
mediated immune response against UMM at least in
a subset of patients. Recently, it has been shown that
the ex vivo incubation of T cells in the presence of
IL-2 appears to correct the signaling defects and to
restore functions in these T cells, and the ζ-chain
expression was found to normalize in T cells of
patients who responded to therapy with IL-2 (23,
 Int. J. Immunopathol. Pharmacol.
53). The detection of patients non-expressing the
zeta-chain in TIL at the time of surgery for the
primary UMM, then, may contribute to the
identification of a subset of patients with a non-
effective TIL population that, in cases of metastatic
melanoma, are unlikely to respond to
immunological treatments.
In conclusion, we thought that the expression of
TCR zeta-chain and Fas-L by tumor cells not only
represents a prerequisite for the development of new
therapeutic strategies for UMM management, but
may also provide better prognostic information of
melanoma outcome, since the absence of zeta chain
expression, particularly when associated with
overexpression of Fas-L by neoplastic cells, resulted
in being significantly associated with a worse
prognosis of the patients. This preliminary
observation deserves further investigation, which
may further clarify the mechanism responsible of the
immune tumor escape in UMM. However, our
results indicate that overcoming the impairment of
TCR function may represent a prerequisite for the
development of new therapeutic strategies for
managing UMM, suggesting that elimination of
tumor cells may be possible by activation of
cytotoxic cells present within ocular melanomas.
ACKNOWLEDGEMENTS
We thank Mr. Pasquale Signoriello, Mr. Mario
Nasti and Dr. Viviana Strazzullo for their precious
technical assistance and Mrs Patricia Reynolds for
the English editing of the paper.
REFERENCES
1. Singh A.D. and A. Topham. 2003. Incidence of
uveal melanoma in the United States: 1973-97.
Ophthalmology 110:956.
2. Jemal A, A. Thomas, T. Murray and M. Thun. 2002.
Cancer statistics, 2002. CA Cancer J. Clin. 52:23.
3. Repp A.C., E.S. Mayhew, S. Apte and J.Y.
Niederkorn. 2000. Human uveal melanoma cells
produce macrophage migration inhibitory factor to
prevent lysis by NK cells. J. Immunol. 165:710.
4. Carlring J., M. Shaif-Muthana, K. Sisley, I.G.
Rennie and A.K. Murray. 2003. Apoptotic cell
177
death in conjunction with CD80 costimulation
confers uveal melanoma cells with the ability to
induce immune responses. Immunology. 109:41.
5. Singh A.D., C.L. Shields and J.A. Shields. 2001.
Prognostic factors in uveal melanoma. Melanoma
Res. 11:255.
6. Zaldivar R.A., T.M. Aaberg, P. Sternberg Jr., R.
Waldron and H.E. Grossniklaus. 2003.
Clinicopathologic findings in choroidal melanomas
after failed transpupillary thermotherapy. Am. J.
Ophthalmol. 135:657.
7. Puusaari I., J. Heikkonen, P. Summanen, A.
Tarkkanen and T. Kivela. 2003. Iodine
brachytherapy as an alternative to enucleation for
large uveal melanomas. Ophthalmology 110: 2223.
8. Bell D.J. and M.W. Wilson 2004. Choroidal
melanoma: Natural history and management options.
Cancer Control 11:296.
9. Kujala E., T. Makime and T. Kivela. 2003. Very
long-term prognosis of patients with malignant uveal
melanoma. Invest. Ophthalmol. Vis. Sci. 44:4651.
10. Paul E.V., B.L. Parnell and M. Fraker. 1962.
Prognosis of malignant melanomas of the choroids
and ciliary body. Int. Ophthalmol. Clin. 2:387.
11. Affeldt J.C., D.S. Minckler, S.P. Azen and L. Yeh.
1980. Prognosis in uveal melanoma with extrascleral
extension. Arc. Ophthalmol. 98:1975.
12. Anastassiou G., S.E. Coupland, A. Stang, R.
Boeloeni, H. Schilling and N. Bornfeld. 2001.
Expression of Fas and Fas ligand in uveal
melanoma: biological implication and prognostic
value. J. Pathol. 194:466.
13. Niederkorn J.Y. 1997. Immunoregulation of
intraocular tumours. Eye 11:249.
14. Apte R.S., E. Mayhew and J.Y. Niederkorn. 1997.
Local inhibition of natural killer cell activity
promotes the progressive growth of intraocular
tumors. Invest. Ophthalmol. Vis. Sci. 38:1277.
15. De Waard-Siebinga I., C.G.J.M. Hilders, B.E.
Hansen, J.L. Van Delft and M.J. Jager. 1996.
HLA expression and tumor-infiltrating immune cells
in uveal melanoma. Graefe’s Arch. Clin. Exp.
Ophthalmol. 234:34.
16. Niederkorn J.Y. and S. Wang. 2005. Immunology of
intraocular tumors. Ocular Immunol. Inflamm. 13:105.
178 S. STAIBANO ET AL.
17. Lai P., H. Rabinovich, P.A. Crowley-Nowick,
M.C. Bell, G. Mantovani and T.L. Whiteside.
1996. Alterations in expression and in function of
signal-trasucing proteins in tumor-associated T and
natural killer cells in patients with ovarian
carcinoma. Clin. Cancer Res. 2:161.
18. Irving B. and A. Weiss. 1991. The cytoplasmatic
domain of the T cell receptor ζ chain is sufficient to
couple to receptor associated signal tasduction
pathway. Cell 64:891.
19. Matsuda M., M. Petersson, R. Lenkei, J.L. Taupi,
I. Magnusson, H. Mellstedt, P. Anderson and R.
Kiessling. 1995. Alterations in the signal-
transducing molecules of T-cells and NK cells in
colorectal tumor-infiltrating, gut mucosal and
peripheral lymphocytes: correlation with the stage of
the disease. Int. J. Cancer 61:765.
20. Kono K., M.E. Ressing, R.M.P. Brandt, C.J.M.
Melief, R.K. Potkul, B. Andersson, M. Petersson,
W.M. Kast and R. Kiessling. 1996. Decreased
expression of signal-trasducing ζ chain in peripheral
T cells and natural killer cells in patients with
cervical cancer. Clin. Cancer Res. 2:1985.
21. Ishigami S., S. Natsugoe, K. Tokuda, A. Nakajo, H.
Higashi, H. Iwashige, H. Aridome, S. Hokita and T.
Aikou. 2002. CD3-ζ chain expression of intratumoral
lymphocytes is closely related to survival in gastric
carcinoma patients. Cancer 94:1437.
22. Zea A.H., C.D. Brendan, D.L. Longo, W.G.
Alvord, S.L. Strobl, H. Mizoguchi, S.P.
Creekmore, J.J. O’Shea, G.C. Poers, J. Urba and
A.C. Ochoa. 1995. Alterations in T cell receptor and
signal trasduction molecules in melanoma patients.
Clin. Cancer Res. 1:1327.
23. Dworacki G., N. Meidenbauer, I. Kuss, T.K.
Hoffmann, W. Gooding, M. Lotze and T.L.
Whiteside. 2001. Decreased ζ chain expression and
apoptosis in CD 3+ peripheral blood T lymphocythes of
patients with melanoma. Clin. Cancer Res. 7(S):947.
24. De Grujil T.D., H.J. Bontkes, F. Peccatori, M.P.W.
Galee, Th.J.M. Helmerhorst, R.H.M. Verheijen,
J. Aarbiou, W.M. Mulder, J.M. Walboomrs, C.J.
Meijer, N. Van de Vange and R. Sheper. 1999.
Expression of CD3-ζ on T-cells in primary cervical
carcinoma and in metastasis-positive and –negative
lymph nodes. Br. J. Cancer 79:1127.
25. Mulder W.M., E. Bloemena, M.J. Stukart, et al.
1997. T cell receptor-ζ and granzyme B expression
in mononuclear cell infiltrates in normal colon
mucosa and colon carcinoma. Gut 40:113.
26. Reichert T.E., R. Day, E. Wagner and T.L.
Whiteside. 1998. Absent or low expression of the ζ
chain in T cells at the tumor site correlates with poor
survival in patients with oral carcinoma. Clin.
Cancer Res. 58:5344.
27. Durie F.H., A.M. Campbell, W.R. Lee and B.E.
Damato. 1990. Analysis of lymphocytic infiltration
in uveal melanoma. Invest. Vis. Sci. 31:2106.
28. Blom D.J., I. De Waard-Siebinga, R.S. Apte, G.P.
Luyten, J.Y. Niederkorn and M.J. Jager. 1997.
Effect of hyperthermia on expression of
histocompatibility antigens and heat-shock protein
molecules on three human ocular melanoma cell
lines. Melanoma Res. 7:103.
29. Ksander B.R., D.C. Geer, P.W. Chen, M.L. Salgaller,
P. Rubsamen and T.G. Murray. 1998. Uveal MM
contain antigenically specific and non-specific
infiltrating lymphocytes. Curr. Eye Res. 17:165.
30. Meecham W.J., D.H. Char and S. Kaleta-
Michaels. 1992. Infiltrating lymphocytes and
antigen expression in uveal melanoma. Ophthalmic
Res. 24:20.
31. De la Cruz P.O., C.S. Specht and I.W. McLean.
1990. Lymphocytic infiltration in uveal malignant
melanoma. Cancer 65:112.
32. Hsu S.M., L. Raine and H. Fanger. 1981. Use of
Avidin-biotin-peroxidase complex (ABC) in
immunoperoxidase techniques: a comparison
between ABC and unlabeled antibody (PAP)
procedures. J. Histochem. Cytochem. 29:557.
33. The Collaborative Ocular Melanoma Study
Group. 1998. Histopathologic characteristics of
uveal melanomas in eyes enucleated from the
Collaborative Ocular Melanoma Studies. COMS
report n°6. Am. J. Ophthalmol. 125:745.
34. McLean I.W., W.D. Foster, L.E. Zimmermann
and J.W. Gamel. 1983. Modifications of
Callender’s classification of uveal melanoma at the
Armed forces Institute of Pathology. Am. J.
Ophthalmol. 96:502.
 Int. J. Immunopathol. Pharmacol.
35. Jiang L.Q., M. Jorquera and J.W. Steilen. 1994.
Immunologic consequences of intraocular
implantation of retinal pigment epithelial allografts.
Exp. Eye Res. 58:719.
36. Jiang L.Q., M. Jorquera and J.W. Steilen. 1993.
Subretinal space and vitreous cavity as
immunologically privileged sites for retinal
allografts. Invest. Ophthalmol. Vis. Sci. 34:3347.
37. Kremer I., E. Gilad, E. Kahan, E. Derazne and R.
Bar-Ishak. 1991. Necrosis and lymphocytic
infiltration in choroidal melanomas. Acta
Ophthalmol. 69:347.
38. Ma D., H. Alizadeh, S.A. Comerford, M.J. Gething,
J.F. Sambrook, R. Anand et al. 1994. Rejection of
intraocular tumors from transgenic mice by tumor-
infiltrating lymphocytes. Curr. Eye Res. 13:361.
39. Davidorf F.H. and J.R. Lang. 1977. Immunology
and immuno-therapy of malignant uveal melanomas.
In: Intraocular tumors. Peyman ed. Apple DJ, Sanders
DR. New York: Appleton/Century/Crofts p. 119.
40. Whelchel J.C., S.E. Farah, I.W. McLean and
M.N. Burnier. 1993. Immunohistochemistry of
infiltrating lymphocytes in uveal malignant
melanoma. Invest. Ophthalmol. Vis. Sci. 34:2603.
41. Apte R. and J.Y. Niederkorn. 1996. Isolation and
characterization of a unique natural killer cell
inhibitory factor present in the anterior chamber of
the eye. J. Immunol. 156:2667.
42. Nitta T., K. Sato, K. Okumura and L. Steinman.
1991. An analysis of T-cell-receptor variable-region
genes in tumor-infiltrating lymphocytes within
malignant tumors. Int. J. Cancer. 49:545.
43. Rabinowich H., T.E. Reichert, Y. Kashii, B.R.
Gastman, M.C. Bell and T.L. Witheside. 1998.
Lymphocyte apoptosis induced by Fas-ligand-
expressing ovarian carcinoma cells. J. Clin. Invest.
101:2579.
44. Gastman B., D. Johnson, T.L. Whiteside and H.
Rabinovich. 1999. Caspase-mediated degradation
of T cell receptor ζ chain. Cancer Res. 59:1422.
45. Somma P., L. Lo Muzio, G. Mansueto, M. Delfino,
G. Fabbrocini, M. Mascolo, C. Mignogna, M. Di
179
Benedetto, F. Carinci, A. De Lillo, L. Pastore, R.
Serpico, G. De Rosa and S. Staibano. 2005.
Squamous cell carcinoma of the lower lip: FAS/FASL
expression, lymphocyte subtypes and outcome. Int. J.
Immunopathol. Pharmacol. 18:59.
46. Griffith T.S., T. Brunner, S.M. Fletcher, D.R.
Green and T.A. Ferguson. 1995. Fas ligand-
induced apoptosis as a mechanism of immune
privilege. Science 270:1189.
47. Streilen J.W. 1993. Immune privilege as the result
of local tissue barriers and immunosuppressive
microenvironments. Curr. Opin. Immunol. 5:428.
48. Wenkel H and J.W Streilen. 1998. Analysis of
immune deviation elicited by antigens injected into the
subretinal space. Invest. Ophthalmol. Vis. Sci. 39:1823.
49. Hallermalm K., A. De Geer, R. KIessling, V.
Levitsky and J. Levitskyaya. 2004. Autocrine
Secretion of Fas Ligand shields tumor cells from
Fas-Mediated killing by cytotoxic lymphocytes.
Cancer Res. 64:6775.
50. Hahne M., D. Rimordi, M. Schroter, P. Romero,
M. Schreier, L.E. French, P. Schneider, T.
Bornand, A. Fontana , D. Lienard, J. Cerottini
and J. Tschopp. 1996. Melanoma cell expression of
Fas (Apo-1/CD45) ligand: implications for tumor
immune escape. Science 274:1363.
51. Finke J.H., A.H. Zea, J. Stanley, D.L. Longo, H.
Mizoguchi, R.R. Tubbs et al. 1993. Loss of T-cell
receptor ζ chain and p56lck in T-cell infiltrating
human renal cell carcinoma. Cancer Res. 53:5313.
52. Nakagomi H., M. Petersson, I. Magnusson, C.
Juhlin, M. Matsuda, H. Mellstedt, J.L. Taupin, E.
Vivier, P. Anderson and R. Kiessling. 1993. Decreased
expression of the signal-transducing ζ chains in tumor
infiltrating T cells and NK cells of patients with
colorectal carcinoma. Cancer Res. 53:5610
53. Rabinowich H., M. Banks, T. Reichert, T.F. Loga,
G.M. Kirkwood and T.L. Whiteside. 1996.
Expression and activity of signaling molecules in T
lymphocytes obtained from patients with metastatic
melanoma before and after IL-2 therapy. Clin.
Cancer Res. 2:1263.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 181-185 (2006)

ALTERED VESSEL SIGNALLING MOLECULES IN SUBJECTS WITH DOWN’S

SYNDROME
F. LICASTRO, M. CHIAPPELLI, E. PORCELLINI, M. TRABUCCHI1, A. MAROCCHI2 and
M.M. CORSI3

Department of Experimental Pathology, University of Bologna; 1Geriatric Research Group,

Brescia; 2Department of Laboratory Medicine, Hospital Niguarda Ca Granda, Milan;
3
Institute of General Pathology, Laboratory of Clinical Pathology, University of Milan, Italy

Received April 27, 2005 - Accepted October 28, 2005

Down’s syndrome (DS) is the most frequent human chromosomal abnormality and is associated
with mental retardation. Some evidence indicates that certain inflammatory molecules may be
increased in DS. Proinflammatory and vasoactive molecules in the blood of non demented subjects
with DS were measured in the present investigation. Plasma levels of interleukin-6 (IL-6), vascular
endothelial growth factor (VEGF), monocyte chemoattractant protein-1 (MCP-1) and C reactive
protein (CRP) were measured in child (2-14 years), adult (20-50 yrs) and elderly (> 60 yrs) DS subjects.
Increased plasma levels of IL-6 and MCP-1 were present in DS. Plasma levels of VEGF were increased
only in DS adults. Positive linear correlation between IL-6 and MCP-1 levels was present. However, no
subclinical inflammation was apparent in DS, since neopterin and CRP levels were within the normal
range. An altered regulation of these molecules might interfere with some processes involved in
cognitive performances of DS subjects.

DS is the most frequent human chromosomal
abnormality (1), occurring in 0.8 out of 1000 live
births. The presence of an extra chromosome 21 leads
to several clinical alterations, a variable degree of
mental retardation (2) and an accelerated aging of
different organs and tissues (3). By the fourth decade
of life, the appearance of cognitive impairment and
dementia further deteriorates mental performances of
DS subjects (4-5). In fact, brains from subjects with
DS show many neuropathological features, i.e.
neuritic plaques, neurofibrillary tangles and
degeneration of the basal forebrain cholinergic
neurons (4-5), which are considered the pathological
hallmarks of Alzheimer’s disease (AD). Altered
immune responses are frequently observed in DS
subjects, even at an early age (6), and have been
considered responsible for the high morbidity of the
syndrome. Few data regarding blood cytokines and
their relations with cognitive decline in DS are
available. A recent investigation showed that plasma
levels of the macrophage inhibiting protein-1 (MIP-1)
was higher in a small group of adult DS than in non
DS mentally retarded controls, and levels of IL-6
correlated with the degree of mental retardation only in
DS subjects (7). Recent findings showed that elevated
levels of IL-6, soluble IL-6 receptor (sIL-6R) and

Key words: Down’ s syndrome, vascular endothelial growth factor, monocyte chemoattractant protein-1

Mailing address:
Prof. Federico Licastro, MD
Dipartimento di Patologia Sperimentale,
Via S. Giacomo, 14
40126, Bologna, Italy 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Tel.: +39 051 2094730 This publication and/or article is for individual use only and may not be further
Fax: +39 051 2094746 reproduced without written permission from the copyright holder.
E-mail licastro@alma.unibo.it 181 Unauthorized reproduction may results in financial and other penalties
182 F. LICASTRO ET AL.
soluble vascular cell adhesion molecule-1 (sVCAM-1)
were increased in children with DS (8) and suggested a
possible remodelling of the molecule network with
regulatory function upon vasculature in DS.
MCP-1 is a member of CC chemokine family and
is involved in inflammatory processes (9) by binding
to specific CC chemokine receptor-2 (CCR-2) leading
to monocyte activation and chemotaxis. CCR2 is also
expressed in endothelial cells of the arterial wall and
MCP-1 activation by CCR2 induces endothelial
regeneration after injury (10), angiogenesis (11) and
collateral formation in vivo (12). Recent findings
showed that MCP-1 induced angiogenesis was
mediated through pathways involving VEGF (13).
VEGF represents a key regulator of physiologic and
pathologic angiogenesis and is associated with
different diseases including cancer, chronic
inflammation and diabetes (14).
DS subjects over-express DS critical region
protein-1 (DSRC-1), which is one of 50-100 genes
residing within the minimal region of human
chromosome-21; this region is present in three
copies in DS subjects (15). DSRC-1 belongs to a
family of calcineurin-interacting proteins which is
able to bind and modulate calcineurin (CnA) (16).
DSRC-1, by regulating CnA, acts as a novel VEGF
regulator and it has been suggested to regulate vessel
maturation by affecting VEGF signaling (17). It is
of interest that MCP-1 has been found to influence
neurodegeneration and neuron repair both in vitro
(18) and in vivo (19). Moreover, an over- expression
of this cytokine has also been found in patients with
neurodegenerative processes of the brain, such as
AD and in an animal model of this disease (20-21).
VEGF and IL-6 has also been claimed to play a
critical role in neurodegeneration (22) and to be
associated with AD (23-24). We hypothesize the
presence of an altered vessel molecule network in
DS in the absence of inflammation and with
biological relevance on vessel morphogenesis,
developing and remodelling. Therefore, we
measured blood levels of IL-6, VEGF, MCP-1 and
CRP in DS subjects from three different age groups.
MATERIALS AND METHODS
Patients
Three groups of male DS patients were studied:
Group 1 consisted of 23 DS children (age 2-14 years,
mean age 8 yrs), Group 2 of 14 DS adults (age 20-50
years, mean age 35 yrs) and Group 3 of 9 DS elderly
patients (> 60 years, mean age 63 yrs). DS was assessed
by clinical examination and karyotype analysis; all
patients showed a mild and variable degree of mental
retardation, were free of other pathological conditions at
the moment of the study and were in good health. The
project was approved by the Ethics Committee of the
University of Bologna and by the “Fondazione
Antoniana” of Bologna, Italy.
Laboratory procedures
Blood samples were collected from DS subjects. Plasma
was obtained by centrifugation (1500 g for 15 min),
transferred into coded plastic tubes, rapidly frozen and
stored at –20° C until analysis. IL-6, VEGF (isoform 165)
and MCP-1 plasma levels were measured using cytokine
assay with the Evidence Investigator ( Randox Ltd., Rome,
Italy). A sandwich chemiluminescent immunoassay was
employed for the cytokine assays: increased levels of
cytokines in a specimen leading to increased binding of
horseradish peroxidase labelled antibody and a consequent
increase in chemiluminescence emission. The light signal
generated from each of the tested regions on the biochip was
detected using digital imaging technology and was
compared to that from a stored calibration curve. The
concentration of analyte present in the sample was
calculated from the calibration curve. Plasma CRP
concentration was evaluated by LANIA (Latex
Agglutination Nephelometric Immunoassay) technique
(Biolatex, Spain). Samples were diluted 1:36 and results
were calculated automatically by IMMAGE system. The
minimum detectable concentration was 0.4 mg/dl. Plasma
levels of neopterin were measured in order to assess
activation of the reticular endothelial system (RES) by using
commercially available ELISA kits (BRAHMS Elitest,
Germany).
Statistical analysis
The results are given as mean ± standard deviation
(SD). Comparisons between groups were assessed by
one-way analysis of variance. Linear regression analysis
between some experimental variables was also assessed
(SPSS statistical package).
RESULTS
Levels of plasma IL-6, VEGF, MCP-1 and CRP in
DS subjects of different age groups are reported in
Table I. IL-6 levels were increased in all age groups
when compared with reference values, however, an

Table I. Plasma levels of IL-6 (pg/mL), VEGF (pg/mL),
and CRP (mg/dl) in three age-cohorts of DS subjects.
------------------------------------------------------------------------------------------------------------------
Age cohorts 2-14 yrs (n=23)
IL-6 111 ± 22
VEGF 27 ± 5
CRP 0.5 ± 0.1
-------------------------------------------------------------------------------------------------------------------
Data are shown as mean ± S.D.; p = statistical
comparisons by ANOVA; n.s. no statistical difference.
Normal reference values: IL-6 = 3.12-12.5; VEGF = 1.5
– 110; CRP = 0.0-0.9.
age-related decrement was present (p < 0.04). Plasma
levels of VEGF were increased in the adults with DS
(p < 0.002). Circulating levels of MCP-1 were
increased in DS, particularly in children and adults with
the syndrome (p < 0.0001), as shown in Fig. 1. Plasma
CRP levels in the three DS groups were within the
normal range (Table I). IL-6 plasma levels positively
correlated with those of MCP-1(R = 0.48, p = 0.013).
As stated previously, DS subjects were free from acute
clinical illness. Moreover, to exclude the presence of
subclinical inflammatory alterations which might
activate macrophage responses, neopterin plasma
levels were also determined in DS subjects and the
levels of this metabolite were within the normal range
(DS = 7 ± 2.0, controls 7 ± 2.3 nml/L).
DISCUSSION
IL-6 levels were increased in DS subjects,
particularly in the youngest subjects, and these
findings confirm previous observations showing
elevated IL-6 and sIL-6R in children with DS
assessed by different methods (6, 8). Elevated IL-6
circulating levels have been described in aging and
have been correlated with the age-associated frailty
and cognitive impairment (25).
Increased circulating IL-6 or sIL-6R has also
been reported in patients with AD (26-27) and
elevated plasma IL-6 predicted subsequent cognitive
decline in subjects from the MacArthur Study of
Successful Aging (28). Altered cytokine levels have
been suggested to play a role in neuropsychiatric
disorders (29) and altered IL-6 brain levels in AD
patients have been found (24).
Previous investigations showing increased
sICAM-3 and sVCAM-1 in DS plasma also suggest
Int. J. Immunopathol. Pharmacol. 183
the presence of mild activation and /or moderate
dysfunction of endothelial cells in these subjects (8).
Elevated levels of IL-6 and intercellular adhesion
20-50 yrs (n=14) > 60yrs (n=9) p
molecules also reflect endothelial dysfunction in
66 ± 15 33 ±12 < 0.04
different pathological conditions, such as
139 ± 35 56 ± 12 < 0.002
atherosclerosis and its complications (30). However,
0.6 ± 0. 1 0.4 ± 0.1 n.s. DS is considered a human condition with low clinical
atherosclerosis manifestation and low cardiovascular
disease risk during adulthood and aging (31-33).
Here we showed that plasma MCP-1 was
elevated in DS and VEGF levels were increased in
adult DS. A positive linear correlation between IL-6
and MCP-1 levels (R = 0.48, p = 0.013) was also
observed. These data further support the notion of an
abnormal endothelial regulation in DS. The plasma
level increases of these molecules could not be
ascribed to clinical or subclinical inflammation,
since the DS subjects studied were free of clinically
apparent pathological conditions and both CRP and
neopterin plasma levels were within the normal
range in all DS subjects.
Increased levels of IL-6, VEGF and MCP-1
reported here may contribute to the pathophysiology of
DS symptoms, such as tissue alterations and impaired
mental performances associated with the syndrome.
400 *
MCP-1 plasma levels (pg/mL)
350
300
250
200 *
150
100
50
0
2-14 20-50 >60
Age cohorts (years)
Fig. 1. Plasma levels of MCP-1(pg/mL) in three age-
cohorts of DS subjects. Normal reference values = 72-110
(pg/mL). * statistical analysis p < 0.0001.
ACKNOWLEDGEMENTS
This research has been supported by funds from
the Italian Ministry of University and Scientific
Research (PRIN and Cofin, Italian CURA Bologna
and BPM Foundation Milan, Italy).
 F. LICASTRO ET AL.
184
REFERENCES
1. Sever J.L., M.R. Gilkeson, T.C. Chen, A.C. Ley
and D. Edmonds. 1970. Epidemiology of
mongolism in the Collaborative Project. Ann. N.Y.
Acad. Sci. 171:328.
2. Baird P.A. and A.D. Sadovnick. 1988. Causes of
death to age 30 in Down syndrome. Am. J. Hum.
Genet. 43:239.
3. Franceschi C., F. Licastro, M. Chiricolo, F.
Bonetti, M. Zannotti, N. Fabris, E. Mocchegiani,
M.P. Fantini, P. Paolucci and M. Masi. 1981.
Deficiency of autologous mixed lymphocyte
reactions and thymic factor level in Down’s
syndrome. J. Immunol. 126:216.
4. Wisniewski K., H.M. Wisniewski and G.Y. Wen.
1985. Occurrence of neuropathological changes and
dementia of Alzheimer’s disease in Down’s
syndrome. Ann. Neurol. 17:278.
5. Mann D.M. and M.M. Esiri. 1989. The pattern of
acquisition of plaques and tangles in the brains of
patients under 50 years of age with Down’s
syndrome. J. Neurol. Sci. 89:169.
6. Licastro F., R.A. Mariani, G. Faldella, E.
Carpenè, G. Guidicini, A. Rangoni, T. Grilli and
G. Bazzocchi. 2001. Immune-endocrine status and
coeliac disease in children with Down’s syndrome:
Relationships with zinc and cognitive efficiency.
Brain Res. Bull. 55:313.
7. Carta M.G., P. Serra, A. Ghiani, E. Manca, M.C.
Hardoy, G.S. Del Giacco, G. Diaz, B. Carpiniello
and P.E. Manconi. 2002. Chemokines and pro-
inflammatory cytokines in Down’s Syndrome: An
early marker for Alzheimer-type dementia?
Psychother. Psychosom. 71:233.
8. Licastro F, M. Chiappelli, M. Ruscica, V.
Carnelli and M.M. Corsi. 2005. Altered cytokine
and acute phase response protein levels in the blood
of children with Down’s syndrome: relationship
with dementia of Alzheimer’s type. Int. J.
Immunopathol. Pharmacol. 18:165.
9. Gosling J., S. Slaymaker, L. Gu, S. Tseng, C.H.
Zlot, S.G. Young, B.J. Rollins and I.F. Charo.
1999. MCP-1 deficiency reduces susceptibility to
atherosclerosis in mice that overexpress human
apolipoprotein B. J. Clin. Invest. 103:773.
10. Weber K.S., P.J. Nelson, H.J. Grone and C. Weber.
1999. Expression of CCR2 by endothelial cells:
implication for MCP-1 mediated wound injury repair
and in vivo inflammatory activation of endothelium.
Arterioscler. Throm. Vasc. Biol. 19:2085.
11. Salcedo R., M.L. Ponce, H.A. Young, K.
Wasserman, J.M. Ward, H.K. Kleinman, J.J.
Oppenheim and W.J. Murphy. 2000. Human
endothelial cells express CCR2 and respond to
MCP-1: direct role of MCP-1 in angiogenesis and
tumor progression. Blood 96:34.
12. van Royen N., I. Hoefer, M. Bottinger, J. Hua, S.
Grundmann, M. Voskuil, C. Bode, W. Schaper, I.
Buschmann and J.J. Piek. 2003. Local monocyte
chemoactrant protein -1 therapy increases collateral
artery formation in apolipoprotein E-deficient mice
but induces systemic monocyte CD11b expression,
neointimal formation, and plaque progression. Circ.
Res. 92:218.
13. Hong K.H., J. Ryu and K.H. Han. 2005. Monocyte
chemoattractant-1 induced angiogenesis is mediated by
vascular endothelial growth factor-A. Blood 105:1405.
14. Ferrara N. and H.P. Gerber. 2001. The role of
vascular endothelial growth factor in angiogenesis.
Acta Haematol. 106:148.
15. Fuentes J.J., M.A. Pritchard, A.M. Planas, A.
Bosh, I. Ferrer and X. Estiville. 1995. A new
human gene from the Down syndrome critical region
encodes a praline-rich protein highly expressed in
fetal brain and heart. Hum. Mol. Genet. 4:1935.
16. Rothermel B., R.B. Vega, J. Yang, H. Wu, R.
Bassel-Duby and R.S. Williams. 2000. A protein
encoded within the Down syndrome critical region is
enriched in striated muscle and inhibits calcineurin
signaling. J. Biol. Chem. 275:8719.
17. Hesser B.A., X.H. Liang, G. Camenisch, S. Yang,
D.A. Lewin, R. Scheller, N. Ferrara and H.P.
Gerber. 2004. Down syndrome critical region
protein 1 (DSCR1), a novel VEGF target gene that
regulates expression of inflammatory markers on
activated endothelial cells. Blood 104:149.
18. Kalehua A.N, J.E. Nagel, L.M. Whelchel, J.J.
Gides, R.S. Pyle, R.J. Smith, Kusiak and D.D.
Taub. 2004. Monocyte chemoattractant protein-1 and
 Int. J. Immunopathol. Pharmacol.
macrophage inflammatory protein-2 are involved in
both excitotoxin-induced neurodegeneration and
regeneration. Exp. Cell. Res. 297:197.
19. Hughes P.M, P.R Allegrini, M. Rudin, V.H
Perry, A.K. Mir and C. Wiessner. 2002.
Monocyte chemoattractant protein-1 deficiency is
protective in a murine stroke model J. Cereb.
Blood Flow Metab. 22:308.
20. Grammas P. and R. Ovase. 2001 Inflammatory
factors are elevated in brain microvessels in
Alzheimer’s disease. Neurobiol. Aging 22:837.
21. Yamamoto M., M. Horiba, J.L. Buescher, D. Huang,
H.E. Gendelman, R.M. Ransohoff and T. Ikezu.
2005. Overexpression of monocyte chemotactic
protein-1/CCL2 in beta-amyloid precursor protein
transgenic mice show accelerated diffuse beta-amyloid
deposition. Am. J. Pathol. 166:1475.
22. Storkebaum E. and P. Carmeliet. 2004. VEGF:
a critical player in neurodegeneration.
J. Clin. Invest.113:14.
23. Del Bo R., M. Scarlato, S. Ghezzi, F. Martinelli
Boneschi, C Fenoglio, S Galbiati, R. Virgilio, D.
Galimberti, G. Galimberti, M. Crimi, C.
Ferrarese, E. Scarpini, N. Bresolin and G.P.
Comi. 2005. Vascular endothelial growth factor gene
variability is associated with increased risk for AD.
Ann. Neurol. 57:373.
24. Licastro F., L.M. Grimaldi, M. Bonafe, C.
Martina, F. Olivieri, L. Cavallone, S. Giovanietti,
E. Masliah and C. Franceschi. 2003. Interleukin-6
gene alleles affect the risk of Alzheimer’s disease
and levels of the cytokine in blood and brain.
Neurobiol. Aging 24:921.
25. Ershler W.B. and E.T. Keller. 2000. Age-associated
185
increased interleukin-6 gene expression, late-life
diseases and frailty. Annu. Rev. Med. 51:245.
26. Licastro F., S. Pedrini, L. Caputo, G. Annoni, L.J.
Davis, C. Ferri, V. Casadei and L.M.E. Grimaldi.
2000. Increased plasma levels of interlukin-1,
interleukin-6 and aplha-1 antichymotrypsin in
patients with Alzheimer’s disease: peripheral
inflammation or signal from the brain. J.
Neuroimmunol. 103:97.
27. Angelis P., S. Scharf, A. Mander, F. Vajda and N.
Christofhidis. 1998. Serum interleukin-6 soluble
receptor in Alzheimer’s disease. Neurosci. Lett. 244:106.
28. Weaver J.D., M.H. Huang, M. Albert, T. Harris,
J.W. Rowe and T.E. Seeman. 2002. Interleukin-6
and the risk of cognitive decline. MacArthur Studies
of Successful Aging. Neurology 59:371.
29. Theoharides T.C., C. Weinkauf and P. Conti.
2004. Brain cytokines and neuropsychiatric
disorders. J. Clin. Psychopharmacol. 24:577.
30. Ridker P.M., N. Rifai, M.J. Stampfer and C.H.
Hennekens. 2000. Plasma concentration of interleukin-
6 and the risk of future myocardial infarction among
apparently healthy men. Circulation 101:1767.
31. Hopkins W.E., N.K. Fukagawa, B.E. Sobel and
D.J. Schneider. 2000. Plasminogen activator
inhibitor type 1 in adults with Down syndrome and
protection against macrovascular disease. Am. J.
Cardiol. 85:784.
32. Yla-Herttuala S., J. Luoma, T. Nikkari and T.
Kivimaki. 1989. Down’s syndrome and
atherosclerosis. Atherosclerosis 76:269.
33. Murdoch J.C., J.C. Rodger, S.S. Rau, C.D. Fletcher
and M.G. Dunnigan. 1977. Down’s syndrome: an
atheroma free model? Br. Med. J. 23:226.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 187-197 (2006)

EXPLOITING THE PLANT SECRETORY PATHWAY TO IMPROVE THE ANTI-

CANCER ACTIVITY OF A PLANT-DERIVED HPV16 E7 VACCINE
R. FRANCONI, S. MASSA, E. ILLIANO, A. MULLER1, A. CIRILLI1, L. ACCARDI2,
P. DI BONITO2, C. GIORGI2 and A. VENUTI1

ENEA, Italian National Agency for New Technologies, Energy and the Environment, BIOTEC,
Laboratory of Plant Genetics and Genomics, C.R. Casaccia, P.O. Box 2400 I-00100 Roma, Italy;
1
Laboratory of Virology, Regina Elena Cancer Institute, Via delle Messi d’Oro 156, Roma, Italy;
2
Department of Infectious, Parasitic and Immunomediated Diseases, Istituto Superiore di Sanità,
Viale Regina Elena 299, 00161 Roma, Italy

Received March 1, 2005 – Accepted October 21, 2005

The human papillomavirus 16 (HPV16) E7 oncoprotein can be considered a ‘tumor–specific antigen’

and, therefore, it represents a promising target for a therapeutic vaccine against HPV-associated tumors.
Efficient production of E7 protein with a plant-based transient expression system has been already
described and it was demonstrated that E7-containing crude plant extracts confer partial protection
against tumor challenge in a mouse model system. Before adopting the plant-based system as a cost-
effective method for the production of an E7-based anti-cancer vaccine, some aspects, such as the
oncoprotein yield, need further investigation. In the present study, we report the transient expression,
mediated by a potato virus X (PVX)-derived vector, of the E7 protein targeted to the secretory system of
Nicotiana benthamiana plants by using a plant-derived signal sequence. Targeting the antigen to the
secretory pathway enhanced the E7 protein expression levels about five-fold. Mice immunized by s.c.
administration with crude foliar extracts containing E7 showed strong stimulation of cell-mediated
immune response after five boosters, as detected by ELISPOT. After challenging with the E7-expressing
C3 tumor cells, tumor growth was completely inhibited in 80% of the vaccinated animals and a drastic
reduction of tumor burden was observed in the remaining tumor-affected mice. These data demonstrate
that, by enhancing E7 yield, it is possible to improve the anti-cancer activity of the plant-based
experimental vaccine and open the way for a large-scale production of the E7 protein which could be
purified or used as ‘in planta’ formulation, also suitable for oral therapeutic vaccination.

The “high risk” human papillomaviruses (HR-
HPVs), particularly the HPV16, are the primary
etiologic agents of cervical cancer and are also
involved in the development of other tumors (skin,
head and neck) (1). Although cervical cytology
screening has resulted in a significant decline in
mortality in developed countries (in the US, Europe
and Japan about 5-6 million women per year are
diagnosed with a pre-neoplastic lesion caused by
HPV), in developing countries cervical cancer

Key words: human papilloma virus, vaccine, plant, cancer immunotherapy, plant signal peptide

Mailing address:
Dr. Rosella Franconi
ENEA, C.R. Casaccia,
BIOTEC-GEN
P.O. Box 2400 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
I-00100 Roma, Italy This publication and/or article is for individual use only and may not be further
Tel. +39-06-30484482; - Fax. +39-06-30484808; reproduced without written permission from the copyright holder.
E-mail: franconi@casaccia.enea.it. 187 Unauthorized reproduction may results in financial and other penalties
188 R. FRANCONI ET AL.
remains one of the main causes of cancer-related
death (2). The host usually clears HPV infection but
in a number of people the infection becomes
persistent leading to progression to chronic disease
with clinical/histological appearance of low or high
grade Squamous Intraepithelial Lesions (SIL) which,
in some cases, may progress to cancer (3). In these
stages of the disease a therapeutic intervention could
be efficacious in curing the disease (Low-High SIL)
and in preventing tumor development and spreading.
Nowadays, pharmaceutical companies are actively
involved in the development of prophylactic vaccines
which are able to prevent primary viral infection and,
consequently, to reduce the incidence of cancer. Some
vaccines are currently in phase III clinical trials with
very encouraging results (4-5). However, due to the
long latency period between infection and cancer, the
benefits of a prophylactic vaccination, in terms of
cancer incidence, would be visible after decades.
Thus, a real need exists to develop therapeutic
vaccines able to hinder the progression of pre-existing
lesions and malignant tumors, and even to eliminate
them. The E5, E6 and E7 oncoproteins of HR-HPVs
are responsible for the onset and maintenance of the
tumor cell transformed state and, therefore, represent
appropriate targets for the development of therapeutic
vaccines (6). E7 is a short-lived protein, which is
degraded both in vitro and in vivo by the ubiquitin-
proteasome pathway (7). Attempts to produce large
amounts of sequence-authentic, non-fused
recombinant E7 protein in eukaryotic expression
systems have practically failed, mainly because of its
rapid degradation (8). Nevertheless some E7-based
HPV-specific therapeutic vaccines are currently being
explored in phase II and III clinical trials and
preliminary promising results have been disclosed but
they still need further improvement by the association
with more appropriate adjuvants able to stimulate
efficacious cell-mediated immunity (9). It is then
important to focus on ‘second generation’ vaccines, by
using technologies allowing to obtain vaccines that are
immunologically more active and more accessible for
developing countries, overcoming current limitations
such as high costs and the improper use of needles.
Plants have emerged as an alternative for the
production of effective ‘second generation’ vaccines.
Plant-derived biopharmaceuticals and vaccine
antigens are cheaper and safer than those derived
from eukaryotic expression systems. There are two
main systems to produce vaccine antigens in plants,
stable transformation and transient expression. Stable
transformation produces a genetic line that can be
propagated vegetatively or by seeds and this
represents the method used for the HPV L1-based
prophylactic vaccine production (10-12), as well as
for the human clinical trials with edible vaccine
published to date (13-16). Transient expression is
mainly achieved by using recombinant plant RNA
viruses (17). The gene coding for the protein of
interest is incorporated into the virus genome. As the
virus spreads and replicates in the host cell, numerous
copies of the target gene are produced and high
protein yields can be achieved in a relatively short
time, typically resulting in a much higher level of
expression than that obtained with stable
transformation. An advantage of this system is that it
allows the expression of antigens that could be toxic
or interfere with plant metabolism, as it might be in
the case of the oncoproteins.
In a previous study we reported the ectopic
production of HPV16 E7 protein in Nicotiana
benthamiana plants using a potato virus X (PVX)-
derived vector (Nb-PVX-E7) (18). Mice immunized
with Nb-PVX-E7 crude extracts showed stimulation
of both humoral and cell-mediated immune
responses, suggesting an adjuvant-like activity of the
E7-containing foliar extracts. About 40% of animals
were protected from tumor challenge, and it was
hypothesized that the low percentage of responders
could be related to the low amount of E7 antigen
contained in the plant extract vaccine dose (18).
In the present work we report the production of
the HPV16 E7 oncoprotein by its targeting to the
plant secretory pathway. This strategy enhanced the
protein expression levels and improved
immunogenic activity of the plant-based vaccine
preparation, leading to increased protection against
HPV-related tumors in a mouse model.
MATERIALS AND METHODS
Preparation of the secretory construct of the E7 gene
The HPV16 E7 gene was N-terminally fused with a
plant-derived signal sequence (ss) for secretion. The ss-
coding sequence of the bean polygalacturonase-inhibiting
protein (PGIP),
MTQFNIPVTMSSSLSIILVILVSLRTALS (PGIPss) (19)
 Int. J. Immunopathol. Pharmacol.
was fused to the 5’ end of the E7 gene by “gene splicing
for overlap extension PCR” (SOE-PCR) performed using
the Pfu polymerase (Stratagene, La Jolla, CA, USA).
The first PCR step was performed using as a template a
plasmid containing the PGIPss sequence fused to the 5’ end of
a single-chain Fv antibody fragment (20). The forward primer
PGIPssCX-dir (5’GGCCATCGATTCTAGACATGACT
CAATTCAATATCCCAGTA-3’, a ClaI site is underlined and
the PGIPss initiation translation codon is in bold) and the
reverse primer E7PGIP-rev (5’TGTAGGTGTATCT
CCATGCATTGAGAGTGCAGTTC TCAA-3’, containing
the N-terminal end of the E7 gene and the C-terminal end
of the PGIPss in bold ) were used to amplify a 125 bp
fragment. In the second PCR step, the E7 gene was amplified
from the plasmid E7-pGEX-4T1 using the forward primer
PGIPssE7-dir (5’TTGAGAACTGCACTCTCAATGCATG
GAGATACACCTACA-3’, containing the C- terminal end
of the PGIPss in bold and the N-terminal end of the E7
gene) and the reverse primer E7-rev (5’-
GGCCGTCGACCCCGGGTTATGGTTTCTGAGAACAG
ATGGG-3’, a SalI site is underlined and the stop codon
is in bold). In this amplification step a 318 bp fragment
was obtained.
The two fragments were purified and then PCR-
assembled by using PGIPssCX-dir as a forward primer
and E7-rev as a reverse primer obtaining the PGIPss-E7
fusion gene. After digestion with the restriction enzymes
ClaI and SalI, the fragment was cloned in the pPVX201
vector, obtaining the pPVX-PGIPss-E7 construct.
Restriction enzymes were obtained from Promega
(Madison, Wisconsin, USA) and from New England
Biolabs (Frankfurt am Main, Germany).
Plant infection and immunoblotting
Plasmid DNA preparation was performed by using the
Nucleobond PC 500 kit (Macherey-Nagel, Düren,
Germany). Two leaves of N. benthamiana plants, at the
four-leaf stage, grown in a containment greenhouse
(Biosafety level 2) were mechanically inoculated with 10
µg of the pPVX-PGIPss-E7 plasmid. The pPVX–E7
plasmid, containing the cytoplasmic version of the E7 gene,
and the pPVX-wt plasmid, without insert, were used as
controls (18).
Both inoculated and systemic leaves were collected at
the infection symptom appearance and stored at -80°C.
Part of the foliar material was lyophilized by freeze-
drying (Freeze-dryer Modulyo, Boc Edwards SpA, Milan,
Italy) and the leaf powder was stored at RT or at 4°C for
at least one year.
Frozen or lyophilized infected leaves, immersed in
liquid nitrogen in a mortar, were ground to fine powder with
a pistil then resuspended in phosphate-buffered saline (PBS)
as already described (18). The Total Soluble Protein (TSP)
189
content in the supernatant was determined by Bradford
assay (BioRad, Hercules, CA, USA) using bovine albumin
as a standard. Twenty µg of TSP were separated by
electrophoresis in 12% SDS-gel and transferred onto
Immobilon-P membrane (Millipore, Bedford, Ma, USA)
and blocked overnight with PBS containing 5% no fat milk.
The membrane was then probed with a mouse polyclonal
antibody (diluted 1:1000) against the E. coli His-E7 protein,
as described (18). Detection was performed by ECL
(Amersham Biosciences Europe GmbH, Cologno Monzese,
Italy) followed by exposure to X-ray film.
ELISA reactivity of the plant-derived E7 protein
Total plant extracts derived from leaves infected with
the pPVX-PGIPss-E7 plasmid were evaluated for the
presence and reactivity of the E7 protein by enzyme-linked
immunosorbent assay (ELISA). Polystyrene microtitre
plates were coated overnight at 4°C with 100 µl plant
extracts/well, incubated with a mouse polyclonal antibody
(diluted 1:1000) against the recombinant His-E7 protein and
then with a horseradish-peroxidase conjugated goat anti-
mouse IgG antibody (Amersham Biosciences Europe
GmbH, Cologno Monzese, Italy). Finally, plates were
incubated with ABTS substrate (2,2-azino-bis-
benzothiazoline-6-sulphonic acid) and absorbance value
measured at 405 nm in an ELISA microtitre plate reader.
The amount of E7 protein in the extracts was estimated by
a triple antibody sandwich ELISA. The extract was added to
microtiter plates coated with an anti-E7 rabbit polyclonal
antibody (21) and known amounts (range 0.25-50 ng) of
purified His-E7 protein produced in E. coli, diluted in N.
benthamiana plant extracts, were used as a standard. The
samples were then treated as described above.
Intercellular fluid extraction
The intercellular fluids (IF) were extracted from
systemic leaves of N. benthamiana plants with viral
symptoms of infection and analysed by immunoblotting and
ELISA. Leaves (sub-apical, about 2 g) were cut into strips 1
cm wide and vacuum infiltrated with cold PBS containing
protease inhibitors. Infiltrated leaves were briefly dried on a
Kleenex towel, then placed in a syringe and centrifuged for
10 min at 1000 x g to extract the IF. Ten microlitres of IF
was separated by SDS/PAGE and analysed by Western blot
as described above. Absence of cytosolic contamination was
checked as previously described (20).
Mice immunization with plant-derived extracts and
tumor challenge
Groups of 8 female C57BL/6 mice (Charles River,
Como, Italy) were vaccinated subcutaneously (s.c.) on day
0, 15, 30, 45, and 60 with 500 µl/mouse of the following
preparations: Nb-PVX-PGIPss-E7 (extract from pPVX-
190 R. FRANCONI ET AL.
PGIPss-E7 infected N. benthamiana leaves containing
approximately 2.5 µg of E7 protein); Nb-PVX-E7 (extract
from pPVX-E7 infected N. benthamiana leaves, containing
0.5 µg of E7 protein); Nb-PVX-wt (extracts from pPVX-wt
infected N. benthamiana leaves) and His-E7+QuilA
(constituted of purified His-E7 protein plus the adjuvant
QuilA, 10 µg/mouse). Ten days after the last booster the
different groups of mice were challenged s.c. with 5x105 of
the syngeneic C3 tumor cells expressing the HPV16
genome (obtained by S. Hallez, Brussels, Belgium). A
group of unvaccinated mice received the same amount of
C3 cells as controls. The tumor growth was analysed by
their weight after the animal sacrifice. These experiments
were repeated at least three times. Animal experiments were
performed following the Institutional animal-use guidelines
and the approval of the Ethical Committee.
Enzyme-linked immunospot assay (ELISPOT) for IFN-
γ-secreting cells
HPV16 E7 specific T cell precursors were detected by
ELISPOT assay, as previously described (18, 22). Briefly,
splenocytes were harvested from each group of vaccinated
mice on day 14 after last booster. 2x105 cells along with
interleukin 2 (50 units/ml; Sigma-Aldrich, St. Louis,
Missouri, USA) were added to each well of a 96-wells
microtiter plate (Millipore, Bedford, MA, USA) coated with
a rat anti-mouse IFN-γ antibody (clone R4-6A2, 8 µg/ml;
BD Biosciences PharMingen, San Diego,CA, USA). The
samples were incubated at 37°C for 24-48 hours with 10
µg/ml of E7-specific H-2Db CTL epitope (aa 49-57,
RAHYNIVTF) (23).
Thereafter, plates were washed six times with PBST
(0.02% Tween-20 in PBS) and incubated with biotinylated
anti-IFN-γ antibody (clone XMG1.2, 2 µg/ml; BD
Biosciences PharMingen, San Diego,CA, USA) in 75 µl
PBST containing 0.1 mg/ml ovalbumin, overnight at 4°C.
Avidin-horseradish peroxidase (2.5 mg/ml, Sigma-
Aldrich, St. Louis, Missouri, USA) was then added and the
spots were developed by adding 3.3’-
diaminobenzidine/peroxidase substrate (Sigma Fast;
Sigma-Aldrich St. Louis, Missouri, USA). The spots were
counted using a dissecting microscope.
RESULTS
Production of HPV16 E7 protein in the secretory
pathway of Nicotiana benthamiana
Virus-mediated expression of heterologous proteins in
plants represents a powerful tool for the production and
delivery of pharmaceutical proteins (17, 24). A secretory
construct of the E7 gene was obtained by fusing the signal
sequence PGIPss at the N-terminus of the protein. The
PGIPss-E7 fusion gene (Fig. 1 A) was cloned in the
pPVX201 vector (Figure 1 B), downstream a duplicated
promoter of the PVX coat protein (CPP), which allows
the synthesis of a soluble product (25). This recombinant
vector was used for the direct mechanical infection of
leaves of N. benthamiana plants, exploiting the presence
in the construct of the cauliflower mosaic virus (CaMV)
35S promoter that allows the production of the infectious
viral RNA genome.
Local and systemic symptoms were observed five and
ten days after infection, respectively. Protein expression was
monitored in the systemic leaves by immunoblotting
showing that the presence of the E7 protein was associated
to PVX infection symptoms (Fig. 2). The Nb-PVX-PGIPss-
E7 and the Nb-PVX-E7 extracts, as well as the IF obtained
from N. benthamiana plants infected with the pPVX-
PGIPss-E7 plasmid, showed a band corresponding to the E7
protein as well as a characteristic high molecular mass band
pattern. This characteristic band pattern was resistant to
SDS treatment and boiling, as already reported (18). The
intensity of the signal in the Nb-PVX-PGIPss-E7 lane was
stronger than that in the Nb-PVX-E7 lane and meaningful of
a five-fold increase of the protein expression level, as
quantified by ELISA (data not shown).
It is generally assumed that proteins produced in leafy
crops tend to be unstable. Therefore we monitored the
stability of E7 proteins after long-term storage by
immunoblotting. The E7 protein was found very stable in
lyophilized infected leaves kept at either 4°C or RT for at
least one year (data not shown).
Plant-derived E7 vaccine induces a cell-mediated
immune response and protects mice against challenge
with HPV16 E7-expressing tumors
Groups of 8 C57BL/6 mice were immunized with
either the different plant-derived preparations without
adjuvant or purified His-E7 protein (10 µg) plus the
adjuvant Quil-A, or saline solution as a control group.
The vaccinated animals received 5 subcutaneous
inoculations of the different vaccine preparations on day
0, 15, 30, 45 and 60. Ten days after the last inoculation
they were challenged with the E7 expressing C3 tumor
cells. The tumor development at the injection site was
monitored by palpation. After 50 days observation the
control mice developed enormous tumors that hampered
their ambulation; for this reason the experiment was
stopped and all the animals were sacrificed.
Mice vaccinated with either saline solution or with the
foliar extracts from plant infected with PVX-wild type
developed the tumor 14 days after the challenge whereas
all the mice vaccinated with the E7 preparations showed
a marked delay in tumor appearance (Fig. 3 A). At the end
of the experiment 80% of mice vaccinated with Nb-PVX-
PGIPss-E7 extracts were tumor-free whereas 40% of
 Int. J. Immunopathol. Pharmacol. 191

Fig. 1. Schematic representation of the constructs used for PVX-mediated HPV16 E7 protein expression in plant. A)
Cytoplasmic and secretory constructs of the HPV16 E7 gene. PGIPss indicates the PGIP signal peptide for the protein
targeting to the secretory pathway. Cloning sites are indicated together with the restriction enzyme. B) Schematic
representation of the pPVX201 plasmid. In this vector the full-length viral cDNA is inserted between the constitutive 35S
promoter derived from the cauliflower mosaic virus (CaMV 35S) and the transcription terminator (NOS ter) of the nopaline
syntethase gene of Agrobacterium tumefaciens, necessary for the regulation of the viral genome expression upon infection
with plasmid DNA. Characteristic components of the viral expression vector are indicated: viral replicase gene (RdRp);
triple gene block encoding protein for cell-to-cell movement (M1-3); viral coat protein gene necessary for encapsidation of
viral RNA (CP); coat protein promoter (CPP); Cla I and Sal I restriction enzyme sites for directional cloning.

animals vaccinated with Nb-PVX-E7 extracts did not
developed tumors (Fig. 3 A). This last result confirms that
previously reported (18). The tumor protection obtained
with the purified recombinant E7 protein plus the
adjuvant Quil A reached 100% of tumor-free mice. It is to
be pointed out that the amount of protein contained in this
last preparation is four times higher than that contained in
the Nb-PVX-PGIPss-E7 extracts. Moreover, the tumors
that developed in C57BL/6 mice in spite of vaccination
turned out to be smaller (less than 1/3 in weight) than
those detected in mice vaccinated with the Nb-PVX-wt
extract (Fig. 3 B). In particular, vaccination with Nb-PVX-
PGIPss-E7 extracts seemed to be more effective than Nb-
PVX-E7 extracts in controlling the tumor growth. Similar
results were obtained from two independent experiments
with the same number of animals per group.
Antigen-specific T-cell responses in immunized mice
The importance of the role of the T-cell immune
response in the anticancer activity is well recognized,
therefore the induction of this response was investigated
in vaccinated mice by ELISPOT. Splenocytes were
isolated from both the controls and the immunized mice,
with or without tumors, at the end of the observation (50
days). After stimulation by the E7-specific CTL epitope,
the IFN-γ-secreting cells were visualized as spots by an
anti- IFN-γ monoclonal antibody and counted with a
dissecting microscope (Fig. 4). Very high levels of IFN-γ-
secreting cells were detected in tumor-free mice
vaccinated with E7-containing plant extracts, while in
tumor-bearing vaccinated mice the number of IFN-γ-
secreting cells was slightly over the controls. This good
correlation between the impairment of the tumor
development and Th1 response induced by the
vaccination confirmed the important role of cell-mediated
immune response in contrasting tumor development. In
particular, the tumor-free mice vaccinated with Nb-PVX-
PGIPss-E7 extracts showed a cell-immune response
higher than mice vaccinated with Nb-PVX-E7 extracts.
DISCUSSION
Active immunotherapy against cancer relies on
the patient’s own ability to develop, after stimulation
by tumor-associated antigens, an immune response
which is able to overcome immune tolerance/anergy
and to lead to a cytotoxic response resulting in
efficient cancer cell killing and prevention of
metastatic spread of the tumor (26).
In the case of HPV-associated tumors,
therapeutic vaccines could be extremely useful to
target those individuals who have already been
infected or who have precancerous lesions caused by
192 R. FRANCONI ET AL.

Fig. 2. Expression of the HPV16 E7 protein in N. benthamiana plants. Western blot analysis of total soluble proteins
(TSP) (20 µg) extracted from N. benthamiana leaves systemically infected with pPVX-E7 (lane 1) and pPVX-PGIPss-E7
constructs (lane 3). Lane 2: purified recombinant His-E7 protein produced in E. coli (40 ng); lane 4: Intercellular fluids
(10 µl) extracted from leaves systemically infected with pPVX-PGIPss-E7; lane 5: TSP (10 µl) extracted from mock-
infected N. benthamiana leaves. After PAGE analysis the products were transferred onto a membrane and protein
detection was performed with an anti His-E7 mouse polyclonal antibody (diluted 1:1000).

HR-HPV types. A successful immunotherapy would
rapidly clear these lesions, lowering the incidence of
surgical interventions and providing protection
against future exposure. Up to now, recombinant
HPV16 E7-based vaccine used in clinical trials has
been produced in the baculovirus expression
systems or in E. coli, mainly as a fusion protein,
since the un-fused E7 protein is unstable (7-8). For
application in humans it is important to obtain
stable, cheap, effective and low cost E7 vaccine.
In recent years, plants have been increasingly used
as an effective heterologous expression system of
recombinant proteins and potential therapeutics (27-
28). Several biopharmaceuticals, that have been
obtained in plant by transient expression systems based
on plant viral vectors, are now in clinical trials (24) and
moreover some cancer bio-medicals have been
obtained using plant viral vectors as well (18, 29-32).
The production of HPV16 E7 protein in Nicotiana
benthamiana tobacco plants as a soluble protein in the
cytosol by using the PVX, was already reported (18).
Mice immunized with crude tobacco extracts
containing E7 showed stimulation of both humoral
and cell-mediated immunity, suggesting an adjuvant-
like activity of the foliar extracts. By using the
cytoplasmic construct the E7 protein expression
levels were 3-4 µg E7 protein/g fresh leaf (18) and the
quantity administered to the mice was 20-fold lower
than that known to prevent tumor growth (i.e. purified
His-E7 expressed in E. coli, 10 µg/booster, plus the
adjuvant Quil-A) (33). Hence, it was reasonable to
assume that the immunogenic activity of the E7 ‘in
planta’ formulation might be further improved by
increasing the amount of E7 protein contained in the
vaccine preparation; this can be achieved by
increasing its expression in the plant system.
To optimise the yield of expressed proteins,
signal sequences can be used to target them to
specific areas of plant cells for accumulation, like
the endoplasmic reticulum, where, in the absence of
further targeting signals, the expressed proteins may
be secreted to the apoplast or retained therein.
Moreover, the endomembrane system is more
suitable for protein folding and assembly than the
reducing environment of the cytosol, as
demonstrated by several studies on antibodies
expressed in plants (20, 34).
It has been shown that, by using PVX-based
vectors, it is possible not only to obtain expression but
also proper compartmentalization of a foreign protein
(20, 35). Indeed, in this study we demonstrated that
PVX-mediated E7 protein expression in the secretory
 Int. J. Immunopathol. Pharmacol. 193

A 120

100
Tumor-free animals (%)..

80

60

40

20

0
0 7 14 21 28 35 40 50
Days
Daysafter tumor
after cellcell
tumor inoculum
inoculum
Nb-PVX-E7 Nb-PVX-wt
none His-E7+QuilA
Nb-PGIPss-PVX-E7

B 5
4,5
•

4
3,5
Tumor weight (gr.)..

3
2,5
•
p<0.0001
2 p<0.0001
1,5
•

1
0,5
•

0
Nb-PVX-wt Nb-PVX-E7 Nb-PGIPss- His-E7+QuilA
PVX-E7
Fig. 3. Mouse protection against C3-induced tumor after vaccination with E7-containing plant extracts. C57BL/6 mice were
vaccinated on days 0, 15, 30, 45, and 60 with either the indicated vaccine preparations or saline solution as control. Two
weeks after the last booster the different groups of mice were challenged with 5x105 E7-expressing syngeneic C3 tumor cells.
The presence of tumors in mice was monitored by palpation twice a week. The animals were sacrificed on day 50 after tumor
challenge. Results are from a representative experiment. A) The plot represents the percentage of tumor-free mice during the
50 days after the challenge. B) The histogram represents the main weight ± SD of the tumors developed in sacrificed animals
in the different vaccination conditions. The p is in respect to the control animals (Nb-PVX-wt).
194 R. FRANCONI ET AL.

80

Without
............ peptide
IFN - gamma ELISPOT Numbers/2x105 Splenocytes

..With
peptide
60
RAHYNIVTF
5

40

20

0
Nb-PVX- wt Nb-PVX-E7 Nb-PVX- Nb-PVX-E7 Nb-PVX-
PGIPss-E7 PGIPss-E7

mice with tumor mice without tumor

Fig. 4. ELISPOT analysis of splenocytes from vaccinated mice. Splenocytes were recovered from the sacrificed mice
vaccinated with the indicated vaccine preparations. The splenocytes from mice vaccinated with the same preparation
were pooled in two pools according to the presence or absence of tumor, respectively. The presence of IFN-γ producing
E7 specific T-cell precursors was determined using an anti-IFN-γ antibody. The number of spots is expressed as a mean
per 2X105 splenocytes. Open and solid columns refer to un-stimulated and stimulated cells with specific CTL E7 peptide,
respectively. Results are from a representative experiment and each bar represents a mean of triplicate points ± SD. The
p value of Nb-PVX-E7 and Nb-PVX-PGIPss-E7 samples in respect to the control (Nb-PVX-wt) is <0.0001. The
difference in the number of spots between Nb-PVX-E7 and Nb-PVX-PGIPss-E7 samples is significant, p<0.0005.

compartment and in the apoplast of N. benthamiana
by using the PGIPss plant-derived signal sequence is
feasible. The expression of E7 protein was five-fold
higher (15 µg/g of leaves) in plants infected with the
pPVX-PGIPss-E7 construct than in plants infected
with the cytoplasmic construct pPVX-E7 (about 3
µg/g of leaves). This result may be related to a positive
effect on protein stability. The E7 protein seems to
accumulate in the secretory system and is secreted into
the apoplast: in fact the protein is present in soluble
form also in the intercellular fluids, confirming the
targeting to the secretory pathway. This offers a natural
way to pre-concentrate the E7 protein, making
purification steps much easier, and gives the rationale
for the construction of transgenic plants for
‘phytosecretion’ or ‘rhizosecretion’ of the E7 protein.
The plant-derived E7-based vaccine as an ‘in
planta formulation’ without adjuvants is able to
elicit a protective Th1 cell response in mice. Strong
cell-mediated immune response was detected in the
immunized mice that were tumor-free, whereas this
response was hardly detectable in the immunized
 Int. J. Immunopathol. Pharmacol.
mice that had developed tumors. Nevertheless, in
these mice the tumor burden was consistently lower
than in the controls immunized with extract
containing the PVX wild type. This result may be a
consequence of the specific activation of cells
(innate immunity?) other than CTL that may account
for the partial control of tumor growth. It was
reported that an effective immunotherapy of tumor
can be achieved by enhancement of either innate or
adaptive immunity, and seems to be optimal when
both are elicited (36).
Mice immunized with the plant extract
containing a higher amount of E7 protein, showed an
increased immune response and a more efficacious
tumor protection. It is noteworthy that this secretory
version of the vaccine still retains the intrinsic
adjuvant-like effect of the crude plant extract that we
already reported (18). Similar adjuvant-like
activities were also detected with other antigens. A
tumor idiotype-specific scFv epitope from a mouse
B cell lymphoma was produced at high levels in N.
benthamiana by a modified TMV vector and the
extracts were utilized as a therapeutic lymphoma
vaccine in s.c. immunization. Interestingly, mice that
received the scFv alone, without adjuvant, showed a
high degree of protection, statistically equivalent to
that showed by mice immunized with the scFv plus
the QS-21 adjuvant (29), indicating that either the
proper conformation or some other unknown factor
provided by the plant-expression system, improved
the efficacy of the immunogen. The same adjuvant-
like effect was evident when human scFvs (cloned
from tumor biopsy cells) were tested in mice for
appropriate anti-idiotype response (30). These plant-
produced scFvs are currently undergoing phase I
clinical trials. A colorectal cancer antibody (31) and
a colorectal cancer antigen (32) have also been
produced in N. benthamiana plants by a TMV–based
vector and this purified plant-derived tumor antigen
was able to stimulate T cells, also indicating the
presence of some adjuvant-like effect.
Targeting of the E7 protein to the secretory
pathway enhances the protein production in plant
and improves the immunotherapeutic activity of the
E7-containing plant extract. We believe that a
further enhancement of this anti-tumor immunity
can be achieved by combination of E7- containing
extract with immuno-stimulatory gene(s) and/or by
195
application of heterologous boost.
Moreover, the obtainment of freeze-dried N.
benthamiana leaf tissues containing high amounts
of the HPV16 E7 antigen, stable for at least one
year at RT, represents a further improvement to
obtain highly concentrated extracts and opens the
way to the use of these plant extracts in oral
immunization. We used freeze-dried N.
benthamiana leaves, mixed with feedstuff, in the
mouse model above described. No toxicity of the
dried crude extracts was observed and higher levels
of anti-E7 antibodies were induced when this plant-
based vaccine was used as part of a prime-boost
vaccination schedule, demonstrating the feasibility
of such approach (Franconi et al., unpublished).
This work represents a significant step toward the
formulation of an anti- HPV-associated cancer
vaccine with features of efficacy, temperature-
stability, ease administration in a poor resource setting
and amenability for a large-scale manufacturing.
ACKNOWLEDGEMENTS
This work was supported by grants from the
Italian Ministry of Health (project R.F. 02/146
‘Strategie di Immunoterapia contro genotipi di HPV
oncogeni e non oncogeni’), Compagnia di San Paolo
(Turin), AIRC, and National AIDS Program. 2004-
2005 (Project C.G. “Control of AIDS associated
pathologies: development of new strategies for the
therapy of HPV infection”).
We thank Mrs. S. Tocchio for editorial assistance.
REFERENCES
1. Zur Hausen H. 2002. Papillomaviruses and cancer:
from basic studies to clinical application. Nature
Rev. Cancer 2:342.
2. Parkin D.M., F. Bray, J. Ferlay and P. Pisani.
2001. Estimating the world cancer burden: Globocan
2000. Int. J. Cancer 94:153.
3. Tindle W.R. 2002. Immune evasion in human
papillomavirus-associated cervical cancer. Nature
Rev. Cancer 2:1.
4. Koutsky L.A., K.A. Ault, C.M. Wheeler, D.R.
Brown, E. Barr, F.B. Alvarez, L.M. Chiacchierini
and K.U. Jansen. 2002. A controlled trial of a
196 R. FRANCONI ET AL.
human papillomavirus type 16 vaccine. N. Engl. J.
Med. 347:1645.
5. Brinkman J.A., A.S. Caffrey, L.I. Muderspach,
L.D. Roman and W.M. Kast. 2005. The impact of
anti HPV vaccination on cervical cancer incidence and
HPV induced cervical lesions: consequences for
clinical management. Eur. J. Gynaecol. Oncol. 26:129.
6. Kadish A.S. and M.H. Einstein. 2005. Vaccine
strategies for human papillomavirus-associated
cancers. Curr. Opin. Oncol. 17:456.
7. Reinstein E., M. Scheffner, M. Oren, A. Ciechanover
and A. Schwartz. 2000. Degradation of the E7 human
papillomavirus oncoprotein by the ubiquitin-
proteasome system: targeting via ubiquitination of the
N-terminal residue. Oncogene 19:5944.
8. Fernando G.J.P., B. Murray, J. Zhou and I.H.
Frazer. 1999. Expression, purification and
immunological characterization of the transforming
protein E7, from cervical cancer-associated human
papillomavirus type 16. Clin. Exp. Immunol. 115:397.
9. Frazer I.H. 2004. Prevention of cervical cancer
through papillomavirus vaccination. Nat. Rev.
Immunol. 4:46.
10. Biemelt S., U. Sonnewald, P. Galmbacher, L.
Willmitzer and M. Muller. 2003. Production of
Human Papillomavirus Type 16 Virus-Like Particles
in Transgenic Plants. J. Virol. 77:9211.
11. Varsani A., A.L. Williamson, R.C. Rose, M. Jaffer,
and E.P. Rybicki. 2003. Expression of Human
papillomavirus type 16 major capsid protein in
transgenic Nicotiana tabacum cv. Xanthi. Arch.
Virol. 148:1771.
12. Warzecha H., H.S. Mason, C. Lane, C.
Tryggvesson, E. Rybicki, AL. Williamson, J.D.
Clements and R.C. Rose. 2003. Oral
immunogenicity of human papillomavirus-like
particles expressed in potato. J. Virol. 77:8702.
13. Tacket C.O., H.S. Mason, G. Losonsky, J.D.
Clements, M.M. Levine and C.J. Arntzen. 1998.
Immunogenicity in humans of a recombinant
bacterial-antigen delivered in transgenic potato. Nat.
Med. 4:607.
14. Tacket C.O., H.S. Mason, G. Losonsky, M.K. Estes,
M.M. Levine and C.J. Arntzen. 2000. Human
immune responses to a novel Norwalk virus vaccine
delivered in transgenic potato. J. Infect. Dis. 182:302.
15. Thanavala Y., M. Mahoney, S. Pal, A. Scott, L.
Richter, N. Natarajan, P. Goodwin, C.J. Arntzen
and H.S. Mason. 2005. Immunogenicity in humans
of an edible vaccine for hepatitis B. Proc. Natl.
Acad. Sci. U S A. 102:3378.
16. Tacket C.O., M.F. Pasetti, R. Edelman, J.A.
Howard and S. Streatfield. 2004. Immunogenicity
of recombinant LT-B delivered orally to humans in
transgenic corn. Vaccine 22:4385.
17. Canizares M.C., L. Nicholson, and G.P.
Lomonossoff. 2005. Use of viral vectors for vaccine
production in plants. Immunol. Cell Biol. 83:263.
18. Franconi R., P. Di Bonito, F. Dibello, L. Accardi,
A. Muller, A. Birilli, P. Simeone, G. Donà, A.
Venuti and C. Giorgi. 2002. Plant-derived human
papillomavirus 16 E7 oncoprotein induces immune
response and specific tumor protection. Cancer
Research 62:3654.
19. Toubart P., A. Desiderio, G. Salvi, F. Cervone, L.
Daroda, G. De Lorenzo, C. Bergmann, A.G.
Darvill and P. Albersheim. 1992. Cloning and
characterisation of the gene encoding the
endopolygalacturonase-inhibiting protein (PGIP) of
Phaseoulus vulgaris L. Plant J. 2:367.
20. Franconi R, P. Roggero, P. Pirazzi, F.J. Arias, A.
Desiderio, O. Bitti, D. Pashkoulov, B. Mattei, L.
Bracci, V. Masenga, R.G. Milne and Benvenuto E.
1999. Functional expression in bacteria and in plants
of a scFv antibody fragment against tospoviruses.
Immunotechnology 4:189.
21. Di Lonardo A., M.L. Marcante, F. Poggiali and A.
Venuti. 1998. HPV16 E7 antibody levels in cervical
cancer patients: before and after treatment. J. Med.
Virol. 54:192.
22. Miyahira Y., K. Murata, D. Rodriguez, J.R.
Rodriguez, M. Esteban, M.M. Rodrigues and F.
Zavala. 1995. Quantification of antigen specific
CD8+ T cells using an ELISPOT assay. J. Immunol
Methods. 181:45.
23. Feltkamp M.C., H.L. Smits, M.P. Vierboom, R.P.
Minnaar, B.M. de Jongh, J.W. Drijfhout, J. ter
Schegget, C.J. Melief and W.M. Kast. 1993.
Vaccination with cytotoxic T lymphocyte epitope-
containing peptide protects against a tumor induced
 Int. J. Immunopathol. Pharmacol.
by human papillomavirus type 16-transformed cells.
Eur J. Immunol. 23:2242.
24. Awram P., R.C. Gardner, R.L. Forster and A.R.
Bellamy. 2002. The potential of plant viral vectors
and transgenic plants for subunit vaccine production.
Adv. Virus Res. 58: 81.
25. Chapman S., T. Kavanagh and D. Baulcombe
1992. Potato virus X as a vector for gene expression
in plants. Plant J. 2:549.
26. Pijpers F., R. Faint and N. Saini. 2005. Therapeutic
cancer vaccines. Nat. Rev. Drug Discov. 4:623.
27. Twyman R.M., E. Stoger, S. Schillberg, P.
Christou and R. Fischer. 2003. Molecular farming
in plants: host systems and expression technology.
Trends Biotechnol. 21:570.
28. Fischer R., E. Stoger, S. Schillberg, P. Christou and
R.M. Twyman. 2004. Plant-based production of
biopharmaceuticals. Curr. Opin. Plant Biol. 7:152.
29. McCormick A.A., M.H. Kumagai, K. Hanley,
T.H. Turpen, I. Hakim, L.K. Grill, D. Tusè, S.
Levy and R. Levy. 1999. Rapid production of
specific vaccines for lymphoma by expression of the
tumor-derived single-chain Fv epitopes in tobacco
plants. Proc. Natl. Acad. Sci. 96:703.
30. McCormick A.A., S.J. Reinl, T.I. Cameron,
F.Vojdani, M. Fronefield, R. Levy and D. Tusè.
2003. Individualized human scFv vaccines produced
in plants: humoral anti-idiotype responses in
197
vaccinated mice confirm relevance to the tumor Ig.
J. Immunol. Methods 278:95.
31. Verch T., V. Yusibov and H. Koprowski. 1998.
Expression and assembly of a full-length
monoclonal antibody in plants using a plant-virus
vector. J. Immunol. Meth. 220:69.
32. Verch T., D.C. Hooper, A. Kiyatkin, Z. Steplewski
and H. Koprowski. 2004. Immunization with a
plant-produced colorectal cancer antigen. Cancer
Immunol. Immunother. 53:92.
33. Fernando G.J., T.J. Stewart, R.W. Tindle and I.H.
Frazer. 1998. Vaccine-induced Th1-type responses are
dominant over Th2-type responses in the short term
whereas pre-existing Th2 responses are dominant in
the longer term. Scand. J. Immunol. 47:459.
34. Schillberg S., S. Zimmermann, A. Voss and R.
Fischer. 1999. Apoplastic and cytosolic expression
of full-size antibodies and antibody fragments in
Nicotiana tabacum. Transgenic Res. 8:255.
35. Roggero P., M. Ciuffo, E. Benvenuto and R.
Franconi. 2001. The expression of a single-chain Fv
antibody fragment in different plant hosts and tissues
by using potato virus X as a vector. Protein Expres.
Purif. 22:70.
36. Stewart T.J., M.J. Smyth, G.J. Fernando, I.H.
Frazer and G.R. Leggatt. 2003. Inhibition of early
tumor growth requires Jα18-positive (natural killer
T) cells. Cancer Res. 63:3058.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 5-9 (2006)

REVIEW ARTICLE
FIBROMYALGIA - NEW CONCEPTS OF PATHOGENESIS AND TREATMENT

H.J. LUCAS, C.M. BRAUCH1, L. SETTAS2 and T.C. THEOHARIDES3

Special Clinic for FMS and CFS, Trier, Germany; 1The Feller Pharmacy, Fell, Germany;
2
Department of Rheumatology, Aristotle University of Thessaloniki, AHEPA Hospital, Thessaloniki,
Greece; 3Departments of Pharmacology and Experimental Therapeutics, Internal Medicine and
Biochemistry, Tufts University School of Medicine, Tufts-New England Medical Center, USA

Received November 29, 2005 – Accepted January 11, 2006

Fibromyalgia (FMS) is a debilitating disorder characterized by chronic diffuse muscle pain, fatigue,
sleep disturbance, depression and skin sensitivity. There are no genetic or biochemical markers and
patients often present with other comorbid diseases, such as migraines, interstitial cystitis and irritable
bowel syndrome. Diagnosis includes the presence of 11/18 trigger points, but many patients with early
symptoms might not fit this definition. Pathogenesis is still unknown, but there has been evidence of
increased corticotropin-releasing hormone (CRH) and substance P (SP) in the CSF of FMS patients, as well
as increased SP, IL-6 and IL-8 in their serum. Increased numbers of activated mast cells were also noted
in skin biopsies. The hypothesis is put forward that FMS is a neuro-immunoendocrine disorder where
increased release of CRH and SP from neurons in specific muscle sites triggers local mast cells to release
proinflammatory and neurosensitizing molecules. There is no curative treatment although low doses of
tricyclic antidepressants and the serotonin-3 receptor antagonist tropisetron, are helpful. Recent
nutraceutical formulations containing the natural anti-inflammatory and mast cell inhibitory flavonoid
quercetin hold promise since they can be used together with other treatment modalities

Fibromyalgia (FMS) is a disorder characterized by The most common presenting symptom is

chronic diffuse muscle pain all over the body. Other
associated symptoms include fatigue, as well as sleep,
cognitive and emotional disturbances, leading to high
disability and poor quality of life. Fibromyalgia occurs
in about 3-13% of the population depending on the
definition used and the population studied; it is more
common in middle-age, especially in females (8:2).
Other comorbid diseases include allergic reactions,
chronic fatigue syndrome, migraines, interstitial
cystitis (IC) and irritable bowel syndrome (IBS). About
30% of patients suffer also from depression or anxiety.
generalized muscle pain of gradual onset, often
following illness or an operation. FMS may also
present with chronic fatigue and it is mostly a
diagnosis of exclusion (1). FMS can be confirmed in
about 80% of patients. The Fibromyalgia Impact
Questionnaire (FIQ) was developed at Oregon
University (www.myalgia.com/FIQ/FIQ) (2). The
“FibroFatigue” scale was developed to monitor
symptoms during treatment (3). The criteria
established by the American College of
Rheumatology in 1990 require that widespread pain

Key words: corticotropin-releasing hormone, IL-6, IL-8, mast cells, quercetin

Mailing address:
T. C. Theoharides, Ph.D., M.D.
Department of Pharmacology and Experimental Therapeutics
Tufts University School of Medicine - 136 Harrison Avenue 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Boston, MA 02111, USA This publication and/or article is for individual use only and may not be further
Tel: (617) 636-6866 - Fax: (617) 636-2456 reproduced without written permission from the copyright holder.
E-mail: theoharis.theoharides@tufts.edu
5 Unauthorized reproduction may results in financial and other penalties
6 H.J. LUCAS ET AL.

Stress CRH, mast cells, SP and fibromyalgia

Mast cell

IL-6, IL-8, TNF

Blood
CRH CRH, vessel
Pituitary: ACTH SP
MUSCLE

HPA axis
Sensory
nerve

PROINFLAMMATORY
Adrenal LOCAL EFFECTS

Glucocorticoids Catecholamines

SYSTEMIC EFFECTS
ANTI-INFLAMMATORY FIBROMYALGIA

Fig. 1. The role of CRH, mast cells and SP in the pathogenesis of fibromyalgia. Local release of CRH and SP from nerve
endings activates mast cells to release proinflammatory and neurosensitizing molecules, such as IL-6, IL-8 and TNF. These
molecules could then further stimulate CRH release.

must be present in all four quadrants of the body, as
well as the axial skeleton, together with 11/18 tender
points (4). Recent studies have challenged the need for
11/18 tender points, especially in newly diagnosed
patients, who may constitute as many as 60% of FMS
patients. There may also be a continuum of tender
point presentation, as the symptoms worsen over time
in untreated patients. “Tender” points have to be
differentiated from “trigger” points characterizing
myofascial pain syndrome (5). FMS patients appear to
have a generalized low pain threshold to a variety of
stimuli. It is interesting that many FMS patients also
complain of skin “sensitivity” without any evidence of
skin erythema or the indication of atopic dermatitis.
It is quite intriguing that many FMS patients
describe symptom onset after some psychological or
inflammatory stressor (4). FMS is may not a distinct
clinical entity (6); there may be at least one
subgroup of patients in which stress factors were the
most predictive indicator of pain (7). A recent FM
workshop tried to identify outcome measures and
research objectives (8). Nevertheless, it is beneficial
for patients to identify with a specific medical entity
because it allows them to feel accepted and
empowers them to seek treatment. Whether FMS is
a distinct entity or not, it represents a significant
burden for the health care system and requires better
information for both physicians and patients.
Pathogenesis
Family proband studies have not produced any
evidence of genetic factors (9). There is no precise
pathogenesis at present. Some evidence indicates
that there are common risk factors between FMS and
psychiatric disorders. Most recent publications
indicate that there is some abnormality with the
hypothalamic-pituitary-adrenal (HPA) axis, with
elevated activity of corticotropin-releasing-hormone
(CRH) and substance P (SP) (10) that may not only
affect the PHA axis, but other endocrine and
immune processes (11).
 Int. J. Immunopathol. Pharmacol.
In view of this finding and the observation that
FMS symptoms commonly occur after a psychological
or inflammatory stressor, FMS may be another
inflammatory disorder exacerbated by stress (12). For
instance, pain perception appeared to be enhanced by
the concurrent presence of stressful events (13), and
repeated sound stress was shown to increase
inflammatory hyperalgesia in rats (14). One study
showed an inverse relationship between serum levels
of the serotonin metabolite 5-hydroxyin dolacetic acid
(5-HIAA) and low pain scores, as well as with serum
SP and sleep disturbances (15).
Other recent publications have reported elevated
levels of cytokines in the serum of FMS patients (16). In
one study, serum IL-1 and IL-6 levels were not different
from controls but IL-8 was significantly elevated (17).
Nevertheless, IL-6 was elevated in the supernatants from
peripheral blood mononuclear cells from FMS patients
(18). Moreover, injection of IL-6 produced excessive
heart rate responses in FMS patients (19). Interestingly,
young FMS patients with milder symptoms had
significantly increased serum IL-8 levels (20).
These findings are of particular interest as mast
cells have been proposed as the target of CRH
outside the brain, leading to enhanced
inflammatory processes that could contribute to
pain (21). In fact, it was recently shown that
human mast cells express functional CRH
receptors, and CRH can induce selective release of
vascular endothelial growth factor (VEGF), which
could enhance inflammation (22). Once
inflammation occurs, IL-1 could then stimulate
mast cells to release IL-6 selectively (23). In other
words, mast cells do not have to degranulate as is
customarily seen in allergic reactions and their
activation could, therefore, be missed in routine
pathology of biopsies from FMS patients.
Increased activated mast cells have been reported
in association with IgG deposits in skin biopsies
from FMS patients (24).
This hypothesis (Fig. 1) could also explain the
skin sensitivity present in many FMS patients. For
instance, skin biopsies from FMS patients had
high IL-6 expression by RT-PCR (25) and
trapezius muscle biopsies had more SP
immunoreactivity (26). CRH content (27) and
vascular permeability (28) increased in the skin or
rats in response to stress, a process mimicked by
7
intradermal administration of CRH (29). CRH
could be acting together with SP or other
neurokinin-1 receptor agonists (30).
Treatment
There is neither effective nor standardized
treatment for FMS (31). Low doses of tricyclic
antidepressants, along with nonsteroidal anti-
inflammatory drugs or tramadol, constitute the main
therapeutic approach (32). Sublingual
administration of interferon-alpha is reported to
have considerable benefit (33). Recent studies
indicate that local injection of the serotonin-3
receptor antagonist tropisetron could have analgesic
effects in FMS (34). However, intravenous
tropisetron appeared to help only 50% of FMS
patient “responders” and in these treatments,
significantly reduced serum SP (35). In general, the
results are inconsistent and a number of adverse
effects have been reported (36). The best approach
would be a combination of pharmacologic treatment
with behavioral and physical therapy (37).
Recent evidence indicates that a formulation
containing the naturally occurring flavonoid
quercetin could have considerable benefit in neuro-
inflammatory conditions, such as FMS (38).
Flavonoids have strong anti-inflammatory and
cytoprotective actions (39) and are particularly
potent inhibitors of cytokine release from human
mast cells (40). One particular formulation
(www.algonot.com, www.algonot.de) (Algonot-
plus®) contains quercetin with chondroitin sulfate
that was shown to also inhibit mast cell secretion
(41) in a formulation with olive kernel extract that
increases absorption of the active ingredients (42).
Future research should focus on CRH-mast cell
interactions and CRH receptor expression in skin or
muscle biopsies from FMS patients. Clinical studies
could use CRH receptor antagonists (21) or mast cell
activation inhibitors, such as Algonot-plus®.
ACKNOWLEDGEMENTS
Aspects of this work were supported by Theta
Biomedical Consulting and Development Co., Inc.
(Brookline, MA). We thank Ms. Jessica Christian
for her word processing skills.
8 H.J. LUCAS ET AL.
REFERENCES
1. Bates D.W., W. Schmitt, D. Buchwald, N.C. Ware,
J. Lee, E. Thoyer, R.J. Kornish and A.L.
Komaroff. 1993. Prevalence of fatigue and chronic
fatigue syndrome in a primary care practice. Arch.
Intern. Med. 153:2759.
2. Bennett R. 2005. The Fibromyalgia Impact
Questionnaire (FIQ): a review of its development,
current version, operating characteristics and uses.
Clin. Exp. Rheumatol. 23:(S):154.
3. Zachrisson O., B. Regland, M. Jahreskog, M.
Kron and C.G. Gottfries. 2002. A rating scale for
fibromyalgia and chronic fatigue syndrome (the
FibroFatigue scale). J. Psychosom. Res. 52:501.
4. Bennett R. 2004. Fibromyalgia: present to future.
Curr. Pain Headache Rep. 8:379.
5. Pongratz D.E. and M. Sievers. 2000.
Fibromyalgia-symptom or diagnosis: a definition of
the position. Scand. J. Rheumatol. 113(S):3.
6. Rau C.L. and I.J. Russell. 2000. Is fibromyalgia a
distinct clinical syndrome? Curr. Rev. Pain 4:287.
7. Thieme K., C. Spies, P. Sinha, D.C. Turk and H.
Flor. 2005. Predictors of pain behaviors in
fibromyalgia syndrome. Arthritis Rheum. 53:343.
8. Mease P.J., D.J. Clauw, L.M. Arnold, D.L.
Goldenberg, J. Witter, D.A. Williams, L.S. Simon,
C.V. Strand, C. Bramson, S. Martin, T.M.
Wright, B. Littman, J.F. Wernicke, R.M.
Gendreau and L.J. Crofford. 2005. Fibromyalgia
syndrome. J. Rheumatol. 32:2270.
9. Arnold L.M., J.I. Hudson, E.V. Hess, A.E. Ware,
D.A. Fritz, M.B. Auchenbach, L.O. Starck and
P.E. Keck, Jr. 2004. Family study of fibromyalgia.
Arthritis Rheum. 50:944.
10. Mease P. 2005. Fibromyalgia syndrome: review of
clinical presentation, pathogenesis, outcome
measures, and treatment. J. Rheumatol. 75(S):6.
11. Neeck G. 2002. Pathogenic mechanisms of
fibromyalgia. Ageing Res. Rev. 1:243.
12. Theoharides T.C. and D.E. Cochrane. 2004. Critical
role of mast cells in inflammatory diseases and the
effect of acute stress. J. Neuroimmunol. 146:1.
13. Van H.B. and U.T. Egle. 2004. Fibromyalgia: a
stress disorder? Piecing the biopsychosocial puzzle
together. Psychother. Psychosom. 73:267.
14. Khasar S.G., P.G. Green and J.D. Levine. 2005.
Repeated sound stress enhances inflammatory pain
in the rat. Pain 116:79.
15. Schwarz M.J., M. Spath, H. Muller-Bardorff,
D.E. Pongratz, B. Bondy and M. Ackenheil. 1999.
Relationship of substance P, 5-hydroxyindole acetic
acid and tryptophan in serum of fibromyalgia
patients. Neurosci. Lett. 259:196.
16. Mullington J.M., D. Hinze-Selch and T.
Pollmacher. 2001. Mediators of inflammation and
their interaction with sleep: relevance for chronic
fatigue syndrome and related conditions. Ann. N.Y.
Acad. Sci. 933:201.
17. Gur A., M. Karakoc, S. Erdogan, K. Nas, R.
Cevik and A.J. Sarac. 2002. Regional cerebral
blood flow and cytokines in young females with
fibromyalgia. Clin. Exp. Rheumatol. 20:753.
18. Wallace D.J., M. Linker-Israeli, D. Hallegua, S.
Silverman, D. Silver and M.H. Weisman. 2001.
Cytokines play an aetiopathogenetic role in
fibromyalgia: a hypothesis and pilot study.
Rheumatology 40:743.
19. Torpy D.J., D.A. Papanicolaou, A.J. Lotsikas, R.L.
Wilder, G.P. Chrousos and S.R. Pillemer. 2000.
Responses of the sympathetic nervous system and the
hypothalamic-pituitary-adrenal axis to interleukin-6: a
pilot study in fibromyalgia. Arthritis Rheum. 43:872.
20. Gur A., M. Karakoc, K. Nas, Remzi, Cevik, A.
Denli and J. Sarac. 2002. Cytokines and depression
in cases with fibromyalgia. J. Rheumatol. 29:358.
21. Theoharides T.C., J.M. Donelan, N. Papadopoulou,
J. Cao, D. Kempuraj and P. Conti. 2004. Mast cells as
targets of corticotropin-releasing factor and related
peptides. Trends Pharmacol. Sci. 25:563.
22. Cao J., N. Papadopoulou, D. Kempuraj, W.S.
Boucher, K. Sugimoto, C.L. Cetrulo and T.C.
Theoharides. 2005. Human mast cells express
corticotropin-releasing hormone (CRH) receptors and
CRH leads to selective secretion of vascular endothelial
growth factor (VEGF). J. Immunol. 174:7665.
23. Kandere-Grzybowska K., R. Letourneau, W.
Boucher, J. Bery, D. Kempuraj, S. Poplawski, A.
Athanassiou and T.C. Theoharides. 2003. IL-1
induces vesicular secretion of IL-6 without degranulation
 Int. J. Immunopathol. Pharmacol.
from human mast cells. J. Immunol. 171:4830.
24. Enestrom S., A. Bengtsson and T. Frodin. 1997.
Dermal IgG deposits and increase of mast cells in
patients with fibromyalgia-relevant findings or
epiphenomena? Scand. J. Rheumat. 26:308.
25 Salemi S., J. Rethage, U. Wollina, B.A. Michel,
R.E. Gay, S. Gay and H. Sprott. 2003. Detection of
interleukin 1beta (IL-1beta), IL-6, and tumor
necrosis factor-alpha in skin of patients with
fibromyalgia. J. Rheumatol. 30:146.
26 De Stefano R., E. Selvi, M. Villanova, E. Frati, S.
Manganelli, E. Franceschini, G. Biasi and R.
Marcolongo. 2000. Image analysis quantification of
substance P immunoreactivity in the trapezius
muscle of patients with fibromyalgia and myofascial
pain syndrome. J. Rheumatol. 27:2906.
27 Lytinas M., D. Kempuraj, M. Huang, W. Boucher,
P. Esposito and T.C. Theoharides. 2003. Acute
stress results in skin corticotropin-releasing hormone
secretion, mast cell activation and vascular
permeability, an effect mimicked by intradermal
corticotropin-releasing hormone and inhibited by
histamine-1 receptor antagonists. Int. Arch. Allergy
Immunol. 130:224.
28 Singh L.K., X. Pang, N. Alexacos, R. Letourneau
and T.C. Theoharides. 1999. Acute immobilization
stress triggers skin mast cell degranulation via
corticotropin releasing hormone, neurotensin and
substance P: A link to neurogenic skin disorders.
Brain Behav. Immunity 13:225.
29. Theoharides T.C., L.K. Singh, W. Boucher, X.
Pang, R. Letourneau, E. Webster and G.
Chrousos. 1998. Corticotropin-releasing hormone
induces skin mast cell degranulation and increased
vascular permeability, a possible explanation for its
pro-inflammatory effects. Endocrinology 139:403.
30. Kandere-Grzybowska K., D. Gheorghe, J.
Priller, P. Esposito, M. Huang, N. Gerard and
T.C. Theoharides. 2003. Stress-induced dura
vascular permeability does not develop in mast
cell-deficient and neurokinin-1 receptor knockout
mice. Brain Res. 980:213.
31. Millea P.J. and R.L. Holloway. 2000. Treating
fibromyalgia. Am. Fam. Physician 62:1575.
32. Dadabhoy D. and D.J. Clauw. 2005. Fibromyalgia:
9
progress in diagnosis and treatment. Curr. Pain
Headache Rep. 9:399.
33. Russell I.J., G.A. Vipraio, J.E. Michalek, F.E.
Craig, Y.K. Kang and A.B. Richards. 1999.
Lymphocyte markers and natural killer cell activity
in fibromyalgia syndrome: effects of low-dose,
sublingual use of human interferon-alpha. J.
Interferon Cytokine Res. 19:969.
34. Muller W. and T. Stratz. 2004. Local treatment of
tendinopathies and myofascial pain syndromes with
the 5-HT3 receptor antagonist tropisetron. Scand. J.
Rheumatol. 119(S):44.
35. Stratz T., B. Fiebich, U. Haus and W. Muller.
2004. Influence of tropisetron on the serum
substance P levels in fibromyalgia patients. Scand. J.
Rheumatol. 119(S):41.
36. Spath M. 2002. Current experience with 5-HT3
receptor antagonists in fibromyalgia. Rheum. Dis.
Clin. North Am. 28:319.
37. Baker K. and A. Barkhuizen. 2005.
Pharmacologic treatment of fibromyalgia. Curr.
Pain Headache Rep. 9:301.
38. Theoharides T.C. and L. Bielory. 2004. Mast cells
and mast cell mediators as targets of dietary
supplements. Ann. Allergy Asthma Immunol. 93:S24.
39. Middleton E. Jr., C. Kandaswami and T.C.
Theoharides. 2000. The effects of plant flavonoids
on mammalian cells: implications for inflammation,
heart disease and cancer. Pharmacol. Rev. 52:673.
40. Kempuraj D., B. Madhappan, S. Christodoulou,
W. Boucher, J. Cao, N. Papadopoulou, CL.
Cetrulo and T.C. Theoharides. 2005. Flavonols
inhibit proinflammatory mediator release,
intracellular calcium ion levels and protein kinase C
theta phosphorylation in human mast cells. Br. J.
Pharmacol. 145:934.
41. Theoharides T.C., P. Patra, W. Boucher, R.
Letourneau, D. Kempuraj, G. Chiang, S. Jeudy,
L. Hesse and A. Athanasiou. 2000. Chondroitin
sulfate inhibits connective tissue mast cells. Br. J.
Pharmacol. 131:1039.
42. Theoharides T.C. 2003. Dietary supplements for
arthritis and other inflammatory conditions: key role of
mast cells and benefit of combining anti-inflammatory
and proteoglycan products. Eur. J. Inflamm. 1:1.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 199-208 (2006)

SEROLOGICAL MARKERS OF PULMONARY TUBERCULOSIS AND OF RESPONSE

TO ANTI-TUBERCULOSIS TREATMENT IN A PATIENT POPULATION IN GUINEA
A. AZZURRI, G.V. KANAUJIA1, O.Y. SOW2, B. BAH2, A. DIALLO3, G. DEL PRETE and
M.L. GENNARO1

Department of Internal Medicine, University of Florence, Italy; 1Public Health Research Institute,
Newark, NJ, USA; 2Service de Pneumo-Phtisiologie, Centre Hospitalier-Universitaire Ignace
Deen, Conakry, Republic of Guinea

Received April 4, 2005 – Accepted December 12, 2005

The aim of the study was to evaluate serological correlates of active tuberculosis and of response to
antituberculosis treatment in a cohort of HIV-negative patients with pulmonary tuberculosis studied at
diagnosis and during treatment at the Service de Pneumo-Phtisiologie, Centre Hospitalier-Universitaire
Ignace Deen, Conakry, Republic of Guinea. Two similar cohorts of HIV-negative healthy households of
patients and healthy community controls were included in the study. Plasma samples were obtained from
168 untreated tuberculosis patients, 167 healthy household controls, and 168 healthy community controls.
Serial plasma samples were also obtained from the tuberculosis patients at 2 and 8 months after initiation
of chemotherapy. IgG antibody levels were measured by an enzyme-linked immunosorbent assay (ELISA)
using ten purified M. tuberculosis antigens. ELISA results were analysed by comparing geometric means
of data. Of the ten antigens tested, five (14kDa Ag, 19kDa Ag, AlaDH, MS, and MPT83) elicited similar
antibody responses in untreated TB patients and controls. In contrast, levels of three antibodies (ESAT-6,
LAM, and 38kDa Ag) were higher in untreated TB patients than in household or community controls (p <
0.0001). Levels were higher in untreated patients than in community controls also for the anti-Rv2626c
antibody (p = 0.0001) and, at a lower significance level, for the anti-FdxA antibody (p < 0.025). Antibody
levels against ESAT-6 and Rv2626c decreased during therapy, while antibody levels to the 38 kDa antigen
and LAM increased during therapy; FdxA antibody levels did not vary with treatment. Neither severity of
presentation nor chest X-ray patterns affected levels of these antibodies before treatment. In contrast, after
the 8-month therapeutic course, patients who presented with moderate/severe disease had higher levels of
anti-ESAT-6, anti-FdxA, and anti-38kDa antibodies than those of patients with mild disease onset. Patients
with bilateral lung lesions had significantly higher anti-38kDa and anti-LAM levels, both at diagnosis and
after 8-month treatment, than patients with lesions involving only one lung. Antibodies to alanine
dehydrogenase and malate synthetase measured at initiation of treatment were higher in tuberculosis
patients who subsequently failed therapy than in those who were cured. The main conclusions of the study
are: a) plasma levels of antibodies to a number of M. tuberculosis represent serological correlates of active
disease; b) these correlates are affected in an antigen-specific fashion by anti-tuberculosis treatment; c)
particular serological markers may be predictive of treatment outcome.

Key words: antibody detection assay, purified antigens, Mycobacterium tuberculosis, West Africa, serology

Mailing address:
Prof. Gianfranco Del Prete
Dept. Internal medicine,
University of Florence
Viale Morgagni 85 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
50134 Florence, Italy This publication and/or article is for individual use only and may not be further
Tel./Fax: +390554378103 reproduced without written permission from the copyright holder.
E-mail: gdelprete@unifi.it 199 Unauthorized reproduction may results in financial and other penalties
200 A. AZZURRI ET AL.
The global burden of tuberculosis (TB) amounts to
more than 8 million new cases of disease and almost 2
million deaths per year, 98% of which occur in low-
income countries (1; http://www.who.int/gtb). A pillar
of TB control strategies worldwide is the detection of
infectious cases, followed by treatment and decreased
transmission of infection to contacts. However,
treatment fails at measurable rates (up to ~ 20%) even
in patients infected with drug-sensitive tubercle bacilli
(2). Both diagnosis of active disease and assessment of
treatment outcome are most commonly based on
finding acid-fast bacilli (AFB) in sputum smears. AFB
microscopy is usually the only diagnostic tool
available in the low-technology settings of the
developing world. Its usefulness for TB diagnosis,
however, is often impaired by the low sensitivity of
this assay in many settings (3-4). As for markers of
treatment outcome, sputum smear conversion after
two months of chemotherapy is currently the most
widely used method to monitor the efficacy of
antimycobacterial chemotherapy (5). However, it is
not accurate (6). Due to these limitations, novel
diagnostic tools need to be developed.
Despite a great deal of effort, accurate
serodiagnosis of TB has proven elusive (4, 7-8). The
varied antibody profiles detected in TB patients
require the use of multi-antigen-based assays which
poses a challenge to assay specificity (9). Moreover,
it has been proposed that antibody profiles vary with
infection stage (10), presumably reflecting antigen
changes in the pathogen over the course of infection
(11). Antibody profiles may also change during
treatment, because the antigen composition of
Mycobacterium tuberculosis may evolve in relation
to disease progression (12-13). Thus there is a need
to further characterize antigen-specific antibody
responses in TB patients prior to and during anti-TB
treatment by using criteria for antigen selection
based on antigen production by tubercle bacilli
during the various phases of disease (11, 14).
The aim of the present study was to evaluate
serological correlates of TB in HIV-negative patients
with pulmonary TB at the time of diagnosis and to
evaluate the effect of anti-TB treatment on such
correlates. The study included antigens produced by
tubercle bacilli at various stages of growth. We
identified a set of antigens that distinguishes active
TB cases from healthy controls in the study
population, and we detected upward and downward
fluctuations in plasma levels of particular specific
antibodies caused by anti-TB treatment.
MATERIALS AND METHODS
Newly diagnosed, smear-positive pulmonary TB
patients older than 15 years of age were recruited after
giving informed consent in the context of a study on
environmental and host-related risk factors for TB in West
Africa (15). Pulmonary TB was defined by the presence of
acid-fast bacilli in 2 consecutive sputum samples, or by one
positive sputum confirmed by positive culture. Chest X-rays
and tuberculin skin tests were performed at enrolment.
Patients and controls gave informed consent for HIV
testing; individuals positive for HIV1 and/or HIV2 were
appropriately counselled and/or treated and excluded from
the study. Directly observed therapy of TB patients included
a regimen of rifampin, isoniazid, pyrazinamide and
ethambutol during the first 2 months, followed by rifampin
and isoniazid for another 6 months, as per guidelines by the
WHO and the National TB control program. At the end of
treatment, cure was assessed by clinical examination
(disappearance of symptoms, weight gain) and the
conversion of sputum smears to negative. Cases of
treatment failure, as indicated by persistence of symptoms,
clinical and chest X-ray evidence of disease and positive
sputum smears, were re-treated according to national TB
control program recommendations.
For each patient enrolled, two control subjects were
recruited: one healthy control person who was age-
matched within 10 years with the TB patient was selected
at random within the household of the patient (household
control), and a second control, similarly age-matched,
was recruited at random in the local community
(community control) (Table I). After baseline sampling,
household controls underwent a 2-year follow-up to
identify possible onset of TB. The study was approved by
the Ethical Committee of the Centre Hospitalier-
Universitaire Ignace Deen, Conakry, Republic of Guinea.
Peripheral blood was collected from all study
participants diagnosed with pulmonary TB within 2
weeks of diagnosis (time 0), after 2 months (month 2) and
at the end of treatment (month 8). Peripheral blood was
also collected from household and community controls.
Samples were identified with accession numbers that did
not reveal the identity of the study subject.
Nine proteins and one non-protein antigen of M.
tuberculosis were used as coating antigens in ELISA.
ESAT-6 (16), 38kDa lipoprotein (38 kDa Ag) (17), 19kDa
lipoprotein (19 kDa Ag) (18), alanine dehydrogenase
(AlaDH) (19), and malate synthase (MS) (20) are proteins
 Int. J. Immunopathol. Pharmacol.
found in the extracellular compartment of M. tuberculosis in
culture (21). The 14kDa Ag, ferredoxin A (FdxA), Rv2626c
and MPT-83 are cell-associated antigens. The 14kDa Ag,
also known as 16kDa Ag or α-crystallin, is a chaperonin
whose production increases during stationary phase growth
and in response to low oxygen or to Th1-mediated adaptive
immunity (22-24). Like the 14kDa Ag, FdxA and Rv2626c
are encoded by genes in the hypoxia-responsive dosR
regulon and are expressed at levels comparable to those of
the 14kDa protein (24 and unpublished results).
Ferredoxins, such as FdxA, are iron-sulphur proteins that
act as multifunctional electron carriers. The function of the
Rv2626c gene product is unknown. MPT-83 is a
membrane-associated glycoprotein (25). Finally,
lipoarabinomannan (LAM), which is found in the
mycobacterial cell wall, was the only non-protein antigen of
the panel (26). AlaDH and MS are enzymes associated with
metabolic activities predominant in non-replicating bacilli
(14, 27). The 38kDa Ag, MPT-83, and ESAT-6 are M.
tuberculosis complex-specific antigens.
Proteins of M. tuberculosis were expressed as
recombinant, polyhistidine-tagged fusion products in
Escherichia coli and they were purified to near-homogeneity
by sequential chromatography as described earlier (28).
LAM of M. tuberculosis H37Rv was obtained from Colorado
State University (contract no. NIH NIAID N01 AI-75320).
Enzyme-Linked Immunosorbent Assays (ELISA) were
used to measure serum IgG antibodies against ten purified
M. tuberculosis antigens following published protocols
(10). Briefly, polystyrene 96-well microtiter plates were
coated overnight at 4°C with purified protein at 1 µg/ml in
0.1 M carbonate-bicarbonate buffer (pH 9.6). Prior to use,
antigen-coated plates were washed extensively with 0.1 M
phosphate-buffered saline (pH 7.4) containing 0.05%
Tween 20 (PBS-T). Serum samples were diluted 1:100 in
PBS-T and added in duplicate to wells coated with each
protein. Plates were incubated for 1 h at room temperature
and then washed extensively with PBS-T. Bound antibodies
were detected by incubation with mouse monoclonal anti-
human IgG-alkaline phosphatase conjugate (Sigma) at a
dilution 1:2,000 in PBS-T for 1 h at room temperature.
After plates were extensively washed with PBS-T, 100 µl
of substrate solution (p-nitrophenylphosphate; Bio-Rad)
was added to each well. Plates were incubated for
another 20 min at room temperature, and color
development was stopped by addition of 100 µl of 0.4
M NaOH per well. Optical density at 450 nm (OD450)
was measured with an automatic microplate reader.
Geometric means of OD450 results and 95% confidence
intervals (CI) were calculated for each study group. In TB
patients values from samples obtained during and at the end
of treatment were compared with their baseline (time 0)
values using a paired t test. The effect of treatment and
201
other variables on the parameters before and at the end of
treatment was assessed using linear regression analysis,
adjusted for baseline values with Stata 8.0 software.
RESULTS
Plasma samples from 168 untreated TB patients, 167
matched healthy household controls, and 168 healthy
community controls were tested for the presence of IgG
antibodies to ten M. tuberculosis antigens. The
correlation between antibody levels and TB disease status
was analysed by comparing geometric means of OD450
values obtained in ELISA. For five antibodies (14kDa Ag,
19kDa Ag, AlaDH, MS, and MPT83) no differences were
detected between untreated TB patients and both household
and community controls (data not shown). In contrast, levels
of three antibodies (ESAT-6, LAM, and 38kDa Ag) were
higher in untreated TB patients than in both control groups
(Figure 1, top half) (p < 0.0001 for the anti-ESAT-6 and anti-
LAM antibody comparisons between untreated TB patients
and both control groups, and for the anti-38kDa antibody
comparison between untreated patients and community
controls; p = 0.0006 for the anti-38kDa antibody comparison
between untreated patients and household controls). Levels
were higher in untreated patients than in community controls
also for the anti-Rv2626c antibody (p = 0.0001) and, at a
lower significance level, for the anti-FdxA antibody (p <
0.025) (Fig. 1, bottom half). The comparison between
untreated patients and household controls was statistically
significant at p < 0.025 for the anti-Rv2626c antibody and
was not significant for the anti-FdxA antibody. Thus, the five
antibodies distinguished between TB patients and one control
group (anti-Rv2626c and anti-FdxA antibodies) or both (anti-
ESAT-6, anti-LAM and anti-38kDa antibodies). Multivariate
analysis was conducted to assess potential confounding
factors, such as age, gender, ethnic group, presence of a BCG
scar, response to tuberculin skin test or concomitant helminth
infection. None of these factors significantly affected levels
of the antibodies examined (data not shown).
The effect of treatment on antibody levels in TB patients
was then investigated. Antibody levels to the five antigens
shown in Fig. 1 were measured for all 168 patients at the end
of treatment (usually 8 months after diagnosis). In 133
patients an additional sample was also obtained at month 2 of
treatment which corresponds with the end of the intensive
phase of treatment. Four antibodies were affected by
treatment: anti-ESAT-6 and anti-Rv2626c levels
progressively decreased during the course of treatment (p
values between < 0.05 and < 0.002 for these comparisons)
(Figure 2, top panels). In contrast, anti-38kDa Ag and anti-
LAM antibodies were higher at both the 2-month point and at
the end (8-month point) of treatment relative to the untreated
baseline. Comparisons were statistically significant at p <
202 A. AZZURRI ET AL.

Fig. 1. Specific antibody levels in pulmonary tuberculosis patients and household and community healthy controls. Plasma
levels of anti-ESAT-6, anti-FdxA, anti-Rv2626c, anti- LAM, and anti-38 kDa Ag IgG antibodies were measured by ELISA in 168
untreated patients with pulmonary tuberculosis, and in matched, household and community healthy controls. Results represent
geometric means (+ 95% confidence intervals) of duplicate determinations of optical density at 450 nm for each sample.

0.0001 for the anti-LAM antibody and at p < 0.02 for the anti-
38kDa antibody (Fig. 2, bottom panels). The levels of anti-
FdxA were unaffected by treatment (data not shown).
We next investigated the correlation between plasma
levels of the five antibodies associated with TB disease
(38 kDa Ag, ESAT-6, FdxA, Rv26262c, and LAM) and
clinical parameters of TB. Neither severity of presentation
at diagnosis nor chest X-ray patterns affected levels of
these antibodies before treatment (Fig. 3). Nor was any
correlation found between chest X-ray pattern of lesions
and post-treatment antibody levels (data not shown). In
contrast, after the 8-month therapeutic course, patients
who presented with moderate/severe disease had higher
levels of anti-ESAT-6, anti-FdxA and anti-38kDa
antibodies than those of patients with mild disease onset
(p <0.025 for anti-FdxA, p <0.05 for anti-38kDa and anti-
ESAT-6 antibodies) (Fig. 3, panel A). No such differences
were seen for anti-LAM and anti-Rv2626c (data not
shown). Patients with bilateral lung lesions had
significantly higher anti-38kDa and anti-LAM levels both
at diagnosis (p <0.05) and after 8-month treatment (p
<0.01 for anti-38kDa and p <0.02 for anti-LAM
antibodies) than patients with lesions involving only one
lung (Fig. 3, panel B). No such differences were found for
anti-ESAT-6, anti-FdxA or anti-Rv2626c antibodies (data
not shown). When we compared antibody levels relative
 Int. J. Immunopathol. Pharmacol. 203

Table I. Demographic and clinical data of matched patients, household and

community controls in the study.
___________________________________________________________________________
Tuberculosis Household Community Patients diagnosed with TB were
patients healthy controls healthy controls divided into two groups according to
n = 168 n = 167 n = 168 clinical presentation: mild cases were
___________________________________________________________________________
A. Demographic data
those characterized by monolateral
nodular lesions, absence of cavitation,
Sex Male 99 (59) 77 (46) 97 (58) low-level fever (if any) and weight loss
Female 69 (41) 90 (54) 71 (42) below 5%; moderate/severe cases
presented mono- or bi-lateral nodular
Age 15-24 58 (35) 67 (40) 54 (32)
25-39 78 (46) 73 (44) 80 (48) lesions, presence of cavities (moderate
> 40 32 (19) 27 (16) 34 (20) when limited to an area not greater
than the upper right lobe; severe when
Ethnic group Fula 63 (37) 62 (37) 63 (37) extended to an entire lung), persistent
Wolof 75 (45) 64 (38) 69 (41)
Mandinka 25 (15) 29 (17) 29 (17)
fever and weight loss > 10%. After
Other 5 (3) 12 (7) 7 (4) completion of treatment patients were
classified as “cured”, based on
B. Clinical data disappearance of symptoms, weight
gain, chest X-ray and conversion of
BCG scar Present 124 (74) 111 (66) 122 (73)
Absent 44 (26) 56 (34) 46 (27) sputum smears to negative, or as “non
cured” for those who failed treatment,
PPD skin 5-10 mm 17 (10) 98 (59) 132 (79) as indicated by persistence of
response >10 mm 151 (90) 69 (41) 36 (21) symptoms, clinical and chest X-ray
Clinical Mild 78 (46)
evidence of disease activity and
presentation Moderate/severe 90 (54) persistence of positive sputum smears.
Control groups were matched with the
Lung Monolateral 62 (37) patient population by age. Moreover,
involvement Bilateral 106 (63)
patient and control cohorts had a
Type of Lung opacity 94 (56) comparable male-to-female ratio and
lesions Cavitary 49 (29) relative distribution of the three major
Nodular 25 (15) ethnic groups (Wolof, Fula and
Mandinka) in the country. Numbers in
Clinical Cured 158 (94)
outcome Non cured 10 (6)
parentheses indicate percent values.

to treatment outcome we found that the levels of
antibodies against AlaDH and MS antibodies were higher
prior to treatment in non-cured than in cured patients
(Table II). No other antibody examined gave this result.
For the AlaDH antibody, levels were higher both before
and after treatment in non-cured than in cured patients (p
<0.05). For the MS antibody, the levels between the two
treatment outcome groups differed before (p <0.02) but
not after treatment.
DISCUSSION
In this paper we set out to identify serological
correlates of tuberculosis and response to anti-
tuberculosis treatment in a patient population referring
to the Centre Hospitalier-Universitaire Ignace Deen,
Conakry, Republic of Guinea. We found that, of ten
specific antibodies tested in the study, five correlated
with TB disease. We also found that anti-tuberculosis
treatment specifically affected levels of some specific
antibodies, but not others. Some of the antibodies
affected by treatment showed an upward trend, others a
downward trend. Thus, the present study provides
evidence of serological surrogate markers of
tuberculosis and of response to anti-TB treatment. Of
five antibodies that correlated with disease, three were
described previously. The 38 kDa lipoprotein, which is
found both on the surface and in the extracellular
compartment of M. tuberculosis cells, is probably the
M. tuberculosis antigen eliciting the strongest antibody
response in pulmonary TB patients (7). Likewise,
LAM, which is a component of the mycobacterial cell
wall, elicits vigorous antibody responses in TB patients
(7). In accordance with earlier literature (7), we show
that antibody responses to the 38kDa antigen and to
LAM increase with disease severity (in our study,
bilateral vs unilateral lung involvement). Moreover, we
204 A. AZZURRI ET AL.

Table II. Plasma levels of anti-alanine dehydrogenase and anti-malate synthetase antibodies in
tuberculosis patients before and after treatment.
___________________________________________________________________________
Time of Anti-alanine dehydrogenase Anti-malate synthetase
blood _______________________ ________________________
sampling Cured Non-cured Cured Non-cured
(n = 158) (n = 10) (n = 80) (n = 8)
___________________________________________________________________________

a b e f
Before treatment 0.276±0.1 0.553±0.43 0.166±0.04 0.25±0.14

c d g h
End of treatment 0.249±0.09 0.415±0.35 0.148±0.09 0.17±0.13
___________________________________________________________________________

Results are presented as geometric means (± 95% confidence intervals) of duplicate determinations of optical
density at 450 nm for each sample. T test: a vs b and c vs d were statistically significant at p < 0.05; e vs f at p
< 0.02; g vs h was non significant (p > 0.05).

have previously shown that ESAT-6, a low-molecular-
weight secreted protein of M. tuberculosis, induces
potent antibody responses in tuberculous humans,
cattle, and non-human primates (9, 29-30). The present
paper constitutes the first report of antibody responses
induced by two proteins of M. tuberculosis, Rv2626c
and FdxA, which we find expressed at high levels
during chronic lung infection of mice (24 and
unpublished data). Thus, our present findings provide
an example of how studies on transcription profiles of
M. tuberculosis during infection can guide
identification of novel mycobacterial antigens.
Bacterial antigen expression profiles can help interpret
antigen-specific immune responses. The 14kDa Ag (or
α-crystallin), Rv2626c and FdxA are each encoded by
genes in the hypoxia-responsive dosR regulon (31),
thus they are presumably co-transcribed. Here we find
that levels of antibody to the 14kDa protein failed to
distinguish cases of active TB from household and
community controls (not shown). Antibody responses
to the 14kDa Ag are preferentially detected in
asymptomatic recent contacts or in cases of past TB
than in active TB patients (10, 32), in keeping with
preferential production of this antigen by “dormant”
bacilli (22-23). Thus, since the present study was
conducted in an area of high TB prevalence, our results
suggest that the anti-14kDa antibody may not
distinguish active TB patients from control groups
because of either of at least two factors. One is a high
likelihood of recent infection in the control population,
which may be associated with a transient antibody rise
(32) [an effect of past TB on the levels of this antibody
can be excluded because only fewer than 4% of the
control population reported a history of TB (33)]. A
second possibility is that antibody responses associated
with latent M. tuberculosis infection are boosted by
repeated exposure to M. tuberculosis (or, perhaps, to
some other mycobacterial species). Consistent with the
above possibilities is the observation that the anti-
Rv2626c and anti-FdxA antibodies distinguished TB
patients from community controls but not from
household controls (Fig. 1). Additional factors,
including antigen load, antigen turn-over or
immunodominance, may explain why antibody
levels were higher in TB patients than in one (anti-
FdxA) or both (anti-Rv2626c) control groups, or not
at all (anti-14kDa).
Our data suggest that the effect of anti-tuberculosis
treatment and treatment outcome on the antibody
response is antigen-specific. The increase of specific
antibody levels to the 38kDa Ag and to LAM during
the early phase of treatment well matches earlier
findings (7). Increases in specific antibody titres in
serum have been explained as a response to antigen
release associated with bacterial killing and/or as a
release of antibodies from circulating immune
complexes when antigen concentration in serum
decreases (13). We also observed that the levels of
 Int. J. Immunopathol. Pharmacol. 205

Fig. 2. Effect of anti-tuberculosis treatment on specific antibody levels. Plasma levels of anti-ESAT-6, anti-Rv2626c, anti-
38kDa Ag, and anti-LAM IgG antibodies were measured by ELISA in 168 patients with pulmonary tuberculosis before
(month 0), after 2 months (month 2) and at the end (month 8) of anti-tuberculous treatment. Results represent geometric
means (+ 95% confidence intervals) of duplicate determinations of optical density at 450 nm for each sample.

antibodies to ESAT-6 and Rv2626c tended to decrease
with treatment, even during the early phase of
treatment. Other workers have shown that T cell
responses to ESAT-6 also decrease with treatment (34).
It is tempting to suggest that some antigens of M.
tuberculosis may better correlate with numbers of live
bacilli than others, because of the relative rate of
antigen synthesis or antigen half-life, among other
factors. Thus, it should be possible to use immune
responses to this type of antigens as indirect markers of
reduced bacillary load during treatment to monitor
response to therapy and help early assessment of
treatment failure. Finally, it is difficult to explain why
anti-38kDa, anti-FdxA and anti-ESAT-6 antibody
levels were higher at the end, but not at the start, of
treatment in patients with moderate/severe clinical
presentation than in patients with mild clinical disease
onset. One possibility is that clinical healing of
206 A. AZZURRI ET AL.

Fig. 3. Effect of severity of clinical presentation (panel A) or extent of lung involvement (panel B) on specific antibody
levels. Plasma levels of anti-38 kDa, anti-FdxA, anti-ESAT-6, and anti-LAM IgG antibodies were measured by ELISA in
168 patientswith pulmonary tuberculosis, before and after treatment. Panel A: antibody levels were assessed in the
plasma samples obtained before (month 0) and at the end of treatment (month 8) from tuberculosis patients with mild (n
= 78) or moderate/severe (n = 90) clinical presentation. Panel B: antibody levels were assessed in the plasma samples
obtained before (month 0) and at the end of treatment (month 8) from tuberculosis patients with unilateral (n = 62) or
bilateral (n = 106) lung involvement. Results represent geometric means (+ 95% confidence intervals) of duplicate
determinations of optical density at 450 nm for each sample.

moderate/severe cases of disease is associated with a
prolonged, sub-clinical inflammatory response that still
provides antigen stimulation to the immune response.
We were surprised to find that baseline levels of
antibodies to two enzymes, alanine dehydrogenase and
malate synthetase, were associated with response to
therapy. Because of the small sample size (sera from
only 8 to 10 patients who failed therapy were
available for analysis), these conclusions await
confirmation in further studies. However, since both
enzymes are thought to be involved in the
metabolism of non-replicating bacilli (14, 27), data
suggest that some cases of therapy failure may be
associated with elevated numbers of “dormant”
 Int. J. Immunopathol. Pharmacol.
bacteria which are less susceptible to antibiotic than
replicating bacteria. This interpretation, however,
does not explain why similar observations were not
made for antibodies directed to other antigens
associated with dormancy, such as the 14kDa Ag,
Rv2626c and FdxA. These differences may imply
that immunoregulatory mechanisms may selectively
affect B- and T-cell responses to specific antigens.
In conclusion, the data presented here show that
particular specific antibodies in serum correlate with
disease state, response to treatment, or treatment
outcome and prompt further evaluation of the
serodiagnostic potential of novel antibodies identified
in this study and an assessment of serological markers
of response to anti-TB treatment.
ACKNOWLEDGEMENTS
We thank PierNatale Brusasca and XuDong Guo
for protein purification; Lanbo Shi for insight in M.
tuberculosis antigen production vis-à-vis growth
state; Karl Drlica and Yuri Buskin for critical
reading of the manuscript; and Dr. V. Boddi for
critical review of statistical analysis. This work was
supported by NIH grant AI-36989 (M.L.G.) and in
part by the Commission of the European Union in
the context of the project Mucosal Vaccines for
Poverty Related Diseases (MUVAPRED, contract
LSHP-CT-2003-503240).
REFERENCES
1. Corbett E.L., C.J. Watt, N. Walker, D. Maher,
B.G. Williams, M.C. Raviglione and C. Dye. 2003.
The growing burden of tuberculosis: global trends
and interaction with the HIV epidemic. Arch. Intern.
Med. 163:1009.
2. El-Sadr W.M., D.C. Perlman, E. Denning, J.P.
Matts and D.L. Cohn. 2001. A review of efficacy
studies of 6-month short-course therapy for
tuberculosis among patients infected with human
immunodeficiency virus: differences in study
outcomes. Clin. Infect. Dis. 32:623.
3. Foulds J. and R. O’Brien. 1998. New tools for the
diagnosis of tuberculosis: the perspective of
developing countries. Int. J. Tuberc. Lung D. 2:778.
4. Chan E.D., L. Heifects and M.D. Iseman. 2000.
207
Immunologic diagnosis of tuberculosis: a review.
Tuber. Lung Dis. 80:131.
5. Rieder H.L. 1996. Sputum smear conversion during
directly observed treatment for tuberculosis. Tuber.
Lung Dis. 77:124.
6. Levy H., C. Feldman, H. Sacho, H. van der Meulen,
J. Kallenbach and H. Koornhof. 1989. A
reevaluation of sputum microscopy and culture in the
diagnosis of pulmonary tuberculosis. Chest 95:1193.
7. Bothamley G.H. 1995. Serological diagnosis of
tuberculosis. Eur. Respir. J. 8(S):676.
8. Gennaro M.L. 2000. Immunologic diagnosis of
tuberculosis. Clin. Infect. Dis. 30(S):243.
9. Lyashchenko K., R. Colangeli, M. House, H.A.
Jahdali, D. Menzies and M.L. Gennaro. 1998.
Heterogeneous antibody responses in tuberculosis.
Infect. Immun. 66:3936.
10. Silva V.M.C., G Kanaujia, M.L. Gennaro and D.
Menzies. 2003. Factors associated with humoral
response to ESAT-6, 38kDa and 14kDa antigens in
patients with a spectrum of tuberculosis. Int. J.
Tuberc. Lung Dis. 7:478.
11. Shi L., R. North and M.L. Gennaro. 2004. Effect
of growth state on transcription levels of genes
encoding major secreted antigens of Mycobacterium
tuberculosis in mouse lung. Infect. Immun. 72:2420.
12. Bothamley G.H., R. Rudd, F. Festenstein and J.
Ivanyi. 1992. Clinical values of the measurement of
Mycobacterium tuberculosis specific antibody in
pulmonary tuberculosis. Thorax 47:270.
13. Imaz M.S. and E. Zerbini. 2000. Antibody response
to culture filtrate antigens of Mycobacterium
tuberculosis during and after treatment of tuberculosis
patients. Int. J. Tuberc. Lung D. 4:562.
14. Schnappinger D., S. Ehrt, M.I. Voskuil, Y. Liu, J.A.
Mangan, I.M. Monahan, G. Dolganov, B. Efron,
P.D. Butcher, C. Nathan and G.K. Schoolnik. 2003.
Transcriptional adaptation of Mycobacterium
tuberculosis within macrophages: insights into the
phagosomal environment. J. Exp. Med. 198:693.
15. Lienhardt C., S. Bennet, G. Del Prete, O.Y. Bah-
Sow, M. Newport, P. Gustafson, K. Manneh, V.
Gomes, A. Hill and K. McAdam. 2002. Investigation
of environmental and host-related risk factors for
tuberculosis in Africa. I. Methodological aspects of a
combined design. Am. J. Epidemiol. 155:1066.
208 A. AZZURRI ET AL.
16. Sorensen A.L., S. Nagai, G. Houen, P. Andersen
and A.B. Andersen. 1995. Purification and
characterization of a low-molecular-mass T-cell
antigen secreted by Mycobacterium tuberculosis.
Infect. Immun. 63:1710.
17. Harboe M. and H.G. Wiker. 1992. The 38-kDa
protein of Mycobacterium tuberculosis: a review. J.
Infect. Dis. 166:874.
18. Ashbridge K.R.A., R.J. Booth, J.D. Watson and
R.B. Lathigra. 1989. Nucleotide sequence of the
19kDa antigen gene from Mycobacterium
tuberculosis. Nucl. Acids Res. 17:1249.
19. Andersen A.B., P. Andersen and L. Ljungqvist.
1992. Structure and function of a 40,000 molecular
weight protein antigen of Mycobacterium
tuberculosis. Infect. Immun. 60:2317.
20. Ohman R. and M. Ridell. 1995. Enzymatic and
antigenic analyses of strains of Mycobacterium
bovis, M. bovis BCG, and M. tuberculosis. Curr.
Microbiol. 30:161.
21. Sonnenberg M.G. and J.T. Belisle. 1997.
Definition of Mycobacterium tuberculosis culture
filtrate proteins by two-dimensional polyacrylamide
gel electrophoresis, N-terminal amino acid
sequencing, and electrospray mass spectrometry.
Infect. Immun. 65:4515.
22. Cunningham A.F. and C.L. Spreadbury. 1998.
Mycobacterial stationary phase induced by low
oxygen tension: cell wall thickening and localization
of the 16-kilodalton alpha-crystallin homolog. J.
Bacteriol. 180:801.
23. Desjardin L.E., L.G. Hayes, C.D. Sohaskey, L.G.
Wayne and K.D. Eisenach. 2001. Microaerophilic
induction of the alpha-crystallin chaperone protein
homologue (hspX) mRNA of Mycobacterium
tuberculosis. J. Bacteriol. 183:5311.
24. Shi L., Y.J. Jung, S. Tyagi, M.L. Gennaro and R.
North. 2003. Expression of Th1-mediated immunity
in mouse lung induces a Mycobacterium tuberculosis
transcription pattern characteristic of nonreplicating
persistence. Proc. Natl. Acad. Sci USA 100:241.
25. Harboe M., H.G. Wiker, G. Ulvund, B. Lund-
Pedersen, A.B. Andersen, R.G. Hewinson and S.
Nagai. 1998. MPB70 and MPB83 as indicators of
protein localization in mycobacterial cells. Infect.
Immun. 66:289.
26. Brennan P.J. 2003. Structure, function, and
biogenesis of the cell wall of Mycobacterium
tuberculosis. Tuberculosis 83:91.
27. Bishai W. 2000. Lipid lunch for persistent pathogen.
Nature 406:683.
28. Colangeli R.A., A. Heijbel, A. Williams, C. Manca,
J. Chan, K. Lyashchenko and M.L. Gennaro. 1998.
Three-step purification of lipopolysaccharide-free,
polyhistidine-tagged recombinant antigens of
Mycobacterium tuberculosis. J. Chromatogr. B
Biomed. Sci. Appl. 714:223.
29. Lyashchenko K.P., J.M. Pollock, R. Colangeli and
M.L. Gennaro. 1998. Diversity of antigen
recognition by serum antibodies in experimental
bovine tuberculosis. Infect. Immun. 66:5344.
30. Brusasca P.N., R.L. Peters, S. Motzel, H. Klein
and M.L. Gennaro. 2003. Antigen recognition by
serum antibodies in non-human primates
experimentally infected with Mycobacterium
tuberculosis. Comp. Med. 53:165.
31. Sherman D.R., M. Voskuil, D. Schnappinger, R.
Liao, M.I. Harrell and G.K. Schoolnik. 2001.
Regulation of the Mycobacterium tuberculosis
hypoxic response gene encoding alpha-crystallin.
Proc. Natl. Acad. Sci. USA 98:7534.
32. Bothamley G.H., J.S. Beck, R.C. Potts, J.M.
Grange, T. Kardjito and J. Ivanyi. 1992. Specificity
of antibodies and tuberculin response after occupational
exposure to tuberculosis. J. Infect. Dis. 166:182.
33. Lienhardt C., A. Azzurri, A. Amedei, K. Fielding,
J. Sillah, O.Y. Sow, B. Bah, M. Benagiano, A.
Diallo, R. Manetti, K. Manneh, P. Gustafson, S.
Bennet, M.M. D’Elios, K. McAdam and G. Del
Prete. 2002. Active tuberculosis in Africa is
associated with reduced Th1 and increased Th2
activity in vivo. Eur. J. Immunol. 32:1605.
34. Pathan A.A., K.A. Wilkinson, P. Klenerman, H.
McShane, R.N. Davidson, G. Pasvol, A.V. Hill and
A. Lalvani. 2001. Direct ex vivo analysis of antigen-
specific IFN-gamma-secreting CD4 T cells in
Mycobacterium tuberculosis-infected individuals:
association with clinical disease state and effect of
treatment. J. Immunol. 167:5217.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 209-215 (2006)

DETECTION OF HUMAN PAPILLOMAVIRUS DNA, P53 AND KI67 EXPRESSION IN

PENILE CARCINOMAS
V. GENTILE, P. VICINI, L. GIACOMELLI1, M.R. CARDILLO2,4, A. PIERANGELI2,3
and A.M. DEGENER2,3

Department of Urology, 1Department of Chirurgical Science and 2Department of Experimental

Medicine and Pathology, 3Section of Virology, and 4Section of Uropathology, “La Sapienza”
University, Rome, Italy

Received May 5, 2005 – Accepted November 22, 2005

Our study is aimed at evaluating the presence of p53 and Ki67 expression by immunohistochemistry
in a series of 11 paraffin-embedded penile carcinomas. We also investigated the presence of Human
Papillomavirus (HPV) DNA in these tumours and performed an accurate typing by DNA sequencing
on positive samples. Immunohistochemistry (IHC) was performed with the anti-p53 and Ki67 mouse
monoclonal antibodies. DNA extracted from small sections of each specimen was submitted to
amplification with HPV specific general primers; PCR products of the proper length were purified and
sequenced. IHC demonstrated nuclear accumulation of mutated p53 and Ki 67 expression in 10/11
tumour samples (90.9%). The prevalence of HPV DNA was 72.7%; the most prevalent type was
HPV16. Sequencing analysis revealed the presence of HPV53 (12.5%), HPV18 (25%) and HPV16
(62.5%). Out of the p53 or Ki67 positive carcinomas the percentage of HPV positives was 80% and 70%
respectively. Our results indicate that penile carcinoma is frequently associated to high risk HPV and
with diffuse p53 and Ki67 expression.

Invasive cancer of the penis is a relatively
uncommon disease in Western countries (0.1-0.9 per
100,000 males in Europe and 0.7-0.9 per 100,000 males
in the USA) whereas the highest incidence occurs in
developing countries; in some areas of Asia, Africa and
South America the incidence of penile carcinoma is
significantly higher, reaching 19 per 100,000 males. In
these countries, penile carcinoma accounts for as much
as 10-20% of male cancer (1). This carcinoma spreads
locally to regional lymph nodes which are often
surgically treated. This procedure has a high morbidity
rate (30-90%) (2); thus the major issue in treating penile
cancer involves the decision of which patient should or
should not be submitted to lymph node dissection.
Many groups have identified prognostic factors for the
incidence of lymph node metastases to avoid surgical
morbidity such as: tumour thickness, histopathological
grade, and venous and lymphatic embolization by
neoplastic cells (3).
In recent years human Papillomaviruses (HPVs)
have been identified as possible etiological agents for
the disease but the correlation between the viral DNA
presence and the prognosis is still uncertain (4). Many
studies have demonstrated the etiological role of

Key words: penile cancer, p53, Ki67, Human Papillomavirus (HPV)

Mailing address:
Anna Marta Degener, PhD
Department of Experimental Medicine and Pathology
Section of Virology
Viale di Porta Tiburtina, 28 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
00185 Rome- ITALY This publication and/or article is for individual use only and may not be further
Tel: +39-06-4474121 - Fax: +39-06-44741236 reproduced without written permission from the copyright holder.
E-mail: annamarta.degener@uniroma1.it 209 Unauthorized reproduction may results in financial and other penalties
210 V. GENTILE ET AL.
human papillomavirus (HPV) in cervical carcinomas
and the association between HPV and cervical cancer
has now been ascertained to reach 99.7% (5). The
overall frequency of HPV DNA detection in
carcinoma of the penis is far lower, nonetheless the
reported prevalence of HPV is highly variable, from
15% to 70%, depending on the sensitivity of the
detection method and on the tumour type (6-8).
Moreover, only a few studies have analyzed penile
carcinogenesis considering both the HPV status and
the histological differentiation.
The progress in molecular biology techniques
makes it possible to analyse several neoplastic
diseases by the identification of oncogene activation
and/or tumour suppressor gene inactivation. The
tumour suppressor gene p53 is located in the short arm
of chromosome 17 and has been implicated in the
pathogenesis of many tumours. Mutations of p53
result in an anomalous protein with an extended half-
life. The mutant protein accumulates in the nucleus of
tumour cells and can be identified by
immunohistochemical reactions (9-10). The role of
p53 as a prognostic factor has been studied in several
neoplastic diseases but its involvement in penile
carcinoma has not been exhaustively determined.
Ki67 is an antigen present in the nuclei of
proliferating cells and it is absent in quiescent cells.
Ki67 is expressed at all phases of the cellular cycle,
except in G0 phase, and it is a cell-cycle- dependent
protein. This non-specific nuclear marker for cellular
proliferation has been found to be a prognostic factor
in numerous cancer types, including several female
genital cancers (11-12).
In two different studies, a diffuse pattern of Ki67
expression has been shown to be an independent factor
indicating a worse clinical prognosis in women with
vulvar cancer (13-14). Ki67 is not useful as a marker
for occult cancer, however in women with vulvar
carcinoma a diffuse Ki67 expression is significantly
associated with poorly differentiated tumours (15).
In this work, we investigated HPV DNA presence
in eleven penile carcinomas and performed an accurate
typing by DNA sequencing on positive samples. In
addition, we analyzed p53 and Ki67 cellular proteins
expression by immunohistochemical methods in
tumour obtained from patients who underwent partial
penis amputation with or without lymphadenectomy.
MATERIALS AND METHODS
Tissue samples
Eleven formalin-fixed, paraffin-embedded blocks
containing intraepithelial penile carcinoma tissue were
selected from the surgical specimens for retrospective
immunohistochemical and molecular studies. Tumours were
graded using the modified Broder’s system (16) (grade I,
well differentiated, grade II/III, moderately differentiated
and grade IV, poorly differentiated), by TNM staging system
(17) and by using the Jackson’s staging system (18).
IHC:Two serial sections (3-µm thick) from penile blocks
were cut into slides coated with 3-aminopropyl-ethyl-xylene
(Sigma-Aldrich, S.R.L, Milan, Italy) and stained using the
avidin-biotin-peroxidase complex (ABC) method (reagents
from Dako S.p.A., Milan, Italy) as previously reported (19).
All sections were previously micro-waved for 5 minutes at
750 W (three cycles). The following primary antibodies
were used at 4°C overnight incubation: anti-p53 (DO-7) and
Ki67 (NCL-MM1) mouse monoclonal antibodies IgG1
fraction (supplied by Dako) at 1:50 dilution. All reactions
included appropriate positive controls (breast tissue) and
negative controls (the primary antibody was replaced by
normal swine serum), using biotinylated secondary
antibodies and avidin-peroxidase reagents (Dako S.p.A.,
Milan, Italy) and the chromogen diaminobenzidine-
hydrogen peroxidase (DAB) (Sigma-Alderich, S.R.L, Milan,
Italy). The slides were analysed by two independent
observers (MRC and PV). An Image Pro-Plus image
analyzer was used to quantify the tumour cells with positive
staining; the results were expressed as percentage of positive
cells (indices) (Fig.1). The estimated visual intensity of p53
and Ki67 immunostaining was graded into three categories
based on p53 and Ki67 index: negative when p53 or Ki67
index was <5% (group 0), weak when the index was >5%
and < 50% (group I), strong when >50% (group II) (19-21).
DNA extraction
DNA was extracted from small sections of each
specimen using a NucleoSpin Tissue kit (Machery Nagel),
following the manufacturer’s recommendations for paraffin-
embedded tissue. Briefly, 20-25 mg of embedded biopsy
material was cut from the paraffin block (each with a new
scalpel), trimmed of excess paraffin, extracted with 1 ml
xylene during a 30 min incubation at 37°C, washed twice
with ethanol and then subjected to standard DNA extraction.
Reduced DNA yields and fragmentation in fixed as
compared to fresh tissue were expected: DNA samples were
quantified by gel electrophoresis and then tested for PCR
suitability by amplification of a cellular house-keeping gene
(HLA). The HLA PCR products (200bp) were detected by
ethidium bromide staining after electrophoretic migration
through 2% agarose gels.
 Int. J. Immunopathol. Pharmacol. 211

HPV detection by PCR assays
The widely used general primers elongated at their 3’
ends (GP5+/GP6+) (22) amplify a highly conserved 150 bp
fragment in L1 gene allowing the detection of a broad
spectrum of mucosotropic HPV genotypes. The shortness of
the amplicon renders the amplification appropriate in DNA
extracted from paraffin-embedded tissue. The 50 µl PCR
mixture contained 10 µl of sample, 20 pmol of each GP5+
and GP6+ primer, 200 µm of each dNTP, 0.2% BSA and
1.25 U Taq DNA polymerase (Roche) and reaction buffer.
PCR was carried out in a Biometra thermocycler with a
thermal lid, following the manufacturer’s instructions (22).
The amplification of a 450 bp fragment from the L1
region of HPV DNA, using the degenerated consensus
primer pair MY09 and MY11, was also performed, as
previously described (23-25).
At the end of the amplification cycles an aliquot of each
reaction was electrophoresed on agarose gel in parallel with
positive (2ng of plasmid containing the entire genome of
different HPV genotypes) and negative (the complete
reaction mix without DNA) controls (Fig. 1, panel (d)).
HPV genotyping
PCR products of the proper length were purified and
sequenced; briefly, amplified fragments were purified with
QIAquick PCR purification kit, according to QIAGEN
protocol. DNA sequencing was performed by automatic
DNA sequencer (Applied Biosystem, mod. 370 A),
according to manufacturer’s specifications (Amplicycle
Kit, Applied Biosystem). Sequence homology was
determined by BLAST and Clustal W programs.
RESULTS
In Table I data regarding three different
parameters for tumour grading, as well as the
immunohistochemistry analysis of cellular protein
p53 and Ki67 and results of HPV DNA test, are
reported. Almost all cases (9/11) of penile tumours
were squamous cell carcinomas (SCC) (82%) while
2 were verrucous carcinomas (VC) (18%). As shown
in the table, three tumours were grade I (well
differentiated), 2 were grade II/III (moderately
differentiated) and 4 were grade IV (poorly
differentiated). By TNM staging system (17), 4
tumours were classified as pT1, 5 as pT2, and 2 as
pT3. Only in 1 case metastases in deep inguinal
bilateral lymph node (N3) were observed, whereas
all the others had no lymph node metastases (N0).
Using the Jackson’s staging system (18), 3 tumours
were stage I (T1N0M0), 6 were stage II (T2N0M0),
1 was stage III (T3N0M0) and 1 tumour was stage
IV (T3N3M0).
HPV DNA was detected in 8/11 cases of penile
carcinoma, indicating a high prevalence of positive
samples (72.7%). Sequencing analysis of all PCR
products revealed in 1 case the presence of HPV 53
(12.5%), in 2 cases of HPV18 (25%) and in 5 cases
of HPV16 (62.5%).
The immunohistochemical examination
demonstrated that nuclear accumulation of p53 was
detectable in almost all tumour samples (10/11,
except sample n. 1), and Ki67 expression in 10/11,
but not in sample n.5. Out of the p53 and Ki67
positive samples, 8 were squamous and 2 were
verrucous tumours. Almost all the cases revealed
over expression of p53 and Ki67 (90.9%). The
immunoreactivity for p53 reached highest levels in 4
out of 10 tumours, whereas the percentage of Ki67
positive cells was elevated in 9 out of 10 (Table I).
In tumours expressing p53 or Ki67, the

Table I. Clinical presentation of carcinoma samples, HPV typing and immunohistochemistry.

p53 p53 Ki 67 Ki 67
Samples Histological Grade TNM Stage HPV % of IHC % of IHC
diagnosis Group type positive categories positive categories
cells cells

1 SCC I pT3N3M0 IV neg 0 0 80% 2

2 SCC IV pT1N0M0 I 16 80% 2 90% 2
3 SCC I T2N0M0 II 16 30% 1 90% 2
4 SCC IV pT2N0M0 II neg 30% 1 90% 2
5 SCC II-III pT2N0M0 II 16 30% 1 0 0
6 VC pT1N0M0 I 18 20% 1 20% 1
7 SCC II-III pT3N0M0 II neg 20% 1 90% 2
8 SCC IV pT2N0M0 II 18 80% 2 70% 2
9 VC pT1N0M0 I 16 95% 2 100% 2
10 SCC IV pT1N0M0 III 16 30% 1 90% 2
11 SCC I pT2N0M0 II 53 95% 2 90% 2
212 V. GENTILE ET AL.

Fig. 1 Sections of a paraffin-embedded squamous cell carcinoma of the penis.

a) The haematoxilin stain shows solid non-keratinisating cords and small irregular nests of neoplastic squamous cells
infiltrating the lamina propria (upper right); adjacent to the tumoral area, normal squamous epithelium is shown (under
left) (magnification x 200).
b) Details of the same section: the IHC reaction with p53 antibody shows brown stained diffuse positivity, predominantly
nuclear, involving almost all nuclei of immunostained squamous cells of the carcinoma.
c) IHC reaction with Ki67 antibody showing diffuse intense reactivity in the nuclei of malignant cells. (b and c
magnification x 400).
d) Electrophoresis in 2% agarose gel of GP-PCR products (150 bp); M= molecular weight marker (100 bp ladder); (-):
negative control; (+): positive control obtained by the amplification of recombinant HPV16-plasmid DNA; A-H : tumour
samples.

percentage of high risk HPV positive samples was
80% and 70%, respectively.
DISCUSSION
The overall prevalence of HPV DNA in penile
carcinomas detected in this study was 72.7%
whereas, considering only SCC, the prevalence was
66.7%. All HPV genotypes found in the carcinoma
samples were high-risk, the most prevalent was
HPV16. This result is one of the highest HPV
prevalences ever reported in similar studies.
Although the number of cases is limited, we believe
that the detection and typing methods employed in
this study are particularly accurate and reliable. We
 Int. J. Immunopathol. Pharmacol.
performed the amplification of short fragments in
order to diminish the problems of target detection in
formalin-fixed tissue, where DNA fragmentation is
frequent. Moreover, we chose a consistent length of
the amplicons of the control cellular gene (200 bp
versus 150 bp of the GP5+/GP6+ fragment in HPV)
to avoid false negative results; in fact, some samples
were negative with MY09/11 primer set (data not
shown). Sequencing the amplified fragments is, in
our opinion, the straightest way to confirm positives
and to identify the HPV genotype.
Clone DO-7 anti p53 monoclonal antibodies
from Dako theoretically recognizes both wild type
and mutant p53 proteins (9), but wild type p53 has a
very short half-life that renders its identification
difficult; conversely mutated p53 accumulates in the
nucleous either in the presence or absence of HPV
proteins and is quantitatively detected by
monoclonal antibodies. This method has been used
before for detection of mutated p53 in genital and
bladder cancer (26-28).
In our study immunohistochemical analysis
showed no significantly different levels of
expression of p53 and Ki67 in penile VC vs SCC,
but only 2 cases of VC were included in this
research. The overall percentage of p53 positive
carcinomas is remarkably high (91%) compared to
reported values ranging from about 25% to 65% (26-
30). In HPV positive tumours, p53 was detected in
100% of samples, 50% of them having a very strong
(group II) estimated intensity. These results confirm
data of Lam et al (1995) reporting 100% of p53
over-expression in HPV positive penile carcinomas
whilst the overall p53 positivity was 40%. They
suggested that there is a strong association between
HPV and p53 gene mutation and that the inverse
correlation existing between them in cervical
carcinoma is not applicable in penile cancer (31).
However, the issue is still controversial because of
contradictory reports concerning association
between HPV presence and p53 gene mutation (32).
To our knowledge, Ki67 expression has never been
reported previously in penile carcinoma. In this
study, the percentage of overall positive samples for
Ki67 and p53 was comparable, but Ki67 showed a
higher level of intensity. The over-expression of
Ki67 correlates with 75% of HPV positive
carcinoma, confirming the data obtained on cervical
213
carcinoma (33). Cellular gene modifications (such
as p53 mutation and Ki67 over-expression) may be
important co-factors for carcinogenesis in penile
carcinoma especially associated with HPV infection.
ACKNOWLEDGEMENTS
This work was partially supported by MIUR.
REFERENCES
1. Mobilio G. and V. Ficarra. 2001. Genital treatment
of penile carcinoma. Curr. Opin. Urol. 11:299.
2. Kamat M.R., J.N. Kulkarni and H.B.
Tongaonkar. 1993. Carcinoma of the penis: the
Indian experience. J. Surg. Oncol. 52:50.
3. Fraley E.E., G. Zhang, R. Sazama and P.H.
Lange. 1985. Cancer of the penis: prognosis and
treatment plans. Cancer 55:1618.
4. Bezerra A.L., A. Lopes, G.H. Santiago, K.C.
Ribeiro, M.R. Latorre and L.L. Villa. 2001.
Human papillomavirus as prognostic factor in
carcinoma of the penis: analysis of 82 patients
treated with amputation and bilateral
lymphadenectomy. Cancer 91:2315.
5. Clifford G.M., J.S. Smith, M. Plummer, N.
Munoz and S. Franceschi. 2003. Human
Papillomavirus types in invasive cancer worldwide:
a meta-analysis. Br. J. Cancer. 88:63.
6. Dianzani C., M. Bucci M, A. Pierangeli, S.
Calvieri and A.M. Degener. 1998. Association of
human Papillomavirus type 11 with carcinoma of the
penis. Urology 51:1046.
7. Picconi M.A., A.M. Eijan, A.L. Distefano, S. Pueyo,
L.V. Alonio, S. Gorostidi, A.R. Teyssie and A.
Casabe. 2000. Human Papillomavirus (HPV) DNA
in penile carcinomas in Argentina: analysis of primary
tumors and lymph nodes. J. Med. Virol. 61:65.
8. Humbey O., S. Cairey-Remonnay, J.S. Guerrini,
M.P. Algros, C. Mougin, H. Bittard and F. Aubin.
2003. Detection of the human Papillomavirus and
analysis of the TP53 polymorphism of exon 4 at
codon 72 in penile squamous carcinomas. Eur. J.
Cancer 39:684.
9. Rogel A., M. Popliker, C.G. Webb and M. Oren.
1985. p53 cellular tumor antigen: analysis of mRNA
214 V. GENTILE ET AL.
levels in normal adult tissue, embryos, and tumors.
Mol. Cell. Biol. 5:2851.
10. Pharoah P.D., N.E. Day and C. Caldas. 1999.
Somatic mutations in the p53 gene and prognosis in
breast cancer: a meta-analysis. Br. J. Cancer 80:1968.
11. Goff B.A., H.G. Muntz, B.E. Greer, H.K. Tamimi
and A.M. Gown. 1998. Oncogene expression: long-
term compared with short-term survival in patients
with advanced epithelial ovarian cancer. Obstet.
Gynecol. 92:88.
12. Salvesen H.G., O.E. Iversen and L.A. Akslen.
1998. Identification of high-risk patients by
assessment of nuclear Ki-67 expression in a
prospective study of endometrial carcinomas. Clin.
Cancer Res. 4:2779.
13. Hendricks J.B., E.J. Wilkinson, P. Kubilis, P.
Drew, S.M. Blaydes and S. Munakata. 1994. Ki-67
expression in vulvar carcinoma. Int. J. Gynecol.
Pathol. 13:205.
14. Marchetti M., R. Salmaso, S. Polonio, D. Perin, T.
Salviato and A. Onnis. 1996. Ki 67 expression in
vulvar carcinoma. Preliminary results. Eur. J.
Gynaecol. Oncol. 17:361.
15. Modesitt S.C., P.A. Groben, L.A. Walton, W.C.
Fowler and L. Van Le. 2000. Expression of Ki-67
in vulvar carcinoma and vulvar intraepithelial
neoplasia III: correlation with clinical prognostic
factors. Gynecol. Oncol. 76:51.
16. Lucia M.S. and G.J. Miller. 1992. Histopathology
of malignant lesions of the penis. Urol. Clin. North
Am. 19:227.
17. Sobin L.H. and C.H. Witteking. 2002. TNM
classification of malignant tumours 6°Ed Wiley-Liss
John Wiley & Sons, Inc., Hoboken, New Jersey,
Publication p.1.
18. Jackson S.M. 1966. The treatment of carcinoma of
the penis. Br. J. Surg. 53:33.
19. Cardillo M.R., S. Monti, F. Di Silverio, V. Gentile,
F. Sciarra and V. Toscano. 2003. Insulin-like
growth factor (IGF)-I, IGF-II and IGF type I receptor
(IGFR-I) expression in prostatic cancer. Anticancer
Research 23:3825.
20. Alkushi A., P. Lim, A. Coldman, D. Huntsman, D.
Miller and C.B. Gilks. 2004. Interpretation of p53
immunoreactivity in endometrial carcinoma:
establishing a clinically relevant cut-off level. Int. J.
Gynecol. Pathol. 23:129.
21. Martins A.C., S.M. Faria, A.J. Cologna, H.J.
Suaid and S. Tucci. 2002. Immunoexpression of
p53 protein and proliferating cell nuclear antigen in
penile carcinoma. J. Urol. 167:89.
22. de Roda Husman A.M., J.M. Walboomers, A.J. van
den Brule, C.J. Meijer and P.J. Snijders. 1995. The
use of general primers GP5 and GP6 elongated at their
3’ ends with adjacent highly conserved sequences
improves human papillomavirus detection by PCR. J.
Gen. Urol. 76:1057.
23. Bernard H.U., S.Y. Chan, M.M. Manos, C.K.
Ong, L.L. Villa, H. Delius, C.L. Peyton, H.M.
Bauer and C.M. Wheeler. 1994. Identification and
assessment of known and novel human
papillomaviruses by polymerase chain reaction
amplification, restriction fragment length
polymorphism, nucleotide sequence, and
phylogenetic algorithms. J. Infect. Dis. 170:1077.
24. Pisani S., M. Imperi, L. Seganti, F. Superti, A.
Tinari, M. Bucci and A.M. Degener. 2004. Effect
of HSV-2 infection on the expression of HPV 16
genes in CaSki cells. Int. J. Immunopathol.
Pharmacol. 17:65.
25. Pisani S., D. Fioriti, M.P. Conte, F. Chiarini, L.
Seganti and A.M. Degener. 2002. Involvement of
herpes simplex type 2 in modulation of gene
expression of human papillomavirus type 18. Int. J.
Immunopathol. Pharmacol. 15:59.
26. Lopes A., A.L. Bezerra, C.A. Pinto, S.V. Serrano,
C.A. de Mello and L.L. Villa. 2002. p53 as a new
prognostic factor for lymph node metastasis in
penile carcinoma: analysis of 82 patients treated
with amputation and bilateral lymphadenectomy. J.
Urol. 168:81.
27. Rodriguez-Alonso A., S. Pita-Fernandez, J.
Gonzales-Carrero and J.L. Noguera-March.
2002. p53 and ki67 expression as prognostic factors
for cancer-related survival in stage T1 transitional
cell bladder carcinoma. Eur. Urol. 41:182.
28. Bernardini S., G.L. Adessi, C. Billerey, E. Chezy,
J.P. Carbillet and H. Bittard. 1999.
Immunohistochemical detection of p53 protein
overexpression versus gene sequencing in urinary
 Int. J. Immunopathol. Pharmacol.
bladder carcinomas. J. Urol. 162:1496.
29. Levi J.E., P. Rahal, A.S. Sarkis and L. Villa. 1998.
Human Papillomavirus DNA and p53 status in penile
carcinomas. Int. J. Cancer 76:779.
30. Zhang X.H., G.Q. Sun, Y. Yang and T.H. Zhang.
2001. Human papillomavirus and p53 protein
immunoreactivity in condylomata acuminatum and
squamous cell carcinoma of penis. Asian J. Androl. 3:75.
31. Lam K.Y., A.C. Chan, K.W. Chan, M.L. Leung
and G. Srivastava. 1995. Expression of p53 and its
215
relationship with human papillomavirus in penile
carcinoma. Eur. J. Surg. Oncol. 21:613.
32. Suzuki H., N. Sato, T. Kodama, T. Okano, S.
Isaka, H. Shirasawa, B. Simizu and J. Shimazaki.
1994. Detection of human papillomavirus DNA and
state of p53 gene in Japanese penile cancer. Jpn. J.
Clin. Oncol. 24:1.
33. Koyamatsu Y., M. Yokoyama, Y. Nakao, K. Fukuda,
T. Saito, K. Matsukuma and T. Iwasaka. 2003. A
comparative analysis of human Papillomavirus types
16 and expression of p53 and Ki-67 in cervical, vaginal,
and vulvar carcinomas. Gynecol. Oncol. 90:547.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 225-229 (2006)

ONCE-WEEKLY ADMINISTRATION OF HIGH-DOSAGE ETANERCEPT IN

PATIENTS WITH PLAQUE PSORIASIS: RESULTS OF A PILOT EXPERIENCE
(POWER STUDY)

N. CASSANO, F. LOCONSOLE, A. GALLUCCIO1, A. MIRACAPILLO, M. PEZZA1 and G.A. VENA

Department of Internal Medicine, Immunology and Infectious Diseases, II Dermatology Clinic,

University of Bari, Italy; 1Unit of Dermatology, Ospedale Fatebenefratelli, Benevento, Italy

Received December 31, 2005 – Accepted January 11, 2006

Etanercept is a soluble tumour necrosis factor receptor fusion protein which is approved for the
treatment of plaque psoriasis at the dose of either 25mg twice weekly (BIW) or, for the initial 12 weeks,
50mg BIW. Alternative dosing regimens have not been evaluated in psoriasis. In this study, we compare
the efficacy and tolerability of two etanercept dosing regimens - 50mg BIW and 100mg once weekly
(OW) - for 12 weeks in 108 patients with moderate-to-severe recalcitrant psoriasis. Efficacy measures
included Psoriasis Area and Severity Index (PASI), severity of pruritus recorded on a visual analogue
scale (VAS) and the influence on quality of life assessed by means of Dermatology Life Quality Index
(DLQI). Both etanercept regimens caused a significant change in all the efficacy parameters after 4
weeks and 12 weeks, at a comparable rate. At week 12, a PASI improvement of at least 50% from
baseline (PASI 50) was achieved by 74% of patients treated with 50mg BIW and 78% of patients
treated with 100mg OW. A PASI 75 response was obtained in 54% and 50% of patients treated with
50mg BIW and 100mg OW, respectively. Treatment was well tolerated with similar type and frequency
of adverse events between the two groups.

Etanercept (Enbrel®, Wyeth Europe Ltd) is a
soluble tumour necrosis factor (TNF) receptor fusion
protein which is approved for the treatment of
rheumatoid arthritis (RA), polyarticular-course
juvenile RA, psoriatic arthritis (PA), ankylosing
spondylitis (AS) and plaque psoriasis. In adult
patients with RA, PA and AS, the dosage is 50mg per
week given as 25 mg subcutaneous injections twice
weekly (BIW). In RA, once weekly (OW)
administration (single 50mg injection) is an
alternative recommended dose. In plaque psoriasis,
the drug can be administered at the dose of either
25mg BIW or, in the initial 12-week phase, 50mg
BIW (1). Other dosing regimens have not been
studied in psoriasis. We wanted to assess the efficacy
and safety of 100mg OW administration of etanercept
for 12 weeks in plaque psoriasis.
MATERIALS AND METHODS
This pilot study (study acronym, POWER: Psoriasis
and Once Weekly Etanercept Response) was designed as
an investigator-blinded study to compare the efficacy and

Key words: etanercept, dosing regimen, plaque psoriasis, treatment

Mailing address:
Prof. Gino A. Vena, M.D.
2nd Unit of Dermatology, University of Bari
Policlinico - Piazza Giulio Cesare, 124
0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
70124 Bari, Italy - This publication and/or article is for individual use only and may not be further
Tel./Fax: +39 80 5478 920 225 reproduced without written permission from the copyright holder.
E-mail: g.vena@dermatologia.uniba.it Unauthorized reproduction may results in financial and other penalties
226 N. CASSANO ET AL.
tolerability of two different 12-week dosing regimens
with etanercept. After obtaining informed consent,
psoriatic patients regarded as candidates to receive
etanercept were sequentially allocated to one of these two
treatment groups according to a 1:1 ratio:
group A: etanercept 50mg BIW for 12 weeks;
group B: etanercept 100mg OW for 12 weeks.
Eligible patients were adult male or female subjects
with chronic plaque psoriasis involving at least 10% of
the body surface area and with a minimum psoriasis area
and severity index (PASI) (2) of 10, in whom standard
systemic therapies and phototherapy were contraindicated
and/or had caused inadequate response in terms of
efficacy or tolerability. Eligibility also required the
absence of the following exclusion criteria: guttate,
erythrodermic and pustular psoriasis; concomitant skin
disorders that could interfere with study evaluations;
known hypersensitivity to etanercept or to any of its
excipients; active or chronic infections, including HIV,
HBV and HCV infection, latent tuberculosis, history of
recurrent infections and risk for sepsis; previous or active
malignancies; relevant haematological, renal and hepatic
disorders; congestive heart failure; demyelinating
diseases; autoimmune rheumatic diseases; recent or
concurrent vaccinations with live viruses or bacteria;
pregnancy and lactation; previous treatment with
biologicals, including etanercept; concomitant treatment
with interleukin-1 antagonists and with any treatment or
procedure capable of influencing psoriasis course and
evaluation, including topical antipsoriatic drugs,
keratolytics, artificial UV light and sun exposure. Non-
medicated emollients were only permitted throughout the
study period. Prior to the baseline evaluation, patients
were to have stopped standard topical psoriasis therapies
for at least 2 weeks and systemic psoriasis therapy or
phototherapy for a minimum of 4 weeks.
A total of 108 patients, 63 males and 55 females with
a mean age of 44.5 (range: 19-67), met the eligibility
criteria (53 in group A and 55 in group B). Patients in
group A (etanercept 50mg BIW) received Enbrel® 50mg
as two subcutaneous injections of 25mg on the same day
(with each injection given at different sites), repeated 3-4
days apart. In group B (etanercept 100mg OW), treatment
was performed in a single administration per week with
four subcutaneous injections of 25mg given on the same
day at distinct sites.
Clinical assessment was performed at baseline, after 4
weeks and after 12 weeks (end of the study) and PASI was
calculated by an independent observer who was unaware
of the dosing regimen used. At each visit, the severity of
psoriasis-associated pruritus was recorded by patients on
a visual analogue scale (VAS), whereas the Dermatology
Life Quality Index (DLQI) (3) was used to evaluate the
impact on quality of life. Routine laboratory examinations
(haematology, serum chemistry and urinalysis) were done
at baseline and weeks 12.
Statistical analysis was performed on an intent-to-treat
basis. Missing data due to any reason were imputed carrying
forward the last assessment available (LOCF approach). In
each group the average change of PASI, VAS for pruritus
and DLQI scores from baseline was reported and was
statistically analyzed using the Wilcoxon matched-pairs
signed-ranks test (significance for p values less than 0.05).
Additional efficacy endopoint was the response rate in each
group defined as the proportion of patients who achieved
both a ≥ 50% and a ≥ 75% improvement of PASI from
baseline (PASI 50 and PASI 75, respectively). Treatment
group comparisons of PASI, VAS and DLQI change were
made using the Mann-Whitney U test; again, p values <0.05
were considered significant. The safety analysis was
descriptive and based on the frequency of adverse events
(AEs) and abnormal laboratory results in patients treated
with etanercept for at least one day.
RESULTS
All the 108 eligible patients received treatment
with etanercept. Of these, four patients were not
included in the efficacy analysis because of
premature discontinuation for administrative
reasons (no. 2) or because of the use of prohibited
treatments (intense exposure to sunlight or artificial
UVA radiations: no. 2) before week 4. After 4 weeks
of treatment, two patients were lost to follow-up and
another withdrew his consent. Therefore, 101
patients completed the 12-week treatment period (50
in group A and 51 in group B).
At baseline, in the entire population, mean PASI
was 18.1 and DLQI score had an average mean
value of 10.7; 64% of patients complained of
pruritus with a mean severity reported on VAS of 48
mm. The two treatment groups were homogeneous
as no significant differences of baseline parameters
were detected between the two arms (p>0.05).
Treatment with each regimen caused a significant
improvement of PASI from baseline after week 4
(p<0.05) and week 12 (p<0.01) without any
significant differences between the two regimens
(Fig. 1, Table I). The response rate (shown in Table
I) gave similar results in the two arms: at the end of
treatment, about two thirds of the patients obtained a
PASI 50 response whereas half of the patients
achieved a PASI 75. The results of PASI were
 Int. J. Immunopathol. Pharmacol. 227
Table I. Efficacy results in the study population.
Group A Group B
(etanercept (etanercept 100mg
50mg BIW) OW)
Baseline parameters (mean± SD)
PASI 17.8 ± 7.8 18.35 ± 8.5
DLQI 10.3 ± 7.2 10.9 ± 6.4
VAS for pruritus (mm) 49 ± 38 46.5 ± 35
Mean improvement at week 4 *
PASI 36% 40%
DLQI 41% 39%
VAS for pruritus 43% 46%
Mean improvement at week 12 **
PASI 74% 76%
DLQI 68% 66%
VAS for pruritus 69% 72%
PASI response rate (%)
PASI 50 at week 4 29 37
PASI 75 at week 4 8 8
PASI 50 at week 12 74 78
PASI 75 at week 12 54 50

* change of all parameters from baseline, in each group: p<0.05

** change of all parameters from baseline, in each group: p<0.01
Comparison of each parameter between the two groups, at baseline, week 4
and week 12: p>0.05

confirmed by patient-reported efficacy measures DISCUSSION

(DLQI and VAS), which showed significant
improvement of scores throughout the study period
with both regimens at a comparable rate (Table I).
Treatment was well tolerated. Type and
frequency of adverse events did not differ between
the treatment groups (Table II). AEs, including the
sporadic laboratory abnormalities, were of mild to
moderate intensity and were not responsible for
permanent discontinuation in any case. Five patients
(two in group A and three in group B) required
temporary withdrawal of treatment due to
concurrent infection until its complete recovery. The
most frequent AEs were injection site reactions
which had a mild intensity in most cases.
Etanercept is a dimeric fusion protein consisting of
the extracellular ligand-binding portion of the human
p75 TNF-receptor linked to the Fc portion of human
IgG1. The efficacy and safety of monotherapy with
etanercept in plaque psoriasis have been documented
by various randomized placebo-controlled trials (4-7).
Some of these studies (4, 6) showed the superiority
over placebo of etanercept 25mg BIW in psoriatic
patients with or without concomitant psoriatic arthritis.
Other studies evidenced that a starting dose of 50mg
BIW for 12 weeks provided a significantly greater
benefit as compared with 25mg BIW, in a dose-
dependent manner (5, 7). After the initial 12-week
228 N. CASSANO ET AL.
Table II. Adverse events in the study population.
Type
(etanercept 50mg BIW)
Injection site reaction
Upper respiratory infections
Flu-like syndrome
Headache
Injection site ecchymosis
Paresthesias
Fatigue
Gastrointestinal symptoms
Dizziness
Ecchymosis (at sites other than injection
sites)
Increase of aminotransferases
Increase of triglycerides
Trombocytopenia
treatment phase with 50mg BIW, a sustained response
can be obtained by a sequential maintenance treatment
with 25mg BIW (5, 7). On the basis of these evidence-
based observations, etanercept has been approved for
the treatment of plaque psoriasis at a starting dose of
either 25mg BIW or 50mg BIW for up to 12 weeks.
Pharmacokinetic and clinical studies have not yet been
evaluated alternative etanercept dosing regimens.
In the other approved indications (RA, PA and
AS), the recommended dose is 25mg BIW, with the
only exception of RA in which 50mg OW
administration is also recommended (1).
Pharmacokinetic modeling revealed that systemic
exposure following 50mg OW dosage regimen was
similar to that generated by 25mg BIW (8-9).
Clinical data from RA patients indicated an overlap
in pharmacokinetics and clinical outcomes between
these dosing regimens (10).
The study herein reported has confirmed the
efficacy and tolerability of etanercept 50mg BIW in
plaque psoriasis and our results are highly consistent
with other studies (5, 7, 11). Etanercept provided
relevant benefit to psoriatic patients, as
demonstrated not only by objective clinical
Frequency (%)
Group A Group B
(etanercept 100mg
OW)
17 21
14 12
11 10
10 11
8 9
8 7
5 6
4 5
3 2
1 0
1 1
1 1
1 0
evaluation (PASI) but also from the patient’s
perspective. In fact, a notable improvement of
pruritus and quality of life issues was noted, in
accordance with previous results (11).
Our pilot experience assessed, for the first time,
the clinical outcome observed after the use of 100mg
OW etanercept regimen in patients with plaque
psoriasis. Interestingly, the efficacy and tolerability
profile of this regimen was comparable to that
observed with 50mg BIW. The bioequivalence of
these regimens, if further confirmed by controlled
studies, can have important practical advantages, as
the 100mg OW regimen may favour patient’s
compliance and adherence to treatment, preserving
the effectiveness and tolerability of the standard
50mg BIW regimen. In both regimens of our study
25mg injections were given because, during the
study, Enbrel® was supplied only as 25mg vials.
The compliance of patients to OW high-dose
administration of etanercept can be further improved
thanks to the recent availability of 50mg vials.
The study was performed in accordance with Good
Clinical Practice and the ethical principles of the
Declaration of Helsinki and subsequent amendments.
 Int. J. Immunopathol. Pharmacol. 229

20

16 etanercept 50mg BIW

etanercept 100mg OW
mean PASI

12

0
baseline week 4 week 12

Fig. 1 PASI variation over the 12-week treatment period with two etanercept dosing regimens. PASI improvement from
baseline was statistically significant in each group at both week 4 (p<0.05) and week 12 (p<0.01). The comparison of
PASI values between the two groups gave no significant differences (p>0.05) at baseline, week 4 and week 12.

7. Papp K.A., S. Tyring, M. Lahfa, J. Prinz, C.E.

ACKNOWLEDGEMENTS
The authors thank Dr Monica Carbonara for her
support in the statistical analysis.
REFERENCES
1. No Authors listed. 2005. Enbrel®. Package insert.
2. Fredriksson T. and U. Pettersson. 1978. Severe
psoriasis: Oral therapy with a new retinoid.
Dermatologica 157:238.
3. Finlay A.Y. and G.K. Khan. 1994. Dermatology Life
Quality Index (DLQI)- a simple practical measure for
routine clinical use. Clin. Exp. Dermatol. 19:210.
4. Mease P.J., B.S. Goffe, J. Metz, A. VanderStoep,
B. Finck and D.J. Burge. 2000. Etanercept in the
treatment of psoriatic arthritis and psoriasis: a
randomised trial. Lancet 356:385.
5. Leonardi C.L., J.L. Powers, R.T. Matheson, B.S.
Goffe, R. Zitnik, A.Wang et al; Etanercept Psoriasis
Study Group. 2003. Etanercept as monotherapy in
patients with psoriasis. N. Engl. J. Med. 349:2014.
6. Gottlieb A.B., R.T. Matheson, N. Lowe, G.G.
Krueger, S. Kang, B.S. Goffe et al. 2003. A
randomized trial of etanercept as monotherapy for
psoriasis. Arch. Dermatol. 139:1627.
Griffiths, A.M. Nakanishi, et al; Etanercept
Psoriasis Study Group. 2005. A global phase III
randomized controlled trial of etanercept in
psoriasis: safety, efficacy, and effect of dose
reduction. Br. J. Dermatol. 152:1304.
8. Nestorov I., R. Zitnik and T. Ludden. 2004.
Population pharmacokinetic modeling of
subcutaneously administered etanercept in
patients with psoriasis. J. Pharmacokinet.
Pharmacodyn. 31:463.
9. Zhou H. 2005. Clinical pharmacokinetics of
etanercept: a fully humanized soluble recombinant
tumor necrosis factor receptor fusion protein. J. Clin.
Pharmacol. 45:490.
10. Keystone E.C., M.H. Schiff, J.M. Kremer, S.
Kafka, M. Lovy, T. DeVries et al. 2004. Once-
weekly administration of 50 mg etanercept in
patients with active rheumatoid arthritis: results of a
multicenter, randomized, double-blind, placebo-
controlled trial. Arthritis Rheum. 50:353.
11. Krueger G.G., R.G. Langley, A.Y. Finlay, C.E.
Griffiths, J.M. Woolley, D. Lalla et al. 2005.
Patient-reported outcomes of psoriasis improvement
with etanercept therapy: results of a randomized
phase III trial. Br. J. Dermatol. 153:1192.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 231-235 (2006)

SHORT REPORT
CYTOKINES IN THE NASAL WASHES OF CHILDREN WITH RESPIRATORY
SYNCYTIAL VIRUS BRONCHIOLITIS

F. MIDULLA, V. TROMBA, L. LO RUSSO, F. MILETO, G. SABATINO1, M. SGARRELLA1, J.R.

PANUSKA2, L. MANGANOZZI, D. KORN and C. MORETTI

Department of Pediatric Emergency, University of Rome “La Sapienza”, Italy;

1
Department of Pediatric. University of Chieti, Italy
2
Department of Medicine, Case Western Reserve University, Cleveland, Ohio

Received May 16, 2005 – Accepted January 12, 2006

Although respiratory syncytial (RS) virus is the major cause of bronchiolitis and pneumonia in
young children, the factors that regulate the associated lung inflammation have not been defined. The
levels of interleukin (IL)10, IL-12, and interferon (IFN) were determined in the nasal wash samples
from 20 infants with a clinical diagnosis of bronchiolitis, seven with confirmed RS virus infections and
9 control children without respiratory illnesses. IL-10 levels were significantly higher in acute nasal
wash samples (1-4 d post-hospitalization) from RS virus- infected infants than in convalescent samples
from these children (14-21 d post-hospitalization), from children with other forms of bronchiolitis and
from control children. In contrast, only one RS virus-infected infant had detectable IL-12 in an acute
nasal wash sample. IFN activity was not detected in any samples from RS virus-infected children. RS
virus infection stimulates IL-10 expression but not IL-12 and IFN, possibly contributing to an
ineffective cell-mediated immune response.

Respiratory syncytial (RS) virus is the major cause
of bronchiolitis and pneumonia in normal or
immunocompromised infants (1). A formalin-
inactivated vaccine for RS virus proved to be
deleterious (2). RS virus causes repeated infections
indicating that natural infection does not induce
effective immunity. Although virus-specific IgE is
rapidly detectable in infected children (3), virus-
specific IgG, IgA and cell-mediated immunity are
often detectable only after the acute infection has
resolved (4). These results suggest that RS virus may
induce an imbalance in the local immune response
delaying specific antiviral immunity thus permitting
efficient viral replication. It has been demonstrated
that RS virus suppresses human alveolar macrophage
expression of early immunoregulatory and anti-viral
cytokines through induction of IL-10, a potent
cytokine synthesis inhibitor (5). IL-10 also inhibits
cell-mediated immunity by decreasing expression of
IFN, tumor necrosis factor, and IL-12 (6).
To examine whether RS virus altered expression of
IL-10, IL-12, and IFN, the levels of these cytokines
were measured in nasal wash samples from children
with confirmed RS virus-induced bronchiolitis and

Key words: IL-10, IL-12, IFN, respiratory syncytial virus, bronchiolitis, nasal washes

Mailing address:
Fabio Midulla, M.D.
Department of Pediatric Emergency
University of Rome “La Sapienza”
Viale Regina Elena 324 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Rome, Italy 00161 This publication and/or article is for individual use only and may not be further
Tel +39-06-4997-7363 - Fax: +39 06 49977413 reproduced without written permission from the copyright holder.
E mail: midulla@unrioma1.it
231 Unauthorized reproduction may results in financial and other penalties
232 F. MIDULLA ET AL.
children with bronchiolitis from other causes, as well
as normal children.
MATERIALS AND METHODS
Patients
This study included 29 infants who were seen in the
Pediatric Clinic of the University of Rome “La Sapienza”
during the winter season of 1999-2000. Twenty patients
were diagnosed with bronchiolitis (mean age 3.6 months;
range 1-15 months) based on clinical examination, chest
radiographs, pulse oximetry and complete virological and
bacteriological cultures. Nine control infants without
respiratory disease (mean age 10.4 months; range 2-24
months) were examined.
Nasal Washes
One to four days after hospitalization all patients and
controls underwent nasal lavage (acute samples). Nasal
washes were performed by instilling two aliquots of
sterile saline (3 ml per aliquot) into each nostril via a
syringe then recovering fluid by gentle aspiration.
Returned volume of nasal lavage fluid did not differ
significantly between acute RS virus-infected and non-
infected children, convalescent children and control
children. Aliquots of nasal lavages were immediately
cultured for pathogenic bacteria, Chlamydia trachomatis,
and Mycoplasma pneumonia by standard techniques.
Separate aliquots were cytocentrifuged, fixed in ice-cold
methanol [acetone (3:1 v/v)] and analyzed for virus
protein expression by indirect immunofluorescence for
Adenovirus, Influenza A and B, Parainfluenza virus 1,2,3
and RS virus (Baxter Immunodiagnostics, West
Sacramento CA). Parallel aliquots were frozen at -80°C
until analyzed by specific ELISA for IL-10 (Bender,
Medsystems, Vienna, Austria) and IL-12 (R&D Systems,
Minneapolis, MN). There was no obvious correlation
between IL-10 levels collected in nasal lavages on day 1
compared to day 4. IFN activity was determined by
inhibition of RS virus replication in Hep-2 cells (2 IU/ml
lower limit of detection) using the methods previously
described. Clinical samples were assessed for IL-10, IL-
12 and interferon recovery by adding recombinant
cytokines to parallel aliquots. Recovery of all cytokines
exceeded 80%. The lower limit of sensitivity for IL-10
was 2 pg/ml and for IL-12 it was 0.5 pg/ml.
Statistics
Statistical analysis was performed using non-
parametric Wilcoxon rank-sum tests for RS virus-infected
acute and convalescent samples. Mann-Whitney tests
were used for comparison between RS virus-infected
children and children with RS virus-negative
bronchiolitis and normal children. Results are presented
as mean ± SEM, and P values less than 0.05 were
considered significant.
RESULTS
RS virus was detected by immunofluorescence in 7
of 20 children with bronchiolitis (35%) who had been
infected during a winter outbreak of RS virus. None of
these children had pneumonia on chest radiographs.
No other viruses were detected in the nasal samples
from children with bronchiolitis or the 9 control
children. None of the nasal wash samples contained
detectable pathogenic bacteria including Chlamydia
trachomatis or Mycoplasma pneumoniae.
IL-10 levels were significantly higher in nasal
samples from children with acute RS virus infection
than in convalescent samples (46.1 ± 9.6 versus 22.4
± 4.5 pg/ml; P<0.03) (Fig. 1). In addition, IL-10
levels were significantly higher in samples from
children with acute RS virus infection than in
children with bronchiolitis of unknown cause (46.1
± 9.6 versus 20.9 ± 2; P<0.006) or control children
without respiratory disease (23.8 ± 4.4; P<0.02)
(Fig. 1). IL-10 levels in convalescent samples from
RS virus-infected children did not differ
significantly from children with bronchiolitis of
unknown cause or controls. In contrast, IL-12 levels,
in parallel aliquots from these children, were
undetectable except for one RS virus-infected child
whose acute lavage sample contained IL-12 at 72
pg/ml with IL-10 present at 54 pg/ml.
Although children with bronchiolitis of unknown
cause who were negative for viral antigens by
immunofluorescence may have had a preceding viral
infection, their undetectable levels of viral antigens
indicated that viral replication was not active at the
time of examination. IFN activity was not detectable
in any RS virus-infected samples, but was detectable
in four children with bronchiolitis of unknown cause
(28 ± 24 IU/ml; range 6-72).
DISCUSSION
Although nasal wash samples from RS virus-
infected infants (7) contain increased levels of IL-8,
no studies have yet determined the levels of other
 Int. J. Immunopathol. Pharmacol. 233

Fig. 1. IL-10 levels (pg/ml) in nasal lavage samples obtained from children during acute or convalescent respiratory
syncytial (RS) virus infections, bronchiolitis of undetermined cause, or control children without lung infection are
indicated. Values shown are mean values from duplicate aliquots. Horizontal lines represent mean values for each
group. Brackets indicate P values determined between groups analyzed by Wilcoxon tests (acute and convalescent RS
virus-positive samples) or Mann-Whitney tests for RS virus-positive versus RS virus-negative or control groups.

important immunoregulatory cytokines. The results
presented here extend prior studies (8-9) and
indicate that acute nasal wash samples from RS
virus-infected children contain markedly elevated
levels of IL-10. After the infection resolves, IL-10
decreases to levels found in control children (non-
respiratory illnesses). In contrast, none of the
parallel aliquots from any of the children we studied,
except from one RS virus-infected child, contained
detectable IL-12 or IFN activity. The lack of IL-12
or IFN in nasal lavage samples from RS virus-
infected children is consistent with prior studies
demonstrating that RS virus is a poor inducer of IFN
and often does not induce cellular immunity until
virus shedding has ceased (10-12). Elevated levels
of IL-10 in nasal wash samples from RS virus-
infected children may serve to suppress the
expression of IL-12 and IFN, which can activate
anti-viral pathways and drive cell-mediated immune
responses (12). Il-10 also promotes the production
of IgE which has been previously found to be
rapidly induced in RS virus-infected children and
associated with more severe disease (3). Thus,
RS virus induction of IL-10 may facilitate
efficient viral replication and interfere with cell-
mediated elimination of virus-infected cells.
Although IFN activates several anti-viral pathways
(14) we found no evidence of IFN activity in the nasal
washes of acute or convalescent samples from RS
virus-infected children. Nasal lavage samples
containing increased IL-10 uniformly lacked
detectable IFN activity, suggesting, in line with in vitro
studies, that IL-10 may inhibit IFN expression (15-
16). IL-10 promotes TH2 cell expansion and cytokine
expression, thereby directly promoting IgE production
(17). In contrast, IFN and IL-12 promote TH1 cell-
mediated immune responses (17). The exclusive
presence of IL-10 in nasal washes from acutely
infected RS infants indicates that this cytokine may
have a direct role in promoting IgE production and
delaying the expression of virus-specific neutralizing
antibodies and cell-mediated immunity.
234 F. MIDULLA ET AL.
It is possible that children with symptoms of
bronchiolitis, yet lacking detectable RS virus, might
have been infected with other lung tropic viruses or
have harbored RS virus at levels below the detection
sensitivity of the assays used. IFN activity was
detected in 4 of 13 patients with bronchiolitis of
unknown cause. Perhaps children with undetectable
RS virus lack detectable IL-10 while those with
detectable RS virus have elevated IL-10. If this
hypothesis is true, then we could envisage a dose-
response relationship between RS virus burden and
IL-10 expression. Increased viral burden and
elevated IL-10 levels may correlate with decreased
IL-12 and IFN. IL-10 was detectable in the nasal
lavages of all children, including those without
known respiratory disease. Thus IL-10 may serve to
regulate expression of pro-inflammatory cytokines
after RS virus infection, but it may also have a role
in homeostasis perhaps to inhibit expression of pro-
inflammatory cytokines (17). Although IL-10 levels
were elevated in acute samples of children with RS
virus bronchiolitis, it will be important to study
larger groups of children to determine the kinetics of
cytokine expression and to assess whether cytokine
levels correlate with disease severity.
IL-10, but not IL-12 and IFN, were present at
significantly elevated levels only in children with acute
RS virus-induced bronchiolitis and at higher levels in
this group than in children with non-RS virus-induced
bronchiolitis or control children. Increased IL-10 may
account for the delayed induction of virus-specific
neutralizing antibodies and cell-mediated immunity.
REFERENCES
1. Collins P.L., K. McIntosh and R.M. Chanock.
1996. Respiratory Syncytial Virus. In Virology. B.N.
Fields, D.M. Knipe, P.M. Howley, ed. Lippincott-
Raven Publishing. Philadelphia, p. 1285.
2. Kapikian A.Z., R.H. Mitchell, R.M. Chanock,
R.A. Shvedoff and E.R. Steward. 1969. An
epidemiologic study of altered clinical reactivity to
Respiratory Syncytial (RS) virus infection in
children previously vaccinated with an inactivated
RS virus vaccine. Am. J. Epidemiol. 89:405.
3. Welliver R.C., D.T. Wong, M. Sun, E. Middleton,
R.S. Vaughan and P.L. Ogra. 1981. The
development of respiratory syncytial virus-specific
IgE and the release of histamine in nasopharyngeal
secretions after infection. NEJM 305:841.
4. Tsutsumi H., S. Sone, Y. Yoto, N. Suzuki, T. Kudoh,
and S. Chiba. 1996. Respiratory syncytial virus
bronchiolitis in a girl undergoing chemotherapy for
acute lymphoblastic leukemia: an immunological
study of local secretion. Ped. Inf. Dis. J. 15:635.
5. Panuska J.R., R. Merolla, N.A. Rebert, S.P.
Hoffman, P. Tsivitse, N.M. Cirino, R.H.
Silverman and J.A. Rankin. 1995. Respiratory
syncytial virus induces interleukin-10 by human
alveolar macrophages. J. Clin. Invest. 96:2445.
6. Merolla R., N.A. Rebert, P.T. Tsivitse. S.P.
Hoffman and J.R. Panuska. 1995. Respiratory
syncytial virus replication in human lung epithelial
cells: inhibition by tumor necrosis factor α and IFN
βm. Am. J. Respir. Crit. Care Med. 152:1358.
7. Noah T.L., F.W. Henderson, I.A. Wortman, R.B.
Devlin, J. Handy, H.S. Koren and S. Becker. 1995.
Nasal cytokine production in viral acute upper
respiratory infection of childhood. J. Infect. Dis. 17:584.
8. Chung H.L., W.T. Kim, J.K. Kim, E.J. Choi, J.H.
Lee, G.H. Lee and S.G. Kim. 2005. Relationship
between atopic and nasal intereulin 10 and 11 levels
in infant with respiratory syncytial virus
bronchiolitis. Ann. Allergy Asthma Immunol. 94:267.
9. Bont L., C.J. Heijnem, A. Kavelaars, W.M. van
Aladeren, F. Brus, J.T. Draaisma, S.M. Greelen
and J.L. Kimpen. 2000. Monocyte IL-10
production during respiratory syncytial virus
bronchiolitis is associated with recurrent wheezing
in a one-year follow-up study. Am. J. Respir. Crit.
Care Med. 16:1518.
10. Nakayama T., S. Sonoda, T. Urano, K. Sasaki, N.
Mahera and S. Makino. 1993. Detection of alpha-
interferon in nasopharyngeal secretions and sera in
children infected with respiratory syncytial virus.
Pediatr. Infect. Dis. 12:925.
11. Hall C.B., R.G. Douglas, R.L. Simons and J.M.
Geiman. 1978. Interferon production in children
with respiratory syncytial, influenza and
parainfluenza virus infections. J. Pediatr. 93:28.
12. Joshi P, A.Shaw, A. Kakakios and D. Isaacs. 2003.
Interferon-gamma levels in nasopharingeal
 Int. J. Immunopathol. Pharmacol.
secretions of infants with respiratory syncytial viral
infections. Clin. Exp. Immunol. 13:143.
13. Scott P. 1993. IL-12: Initiation cytokine for cell-
mediated immunity. Science 260:496.
14. Sen G.C. and R.M. Ransohoff. 1993. Interferon-
induced antiviral actions and their regulation. Adv.
Virus Res. 42:57.
15. Hogan S.P., A. Moul, H. Kikutani, A.J. Ramsay
and P.S. Foster. 1997. Aeroallergen-induced
eosinophilic inflammation, lung damage and airways
235
hyperreactivity in mice can occur independently of
IL-4 and allergen-specific immunoglobulins. J. Clin.
Invest. 99:1329.
16. Bonfield T., J.R. Panuska, M. Konstan, J.
Hilliard, H. Ghnaim and M. Berger. 1995.
Inflammatory cytokines in cystic fibrosis lungs. Am.
J. Resp. Crit. Care Med. 152:2111.
17. Locksley R.M. 1993. Interleukin-12 in host
defense against microbial pathogens. Proc. Natl.
Acad. Sci. 90:5879.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 237-240 (2006)

CASE REPORT
INFLIXIMAB IN RECALCITRANT SEVERE ATOPIC ECZEMA ASSOCIATED WITH
CONTACT ALLERGY

N. CASSANO, F. LOCONSOLE, C. COVIELLO and G.A. VENA

Department of Internal Medicine, Immunology and Infectious Diseases, II Unit of Dermatology,

University of Bari, Italy

Received February 14, 2005 – Accepted September 22, 2005

Infliximab is an anti-tumour necrosis factor (TNF)-alpha chimeric monoclonal antibody which is

effective in diseases associated with a T-helper (Th) 1 response, such as rheumatoid arthritis, Crohn’s
disease and psoriasis. There are sporadic case reports of atopic dermatitis (AD) induced or precipitated by
anti-TNF-alpha therapy, which have been attributed to the switch towards Th2-mediated reactions. We
report the case of a 30-year-old man with long-standing severe AD associated with contact allergy and
poorly responding to conventional treatments. The use of infliximab resulted in a dramatic amelioration of
AD lesions and pruritus, persisting at follow-up examinations over a 3-year period. Probably, the
unexpected response to infliximab therapy in this case might be due to some peculiar features of AD in our
patient (i.e. chronic-continuous course and concomitant contact allergy) which could have been responsible
for a more preponderant recruitment of Th1 cells as compared to “common” forms of AD.

Infliximab is an anti-tumour necrosis factor (TNF)-
alpha chimeric monoclonal antibody which is
effective in diseases associated with a T-helper (Th) 1
response, such as rheumatoid arthritis, Crohn’s disease
and psoriasis (1-5). There are sporadic case reports of
immune-mediated cutaneous eruptions induced or
precipitated by anti-TNF-alpha therapy, including
atopic dermatitis (AD) (6-8). Unaware of the possible
risk of aggravating AD with anti-TNF- alpha therapy,
in January 2003, we used infliximab in a case of severe
recalcitrant AD associated with contact allergy.
MATERIALS AND METHODS
A30-year-old man presented with a 22-year history of AD,
which had notably worsened in the last 4 years, being
characterized by a continuous course, long-lasting widespread
lesions and incoercible pruritus, refractory to topical steroids
and H1-receptor antagonists. The patient also experienced two
episodes of erythrodermia associated with generalized
lymphadenopathy. The deterioration of AD included
pronounced impact on quality of life and mood disorders so
that after two years the patient received treatment with
paroxetine and benzodiazepines. He also presented a
concomitant contact sensitisation to nickel sulphate and
potassium bichromate but prevention did not cause any
substantial benefit on skin manifestations and symptoms. On
two separate occasions over the last three years,
histopathological analysis of skin samples taken from lesional
skin showed the typical findings of an eczematous dermatitis.
Systemic corticosteroids and cyclosporin gave only
partial temporary relief of AD and had to be discontinued
after a few months because of side effects, whereas
leukotriene antagonists and high-dose immunoglobulins did
not show any effects. Treatment with 0.1% tacrolimus

Key words: atopic dermatitis, contact allergy, infliximab, TNF-alpha, T helper cells

Mailing address:
Prof. G.A. Vena, MD
MIDIM Department, 2nd Unit of Dermatology - University of Bari
Policlinico, Piazza Giulio Cesare, 11 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
70124 Bari, Italy This publication and/or article is for individual use only and may not be further
Tel./Fax: 0039 080 5478920 reproduced without written permission from the copyright holder.
E-mail: g.vena@dermatologia.uniba.it
237 Unauthorized reproduction may results in financial and other penalties
238 N. CASSANO ET AL.
ointment caused a sustained improvement of facial lesions,
but an unsatisfactory control of pruritus and only a
slight/moderate patient’s self-perceived effect on AD located
on other sites because body lesions were diffuse and
continuously relapsing. For this reason, the patient
discontinued tacrolimus ointment after 6 months. Then,
immediately prior to the admission to our unit, the patient
was treated with topical mometasone furoate and cetirizine.
Relevant medical history also included childhood asthma
and rhinitis, and persistent hyperimmunoglobulinemia E
(>5,000 kU L-1). Hyper-IgE syndrome was excluded on the
basis of the absence of other typical manifestations (facial or
skeletal abnormalities, and relapsing infections) (9).
Diagnosis of AD was confirmed according to Hanifin and
Rajka criteria (10). On clinical examination, AD was
characterized by diffuse confluent lesions on the trunk and
limbs. SCORAD index (11), used to assess the extent and
intensity of AD lesions and the severity of symptoms, had a
value of 74. Histological examination of a biopsy specimen
disclosed the features of AD in chronic phase, with sparse
microvesicular spongiotic aspects and prominent
psoriasiform changes. After obtaining a written informed
consent, the patient was treated with infliximab.
RESULTS
Infliximab 3 mg/kg was given intravenously, and,
within a few hours, the patient noted a marked relief of
pruritus. During the post-infusion period, the
symptomatic therapy already used by the patient was
continued as needed. After a week, AD showed a slight
improvement (SCORAD: 58) which became
progressively more evident (SCORAD at 4 weeks:
21.3). At 6 weeks, because of pruritus exacerbation, a
second infusion of infliximab was administered at the
dose of 5 mg/kg and a rapid antipruriginous effect was
again obtained. AD notably improved in the subsequent
4 weeks, with a SCORAD value of 13.6. Treatment with
mometasone and cetirizine was gradually tapered and
completely stopped within 3 months, as was
psychotherapy. Since then, regular follow-up
evaluations have shown a stable improvement of AD
and itch (maximum value of SCORAD 25), with
symptom-free periods during summer months and
successful control of flares with tacrolimus ointment. An
indirect measure of AD improvement is also provided by
the consumption of tacrolimus tubes, the number of
which had an approximately 3- to 4-fold reduction as
compared with the number previously used. Moreover,
in the follow-up evaluations, topical tacrolimus was
applied on sparse and limited areas, especially on trunk,
face, neck, antecubital and popliteal folds. No adverse
events possibly related to infliximab were observed.
DISCUSSION
TNF-alpha is a multifunctional cytokine that
regulates not only immune response and
inflammation, but also tissue remodeling, keratinocyte
motility, cell cycle and apoptosis, as well as basement
membrane components and matrix metalloproteases
(12-13). Some evidence has suggested the relationship
between TNF-alpha-308*2 polymorphism, which is
associated with the increased secretion and activity of
TNF-alpha, and the risk of developing asthma or atopy
but there are still controversial data on this topic (14).
Increased secretion of TNF-alpha has been detected in
the respiratory tract of atopic asthmatics (15-16).
The role of TNF-alpha in AD is still unknown,
although it has been implicated in the expression of
adhesion molecules on both endothelia and keratinocytes
in this disease (17-18). Determination of TNF-alpha
plasma levels and production by mononuclear cells in
AD patients gave controversial results (19-22). It should
also be mentioned that CD30, which is a marker of Th2
cell activation and whose soluble form is significantly
elevated in AD, belongs to the TNF-receptor family (23).
Recently, it has been found that TNF-alpha is the main
inducer of inducible protein-10, belonging to the CXC
chemokine subfamily, by skin fibroblasts from patients
with atopic dermatitis (24).
To our knowledge, the present case represents the
first report of AD successfully treated with infliximab.
On the contrary, there are reports of AD or AD-like
eruptions being associated with the use of infliximab or
etanercept in patients with psoriasis, rheumatoid
arthritis or juvenile idiopathic arthritis (6-8). These
events have been attributed to the shift towards a
predominant Th2 response due to the downregulation of
Th1 cytokines caused by anti-TNF-alpha biologicals (8,
25). Therefore, considering these reports, AD could not
represent an indication for anti-TNF-alpha therapy,
unlike conventional systemic immunomodulating drugs
which have proved effective in both psoriasis and AD,
such as cyclosporin A (26-28). The results obtained in
our case appear to suggest that there can be selected
subgroups of AD patients who might benefit from
infliximab, although their discriminating characteristics
 Int. J. Immunopathol. Pharmacol.
are unknown. However, awaiting more precise data on
the mechanism of action of infliximab, we can
hypothesize that the chronic-continuous and recalcitrant
course of AD, as confirmed by the psoriasiform pattern
on histology, and the concomitant contact dermatitis in
our patient might have influenced a more preponderant
Th1-mediated response than that expected in
“common” forms of AD (29-34). Interestingly, some
evidence supports the role of TNF-alpha in the
pathogenesis of contact dermatitis (35-37).
*NOTE: After the submission of this paper, a
study evaluating treatment with infliximab in atopic
dermatitis has been published (Jacobi A. et al. 2005.
J. Am. Acad. Dermatol. 52:522)
REFERENCES
1. Maini R., E.W. St Clair, F. Breedveld, D. Furst, J.
Kalden, M. Weisman, J. Smolen, P. Emery, G.
Harriman, F. Feldman and P. Lipsky. 1999.
Infliximab (chimeric anti-tumour necrosis factor alpha
monoclonal antibody) versus placebo in rheumatoid
arthritis patients receiving concomitant methotrexate: a
randomised phase III trial. Lancet 354:1932.
2. Garnett W.R. and N. Yunker. 2001. Treatment of
Crohn’s disease with infliximab. Am. J. Health Syst.
Pharm. 58:307.
3. Chaudari U., P. Romano, L.D. Mulcahy, L.T.
Dooley, D.G. Baker and A.B. Gottlieb. 2001. Efficacy
and safety of infliximab monotherapy for plaque-type
psoriasis: a randomised trial. Lancet 357:1842.
4. Antoni C. and B. Manger. 2002. Infliximab for
psoriasis and psoriatic arthritis. Clin. Exp.
Rheumatol. 20:122.
5. Cassano N., F. Loconsole, A. Amoruso, C.
Coviello, M. Filieri, R. Filotico, S. Del Vecchio
and G.A.Vena. 2004. Infliximab monotherapy for
refractory psoriasis: preliminary results. Int. J.
Immunopathol. Pharmacol. 17:373.
6. Wright R.C. 2003. Atopic dermatitis-like
eruption precipitated by infliximab. J. Am. Acad.
Dermatol. 49:160.
7. Mangge H., S. Gindl, H. Kenzian and K. Schauenstein.
2003. Atopic dermatitis as a side effect of anti-tumor
necrosis factor-alpha therapy. J. Rheumatol. 30:2506.
239
8. Chan J.L., L. Davis-Reed and A.B. Kimball. 2004.
Counter-regulatory balance: atopic dermatitis in
patients undergoing infliximab infusion therapy. J.
Drugs Dermatol. 3:315.
9. Hsu C.T., Y.T. Lin, Y.H. Yang and B.L. Chiang.
2004. The hyperimmunoglobulin E syndrome. J.
Microbiol. Immunol. Infect. 37:121.
10. Hanifin J.M. and G. Rajka. 1980. Diagnostic features
of atopic dermatitis. Acta Derm. Venereol. 92(S):44.
11. European Task Force on Atopic Dermatitis. 1993.
Severity scoring of atopic dermatitis: the SCORAD
index. Consensus report of the European Task Force
on Atopic Dermatitis. Dermatology 186:23.
12. Locksley R.M., N. Killeen and M.J. Lenardo.
2001. The TNF and TNF receptor superfamilies:
integrating mammalian biology. Cell 104:487.
13. Banno T., A. Gazel and M. Blumenberg. 2004.
Effects of tumor necrosis factor-alpha (TNF alpha)
in epidermal keratinocytes revealed using global
transcriptional profiling. J. Biol. Chem. 279:32633.
14. Wang T.N., W.Y. Chen, T.H. Wang, C.J. Chen,
L.Y. Huang and Y.C. Ko. 2004. Gene-gene
synergistic effect on atopic asthma: tumour necrosis
factor-alpha-308 and lymphotoxin-alpha-NcoI in
Taiwan’s children. Clin. Exp. Allergy 34:184.
15. Gosset P., A. Tsicopoulos, B. Wallaert, C.
Vannimenus, M. Joseph, A.B. Tonnel and A.
Capron. 1991. Increased secretion of tumour necrosis
factor alpha and interleukin-6 by alveolar macrophages
consecutive to the development of the late asthmatic
reaction. J. Allergy Clin. Immunol. 88:561.
16. Ying S., D.S. Robinson, V. Varney, Q. Meng, A.
Tsicopoulos, R. Moqbel, S.R. Durham, A.B. Kay
and Q. Hamid. 1991. TNF alpha mRNA expression
in allergic inflammation. Clin. Exp. Allergy 21:745.
17. de Vries I.J., E.G. Langeveld-Wildschut, F.C. van
Reijsen, G.R. Dubois, J.A. van den Hoek, I.C.
Bihari, D. van Wichen, R.A. de Weger, E.F. Knol,
T. Thepen and C.A. Bruijnzeel-Koomen. 1998.
Adhesion molecule expression on skin endothelia in
atopic dermatitis: effects of TNF-alpha and IL-4. J.
Allergy Clin. Immunol. 102:461.
18. Ackermann L. and I.T. Harvima. 1998. Mast cells
of psoriatic and atopic dermatitis skin are positive
for TNF-alpha and their degranulation is associated
240 N. CASSANO ET AL.
with expression of ICAM-1 in the epidermis. Arch.
Dermatol. Res. 290:353.
19. Sumimoto S., M. Kawai, Y. Kasajima and T.
Hamamoto. 1992. Increased plasma tumour
necrosis factor-alpha concentration in atopic
dermatitis. Arch. Dis. Child. 67:277.
20. Takahashi T., Y. Sasaki, K. Hama, M. Furue and
Y. Ishibashi. 1992. Production of IL-4, IL-2, IFN-
gamma, and TNF-alpha by peripheral blood
mononuclear cells of patients with atopic dermatitis.
J. Dermatol. Sci. 3:172.
21. Laan M.P., H. Koning, M.R. Baert, A.P. Oranje,
W.A. Buurman, H.F. Savelkoul and H.J. Neijens.
1998. Levels of soluble intercellular adhesion
molecule-1, soluble E-selectin, tumor necrosis factor-
alpha, and soluble tumor necrosis factor receptor p55
and p75 in atopic children. Allergy 53:51.
22. Bunikowski R., K. Gerhold, M. Brautigam, E.
Hamelmann, H. Renz and U. Wahn. 2001. Effect of
low-dose cyclosporin a microemulsion on disease
severity, interleukin-6, interleukin-8 and tumor
necrosis factor alpha production in severe pediatric
atopic dermatitis. Int. Arch. Allergy Immunol. 125:344.
23. Bengtsson A., L. Holm, O. Back, J. Fransson and A.
Scheynius. 1997. Elevated serum levels of soluble
CD30 in patients with atopic dermatitis (AD). Clin.
Exp. Immunol. 109:533.
24. Villagomez M.T., S.J. Bae, I. Ogawa, M.
Takenaka and I. Katayama. 2004. Tumour
necrosis factor-alpha but not interferon-gamma is the
main inducer of inducible protein-10 in skin
fibroblasts from patients with atopic dermatitis. Br.
J. Dermatol. 150:910.
25. Frydas S., E. Karagouni, M. Hatzistilianou, D.
Kempuraj, S. Comani, C. Petrarca, T. Iezzi, N.
Verna, P. Conti and M.L. Castellani. 2004.
Cytokines and allergic disorders: revisited study. Int.
J. Immunopathol. Pharmacol. 17:233.
26. Verna N., E. Cavallucci, F. Di Stefano, S. Ramondo,
F. Paolini, R. Caruso, M. Grana, M. Mariano, C.
Schiavone, R. Paganelli and M. Di Gioacchino.
2002. Cyclosporin-A in allergic diseases. Int. J.
Immunopathol. Pharmacol. 15(S):29.
27. Peris K., M.C. Fargnoli, C. Mordenti, M.S.
Chimenti and S. Chimenti. 2002. Cyclosporin A
for treatment of psoriasis. Int. J. Immunopathol.
Pharmacol. 15(S):35.
28. Masci S. and M. Andreassi. 2002. Atopic
dermatitis and cyclosporin. Int. J. Immunopathol.
Pharmacol. 15(S):41.
29. Thepen T., E.G. Langeveld-Wildschut, I.C. Bihari,
D.F. van Wichen, F.C. van Reijsen, G.C. Mudde
and C.A. Bruijnzeel-Koomen. 1996. Biphasic
response against aeroallergen in atopic dermatitis
showing a switch from an initial TH2 response to a
TH1 response in situ: an immunocytochemical study.
J. Allergy Clin. Immunol. 97:828.
30. Werfel T., A. Morita, M. Grewe, H. Renz, U.
Wahn, J. Krutmann and A. Kapp. 1996. Allergen-
specificity of skin-infiltrating T-cells is not restricted
to a type 2 cytokine pattern in chronic skin lesions of
atopic dermatitis. J. Invest. Dermatol. 107:871.
31. Grewe M., C.A. Bruijnzeel-Koomen, E. Schopf, T.
Thepen, A.G. Langeveld-Wildschut, T. Ruzicka T
and J. Krutmann. 1998. A role for Th1 and Th2
cells in the immunopathogenesis of atopic
dermatitis. Immunol. Today 19:359.
32. Chen L., O. Martinez, L. Overbergh, C. Mathieu, B.S.
Prabhakar and L.S. Chan. 2004. Early up-regulation of
Th2 cytokines and late surge of Th1 cytokines in an atopic
dermatitis model. Clin. Exp. Immunol. 138:375.
33. Romagnani S. Th1 and Th2 in human diseases.
1996. Clin. Immunol. Immunopathol. 80:225.
34. Girolomoni G., S. Sebastiani, C. Albanesi and A.
Cavani. 2001. T-cell subpopulations in the
development of atopic and contact allergy. Curr.
Opin. Immunol. 13:733.
35. Lisby S., K.M. Muller, C.V. Jongeneel, J.H.
Saurat and C. Hauser. 1995. Nickel and skin
irritants up-regulate tumor necrosis factor-alpha
mRNA in keratinocytes by different but potentially
synergistic mechanisms. Int. Immunol. 7:343.
36. Becke F.M., T. Hehlgans, G. Brockhoff and D.N.
Mannel. 2001. Development of allergic contact
dermatitis requires activation of both tumor necrosis
factor-receptors. Eur. Cytokine Netw.12:45.
37. Westphal G.A., A. Schnuch, R. Moessner, I.R.
Konig, B. Kranke, E. Hallier, A. Ziegler and K.
Reich. 2003. Cytokine gene polymorphisms in allergic
contact dermatitis. Contact Dermatitis 48:93.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 241-244 (2006)

CASE REPORT
ENCRUSTED CYSTITIS IN AN IMMUNOCOMPROMISED PATIENT: POSSIBLE
COINFECTION BY CORYNEBACTERIUM UREALYTICUM AND E. COLI

M. PENTA, D. FIORITI, A. CHINAZZI, V. PIETROPAOLO, M.P. CONTE, S. SCHIPPA, M.

TECCA, V. GENTILE1, C. DE DOMINICIS1 and F. CHIARINI

Department of Public Health Sciences, 1Department of Urology, “La Sapienza” University, Rome, Italy

Received February 15, 2005 - Accepted October 21, 2005

Encrusted cystitis is a severe chronic inflammatory disease of the bladder characterized by excessively
alkaline urine and calcifications within the bladder wall. A case of a 60 year-old man affected by systemic
lupus erythematosus (SLE), which developed encrusted cystitis due to Corynebacterium urealyticum with
E. coli coinfection, shows that the treatment of encrusted cystitis with a endoscopic debulking of the
encrusted stones and an antimicrobial therapy specific for C. urealyticum often is not sufficient for the
complete resolution of symptoms.

C. urealyticum is a Gram-positive, slow-growing, intermittent hematuria with urinary gravel. He had

multiresistant, urease-positive microorganism with
diphtheroid morphology. Since 1985 it has been
known as a cause of alkaline encrusted cystitis and
other urinary tract infections (1), occurring mainly
in patients subjected to urological manipulation.
Alkaline encrusted cystitis is a condition
characterized by the deposition of inorganic salts on
a damaged urothelium. The patient presents
symptoms of cystitis (2). Moreover C. urealyticum
has been involved in endocarditis, pneumonia,
peritonitis, osteomyelitis and soft-tissue infections
(3). We report a case of encrusted cystitis due to
Corynebacterium urealyticum in a patient with SLE.
MATERIALS AND METHODS
A 60 year-old man, affected by SLE and in treatment
with steroid therapy, presents with persistent symptoms of
urinary tract infection including dysuria, pollakiuria, and
undergone cystoscopy, which showed stone deposits in
the bladder wall. Analysis of the urinary stone deposits on
the bladder mucosa revealed the presence of ammonium
magnesium phosphate (struvite) and calcium hydroxy
phosphate (apatite).
The urine sample was plated onto modified
MacConkey agar (Oxoid) and CLED (cystine-lactose-
electrolyte-deficient) agar and incubated at 37°C for 48 h.
The identification and the antibiotic sensitivity testing for
common pathogen germs were performed with the
Phoenyx identification system (Becton Dickinson, USA).
The urine and pus culture for Corynebacterium spp. on
7% sheep blood agar (Oxoid, England) was performed
with incubation at 37°C in air for 24 h. The
microbiological criteria for identification of C.
urealyticum were the presence of gram-positive bacteria
with diphtheroid morphology catalase-positive and
strongly urease-positive. For identification the API-
Coryne identification strip (API Laboratory Products;
bio-Mérieux, France) and the Phoenyx identification
system (Becton Dickinson, USA) were utilised. The

Key words: encrusted cystitis, Corynebacterium urealyticum, E.coli, bladder, coinfection

Mailing address:
Valeria Pietropaolo Ph.D.
Department of Public Health Sciences
Faculty of Medicine “La Sapienza” University
P.le Aldo Moro, 5 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
00185 Rome, Italy This publication and/or article is for individual use only and may not be further
Tel.: +39 06 4991443 - Fax : +39-06-49914626 reproduced without written permission from the copyright holder.
E-mail : valeria.pietropaolo@uniroma1.it
241 Unauthorized reproduction may results in financial and other penalties
242 M. PENTA ET AL.
antibiotic sensitivity testing for C. urealyticum was
performed with Disk Diffusion Susceptibility Testing
(Kirby-Bauer Method) and with the following antibiotics:
cefuroxime, norfloxacin, amoxicillin/clavulanic acid,
gentamicin, piperacillin/tazobactam, vancomycin and
ceftazidime.
RESULTS
The first urine culture for common pathogen
germs performed in MacConkey and CLED agar
and incubated at 37°C for 48 h. was negative.
Microscopic analysis of the urine showed 10-20
leucocytes with +++ bacteria/field (m.f.). The urine
pH was >9.0. Two months later the patient
presented again with persistent symptoms of
urinary tract infection. A second cystoscopy was
performed and revealed the reappearance of stone
deposits in the bladder mucosa. In addition, a
biopsy was performed on both pathologic and
healthy tissues. Histological examination of a
biopsy taken from the bladder wall showed a
chronic ulcerative and necrotic inflammation
(infiltrates of lymphocytes, plasma cells and
neutrophilic granulocytes) with no signs of
malignancy. Moreover, the urine culture for
Corynebacterium spp. was also performed. The
Fig.1. Growth of C. urealyticum on blood agar. The
culture on 7% sheep blood agar (Oxoid, England) after
24 h of aerobic incubation at 37°C in air revealed non
hemolytic pinpoint colonies (arrow).
culture revealed non-hemolytic pinpoint colonies.
The microbiological criteria for identification of C.
urealyticum were the presence of gram-positive
bacteria with diphtheroid morphology catalase-
positive and strongly urease-positive. The API-
Coryne identification strip, profile obtained
(2101004), identified as C. urealyticum in the
isolate with 99.9% probability. The antibiotic
sensitivity testing was performed using the Kirby-
Bauer Method and showed susceptibility to
cefuroxime, norfloxacin, amoxicillin/clavulanic
acid, gentamicin, piperacillin/tazobactam and
vancomycin. The patient was treated successfully
with amoxicillin/clavulanic acid for ten days. On
follow-up the patient was clinically well, with
resolution of his complaints. Urine culture for C.
urealyticum one month after the start of antibiotic
therapy was negative, whereas the urinary sediment
culture was positive again for C. urealyticum;
identification was confirmed by the API-Coryne
system, profile code 2101004. The results of antibiotic
sensitivity testing were identical to the previous test,
therefore the patient was treated with vancomycin for
10 days. One month after the following antibiotic
therapy, the urine contained mucus, pus and blood,
with a strong odor of ammonia and the patient
presented with dysuria, urethral discomfort and
urinary urgency. The pus culture for C. urealyticum
search was negative, but was positive for gram-
negative bacteria. In fact, the Phoenyx identification
system revealed E. coli (10.000 UFC/ml). The patient
was treated successfully with ciprofloxacin for 10
days. The last urine culture for C. urealyticum and for
common pathogens search was negative.
DISCUSSION
C. urealyticum is a Gram-positive, slow-growing
on blood agar (Fig. 1), nonmotile, catalase-positive,
multiresistant, urease-positive microorganism with
filamentous morphology (Corynebacteria are often
pleomorphic). This bacterium has been involved in
endocarditis, (4) pericarditis (5), bacteriemia (6),
peritonitis (7), osteomyelitis (8), necrotic infections of
soft-tissue(3), and wound infections (9). Since 1985 it
has been known as a cause of alkaline encrusted
cystitis and other urinary tract infections (UTI) (1),
occurring mainly in debilitated or transplanted patients
 Int. J. Immunopathol. Pharmacol.
subjected to urological manipulation (10). Alkaline
encrusted cystitis is a condition characterized by
mucosal inflammation with deposits of ammonium
magnesium phosphate on the urothelium. This occurs
when urease-producing microorganisms cause a rise in
the pH of the urine which, in turn, precipitates the
deposition of the inorganic salts. The patient presented
with symptoms of cystitis (11). Symptoms of UTI in
the presence of urine with alkaline pH and struvite
crystals are strongly suggestive of infection with C.
urealyticum (12). The incidence of UTIs due to C.
urealyticum is less than 2% worldwide (13). Treatment
of C. urealyticum urinary infection may be difficult.
This microorganism has been found to be highly
resistant to antimicrobical agents, including
nitrofurantoin, trimethoprim-sulfamethoxazole,
ampicillin and cephalothin, those agents commonly
used to UTIs (14). In our case, however, the strain
was susceptible to many antibiotics; therefore the
patient was treated with amoxicillin/clavulanic acid
and subsequently with vancomycin. After treatment,
even though the last urine culture for C. urealyticum
was negative, the patient presented with a UTI positive
for E. coli. Therefore, the patient was treated with
ciprofloxacin for ten days and finally he was clinically
well with complete resolution of his complaints.
The present paper discloses an uncommon case
of encrusted cystopathy with alkaline urine
associated to uroinfection by C. urealyticum and E.
coli. The coexistence of encrusted cystitis (15) and
E. coli superinfection remains unknown. Our data
show that the treatment of encrusted cystitis with a
cystoscopic resection of the encrusted stones and an
antimicrobical therapy specific for C. urealyticum
often is not sufficient for the complete resolution of
symptoms in cases of E. coli superinfection.
REFERENCES
1. Soriano F., C. Ponte, M. Santamaria, J.M.
Aguado, I. Wilhelmi, R. Vela and L.C. Delatte.
1985. Corynebacterium group D2 as a cause of
alkaline-encrusted cystitis: report of four cases and
characterization of the organisms. J. Clin.
Microbiol. 21:788.
2. Berney D.M., I. Thompson, M. Sheaff and S.I.
Baithun. 1996. Alkaline encrusted cystitis
associated with malakoplakia. Histopathol. 28:253.
243
3. Saavedra J., J.N. Rodriguez, A. Fernandez-
Jurado, M.D. Vega, L. Pascual and D. Prados.
1996. A necrotic soft-tissue lesion due to
Corynebacterium urealyticum in a neutropenic child.
Clin. Infect. Dis. 22:851.
4. Ena J., J. Berenguer, T. Pelaez and E. Bouza.
1991. Endocarditis caused by Corynebacterium
group D2. J. Infect. 22:95.
5. Ojeda-Vargas M., M.A. Gonzalez-Fernandez, D.
Romero, A. Cedres and C. Monzon-Moreno.
2000. Pericarditis caused by Corynebacterium
urealyticum. Clin. Microbiol. Infect. 6:560.
6. Wood C.A. and R. Pepe. 1994. Bacteriemia in a patient
with non-urinary tract infection due to Corynebacterium
urealyticum. Clin. Infect. Dis. 19:367.
7. Van Bosterhaut B., G. Claeys, J. Gigi and G.
Wauters. 1987. Isolation of Corynebacterium group
D2 from clinical specimens. Eur. J. Clin. Microbiol.
Infect. Dis. 6:418.
8. Chomarat M., P. Breton and J. Dubost. 1991.
Osteomyelitis due to Corynebacterium group D2.
Eur. J. Clin. Microbiol. Infect. Dis. 10:43.
9. Soriano F., C. Ponte, P. Ruiz and J. Zapardiel.
1993. Non-urinary tract infections caused by
multiply antibiotic-resistant Corynebacterium
urealyticum. Clin. Infect. Dis. 17:890.
10. Vazquez V., M.D. Morales, C. Serrano, M. Reus,
S. Llorente and J. Garcia. 2004. Corynebacterium
urealyticum in renal trasplantation. CT and
sonography imaging characteristics of encrusted
cistitis and pielitis. Nefrologia 24:288.
11. Giannakopoulos S., G. Alivizatos, C. Deliveliotis,
A. Skolarikos, J. Kastriotis and F. Sofras. 2001.
Encrusted cystitis and pyelitis. Eur. Urol. 39:446.
12. Karayannis A., D. Picramenos, F. Sofras, D.
Karanastasis, I. Stenos and T. Becopoulos. 1993.
Encrusted cystitis: aetiology, clinical aspects and
management. Br. J. Urol. 72:571.
13. Nebreda-Mayoral T., J.L. Munoz-Bellido and
J.A. Garcia-Rodriguez. 1994. Incidence and
characteristics of urinary tract infections caused by
Corynebacterium urealyticum (Corynebacterium
group D2). Eur. J. Clin. Microbiol. Infect. Dis. 13:600.
14. Santamaria M., C. Ponte, I. Wilhelmi and F.
Soriano. 1985. Antimicrobial susceptibility of
244 M. PENTA ET AL.

Corynebacterium group D2. Antimicrob. Agents Arbash and E. Andrada Becerra. 1992. Encrusted
Chemother. 28:845. cystitis. Review of the literature and report of a case.
15. Romero Perez P., M. Amat Cecilia, A.R. Omera Actas. Urol. Esp. 16:496.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY
LETTER TO THE EDITOR
SURVEILLANCE COLONOSCOPY SHOULD BE CONDUCTED IN PATIENTS WITH
COLORECTAL SHISTOSOMIASIS EVEN AFTER SUCCESSFUL TREATMENT OF
THE DISEASE
T. KONISHI, T. WATANABE, J. SHIBAHARA1 and H. NAGAWA
Department of Surgical Oncology and 1Department of Pathology, University of Tokyo, Tokyo, Japan
Received November 30, 2005 – Accepted January 11, 2006
Dear Sir:
We have read with great interest the article by
Waku et al (1). They demonstrated a strong
association between the chronic Shistosoma infection
in the colorectum and the development of colorectal
cancer, and suggested that chronic inflammation due
to the chronic infection might induce the
carcinomatous transformation of the bowel
epithelium. Although their work is excellent, there is
one major point which needs further discussion.
It has been reported that chronic inflammation and
subsequent fibrosis due to the remnant inactive ova
could persist for years even after the successful
elimination of the active Schistosoma infection (2).
This is one of the important mechanisms by which
liver cirrhosis progresses and sometimes leads to the
development of liver cancer even after the treatment of
Schistosoma infection (2). Likewise, colorectal cancer
may develop due to the remnant old ova even without
active Schistosoma infection. We have previously
reported such a case (3). The case was a 55-year-old
Japanese man who was born and bred in Yamanashi
prefecture, a rural endemic area of Schistosoma
japonicum. Colonoscopy revealed an advanced rectal
cancer with multiple white-yellowish small spots
around the tumor. Histological examination of the
surgical specimen revealed that the white-yellowish
Key words: encrusted cystitis, Corynebacterium urealyticum, E. coli, bladder, coinfection
Mailing address:
Tsuyoshi Konishi
Department of Surgical Oncology, University of Tokyo,
7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan
Tel: +81-3-5800-8653
Fax: +81-3-3811-6822
E-mail: KONISHIT-SUR@h.u-tokyo.ac.jp
245
Vol. 19, no. 1, 245-246 (2006)
spots around the tumor corresponded to the nests of
old calcified ova of Schistosoma japonicum. Diffuse
fibrosis was observed around the foci, suggesting
chronic inflammation due to the presence of the old
ova. The patient needed no further treatment for
Schistosomiasis because the infection was old and
inactive. Nevertheless, the analysis of the resected
specimen revealed that the number of the remnant
calcified ova was extremely high in the area close the
tumor, suggesting an etiologic contribution of the
presence of massive ova to the development of cancer.
The article by Waku et al implies that
colonoscopy is needed for screening of colorectal
cancer in patients with chronic Shistosoma
infection. In addition, we advocate that periodical
colonoscopic surveillance should be conducted even
after the successful elimination of the infection,
because the remnant old ova could induce chronic
inflammation and finally lead to the development of
colorectal cancer.
REFERENCES
1. Waku M., L. Napolitano, E. Clementini, T. Staniscia,
C. Spagnolli, A. Andama, P. Kasiriye and P.
Innocenti. 2005. Risk of cancer onset in sub-Saharan
Africans affected with chronic gastrointestinal parasitic
0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
This publication and/or article is for individual use only and may not be further
reproduced without written permission from the copyright holder.
Unauthorized reproduction may results in financial and other penalties
246 T. KONISHI ET AL.

diseases. Int. J. Immunopathol. Pharmacol. 18:503. Watanabe, H. Nagawa, T. Muto, Y. Hirata, K.

2. Abdel-Hadi A.M. and M.Talaat. 2000. Histological Kimura and S. Kojima. 1999. Possible associations
assessment of tissue repair after treatment of human of rectal carcinoma with Schistosoma japonicum
schistosomiasis. Acta Trop. 77:91. infection and membranous nephropathy: a case
3. Matsuda K, T. Masaki, S. Ishii, H. Yamashita, T. report with a review. Jpn. J. Clin. Oncol. 29:576.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 11-33 (2006)

REVIEW ARTICLE
HORMONE REFRACTORY PROSTATE CANCER (HRPC):
PRESENT AND FUTURE APPROACHES OF THERAPY

G. DI LORENZO and S. DE PLACIDO

Dipartimento di Endocrinologia Molecolare e Clinica, Cattedra di Oncologia

Università degli Studi di Napoli Federico II, Naples, Italy

Received October 28, 2005 – Accepted January 10, 2006

The mainstay of therapy for patients with advanced prostate cancer still remains androgen deprivation,
although response to this is invariably temporary. Most of the patients develop hormone-refractory disease
resulting in progressive clinical deterioration and, ultimately, death. Until recently there has been no
standard chemotherapeutic approach for hormone refractory prostate cancer (HRPC), the major benefits
of chemotherapy being only palliative. The studies combining mitoxantrone plus a corticosteroid
demonstrated that chemotherapy could be given to men with symptomatic HRPC with minimal toxicity
and a significant palliation could be provided. Recently, results from 2 phase III randomized clinical trials
demonstrating that a combination of docetaxel plus prednisone can improve survival in men with HRPC
have propelled docetaxel-based therapy into the forefront of treatment options for these patients as the new
standard of care. There is a promising activity of new drug combinations such as taxanes plus vinca
alkaloids; bisphosphonates are assuming a prominent role in prostate therapy through their ability to
prevent skeletal morbidity. Combinations of classic chemotherapeutic agents and biological drugs began
to be tested in phase II-III trials and the first results appear interesting. This article focuses on
combinations recently evaluated or under clinical development for the treatment of HRPC.

In 2005, approximately 200,000 men were
diagnosed with prostate cancer and 30,000 men will
die from metastatic prostate cancer (1). Androgen
deprivation is only temporarily effective in metastatic
prostate cancer secondary to the development of
molecular mechanisms of tumor resistance.
Prostate cancer which grows despite castrate levels
of testosterone, which no longer responds to any form
of hormonal manipulation and for which non-hormonal
approaches are required, can be precisely defined as
hormone-refractory prostate cancer (HRPC) (2).
Chemotherapy (CT) for this stage of the disease has
been studied since early 1970 but the results have been
modest. In 1985 Eisenberger et al. reviewed 17
randomized clinical trials and found an objective
response rate (complete plus partial response) of 4.5%
(3). In 1992 Yagoda and Petrylak reviewed 26 trials
conducted between 1987 and 1991 and reported an
overall response rate of 8.7% (4). Therefore, in the past,
there has been a general reluctance to treat patients with
HRPC using CT as it was considered to be ineffective,
with unacceptable toxicity, especially in elderly patients

Key words: chemotherapy, hormone refractory prostate cancer, treatment

Mailing address:
Dr. Giuseppe Di Lorenzo
Cattedra di Oncologia Medica
Università degli Studi di Napoli Federico II, 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Via Pansini 5, 80131 Napoli, Italy This publication and/or article is for individual use only and may not be further
Tel: (+39)-081-7462053 - Fax: (+39)-081-2203147 reproduced without written permission from the copyright holder.
E-mail: giuseppedilorenzoncol@hotmail.com
11 Unauthorized reproduction may results in financial and other penalties
12 G. DI LORENZO ET AL.
with poor performance status. Moreover, many of these
early studies suffered from important methodological
flaws: some enrolled too few patients, others included a
heterogeneous group of patients within the same study
cohort, and there were no definitive objective response
criteria because of the typical behaviour of the disease.
For these reasons, until recently there has been no
standard chemotherapeutic approach for HRPC.
However, over the last 5 years previous skepticism has
been challenged by the development of new agents and
combinations, thanks to an increased understanding of
the biology of this form of prostate cancer, to the
evaluation of more appropriate response criteria, such as
prostate-specific antigen (PSA) and quality of life
(QoL) and to the consequent definition of newer
study end-points. In this article recent advances in
the treatment of HRPC using chemotherapeutic
regimens are reviewed.
Chemotherapy agents: before the Taxanes-Era
Anthracyclines Mitoxantrone is an anthracenedione
structurally related to anthracyclines such as
doxorubicin, although its toxicity profile is
considerably less. A multicenter phase II Canadian
study of mitoxantrone plus prednisone demonstrated a
significant palliative benefit for this combination (5). In
a multicenter phase II Australian trial, mitoxantrone,
without the concomitant use of corticosteroids,
demonstrates anticancer activity against HRPC (6), as
did another study performed by Otto et al (7). These
early experiences led to a randomized phase III
comparison of mitoxantrone plus prednisone versus
prednisone alone (8). Palliative response was the
primary end-point. Of the 80 randomized patients to
receive mitoxantrone and prednisone, 30 (38%) met
the criteria for a palliative response compared with 17
of 81 (21%) who received prednisone alone. Palliation
also lasted significantly longer in the patients receiving
the combination compared with those on prednisone
alone (median 43 versus 18 weeks). The patients
receiving prednisone alone were allowed to crossover
to receive mitoxantrone at the time of disease
progression. There was no significant difference in the
median survival rate between the two groups, possibly
owing to this crossover design. The treatment was well
tolerated with minimal hematological toxicity and
possible cardiac toxicity in 4% of the patients treated
with mitoxantrone. Patients achieving a more frequent
palliative response had a significant decline in PSA, but
no significant difference in PSA declines was noted
between the two treatment arms. In a Cancer and
Leukemia Group B Study, Kantoff et al. randomized
242 patients to mitoxantrone plus hydrocortisone
versus hydrocortisone alone (9). The primary end-point
was survival. No crossover was allowed. PSA declines
(>50%) were seen in 33% of the patients receiving
chemotherapy versus 18% on steroids alone. Survival
did not differ between the treatment arms. Overall, the
studies of mitoxantrone plus glucocorticoids have
shown that as many as 40% of the patients will have
improvements in pain and QoL with this treatment,
with a reasonable toxicity profile, although there does
not seem to be any significant impact on the overall
survival. For these reasons, the FDA approved the
mitoxantrone/corticosteroids combination as palliative
treatment for patients with HRPC. In a recent phase II
Cancer and Leukemia Group B study, the authors
thought to determine the safety and activity of higher
doses of mitoxantrone in combination with
granulocyte-macrophage colony-stimulating factor
(GM-CSF) and glucocorticoids, and they found that
higher doses of mitoxantrone had inacceptable degrees
and frequency of thrombocytopenia (10).
Doxorubicin alone may have a significant
palliative effect but it has minimal overall activity in
HRPC patients. This drug has been combined with
escalating doses of cyclophosphamide in a phase II
trial that enrolled 35 patients (11). 5 of the 15 patients
(33%) with measurable disease had evidence of a
response. 16 of the 35 patients (46%) had a >50%
decrease in PSA levels. This combination required
growth factor support and it was generally well-
tolerated, although 33% of the cycles were associated
with grade 4 neutropenia; febrile neutropenia occurred
in only 7.8% of all cycles.
In a study carried out by Culine et al. the weekly
administration of doxorubicin with estramustine
phosphate appeared to be a safe combination for
patients with HRPC (12). The biochemical response
rate was 58% among 31 assessable patients, and the
objective response rate was 45% in 11 patients with
measurable lesions. The morbidity of the
doxorubicin-estramustine phosphate combination
was generally acceptable; indeed only 2 patients
required intercurrent hospitalization for the
management of febrile episodes out of 12 who
 Int. J. Immunopathol. Pharmacol.
developed grade 3-4 neutropenia during treatment.
No cardiotoxicity was observed and these results
suggested that a weekly regimen with low doses of
doxorubicin was able to reduce side effects.
Another phase II study reported the results of
epirubicin, the 4’-epimer of doxorubicin, and
estramustine phosphate in 24 assessable patients
with HRPC. A biochemical response was noted in
54% of the patients although no objective response
occurred (13). Recchia et al. found that the
combination of epirubucin, mytomicin C and 5-
fluorouracil shows activity in the treatment of HRPC
patients, giving substantial palliation of symptoms
(14). After doxorubicin and other anthracyclines
were recognized as active antineoplastic agents,
several drug development programs examined
newer classes of compounds that would preserve the
DNA-intercalating ability and eliminate cardiac
toxicity as a side effect (liposomal anthracyclines).
Liposomal encapsulation may enhance its
therapeutic efficacy and also reduce toxicity.
Recently Heidenreich conducted a prospective
randomized phase II to evaluate feasibility, toxicity
and therapeutic efficacy associated with pegylated
doxorubicin. 48 patients were randomized to receive
pegylated liposomal doxorubicin at either 25 mg/mq
every 2 weeks for 12 cycles (Group A) or 50 mg/mq
every 4 weeks for 6 cycles (group B). The results
show that patients in group B had a significantly
higher rate of response to pain (52.6 vs 28.6; p=0.04)
and the mean 1-year survival rate was also
significantly higher in group B (42% vs 15%;
p=0.02) (15). Considering the promising results, the
dosage tested in the current study should be used in
future phase II and III trials.
Estramustine. Estramustine phosphate is a stable
coniugate of nor-nitrogen mustard and estradiol, the
cytotoxic activity of which stems from antimitotic
rather than any alkylating or steroid properties. The
mechanism of this antimitotic activity is believed to be
the binding of estramustine phosphate to microtuble-
associated proteins and tubulin, leading to microtubule
disassembly. As a single agent, it has a modest activity
in treating prostate cancer, with most studies reporting
rates of approximately 20% (16).
In a randomized multicenter trial the Danish
Prostatic Cancer Group compared the effect of
13
estramustine phospate to placebo as a supplement to
standard palliative therapy for patients with HRPC
(17). The selected dose of 560 mg/daily was lower
than that used by others. Estramustine phosphate was
not found to be superior to placebo as a second-line
therapy in patients with HRPC in terms of subjective
responses (18 vs 7%) and overall (9.4 vs 6.1 months)
and cancer-specific (10.3 vs 6.1 months) survival. Of
61 patients in the estramustine phosphate-treated
group, 29 achieved a reduction in PSA levels >25% at
1 month of follow-up compared to only 3 of 68
patients receiving placebo. A decrease in PSA levels
after 1 month correlated significantly with survival.
The semisynthetic podophyllotoxin derivative
etoposide is an inhibitor of topoisomerase II, a nuclear
matrix associated enzyme involved in DNA
replication and repair. Since estramustine also binds
nuclear matrix-associated proteins, a possible synergy
was suspected between these two drugs which was
confirmed in preclinical and clinical studies. In 1994
Pienta reported the results of a phase II trial using the
combination of oral estramustine 15 mg/kg/day and
oral etoposide 50 mg/m2/d in 52 CT-naïve patients
with HRPC (18). The response rate was 45% in those
with soft-tissue disease and 54% of the patients
showed at least a 50 % decrease of the PSA levels, but
a significant toxicity was noted. In an attempt to
reduce this toxicity these authors performed a second
phase II study using the same dose of etoposide but
with a reduction in the dose of estramustine to 10
mg/kg/d and included patients who had previously
received CT (19). Eight (53%) of 15 patients with
measurable disease had a partial response. Of the 47
patients with disease limited to bones, 16 patients
(34%) showed at least a 50 % reduction from baseline
PSA level. The toxicity was reduced in this trial. More
recently, the same group of investigators from the
University of Michigan presented the results of
another phase II trial showing the toxicity of
estramustine delivered in high doses (20). To confirm
the results of these studies Dimopoulos treated 56
patients with HRPC who had failed flutamide
withdrawal, obtaining response rates in 45% of the
patients with measurable lesions and documenting
>50% decrease of the PSA levels in 59% (21).
More recently, in a phase II study, Bracarda treated
32 patients with HRPC with estramustine phosphate
and low-dose cyclophosphamide (22). This
14 G. DI LORENZO ET AL.
combination was shown to be effective with a response
rate of 43.7% and above, both in terms of biochemical
response and symptom improvement, to each of the
two drugs. The toxicity was mild and mainly
gastrointestinal and no severe hematologic toxicity was
observed. A possible explanation for this can be found
in the intermittent administration of estramustine
phosphate and in the capacity of cyclophosphamide to
preserve bone marrow stem cells.
Vinca alkaloids. The effects of Vinca alkaloids
are presented in Table I. Vinblastine is an antitubulin
agent; it has been used in combination with
estramustine because of its complementary effects,
distinct molecular targets and different toxicity
profile (23). To compare this combination versus
vinblastine alone in patients with HRPC, a phase III
trial was conducted by Hudes et al. (24). It showed
that overall survival tended to favor estramustine-
vinblastine, but this was not statistically significant.
The estramustine-vinblastine combination was
superior to vinblastine alone for secondary end
points of time to progression. Albrecht et al. have
evaluated estramustine versus estramustine/vinblastine
in an EORTC trial. Much less favourable results were
reported, with a median survival of 93.5 and 46.6
weeks, respectively in 92 patients with hormone
refractory prostate cancer (25).
Vinorelbine has a modest toxicity and it is probably
the vinca alkaloid with the least neurotoxicity. In a
phase II trial performed by Fields-Jones et al. a durable
clinical benefit (response rate 39%) was shown,
defined by improvement in pain index and
performance status (26). Encouraging results have
been obtained recently by Oudard et al. in a phase II
study using vinorelbine on an out-patient weekly
schedule (27). In another study conducted by Carles
et al., of the 24 patients treated with a combination of
estramustine and vinorelbine, 9 (37.5%) had a decline
greater than 65% in the PSA levels, but no objective
response was observed in patients with measurable
disease (28). Colleoni demonstrated in a phase II study
that the combination of estramustine, oral etoposide
and vinorelbine is active in HRPC with a clinical
response rate of 32% and a biochemical response rate
of 56% (29). In the study performed by Hudes et al.
granulocytopenia occurred significantly less using
estramustine-vinblastine as compared to vinblastine
alone (grades 2, 3, and 4 in 7, 7, and 1% vs 27, 18, and
9% of the patients, respectively). An interesting
observation in this trial was that estramustine seemed
to provide protection against vinblastine-induced
granulocytopenia (25), however, grade 2, or worse,
nausea (26 vs 7%, respectively) and extremity edemas
(22 vs 8%, respectively) were more frequent in the
patients treated with estramustine-vinblastine.
The first randomised phase III study of intravenous
vinorelbine plus hormone therapy has been recently
published by Abratt (30). Patients with metastatic
prostate cancer, progressive after primary hormonal
therapy, were randomised to receive intravenous
vinorelbine (30 mg/mq) days 1 and 8 every 3 weeks and
hydrocortisone or hydrocortisone alone until disease
progression. The final analysis was performed on a total
of 414 patients. The primary end-point was progression-
free survival (PFS). Reported results were all based on
intention-to-treat analyses. The results have shown that
PFS was significantly prolonged in the Vinorelbine
group (p=0.055). The 6-month PFS rates were 33.2%
versus 22.8% and the median durations of PFS were 3.7
versus 2.8 months. The PSA response rate was
significantly higher for vinorelbine (VRL) +
hydrocortisone (HT) compared with HT (30.1 versus
19.2%, p< 0.01). Clinical benefit, defined as a decrease
in pain intensity or analgesic consumption or an
improvement of Karnofsky PS for at least 9 weeks, and
at least stable assessment in the other two, was also
more frequently observed in patients who received VRL
plus HT versus HT alone (30.6% and 19.2%; P=0.008).
There was no statistical difference in overall survival.
This study demonstrates that the combination of VRL
and hydrocortisone compared with hydrocortisone
alone results in improved clinical benefit, PFS and PSA
response rate. This therapeutic gain is similar to that
previously reported with mitoxantrone in combination
with low-dose corticosteroids. There was no gain in
survival; however, the combination is well tolerated in
this elderly group of patients, who often present cardiac
co-morbidities, and therefore offers an active and safe
therapeutic option for patients with hormone-refractory.
Vinorelbine has also been combinated with
estramustine and estramustine-mitoxantrone in two
recent trials. In the first trial 51 patients were treated
with vinorelbine (25 mg/mq) on days 1 and 8 every
3 weeks and estramustine (oral 600 mg/mq) daily
(31). PSA response which was the primary efficacy
 Int. J. Immunopathol. Pharmacol. 15

Table I. Studies with Vinca Alkaloids.

Authors Pts Regimens Clinical response/ Toxicity
Biochemical response (grade 3-4)
Hudes 201 Estramustine 600mg/mq QoL Improvement Neutropenia (8%),
days 1-42 q8 wks. 10%; Survival 9.2 edema (22%)
months; time to
progression: 2.2 months
vs vs. vs.
Estramustine 600mg/mq QoL Impr. 50%; Neutropenia (27%),
days 1-42 q8 wks. Survival 11.9 months; edema (8%).
Vinblastine 4mg/mq x 6 ws time to progression: 3.7
q 8 wks. months.
Attivissimo 15 Estramustine 10mg/kg x 6wk PSA decrease in 31.2% Paresthesias,
q8wks. of pts. diarrhea and nausea
Vinblastine 4mg/mq x 6wk
q8 wks.
Carles 25 Estramustine 600mg/mq PSA decrease in Nausea, vomiting
days1-42 q8 wks. 37.5% of pts. and peripheral
Vinorelbine 25mg/mq days neuropathy
1, 8, 22, 29 q8 wks.
Colleoni 25 Estramustine 400mg/mq x 6 Objective response in Neutropenia and
wks. 66% of pts. anemia
Vinorelbine 25mg days 1, 8, PSA decrease in 64% of
28, 35 q6 wks. pts.
Etoposide days 1-14, 28-42.
Fields-Jones 49 Vinorelbine 22mg/mq PSA decrease in 64% of Anemia and
weekly x 8 wks and then q2 pts. constipation
wks.
Oudard 47 Vinorelbine 25mg/mq Objective response in granulocytopenia
weekly x 8 wks. 75% of pts
PSA decrease in 17% of
pts
Abratt 414 Vinorelbine 30mg/mq 1,8 Progression-free Neutropenia 6.5%
q21 + hydrocortisone 40 survival better for
mg/day. Vinorelbine group.
vs PSA response rate was
Hydrocortisone alone. higher for the
vinorelbine group
Carles Galceran 51 Vinorelbine 25mg/mq g1,8 Objective response in Neutropenia 6.1%
q21. 29% of pts.
estramustine 600mg/mq PSA decrease in 41%.
daily. PFS 4.7 months.
Survival: 14.3 months
Samelis 52 Oral Estramustine. Objective response in Well tolerated
Vinorelbine 25mg/mq days 2 31% of pts.
and 9. PSA decrease in 56% of
Mitoxantrone 12mg day 2. pts.
q every; wks: weeks; PFS: progression-free survival; QoL: quality of life; Impr: Improvement;
pts: patients. Objective response: response in patients with measurable disease.
PSA decrease: decrease >50%. Grade 3-4 toxicity: according WHO scale.
16 G. DI LORENZO ET AL.
criterion was reported in 21 patients (41.2%) in the
intent to treat (ITT) population. Median progression-
free survival and overall survival were 4.7 months
and 14.3 months respectively.
The second trial was conducted by the Hellenic
Cooperative Oncology Group (32). 52 patients were
included in the study. The treatment schedule consisted
of estramustine capsules (140 mg 3 times daily on days
1 to 3 and days 8 to 10 per os), intravenous
mitoxantrone (12 mg/mq on day 2) and intravenous
vinorelbine (25 mg/mq on day 2 and day 9) given in a
3-week cycle. 31% of patients with measurable soft-
tissue disease demonstrated an objective response and
56% had a greater than 50% reduction in PSA. The
median duration of response was 6.9 months and the
median survival for all patients was 14.5 months.
Alkylating agents. The activity of cyclophosphamide
in combination with estramustine, etoposide or uracil
plus tegafur is described in three studies (22, 33-34).
Platinum compounds. Cisplatin has been shown to
be active in advanced prostate cancer. In preclinical
models there is evidence of synergism between
cisplatin and anthracyclines. The non-overlapping
toxicities of cisplatin and epirubicin prompted Huan to
conduct a phase II study of this combination in patients
with HRPC (35). This study produced a biochemical
response in 32%, symptomatic improvement in 38%
and a partial response of measurable diseases in 14% of
the patients. Veronesi et al. evaluated a multi-drug
regimen comprising cisplatin, epirubicin and
estramustine phosphate in terms of feasibility, toxicity
and activity in younger (<70 years) patients with
HRPC (36). The overall response rate was 39% and a
substantial improvement of symptoms was obtained in
17 of 19 (89%) patients. A moderate toxicity was
observed without any fatal events.
Second-generation analogs of cisplatin have been
produced which, in early studies, have had
quantitatively less toxicity than the parent
compound while retaining antitumor activity. A
study carried out by Miglietta evaluated the response
to carboplatin treatment in 40 patients with HRPC; a
palliative response was achieved in 56% of the
patients (37). In another phase II study performed by
the Swiss Group for Clinical Cancer Research
carboplatin was adminstered to 27 patients; it
showed only limited objective activity in HRPC, but
induced palliation in about half of the patients (38).
A combination regimen with etoposide, epirubicin
and carboplatin was used to treat 12 patients with
advanced prostate cancer (39); it showed a partial
response rate of 25% and pain relief was obtained in
44% of the patients; the regimen toxicities were
primarily hematologic.
A randomized, multicenter phase II study
evaluating oxaliplatin (a new analog of cisplatin)
alone and oxaliplatin –5-fluorouracil combination
has been published by Droz et al. (40). 54 patients
received oxaliplatin (OXA) 130 mg/mq alone or
with fluorouracil (OXAFU) (1000 mg/mq/day,
continuous intravenous infusion, days 1-4) every 3
weeks. Three partial responses occurred in 21
evaluable OXA patients (14%) and 5 of 26 evaluable
OXAFU patients (19%). Clinical benefit response
was assessed in 20 OXA and 22 OXAFU patients,
with more responders in the OXAFU arm. Median
time to progression in the OXA and OXAFU arms
was 2.6 and 3.4 months, and the median overall
survival was 9.4 and 11.4 months respectively.
Hematotoxicity was common, but mostly mild to
moderate. Neutropenia was more common in
OXAFU than OXA patients.
Antimetabolites. Hormone refractory prostate
cancer patients have been treated with 5-Fluorouracil
(5-FU) in several studies (41-44). In a phase II trial
performed by Morant 43 patients were treated with
another antimetabolite, gemcitabine, with a significant
beneficial impact on pain at the dose and schedule
indicated (1200 mg/m2 over 2 hours on days 1, 8
and15 of a 28-day cycle) (45).
Suramin. Suramin is a polysulfonated
naphthylurea, originally used to treat trypanosomiasis.
It has shown a concentration-dependent activity
against human prostate cancer cell-lines, acting as a
competitive inhibitor for a variety of cellular enzymes
and growth factors (46). A recent randomized study of
458 symptomatic HRPC patients comparing suramin
plus hydrocortisone to placebo plus hydrocortisone,
demonstrated significant improvements in pain (43
vs 28%), median duration of pain response (240 vs
69 days) and 50% PSA declines (32 vs 16%) (47).
Neither the QoL nor the performance status was
 Int. J. Immunopathol. Pharmacol.
affected by suramin treatment and the overall
survival was similar. Most adverse events were of
mild or moderate intensity and were easily managed
medically. Importantly, this study prospectively
controlled for a placebo effect as well as for the
effects of hydrocortisone and antiandrogen
withdrawal. The results demonstrate that suramin is
well tolerated and easily administered using the dose
schedule described, and such treatment seems to
offer moderate palliative benefits for patients with
symptomatic HRPC. The role of suramin in the
treatment of HRPC remains unclear. The great
variety of results of different published studies
derives from the heterogeneity of the patients
observed, the lack of a definitive therapeutic
schedule and the dose-dependent toxicity, all being
important confounding variables (48-52).
Chemotherapeutic agents: The Taxanes-Era
Taxanes (Phase I-II studies). The taxanes
(docetaxel and paclitaxel) represent a relatively new
class of chemotherapeutic agents that achieve their
antineoplastic effect principally by the
depolymerization of microtubules and by inhibition
of the anti-apoptotic effect of bcl-2 (Table II). We
analyzed studies (phase I-II) with taxanes in HRPC
patients, used as monotherapy or as combination
therapy, and all of them represent a small number of
patients. In most of the studies a taxane is used in
combination with estramustine, because of the
synergistic action.
The combination of paclitaxel, given as a 96-
hour infusion, and estramustine showed an objective
response in 4 out of 9 patients with measurable soft-
tissue disease in an initial phase II trial (53). The
dose and schedule of paclitaxel are now evolving.
Recently, weekly paclitaxel was tested in three
different phase I trials and it appears to have an
acceptable profile of activity and toxicity (54-56).
Docetaxel has a significantly longer cellular affinity
and uptake as well as a slower cellular affinity than
paclitaxel, effectively prolonging the duration of the
drug exposure. Moreover, it is approximately twice as
efficient as paclitaxel in stabilizing microtubules against
depolymerization and it appears to be a more potent
inducer of bcl-2 phosphorylation and apoptotic cell
death. Kreis studied 17 patients with HRPC with fixed-
dose estramustine (14 mg/kg/day) administered for 21
17
days and escalating doses of docetaxel (ranging from 40
to 80 mg/m2) on day 1 of each cycle (57). The
maximum tolerated dose of docetaxel in this
combination was 80 mg/m2, dose-limiting being
leukopenia and fatigue; the recommended starting dose
for phase II studies was 70 mg/m2. In the phase I/II trials
reported by Petrylak, docetaxel doses were escalated
from 40 to 70 mg/m2 and administered once every 21
days, with 280 mg of estramustine administered orally
three times a day for 5 days of each cycle (58-59). For
minimally pretreated patients, the maximum tolerated
dose of docetaxel was 80 mg/m2, dose-limiting being
granulocytopenia; the recommended phase II starting
dose of docetaxel was 70 mg/m2. Exstensively pre-
treated patients did not receive escalated doses >60
mg/m2 of docetaxel; the recommended phase II
starting dose was 60 mg/m2.
Savarese (Cancer and Leukemia Group B)
completed a phase II study of docetaxel, estramustine,
and low-dose hydrocortisone in 47 men with HRPC
(60). The combined measurable and biochemical
response rate was 54%. The toxicity of this combination
regimen was moderate and tolerable. The predominant
toxicity was neutropenia. Although there are potentially
overlapping gastrointestinal and vascular toxicities, few
patients in this study have developed grade 3-4 nausea,
vomiting or diarrhea. The incidence of tromboembolic
events during therapy was 9%. In the phase I study
performed by Petrylak on estramustine/docetaxel, 1
patient had a cerebrovascular accident and 2 patients had
deep venous thromboses (59). In the phase I trial carried
out by Kreis, two vascular events occurred at the 70
mg/m2 docetaxel dose (57). In all four studies of HRPC
patients, the overall risk of a thrombotic event appears to
be approximately 10%. The hypercoagulability
observed with this therapy may be a manifestation of
estramustine alone or an effect of the specific
combination of docetaxel and estramustine. To
minimize the toxicities commonly seen with
estramustine (especially deep vein thrombosis) without
compromising the efficacy of this drug combination,
Sinibaldi et al. proposed a shorter dosing schedule,
suggesting that in the heavily pre-treated patients, it is
active and has a moderate toxicity (61). Sitka Copur
found that a weekly docetaxel and estramustine
regimen is probably more suitable than previously
studied schedules for HRPC patients with a poor
performance status (62). Investigators from the
18 G. DI LORENZO ET AL.

University of Michigan conducted a phase II trial
combining estramustine, etoposide and paclitaxel,
demonstrating significant activity of this regimen in
patients with HRPC (63).
Recently Gravis investigated the clinical benefit,
the impact on Quality of Life (QoL) and the tolerability
of weekly docetaxel in symptomatic patients with
HRPC. Thirty men, 15 of whom had received previous
chemotherapy, were treated. Overall, 46% of patients
achieved a positive pain response and 48% achieved a
50% or greater reduction in PSA (64).
It is important to note that only a randomized study
would definitively answer the question of whether
docetaxel/estramustine truly improves the survival in
this patient population, comparing estramustine and
docetaxel with the standard arm of mitoxantrone and
prednisone (the FDA approved this combination based
solely on its palliative effects in patients with HRPC),
using time to progression and survival as the primary
aims and toxicity and QoL parameters and magnitude
of decline of PSA as secondary aims.

Table II. Phase II studies with Taxanes (Phase II).

Authors Pts Regimens Clinical response/ Toxicity
Biochemical (grade 3-4)
response
Smith 40 Estramustine 10mg/kg/day x Objective response in Neutropenia
14days. 45% of pts.
Etoposide 50mg/mq/day x PSA decrease in 65%
14days. of pts.
Paclitaxel 135mg/mq day 1 q
3wks.
Hudes 33 Estramustine 600mg/mq/day. Objective response in Leukopenia,
Paclitaxel 120mg/mq in IV 96h q 44% of pts. -AST/ALT,
3wks. PSA decrease in 52% embolic events
of patients. and edema
Petrylak 31 Estramustine 280mg days 1-5. PSA decrease in Neutropenia and
Docetaxel 70mg/mq q3 wks. 88% of patients with thromboembolic
cortisone. events
PSA decrease in 84%
without cortisone.
Savarese 47 Estramustine 10mg/kg /d days 1- Objective response in Neutropenia and
5 q3 wks. 50% of pts. thromboembolic
Docetaxel 70mg/mq q3wks. PSA decrease in 68% events
of pts.
Sinibaldi 22 Estramustine 280mg. Objective response in Neutropenia
Docetaxel 70mg/mq q3 wks. in 25% of pts.
PSA decrease in
38.8% of pts.
Sitka Copur 30 Estramustine days 1-3 weekly 2 Objective response in Nausea, asthenia,
wks. 76% of pts. diarrhea and
Docetaxel 35mg/mq weekly q2 PSA decrease in 66% edema
wks. of pts.
Trivedi 18 Paclitaxel 150mg/mq x 6 wks q8 Objective response in Neutropenia,
wks. 22.2% of pts. neuropathy and
PSA decrease in myalgia/arthalgia
39%.
Gravis 30 Docetaxel 35mg/mq x 6 wks. 46% achieved No toxicity grade
Followed by 2 wks-rest. positive pain. 3-4
PSA decrease in 48%
of pts.
Wks: weeks;q:q:every;
Wks: weeks; every;
pts:pts: patients;
patients; : Increase;
-: Increase; rest: norest: no therapy
therapy.
Objective response: response in patients with measurable disease.
PSA decrease: decrease >50%.
Grade 3-4 toxicity: according WHO scale.
 Int. J. Immunopathol. Pharmacol.
Table III. Studies with Taxanes ( Phase III).
Taxanes ( Phase III studies). The previous studies
with docetaxel have now been supplemented by new
data from 2 randomized phase III multi-centre
studies using the taxane based chemotherapeutic
agent, docetaxel (65-66). In the first trial, the TAX
327 study, the drug was used with steroid only, with
the comparator being mitoxantrone and prednisone,
the currently accepted “standard care” (65). The 3-
arm study compared weekly or 3-weekly docetaxel,
administered with prednisone, to a standard arm of
mitoxantrone and steroid. 1006 patients were
randomised to one of the 3 arms and it is worth
noting that the vast majority had a good performance
status prior to treatment. The most effective
treatment was the 3 weekly regimen, which
produced a significant improvement of 24% in
overall patient survival. This equated to an actual
median survival improvement of 2.4 months in
comparison to the control arm (18.9 months
docetaxel vs. 16.5 months control). There were also
significant improvements in pain (35% vs 22%),
PSA response (45% vs 32%) and QoL. The second
study, SWOG 99-16 randomised 770 patients to 3-
weekly docetaxel in combination with estramustine,
19
compared with mitoxantrone and steroid (66). A
similar result to that seen with TAX-327 was
observed, with a 23% improvement in survival and
a 28% reduction in risk of death from HRPC. The
toxicity rates in this study were higher in a number
of areas (haematological, cardiovascular,
neurological etc.) although there were no toxic
deaths. The higher toxicity rate, by comparison with
the results seen in TAX.327, was thought to relate to
the addition of estramustine.
The two studies show, for the first time, that the
taxane based regimens not only improved QoL and
PSA response in HRPC, they also extended the
overall survival of patients undergoing treatment
(66-67). This is the first time that a
chemotherapeutic treatment has been shown to do
this in prostate cancer and the results represent a
significant milestone in the treatment of this disease.
Table III summarizes the results of the 2 studies.
Chemotherapy agents: The Post-Taxanes Era
Docetaxel-based combinations. The demonstration
of improved survival with docetaxel-based
chemotherapy in HRPC has raised new questions and
20 G. DI LORENZO ET AL.

. Table IV. Docetaxel-based Combination.

Authors Pts Regimens Clinical and Toxicity
Biochemical response (grade 3-4)
Koletsky 21 Docetaxel 25mg/mq days 2 Partial responses. Neutropenia in 6 pts.
1, 8. PSA decrease in 60% of
Vinorelbine 20mg/mq pts.
1,8 q 21.
Di Lorenzo 19 Docetaxel 25mg/mq. Objective responses in Neutropenia in 32%
Vinorelbine 20mg/mq. 22% of pts. of pts.
for 6 wks q 8 wks. PSA decrease in 47% of
pts.
Goodin 40 Docetaxel 60mg/mq day 1 partial response, 4 stable Deep vein
1. disease. thrombosis in 1 pts
Vinorelbine 1,8 q 21. 37% and 29% PSA Neutropenia in 3 pts.
decrease in no treated and
pretreated pts.
Oh 30 Docetaxel 20-43mg/mq Survival 14.6 months. Myelosuppression.
weekly . PSA decrease in 75% of
Estramustine 140mg . pts.
Carboplatin AUC 6.
Oh 4 Docetaxel 60-70mg/mq. PSA decrease in 100% of Fatigue.
Carboplatin AUC 4/5. pts.
Kouroussis 19 Docetaxel 20mg/mq. PSA decrease in 63% of Neutropenia in 1 pts
Liposomal doxorubicin 6 pts. Fatigue in 8 pts.
mg for 3 wks q 4 wks.
Ryan 34 Docetaxel 60-75mg/mq q PSA decrease in 38% of Neutropenia in 56%
21 . pts. of pts.
Exisulind 150 and 250mg Survival 16 months.
twice daily.
Saferinejad 42 Docetaxel 70mg/mq day 18 /25 (72%) partial Leukopenia in
2 q28. response. 33.3% .
Estramustine 10mg/kg PSA decrease in 100% of Thrombocytopenia
orally days 1-21 q28 pts. in 21.4%.
Suramin 2150 mg q28. Anemia in 21%.
Font 30 Mitoxantrone 10mg/mq PSA decrease in 63% of Neutropenia in 20%
day 1 q21. pts. of pts.
Prednisone 5mg twice Survival: 18 months. 6% deep venous
daily for 3 cycles, Progression-free survival: thrombosis.
followed by 10 months.
Estramustine 280mg
three times daily.
Docetaxel 75mg/mq day
2 q21 for 7 cycles.
q: every; wks: weeks; partial response: lesion reduction >50%.
Objective response: response in patients with measurable disease. Survival: overall survival
PSA decrease: decrease >50%. Grade 3-4 toxicity: according WHO scale.
 Int. J. Immunopathol. Pharmacol.
new interest for researchers to improve the previous
results using docetaxel as standard therapy and adding
other drugs in combination. Many articles have been
published during recent years with docetaxel-based
combinations. Table IV summarizes the results.
Three articles evaluated docetaxel plus vinorelbine.
In the first, Koletsky et al., treated 21 patients with
vinorelbine 20 mg/mq followed by docetaxel 25
mg/mq on days 1 and 8 of a 21-day cycle (67). Of
the 19 patients who were evaluable for biochemical
response, prostate specific antigen reduction from
baseline of >75% or < 75% were observed in eight
and ten patients respectively (median prostate
specific antigen decrease, 60% +/-31%).
In the second study our group investigated the
clinical benefit, the impact on biochemical and
objective response and the tolerability of weekly
docetaxel with vinorelbine (VIN-DOX) (68).
Patients were treated with docetaxel 25 mg/mq and
vinorelbine 20 mg/mq intravenously for repeated
periods of 6 consecutive weeks followed by a 2
week rest until disease progression. 19 men were
treated. Overall, 42% achieved a performance-status
significant change and pain response; 47% achieved
a 50% or greater reduction in PSA. The objective
response rate was observed in 2 of 9 patients with
measurable disease (22%). The most important
toxicity was neutropenia (grade 3= 32%). We
believe that the combination of weekly VIN-DOX is
very active and for this reason we have begun a new
trial with docetaxel, vinorelbine and zoledronic acid.
Preliminary data are very interesting (69).
Recently Goodin et al evaluated the combination
of docetaxel and vinorelbine in 40 patients with
proven adenocarcinoma of the prostate. Of the 40
patients enrolled, 19 had received no prior
chemotherapy and 21 had received at least one prior
chemotherapy regimen. Of the 19 patients without
prior chemotherapy and the 21 with prior
chemotherapy, 7 (37%) and 6 (29%), respectively,
demonstrated a decrease in PSA by >50%
maintained for at least 4 weeks. Out of eight patients
with measurable disease, one achieved a partial
response and four demonstrated stable disease.
There was one patient with deep vein thrombosis,
and febrile neutropenia was noted in only three
patients after the protocol was modified to include
filgrastim support. (70).
21
Docetaxel has also been used in combination
with carboplatin in two recent trials. In the first
study Oh et al conducted a phase I study to define
the maximal tolerated dose, safety and efficacy of
docetaxel, carboplatin and estramustine. Docetaxel
was given on days 2, 9 and 16 of a 28-day cycle
starting from 20 until 43 mg. Patients also received
estramustine (140 mg per os three times daily on
days 1-5, 8-12 and 15-19) and carboplatin (AUC 6).
The authors concluded that the recommended phase
II dose of docetaxel is 43 mg/mq combined with
estramustine and carboplatin (71).
The same group treated a small number patients
with docetaxel (70 mg/mq) plus carboplatin
(area under the curve of 4/5). Out of 4 patients, PSA
decreased by > 50% in all 4 and were associated with
improvement in symptoms in 3 of the 4. Treatment
was well tolerated, with fatigue as the most common
reported side effect (72). Docetaxel was combinated
also with other drugs: with liposomal doxorubicin by
Kouroussis (73), with exisulind (an oral sulphone
metabolite of sulindac) by Ryan et al (74), with
estramustine and suramin by Safarinejad (75), and
with ifosfamide by Hervonen (76).
A very interesting trial was recently published by
Font et al. In this study the authors tested a
sequential administration of two regimens:
mitoxantrone/prednisone followed by estramustine
and docetaxel. A sequential administration could be
a viable alternative for delivering full doses of
chemotherapy, avoiding overlapping toxicity and
preserving dose intensity. Thirty HRPC patients were
treated with mitoxantrone 10 mg/mq day 1, every 3
weeks, plus prednisone 5 mg twice daily for 3 cycles,
followed by estramustine 280 mg three times daily
days 1 to 5, plus docetaxel 75 mg/mq day 2 every 3
weeks for 10 cycles. All patients were assessed for
response and toxicity. After mitoxantrone/prednisone
treatment, the PSA response rate was 23%, which
increased to 63% after completion of sequential
mitoxantrone/prednisone and estramustine/docetaxel.
Median survival was 18 months and the median
progression-free survival was 10 months. 6 (20%)
patients had grade 3-4 neutropenia and two (6%)
patients had deep venous thrombosis (77).
Oral drugs. Recently, many studies have been
published with oral drugs in hormone refractory
 G. DI LORENZO ET AL.
22

prostate cancer. Table V summarizes the results. As
we can see from two studies, oral cyclophosphamide
was used as treatment (78-79) while oral etoposide
was used in two others (80-81). The results are
interesting in terms of response rate and safety.
Satraplatin is a novel oral platinum complex that
shows activity against HRPC. A randomized
multicenter phase III trial was initiated in men with
HRPC as first line chemotherapy. After 50
randomized patients, an ad hoc analysis of all
available data is reported. Patients were randomized
between satraplatin 100 mg/mq for 5 days plus
prednisone 10 mg orally bid or prednisone alone. A
> 50% PSA decrease was seen in 33.3% of patients.
Median overall survival was 14.9 months and
progression-free survival was 5.2 months. Toxicity
was generally minimal. The trial was closed to
further accrual by the sponsoring company (82).
Considering the preliminary results in Europe, the
satraplatin and prednisone against refractory prostate
cancer (SPARC) trial was initiated. This is an
international, multicenter, randomized, double- blind
trial which was designed to evaluate the oral platinum
analog satraplatin as second line chemotherapy in men
with HRPC. The primary aim of the SPARC trial is
time to progression; other objectives include survival,

Table V. Oral drugs.

Authors Pts Regimens Clinical response and Toxicity

Biochemical response (grade 3-4)
Hellerstedt 37 Cyclophosphamide PSA decrease in 42% of pts. Treatment well
100mg days 1-20 Survival 16.4 months. tolerated.
q 30.
Meluch 42 Etoposide Objective response in 35% Neutropenia in 38%
50mg days 1-10 of pts. of pts.
q 28. Survival: 9.5 months.
Nicolini 8 Cyclophosphamide Response rate: 25%. Neutropenia in all
low dose. Clinical benefit: 62%. patients (grade 2-3).

Berruti 46 Etoposide 54% have PSA response Treatment well

100mg days 1-21 46% objective response tolerated.
q 28. Survival 18.4 months
Sternberg 50 Satraplatin 100 PSA decrease in 33.3% Toxicity minimal.
mg/mq for 5 days Survival 14.9 months.
q 21.
Spicer 14 Capecitabine 1250 PSA decrease in 50% of pts. Hand-foot syndrome
mg/mq days 1-14 in 50% of patients.
q 21.
Miyake 68 Uracil/Tegafur 300- PSA decrease in 60.3% of No severe side-
600mg/day. pts. effects.

Caristi 18 Vinorelbine 60 PSA decrease in 6 pts. Neutropenia in 3 pts

mg/mq days 1,8 q21 ( grade 2).

q: every.
Objective response: response in patients with measurable disease.
Survival: overall survival.
PSA decrease: decrease >50%. Grade 3-4 toxicity: according WHO scale.
Clinical benefit: quality of life improvement.
 Int. J. Immunopathol. Pharmacol.
safety and pain assessment. The US Food and Drug
Administration (FDA) has granted accelerated
approval status to satraplatin in the SPARC trial
because there are currently no approved agents for
second-line treatment of HRPC.
As shown in Table V, good results are reported
with capecitabine and Uracil/Tegafur (83-84).
Preliminary results, recently presented at the 7th
National Congress of Medical Oncology in Naples
(Abstract L13), suggest that oral vinorelbine is a safe
and moderately active option in the palliation of
elderly HRPC patients (85).
Bisphophonates. Prostate cancer is associated
with significant bone morbidity as about 80% of
patients with metastatic disease have bone
involvement and widely utilized androgen
suppression leads to bone loss and associated bone
fractures (86). Bisphosphonates, as a class, are
established for the prophylaxis and treatment of
osteoporosis and for reducing the risk of bone
fractures in postmenopausal women (87).
Bisphosphonates inhibit osteoclast activity and
although prostatic bony metastases appear to be
primarily osteoblastic, there is also substantial bone
resorption suggesting significant underlying
osteoclast activity (86-87). In a recent trial
Pamidronate disodium failed to demonstrate a
significant overall treatment benefit compared to
placebo in palliation of bone pain or reduction of
skeletal-related events (SREs) (88).
The third-generation bisphosphonate zoledronic
acid was found potentially to suppress the
proliferation of prostate cancer. It has recently been
shown to increase apoptosis of cell lines in vitro,
while significantly inhibiting the growth of
osteoblastic and osteolytic metastases in vivo
(89). In an international, multicenter, randomized
trial of 422 men with HRPC and bony metastases,
treatment with zoledronic acid over a 15 month
period led to a statistically significant reduction in
skeletal-related events (SREs), including fractures.
In addition, there was a significant delay in the
onset of the first SREs. The renal toxicity initially
observed was prevented by lengthening the
infusion to 15 minutes (90).
An extension of previous studies with zoledronic
acid administered for 15 months confirms previous
23
results, concluding that this drug is active in
hormone refractory prostate cancer (91).
Currently, zoledronic acid is approved by the US
Food and Drug Administration for the prevention of
SREs in HRPC and should be used standardly in this
setting. Our preliminary results show that zoledronic
acid can improve the efficacy of docetaxel with
vinorelbine (69). At present 3 trials with zoledronic
acid are ongoing in HRPC as prevention of bony
metastases (92).
Radiopharmaceuticals. Strontium-89 and samarium-
153 labeled ethylenediaminetetramethylenephosphonic
acid are beta particle-emitting isotopes available in the
USA for the palliation of painful bony metastases caused
by prostate cancer. These agents differ in radiation tissue
penetration and half-lives, with strontium-89 being
much longer than samarium-153 (50 and 1.9 days,
respectively). These differences affect the onset of
pain relief, which with strontium-89 is somewhat
delayed, whereas the palliation of pain and recovery
of bone marrow occur sooner with samarium-153.
Samarium-153 emits gamma radiation which makes
it amenable to use for imaging studies. The chief
complication of bone-seeking radioisotopes is
myelosuppression (93).
Biological drugs. Nowadays, a greater
understanding of the biology underlaying the disease
has led to new therapeutic perspectives such as the
introduction of agents that target the molecular
mechanisms (trasduction signaling, angiogenesis,
cell cycling, cell differentation) responsible for
tumorigenesis, growth, metastatic spread and
resistance to the standard hormonal treatment. Table
VI shows the potential target in prostate cancer.
In one of our reports we show that EGFR is
overexpressed in prostate cancer and how its
overexpression significantly increases in the
hormone-refractory state. Moreover, we
demonstrate that EGFR overexpression is related to
disease progression in terms of biochemical relapse
and it is independent from other parameters (such as
Gleason score, PSA, stage), therefore highly
significative (94). Why not use EGFR as the target
of therapy?
ZD1839 (Gefitinib) is an orally active, selective
EGFR tyrosine kinase inhibitor (TKi) that blocks
24 G. DI LORENZO ET AL.
Table VI. Potential biological targets in HRPC.
signal transduction pathways implicated in
proliferation and survival cancer cells. Miller et al.
found a PSA response (defined as PSA decline ≥
50% lasting ≥ 4 weeks) in 5 of 18 hormone
refractory patients treated with ZD1839 in
combination with mitoxantrone and prednisone (95),
while Souliè shows a PSA response in 10 of 30
patients treated with ZD1839 in combination with
docetaxel and estramustine (96). These preliminary
data indicate that the combination of ZD1839 with
chemotherapy may have potential in the treatment of
hormone refractory prostate cancer.
Recently Canil et al. (97) evaluated the efficacy
and toxicity of two doses of oral gefitinib in patients
with minimally symptomatic hormone refractory
prostate cancer. 40 patients were randomly assigned
to 250 mg or 500 mg oral gefitinib daily
continuously. None of the patients demonstrated a
PSA or objective measurable response. Gefitinib, as
a single agent, did not result in any responses in PSA
or objective measurable disease at either dose level.
Another member of the Erb family of receptors, -the
c-erbB2, is currently being tested. Small et al. have
carried out a phase I study using trastuzumab (anti c-
erbB2) in association with docetaxel and
estramustine (98).
Lara et al. screened for HER-2 overexpression in
patients developing hormone-refractory prostate
carcinoma (HRPC) and conducted a Phase II trial of
trastuzumab plus docetaxel in HER-2-positive
patients. Paraffin-embedded tumor specimens from
potentially eligible patients were screened for HER-
2 expression by immunohistochemistry (IHC)
and/or amplification by fluorescent in situ
hybridization (FISH). Shed HER-2 was also
assessed by enzyme-linked immunoradsorbent assay
(ELISA). Patients with HER-2-positive tumor
specimens (IHC 2+ or 3+ or FISH ratio > 2) were
initially randomized to receive either single-agent
trastuzumab or docetaxel. After two treatment
cycles, non-responding patients received the
trastuzumab/docetaxel combination. Treatment was
comprised of 30 mg/m(2) of docetaxel weekly for 6
weeks followed by a 2-week break and 4 mg/kg of
trastuzumab intravenously during Week 1 then 2
mg/kg per week thereafter. The cycle length was 8
weeks. Only 3 of 37 patients had elevated shed
HER-2 by ELISA (> 15 mg/mL). None
overexpressed HER-2 by IHC. FISH amplification
was found in 0 of 34 tissue samples. Of seven
 Int. J. Immunopathol. Pharmacol.
patients with IHC 3+ or 2+, four were tested by
ELISA and two by FISH. None were abnormal. Age
and Gleason score did not correlate with IHC status.
Of the seven patients eligible for the Phase II study,
only four agreed to participate. The trial was thus
closed for non feasibility (the overall HER-2
positivity rate was < 20%). No patient responded to
trastuzumab alone. The median survival was not
reached and the median progression-free survival
was 7 months (99).
Over expression of bcl-2 is involved in the
transition from androgen-dependent to androgen-
independent prostate cancer (100). There are
preliminary results on G3139 (bcl-2 antisense
oligonucleotide) therapy in combination with
docetaxel in hormone refractory prostate cancer
(101). Moreover, phase III studies are ongoing.
A number of approved and investigational agents
are being studied in combination with docetaxel in
HRPC. The most promising agents appear to be
calcitriol, thalidomide, bevacizumab and atrasetan
(Table VII). Calcitriol has antiproliferative effects
on prostate cancer cells, including hormone
refractory prostate cell lines, and increases
cytotoxicity to taxanes (102). A phase II study
Table VII. Trials with biological agents in HRPC.
Target Study
HER-1 Phase I-II
C-erbB2 Phase II
VEGF Phase II
Phase III ongoing
Phase II
Phase III ongoing
Bcl-2 Phase II
Phase III ongoing
Endothelin receptors Phase II
antagonist Phase III ongoing
Vaccine therapy Phase II ongoing
BCR-ABL Phase II ongoing
25
demonstrated that the combination of docetaxel and
calcitriol produces response rate and overall survival
similar to that seen in SWOG 9916 (103).
Angiogenesis is a promising target in prostate
cancer and several trials are evaluating docetaxel in
combination with agents that interfere with tumor
neovascularization. The highest median survival
reported in any phase II trial in HRPC was seen in a
trial comparing weekly docetaxel plus thalidomide
to docetaxel alone in 75 patients with chemotherapy-
naïve HRPC. In this phase II trial, median survival
was 29 months in the docetaxel-thalidomide group;
69% of patients in the combination arm versus 42%
receiving docetaxel alone were alive at 18 months
(104). Docetaxel has also been evaluated in
combination with bevacizumab, a monoclonal
antibody that targets vascular endothelial growth
factor. Bevacizumab and docetaxel were given every
3 weeks and estramustine was given on days 1 to 3
of each cycle. The majority of patients (79%) had a
PSA response (105). The Cancer and Leukemia
Group B (CALGB) have begun a phase III trial to
evaluate a combination of docetaxel-prednisone-
bevacizumab versus docetaxel-prednisone alone.
The endothelin family of peptides has recently
Drugs Comments
ZD1839 Poor activity
Trastuzumab Poor activity
Thalidomide + docetaxel Promising activity
Docetaxel +/- thalidomide
Bevacizumab+ docetaxel Promising activity
Docetaxel +/- bevacizumab
Calcitriol + docetaxel Good combination
Docetaxel +/- Oblimersen Promising activity
Atrasetan Promising activity
Docetaxel +/- atrasetan
GVAX + docetaxel Interesting preliminary
results
Glivec Poor activity
26 G. DI LORENZO ET AL.
been identified as contributing to the
pathophysiology of prostate cancer. The endothelins
are autocrine/paracrine factors with diverse activity,
and they modulate vasomotor tone, nociception,
hormone production and cell proliferation in a
variety of tissues. These effects of endothelin (ET-1)
are mediated by endothelin-1 receptors (ET-A and
B). In prostate cancer the endothelin B receptor is
diminished while expression of ET-A receptor
increases with tumor stage and grade. There are
multiple pathways by which the ET-1/ET-A axis
may promote prostate cancer progression. ET-1 is a
mitogen for prostate cancer cell lines and acts
synergistically with other peptide growth factors.
ET-1 is also a mitogen for osteoblasts. Selective ET-
A receptor antagonists block the proliferative effects
of ET-1 in both prostate cancer cells and
osteoblasts. Atrasetan (ABT 627) is a selective ET-A
receptor antagonist that blocks the biological effects
of endothelin (106-110).
Carducci conducted a randomized, phase II trial,
to evaluate the efficacy and safety of atrasetan in the
treatment of asymptomatic, hormone-refractory
prostatic adenocarcinoma. This study demonstrates
that atrasetan has clinical activity in advanced
prostate cancer. An intent to treat analysis shows that
patients treated with 10 mg atrasetan (daily oral dose)
had a trend towards prolongation in disease
progression and a statistical delay in PSA progression.
These data substantiate the role of the ET-1/ET-A axis
as a therapeutic target in hormone refractory prostate
cancer (111). This promising agent will be combined
with docetaxel-prednisone and compared with the
standard regimen of docetaxel-prednisone by an
international group (SWOG).
The combination of vaccine therapy with
docetaxel is also currently under investigation.
GVAX is a vaccine in which irradiated prostate
cancer cells are transfected with
granulocyte/macrophage colony-stimulating factor.
Preliminary data suggest that GVAX will delay time to
progression in HRPC (112). Combination studies of
docetaxel with GVAX are currently being designed.
Chemotherapy: where do we stand?
The treatment of HRPC and the role of
chemotherapy continue to be an open field for
discussion.
The results of TAX 327 and SWOG 99-16 show
for the first time that the Taxane-based regimens not
only improve QoL and PSA response in HRPC but
also extend the overall survival of patients
undergoing treatment (65-66). This is the first time
that a chemotherapeutic regimen has been shown to
improve survival and the results represent a
significant milestone in the treatment. However, the
data and its implication need to be considered
carefully before concluding that henceforth all
HRPC patients should be treated with these agents.
In fact, the efficacy of the drug is not universally
effective in all patients. The taxane combination
clearly works but only approximately 1/3rd of
patients respond and the survival benefit is small,
equating to a median of 2.4 months. This moderate
improvement in efficacy was accompanied by a
significant increase in overall toxicity, with up to
45% of patients suffering grade 3 to 4 toxic effects.
The majority of patients in TAX 327 and SWOG 99-
16 had a good performance status but this does not
reflect everyday practice.
Several new docetaxel-based combination
regimens are under evaluation in an effort to further
improve results in these patients (67-77). Phase II
trials show promising results when docetaxel is
combined with angiogenesis inhibitors (99-102).
Results from randomized phase II trials are needed
to validate these findings. In addition, new agents
are being investigated in the second-line setting in
upcoming studies.
As the role of chemotherapy for the treatment of
prostate cancer evolves, the need for strong
partnerships between urologists and oncologists
increases. Optimal patient management will
involve close coordination between these
disciplines to ensure that all appropriate treatment
options are explored for the benefit of all patients
with prostate cancer.
REFERENCES
1. Jemal A., R.C. Tiwari, T. Murray, A. Ghafoor, A.
Samuels and E. Ward. 2004. Cancer statistics. CA
Cancer J. Clin. 54:8.
2. Scher H.I., G. Steineck and W.K. Kelly. 1995.
Hormone-refractory (D3) prostate cancer: refining
the concept. Urology 46:142.
 Int. J. Immunopathol. Pharmacol.
3. Eisenberger M.A., R. Simon, P.J. O’Dwyer, R.E.
Wittes and M.A. Friedman. 1985. A re-evaluation of
non-hormonal cytotoxic chemotherapy in the treatment
of prostatic carcinoma. J. Clin. Oncol. 3:827.
4. Yagoda A. and D.P. Petrylak. 1993. Cytotoxic
chemotherapy for advanced hormone-resistant
prostate cancer. Cancer 71:1098.
5. Moore M.J., D. Osoba, K. Murphy, I.F. Tannock,
A. Armitage, B. Findlay, C. Coppin, A. Neville, P.
Venner and J. Wilson. 1994. Use of palliative end-
points to evaluate the effects of mitoxantrone and
low-dose prednisone in patients with hormonally
resistant prostate cancer. J. Clin. Oncol. 12:689.
6. Raghavan D., G. Coorey, M. Rosen, J. Page and T.
Farebrother. 1996. Management of hormone resistant
prostate cancer: an australian trial. Semin. Oncol. 23:2.
7. Otto T., K. Rembrink, M. Goepel, S. Krege, M.
Meyer-Schwiekerath and H. Rubben. 1996.
Therapy of hormone refractory prostate carcinoma
with mitoxantrone. A clinical phase II study.
Urologe A. 35:142.
8. Tannock I.F., D. Osoba, M.R. Stockler, D.S.
Ernst, A. Neville, M.J. Moore, G. Armitage, J.
Wilson, P. Venner, C. Coppin and K. Murphy.
1996. Chemotherapy with mitoxantrone plus
prednisone or prednisone alone for symptomatic
hormone-resistant prostate cancer: a Canadian
randomized trial with palliative end-points. J. Clin.
Oncol. 14:1756.
9. Kantoff P., S. Halabi, M. Conaway, J. Picus, J.
Kirschner, V. Hars, D. Trump, E. Winner and N.
Vogelzang. 1999. Hydrocortisone with or without
mitoxantrone in men with hormone refractory
prostate cancer: results of the Cancer and Leukemia
Group B 9182 study. J. Clin. Oncol. 17:2506.
10. Levine E.G., S. Halabi, J.D. Roberts, E.B. Kaplan,
R. Rago, J.N. Atkins and N.J. Vogelzang. 2002.
Higher doses of mitoxantrone among men with
hormone-refractory prostate carcinoma: a Cancer and
Leukemia Group B study. Cancer 94:665.
11. Small E.J., S. Srinivas, B. Egan, A. McMillan and
Readern. 1996. Doxorubicin and dose-escalated
cyclophosphamide with granulocyte colony-
stimulating factor for the treatment of hormone-
resistant prostate cancer. J. Clin. Oncol. 14:1617.
27
12. Culine S., J. Kattan, S. Zanetta, C. Thèodore, K.
Fizazi and J.P. Droz. 1998. Evaluation of
estramustine phospate combined with weekly
doxorubicin in patients with androgen-indipendent
prostate cancer. Am. J. Clin. Oncol. 21:470.
13. Hernes E.H., S.D. Fossa, S.Vaage, P. Ogreid, A.
Heilo and E. Paus. 1997. Epirubicin combined with
estramustine phospate in hormone-resistant prostate
cancer: a phase II study. Br. J. Cancer 76:93.
14. Recchia F., G. Sica, S. De Filippis, M. Rosselli,
P.L. Pompili and S. Rea. 2001. Phase II study of
epirubicin, mytomicin C and 5-fluoruracil in
hormone-refractory prostatic carcinoma. Am. J. Clin.
Oncol. 24:232.
15. Heidenreich A., F. Sommer, C. Ohlmann, A.J.
Schrader, P. Olbert, J. Goecke and U.H.
Engelmann. 2004. Prospective randomized phase II
trial of pegylated doxorubicin in the management of
symptomatic hormone-refractory prostate cancer.
Cancer 101:948.
16. Benson R.C. and B. Hartley-Asp. 1990.
Mechanisms of action and clinical uses of
estramustine. Cancer Invest. 8:375.
17. Iversen P., F. Rasmussen, C. Asmussen, B.J.
Christensen, J. Eickhoff, P. Klarskov, E. Larsen,
P. Mogensen, S. Mommsen and P. Rosenkilde.
1997. Estramustine phospate versus placebo as
second line treatment after orchiectomy in patients
with metastatic prostate cancer: DAPROCA study
9002. J. Urol. 157:929.
18. Pienta K.J., B.G. Redman, M. Hussain, G.
Cummings, P.S. Esper, C. Appel and L.E. Flaherty.
1994. Phase II of oral estramustine and oral etoposide
in hormone refractory adenocarcinoma of the prostate.
J. Clin. Oncol. 12:2005.
19. Pienta K.J., B.G. Redman, R. Bandekar, M.
Strawderman, K. Cease, P.S. Esper, H. Naik and
D.C. Smith. 1997. A phase II trial of oral
estramustine and oral etoposide in hormone
refractory prostate cancer. Urology 50:401.
20. Pienta K.J., E.I. Fisher, M.A. Eisenberger, G.M.
Mills, J.W. Goodwin, J.A. Jones, S.R. Dakhil,
E.D. Crawford and M.H. Hussain. 2001. A phase
II trial of estramustine and etoposide in hormone
refractory prostate cancer: a southwest oncology
28 G. DI LORENZO ET AL.
group trial (SWOG 9407). Prostate 46:257.
21. Dimopoulos M.A., C. Panopoulos, C. Bamia, C.
Deliveliotis, G. Alivizatos, D. Pantazopoulos, C.
Costantinidis, A. Kostakopoulos, I. Kastriotis, A.
Zervas, G. Aramantinos and C. Dimopoulos.
1997. Oral estramustine and oral etoposide for
hormone refractory prostate cancer. Urology 50:754.
22. Bracarda S., M. Tonato, P. Rosi, V. De Angelis, E.
Mearini, S. Cesaroni, P. Fornetti and M. Porena.
2000. Oral estramustine and cyclophosphamide in
patients with metastatic hormone refractory prostate
carcinoma. Cancer 88:1438.
23. Attivissimo L.A., J.V. Fetten and W. Kreis. 1996.
Symptomatic improvement associated with
combined estramustine and vinblastine
chemotherapy for metastatic prostate cancer. Am. J.
Clin. Oncol. 19:581.
24. Hudes G., L. Einhorn, E. Ross, A. Balsham, P.
Loehrer, H. Ramsey, J. Sprandio, M. Entmacher,
W. Dugan, R. Ansari, F. Monaco, M. Hanna and
B. Roth. 1999. Vinblastine versus vinblastine plus
oral estramustine phosphate for patients with
hormone refractory prostate cancer: a Hoosier
Oncology Group and Fox Chase Network phase III
trial. J. Clin. Oncol. 17:3160.
25. Albrecht W., S. Horenblas, J.M. Marechal, A.
Mikisch, V. Seretta, G. Cassetta, H. van Poppel,
S. Kalman and R. Sylvester. 1998. EMP versus
EMP/VBL. Chemotherapie beim hormonrefraktaren
Prostatakrazinom. Urologe A. 37:32.
26. Fields-Jones S., A. Koletsky, G. Wilding, M.
O’Rourke, J. Eckardt, B. Yates, C. McGuirt and
H.A. Burris. 1999. Improvement in clinical benefit
with vinorelbine in the treatment of hormone
refractory prostate cancer: a phase II trial. Ann.
Oncol. 10:1307.
27. Oudard S., A. Caty, Y. Humblet, M. Beauduin, E.
Suc, M. Piccart, F. Rolland, P. Fumoleau, R. Bugat,
P. Houyau, A. Monnier, X. Sun, P. Montcuquet, J.
Breza, J. Novak, T. Gil and D. Chopin. 2001. Phase
II study of vinorelbine in patients with androgen-
indipendent prostate cancer. Ann. Oncol. 12:847.
28. Carles J., M. Domenech, A. Gelabert -Mas, M.
Nogue, M. Tabernero, A. Arcusa, I. Guasch, A.
Miguel, J. Ballesteros and X. Fabregat. 1998.
Phase II study of estramustine and vinorelbine in
hormone refractory prostate carcinoma patients.
Acta Oncol. 37:187.
29. Colleoni M., C. Graiff, G. Vicario, P. Nelli, G.
Sgarbossa, F. Pancheri and P. Manente. 1997.
Phase II study of estramustine, oral etoposide, and
vinorelbine in hormone refractory prostate cancer.
Am. J. Clin. Oncol. 20:383.
30. Abratt R.P., D. Brune, J. Kliment, J. Breza, F.P.
Selvaggi, P. Beuzeboc, T. Demkow and S. Oudard.
2004. Randomised phase III study of intravenous
vinorelbine plus hormone therapy versus hormone
therapy alone in hormone-refractory prostate cancer.
Ann. Oncol. 15:1613.
31. Carles Galceran J.R. Bastus Piulats, J. Martin-
Broto, P. Maroto Rey, M. Nogue Aligue, M.
Aligue, M. Domenech Santasusana, A. Arcusa
Lanza, J. Bellmunt Molins, C. Colin and A.
Girard. 2005. A phase II study of vinorelbine and
estramustine in patients with hormone-resistant
prostate cancer. Clin. Transl. Oncol. 7:66.
32. Samelis G.F., H. Kalofonos, A. Adamou, P.
Kosmides, D. Skardos, G. Aravantinos, C.
Kiamouris, O. Adimichi, G. Fountzilas and A.M.
Dimopoulos. 2005. The combination of
estramustine, vinorelbine, and mitoxantrone in
hormone-refractory prostate cancer: a Phase II
feasibility study conducted by the Hellenic
Cooperative Oncology Group. Urology 66:382.
33. Maulard-Durdux C., B. Dufour, C. Hennequin, Y.
Chrètien, S. Delanian and M. Housset. 1996.
Phase II study of oral cyclophosphamide and oral
etoposide combination in hormone-refractory
prostate carcinoma patients. Cancer 77:1144.
34. Nishimura K., N. Nonomura, Y. Ono, M. Nozawa,
T. Fukui, Y. Harada, T. Imazu, N. Takaha, H.
Sugao, T. Miki and A. Okuyama. 2001. Oral
combination of cyclophosphamide, uracil plus
tegafur and estramustine for hormone-refractory
prostate cancer. Oncology 60:49.
35. Huan S.D., D.J. Stewart, S.E. Aitken, R. Segel and
J.C. Yau. 1999. Combination of epirubicin and
cisplatinum in hormone refractory metastatic
prostate cancer. Am. J. Clin. Oncol. 22:471.
36. Veronesi A., G.L. Re, S. Foladore, A. Merlo, N.
 Int. J. Immunopathol. Pharmacol.
Giuliotto, R. Talamini and S. Monfardini. 1996.
Multidrug chemotherapy in the treatment of non-
elderly patients with hormone refractory prostatic
carcinoma. Eur. Urol. 29:434.
37. Miglietta L., L. Cannobbio and F. Boccardo. 1995.
Assessment of response to carboplatin in patients with
hormone refractory prostate cancer: a critical analysis
of drug activity. Anticancer Res. 15:2825.
38. Jungi W.F., J. Bernhard, C. Hurniy, S.F. Schmitz,
S. Hanselmann, H. Gusset, D. Pestalozzi and A.
Goldhirsch. 1998. Effect of carboplatin on response
and palliation in hormone-refractory prostate cancer.
Swiss Group for Clinical Cancer Research (SAKK).
Supp. Care Cancer 6:462.
39. Fuse H., Y. Muraishi, Y. Fujishiro and T.
Katayama. 1996. Etoposide, epirubicin and
carboplatin in hormone refractory prostate cancer.
Int. Urol. Nephrol. 28:79.
40. Droz J.P., X. Muracciole, N. Mottet, M. Ould
Kaci, J.M. Vannetzel, N. Albin, S. Culine, J.M.
Rodier, J.L. Misset, S. Mackenzie, E. Cvitkovic
and G. Benoit. 2003. Phase II study of oxaliplatin
versus oxaliplatin combined with infusional 5-
fluorouracil in hormone refractory metastatic
prostate cancer patients. Ann. Oncol. 14:1291.
41. Berlin J.D., K.J. Propert, D. Trump, G. Wilding,
G. Hudes, J. Glick, P. Burch, A. Keller and P.
Loehrer. 1998. 5-Fluorouracil and leucovorin
therapy in patients with hormone refractory prostate
cancer: an Eastern Cooperative Oncology Group
phase II study (E1889). Am. J. Clin. Oncol. 21:171.
42. Atkins J.N., H.B. Muss, L.D. Case, F. Richards, T.
Grote and J. McFarland. 1996. Leucovorin and
high-dose fluorouracil in metastatic prostate cancer.
A phase II trial of the piedmont Oncology
Association. Am. J. Clin. Oncol. 19:23.
43. Breul J., G. Jakse, G. Forster, A. Lampel, A.
Rohani and R. Hartung. 1997. 5-fluorouracil
versus folinic acid and 5-fluorouracil in advanced,
hormone-resistant prostate cancer: a prospective
randomized pilot trial. Eur. Urol. 32:280.
44. Shinohara N., T. Demura, K. Matsumura, K.
Toyoda, A. Kashiwagi, S. Nagamori, H. Ohmuro,
S. Ohzono and T. Koyanagi. 1998. 5-Fluorouracil
and low-dose recombinant interferon-alpha-2a in
29
patients with hormone refractory adenocarcinoma of
the prostate. Prostate 35:56.
45. Morant R., J. Bernhard, R. Maibach, M. Borner,
M.F. Fey, B. Thurlimann, E. Jacky, F. Trinkler, J.
Bauer, G. Zulian, S. Hanselmann, C. Hurny and
F. Hering. 2000. Response and palliation in a phase
II trial of gemcitabine in hormone refractory
metastatic carcinoma. Swiss Group for Clinical
Cancer Research (SAKK). Ann. Oncol. 11:183.
46. Myers C., M. Cooper, C. Stein, R. LaRocca,
M.M. Walther, G. Weiss, P. Choyke, N. Dawson,
S. Steinberg, M. Uhrich, J. Cassidy, D.R. Kohler,
J. Trepel and M. Linehan. 1992. Suramin: a novel
growth factor antagonist with activity in hormone-
refractory metatstatic prostate cancer. J. Clin.
Oncol. 10:881.
47. Small E.J., M. Meyer, M.E. Marshall, L.M.
Reyno, F.J. Meyers, R.B. Natale, P.F. Lenehan, L.
Chen, W.J. Slichenmyer and M. Eisenberger.
2000. Suramin therapy for patients with
symptomatic hormone-refractory prostate cancer:
results of a randomized phase III trial comparing
suramin plus hydrocortisone to placebo plus
hydrocortisone. J. Clin. Oncol. 18:1440.
48. Eisenberger M.A., V.J. Sinibaldi, L.M. Reyno, R.
Sridhara, J.D. Iodrell, E.G. Zuhowski, K.H.
Tkaczuk, M.H. Lowitt, R.K. Hemady, S.C.
Jacobs, D. VanEcho and M.J. Egorin. 1995. Phase
I clinical evaluation of a pharmacologically guided
regimen of suramin in patients with hormone-
refractory prostate cancer. J. Clin. Oncol. 13:2174.
49. Kelly K.W., T. Curley, C. Leibertz, A. Dnistrian,
M. Schwartz and H.I. Scher. 1995. Prospective
evaluation of hydrocortisone and suramin in patients
with androgen-independent prostate cancer. J. Clin.
Oncol. 13:2208.
50. Dawson N.A., M.R. Cooper, W.D. Figg, D.J.
Headlee, A. Thibault, R.C. Bergan, S.M.
Steinberg, E.A. Sausville, C.E. Myers and O.
Sartor. 1995. Antitumor activity of suramin in
hormone-refractory prostate cancer controlling for
hydrocortisone treatment and flutamide withdrawal
as potentially confounding variables. Cancer 6:453.
51. Rosen P.J., E.F. Mendoza, E.M. Landaw, B.
Mondino, M.C. Graves, J.H. McBride, P. Turcillo,
30 G. DI LORENZO ET AL.
J. deKernion and A. Belldegrun. 1996. Suramin in
hormone-refractory metastatic prostate cancer: a
drug with limited activity. J. Clin. Oncol. 4:1626.
52. Calvo E., J. Cortes, J. Rodriguez, M. Sureda, C.
Beltran, J. Rebollo, R. Martinez-Monge, J.M.
Berian, J. de Irala and A. Brugarolas. 2001. Fixed
higher dose schedule of suramin plus hydrocortisone
in patients with hormone refractory prostate carcinoma
a multicenter phase II study. Cancer 92:2435.
53. Hudes G., F. Nathan, C. Khater, N. Has, M.
Cornfield, B. Giantonio, R. Greenberg, L. Gomella,
S. Litwin, E. Ross, S. Roethke and C. McAleer.
1993. Phase II trial of 96 hour paclitaxel plus oral
estramustine phospate in metastatic hormone-
refractory prostate cancer. J. Clin. Oncol. 15:3156.
54. Trivedi C., B. Redaman, L.E. Flaherty, O. Kucuk,
W. Du, L.K. Heilbrun and M. Hussain. 2000.
Weekly one-hour infusion of paclitaxel. Clinical
feasibility and efficacy in patients with hormone-
refractory prostate carcinoma. Cancer 89:431.
55. Haas N., B. Roth, C. Garay, G. Yeslow, M.
Entmacher, A. Weinstein, A. Rogatko, J. Babb, C.
Minnitti, D. Flinker, T. Gillon and G. Hudes.
2001. Phase I trial of weekly paclitaxel plus oral
estramustine phosphate in patients with hormone-
refractory prostate cancer. Urology 58:59.
56. Ferrari A.C., A. Chachoua, H. Singh, M.
Rosenthal, S. Taneja, M. Bednar, J. Mandeli and
F. Muggia. 2001. A phase I/II study of weekly
paclitaxel and 3 days of high dose oral estramustine
in patients with hormone refractory prostate
carcinoma. Cancer 91:2039.
57. Kreis W., D.R. Budman, J. Fetten, A.L.
Gonzales, B. Barile and V. Vinciguerra. 1999.
Phase I trial of the combination of daily
estramustine phospate and intermittent docetaxel in
patients with metastatic hormone refractory
prostate carcinoma. Ann. Oncol. 10:33.
58. Petrylak D.P., R.B. Macarthur, J. O’Connor, G.
Shelton, T. Judge, J. Balog, C. Pfaff, E. Bagella,
D. Heitjan, R. Fine, N. Zuech, I. Sawczuk, M.
Benson and C.A. Olsson. 1999. Phase I trial of
docetaxel with estramustine in androgen-
independent prostate cancer. J. Clin. Oncol. 17:958.
59. Petrylak D.P., R.B. Macarthur, J. O’Connor, G.
Shelton, A. Weitzman, T. Judge, C. England-Owen,
N. Zuech, C. Pfaff, J. Newhouse, E. Bagiella, D.
Heitjan, I. Sawczuk, M. Benson and C. Olsson.
1999. Phase I/II studies of docetaxel (taxotere)
combined with estramustine in men with hormone-
refractory prostate cancer. Semin. Oncol. 26:28.
60. Savarese D.M., S. Halabi, V. Hars, W.L. Akerley,
M.E. Taplin, P.A. Godley, A. Hussain, E.J. Small
and N. Vogelzang. 2001. Phase II study of
docetaxel, estramustine and low-dose
hydrocortisone in men with hormone-refractory
prostate cancer: a final report of CALGB 9780. J.
Clin. Oncol. 19:2509.
61. Sinibaldi V., M. Carducci, M. Laufer and M.
Eisenberger. 1999. Preliminary evaluation of a short
course of estramustine phospate and docetaxel
(taxotere) in hormone refractory prostate cancer.
Semin. Oncol. 26:45.
62. Sitka Copur M., P. Ledakis, J. Lynch, R. Hauke,
S. Tarantolo, M. Bolton, M. Norvell, J. Muhvic, L.
Hake and J. Wendt. 2001. Weekly docetaxel and
estramustine in patients with hormone-refractory
prostate cancer. Semin. Oncol. 28:16.
63. Smith D.C., P. Esper, M. Strawderman, B.
Redman and K.J. Pienta. 1999. Phase II trial of
oral estramustine, oral etoposide and intravenous
paclitaxel in hormone refractory prostate cancer. J.
Clin. Oncol. 17:1664.
64. Gravis G., F. Bladou, N. Salem, G. Gravis, F.
Bladou, N. Salem, G. Macquart-Moulin, G.
Serment, J. Camerlo, D. Genre, V.J. Bardou, D.
Maraninchi and P. Viens. 2003. Weekly
administration of docetaxel for symptomatic
metastatic hormone-refractory prostate carcinoma.
Cancer 98:1627.
65. Tannock I.F., R. de Wit, W.R. Berry, J. Horti, A.
Pluzanska, K.N. Chi, S. Oudard, C. Theodore,
N.D. James, I. Turesson, M.A. Rosenthal and
M.A. Eisenberg. 2004. Docetaxel plus prednisone
or mitoxantrone plus prednisone for advanced
prostate cancer. N. Engl. J. Med. 351:12.
66. Petrilak D.P., C.M. Tangen, M.H. Hussain, P.N.
Lara, J.A. Jones, M.E. Taplin, P.A. Burch, D. Berry,
C. Moinpour, M. Kohli, M.C. Benson, E.J. Small,
D. Raghavan and E.D. Crawford. 2004. Docetaxel
 Int. J. Immunopathol. Pharmacol.
and estramustine compared with mitoxantrone and
prednisone for advanced refractory prostate cancer. N.
Engl. J. Med. 351:1513.
67. Koletski A.J., M.L. Guerra and L. Kronish. 2003.
Phase II study of vinorelbine and low-dose docetaxel
in chemotherapy-naive patients with hormone-
refractory prostate cancer. Cancer J. 9:286.
68. Di Lorenzo G., C. Pizza, R. Autorino, M. De
Laurentiis, O. Marano, A. D’Alessio, G. Cancello,
V. Altieri, G. Tortora, S. Perdonà, A.R. Bianco
and S. De Placido. 2004. Weekly docetaxel and
vinorelbine (VIN-DOX) as first line treatment in
patients with hormone-refractory prostate cancer.
Eur. Urol. 46:712.
69. Autorino R., G. Di Lorenzo, S. Perdonà, M. De
Laurentiis, G. Cancello, G. Napodano, V.
Montanaro, V. Altieri, M. D’Armiento, A.R.
Bianco and S. De Placido. 2005. Docetaxel,
vinorelbine and zoledronic acid as first line of
chemotherapy in patients with hormone refractory
prostate cancer. Congresso Nazionale di Urologia
Oncologica (abstract ) (SIURO) Palermo.
70. Goodin S., K.V. Rao, M. Kane, T. Capanna, S. Doyle-
Lindrud, E. Engle, L. Jin, M. Todd and R.S. DiPaola.
2005. A phase II trial of docetaxel and vinorelbine in
patients with hormone-refractory prostate cancer.
Cancer Chemother. Pharmacol. 56:199.
71. Oh W.K., E. Hagmann, J. Manola, D.J. George,
T.D. Gilligan, J.O. Jacobson, M.R. Smith, D.S.
Kaufman and P.W. Kantoff. 2005. A phase I study
of estramustine, weekly docetaxel, and carboplatin
chemotherapy in patients with hormone-refractory
prostate cancer. Clin. Cancer Res. 11:284.
72. Oh W.K., D.J. George and M.H. Tay. 2005. Response
to docetaxel/carboplatin in patients with hormone-
refractory prostate cancer not responding to taxane-
based chemotherapy. Clin. Prostate Cancer 4:61.
73. Kouroussis C.H., N. Androulakis, L.Vamvakas, A.
Kalykaki, S. Spiridonakou, N. Kentepozidis, Z.
Saridaki, E. Xiropoulou and V. Georgoulias.
2005. Phase I study of weekly docetaxel and
liposomal doxorubicin in patients with advanced
solid tumors. Oncology 69:202.
74. Ryan C.W., W.M. Stadler and N.J. Vogelzang.
2005. A phase I/II dose-escalation study of exisulind
31
and docetaxel in patients with hormone-refractory
prostate cancer. BJU Int. 95:963.
75. Safarinejad M.R. 2005. Combination
chemotherapy with docetaxel, estramustine and
suramin for hormone refractory prostate cancer.
Urol. Oncol. 23:93.
76. Hervonen P., A. Jekunen, P. Lefebre, and P.
Kellokumpu-Lehtinen. 2003. Docetaxel-
ifosfamide combination chemotherapy in patients
with metastatic hormone-refractory prostate cancer:
a phase I pharmacokinetic study. Int. J. Clin.
Pharmacol. Res. 23:1.
77. Font A., A. Murias, F.R. Arroyo, C. Martin, J.
Areal, J.J. Sanchez, J.A. Santiago, M. Constela,
J.M. Saladie and R. Rosell. 2005. Sequential
mitoxantrone/prednisone followed by
docetaxel/estramustine in patients with hormone-
refractory metastatic prostate cancer: results of a
phase II study. Ann. Oncol.16:419.
78. Nicolini A., P. Mancini, P. Ferrari, L. Anselmi, G.
Tartarelli, V. Bonazzi, A. Carpi and R. Giardino.
2004. Oral low-dose cyclophosphamide in
metastatic hormone refractory prostate cancer
(MHRPC). Biomed. Pharmacother. 58:447.
79. Hellerstedt B., K.J. Pienta, B.G. Redman, P.
Esper, R. Dunn, J. Fardig, K. Olson and D.C.
Smith. 2003. Phase II trial of oral
cyclophosphamide, prednisone, and
diethylstilbestrol for androgen-independent prostate
carcinoma. Cancer 98:1603.
80. Berruti A., E. Fara, M. Tucci, R. A. Berruti, E.
Fara, M. Tucci, R. Tarabuzzi, A. Mosca, C.
Terrone, G. Gorzegno, G. Fasolis, G. Tampellini,
F. Porpiglia, M. De Stefanis, D. Fontana, O.
Berretto and L. Dogliotti. 2005. Oral estramustine
plus oral etoposide in the treatment of hormone-
refractory prostate cancer patients: a phase II study
with a 5-year follow-up. Urol. Oncol. 23:7.
81. Meluch A.A., F.A. Greco, L.H. Morrissey, E.L.
Raefsky, R.G. Steis, J.A. Butts and J.D.
Hainsworth. 2003. Weekly paclitaxel, estramustine
phosphate, and oral etoposide in the treatment of
hormone-refractory prostate carcinoma: results of a
Minnie Pearl Cancer Research Network phase II
trial. Cancer 98:2192.
32 G. DI LORENZO ET AL.
82. Sternberg C.N., P. Whelan, J. Hetherington, B.
Paluchowska, P.H. Slee, K. Vekemans, P. Van
Erps, C. Theodore, O. Koriakine, T. Oliver, D.
Lebwohl, M. Debois, A. Zurlo and L. Collette.
Genitourinary Tract Group of the EORTC. 2005.
Phase III trial of satraplatin, an oral platinum plus
prednisone vs. prednisone alone in patients with
hormone-refractory prostate cancer. Oncology 68:2.
83. Spicer J., T. Plunkett, N. Somaiah, S. Chan, A.
Kendall, N. Bolunwu and H. Pandha. 2005. Phase
II study of oral capecitabine in patients with
hormone-refractory prostate cancer. Prostate Cancer
Prostatic.Dis. 2:5.
84. Miyake H., I. Hara, H. Yamazaki and H. Eto.
2005. Outcome of oral uracil/tegafur (UFT) therapy
for patients with hormone refractory prostate cancer.
Oncol. Rep. 14:673.
85. Caristi N., R. Maisano, G. Lupo, G. Chiofalo, M.
Picciotto, V. Adamo, G. Altavilla and F. La Torre.
2005. Oral vinorelbine as first line treatment for
elderly patients with hormone- refractory prostate
cancer. Ann. Oncol. 7:13.
86. Jacobs S.C. 1983. Spread of prostatic cancer to
bone. Urology 21:337.
87. Smith M.R., J. Eastham, D.M. Gleason, D.
Shasha, S. Tchekmedyian and N. Zinner. 2003.
Randomized controlled trial of zoledronic acid to
prevent bone loss in men receiving androgen
deprivation therapy for nonmetastatic prostate
cancer. J. Urol. 169:2008.
88. Small E.J., M.R. Smith, J.J. Seaman, S. Petrone
and M.O. Kowalski. 2003. Combined analysis of
two multicenter randomized placebo controlled
studies of pamidronate disodium for the palliation of
bone pain in men with metastatic prostate cancer. J.
Clin.Oncol. 21:4277.
89. Corey E., L.G. Brown, J.E. Quinn, M. Poot, M.P.
Roudier, C.S. Higano and R.L. Vessella. 2003.
Zoledronic acid exhibits inhibitory effects on
osteoblastic and osteolytic metastases of prostate
cancer. Clin. Cancer Res. 9:295.
90. Saad F., D.M. Gleason, R. Murray, S.
Tchekmedyian, P. Venner, L. Lacombe, J.L. Chin,
J. Vinholes, J.A. Goas and M. Zheng. 2002. A
randomized, placebo-controlled trial of zoledronic
acid in patients with hormone-refractory metastatic
prostate carcinoma. J. Natl. Cancer Inst. 94:1458.
91. Saad F., D.M. Gleason, R. Murray, S.
Tchekmedyian, P. Venner, L. Lacombe, J.L. Chin,
J. Vinholes, J.A. Goas and M. Zheng. 2004. Long-
term efficacy of zoledronic acid for the prevention of
skeletal complications in patients with metastatic
hormone-refractory prostate cancer. J. Natl. Cancer
Inst. 96:879.
92. Hortobagy A. 2005. Davos Meeting 2005 May.
93. Singh A., R.A. Holmes and M. Farhangi. 1989.
Human pharmacokinetics of samarium-153 EDTMP
in metastatic cancer. J. Nucl. Med. 30: 1814.
94. Di Lorenzo G., G. Tortora, F. D’Armiento, G. De
Rosa, S. Staibano, R. Autorino, M. D’Armiento,
M. De Laurentiis, S. De Placido, G. Catalano,
A.R. Bianco and F. Ciardiello. 2002. Expression of
epidermal growth factor receptor (EGFR) correlates
with disease relapse and progression to androgen-
independence in human prostate cancer. Clin.
Cancer Res. 8:3838.
95. Miller K., N. Raabe, J. Trachtenberg, D. Trump,
G. Wilding and A. Das-Gupta. 2002. ZD1839, an
epidermal growth factor tyrosine kinase inhibitor
(EGFR-TKi) is well tolerated in combination with
mitoxantrone and prednisone in patients with
hormone-refractory prostate cancer (HRPC). Ann.
Oncol.3 ( suppl. 5) (Abstract n. 3270).
96. Souliè P., D. Trump, G. Wilding, E. Small and A.
Das-Gupta. 2002. ZD1839, an epidermal growth
factor tyrosine kinase inhibitor (EGFR-TKi) in
combination with docetaxel and estramustine in
patients with hormone-refractory prostate cancer
(HRPC). Ann. Oncol. 13(S):3280.
97. Canil C.M., M.J. Moore, E. Winquist, T. Baetz, M.
Pollak, K.N. Chi, S. Berry, D.S. Ernst, L. Douglas,
M. Brundage, B. Fisher, A. McKenna and L.
Seymour. 2005. Randomized phase II study of two
doses of gefitinib in hormone-refractory prostate
cancer: a trial of the National Cancer Institute of
Canada-Clinical Trials Group. J. Clin. Oncol. 23:455.
98. Small E.J., R. Bok, D.M. Reese, D. Sudilovsky and
M. Frohlich. 2001. Docetaxel, estramustine, plus
trastuzumab in patients with metastatic androgen-
independent prostate cancer. Semin. Oncol. 4:71.
 Int. J. Immunopathol. Pharmacol.
99. Lara P.N. Jr., K.G. Chee, J. Longmate, C. Ruel,
F.J. Meyers, C.R. Gray, R.G. Edwards, P.H.
Gumerlock, P. Twardowski, J.H. Doroshow and
D.R. Gandara. 2004. Trastuzumab plus docetaxel in
HER-2/neu-positive prostate carcinoma: final results
from the California Cancer Consortium Screening
and Phase II Trial. Cancer 100:2125.
100. Tolcher A.W. 2001. Preliminary phase I results of
G3139 (bcl-2 antisense oligonucleotide) therapy in
combination with docetaxel in hormone-refractory
prostate cancer. Semin. Oncol. 4:67.
101. Chi K.N., M.E. Gleave, R. Klasa, N. Murray, C.
Bryce, D.E. Lopes de Menezes, S. D’Aloisio and
A.W. Tolcher. 2001. A phase I dose-finding study of
combined treatment with an antisense bcl-2
oligonucleotide (Genasense) and mitoxantrone in
patients with metastatic hormone-refractory prostate
cancer. Clin. Cancer Res. 7:3920.
102. Wu-Wong J.R. 1999. Endothelin receptor
antagonists: past, present and future. Curr. Opin.
Cardiovasc. Pulmon. Ren. Invest. Drugs 1:346.
103. Hershberger P.A., W.D. Yu, R.A. Modzelewski,
R.M. Rueger, C.S. Johnson and D.L. Trump.
2001. Calcitriol (1,25-dihydroxycholecalciferol)
enhances paclitaxel antitumor activity in vitro and in
vivo and accelerates paclitaxel-induced apoptosis.
Clin. Cancer Res. 7:1043.
104. Beer T.M., K.M. Eilers, M. Garzotto, M.J.
Egorin, B.A. Lowe and W.D. Henner. 2003.
Weekly high-dose calcitriol and docetaxel in
metastatic androgen-independent prostate cancer. J.
Clin. Oncol. 21:123.
105. Dahut W.L., J.L. Gulley, P.M. Arlen, Y. Liu, K.M.
Fedenko, S.M. Steinberg, J.J. Wright, H. Parnes,
C.C. Chen, E. Jones, C.E. Parker, W.M. Linehan
33
and W.D. Figg. 2004. Randomized phase II trial of
docetaxel plus thalidomide in androgen-independent
prostate cancer. J. Clin. Oncol. 22:2532.
106. Picus J., S. Halabi and B. Rini. 2003. The use of
bevacizumab with docetaxel and estramustine in
hormone refractory prostate cancer: initial results of
CALGB 900006. Proc. Am. Soc. Clin. Oncol. 22: 393.
107. Usami B.A., R. Shen and M. Janeczko. 2000.
Methylation of the neutral endopeptidase gene promoter
in human prostate cancer. Clin. Cancer Res. 6:1664.
108. Gohji K., S. Kitazawa and H. Tamada. 2001.
Expression of endothelin receptor A associated with
prostate cancer progression. J. Urol. 165:1033.
109. Nelson J.B., K. Chan-Tack, S.P. Hedican et al.
1996. Endothelin-1 production and decreased
endothelin B receptor expressin in advanced prostate
cancer. Cancer Res. 56:663.
110. Nelson J.B., S.H. Nguyen and J.R. Wu-Wong.
1999. New bone formation in an osteoblastic tumor
model is increased by endothelin-1 overexpression
and decreased by endothelin A receptor blockade.
Urology 53:1063.
111. Carducci M., R.J. Padley, J. Breul, N.J. Vogelzang,
B.A. Zannenberg, D.D. Daliani, C.C. Schulman,
A.A. Nabulsi, R.A. Humerickhouse, M.A.
Weinberg, J.L. Schmitt and J.B. Nelson. 2003.
Effect of endothelin–A receptor blockade with
atrasetan on tumor progression in men with hormone-
refractory prostate cancer: a randomized, phase II,
placebo-controlled trial. J. Clin. Oncol. 4:679.
112. Small E., C. Higano and D. Smith. 2004. A phase
II study of an allogenic GM-CSF gene-transduced
prostate cancer cell line vaccine in patients with
metastatic hormone-refractory prostate cancer
(HRPC). J. Clin. Oncol. 22(S):4565.1.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 35-47 (2006)

SHEAR STRESS MODULATES THE EXPRESSION OF THROMBOSPONDIN-1 AND

CD36 IN ENDOTHELIAL CELLS IN VITRO AND DURING SHEAR STRESS-INDUCED
ANGIOGENESIS IN VIVO

M. BONGRAZIO, L. DA SILVA-AZEVEDO, E.C. BERGMANN, O. BAUM1, B. HINZ, A.R.

PRIES and A. ZAKRZEWICZ

Department of Physiology, Charité Campus Benjamin Franklin, Berlin, Germany; 1Institute of

Anatomy, University of Bern, Bern, Switzerland
The first two authors contributed equally to this work.

Received December 20, 2005 – Accepted January 23, 2006

Binding of thrombospondin-1 (TSP-1) to the CD36 receptor inhibits angiogenesis and induces apoptosis
in endothelial cells (EC). Conversely, matrix-bound TSP-1 supports vessel formation. In this study we
analyzed the shear stress-dependent expression of TSP-1 and CD36 in endothelial cells in vitro and in vivo
to reveal its putative role in the blood flow-induced remodelling of vascular networks. Shear stress was
applied to EC using a cone-and-plate apparatus and gene expression was analyzed by RT-PCR, Northern
and Western blot. Angiogenesis in skeletal muscles of prazosin-fed (50 mg/l drinking water; 4 d) mice was
assessed by measuring capillary-to-fiber (C/F) ratios. Protein expression in whole muscle homogenates
(WMH) or BS-1 lectin-enriched EC fractions (ECF) was analyzed by Western blot. Shear stress down-
regulated TSP-1 and CD36 expression in vitro in a force- and time-dependent manner sustained for at least
72 h and reversible by restoration of no-flow conditions. In vivo, shear stress-driven increase of C/F in
prazosin-fed mice was associated with reduced expression of TSP-1 and CD36 in ECF, while TSP-1
expression in WMH was increased. Down-regulation of endothelial TSP-1/CD36 by shear stress suggests a
mechanism for inhibition of apoptosis in perfused vessels and pruning in the absence of flow. The increase
of extra-endothelial (e.g. matrix-bound) TSP-1 could support a splitting type of vessel growth.

Thrombospondin-1 (TSP-1), a multifunctional
matricellular protein, is synthesized and secreted by
numerous cells including endothelial cells,
fibroblasts, and smooth muscle cells (1). One of its
biological activities is the modulation of
angiogenesis. However, the role of TSP-1 in this
context is quite complex since it shows both pro-
and anti-angiogenic effects. TSP-1 was originally
described as a potent inhibitor of angiogenesis in
vitro (2-3) and in vivo (4-5). This effect is
predominantly achieved through inhibition of
endothelial cell proliferation/migration, as well as
by induction of endothelial apoptosis. The
interaction of the type-1 repeat domains (TSR) of
TSP-1 with different receptors plays a crucial role in
mediating these anti-angiogenic effects (6-7). The
multifunctional CD36 receptor, also known as
scavenger receptor for oxidized LDL (8), is able to

Keywords: endothelial cells, shear stress, gene regulation, TSP-1, CD36, angiogenesis, atherosclerosis

Mailing address:
Dr Andreas Zakrzewicz
Department of Physiology
Charité Campus Benjamin Franklin - Arnimallee 22 1721-727X (2005)
Copyright © by BIOLIFE, s.a.s.
14195 Berlin, Germany This publication and/or article is for individual use only and may not be further
Tel: 0049-30-84451641 - Fax:0049-30-84451634 reproduced without written permission from the copyright holder.
E-mail: andreas.zakrzewicz@charite.de
35 Unauthorized reproduction may results in financial and other penalties
36 M. BONGRAZIO ET AL.
bind to the TSR domains of TSP-1. The expression
of CD36 on endothelial cells has been shown to be
essential for the antiangiogenic effects of TSP-1 (9).
In particular, binding of TSP-1 to CD36 inhibits
endothelial migration and activates the fyn/caspase-
3/p38MAPK cascade, thus inducing endothelial cell
apoptosis (9-10).
In contrast, other studies describe TSP-1 as a pro-
angiogenic molecule: (i) matrix-bound TSP-1 is pro-
angiogenic in the aorta ring model (11); (ii)
proteolytic products of TSP-1 (i.e. the amino-
terminal domain) support the induction of
angiogenesis in the rabbit cornea model (12); (iii)
the binding of the carboxy-terminus of TSP-1 to
CD47/IAP (integrin associated protein) promotes
proliferation and migration especially in smooth
muscle cells (13-14); (iv) high concentrations of
TSP-1 in the stroma of strongly vascularized
neoplasms and its binding and consequent activation
of latent TGFβ sustain tumor angiogenesis (12).
Taken together, these data suggest that the effect of
TSP-1 on angiogenesis depends not only on its
concentration but also on the type of presentation
(matrix-bound or in solution) and the cellular
distribution of its receptors.
TSP-1 acting on its receptor CD47, an integrin
associated protein (IAP), was previously proposed
to be involved in the regulation of endothelial
function by altered flow conditions (15-17). These
studies show that the endothelial expression of both
molecules is induced in the absence of shear stress
or during disturbed (turbulent) flow, leading to
endothelial apoptosis.
Among the hemodynamic forces exerted by blood
flow, wall shear stress plays a prominent role in the
regulation of long term angio-adaptive processes, like
angiogenesis, pruning or remodelling (18-20). The
endothelial cells lining the inner vascular wall are
directly exposed to blood flow, and their gene
expression is modulated in response to altered
hemodynamic conditions (21-23). Specifically, shear
stress-regulated genes could serve as one link between
flow conditions and long term vessel adaptation. Some
of the known shear stress-modulated genes have been
proposed to be involved in the regulation of structural
vessel adaptation (23-25). However, the mechanisms
proposed so far are not sufficient to cover the large
variety of hemodynamic and metabolic situations and
the corresponding angio-adaptive responses (26-28).
The ability to modulate angiogenesis together
with its sensitivity to shear stress, suggests TSP-1 to
be involved in the regulation of flow-dependent
angioadaptation. This involvement would be
supported by a concomitant shear stress-dependent
regulation of its endothelial receptor CD36. In this
study we investigated the expression of TSP-1 and
CD36 by altered hemodynamic conditions in vitro
and in vivo. To this aim, their expression was
analysed in micro- and macro-vascular endothelial
cells exposed to shear stress in a cone-and-plate
apparatus, and in the endothelial and extra-
endothelial fractions of skeletal muscles of prazosin-
treated and control mice.
MATERIALS AND METHODS
Cell Cultures
Human umbilical vein endothelial cells (HUVEC) and
human cardiac microvascular endothelial cells (HCMEC)
were isolated as previously described (24, 30). HUVEC
were cultured using MCDB 131 (500 ml, Endothelial Cell
Basal Medium MV, PromoCell, Germany) as culture
medium, supplemented with fetal calf serum (25 ml)
endothelial growth supplement/heparin (2 ml), hEGF (5
µg), and hydrocortisone (500 µg), all purchased as
SupplementPack MV® (PromoCell, Germany). HCMEC
were cultured with medium 199 containing fetal calf
serum (20%), endothelial cell growth factor (10 ng/ml,
Boehringer, Germany), streptomycin (100 µg/ml, Sigma),
and penicillin (100 U/ml, Sigma). Both types of
endothelial cells were kept in 5% CO2 at 37°C.
Endothelial cells (HUVEC: passage 1; HCMEC: passage
5-8) were seeded on Primaria® culture dishes (100 mm in
diameter; Becton Dickinson, France) and used for shear
stress experiments at confluence.
Shear stress experiments
Shear stress experiments were performed using the
cone-and-plate system as previously described (24).
Briefly, Petri dishes with confluent endothelial cells were
placed in a cone-and-plate apparatus maintained in a
humidified incubator at 37°C with 5% CO2/95% air. Wall
shear stress (τw) was calculated according to the formula:
τw= (ω/α) η, where ω is the angular velocity, α the cone
angle, and η the fluid viscosity. Laminar flow (R<1,
according to (31)) was generated using ω≤14.0 (rad•s-1),
η=0.0075 dyn•s•cm-2, and a cone with α=1.745·10-2 (rad).
Endothelial cells were exposed to a shear stress level of
 Int. J. Immunopathol. Pharmacol.
6.0 dyn·cm-2 for 4, 24, 48, and 72 h or to levels of 0.6, 1.0,
2.0, 3.0, and 6.0 dyn•cm-2 for 24 h. In additional experiments,
shear stress-exposed endothelial cells (6 dyn·cm-2; 24 h) were
returned to static conditions for 1, 4, 24 h.
Animals and prazosin administration
In accordance with approvals obtained from the
University and State authorities for animal welfare, this
study was performed on C57BL/6 mice bred in our
animal care facility under standard conditions. For
experiments, healthy male animals (three months old;
25–30 g weight) were used. Mice were fed with prazosin
(50 mg/l, Sigma, Germany) in the drinking water for 4
days, while control animals received water without
prazosin (32). The mice were anesthetized and killed by
an excess of Na-pentobarbital (Narcoren®, Merial,
Germany).
Non-specific alkaline phosphatase histochemistry
Extensor digitorum longus (EDL) muscles were
mounted (Tissue-Tek®, Sakura Finetek, Netherlands) on a
cork plate using frozen in liquid nitrogen-cooled
methylbutane, and stored in a closed plastic bag at –40°C
until use. Transversally cut cryosections (10 µm-thick)
from the middle part of the muscle were used. The
histochemical alkaline phosphatase (AP) reaction was
performed as previously described (34) and stopped by
extensive washing. The capillary-to-fiber (C/F) ratio was
calculated by counting the AP-reactive capillaries and
skeletal muscle fibers in a defined area containing at least
200 skeletal muscle fibers. In each muscle, 3–5 such
fields were evaluated for statistical analysis.
Isolation of the endothelial cell fraction
Endothelial cells from the skeletal muscles of mice
were isolated as previously described (34). Briefly,
minced tissue of the EDL, tibialis anterior and rectus
femoris muscles were pooled and subjected to
collagenase digestion and subsequent Griffonia
simplicifolia (BS-1) lectin precipitation with
paramagnetic beads, to obtain a highly enriched
endothelial cell fraction in the pellet.
RNA isolation and reverse transcription
Endothelial cells from in vitro experiments were
harvested by trypsination and RNA was isolated using the
RNeasy Mini kit (Qiagen, Germany) following the
manufacturer’s protocol. RNA (2 µg) and oligo-dT12-18 (2
µg, Pharmacia, Sweden) were heated at 70°C for 8
minutes and quickly chilled on ice. Reaction buffer (50
mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2, 10 mM
DTT, 500 µM dNTP) and 200 U reverse transcriptase
37
(SuperScript II®}, Life Technologies, USA) were added to
a final volume of 25 µl. Samples were incubated at 42°C
for 1 hour to generate cDNA followed by inactivation of
the enzyme at 70°C for 10 minutes.
Semi-quantitative RT-PCR
The cDNA thus obtained was diluted to a final volume
of 100 µl and aliquots (10 µl) were used for PCR
amplification. The PCR mix contained: 75 mM Tris-HCl,
pH 8.8, 20 mM (NH4)2SO4, 0.01% (v/v) Tween 20, 1.5
mM MgCl2, 200 µM dNTP, 1.0 U Taq polymerase
(ThermoprimePlus®}, Advanced Biotechnology, UK) and
1 µM (TSP-1, CD36) or 20 nM (GAPDH) primers.
Sequences of the primers used are listed in Table I.
Cycling parameters were optimized to obtain
measurements in the exponential phase of amplification
(33). Cycle number and annealing temperatures used
were: GAPDH = 25, 58°C; TSP-1 = 20, 63°C; CD36 =
28, 63°C. PCR products were separated on agarose gels,
stained with ethidium bromide, and subjected to image
analysis (ONE-Dscan, Scanalytics, USA). The optical
density ratio (ODR) was determined indicating the ratio
between the OD of the band of interest and that of
GAPDH.
Real-time PCR
DNA standards for GAPDH (955 bp) and CD36 (570
bp) were prepared by RT-PCR as described above.
Products were purified using the MiniElute PCR
Purification kit (Qiagen, Germany) and diluted to 108-102
copies/µl. Amplification reactions (final volume 20 µl)
contained 1 µl of standard dilutions or 4 µl cDNA
samples, 4 µl of GAPDH or CD36 nested primers (0.3
µM, Table I), and 10 µl Master mix SYBR-Green
(QantiTect SYBR Green PCR Kit, Qiagen, Germany).
Amplification was performed in a Rotor Gene 2000
cycler (Corbett Research, Australia) under the following
conditions: 94°C, 900 s + 45 x (94°C, 15 s; 56°C, 30 s;
72°C, 75 s). To control for single amplification products,
the PCR was followed by a stepwise increase in the
temperature to calculate a melting curve. The values for
CD36 were normalized using the corresponding GAPDH
values (ValueCD36/ValueGAPDH).
Northern analysis
A T7 RNA polymerase promoter was ligated
(Lig’nScribe, Ambion, USA) to the purified RT-PCR
product for TSP-1 and CD36 and biotin labelled antisense
RNA probes were generated using the North2South kit
(Pierce, USA). Total RNA (15 µg/lane) was resolved on
1.2 % agarose gels containing 2.2 M formaldehyde and
blotted onto positively charged nylon membrane (Nytran
38 M. BONGRAZIO ET AL.
SuPerCharge, Schleicher&Schuell, Germany) using 10 X
SSC (1.5 M NaCl, 0.15 M sodium citrate, pH 7.0) as
transfer buffer. After prehybridization (1 h; 68°C), the
blots were incubated overnight at 68°C in hybridization
solution (UltraHyb®, Ambion, USA) containing 10-20
ng/ml of biotin-labelled probes. Membranes were washed
twice at 68°C for 30 min in 0.1 X SSC, 0.1 % (w/v) SDS.
Hybridizing probes were detected by chemiluminescence
using CDP-Star (PerkinElmer, USA) as substrate. Data
quantification was performed by determination optical
density (ONE-Dscan, Scanalytics, USA) of the spots and
results were normalized to 18S.
Protein analysis
For analysis of protein expression in untreated (control
conditions using 0 dyn•cm-2 for 24 h) or shear stress-
exposed (6 dyn•cm-2 for 24 h) endothelial cells, experiments
were performed using serum-free medium. Supernatants (6-
8 ml) were collected and stabilized by the addition of
proteinase inhibitors (Complete Mini, Roche, Germany).
Adhering endothelial cells were lysed in 800 µl sample
buffer (50 mM Tris, pH 7.8, 150 mM NaCl, 3% CHAPS, 1
mM EDTA, Complete-proteinase inhibitors) and lysates
were cleared by centrifugation (20000 X g; 15 min; 4°C).
For immunoblot detection, samples were resolved on 7.5%
SDS-PAGE gels and transferred to nitrocellulose
membranes as previously described (34). After blocking
with 5% (w/v) fat-free milk, blots were incubated with a
mouse monoclonal anti-human TSP-1 IgG (1:500,
Neomarker, USA) and successively with a horseradish-
peroxidase-conjugated antimouse IgG antibody (1:10000;
DAKO, Denmark). Detection was performed by
chemiluminescence (West Femto substrate, Pierce, U.S.A).
Endothelial cell fractions from skeletal muscles of
untreated and prazosin-treated mice were extracted in
lysis buffer (20 mM Na-phosphate, pH 7.8, 1% Triton X-
100, 1 mM EDTA, 150 mM NaCl, Complete-protease
inhibitors). Immunoblotting was performed as described
above. For CD36 detection, a combination of a mouse
monoclonal anti-CD36 IgM (1:500, Santa Cruz
Biotechnology, USA) and a rabbit polyclonal anti-CD36
IgG (1:500, Cayman Chemical, USA) was used.
Whole skeletal muscle homogenates (Sorvall Potter
homogenizer, 10 strokes) from prazosin experiments were
extracted in lysis buffer and subjected to TSP-1
immunoprecipitation. 1 mg protein was incubated with
anti-TSP-1 antibody (5 µg, Santa Cruz Biotechnology,
USA) and 25 µl protein A-sepharose (CL-4B, Sigma,
Germany) in 1 ml lysis,buffer. Samples were incubated
overnight at 4°C with gentle rotation. Protein A-
Sepharose pellets were washed four times with lysis
buffer and once with 10 mM Tris-HCl, pH 7.4, 50 mM
NaCl. Bound TSP-1 was eluted at 100°C (5 min) in
twofold SDS-PAGE loading buffer (100 mM Na-
Phosphate, pH 7.4, 4% SDS, 200 mM DTT, 20%
glycerol, 0.02% bromphenol blue) and subjected to
immunoblot detection as described above.
Statistical analysis
For shear stress experiments using the cone-and-plate
system, “n” refers to the number of umbilical cords used for
isolation of endothelial cells. Results are expressed as mean
± SD. Statistical significance was determined by Student’s
t-test. Significance was assumed at a value of p≤0.05.
RESULTS
Human umbilical vein endothelial cells
(HUVEC) or human cardiac microvascular
endothelial cells (HCMEC) were exposed to
laminar shear stress (6 dyn•cm-2; 24 h) and TSP-1
expression was analysed by Northern and Western
blotting. As shown in Fig. 1a (Northern blot), the
mRNA for TSP-1 was strongly down-regulated by
shear stress in both endothelial cell types.
Quantifying Northern blot data showed more than
80% reduction of TSP-1 expression in HUVEC by
shear stress. The shear stress-dependent down-
regulation of TSP-1 in HUVEC was confirmed at
the protein level both in the intracellular and
extracellular fractions (Fig. 1b, Western blot).
The expression of the CD36 receptor was also
down-regulated by shear stress (Fig. 2). RTPCR
analysis revealed a marked reduction of CD36
mRNA in HUVEC and HCMEC exposed to shear
stress (6 dyn·cm-2; 24 h) (Fig. 2a). This effect was
confirmed in HUVEC by Northern blot analysis
(Fig. 2b) and quantified using real time RT-PCR
(Fig. 2c). The expression of CD36 after shear stress
exposure was reduced to about 40%. The
dependence of TSP-1 and CD36 expression on shear
stress intensities is shown in Fig. 3a. Shear stress
levels as low as 2 dyn·cm-2 or 1 dyn·cm-2 for TSP-1
or CD36, respectively, significantly down-regulated
the mRNA expression of these molecules. The
repression of TSP-1 mRNA in HUVEC by shear
stress (6 dyn·cm-2) was initiated after 4 h, and
reached a maximum after 24 h (Fig. 3b). This effect
was maintained for at least 72 h. The down-
regulation of CD36 reached a steady state level as
early as 4 h following the onset of flow. The shear
stress-dependent down regulation of TSP-1 and
 Int. J. Immunopathol. Pharmacol.
Fig. 1. Modulation of TSP-1 expression in shear stress-
exposed endothelial cells. (a) The expression of mRNA for
TSP-1 in control (static) and shear stress-exposed (shear:
cone-and-plate apparatus: 6 dyn/cm ; 24 h) HUVEC and
2
HCMEC was analyzed by Northern blot and data were
normalized using 18S as internal control. A graphical
representation of statistical evaluation (mean ± SD, n=6; *
p≤0.01) is shown. (b) The analysis of the shear stress-
dependent modulation of TSP-1 protein in HUVEC was
performed in cell lysates and supernatants using Western blot.
CD36 was shown to be reversible after restoration of
no-flow conditions. As shown in Fig. 4, the
expression of both molecules returned to control
values within 24 h.
To analyze the endothelial expression of TSP-1
and CD36 by increased shear stress in vivo,
C57BL/6 mice were fed with prazosin (50 mg/l
39
drinking water) for 4 days. The prazosin-induced
increase of wall shear stress in the microcirculation of
skeletal muscles led to an increase in the number of
capillaries per muscle fiber (capillary/fiber-ratio,
C/F), indicating the onset of angiogenesis (Fig. 5a).
Endothelial cell fractions (ECF) were isolated from
skeletal muscles of untreated and prazosin-fed mice
and the expression of TSP-1 and CD36 was analyzed by
Western blot. The results show a strong down-regulation
of the expression of these molecules in mice treated with
prazosin (Fig. 5b). These results are in agreement with
the shear stress-dependent down-regulation of TSP-1 and
CD36 observed in vitro in cultured endothelial cells.
Because pro- and anti-angiogenic effects of TSP-1 could
depend on its presentation, i.e. bound at the extracellular
matrix or as a soluble molecule potentially activating
endothelial CD36, respectively, we investigated its
expression in whole muscle homogenates (WMH) of
prazosin-treated mice. Since the non-endothelial fraction
of TSP-1, according to the different cell masses in
skeletal muscles, should be dominating in WMH, it was
assumed that changes in the TSP-1 content of WMH
reflect its regulation in the non-endothelial/matrix
compartment. Immunoprecipitation followed by
Western blotting showed that the TSP-1 concentration
in WMH of prazosin-fed mice was considerably higher
than in untreated animals (Fig 5c). This expression
pattern is opposite to that observed in ECF.
DISCUSSION
In this study we report in vitro and in vivo data
showing the concomitant shear stress-dependent
down-regulation of thrombospondin-1 (TSP-1) and
CD36 expression in endothelial cells. This hints at the
inhibition of TSP-1/CD36-mediated endothelial
apoptosis in perfused vessels or, by contrast, the
induction of endothelial apoptosis to prune non-
perfused vessels. Furthermore, we showed that the
increase of capillary-fiber-ratio in prazosin-treated
mice is accompanied by an augmented expression of
TSP-1 in the non-endothelial fraction of skeletal
muscle. This finding may indicate an involvement of
matrix-bound TSP-1 as support for shear stress-
driven angiogenesis.
TSP-1, a key modulator of angiogenesis, has
previously been proposed to play a role as a
molecular link between flow conditions and long term
40 M. BONGRAZIO ET AL.
Fig. 2. Modulation of CD36 expression in shear stress-
exposed endothelial cells.
(a) CD36 mRNA expression in control (static) and shear
stress-exposed (shear: cone-and-plate apparatus: 6
dyn/cm_; 24 h) HUVEC and HCMEC was analyzed by
semi-quantitative RT-PCR (HUVEC: 30 cycles; HCMEC:
35 cycles). In HUVEC, the analysis of CD36 expression was
additionally investigated by Northern blot (b) and real-time
RT-PCR (c). For evaluation of real-time RT-PCR results,
data (mean ± SD, n=6; * p≤0.01) were normalized using
GAPDH as housekeeping gene.
vessel adaptation (13-15). In these studies, the up-
regulation of endothelial TSP-1 expression in
absence of flow has been suggested to be involved in
the induction of endothelial apoptosis in non-
perfused wells and to contribute to vessel
degradation. In the present study, this concept is
further supported by revealing the regulation
characteristics of endothelial TSP-1 by shear stress
and analysing the shear stress-dependent modulation
of the CD36 receptor, which is known to be involved
in the anti-angiogenic/pro-apoptotic properties of
TSP-1 in endothelial cells.
The role of CD36 as endothelial receptor for
TSP-1 has been extensively described (6-7, 9-10).
Based on reports showing no expression of CD36 in
macrovascular endothelial cells (35-37), it has been
postulated to be restricted to the microcirculation.
Contrary to these reports, our data and those of other
groups (38-41) show that macrovascular endothelial
cells do express CD36. In the present study we used
first passage macrovascular endothelial cells from
human umbilical veins (HUVEC). McDouall et al.
(42) reported a decreased expression of CD36 in
microvascular endothelial cells by prolonged culture
time. Although this issue has not been examined in
macrovascular endothelial cells, a passage-
dependent down-regulation of CD36 in HUVEC
similar to that reported for microvascular endothelial
cells can not be excluded, and could account for the
absence of CD36 expression observed in the above-
mentioned studies. Furthermore, CD36-expressing
HUVEC have a slower growth rate (9) which could
result in a negative selection by successive passages.
Expression of CD36 in HUVEC was higher than
in microvascular endothelial cells (HCMEC) (Fig.
2), which had been reported to express CD36 by
other groups (35-37). However, HCMEC from
higher passages (5-8) than those of HUVEC (first
passage) had to be used, because of their limited
availability. According to the reported down-
regulation of CD36 by prolonged culture time (42),
first passage HCMEC may exhibit higher expression
levels. Furthermore, HUVEC and HCMEC show the
same shear stress-dependent suppression of CD36.
This regulation was also confirmed in vivo in the
endothelial fraction of skeletal muscles of mice
developing shear stress-driven angiogenesis
(prazosin model). Taken together, these data suggest
HUVEC and the prazosin model as suitable in vitro
and in vivo systems, respectively, to study shear
stress-effects on CD36 expression.
Based on our in vitro data, a reduced expression of
TSP-1/CD36 is to be expected in the large majority of
blood vessels: (i) the down-regulation of these
 Int. J. Immunopathol. Pharmacol.
Fig. 3. Effect of increasing shear stress and exposure-time
on the expression of TSP-1 and CD36.
HUVEC were exposed to different shear stress (0.6, 1.0,
3.0, 6.0 dyn/cm2) for 24 h (a) or to unique shear stress (6
dyn/cm2) for 4, 24, 48, 72 h (b) and mRNA expression for
TSP-1 and CD36 was analysed by Northern blot and RT-
PCR, respectively. Results (mean±SD) are expressed as %
of Static (0 dyn/cm2). n=3-6; *p≤0.05 **p≤0.01 vs. Static.
molecules is not restricted to a specific EC type since
it has been observed in EC from macro- and
microvascular vessels; (ii) it occurs even at shear
stress magnitudes of 1-2 dyn·cm-2, a value exceeded in
the majority of blood vessels throughout the vascular
system, including the microcirculation (43); (iii)
transient situations of reduced/absent flow are not
sufficient to induce TSP-1/CD36 expression. Thus,
the shear stress-dependent modulation of TSP-
1/CD36 is expected to represent a widespread
mechanism stabilizing blood vessels under
physiological conditions. Considering the key role of
41
CD36 as mediator of the pro-apoptotic effects of TSP-
1 on endothelial cells (9-10), the combined
suppression of both molecules could represent a more
effective mechanism to maintain physiologically
perfused blood vessels by low rates of apoptosis.
For the induction of TSP-1 and CD36 expression
in endothelial cells, relatively long incubation times
(4-24 h) at very low or absent flow are required (Fig.
4). In the vascular system, these conditions can only
be found in low/non-perfused vessels during
vascular remodelling and pruning or in the presence
of vascular occlusions. Endothelial apoptosis
induced by up-regulated expression of TSP-1 and
CD36 could contribute to pruning of low/non-
perfused vessels.
In this study, the expression of TSP-1 and CD36
by altered hemodynamic conditions has been further
investigated in vivo. The administration of the α1-
adrenergic antagonist prazosin increases wall shear
stress exerted on the endothelium and induces
angiogenesis (increased capillary/fiber-ratio) in the
skeletal muscles of rats (29) and mice (44). Using an
endothelial cell-enriched fraction from skeletal
muscles, we showed that increased shear stress
reduces endothelial expression of TSP-1 and CD36
at the protein level, thus in principle confirming the
in vitro data. However, the shear stress dependence
of this regulation seems to differ between the two
models. While near complete suppression of both
mRNA species occurs at relatively low shear stress
levels (1-2 dyn·cm-2) in HUVEC in vitro, there is a
significant amount of the two proteins detectable in
ECF from control mice, although under control
conditions a capillary wall shear stress of
11.05±1.25 dyn·cm-2 has been reported for the
tibialis anterior muscle in rats (61). These
quantitative differences might be due to differences
between the two species (human versus mouse) or
the in vivo versus in vitro approach.
In the in vivo model, non-endothelial TSP-1 was
found to be up-regulated after prazosin treatment. This
may be related to the finding that capillary growth in
the prazosin model occurs by splitting (26-28), also
reported as (shear stress-triggered) intussusceptive
angiogenesis (reviewed in 45), rather than sprouting of
capillaries. While the sprouting type of angiogenesis,
e.g. reported for stretched muscles, involves up-
regulation of MMP-2, the splitting type does not (46-
42 M. BONGRAZIO ET AL.

Fig. 4. Modulation of TSP-1 and CD36 expression by restoration of static condition.

HUVEC were cultured without flow (static), exposed to shear stress (shear: 6 dyn/cm2; 24 h) or first exposed to shear
and then further incubated for either 1 h, 4 h or 24 h under static culture condition. Analysis and data presentation were
performed as described in Figure 3. n=5-6; *p≤0.01 vs. Static.

Table I. Primers.
Product
Gene Primer Sequence Accession No.
length (bp)

GAPDH f: GGTCGGAGTCAACGGATTTGGT 977 X01677

r: TGTGGGCCATGAGGTCCACCAC

TSP-1 f: CTCAGGGATACTCGGGCCTTTCT 150 NM_003246

r: AATCTTTCCAGCCTATGTGACGAGG

CD36 f: GTGCAATCTTCGAACCTTCACTA 570 NM_000072

r: TGTCTGGGTTTTCAACTGGAGAG

GAPDH- f: CATGACAACCTTTGGTATCGTGG 140 X01677

nested *
r: GTAGAGGGCAGGGATGATGTTCT

CD36- f: CATGACAACCTTTGGTATCGTGG 144 NM_000072

nested *
r: GTAGAGGGCAGGGATGATGTTCT

* Primers for Real-Time PCR.

 Int. J. Immunopathol. Pharmacol. 43

Fig. 5. Angiogenesis and TSP-1/CD36 expression by prazosin treatment.

(a) C57BL/6 mice were fed with prazosin (50 mg/l drinking water; 4 days) and capillaries in cross sections of extensor
digitorum longus muscles were stained histochemically by alkaline phosphatase (AP) reaction. The capillary-to-fiber
(C/F) ratio was calculated by counting the AP-reactive capillaries and skeletal muscle fibers as described in “Materials
and Methods”. n=3, *p≤0.05. Bar, 50 µm. (b) Endothelial cells isolated from skeletal muscles of untreated (U) and
prazosin-fed (P) mice were analyzed for TSP-1 and CD36 expression using Western blot. Blots are representative of 3
independent experiments. (c) The modulation of TSP-1 expression in whole skeletal muscle homogenates after prazosin
treatment was analyzed by immunoprecipitation and Western blot. A representative blot is shown.

48). TSP-1 has been shown to inhibit MMP-2
expression (49), and the increased expression of TSP-
1 may thus favour the splitting type of angiogenesis
observed during prazosin treatment. Moreover, TSP-1
is known to be involved in the activation of latent
TGF-β (50). Activated TGF-β contributes to the
recruitment of pericytes, strengthening of the
extracellular matrix, basement membrane reformation
and stabilization of vessels in general (reviewed in 51).
The involvement of TSP-1 in splitting angiogenesis
correlates to the slightly reduced capillary density
found in TSP-1 knockout mice (52).
Beyond angiogenesis as the focus of this study,
TSP-1 plays a role in platelet activation (53) while
CD36 works as a scavenger receptor for ox-LDL (8).
TSP-1 bound to the subendothelial matrix, may
complement or even substitute the von Willebrand
factor during platelet adhesion at high shear rates
(54). Therefore, reduced concentrations of TSP-1 in
cell culture supernatants of HUVEC under shear
stress, but enhanced TSP-1 concentrations in WMH
during elevated shear stress in the prazosin model
could, in vivo, lead to reduced platelet activation
under high shear stress and intact endothelium, or
44 M. BONGRAZIO ET AL.
enhanced platelet adhesion under high shear stress
but disrupted endothelium. Suppression of
endothelial CD36 by shear stress could be one more
of several already-known protective mechanisms
against atherosclerosis, activated by steady laminar
blood flow (36, 59). It could be especially
responsible for the decrease in endothelial LDL
uptake observed during steady laminar flow (60).
Taken together, the data in this study show
combined down-regulation of TSP-1 and CD36 in
endothelial cells by shear stress. The main consequence
of this may be to support shear stress-driven
angiogenesis by capillary splitting, especially in
conjunction with an increased TSP-1 concentration in
the surrounding tissue. The opposite mechanisms may
work to prune non-perfused blood vessels. Thus, the
TSP-1/CD36 system may play a significant role during
angioadaptation to changing hemodynamic conditions.
ACKNOWLEDGEMENTS
We thank Dr. R. Gossrau for his continuous support,
especially in the histochemical analysis of muscle cross
sections, Dr. M. Gräfe for providing human cardiac
microvascular endothelial cells, and Gabriele Beyer
and Renate Noske-Reimers for expert technical
assistance. This work was supported by Deutsche
Forschungsgemeinschaft (FOR341/TP 3 and TP 12).
REFERENCES
1. Adams J.C. 2001. Thrombospondins: multifunctional
regulators of cell interactions. Annu. Rev. Cell. Dev.
Biol. 17:25.
2. Iruela-Arispe M.L., P. Bornstein and H. Sage.
1991. Thrombospondin exerts an antiangiogenic
effect on cord formation by endothelial cells in vitro.
Proc. Natl. Acad. Sci. U.S.A. 88:5026.
3. Tolsma S.S., M.S. Stack and N. Bouck. 1997.
Lumen formation and other angiogenic activities of
cultured capillary endothelial cells are inhibited by
thrombospondin-1. Microvasc. Res. 54:13.
4. Rastinejad F., P.J. Polverini and N.P. Bouck. 1989.
Regulation of the activity of a new inhibitor of
angiogenesis by a cancer suppressor gene. Cell 56:345.
5. Tolsma S.S., O.V. Volpert, D.J. Good, D.A.
Frazier, P.J. Polverini and N. Bouck. 1993.
Peptides derived from two separate domains of the
matrix protein thrombospondin-1 have anti-
angiogenetic activity. J. Cell Biol. 122:497.
6. Guo N., H.C. Krutzsch, J.K. Inman and D.D.
Roberts. 1997. Thrombospondin 1 and type I repeat
peptides of thrombospondin 1 specifically induce
apoptosis of endothelial cells. Cancer Res. 57:1735.
7. Iruela-Arispe M.L., M. Lombardo, H.C.
Krutzsch, J. Lawler and D.D. Roberts. 1999.
Inhibition of angiogenesis by thrombospondin-1 is
mediated by 2 independent regions within the type 1
repeats. Circulation 100:1423.
8. Febbraio M., D.P. Hajjar and R.L. Silverstein.
2001. CD36: A class B scavanger receptor involved
in angiogenesis, atherosclerosis, inflammation, and
lipid metabolism. J. Clin. Invest. 108:785.
9. Dawson D.W., S.F.A. Pearce, R. Zhong, R.L.
Silverstein, W.A. Frazier and N. Bouck. 1997.
CD36 mediates the in vitro inhibitory effects of
thrombospondin-1 on endothelial cells. J. Cell
Biol. 183:707.
10. Nör J.E., R.S. Mitra, M.M. Sutorik, D.J. Mooney,
V.P. Castle and P.J. Polverini. 2000.
Thrombospondin-1 induces endothelial cell
apoptosis and inhibits angiogenesis by activating the
caspase death way. J. Vasc. Res. 37:209.
11. Nicosia R.F. and G.P. Tuszynski. 1994. Matrix-
bound thrombospondin promotes angiogenesis in
vitro. J. Cell Biol. 124:183.
12. Taraboletti G., L. Morbidelli, S. Donnini, A.
Parenti, H.J. Granger, R. Giavazzi and M. Ziche.
2000. The heparin binding 25 kDa fragment of
thrombospondin-1 promotes angiogenesis and
modulates gelatinase and TIMP-2 production in
endothelial cells. FASEB J. 14:1674.
13. Wang X.Q. and W.A. Frazier. 1998. The
thrombospondin receptor (CD47IAP) modulates and
associates with alpha 2 beta 1 integrin in vascular
smooth muscle cells. Mol. Biol. Cell. 9:865.
14. Nesselroth S.M., A.I. Willis, S. Fuse, E.T. Olson, J.
Lawler, B.E. Sumpio and V. Gahtan. 2001. The C-
terminal domain of thrombospondin-1 induces vascular
smooth muscle cell chemotaxis. J. Vasc. Surg. 33:595.
15. Bongrazio M., A. Zakrzewicz, J. Knöchel, C.
Baumann, P. Gaehtgens and A.R. Pries. 2000.
Differential expression of thrombospondin repeat
 Int. J. Immunopathol. Pharmacol.
type1-containing proteins in flow exposed
endothelial cells. Eur. Heart J. 21(S):359.
16. Freyberg M.A., D. Kaiser, R. Graf, P. Vischer
and P. Friedl. 2000. Integrin-associated protein
and thrombospondin-1 as endothelial
mechanosensitive death mediators. Biochem.
Biophys. Res. Commun. 271:584.
17. Freyberg M.A., D. Kaiser, R. Graf, J. Buttenbender
and P. Friedl. 2001. Proatherogenic flow conditions
initiate endothelial apoptosis via thrombospondin-1
and the integrin-associated protein. Biochem. Biophys.
Res. Commun. 286:141.
18. Skalak T.C. and R.J. Price. 1996. The role of
mechanical stresses in microvascular remodelling.
Microcirculation 3:143.
19. Zakrzewicz A., T.W. Secomb and A.R. Pries.
2002. Angioadaptation: keeping the vascular system
in shape. News Physiol. Sci. 17:197.
20. Pries A.R., B. Reglin and T.W. Secomb. 2003.
Structural response of microcirculatory networks to
changes in demand: information transfer by shear
stress. Am. J. Physiol. Heart Circ. Physiol.
284:H2204.
21. Resnick N. and M.A. Jr. Gimbrone. 1995.
Hemodynamic forces are complex regulators of
endothelial gene expression. FASEB J. 9:874.
22. Braddock M., J.L. Schwachtgen, P. Houston,
M.C. Dickson, M.J. Lee and C.J. Campbell. 1998.
Fluid shear stress modulation of gene expression in
endothelial cells. News Physiol. Sci. 13:241.
23. Topper J.N. and M.A. Gimbrone Jr. 1999. Blood
flow and vascular gene expression: fluid shear stress
as a modulator of endothelial phenotype. Mol. Med.
Today 5:40.
24. Bongrazio M., C. Baumann, A. Zakrzewicz, A.R.
Pries and P. Gaehtgens. 2000. Evidence for
modulation of genes involved in vascular adaptation
by prolonged exposure of endothelial cells to shear
stress. Cardiovasc. Res. 47:384.
25. Wasserman S.M. and J.N. Topper. 2004.
Adaptation of the endothelium to fluid flow: in vitro
analyses of gene expression and in vivo implications.
Vasc. Med. 9:35.
26. Hansen-Smith F.M., O. Hudlicka and S. Egginton.
1996. In vivo angiogenesis in adult rat skeletal muscle:
45
early changes in capillary network architecture and
ultrastructure. Cell Tissue Res. 286:123.
27. Zhou A., S. Egginton, O. Hudlicka and M.D.
Brown. 1998. Internal division of capillaries in rat
skeletal muscle in response to chronic vasodilator
treatment with alpha1- antagonist prazosin. Cell
Tissue Res. 293:293.
28. Egginton S., A.-L. Zhou, M.D. Brown and O.
Hudlicka. 2001. Unorthodox angiogenesis in
skeletal muscle. Cardiovasc. Res. 49:634.
29. Hudlicka O. 1998. Is physiological angiogenesis in
skeletal muscle regulated by changes in
microcirculation? Microcirculation 5:5.
30. Zakrzewicz A., M. Grafe, D. Terbeek, M.
Bongrazio, W. Auch-Schwelk, B. Walzog, K.
Graf, E. Fleck, K. Ley and P. Gaehtgens. 1997. L-
selectin-dependent leukocyte adhesion to
microvascular but not to macrovascular endothelial
cells of the human coronary system. Blood 89:3228.
31. Sdougos H.P., S.R. Bussolari and C.F. Dewey.
1984. Secondary flow and turbulence in a cone-and-
plate device. J. Fluid. Mech. 138:379.
32. Da Silva-Azevedo L., O. Baum, A. Zakrzewicz
and A.R. Pries. 2002. Vascular endothelial growth
factor is expressed in endothelial cells isolated from
skeletal muscles of nitric oxide synthase knockout
mice during prazosin-induced angiogenesis.
Biochem. Biophys. Res. Commun. 297:1270.
33. Bongrazio M., M. Grafe, A.R. Pries, P. Gaehtgens
and A. Zakrzewicz. 2001. Improvement of RNA
fingerprinting efficiency for the analysis of
differential gene expression in human cardiac
macro- and microvascular endothelial cells.
Pharmacol. Res. 43:553.
34. Bongrazio M., A.R. Pries and A. Zakrzewicz. 2003.
The endothelium as physiological source of properdin:
role of wall shear stress. Mol. Immunol. 39:669.
35. Swerlick R.A., K.H. Lee, T.M. Wick and T.J.
Lawley. 1992. Human dermal microvascular
endothelial but not human umbilical vein
endothelial cells express CD36 in vivo and in vitro.
J. Immunol. 148:78.
36. Petzelbauer P., J.R. Bender, J. Wilson and J.S.
Pober. 1993. Heterogeneity of dermal microvascular
endothelial cell antigen expression and cytokine
46 M. BONGRAZIO ET AL.
responsiveness in situ and in cell culture. J.
Immunol. 151:5062.
37. Huh H.Y., S.K. Lo, L.M. Yesner and R.L.
Silverstein. 1995. CD36 induction on human
monocytes upon adhesion to tumor necrosis factor
activated endothelial cells. J. Biol. Chem. 270:6267.
38. Wyler B., L. Daviet, H. Bortkiewicz, J.C. Bordet
and J.L. McGregor. 1993. Cloning of the cDNA
encoding human platelet CD36: comparison to PCR
amplified fragments of monocyte, endothelial and
HEL cells. Thromb. Haemost. 70:500.
39. Kerkhoff C., C. Sorg, N.N. Tandon and W.
Nacken. 2001. Interaction of S100A8/S100A9-
arachidonic acid complexes with the scavenger
receptor CD36 may facilitate fatty acid uptake by
endothelial cells. Biochemistry 40:241.
40. Kanda S., Y. Mochizuki, Y. Miyata, H. Kanetake
and N. Yamamoto. 2002. Effects of vitamin D(3)-
binding protein-derived macrophage activating
factor (GcMAF) on angiogenesis. J. Natl. Cancer
Inst. 94:1311.
41. Liu Y., Y. Zhu, F. Rannou, T.S. Lee, K. Formentin, L.
Zeng, X. Yuan, N. Wang, S. Chien, B.M. Forman and
J.Y. Shyy. 2004. Laminar flow activates peroxisome
proliferator-activated receptor-gamma in vascular
endothelial cells. Circulation 110:1128.
42. McDouall R.M., M. Yacoub and M.L. Rose. 1996.
Isolation, culture, and characterisation of MHC class
II-positive microvascular endothelial cells from the
human heart. Microvasc. Res. 51:137.
43. Nerem R.M., R.W. Alexander, D.C. Chappell,
R.M. Medford, S.E. Varner and W.R. Taylor.
1998. The study of the influence of flow on vascular
endothelial biology. Am. J. Med. Sci. 316:169.
44. Baum O., L. Da Silva-Azevedo, G. Willerding, A.
Wockel, G. Planitzer, R. Gossrau, A.R. Pries and
A. Zakrzewicz. 2004. Endothelial NOS is main
mediator for shear stressdependent angiogenesis in
skeletal muscle after prazosin administration. Am. J.
Physiol. 287:2300.
45. Djonov V., O. Baum and P.H. Burri. 2003. Vascular
remodelling by intussusceptive angiogenesis. Cell
Tissue Res. 314:107.
46. Rivilis I., M. Milkiewicz, P. Boyd, J. Goldstein,
M.D. Brown, S. Egginton, F.M. Hansen, O.
Hudlicka and T.L. Haas. 2002. Differential
involvement of MMP-2 and VEGF during muscle
stretch- versus shear stress-induced angiogenesis.
Am. J. Physiol. 283:1430.
47. Haas T.L., M. Milkiewicz, S.J. Davis, A.L. Zhou,
S. Egginton, M.D. Brown, J.A. Madri and O.
Hudlicka. 2000. Matrix metalloproteinase activity is
required for activityinduced angiogenesis in rat
skeletal muscle. Am. J. Physiol. 279:1540.
48. Brown M.D. and O. Hudlicka. 2003. Modulation
of physiological angiogenesis in skeletal muscle by
mechanical forces: Involvement of VEGF and
metalloproteinases. Angiogenesis 6:1.
49. Donnini S., L. Morbidelli, G. Taraboletti and M.
Ziche. 2004. ERK1-2 and p38 MAPK regulate
MMP/TIMP balance and function in response to
thrombospondin-1 fragments in the microvascular
endothelium. Life Sci. 74:2975.
50. Murphy-Ullrich J.E. and M. Poczatek. 2000.
Activation of latent TGF-beta by thrombospondin-1:
mechanisms and physiology. Cytokine Growth
Factor Rev. 11:59.
51. Driesche S., C.L. Mummery and C.J.
Westermann. 2003. Hereditary teleangiectasia: an
update on transforming growth factor β signalling
in vasculogenesis and angiogenesis. Cardiovasc.
Res. 58:20.
52. Lawler J., M. Sunday, V. Thibert, M. Duquette,
E.L. George, H. Rayburn and R.O. Hynes. 1998.
Thrombospondin-1 is required for normal murine
pulmonary homeostasis and its absence causes
pneumonia. J. Clin. Invest. 101:982.
53. Bornstein P. 2001. Thrombospondins as
matricellular modulators of cell function. J. Clin.
Invest. 107:929.
54. Jurk K., K.J. Clemetson, P.G. de Groot, M.F.
Brodde, M. Steiner, N. Savion, D. Varon, J.J.
Sixma, H. Van Aken and B.E. Kehrel. 2003.
Thrombospondin-1 mediates platelet adhesion at
high shear via glycoprotein Ib (GPIb): an
alternative/backup mechanism to von Willebrand
factor. FASEB J. 17:1490.
55. Rader D.J. and K.A. Dugi. 2000. The endothelium
and lipoproteins: insights from recent cell biology
and animal studies. Semin. Thromb. Hemost. 26:521.
56. Murase T., N. Kume, R. Korenaga, J. Ando, T.
Sawamura, T. Masaki and T. Kita. 1998. Fluid
 Int. J. Immunopathol. Pharmacol.
shear stress transcriptionally induces lectin-like
oxidized LDL receptor-1 in vascular endothelial
cells. Circ. Res. 83:328.
57. Liu Y., B.P. Chen, M. Lu, Y. Zhu, M.B. Stemerman,
S. Chien and J.Y. Shyy. 2002. Shear stress activation
of SREBP1 in endothelial cells is mediated by
integrins. Arterioscler. Thromb. Vasc. Biol. 22:76.
58. Ameshima S., H. Golpon, C.D. Cool, D. Chan,
R.W. Vandivier, S.J. Gardai, M. Wick, R.A.
Nemenoff, M.W. Geraci and N.F. Voelkel. 2003.
Peroxisome proliferatoractivated receptor gamma
(PPARgamma) expression is decreased in
pulmonary hypertension and affects endothelial cell
47
growth. Circ. Res. 92:1162.
59. Berk B.C., W. Min, C. Yan, J. Surapisitchat, Y.
Liu and R. Hoefen. 2002. Atheroprotective
mechanisms activated by fluid shear stress in
endothelial cells. Drug News Perspect.15:133.
60. Deng X., Y. Marois, T. How, Y. Merhi, M. King, R.
Guidoin and T. Karino. 1995. Luminal surface
concentration of lipoprotein (LDL) and its effect on
the wall uptake of cholesterol by canine carotid
arteries. J. Vasc. Surg. 21:135.
61. Dawson J.M. and O. Hudlicka. 1993. Can changes
in microcirculation explain capillary growth in
skeletal muscle? Int. J. Exp. Path. 74:65.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 49-56 (2006)

GROWTH FACTOR RECEPTORS IN HEMATOPOIETIC STEM CELLS: EPH FAMILY

EXPRESSION IN CD34+ AND CD133+ CELL POPULATIONS FROM MOBILIZED
PERIPHERAL BLOOD
P. LAZAROVA, Q. WU1, G. KVALHEIM, Z. SUO1, K. W. HAAKENSTAD, K. METODIEV2
and J. M. NESLAND1

Lab for Cellular Therapy, 1Department of Pathology, The National Hospital-The Norwegian
Radium Hospital, University of Oslo, Oslo 0310, Norway; 2Department of Microbiology and
Immunology, Medical University, Varna 9002, Bulgaria

Received February 7, 2005 – Accepted December 2, 2005

Cell-surface antigen expression of hematopoietic stem cells has a crucial role in characterizing cell
subpopulation with distinct functional properties. The Eph receptors are the largest receptor tyrosine kinase
family being involved in processes like vascular remodelling during development and physiological and
pathological angiogenesis. Some Eph/Ephrin members are expressed in hematopoietic cells. The ability to
isolate purified cell populations co-expressing CD34 and CD133 antigens as most commonly used markers
for identification of hematopoietic progenitors has provided the opportunity to identify their surface-
receptor profile. As positively expressed CD34 and CD133 cells take place not only in hematopoietic but also
in endothelial differentiation, we aimed to define the Eph/Ephrin characteristic of these cells and relate these
findings to new therapy strategies. Positive selections of CD34 and CD133 cells from PBPC in lymphoma
patients were performed using magnetic beads and AutoMACS (Miltenyi Biotec) device. The purity of
isolated cells was tested by flow cytometry. Immunocytochemistry was used to assess the Eph/Ephrin
expression profile of positively selected samples. Our study revealed that all samples (10 from CD34+ and 8
from CD133+ cells) expressed one or more of Eph/Ephrin antigens in different proportions. All CD34 + cell
samples, and 6 of 8 in the CD133+ cell fraction were strongly immunoreactive for EphA2. EphB2 was
strongly expressed in all CD133+ cases, but 50% of the CD34 positive group lacked or weakly expressed this
receptor. EphB4 was negative in 9 of 10 CD34+ cases and in all CD133 +cells. Thus, we have shown the
surface marker profile of positively selected CD34 and CD133 cells in leukapheresis samples from
lymphoma patients with regard to Eph/Ephrin receptors and discussed their biological clinical potential.

The human hematopoietic system is sustained by
rare pluripotent hematopoietic stem cells (HSC) in
the bone marrow that are capable of self-renewal
and differentiation into multiple hematopoietic
lineages. As stem cells proliferate, they give rise to
lineage-committed cells with more limited
proliferative potential, which in turn mature to
functional end cells (1). HSC are a phenotypically
and functionally heterogeneous population of cells.
Primitive hematopoietic cell subpopulations derived
from different hematopoietic sources, bone marrow,
cord blood, peripheral blood or aphaeresis product,

Key words: CD34, CD133, stem cells, Eph family receptors

Mailing address:
Gunnar Kvalheim, MD, PhD,
Laboratory for Cellular Therapy,
The Norwegian Radium Hospital,
University of Oslo, 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Oslo 0310, Norway This publication and/or article is for individual use only and may not be further
Fax: +47 2293 4596 - Tel: +47 2293 5913 reproduced without written permission from the copyright holder.
E-mail address: gunnar.kvalheim@klinmed.uio.no 49 Unauthorized reproduction may results in financial and other penalties
50 P. LAZAROVA ET AL.
can be isolated, enriched and subjected to different
assays that are able to evaluate the biological
functions of HSC for further clinical application (2).
Considerable progress has been made in the
isolation and characterization of hematopoietic stem
cells population. Several methods have been
employed to separate the HSC from the other cellular
elements of the bone marrow or peripheral blood.
The most commonly used marker to identify
human stem and progenitor cells is the CD34 antigen.
CD34 is a glycoprotein that is present in about 0.5-3%
on the membranes of all nucleated cells in adult
human bone marrow, about 1% in cord blood and
0.05-0.2% in peripheral blood. This molecule is
highly expressed on primitive cells but is significantly
downregulated upon differentiation into more mature
cells (3). Enriched fractions of CD34 cells have been
shown to contain virtually all hematopoietic
progenitors that are clonogenic in vitro (4-6).
Another important marker for the identification
of early hematopoietic progenitors and stem cells is
CD133 (previously designated AC133) antigen (7).
This antigen is a unique five-transmembrane (5-TM)
glycoprotein and represents the human homolog of
murine prominin. The antigen is phylogenetically
conserved but the specific function and potential
ligands for the prominin family remain to be
characterized. However, human and mouse versions
of prominin have been shown to share similar
selective membrane association and tissue
expression profiles (8-9). In the hematopoietic
system, CD133 expression is restricted to
subpopulations of CD34bright stem and progenitor cells
found in adult bone marrow, fetal liver and bone
marrow, cord blood, and adult peripheral blood (10).
The coexpression with CD34 antigen on the primitive
stem and progenitor cell populations reveals its role in
hematopoiesis and cell differentiation. CD133 has not
only been found on hematopoietic precursors, but also
on circulating cells with endothelial capacity (11).
The HSC are heterogeneous in their surface receptors
profile concerning expression of tyrosine kinase
receptors, that seems to be crucial in the diverse cell
differentiation (12).
The largest subfamily of receptor tyrosine
kinases (RTK) encoded in the human genome is Eph
receptors. Interactions of Eph receptor tyrosine
kinases with their membrane-bound ligands, the
ephrins, are implicated in important developmental
processes, including tissue morphogenesis in the
nervous and cardiovascular systems (13-14). The
Eph signalling is crucial for the mediating of cell-
cell communication, cell attachment, shape and
mobility. According to their structural features and
their binding affinities, both Eph receptors and
ephrins are divided into two subclasses, A and B.
EphA (A1-A8) receptors bind preferentially the
ephrins A (A1-A5), that are attached to the cell via
glycosylphosphatidylinositol (GPI) linkage.
Whereas EphB (B1-B6) receptors interact with three
different ephfrins B (ephrinB1-B3), that are
transmembrane ligands (15).
To date, a few Eph receptor members and ephrin
molecules have been reported in cells of the human
hematopoietic system. EphB1 is abundantly detected
in plasmacytoid DC (16), EphB4 has a wide
distribution in fetal and adult tissue including primary
CD34+ hematopoietic progenitors and several
myeloid cells (17) and also has been described in B-
cell differentiation (18). EphA1, EphA2, and EphB2
are reported to be expressed in thymus (19). EphA3
has been originally cloned from a pre-B-cell leukemia
and is expressed in some T-cell lines.
However, although the expression of some Eph
receptors in the hematopoietic progenitor cells, their
functions in the differentiation processes of these
cells are mostly unspecified.
In an attempt to characterize the surface marker
profile of hematopoietic stem cells, we have mapped
the Eph and ephrin expressions in CD34+ and
CD133+ cells isolated from leukapheresis product
and discussed their potential biological impact.
MATERIALS AND METHODS
Cell sources
Samples were obtained from cancer patients undergoing
peripheral blood progenitor stem cell (PBPC) harvesting
following treatment with chemotherapy and G-CSF. A CS
3000 Fenwall Cell Separator (Baxter, Deerfield, IL, U.S.A.)
PBPC was used for PBPC collection. CD34+ cell
enrichment was done from PBPC of 10 individual patients
while the CD133+ cells were obtained from PBPC products
of 8 patients. All patients included in the study were
lymphoma patients in good clinical remission.
Positive selection of CD34 cells and CD133 cells
For CD34+ or CD133+ cell isolation, PBPC were
subjected to immunomagnetic separation using a magnetic
 Int. J. Immunopathol. Pharmacol.
activated cell sorting (MACS) CD34 Progenitor Cell
Isolation Kit or CD133 cell isolation kit (Miltenyi Biotec,
Bergisch Gladbach, Germany), following the manufacturer’s
recommendations. In brief, an aliquot of 109 PBPC from each
leukapheresis product was passed through 30-µm nylon mesh
in order to remove clumps, washed once and resuspended in
cold PBS/ 0.5% BSA/ 2mM EDTA at concentration of 108
cells per 300 µl, then proceeded to magnetic labelling. The
cell samples were incubated for 30 min at 4C° with anti-
CD133 or anti-CD34 antibodies conjugated to magnetic
microbeads and with FcR blocking reagent (human
immunoglobulin G) to inhibit unspecific or Fc-receptor
mediated binding of antibodies to non-target cells. The
concentration was 100µl FcR blocking reagent and 100µl
CD34 or CD133 MicroBeads per 108 cells. After incubation
the labelled cells were washed with cold PBS and processed
to magnetic separation with AutoMACS device (Miltenyi
Biotec, Bergisch Gladbach, Germany) using the programme
“posseld” according to manufacturer’s instructions.
Flow Cytometric Analysis of Positively Selected CD34
Cells and CD133 Cells
Aliquots of isolated CD133+ and CD34+ cell samples
were stained with antibodies for flow cytometric analysis as
follows: Positively selected CD34 cell aliquot was
incubated with phycoerythrin (PE) - conjugated anti CD34
MoAb (8G12), following standard single staining procedure
for flow cytometry. The anti -CD133 antibody conjugated to
PE (clone: AC133/2- AC141) and anti-CD34 (Anti-HPCA-
2) MoAb labeled with fluoresceinisotiocyanate (FITC) were
used for evaluating CD133+ selected cell samples. Clone
AC133/2 recognizes a different epitope and does not
overlap with clone AC133 used in the selection. Isotype-
matched mouse immunoglobulin was provided as control.
The anti-CD133 MoAb was obtained from Miltenyi Biotec,
all other antibodies were from Becton-Dickinson. The
single- (for CD34+ isolation) and two-colour (for CD133+
isolation) flow cytometric analyses were performed by
FACSort (Becton Dickinson) device.
Cytospin preparation
The positively selected CD34 and CD133 cell samples
were processed for cytospin preparation, following a
standard in-house protocol (20). Briefly, the cells were
resuspended in PBS/1%HAS with FCS at a concentration
2x106/ ml. 50-70µl of the cell suspension were placed into
each slide-assembled funnel chamber of Shandon
cytocentrifuge and spun down at 800 rpm for 4 minutes.
The slides were then air-dried, and proceeded to
immunostaining.
Immunostaining
Immunocytochemistry assay was performed by using
the Dako EnVisioinTM+ System, Peroxidase (DAB) (K4007
51
and K4011, Dako Corporation, CA, USA) and Dako
Autostainer. The cytospins were fixed for 10 min in ice-cold
acetone and air-dried. After incubation with 0.03%
hydrogen peroxide for 5 minutes to block the endogenous
peroxidase activity, the slides were washed by TBS (from
Dako Cytomation) and incubated with primary antibodies
(Table I) for 30 minutes at room temperature. For EphA2,
EphB4 and Ephrin A1, the cytospins were incubated with
peroxidase labelled polymer conjugated to goat anti-rabbit
IgG for 30 minutes. For Ki-67, peroxidase labelled polymer
conjugated to goat anti-mouse IgG for 30 minutes
incubation was used. The cytospins for EphB2 were
incubated with mouse anti-goat IgG (sc-2489, Santa Cruz
Biotechnology) diluted 1:100 for 30 minutes, and then
incubated with peroxidase labelled polymer conjugated to
goat anti-mouse for 30 minutes. Slides were stained for 10
minutes with 3, 3’- diaminobenzidine tetrahydrochloride
(DAB) and then counterstained with haematoxylin,
dehydrated, and mounted in Diatex. Every series included
positive controls. The negative controls included: 1)
substitution of the monoclonal antibody with mouse
myeloma protein of the same subclass and concentration as
the monoclonal antibody; 2) replacement of polyclonal
primary antibody with normal goat IgG of the same
concentration as the polyclonal antibodies. All controls gave
satisfactory results. Four semiquantitative classes were used
to describe the number of positively stained cells: - none, +
less than 10% of the cells, ++ 10-50% of the cells and +++
more than 50% of the cells.
Eelectron microscopy
The positively selected CD34 and CD133 cells were fixed
overnight using McDowell′s solution (4% paraformaldehyde
and 1% glutaraldehyde). The material was then rinsed twice
in 0.1 M cacodylate buffer for 10 min. and postfixed in 1%
osmiumtetroxide for 1h in 4-6°C. The samples were
thereafter rinsed in distilled water and stained on block in 2%
uranylacetate for 1h. Following an additional rinsing in
distilled water, the samples were dehydrated in ethanol baths
(70%, 90%, 96%, 100%x 3) and 3x propyleneoxide for
10min. Embedding was completed using Epon 812 and
gelatine capsules placed in a heating oven (80°C) over night.
After that ultrathin sections about 50-80 nm were cut.
RESULTS
Flow cytometry- Purity of selected CD34+ and
CD133+ cells
The CD34+ and CD133+ cell fractions were
analyzed using flow cytometry to assess the purity of
isolated cells. The purity of positively selected cells
was high (over 90%) in all samples. Our results
revealed a complete overlapping and co-expression of
52 P. LAZAROVA ET AL.

CD34+ and CD133+ antigens in PBPC. Fig.1.A and B Table II. A. Eph/ Ephrin- expression profile in CD34
show representative sample from one patient. positive cells.
(Numberp of cases=
p ) 10 patient samples).
Electron microscopy Antigen Eph A2 Eph B2 Eph B4 Ephrin A1 Ki 67
expression
A) CD 34 positive cells
A slight variation in cellular size was seen. The - 0 3 6 0 8
cells had irregular nucleoli with a slight to moderate + 0 2 3 2 1
accumulation of heterochromatin along the nuclear ++ 0 4 1 7 1
membrane. The nucleolus was inconspicuous to +++ 10 1 0 1 0
moderate. Cytoplasm was filled with mitochondria,
much more than seen in CD133 positive cell Table II. B. Eph/ Ephrin- expression profile in CD133
populations. On the surface abundant filipodia/microvilli positive cells.
were present (Fig.2.A). (No of cases= 8 patient samples).
Antigen Eph A2 Eph B2 Eph B4 Ephrin A Ki 67
expression
Table I. Primary antibodies which were used in the
immunostaining. - 1 0 7 3 8
+ 1 0 1 0 0
Antibody Company Product Description Dilution
number ++ 0 2 0 4 0

+++ 6 6 0 1 0
EphA2 Santa Cruz sc-924 Rabbit 1:400, Four semiquantitative classes were used to describe the number
Biotechnolo polyclonal 0.5 g
gy, Inc, IgG/ml
of positively stained cells: - none, + less than 10% of the cells,
CA,USA ++ 10-50% of the cells and +++ more than 50% of the cells.
EphrinA1 The same as sc-911 Rabbit 1:300,
above polyclonal 0.7 g
IgG/ml cytoplasmic EphA2 immunoreactivity was present in
EphB2 The same as sc-1763 Goat 1:100, all cases (Fig.3.A), while EphB2, EphB4 and
above polyclonal 1.3 g IgG
/ml
EphrinA1 were more variably expressed. Eight out of
EphB4 The same as sc-5536 Rabbit 1:100, 1 g ten cases did not show any proliferation activity as
above polyclonal IgG/ml assessed by Ki 67 antigen expression.

Ki-67 Dako A/S, M-7187 Mouse 1: 50, 0.9 g B) Eph and Ephrin antigen expression on CD 133
Glostrup, monoclonal IgG /ml positive cells
Danmark
Six out of eight cases were strongly positive for
EphA2 (Table II B). EphB2 was moderately or strongly
B) CD 133 positive cells positive in all eight cases (Fig.3.B). EphB4 was
Material presented for EM revealed a relatively negative in seven out of eight cases. EphrinA1 showed
uniform cell population in which the cells had slightly a broader variation in expression profile. All cases were
irregular nuclei with a finely dispersed chromatin and Ki 67 negative. As can be seen in Tables 2 and 3,
small nucleoli. Cytoplasm was moderate and with although the difference between Eph/Ephrin antigen
varying amounts of mitochondria. Inconspicuous expression on CD34 and CD133 compartment was not
amounts of ribosomes, rough endoplasmic reticulum, significant, there are some variations in the proportions
intermediate filaments without focal densities, and of EphA2, EphB2 and EphrinA1 antigens.
lysosomes were observed. The cell surface was slightly
irregular, with small filipodia (Fig.2.B). DISCUSSION

Immunocytochemistry The antigen-expression characteristics of

A) Eph and Ephrin antigen expression on CD 34+ cells hematopoietic stem and progenitor cells are important
All cases were immunoreactive for one or more of in defining the biological functions of stem cell
the Eph and Ephrin markers (Table II A). A strong populations. Isolated CD34+ hematopoietic progenitor
 Int. J. Immunopathol. Pharmacol.
Fig. 1a
Fig. 1 A and B. Purity of selected CD34+ and CD133+ cells showing a complete overlapping of the antigen of
CD34/CD133 expression
cells constitute a heterogeneous population of cells
including a small proportion of pluripotent SC and a
much larger population of precursors, which are
already committed to the different hematopoietic cell
lineages (21). The recently described early
hematopietic antigen CD133 might be an alternative
source of stem cells for transplantation (7). The cell
surface marker CD133 is not expressed on
differentiated hematopietic or endothelial cells and
therefore coexpression of CD133 with endothelial
markers can be used to distinguish endothelial
precursors from mature endothelial cells. At present, it
is unclear whether CD133 only represents a surface
marker or has a functional activity involved in the
regulation of neovascularization (22). In vitro studies of
CD133+ cells indicates that functional hematopoietic
or endothelial progenitors can be expanded from these
selected cells in a similar manner to that of CD34
populations, thus suggesting that CD133+ cells share
similar growth factor requirements for hematopoietic
(23) and endothelial differentiation (24). The
hematopoietic and endothelial precursors share not
only CD34 and CD133, but many other cell surface
antigens as well, especially growth factor receptors
involved in cell proliferation, differentiation and
angiogenesis. The presence of these tyrosine kinase
receptors, including VEGFR, Tie and Eph family in
endothelial cells is considered to be critical for vascular
formation (25-27). In the present study we have shown
53
Fig. 1b
that highly enriched CD34+ cells or CD133+ cells from
PBPC identify the same type of cells since both
antigens are equally expressed in both enriched
populations.
The impact of Eph receptor family and ephrins in
regulation of angiogenesis is well established (28).
Binding of Eph receptor and its ligand induces
dimerization and phosphorylation of kinase domains
and, activates several important intracellular
signalling pathways, such as the PI-3 kinase
pathway, the ERK/MARK pathway, and the Ras
pathway, takes place. The phosphorylation process
is balanced with tyrosine phosphatases quickly
dephosphorylating the kinases (29).
Class A Eph receptors have been shown to control
postnatal angiogenesis in adults. EphA2 is a key
regulator of endothelial cell migration and vascular
assembly (30). Our results indicate that positively
selected CD34 and CD133 cell samples from
mobilized PBPC express definitely the Eph receptor
family and ephrins. CD34 positive cells were strongly
expressing EphA2 receptor in all patients, and in the
CD133+ cell fraction 6 of 8 patients were strongly
positive for this antigen.
Gene targeting studies have determined class- B
Eph family members as key regulators of
developmental angiogenesis. Recent findings on Eph
B-mediated cellular functions have provided evidence
for their role in controlling vascular homeostasis in the
54 P. LAZAROVA ET AL.
Fig. 2 Electron micrographs of CD34 and CD133
positive cells.
A Electron micrograph of CD34 positive cells(26x). Note
the irregular nucleoli and numerous mitochondria.
Abundant microvilli are seen on the surface.
B Electron micrograph of CD133 positive cells (38x). The
amount of mitochondria is less prominent than seen in
CD34 positive cells.
Microvilli/filipodia are also less prominent.
adult (31). The fact that EphB2 is expressed in all CD
133 positive cases while 50% of the group of CD 34+
cells lack (no=3) or weakly express (no=2) this
receptor suggests that CD133+ cells have a different
role in angiogenesis than CD34+ cells. If we make the
cut off for evaluation at 10% we do see that EphB4 is
negative in nine out of ten CD34 positive cases and
negative in all CD 133 positive cases. Thus, in our
leukapheresis specimens we do see less expression of
EphB4 than reported previously in primary CD34+
hematopoietic progenitors from cord blood and
Fig. 3 Immunostaining of Eph in CD34 and CD133
positive cells.
A. Group of CD34 positive cells with immunoreactivity
for EphA2(40X). The strong staining of EphA2 is located
in cytoplasm in CD34 positive cells.
B Group of CD133 positive cells with EphB2
immunoreactivity (40X). The strong staining of EphB2 is
located in cytoplasm in CD133 positive cells.
bone marrow (12, 17, 32). As the Eph RTK family
expression on CD34+ and CD133+ cells from PBPC
with regard to endothelial differentiation has not been
reported previously we can not compare our findings.
The possibility of inducing endothelial
differentiation in cells from populations of CD34
positive cells is well documented (11, 24, 33). Here
we also have shown that the cells express Eph
family members and thus have a tool available for
the endothelial differentiation process.
Angiogenesis is crucial for pathogenesis of cancer
 Int. J. Immunopathol. Pharmacol.
and is associated with tumour growth and metastasis.
EphA2 and its ligand EphrinA are expressed by both
endothelial cells and various human tumour cells, thus
establishing a microenvironment that stimulates
tumour neoangiogenesis by activating EphA2
receptors expressed on angiogenic endothelial cells
(34). The essential role of EphA and ephrin-A
signalling in tumour progression via influencing the
tumour neovascularization represents promising new
targets for antiangiogenic cancer drug development.
In this study we have reported the Eph/Ephrin-
expression profile of CD34 and CD133 positive cells
isolated from mobilized PBPC. The findings might be
important in clinical practice, especially for future
antiangiogenic drug treatment of cancer patients,
because the expression profile of Eph/Ephrin and
functional studies of CD34 and CD133 cells during
such therapy can be crucial for treatment response.
ACKNOWLEDGEMENTS
We appreciate the work performed by Ellen
Hellesylt, Elisabeth Emilsen and Mette Ingrud in
Department of Pathology, The National Hospital, The
Norwegian Radium Hospital, Oslo.
REFERENCES
1. Ogawa M. 1993. Differentiation and proliferation of
hematopoietic stem cells. Blood 81:2844.
2. Osawa M., K. Hanada, H. Hamada and H.
Nakauchi. 1996. Long-term lymphohematopoietic
reconstitution by a single CD34-low/negative
hematopoietic stem cell. Science 273:242.
3. Krause D.S., M.J. Fackler, C.I. Civin and W.S.
May. 1996. CD34: structure, biology, and clinical
utility. Blood 87:1.
4. DiGiusto D., S. Chen, J. Combs, S. Webb, R.
Namikawa, A. Tsukamoto, B.P. Chen and A.H.
Galy. 1994. Human fetal bone marrow early
progenitors for T, B, and myeloid cells are found
exclusively in the population expressing high levels
of CD34. Blood 84:421.
5. Galy A.H., S. Webb, D. Cen, L.J. Murray, J.
Condino, R. S. Negrin and B.P. Chen. 1994.
Generation of T cells from cytokine-mobilized
peripheral blood and adult bone marrow CD34+
55
cells. Blood 84:104.
6. Mu L.J., P. Lazarova, G. Gaudernack, S. Saeboe-
Larssen and G. Kvalheim. 2004. Development of a
clinical grade procedure for generation of mRNA
transfected dendritic cells from purified frozen
CD34(+) blood progenitor cells. Int. J.
Immunopathol. Pharmacol. 17:255.
7. Miraglia S., W. Godfrey, A.H. Yin, K. Atkins, R.
Warnke, J.T. Holden, R.A. Bray, E.K. Waller and
D.W. Buck. 1997. A novel five-transmembrane
hematopoietic stem cell antigen: isolation,
characterization, and molecular cloning. Blood 90:5013.
8. Corbeil D., K. Roper, C.A. Fargeas, A. Joester
and W.B. Huttner. 2001. Prominin: a story of
cholesterol, plasma membrane protrusions and
human pathology. Traffic 2:82.
9. Corbeil D., K. Roper, A. Hellwig, M. Tavian, S.
Miraglia, S.M. Watt, P.J. Simmons, B. Peault,
D.W. Buck and W.B. Huttner. 2000. The human
AC133 hematopoietic stem cell antigen is also
expressed in epithelial cells and targeted to plasma
membrane protrusions. J. Biol. Chem. 275:5512.
10. Yin A. H., S. Miraglia, E. D. Zanjani, G. Almeida-
Porada, M. Ogawa, A. G. Leary, J. Olweus, J.
Kearney and D. W. Buck. 1997. AC133, a novel
marker for human hematopoietic stem and
progenitor cells. Blood 90:5002.
11. Peichev M., A.J. Naiyer, D. Pereira, Z. Zhu, W.J.
Lane, M. Williams, M.C. Oz, D.J. Hicklin, L.
Witte, M.A. Moore and S. Rafii. 2000. Expression
of VEGFR-2 and AC133 by circulating human
CD34(+) cells identifies a population of functional
endothelial precursors. Blood 95:952.
12. Suda T., A. Iwama, M. Hashiyama, S. Sakano and
M. Ohno. 1997. Receptor tyrosine kinases involved
in hematopoietic progenitor cells. Leukemia 11:451.
13. Himanen J. P. and D. B. Nikolov. 2003. Eph receptors
and ephrins. Int. J. Biochem. Cell Biol. 35:130.
14. Wilkinson D.G. 2000. Eph receptors and ephrins:
regulators of guidance and assembly. Int. Rev.
Cytol. 196:177.
15. Eph Nomenclature Committee. 1997. Unified
nomenclature for Eph family receptors and their
ligands, the ephrins. Cell 90:403.
16. Rissoan M.C., T. Duhen, J.M. Bridon, N.
Bendriss-Vermare, C. Peronne, B. de Saint Vis, F.
56 P. LAZAROVA ET AL.
Briere and E.E. Bates. 2002. Subtractive
hybridization reveals the expression of
immunoglobulin-like transcript 7, Eph-B1,
granzyme B, and 3 novel transcripts in human
plasmacytoid dendritic cells. Blood 100:3295.
17. Bennett B.D., Z. Wang, W.J. Kuang, A. Wang,
J.E. Groopman, D.V. Goeddel and D.T. Scadden.
1994. Cloning and characterization of HTK, a novel
transmembrane tyrosine kinase of the EPH
subfamily. J. Biol. Chem. 269:14211.
18. Aasheim H. C., L. W. Terstappen and T. Logtenberg.
1997. Regulated expression of the Eph-related receptor
tyrosine kinase Hek11 in early human B lymphopoiesis.
Blood 90:3613.
19. Lickliter J.D., F.M. Smith, J.E. Olsson, K.L.
Mackwell and A.W. Boyd. 1996. Embryonic stem
cells express multiple Eph-subfamily receptor
tyrosine kinases. Proc. Natl. Acad. Sci. USA 93:145.
20. Kvalheim G. 1998. Diagnosis of minimal residual
disease in bone marrow and blood in cancer
patients—methods and clinical implications. Acta
Oncol. 37:455.
21. Menendez P., M.C. del Canizo and A. Orfao.
2001. Immunophenotypic characteristics of PB-
mobilised CD34+ hematopoietic progenitor cells. J.
Biol. Regul. Homeost. Agents 15:53.
22. Urbich C. and S. Dimmeler. 2004. Endothelial
progenitor cells: characterization and role in vascular
biology. Circ. Res. 95:343.
23. Matsumoto K., K. Yasui, N. Yamashita, Y. Horie,
T. Yamada, Y. Tani, H. Shibata and T. Nakano.
2000. In vitro proliferation potential of AC133
positive cells in peripheral blood. Stem Cells 18:196.
24. Gehling U. M., S. Ergun, U. Schumacher, C.
Wagener, K. Pantel, M. Otte, G. Schuch, P.
Schafhausen, T. Mende, N. Kilic, K. Kluge, B.
Schafer, D.K. Hossfeld and W. Fiedler. 2000. In
vitro differentiation of endothelial cells from
AC133-positive progenitor cells. Blood 95:3106.
25. Carmeliet P. and D. Collen. 1999. Role of vascular
endothelial growth factor and vascular endothelial
growth factor receptors in vascular development.
Curr. Top. Microbiol. Immunol. 237:133.
26. Gale N.W. and G.D. Yancopoulos. 1999. Growth
factors acting via endothelial cell-specific receptor
tyrosine kinases: VEGFs, angiopoietins, and ephrins
in vascular development. Genes Dev. 13:1055.
27. Jones N., K. Iljin, D.J. Dumont and K. Alitalo.
2001. Tie receptors: new modulators of angiogenic
and lymphangiogenic responses. Nat. Rev. Mol. Cell
Biol. 2:257.
28. Cheng N., D.M. Brantley and J. Chen. 2002. The
ephrins and Eph receptors in angiogenesis. Cytokine
Growth Factor Rev. 13:75.
29. Kikawa K.D., D.R. Vidale, R.L. Van Etten and
M.S. Kinch. 2002. Regulation of the EphA2 kinase
by the low molecular weight tyrosine phosphatase
induces transformation. J. Biol. Chem. 277:39274.
30. Brantley-Sieders D.M., J. Caughron, D. Hicks, A.
Pozzi, J.C. Ruiz and J. Chen. 2004. EphA2
receptor tyrosine kinase regulates endothelial cell
migration and vascular assembly through
phosphoinositide 3-kinase-mediated Rac1 GTPase
activation. J. Cell Sci. 117:2037.
31. Augustin H.G. and Y. Reiss. 2003. EphB receptors
and ephrinB ligands: regulators of vascular assembly
and homeostasis. Cell Tissue Res. 314:25.
32. Wang Z., N. Miura, A. Bonelli, P. Mole, N.
Carlesso, D.P. Olson and D.T. Scadden. 2002.
Receptor tyrosine kinase, EphB4 (HTK), accelerates
differentiation of select human hematopoietic cells.
Blood 99:2740.
33. Asahara T., T. Murohara, A. Sullivan, M. Silver,
R. van der Zee, T. Li, B. Witzenbichler, G.
Schatteman and J. M. Isner. 1997. Isolation of
putative progenitor endothelial cells for
angiogenesis. Science 275:964.
34. Ogawa K., R. Pasqualini, R.A. Lindberg, R. Kain,
A.L. Freeman and E.B. Pasquale. 2000. The
ephrin-A1 ligand and its receptor, EphA2, are
expressed during tumor neovascularization.
Oncogene 19:6043.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 57-66 (2006)

INCREASED LEVELS OF IGF-1 AND BETA2-MICROGLOBULIN IN EPITHELIAL

LINING FLUID OF PRETERM NEWBORNS DEVELOPING CHRONIC LUNG
DISEASE. EFFECTS OF rhG-CSF
E. CAPOLUONGO, G. VENTO1, F. AMEGLIO, P. LULLI, P.G. MATASSA1, C. CARROZZA, S.A.
SANTINI, M. ANTENUCCI, M. CASTAGNOLA, B. GIARDINA, C. ROMAGNOLI1 and C. ZUPPI

Biochemistry and Clinical-Biochemistry Institute and Scientific International Institute “Paolo VI”;
1
Department of Pediatrics, Division of Neonatology, Catholic University, 00168 - Rome, Italy

Received March 2, 2005 – Accepted July 25, 2005

Insulin-like growth factor-1 (IGF-1) is involved in regulating the TH-1/TH-2 balance, favoring the
development of the TH-2 compartment which enhances fibrosis, one of the main characteristics of
Chronic Lung Disease (CLD) in premature newborns. Limited data is available concerning a possible
association between early epithelial lining fluid (ELF) concentrations of IGF-1 (total and free forms),
IGF-binding protein-3 (IGFBP-3), b2-microglobulin (B2M) and subsequent development of CLD in
preterm neonates. If neutropenic, preterm neonates are frequently treated with recombinant human
Granulocyte Colony Stimulating Factor (rhG-CSF). The objective of the study was to correlate ELF
concentrations of IGF-1 and B2M during the first week of life both in non-neutropenic and in rhG-
CSF-treated neutropenic preterm neonates, with subsequent development in CLD. Thirty preterm
neonates with Respiratory Distress Syndrome (6 with neutropenia) were studied. Eleven out of 24
non-neutropenic preterm infants (46%) and all of the six neutropenic subjects (100%) developed
CLD. With the exception of first day values, there was a clear similarity in the behaviors of assayed
molecules between non-neutropenic and neutropenic patients developing CLD. Non-neutropenic
patients without CLD showed significantly lower values of free IGF-1 and B2M both on days 1 and
3. Total IGF-I and cell counts were different only on the 3rd day. Conclusions: 1) the mechanisms
leading to CLD might be mediated by high levels of IGF-family molecules soon after birth 2) B2M
could be a marker of increased bronchoalveolar lavage fluid cellularity with potential inflammatory
properties 3) G-CSF treatment induces an increased synthesis of IGF-1 molecules by cells recruited
in the lung, with possible enhancement of the fibrogenic mechanisms.

Chronic lung disease (CLD) in very low birth
weight infants is a major health concern facing
neonatologists because of its morbidity and high
mortality risk (1-2). The pathogenesis of CLD is still
unclear, although several risk factors have been
described (3-6). Great importance has recently been
attributed to pulmonary inflammation (1-3) and several
pro-inflammatory and anti-inflammatory/fibrogenic
cytokines in bronchoalveolar lavage fluid (BALF)
have been indicated as possible triggers of
pulmonary fibrosis (1-3, 5), one of the main
characteristics of CLD (1). In adult lung fibrosis, an

Key Words: Beta2-microglobulin, G-CSF, free IGF-1, total IGF-1, IGFBP-3

Mailing address:
Dr Ettore Capoluongo, Phd.
Institute of Biochemistry and Clinical Biochemistry
Catholic University School of Medicine 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Largo F. Vito, 1. 00168 –Rome, Italy This publication and/or article is for individual use only and may not be further
Tel/Fax: +39 06 30156706 reproduced without written permission from the copyright holder.
Email: ecapoluongo@rm.unicatt.it
57 Unauthorized reproduction may results in financial and other penalties
58 E. CAPOLUONGO ET AL.
increased level of Insulin-like Growth Factors
(IGFs) has been reported (6) and several
investigators have defined IGF-1 as a strong pro-
fibrogenic mediator acting as a potent mitogen (7)
and stimulator of collagen synthesis by fibroblasts
(8). Serum IGF-1 is principally produced by the
liver, after growth hormone induction, although it is
also secreted by a number of different cells (such as
fibroblasts and endothelial cells) (7-10). Lung
macrophages represent the main local source of
IGF-I (9) and are the cells responsible for synthesis
and release of IGF-1 in adult patients with idiopathic
pulmonary fibrosis (11), systemic sclerosis (12),
coal-workers’ pneumoconiosis (13), pulmonary
sarcoidosis (14) and interstitial lung disease of
children (15-16). The bioavailability of IGF-1 in all
tissues, including the lung, is influenced by high
affinity IGF-binding proteins (IGFBPs 1-6). At the
tissue level, IGFBPs prolong the half-life of the
IGFs, regulate their metabolic clearance (15) and act
as direct modulators of IGF-1 interactions with its
receptors. The major circulating binding protein is
IGFBP-3 (11) and its binding to IGF-1 and another
acid-labile subunit greatly prolongs the IGF-1 half-
life (17). In addition, IGF-1 exists in an unbound
active form, named free IGF-1 (17).
As IGF-1 is a powerful inducer of T-helper-2
(TH-2) polarization, it may modulate the cytokine
network (18, 19). TH-2 lymphocytes release an
abundance of transforming growth factor beta-1
(TGFβ-1), a strong profibrotic mediator (19), which
in turn induces IGF-1 production in lung fibroblasts
(autocrine loop) (16-18). Finally, tumor necrosis
factor-alpha, a proinflammatory cytokine and one of
the most important mediators of fibrotic processes,
appears to be responsible for the production of both
IGF-1 and TGFβ-1 (18). In our previous studies (3-
4) we reported that severe bronchopulmonary-
dysplasia (BPD) was characterized by the presence
of high levels of TGFβ-1, platelet-derived growth
factor-BB (PDGF-BB), and vascular endothelial
growth factor (VEGF) in Epithelial Lining Fluid
(ELF). In particular, the highest levels of TGFβ-1
were found in severe forms of BPD and were
associated with poor pulmonary mechanics,
suggesting an increase of fibrogenic cytokines in the
development of BPD (3).
In our experience, preterm neutropenic babies
often develop CLD, even after having been treated
with recombinant human Granulocyte Colony
Stimulating Factor (rhG-CSF), normally used to
treat and/or prevent systemic infection (20-21).
Neutropenia risk factor is significantly associated
with morbidity and mortality. Recombinant human
G-CSF stimulates myeloid precursor proliferation,
maturation and function of neutrophils and
monocytes (20). The administration of this growth
factor in preterm neonates with allo-immune
neonatal neutropenia, may produce a rapid increase
in absolute neutrophil (with increments in
proinflammatory cytokine release) and monocyte
numbers (20-23). Moreover, animal studies (20)
showed an enhancement of blood and lung IGF-1
with subsequent fibrotic processes, as a secondary
effect of G-CSF treatment. Beta2-microglobulin
(B2M) is a membrane-bound molecule associated
with Class I HLA and has recently been reported to
be a strong profibrotic molecule, increased in the
urine of CLD patients (24).
The aim of this study was to correlate the levels
of IGF-1 (total IGF-1, free IGF-1 and IGFBP-3) and
B2M in ELF of preterm neonates with or without
subsequent development of CLD, and to evaluate
the effects of rhG-CSF treatment on the release of
IGF-1 and B2M and development of fibrosis.
MATERIALS AND METHODS
This study was carried out in the Neonatal Intensive
Care Unit of the Catholic University of Rome between
June 2001 and October 2002 and included babies whose
characteristics are reported in Table I. Eligibility
requirements included delivery in our Hospital and
endotracheal intubation at birth and on-going intensive
care. Excluded from this study were newborns with major
congenital malformations, prenatal or postnatal infection
during the first week of life (positive blood or BALF
cultures), with severe asphyxia (Apgar score < 5 at 1’ and
5’), or babies treated with early dexamethasone therapy.
Thirty-four patients were eligible for the study of which
four were excluded because of congenital pneumonia (3
cases) and chromosomal disease (1 case). Three groups of
neonates were studied: Group A) 13 CLD-negative non-
neutropenic preterm neonates who developed RDS but
were nursed in air and had a normal chest radiograph by
28 days of age. Group B) 11 non-neutropenic preterm
neonates who developed RDS followed by CLD (oxygen-
dependent at 28 days of age and abnormal chest
 Int. J. Immunopathol. Pharmacol.
radiograph); Group C) 6 neutropenic preterm neonates
with RDS treated with rhG-CSF for severe neutropenia at
birth, all developed CLD. All six patients were born to
mothers with severe preeclampsia.
All the newborns received surfactant therapy (200
mg/kg of Curosurf-Chiesi, Italy) during the first six hours
of life. Mechanical ventilation was performed with
BabyLog 8000 ventilator, as previously described (3).
Patients with severe neutropenia (absolute blood
neutrophil count <1.0 x109/L) at birth were treated with
rhG-CSF at 10 µg/day for 15-30 min intravenous over 3
consecutive days, starting on the first day of life, together
with antibiotics to prevent septic episodes. All infants of
the other two groups also received the same antibiotic
prophylaxis to prevent pulmonary colonization and/or
infections during the study period.
The study protocol and consent forms were approved by
the Ethical Committee of the Department of Pediatrics.
BALF collection
BALF was collected on day 1 (within the first 24 h
after birth, always 9-12 hours after surfactant therapy)
and on day 3, as previously described (3). Briefly, two
sequential and separate aliquots of 1 ml/kg of 0.9%
sodium chloride were instilled, immediately followed by
suctioning, through a 6-Fr gauge suction catheter that had
been introduced via a slide valve at the endotracheal tube
connection and advanced gently until resistance was met.
BALF samples in the Neutropenic Group were
additionally collected on days 2 and 4 (24 h after stopping
rhG-CSF administration). BALF samples were
centrifuged at 800 x g for five minutes at 4 °C and were
then divided into two aliquots, both stored at –80 °C until
analyzed. To normalize the dilution bias resulting from
the BALF collection practice, a measurement of urea
BALF and serum concentrations was performed in
duplicate by means of a colorimetric assay (Urea
Nitrogen suitable on Olympus AU400). The ratio
serum/BALF urea was used as a multiplying coefficient
to transform BALF into ELF concentrations for the
different molecules (25).
On admission and during the study period, BALF was
cultured for microbiological analysis of bacteria,
Ureaplasma urealyticum, Chlamydia and fungi, in order
to diagnose lung infection or colonization. Culture-
positive BALF specimens, or those with visible blood
staining, were excluded from final analysis. For the
absolute cell count, BALF samples were analyzed by
means of Bayer H*3 automatic analyzer (Bayer
Diagnostics S.r.l., Milan, Italy), as previously described
(26). Differential count was calculated by microscopic
examination after May-Grunwald-Giemsa dye.
59
Total IGF-1 assay
Total IGF-1 was performed by means of a
commercially available kit (Nichols Advantage) suitable on
Liaison Instrument [Byk Gulden Italy, Cormano (Milan,
Italy)] using a calibration curve ranging from 14 ng/ml to
250 ng/ml. Tests were performed in triplicate and the
Coefficients of variations (CVs) were less than 7%. (27).
IGF-1 free assay:
IGF1-free in BALF was measured in triplicate by
radioimmune assay (RIA) method (Diagnostic Systems
Laboratories, Inc. USA, commercialized in Italy by Pantec
S.r.l., Turin – Italy) using as calibration curve points 0.00,
0.0042, 0.085, 0.170, 0.500, 1.700, 6.00 ng/mL. The CVs
at the lowest level of 0.03 was < 6.5%. (28).
IGFBP-3 assay
IGFBP-3 was measured in triplicate by RIA method
(Diagnostic Systems Laboratories, Inc. USA,
commercialized in Italy by Pantec Turin - Italy) using as
calibration curve points 0.00, 23.7, 47.5, 95.0, 190.0,
380.0, 1000; ng/ml. The CV percent at level of 23,7 was
< 5.8% on quintuplicate controls. (29).
Beta2-Microglobulin assay
An immunonephelometric method (DADE Behring,
SPA Milan, Italy) was performed. The CV percent at level
of 0.49 ng/ml was < 3.0% on quintuplicate controls (30).
The results for all assays on BALF samples were
obtained by triplicate determinations.
Statistical Analysis
Due to the limited number of the subjects and to the
lack of knowledge of the data distribution, only non-
parametric tests were employed. In particular, the Mann-
Whitney test was used for comparing results between
groups, while the paired Wilcoxon or the Friedman tests
were employed to compare the data over time.
RESULTS
Analysis of patients’ characteristics in the three
groups (Table I)
As expected for these types of patients, significant
differences were found for gestational age (GA) and
birth weight (BW) among the three groups A, B and C.
However, the two groups B and C (both CLD positive)
did not differ significantly from each other, while group
A showed significantly higher GA and BW as compared
with either group B or C. All the other variables reported
in Table I were not statistically different.
60 E. CAPOLUONGO ET AL.

Table I. Characterization of groups of patients.

Non-neutropenic Neutropenic P1= P2=
Group A Group B Group C
Variables A vs B vs C B vs C
CLD-negative CLD-positive CLD-positive
(N=13) (N=11) (N=6)
*GA, wks 31 (29-32) 28 (26-32) 27 (26-32) < 0.001 NS

*BW, g 1625 (1295-2160) 1013 (590-1530) 835 (650-1560) < 0.001 NS

§
M/F ratio 6/7 6/5 2/4 NS NS
§
AGA 11 (85%) 9 (82%) 4 (67%) NS NS
§
Antenatal 6 (46%) 8 (73%) 4 (67%) NS NS
steroid
§
Sepsis 3 (23%) 5 (45%) 2 (33%) NS NS
§
PDA 2 (15%) 2 (18%) 2 (33%) NS NS
§
Mortality 0 1 (9%) 0 NS NS

*GA: gestational age; *BW: birth weight; * Medians and (range).

§M: males; §F: females; §AGA: appropriate for gestational age; §PDA: patent ductus
arteriosus
NS = Not significant; Group C was treated with rh-G-CSF after blood collection on Day1.
P1: non parametric tests (ANOVA for quantitative and contingency tables for qualitative
variables) were performed on the groups A, B, C.
P2: non parametric tests (Mann-Whitney test for quantitative and CHI square for qualitative
variables) were performed between groups B and C.

Analysis of the ELF molecule levels (Fig. 1a,
1b and Table II)
Comparisons of Groups A and B: Group B (non-
neutropenic CLD-positive) showed significantly higher
free IGF-1 levels both on the first and third days as
compared with Group A (non-neutropenic CLD-
negative subjects). Only on the third day (with a similar
trend for day 1) total IGF-1 and B2M were significantly
increased in Group B as compared with Group A.
IGFBP-3 differences never reached a statistical
significance (possibly due to the high standard
deviations) although the trend was similar (higher
median in group B vs. A).
Comparisons between groups B and C:
Neutropenic CLD-positive neonates showed lower
cell number, and lower total IGF-1, free IGF-1,
IGFBP-3 and B2M concentrations. The differences
in fre IGF-1, total IGF-1 and cell count was
significantly lower on Day one in group C
(neutropenic CLD-positive) than in non-neutropenic
(CLD-positive) group B. However, by Day 3, free
IGF-1, cell count and B2M were significantly higher
in group C vs. group B (p= 0.05).
Comparisons of Groups A and C: A statistical
comparison between the groups A and C was similar
to that observed for groups A and B. In fact, groups
B and C were similar after rhG-CSF treatment.
Over time analysis of groups A, B and C.: Group
A: No significant differences were found between the
levels of BALF absolute cell counts and ELF B2M,
free IGF-1, total IGF-1 and IGFBP-3 molecules
observed at day 3 as compared with day 1.
Group B: significant increases were found
between day 3 and day 1 for BALF absolute cell
counts (ratio of day3/day1 medians = 1.33, p=0.04),
ELF B2M (ratio of day3/day1 medians = 2.08,
p=0.04), free IGF-1 (ratio of day3/day1 medians =
1.31, p=0.03), IGFBP-3 (ratio of day3/day1 medians
= 1.22, p=0.04) and total IGF-1 (ratio of day3/day1
medians = 1.1, not significant).
Group C: All the variables were significantly
 Int. J. Immunopathol. Pharmacol. 61

Table II. Medians and ranges over time of ELF concentrations of three variables in
non-neutropenic and in G-CSF-treated neutropenic patients.
Non-neutropenic Neutropenic P1= P2=
Group A Group B Group C
Variables DAY A vs B B vs C
Non-CLD CLD CLD
(N=13) (N=11) (N=6)
1 1.4 (0.6-2.4) 2.2 (0.8-6.1) 1.1 (0.6-4.1) 0.02 0.05

2 Nd Nd 4.8 (1.5-9.2) -
FreeIGF-1
ng/ml 3 1.4 (1-2.8) 2.9 (2-7.1) 6.8 (3.0-10.6) 0.01 0.05

4 Nd Nd 2.9 (1.7-3.6) -

1 15.3 (0.9-59.8) 31.7 (15.1-79.6) 13.0 (2.0-17.0) 0.06 0.05

total IGF-1 2 Nd Nd 20.5 (5.7-59.0) -

ng/ml
3 14.7 (9.4-54) 35.0 (26-66.8) 29.7 (20.0-30.6) 0.02 NS

4 Nd Nd 21.0 (4.7-24.9) - -

1 889 (113-2054) 1360 (508-3899) 834 (698-969) 0.07 NS

2 Nd Nd 1427(1352-2258) - -
IGFBP-3
ng/ml 3 1000 (500-2145) 1660 (566-2836) 1999 (1571-2168) 0.09 NS

4 Nd Nd 1726(1188-2229) - -

N = number of patients; nd = not done; NS = not significant. Non parametric

tests were used for statistical comparisons; P1= unpaired Mann & Whitney non-
parametric test between non-neutropenic non-CLD (Group A) vs. non-neutropenic
CLD patients (Group B), P2= unpaired Mann & Whitney non-parametric test
between non-neutropenic CLD patients (Group B) vs neutropenic CLD (Group C).

increased: BALF absolute cell counts (ratio of
day3/day1 medians = 6.71, p=0.01), ELF B2M (ratio of
day3/day1 medians = 4.97, p=0.02), free IGF-1 (ratio of
day3/day1 medians = 6.18, p=0.01), total IGF-1 (ratio
of day3/day1 medians = 2.28, p=0.04) and IGFBP-3
(ratio of day3/day1 medians = 2.4, p=0.04).
The free/total IGF-1 ratio, although increased, was
not significantly modified after therapy (data not
shown). The median value for these ratios was 10.4%,
higher than that reported for serum by other authors (31).
Analyzing all three groups’ data, a statistically
significant correlation was observed between ELF B2M
and IGFBP-3 (R=0.82, p<0.001) and a significant
correlation was found between ELF B2M levels and
BALF absolute cell counts (R= 0.65; p< 0.001).
As expected, blood neutrophil count was
increased significantly after rhG-CSF treatment in
the neutropenic group C. In fact, the pre-treatment
median values (563/mmc, range 210-965) increased
after 24hours (1009/mmc, 648-1870) and even more
after 48 hours (3530/mmc, 951-5950) from starting
therapy, indicating that rhG-CSF was effective in
these babies (see Table II).
DISCUSSION
CLD is characterized by increased fibrosis in the
lung (1) and therefore it is important to evaluate the
local presence and expression of IGF-1, a molecule
able to activate the mechanisms leading to fibrosis
(32). Thus, our study is based on the evaluation of
IGF-I family molecules in ELFs of preterm neonates,
62 E. CAPOLUONGO ET AL.
Fig. 1a. Medians over time of BALF absolute cell count:
in the three e groups.
Fig. 1b. Medians over time of B2M in the three groups.
with high risk of developing CLD, giving particular
attention to neutropenic babies treated with rhG-CSF.
This factor has recently been shown to induce a TH-2
polarization and “suppressive” dendritic cells,
releasing high amounts of anti-inflammatory,
profibrotic cytokines such as TGF-β1 and IL-10 (33),
some of the most powerful inducers of fibrotic
processes. Therefore, rhG-CSF may be a contributing
factor to the development of CLD in preterm neonates.
To analyze the role of IGF-1, the concentrations
of free IGF-1, total IGF-1 and IGFBP3 [the most
abundant IGF carrier molecule (17, 31)], were
measured in BALF. In addition, the B2M levels
were determined, since this small molecule has
recently been reported to be the major protein
component of fibril amyloid deposits (34). B2M is
also found increased in the urine of BPD patients (24).
The various BALF determinations were
transformed in ELF concentrations by means of the
urea correction to eliminate dilution bias. This
method, although criticized, is still considered the
most reliable when comparing different groups of
individuals (35). The total cell count was also
determined in BALF samples to observe whether or
not molecules and cells changed concomitantly.
Our data suggest a statistical association between
CLD development and higher ELF concentrations of
the four molecules analyzed in one or two time
points. These differences between non-neutropenic
CLD-positive and CLD-negative groups were
significant for BALF absolute cell counts, ELF
B2M, free and total IGF-1 levels. In particular, CLD
seems to be characterized by higher free IGF-1
(active molecular form) and B2M ELF levels, in
agreement with data previously reported in other
inflammatory lung conditions (24, 36).
In neutropenic patients, rhG-CSF administration
was followed by significantly increased levels of free
IGF-1 (ratio of day3/day1 medians = 6.18), and B2M
(ratio of day3/day1 medians = 4.91) as well as of total
IGF-1 and IGFBP-3 (ratios of 2.28 and 2.4
respectively), together with increased BALF
cellularity (ratio = 6.71), and the values of the different
variables observed on the 3rd day were generally higher
than those measured in Group B at the same time (Day
3). Also the blood neutrophil counts were significantly
increased, confirming the effects of the growth factor
both at the peripheral and local level. It is not
surprising that such free IGF-1 increases over time
may accelerate fibrotic processes, including those
characterizing CLD. It is also not surprising that,
despite the concomitant increase of IGFBP-3, a
molecule able to bind IGF-1 and block its activity, the
free fraction was increased more than the binding
protein, with a subsequent increase of the active
molecule. In addition, not all tissues express these
molecules at the same rate, both for synthesis
induction and for specific molecule half-life (11, 15,
37). The prevalence of CLD observed in Group C was
significantly higher (p<0.01) than in the untreated
non-neutropenic patients, from 100% to 46%.
At present, there are no studies evaluating
whether rhG-CSF might induce CLD in human
 Int. J. Immunopathol. Pharmacol.
preterm newborns. This is the first report showing a
significant association between CLD and rhG-CSF
administration in neutropenic preterm infants. The
prevalence of other risk factors for CLD (postnatal
infections, antenatal corticosteroids, patent ductus
arteriosus, male sex) was not significantly different
in neutropenic and non-neutropenic patients (Table
I), even if the number of patients was limited. As
expected, only GA and BW were different between
group A and the remaining groups B and C. Even
though recent data obtained in newborns’ sera (39-40)
show that an increase of IGF-1 concentration is
expected for older gestational ages, our study reports
lower amounts in ELF samples of group A , suggesting
that higher values of IGF-1 in groups B and C depend
on CLD risk more than on gestational age.
This paper is limited by the absence of a rhG-
CSF-untreated neutropenic group, which for ethical
reasons was not performed, as neutropenia is
associated with high risk of infections. In
neutropenic babies the increased levels of free and
total IGF-1 plus IGFBP-3 were observed especially
during the first three days, before a slow decline (on
day 4) due to the termination of rhG-CSF
administration (23). These results may be related to
the evident initial increase of absolute cell count in
BALF and subsequent decline after the third day, in
keeping with the known activity of rhG-CSF (23).
Also B2M (a good marker of cellularity) levels
were augmented following rhG-CSF administration.
In fact, this growth factor can induce the
proliferation and recruitment of HLA class I positive
neutrophil lineage (40). Furthermore, on the basis of
the correlation between IGFBP-3 and B2M, the
synthesis of these molecules might be coordinated.
It is worthwhile to underline that the increase in
free IGF-1 levels is higher than observed for total
IGF-1 and IGFBP-3, suggesting that the specific
activities of this factor, including those addressed to
fibrotic processes, may be enhanced. A similar
behavior was observed by Kawai et al. in serum of
normal children in the first year of life (31), even if
our values of IGF-1 family molecules in ELF were
higher than those reported in serum.
The increased levels of B2M could also be very
important in the genesis of pulmonary fibrosis, as
this process is associated with amyloid fibril
formation. In fact, B2M is the major protein
63
component of the fibril amyloid deposits and itself
forms amyloid fibrils (34). A synergy between IGF-
1 and B2M effects may induce more severe
pathologic processes. Previous data indicate that
IGF-1 is elevated in human fibrotic lung diseases
and in animal models of pulmonary fibrosis (6-12,
14-15, 41). In addition, recent studies have found a
correlation between IGF-1 staining and CD68-
positive cells, and lung fibroblasts, suggesting
alveolar macrophages are a major source of the IGF-
1 molecules present in the lung (32, 37, 43).
Recently, some of the authors of this study
reported an involvement of rhG-CSF, TH-2
polarization and TGF-β1 release in subjects treated
with G-CSF to mobilize stem cells in relatives of
leukemic patients before transplantation (33).
Moreover T-cells have been shown to be polarized
towards TH-2 compartment by G-CSF, both in
adults and in neonates, releasing large amounts of
IL-10 and TGF-β1. IGF-1 has also been reported as
a TH-2 polarizing agent as well as a pro-fibrogenic
molecule (19-20, 44-45).
The results of these studies suggest that rhG-
CSF treatment induces an increase in IGF-1
synthesis by sensitive cells, leading to enhanced
fibrogenic mechanisms. Obviously, our data do not
represent a demonstration that rhG-CSF is the only
cause of subsequent CLD development, because
other risk factors may influence an unfavorable
clinical outcome. Our data are in agreement with
recent reports showing a significant association
between BALF and serum G-CSF levels and
activation of neutrophils in acute respiratory
distress syndrome (ARDS) (36, 46-47).
In conclusion, this manuscript does not exclude
the use of rhG-CSF in severe neutropenic preterm
newborns (where it might be mandatory) (21), but
underlines the necessity to find the right criteria to
safely administer this drug, as also reported for
neutropenic cancer patients (48). Further studies are
therefore necessary to establish suitable guidelines.
ACKNOWLEDGEMENTS
Particular thanks to Doctors S. Rocchetti, C.
Santonocito and M. Martelli for technical support
and assistance.
64 E. CAPOLUONGO ET AL.
REFERENCES
1. Pierce M.R. and E. Bancalari. 1995. The role of
inflammation on the pathogenesis of
bronchopulmonary dysplasia. Ped. Pulmonol. 9:371.
2. Bancalari E., G.E. Abdenour, R. Feller and J.
Gannon. 1979. Bronchopulmonary dysplasia:
clinical presentation. J. Pediatr. 95:819.
3. Vento G., P.G. Matassa, F. Ameglio, E.
Capoluongo, L. Tortorolo and C. Romagnoli.
2002. Effects of early dexamethasone on pulmonary
fibrogenic mediators and respiratory mechanics in
preterm infants. Eur. Cytokine Netw. 13:207.
4. Vento G., P.G. Matassa, E. Capoluongo, L.
Tortorolo, C. Romagnoli and F. Ameglio. 2003.
Glucocorticoids in preterm infants and discrepancies
of Vascular Endothelial Growth Factor. Am. J.
Respir. Crit. Care Med. 168:501
5. Sime PJ. and K.M. O’Reilly. 2001. Fibrosis of the
lung and other tissues: new concepts in pathogenesis
and treatment. Clin. Immunol. 99:308
6. Pala L., S. Giannini, E. Rosi, B. Cresci, G. Scano,
S. Mohan, R. Duranti and C.M. Rotella. 2001.
Direct measurement of IGF-1 and IGFBP-3 in
bronchoalveolar lavage fluid from idiopathic
pulmonary fibrosis. J. Endocrinol. Invest. 24:856
7. Cambrey A., D.O.J. Kwon, A.J. Gray, N.K.
Harrison, M. Yacoub, P.J. Barnes, G.J. Laurent and
K.F. Chung. 1995. Insulin-like growth factor 1 is a
major fibroblast mitogen produced by primary cultures
of human airway epithelial cells. Clin. Sci. 89:611.
8. Goldstein R.H., C.F. Poliks, P.F. Pilch, B.D. Smith
and A. Fine. 1989. Stimulation of collagen formation
by insulin and insulin-like growth factor I in cultures of
human lung fibroblasts. Endocrinology 124:964.
9. Rom W.N., P. Basset, G.A. Fells, T. Nukiwa, B.C.
Trapnell and R.G. Crystal. 1988. Alveolar
macrophages release an insulin-like growth factor 1-
type molecule. J. Clin. Invest. 82:1685.
10. Homma S., I. Nagaoka, H. Abe, K. Takahashi, K.
Seyama, T. Nukiwa and S. Kira. 1995.
Localization of platelet-derived growth factor and
insulin-like growth factor-1 in the fibrotic lung. Am.
J. Respir. Crit. Care Med. 152:2084.
11. Aston C., J. Jagirdar, T.C. Lee, T. Hur, R.L. Hintz
and W.N. Rom. 1995. Enhanced insulin-like growth
factor molecules in idiopathic pulmonary fibrosis.
Am. J. Respir. Crit. Care Med. 151:1597.
12. Harrison N.K., A.D. Cambrey, A.R. Myers, A.M.
Southcott, C.M. Black, R.M. DuBois, G.J. Laurent
and R.J. McAnulty. 1994. Insulin-like growth factor-
1 is partially responsible for fibroblast proliferation
induced by bronchoalveolar lavage fluid from patients
with systemic sclerosis. Clin. Sci. 86:141.
13. Vanhee D., P. Gosset, B. Wallaert, C. Voisin and
A.B. Tonnel. 1994. Mechanisms of fibrosis in coal
workers’ pneumoconiosis: increased production of
platelet-derived growth factor, insulin-like growth
factor type I, and transforming growth factor beta
and relationship to disease severity. Am. J. Respir.
Crit. Care Med. 150:1049.
14. Allen J.T., C.A. Bloor, R.A. Knight and M.A.
Spiteri. 1998. Expression of insulin-like growth
factor binding proteins in bronchoalveolar lavage
fluid of patients with pulmonary sarcoidosis. Am. J.
Respir. Cell. Mol. Biol. 19:250.
15. Chadelat K., M. Boule, S. Corroyer, B. Fauroux ,
B. Delalsl, G. Tournier and A. Clement. 1998.
Expression of insulin-like growth factors and their
binding proteins by bronchoalveolar cells from
children with and without interstitial lung disease.
Eur. Respir. J. 11:1329.
16. Bloor C.A., R.A. Knight, R.K. Kedia, M.A.
Spiteri and J.T. Allen. 2001. Differential mRNA
expression of insulin-like growth factor-1 splice
variants in patients with idiopathic pulmonary
fibrosis and pulmonary sarcoidosis Am. J. Respir.
Crit. Care Med. 15:265.
17. Rosenfeld R.G. and C.T. Roberts. 1999. The IGF
systems: molecular biology, physiology, and clinical
applications. In Contemporary endocrinology. NJ
Totowa, ed. Humana Press. p. 227.
18. Krein P.M. and B.W. Winston. 2002. Roles of
Insuline-Like Growth Factor I and Transforming
Growth Factor-β in fibrotic lung disease. Chest
122(S):289.
19. Wynes M.W. and D.W. Riches. 2003. Induction of
macrophage insulin-like growth factor-I expression
by the Th2 cytokines IL-4 and IL-13. J. Immunol.
171:3550.
 Int. J. Immunopathol. Pharmacol.
20. Banerjea M.C. and C.P. Speer. 2002. The current
role of colony-stimulating factors in prevention and
treatment of neonatal sepsis. Semin. Neonatol. 7:335.
21. Carr R., N. Modi and C. Dore. 2003. G-CSF and
GM-CSF for treating or preventing neonatal
infections. Cochrane Database Syst. Rev. CD003066.
22. Escande B., P. Kuhn, C. Gaugler and J Messer.
2003. Neonatal neutropenia, nosocomial infection
and granulocyte-colony stimulating factor. Arch.
Pediatr. 10:93.
23. Girlando P., A.A. Zuppa, C. Romagnoli and G.
Tortorolo. 2000. Transient effect of granulocyte
colony-stimulating factor in allo-immune neonatal
neutropenia. Biol. Neonate 78:277.
24. Nishimaki S., Y. Shima, M. Sato, H. An, M.
Hashimoto, Y. Nishiyama, S. Iwasaki, I. Tateishi,
K. Seki and S. Yokota. 2003. Urinary beta 2-
microglobulin in premature infants with
chorioamnionitis and chronic lung disease. J.
Pediatr. 143:120.
25. Rennard S.I., G. Basset, D. Lecossier, K.M.
O’Donnell, P. Pinkston, P.G. Martin and R.G.
Crystal. 1986. Estimation of volume of epithelial
lining fluid recovered by lavage using urea as marker
of dilution. J. Appl. Physiol. 60:532.
26. Vento G., P.G. Matassa, E. Zecca, L. Tortorolo,
M. Martelli, M.P. De Carolis, L. Maggio, G. Zini,
G. d’Onofrio, S. Valentini and C. Romagnoli.
2004. Effect of Dexamethasone on tracheobronchial
aspirate fluid cytology and pulmonary mechanics in
preterm infant. Pharmacology 71:113.
27. Brabant G., A. von zur Muhlen, C. Wuster, M.B.
Ranke, J. Kratzsch, W. Kiess, J.M. Ketelslegers, L.
Wilhelmsen, L. Hulthen, B. Saller, A. Mattsson, J.
Wilde, R. Schemer and P. Kann. German KIMS
Board. 2003. Serum insulin-like growth factor I
reference values for an automated chemiluminescence
immunoassay system: results from a multicenter
study. Horm. Res. 60:53.
28. Singer C.F., M. Mogg, W. Koestler, M. Pacher, E.
Marton, E. Kubista and M. Schreiber. 2004.
Insulin-like growth factor (IGF)-I and IGF-II serum
concentrations in patients with benign and malignant
breast lesions: free IGF-II is correlated with breast
cancer size. Clin. Cancer. Res. 15:4003.
65
29. Huysman M.W., A.C. Hokken-Koelega, W.C. Hop
and P.J. Sauer. 2003. Effect of dexamethasone
treatment on serum GH, IGF-1, and the binding
proteins IGFBP-1 and -3 in ventilated very preterm
infants. Pediatr. Res. 54:37.
30. Norlund L. G. Fex, J. Lanke, H. Von Schenck,
J.E. Nilsson, H. Leksell and A. Grubb. 1997.
Reference intervals for the glomerular filtration rate
and cell-proliferation markers: serum cystatin C and
serum beta 2-microglobulin/cystatin C-ratio. Scand.
J. Clin. Lab. Invest. 57:463.
31. Kawai N., S. Kanzaki, S. Takano-Watou, C. Tada, Y.
Yamanaka, T. Miyata, M. Oka and Y. Seino. 1999.
Serum free Insulin-Like Growth Factor I (IGF-1), Total
IGF-1, and IGF-Binding Protein-3 concentrations in
normal children with Growth Hormone Deficiency. J.
Clin. Endocrinol. Metab. 84:82.
32. Krein P.M., P.J.B. Sabatini, W. Tinmouth, F.H.Y.
Green and B.W. Winston. 2003. Localization of
insulin-like growth factor-I in lung tissues of patients
with fibroproliferative acute respiratory distress
syndrome. Am. J. Respir. Crit. Care Med. 167:83.
33. Rutella S., L. Pierelli, G. Bonanno, S. Sica, F.
Ameglio, E. Capoluongo, A. Mariotti, G. Scambia,
G. d’Onofrio and G. Leone. 2002. Role for
granulocyte colony-stimulating factor in the generation
of human T regulatory type 1 cells. Blood 100:2562.
34. Ivanova M.I., M. Gingery, L.J. Whitson and D.
Eisenberg. 2003. Role of the C-terminal 28 residues
of beta2-microglobulin in amyloid fibril formation.
Biochemistry 42:13536.
35. Dargaville P.A., M. South, P. Vervaart and P.N.
McDougall. 1999. Validity of markers of dilution in
small volume lung lavage. Am. J. Respir. Crit. Care
Med. 160:778.
36. Chetty A., S. Andersson, P. Lassus and H.C.
Nielsen. 2004. Insulin-like growth factor-1 (IGF-1)
and IGF-1 receptor (IGF-1R) expression in human
lung in RDS and BPD. Pediatr. Pulmonol. 37:128.
37. Jones J.I. and D.R. Clemmons. 1995. Insulin-like
growth factors and their binding proteins: biological
actions. Endocr. Rev. 16:3.
38. Javaid M.K., K.M. Godfrey, P. Taylor, S.R.
Shore, B. Breier, N.K. Arden and C. Cooper.
2004. Umbilical venous IGF-1 concentration,
66 E. CAPOLUONGO ET AL.
neonatal bone mass, and body composition.
J. Bone Miner. Res.19:56.
39. Chellakooty M., K. Vangsgaard, T. Larsen, T.
Scheike, J. Falck-Larsen, J. Legarth, A.M.
Andersson, K.M. Main, N.E. Skakkebaek and A.
Juul. 2004. A longitudinal study of intrauterine
growth and the placental growth hormone (GH)-
insulin-like growth factor I axis in maternal
circulation: association between placental GH and
fetal growth. J. Clin. Endocrinol. Metab. 89:384.
40. Gertz M.A., M.Q. Lacy, D.J. Inwards, M.G. Chen,
A.A. Pineda, D.A. Gastineau, P.R. Greipp, J.A.
Lust, A. Tefferi, T.E. Witzig, R.A. Kyle and M.R.
Litzow. 1999. Early harvest and late transplantation as
an effective therapeutic strategy in multiple myeloma.
Bone Marrow Transplant. 23:221.
41. Currie A.E., M. Kelly, J.R. Vyas, H. Pandya, D.
Field and S. Kotecha. 2002. Fibroblast mitogenic
activity of lung lavage fluid from infants with
chronic lung disease of prematurity. Arch. Dis.
Child. Fetal Neonatal. 86:193.
42. Meduri G.U., G. Kohler, S. Headley, E. Tolley, F.
Stentz and A. Postlethwaite. 1995. Inflammatory
cytokines in the BAL of patients with ARDS: persistent
elevation over time predicts outcome. Chest 108:130.
43. Shen Y.C., C.F. Chiu, K.C. Chow, C.L. Chen, Y.C.
Liaw and S.P. Yeh. 2004. Fatal pulmonary fibrosis
associated with BCNU: the relative role of platelet-
derived growth factor-B, insulin-like growth factor I,
transforming growth factor-beta1 and cyclooxygenase-
2. Bone Marrow Transplant. 34:609.
44. Sconocchia G., H. Fujiwara, K. Rezvani, K.
Keyvanfar, F. El Ouriaghli, M. Grube, J.
Melenhorst, N. Hensel and A.J. Barrett. 2004. G-
CSF-mobilized CD34+ cells cultured in interleukin-2
and stem cell factor generate a phenotypically novel
monocyte. J. Eur. Acad. Dermatol. Venereol. 18:310.
45. Kakinoki Y., H. Kubota and Y. Yamamoto. 2004.
CD64 surface expression on neutrophils and
monocytes is significantly up-regulated after
stimulation with Granulocyte colony-stimulating
factor during CHOP chemotherapy for patients with
non-Hodgkin’s lymphoma. Am. J. Physiol. Cell.
Physiol. 286:1302.
46. Wiedermann F.J., A.J. Mayr, N.C. Kaneider, D.
Fuchs, N.J. Mutz and W. Schobersberger. 2004.
Alveolar Granulocyte colony-stimulating factor and
alpha-chemokines in relation to serum levels,
pulmonary neutrophilia, and severity of lung injury
in ARDS. Chest 125:212.
47. Wiedermann F.J., A.J. Mayr, P. Hobisch-Hagen, D.
Fuchs and W. Schobersberger. 2003. Association of
endogenous G-CSF with anti-inflammatory mediators
in patients with acute respiratory distress syndrome. J.
Interferon Cytokine 23:729
48. Ohta Y., S. Hayakawa, M. Karasaki-Suzuki, K.
Sugita, S. Komine, F. Chishima, Y. Hatta, T. Horie,
N. Seo, A. Sheikh, N. Nemoto and T. Yamamoto.
2004. Granulocyte Colony-stimulating Factor
Suppresses Autologous Tumor Killing Activity of the
Peripheral Blood Lymphocytes in the Patients with
Ovarian Carcinoma. Am. J. Reprod. Immunol. 52:81.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 67-79 (2006)

c-MYC DEREGULATION IS INVOLVED IN MELPHALAN RESISTANCE OF

MULTIPLE MYELOMA: ROLE Of PDGF-BB
C. GRECO1, I. D'AGNANO4,5, G. VITELLI1 , R. VONA1,6, M. MARINO3, M. MOTTOLESE3 ,C.
ZUPPI2, E. CAPOLUONGO2 and F. AMEGLIO2

1
Clinical Pathology Service, Regina Elena Cancer Institute, Rome; 2Institute of Biochemistry and
Clinical Biochemistry, Catholic University of Sacred Heart, Rome; 3Pathological Anatomy Service,
Regina Elena Cancer Institute, Rome; 4Pharmacology Dept, University of Milan; 5Institute of
Biomedical Technology-CNR, Milan; 6Dept of Drug Research and Evaluation Section of Cell
Aging and Degeneration, Ist. Superiore di Sanita’, Rome, Italy

Received March 22, 2005 - Accepted July 8, 2005

Oncogenes are important regulators of cancer growth and progression and their action may be
modulated by proteins of the growth factor family, such as angiogenic cytokines, known to be strongly
involved in neoplastic evolution. Reciprocal interactions between oncogenes and angiogenic modulators
may represent, in haematological neoplasms, including multiple myeloma (MM), a possible mechanism
of drug resistance. The aim of this work is to investigate in vitro and in vivo whether or not c-myc
deregulation is involved in the melphalan resistance elicited by myeloma patients and consequently to
clarify the role of the angiogenic factor PDGF-BB in modulating c-myc protein expression. Fifty-one
MM patients on chemotherapy with melphalan were analyzed for structural alterations of the c-myc
gene, c-Myc protein expression, as well as for serum PDGF-BB release. For the in vitro study, two M14-
derived established cell clones, differing for the c-Myc protein expression (c-Myc low -expressing or
constitutively expressing clones) were used. Our results show that PDGF-BB is able to up-regulate Myc
expression and reduce melphalan sensitivity of tumor cell clones, constitutively expressing c-myc gene
product. In addition, down-regulation of c-Myc protein induces the expression of PDGF-b receptor
molecules and reduces PDGF-BB release. In agreement with these results, in vivo data show that
melphalan-resistant MM patients present overexpressed c-Myc protein and higher serum PDGF-β ββ
receptor levels compared to minor responding patients.

Despite increased scientific knowledge of the
intimate mechanisms of cancer development, multiple
myeloma (MM) still represents a clinical problem,
especially for its resistance to conventional treatments
(1). Chemotherapy with melphalan is often used to
control MM growth, sometimes with transient effects,
suggesting that the tumor responsiveness may be
modulated over time. Knowledge of the regulation of
sensitivity/resistance mechanisms, therefore, represents
a great possibility for managing this kind of malignancy.
As well as solid tumors, hematological diseases,
including MM, are influenced by the angiogenetic
factors and new anti-angiogenic therapies (i.e.
Thalydomide). These drugs have now been

Key words: c-myc, PDGF-BB, melphalan resistance, MM

Mailing address:
Franco Ameglio, MD, PhD
Institute of Biochemistry and Clinical Biochemistry,
Catholic University of Sacred Heart,
Largo A. Gemelli 8, 00168 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Rome, Italy; This publication and/or article is for individual use only and may not be further
Tel. +39 0630154250 - Fax: +39 0630156706 reproduced without written permission from the copyright holder.
E-mail: francoameglio@hotmail.com 67 Unauthorized reproduction may results in financial and other penalties
68 C. GRECO ET AL.
successfully tested against these neoplasms (2-3).
Oncogenes and their products are considered one of
the potential targets of these angiogenic factors and c-
myc is one of the more studied oncogenes commonly
involved in tumorigenesis and progression of
hematological diseases (4-6). One of these angiogenic
factors is the platelet-derived growth factor (PDGF),
known to influence the c-myc gene expression through
the c-myc promoter in a Src-dependent manner.
Subsequently, Vav2 and furtherly the RAC-dependent
pathways are activated, the last one controlling the c-
myc gene expression. The latter, in turn, has already
been reported to be involved in MM pathogenesis (7).
In fact, activated c-myc characterizes cells with high
proliferative rate and overt clinical phases of MM,
while the inactivated gene is frequently associated
with less aggressive forms of this pathology and also
with those still undefined phases, such as monoclonal
gammopathy of undetermined significance
(MGUS)(8) that may be better classified only by
sequencial observations over time. In addition, PDGF-
BB has been reported to be involved in autocrine and
paracrine growth stimulation of human tumors. In fact,
autocrine PDGF stimulation generates proliferative as
well as anti-apoptotic signals favouring cell
multiplication (9).
Interestingly, c-myc gene is capable of regulating
the PDGF-BB receptor expression, normally
modulating a reciprocal interplay in a feed-back model
(10-11). It is tempting to speculate that this regulation
may be functionally altered in MM patients, as also
happens in the skin tumor dermatofibrosarcoma
protuberans, where a translocation of the 1A1 collagen
gene to the PDGF-BB chain gene produces a fusion
protein processed as a PDGF-like growth factor,
accumulated in large amounts and promoting
malignant transformation (12). Little information is
available at present on how c-myc gene regulates
melphalan resistance (13-14), even if a relationship
between these molecules has previously been reported.
In fact, melphalan administration is able to down-
regulate c-myc gene in a dose-dependent manner.
If PDGF-BB is capable of deregulating c-myc
gene, it should have a regulatory role both in
worsening the disease (c-myc structural/expressive
alterations characterize overt MM) and also in
inhibiting drug sensitivity, thus underlying the
opportunity of using anti-angiogenic factors in these
patients. To approach this point, the present study
was based on two different experimental phases:
a) analysis of the influence of PDGF-BB
treatment on melphalan cell sensitivity (and its
modulation) by using a standardized in vitro model.
To this aim, an already established model (15) based
on two cell clones derived from human melanoma
(another tumor sharing with MM a variable
sensitivity to melphalan) and differing for the Myc
protein status was employed;
b) evaluation of the c-myc gene status, Myc
protein expression and serum PDGF-BB release in a
group of MM patients ongoing chemotherapy with
melphalan.
The response to such particular points may be
helpful not only to better understand the biology of
myeloma (as well as that of other tumors with
common regulatory characteristics) but also to
suggest new potential and more rational therapeutic
approaches to overcome drug resistance.
MATERIALS AND METHODS
Patients and Treatment
Fifty-one patients suffering from MM entered this
study after giving informed consent. All patients (37 male
and 14 female) with ages ranging between 37 and 86
years (median 66) attended the Medical Oncology
Divisions of the Regina Elena Institute of Rome and were
diagnosed according to Durie’s criteria (16).
Immunoglobulin M-component sub-types were as
follows: IgGk (42%), IgGL (26%), IgAk (17%) and IgAL
(15%). Patients received melphalan (MP) treatment (0.25
mg/kg body wt/day and Prednisone 2 mg/kg body weight)
for 4 consecutive days. The course was repeated at every
6th week until tumor progression. The response was
defined as minor response (MR) when the serum M-
protein had decreased by > 25% but < 50% or the urinary
BJ had decreased by > 50% but not to < 0.2g in 24h. The
no response (NR) group was defined by serum M-protein
levels that had decreased to < 25% or by urine BJ protein
levels that had decreased to < 50% of initial levels.
Immunohistochemistry
Immunohistochemical (IHC) staining was carried out
after deparaffinization and antigen retrieval treatment of
sections in a microwave oven at 750 W for 5 min. in
citrate buffer (pH 6.0) with a Super Sensitive Link-
Labeled Detection System (Biogenex, Menarini Florence,
Italy). Overexpression of c-myc oncogene product was
determined using the high affinity monoclonal antibody
 Int. J. Immunopathol. Pharmacol.
mAb 9E11 (1:50 Novocastra, U.C.S., Rome, Italy) raised
against a synthetic peptide representing amino acid
residues 408-420 on the human c-Myc oncoprotein. To
determine the consistency of bone marrow plasma cells
infiltration we used the mouse MoAb anti Syndecan-1
(CD138 clone B-B4 Novocastra, UCS). The enzymatic
activity was developed using 3-amino-9-ethylcarbazole
(DakoCytomation) as chromogenic substrate. Following
counterstaining with Mayer’s haematoxylin, slides were
mounted in aqueos mounting medium (glycergel,
DakoCytomation). Negative controls consisted of parallel
sections in which the primary antibody was omitted.
Slides were observed by two independent observers with
no knowledge of the other experimental results.
Southern blot analysis
Southern blot analysis was performed on DNA
prepared from bone marrow aspirates (phenol-chloroform
method), as previously described (8). Briefly, ten
micrograms of DNA were digested to completion with
EcoRI restriction endonuclease, fractionated by
electrophoresis in 0.8% agarose gel, transferred to nylon
membranes (Hybond N+, Amersham Aylesbury, UK) and
fixed by UV irradiation. DNA probe was c-myc III exon
(14 kilobase long purchased from Oncor, USA) labelled
with Digoxygenin- dUTP random priming system.
Hybridization was performed at high stringency and the
hybridization signal was revealed by a effect of melphalan on cell growth of pINDneo and pINDc-
chemiluminescence detection method according to the
manufacturer’s protocol (Boehringer Mannheim, USA).
After removal of the c-myc probe (0.2N NaOH, 0.1%
SDS) the membranes were stripped and reprobed to a
beta-actin probe (Oncor, USA), used as internal control.
The levels of amplification in individual cases were
determined by densitometric comparison (LKB 2202
Ultrascan Densitometer) of the c-myc intensity signals
from normal and pathologic peripheral blood cell
lymphocytes. The dosage of c-myc oncogene in
pathologic DNA, relative to normal DNA, was
determined from intensity ratios calculated according to
the formula of Peltomaki (17). An increase in c-myc
dosage in tumor DNA (≥- 2.0 fold) with respect to normal
DNA was considered as an index of gene amplification.
Each experiment was performed in duplicate
Measurement of PDGF-BB
The serum PDGF-BB level was measured on samples
collected from MM patients and 15 healthy blood donors
(matched for sex and age). Data were normalized for
platelet concentration to eliminate the bias due to PDGF-
BB platelet content. PDGF-BB concentration was
detected in supernatants aliquots collected from both
pINDc-myc AS and pINDneo clones at 24h of cell
69
growth. All samples were stored at -80°C until use. The
PDGF-BB protein measurements were performed by
using an enzyme-linked immunosorbent assay (ELISA)
(R & D System, Minneapolis, MN, USA). Standards and
samples were assayed in duplicate.
Cell cultures
M14 human melanoma Ecdysone-inducibile pINDc-
myc AS and pINDneo stable cell clones, obtained as
previously described (15), were cultured in RPMI-1640
medium supplemented with 10% fetal calf serum,
antibiotics and L-glutamine at 37°C in a 5%CO2 /95% air
atmosphere in a humidified incubator, in the presence of
both G418 (GIBCO, USA) and zeocyn (Invitrogen, San
Diego, CA, USA).
In vitro treatment
The effect of different doses of melphalan (1,3 and 10
µM) was evaluated on cell growth in both pINDneo and
pINDc-myc AS-induced clones. 1 x 105 cells were seeded
in 12-wells plates. Twenty-four hours after seeding, cells
were exposed to melphalan (single bolus) for 24, 48, 72
and 96 h. Ponasterone A (Invitrogen, USA) was used to
induce the c-myc AS RNA transcription in pINDc-myc
AS clone, giving a dose of 20 µM every 24 h.
At each time-point cells, were harvested and counted by
using the trypan blue-dye exclusion test. The inhibitory
myc AS-induced clones was evaluated as percent of control.
The effect of the highest dose of melphalan (10 µM) was
evaluated in pINDneo cell clone after induction with
PDGF-BB 50 ng/ml for 24 h. 1 x 105 cells were seeded in
12-wells plates. Twenty-four hours after seeding, cells were
starved in medium containing 3% FCS and 24 h later
PDGF-BB 50 ng/ml was added to the culture medium.The
day after, the cells were exposed to melphalan 10 µM for
further 24 h. The cells were then harvested and counted by
the trypan blue-dye exclusion test.
Cell cycle analysis
Cell cycle analysis of pINDc-myc AS-induced and
pINDneo clones treated or not with different doses of
melphalan was performed at 24, 48 and 72 h after drug
exposure by Propidium Iodide (PI)-staining. Cells were
harvested by trypsinization, washed in cold PBS and fixed
in 70% ethanol for at least 1 h. After removing the alcoholic
fixative and washing once in cold PBS, 5 x 105 cells were
stained with a solution containing PI 50 µg/ml and RNAse
A 75 KU/ml for 1 h in the dark. Twenty thousand
events/samples were acquired using a FACScalibur
cytofluorimeter (Becton Dickinson, Sunnyvale, CA, USA).
The analysis was performed using the CellQuest software
package (Becton Dickinson). The percentages of the cells in
70 C. GRECO ET AL.
the different cell cycle phases were estimated by applying
the Modfit software to each histogram.
Apoptosis detection
Induction of apoptosis by melphalan treatment was
investigated in pINDc-myc AS and pINDneo clones by
both evaluating the fraction in the sub-G1 region of DNA
flow cytometric histograms and performing annexin V
assay. For the annexin V assay, cells treated as described
above were harvested, washed once in PBS and processed
using the manufacturer’s kit protocol (Annexin V-EGFP
Apoptosis detection kit, MBL International, USA). Ten
thousand events/samples were acquired using a
FACScalibur flow cytometer (Becton Dickinson) and
analysis performed using the CellQuest software package
(Becton Dickinson).
Western blot analysis
The expression of Myc protein was evaluated after
PDGF-BB induction of serum-starved cells. pINDc-myc
AS cells were seeded in complete medium and after 24 h
deprived of serum for further 24 h. Cells were then treated
with different doses of PDGF-BB (10,25 and 50 ng/ml ;
Sigma-Aldrich, USA) for 0.5, 3 and 12 h. At each time
cells were harvested, washed once in PBS, solubilized in
lysis buffer (0.01 M Tris-HCl [pH 7.5], 0.144 M NaCl,
0.5% Nonidet P-40, 0.5% sodium dodecyl sulfate [SDS],
0.1% aprotinin, 10 mg/ml leupeptin and 2 mM
phenylmethylsulfonyl fluoride) and treated by 4s of
sonication. The protein content in the different samples
was quantified using the BCA protein assay (Pierce
Chemical Co., Rockford, IL, USA). Thirty-micro-gram
aliquots of protein were subjected to 10% SDS-
polyacrylamide gel electrophoresis. The resolved proteins
were blotted into a nitrocellulose membrane and the blots
were blocked with 5% non-fat milk in PBS-Tween 20
(0.1%). Blots were then incubated with the anti-human
Myc Mab (clone 9E10, Sigma-Aldrich, USA) and anti-
human HSP 72/73 Mab (Ab-1, Oncogene Science Inc.).
Peroxidase labeled anti-mouse antibody (Amersham Life
Science, Arlington Heights, IL, USA) was used as
secondary antibody. The immunoblots were processed for
enhanced chemiluminescence detection (Amersham life
Science). The relative amount of transferred proteins in a
given sample was quantified by scanning X-ray films and
estimating the relative arbitrary density units, normalized
to the HSP 72/73 content in each sample.
FACS analysis of PDGF-β receptor
The expression of PDGF-β receptor was evaluated in
pINDneo and pINDc-myc AS clones at 12 and 24 h after
induction of c-myc AS RNA transcription. PINDneo and
pINDc-myc AS induced cells were harvested using
trypsin-EDTA solution, washed once with cold PBS
containing 0.002% EDTA and 10 mM NaN3 (washing
buffer). 1 x 106 cells/sample were incubated with anti-
PDGF-β receptor MoAb (clone PDGF-B2, Sigma, Saint
Louis, USA) in complete medium for 1 h at 4°C. Negative
control cells were incubated with complete medium. Cells
were then washed three times with washing buffer and
incubated for 1 h at 4°C with FITC-conjugated F(ab’)2
rabbit anti-mouse IgG fragments (DAKO, Denmark).
Cells were again washed three times in cold washing
buffer and resuspended in 500 µl washing buffer for
FACS analysis. Five microliter of a solution of PI (final
concentration 10 µg/ml) were added just prior to FACS
analysis. In order to exclude non-viable cells, samples were
analysed using a FACScalibur flow cytometer (Becton
Dickinson). Ten thousand events were stored for each
sample. The list mode data were analysed using Cell Quest
software packaging (Becton Dickinson).
Statistical analysis
Statistical analysis was performed by adopting the
following tests: Student’s t test or Chi square test when
appropriate. The significance cut off was P<0.05.
RESULTS
Melphalan resistance is associated to c-myc
gene amplification and myc protein overexpression
in Myeloma patients
No complete response to melphalan was
observed in our group of MM patients. Thirty-one
out of 51 patients (60.8%) were totally refractory to
melphalan treatment (NR group), while twenty
(39.2%) elicited a minor response (MR group). To
assess whether the response to melphalan could be
influenced by the c-myc gene status, a Southern blot
analysis was performed on bone marrow specimens
collected from MM. Only two patients (10%) of the
MR group had c-myc amplified compared with
96.8% (30 out of 31 patients) of the NR group
(p=0.002). The remaining patients (18 MR and 1
NR) did not show c-myc amplification. As no clear
correlation has been reported in literature between
the gene structural alterations and the Myc protein
expression, immunohistochemistry was also
performed on 15 randomly selected specimens
collected from the same bone marrow biopsies. A
good association was found between the gene
analysis and protein expression. All samples
presented plasma cellular infiltration as
 Int. J. Immunopathol. Pharmacol. 71

Fig. 1 (A-F). Correlation between melphalan response, c-myc gene status and Myc protein expression: representative
examples of two myeloma patients. (A and D): Serum protein electrophoresis of two MM patients eliciting a different
response to melphalan, during the course of disease: (a) before treatment, (b) after the 3rd cycle of chemotherapy, (c) at
the end of chemotherapy. For each sample, the corresponding c-myc signals (Southern blot analysis) are reported. #
D30: patient progressively resistant to chemotherapy, #M4: patient sensitive to therapy. (C and F):
Immunohistochemical pictures of Myc protein expression evaluated on bone marrow specimens of the same two
patients. (B and E): bone marrow samples of these patients showing a strong CD138 positivity.

demonstrated both morphologically and by IHC.
Myc protein was found strongly positive in all the
NR cases examined (n=6) which also resulted
positive for c-myc gene amplification. The
remaining 9 samples belonging to the group of MR
patients were found weakly positive (5/9) or
completely negative (4/9) for the oncoprotein
expression. These patients have not elicited c-myc
gene structural alterations. Figure 1 shows two
representative examples of the serum protein
electrophoresis of a NR ( #30) and MR (#M4)
myeloma patient ongoing chemotherapy with
melphalan. Parallel to the changes in the monoclonal
component concentration (a marker of tumor
sensitiveness), variation in the c-myc gene status
(amplified - not amplified) (panels A and D for NR
and MR patients, respectively) as well as different
expression levels of the oncoprotein (panels C and
F), measured on CD138+ cells (panels B and E) was
clearly observed.
The down-regulation of Myc protein sensitizes
tumor cells to melphalan treatment.
To verify whether the Myc protein inhibition
could sensitize tumor cells to melphalan treatment
we studied the effect of melphalan on the growth of
a human melanoma cell clone previously selected by
our group (15). Considering the difficulty
encountered in expanding in vitro malignant plasma
cells from the bone marrow of MM patients and the
questionable relevance to myeloma biology of
established myeloma cell lines (18), we selected the
72 C. GRECO ET AL.
above-mentioned model for the following reasons:
a) melanoma and myeloma share melphalan
resistance and b) this model allows that Myc protein
expression can be modulated. Both the cells stably
transfected with an inducible c-myc AS construct
(M14 pINDc-myc AS Ecdysone-inducible clone)
and control cells transfected with the empty vector
(pINDneo clone) were treated with melphalan
according to different drug doses and exposure
times. The growth of the two clones was monitored
up to 5 days in the absence or presence of the drug
(Fig. 2). Melphalan inhibited the cell proliferation of
pINDneo clone as a function of the dose employed,
with a maximum inhibitory percentage of 60%
elicited by the highest dose of 10 µM and
evidenced from 72 up to 120 h cell growth. The
lowest doses employed (1 and 3 µM) showed
maximum cell growth inhibitions of about 20% and
40%, respectively (left panel). The down-regulation
of Myc protein sensitized the cells to melphalan
treatment (right panel). Indeed, the lowest melphalan
dose (1µM) inhibited the cell proliferation by about
40% already after 24h exposure (corresponding to
48h cell growth), with a maximum effect evidenced
from 72 h cell growth (more than 80% inhibition).
However, it is to be noted that the down-regulation of
Myc protein itself is able to inhibit the tumor cell
proliferation by about 70%.
To elucidate the mechanism by which Myc
down-regulation sensitizes tumor cells to melphalan,
we analysed the cell cycle distribution after
melphalan exposure in pINDneo and pINDc-myc
AS-induced clones. Fig. 3 shows representative
DNA histograms, with the relative cell cycle phase
Fig. 2. Myc down-regulation sensitizes M14
melanoma cells to melphalan treatment.
pINDneo control (left) and pINDc-myc AS-
induced (right) cells were exposed to 1 ( ),
3 ( ) and 10 ( ) M melphalan for the
indicated times. Untreated cells (♦). At
each time cells were harvested and counted
by the trypan blue dye exclusion test. The
number of viable cells is reported in the
growth curves shown in the figure. Values
are means (bar, SE) of three different
experiments with similar results. The arrow
represents time of drug administration and
stars time of Ecdysone adding.
percentages of control and melphalan-treated cells
for both clones, as evaluated by PI-staining and
FACS analysis. Exposure of the pINDneo cells to
melphalan for 24 h (corresponding to 48h cell
growth ) resulted in a dose dependent accumulation
of cells in the G2 phase (34.3, 42.7 and 58.8% at 1,
3 and 10 µM, respectively) as compared with the
untreated cells (20.4%), with a concomitant
depletion from the G1 and S phases. This G2
accumulation decreased (for the highest 10 µM
dose, 44.5%) after 48 h of treatment (72 h cell
growth). When Myc protein was down-regulated the
melphalan-induced G2 arrest was decreased, even
using the highest 10 µM melphalan dose (26.6%
after 24h of treatment). However, a transitory
increase in the S phase fraction was observed at the
same time, suggesting that Myc–down regulation
produced a delay in cell cycle progression.
The decreased percentage in the G2 phase
observed in Myc down-regulated cells after
exposure to melphalan is consistent with the
activation of apoptosis (Fig. 4). In Fig. 4A
representative cytograms are reported of Annexin V-
GFP vs DNA-PI biparametric FACS analysis in
pINDneo and pINDc-myc AS cells exposed to
melphalan 10 µM for 24 (b and d, respectively) and
72 h (c and e, respectively). In Fig. 4B the results
obtained are summarized. Melphalan treatment
induced modest percentages of apoptosis in pINDneo
cells, showing a maximum value of less than 40% at
the highest dose and after 72 h of exposure (96 h cell
growth). On the contrary, when Myc was down-
regulated (pINDc-myc AS) the percentage of
apoptosis increased dramatically already after 24 h
 Int. J. Immunopathol. Pharmacol. 73

Fig. 3. Effect of melphalan on cell cycle phases distribution of pINDneo and pINDc-myc AS-induced clones. Both cell
clones were exposed to the indicated melphalan concentration (1,3 and 10 µM) for 24 and 48 h (corresponding to 48
and 72 h cell growth, indicated in the figure). Untreated (C) and treated cells were then stained with PI and analyzed
for DNA content by flow cytometry. The percentages of cells in G1, S and G2 phases of cell cycle were estimated by
applying to each histogram the Modfit software. The fraction of hypodiploid cells, indicative of apoptosis, was
calculated by putting a gate in the sub-G1 region of each histogram, as indicated. The reported data is representative of
three different experiments with similar results.

after treatment (48 h cell growth). The apoptotic
effect is a function of the melphalan dose employed,
achieving values of about 80% at 72 h after treatment
(corresponding to 96 h cell growth). Superimposable
results concerning the induction apoptosis were also
obtained in both M14 cell clones by analizing the sub-
G1 region in the cell cycle DNA histograms,
indicative of apoptosis (data not shown).
Myc protein is up-regulated by PDGF-BB and
PDGF-β receptor expression is regulated by c-myc.
Since it has been demonstrated that Myc protein
expression is induced by PDGF signaling (7) we
wanted to verify whether exposure of M14 cells to
PDGF-BB could increase Myc expression. Twenty-
four hour serum deprived pINDc-myc AS cells, not
induced by Ecdysone, were exposed to different
concentrations (10, 25 and 50 ng/ml) of PDGF-BB
for 30 min, 3h and 12 h and Western blot analysis
was performed at each time. Exposure of the cells to
PDGFBB induced the expression of the Myc protein
in a dose-dependent manner and as a function of the
induction time (Fig. 5 A). The densitometric analysis
of the protein amounts, normalized to HSP 72/73
and referred to serum-deprived cells (% of control)
demonstrated that no significant differences were
observed after 30 min. of PDGF-BB induction,
while an increase of Myc protein of about 70 % and
85 % was observed for the highest PDGF-BB dose
after 3 and 12 h of exposure, respectively.
74 C. GRECO ET AL.
Fig. 4. Apoptosis was evaluated in pINDneo and pINDc-
myc AS-induced cells treated as in Fig. 2, by using the
Annexin V-EGFP Apoptosis Detection Kit (MBL,
International). Samples were processed following the
manufacturer’s protocol and then measured by FACS. A)
Representative cytograms of pINDneo and pINDc-myc AS-
induced cells treated with melphalan 10 µM for 24 (b and
d, respectively) and 72h (c and e, respectively),
corresponding to 48h and 96h cell growth. Untreated
pINDneo cells (a). The low left quadrant in each cytogram
represents the undead cells, while the upper right quadrant,
the apoptotic cells. B) Apoptotic fractions in pINDneo and
pINDc-myc AS-induced cells treated with melphalan
1(striped bar) 3 (dotted bar) and 10 ( ) µM. Untreated cells
( ). Values are means (bar, SE) of three different
experiments with similar results.
In addition, since data from literature suggest that
Myc plays an essential role in the negative feedback
loop regulating the expression of the PDGF-β
receptor (10,11), we investigated whether the
inhibition of Myc expression in M14 cells could
modulate the expression of PDGF-β receptor.
pINDc-myc AS cells were induced by Ecdysone and
both the cell expression of PDGF-β receptor and the
level of PDGF-BB released in the culture medium
were analyzed. Fig. 5B reports the FACS profiles of
the cell-associated immunofluorescence obtained
using an antibody which recognizes PDGF-β
receptor. Parallel to Myc inhibition, an increase in
the cell expression of the growth factor receptor was
achieved after 24 h of Ecdysone-induction
evidenced by a significant increase in the mean
fluorescence values (10.7 compared to 6.8 of control
cells: Fig. 5B, d). Twelve hours after Ecdysone
induction no differences in PDGF-β receptor
expression were observed as compared to non
induced cells (Fig. 5B, c and b, respectively).
Consistent with the increase in PDGF-β receptor
expression after Myc down-regulation are the results
of the ELISA assay concerning the release of PDGF-
BB in the culture medium of both clones at 24 h of
cell growth. This period of time was chosen
considering that the down regulation of the Myc
protein was first observed after 24 h of Ecdysone
induction (15). The results showed a markedly lower
PDGF-BB concentration in the culture medium of
pINDc-myc AS induced cells as compared to the
control cells (2.25 pg/ml vs 42.35 pg/ml,
respectively; p < 0.001).
PDGF-BB increases resistance to melphalan
both in tumor cell lines and in MM patients.
Fig. 6 reports the effect of PDGF-BB on
M14pINDneo cells response to melphalan treatment.
Cells growing in 3% serum were induced with PDGF-
BB and the 24 h-effect of the melphalan dose 10 µM
on cell proliferation was evaluated. PDGF-BB
exposure is able to increase proliferation in serum-
deprived cells by 30%. When serum-deprived cells
were treated for 24h with melphalan, an inhibitory
effect of about 25% was observed. By contrast, a pre-
exposure of the cells to PDGF-BB is able to abrogate
the melphalan-mediated inhibitory effect on cell
growth, rendering the cells more resistant to the drug.
To confirm in vivo the relationship previously
demonstrated in vitro between PDGF-ββ, Myc and
melphalan responsiveness, we initially analyzed the
serum PDGF-ββ release and the c-myc gene copy
number in MM patients at diagnosis and on
chemotherapy, then comparing them in both
responder and non-responder patients. As shown in
Table 1, parallel to the resistance to melphalan, a
significantly higher concentration of the angiogenic
factor and an increased number of the c-myc gene
copies (p=0.0001 and p=0.0002, respectively)
characterized patients refractory to melphalan as
compared with responder patients.
DISCUSSION
A precise regulation of Myc expression is
essential to mantain normal cell function. For this
purpose, protein synthesis and stability is tightly
controlled from gene trascription to protein
degradation throughout a complex signaling
 Int. J. Immunopathol. Pharmacol. 75

Fig. 5. PDGF-BB induces the expression of Myc protein and PDGF-β receptor expression is regulated by c-myc. A)
pINDc-myc AS cells, not induced by Ecdysone, were serum deprived for 24h and then PDGF-BB was added at the
indicated concentrations. At each reported time cells were harvested and lysed for western blot analysis, as described
in the Materials and Methods section. Each lane was loaded with 30-µg of protein. Blots were incubated with an anti-
Myc MoAb (clone 9E10) and HSP 72/73 was used as control for loading equal amounts of proteins. Band intensities
were measured by densitometry. B) pINDc-myc AS cells were induced with Ecdysone for 12h and 24h. At each time the
cells were harvested and processed for indirect immunofluorescence using a MoAb recognizing PDGF-ββ receptor.
Samples-associated fluorescence was detected by FACS. a) negative control; b) positive control; c) and d) Myc down-
regulated cells at 12h and 24h, respectively. The number on the left top in each histogram indicates the median
fluorescence value of the distribution.

pathway involving Ras-activated kinases, Pin1
prolyl isomerase, the PP2A phosphatase and a series
of Myc phosphorylation and dephosphorylation
events. Also the catabolism of this molecule is under
the control of a nucleolar isoform of the ubiquitin
ligase that regulates Myc protein accumulation (19).
Despite these strict control mechanisms, c-myc is
frequently deregulated in human cancers and it is
common knowledge that the oncoprotein may
initiate and mantain the transformed state so that
there are several projects to use Myc as a therapeutic
target in cancer (20). Myc accumulation leads to a
number of metabolic consequences, including cell
proliferation increase, differentiation inhibition and
apoptosis induction (21). Among these functions
exerted by Myc, two specific aspects have been
76 C. GRECO ET AL.
Fig. 6. PDGF-BB abrogates the inhibitory effect on cell
proliferation produced by melphalan treatment. pINDneo
cells were grown in 3% FCS-containing medium and
after 24h PDGF-BB 50 ng/ml was added for further 24
h. The cells were then exposed to melphalan 10 µM for
24h, afterwards harvested and counted by the trypan
blue-dye exclusion test. Control (striped bar), PDGF-BB
induced ( ), melphalan treated (dotted bar), PDGF-BB +
melphanan treated ( ) cells. Values are means (bar, SE)
of three different experiments with similar results. P<0.05
calculated for both PDGF-BB induced cells and PDGF-
BB + melphalan treated cells versus controls. P<0.01
calculated for PDGF-BB + melphalan treated cells
versus melphalan treated cells.
considered in this report: a) the interactions with the
angiogenetic mechanisms and angiogenetic
cytokines (22-23) and b) the interactions with the
cancer drug sensitivity (24-25). Both these aspects
have been analyzed in human myeloma, where the
influence of c-myc and its product has been recently
underlined in animal models (26-27).
A first finding obtained was the greater
expression of Myc protein in histological sections of
myelomas from patients clinically classified as non-
responders versus low responders to melphalan
treatment (a drug known to exert a cytotoxic effect
on neoplastic cells by alkylating different molecular
targets). Secondly, we analyzed the relationship
between melphalan-resistance and Myc up-
regulation observed in the previous group of
myeloma patients. In fact, many studies have been
directed to clarify the role of c-myc gene in tumor
cell responsiveness to chemotherapy but they failed
to elucidate the kind of effect induced by c-myc
deregulation (drug sensitivity or resistance), the
results obtained being contradictory (28-29),
possibly due to to the complexity of apoptotic
mechanisms induced by this drug (30).
The model system employed in the present study
is representative of the in vivo situation in that the
cell clone M14 pINDneo, constitutively expressing
Myc, elicited a dose-dependent resistance to
melphalan like myeloma patients, as previously
reported (1) and confirmed in this study (Fig. 2).
Moreover, the availability of the M14 pINDc-
mycAS-inducible cell clone allowed us to
demonstrate that myc down-regulation by Ecdysone
is able to revert melphalan resistance and sensitize
cells to the drug. This effect, particularly evident at
the dose of 10 uM melphalan (exposure time of
48h), can be explained by the removal of the G2
cell cycle block, induced by melphalan on the
pINDc-myc AS cells and the activation of apoptotic
mechanisms. In fact, the results of the flow
cytometric analysis of the Annexiv V shows that
Myc down-regulated cells were much more
susceptible to melphalan-induced cell death than the
control cells, constitutively expressing this
oncoprotein (96h melphalan 10µM: 86.7% pINDc-
myc AS cells versus 35.2% pINDneo cells ).
Data from the literature have reported that the
growth factor PDGF-BB (a cytokine belonging to the
pro-fibrotic/angiogenetic group of biological
mediators) is able to increase the c-myc mRNA
expression either in normal (7, 31-32) or in tumor
cells (33). In this second case such effect is correlated
with the malignant degree of the tumors examined).
The effect exerted by PDGF-BB added to the cell
culture has also been confirmed by data shown in this
report (Fig. 5). In the light of these results,
considering the emerging role of angiogenic factors
as predictors of poor prognosis in hemathologic
diseases (34), including multiple myeloma, we
verified whether the exposure of pINDc-myc AS cells
to PDG-BB could restore Myc protein expression.
Western blot analysis supported our hypothesis and
c-Myc expression was shown to be markedly
enhanced by PDGF-BB in a dose-effect manner and
as a function of the time of induction (Fig. 5).
The interaction between c-myc and PDGF-BB
seems to constitute an auto-enhancing loop: in fact,
PDGF-BB deregulates c-myc and, in turn, the latter
induces the synthesis of angiogenetic factors (31,
35-36) including PDGF-BB, as evidenced by the
 Int. J. Immunopathol. Pharmacol.
Table I. Relationship between serum PDGF-BB
concentration and c-myc gene status
Groups (n° pts) PDGFBB level P c-myc gene
(pg/ml) copy
number
Healthy CO (25) 13.6 ± 4.0 n.d.
MM dia (51) 16.8 ± 7.3 0.045 a 3.9 ± 1.6
b b
MM MR (20) 3.48 ± 3.7 0.0001 1.2 ± 0.6
MM NR (31) 17.8 ± 3.9 0.0001 c
4.0 ± 1.4
Values are expressed as mean ±SD.
MM dia: Myeloma patients at diagnosis; MR : Minor
responders; NR : No responders.
Values represent the mean ( ± SD) of two separate
experiments. aHealthy Controls vs MM dia; bMM dia vs
MM MR; cMM MR vs MM NR Differences between serum
PDGFββ levels and c-myc gene copy number calculated
in MM dia group vs NR group were not statistically
significant (p=0.48 and 0.89, respectively).
n.d. = not done.
results shown in Table I, where a deregulation of c-
myc was concomitant to a drop of PDGF-BB cell
release. Interestingly, together with decreased
PDGF-BB surnatant levels, Myc down-regulated
cells also showed increased PDGF-BB receptor, as
detected by flow cytometry techniques, making the
cell apparently more sensitive to the PDGF-BB
effect. These findings are perfectly in accordance
with the large bulk of recent research regarding the
mechanisms activated in the transcription of PDGF-
BB receptor (11, 35-38). In keeping with these
findings are the data obtained on sera of patients
with myeloma showing increased PDGF-BB levels
as compared to healthy controls. Moreover, they also
evidence a strong correlation between PDGFBB
concentration and response to melfalan in that
resistant patients presented a significantly higher
serum concentration of the angiogenic factor in
respect to the partially sensitive ones (Table I). We
did not determine which cells may be involved in
producing these PDGF-BB molecules, however it is
reasonable to think that they are produced by
myeloma cells as already reported for other
77
cytokines (39-40).
In conclusion, this study supports the idea that also
p in myeloma patients the interplay between PDGF-BB
and c-myc gene may represent an interesting
mechanism to induce and maintain the plasma cell
neoplastic characteristics and a reliable target to
control the drug resistance of hematological diseases
as well others with activated similar mechanisms.
ACKNOWLEDGEMENTS
0.0001
Partially supported by grants from the Ministero
0.0001 c della Salute (to I.D.)
REFERENCES
1. Yang H.H., M.H. Ma, R.A. Vescio and J.R. Berenson.
2003. Overcoming drug resistance in multiple
myeloma: the emergence of therapeutic approaches to
induce apoptosis. J. Clin. Oncol. 21:4239 .
2. Barlogie B., G. Tricot and E. Anaissie. 2001.
Thalidomide in the management of multiple
myeloma. Sem. Oncol. 28:577.
3. Moehler T.M., J. Hillengass, H. Goldschmidt and
A.D. Ho. 2004. Antiangiogenic therapy in hematologic
malignancies. Curr. Pharm. Des. 10:1221.
4. Shou Y., M.L. Martelli, A. Gabrea , Y. Qi, L.A.
Brents, A. Roschke, G. Dewald, I.R. Kirsch, P.L.
Bergsagel and W.M. Kuehl. 2000. Diverse
karyotypic abnormalities of the c-myc locus
associated with c-Myc dysregulation and tumor
progression in multiple myeloma. Proc. Natl. Acad.
Sci. USA 97: 228.
5. Skopelitou A., M. Hadjiyannakis, A. Tsenga, S.
Theocharis, V. Alexopoulou, C. Kittas and N.
Agnantis. 1993. Expression of c-Myc p62 oncoprotein
in multiple myeloma : an immunohistochemical study
of 180 cases. Anticancer Res. 13: 1091.
6. Deiry W.S. 1997. Role of oncogenes in resistance
and killing by cancer therapeutic agents. Curr. Opin.
Oncol. 9:79.
7. Chiariello M., M.J. Marinissen and J.S. Gutkind.
2001. Regulation of cMyc expression by PDGF
through Rho GTPases. Nature Cell Biol. 3:580.
8. Greco C., F. Ameglio, S. Alvino, A. Mosiello, A.M.
Cianciulli, I. Venturo, G. Del Monte, M.
78 C. GRECO ET AL.
Giampaolo, A.W. Tong and G.M. Gandolfo. 1999.
Phenotypic and genotypic alterations characterize
patients bearing plasma cell dyscrasias with a high
M-component. Cell Prolif. 32:231.
9. Heldin C.H. and B. Westermark. 1999. Mechanism
of action and in vivo role of platelet-derived growth
factor. Physiol. Rev. 79:1283.
10. Oster S.K., W.W. Marhin, C. Asker, L.M.
Facchini, P.A. Dion, K. Funa, M. Post, J.M.
Sedivy and L.Z. Penn. 2000. Myc is an essential
negative regulator of platelet-derived growth factor
beta receptor expression . Mol. Cell Biol. 20: 6768.
11. Izumi H., C. Molander, L.Z. Penn, A. Ishisaki, K.
Kohno and K. Funa. 2001. Mechanism for the
transcriptional repression by c-Myc on PDGF beta-
receptor. J. Cell Sci .114:1533.
12. Sjöblom T., A. Shimizu, K.P. O’Brien, K.
Pietras, P. Dal Cin, E. Buchdunger, J.P.
Dumanski, A. Östman and C.H. Heldin. 2001.
Growth inhibition of dermatofibrosarcoma
protuberans tumors by the platelet-derived growth
factor receptor antagonist STI571 through
induction of apoptosis. Cancer Res . 61:5778.
13. Vikhanskaya F., M. D’Incalci and M. Broggini. 1993.
Effects of DNA damaging agents on gene expression in
two human cancer cell lines. Cell Mol. Biol . 39:855.
14. Gieseler F. and V. Nüssler. 1998. Cellular resistance
mechanisms with impact on the therapy of multiple
myeloma. Leukemia 12:1009.
15. D’Agnano I., A. Valentini, C. Fornari, B. Bucci,
G. Starace, A. Felsani and G. Citro. 2001. Myc
down-regulation induces apoptosis in M14
melanoma cells by increasing p27kip1 levels.
Oncogene 20:2814.
16. Durie B.G.M. 1986. Staging and kinetics of
Multiple Myeloma. Sem. Oncol. 13:300.
17. Peltomäki P., O. Alfthan and A. de La Chapelle.
1991. Oncogenes in human testicular cancer. DNA
and RNA studies. Br. J. Cancer. 63:851.
18. Pellati-Deceunynk C., M. Amiot, R. Bataille, I.
Van Riet, B. Van Camp, P. Omede and M.
Boccadoro. 1995. Human myeloma cell lines as a
tool for studying the biology of multiple myeloma: a
reappraisal 18 years after. Blood 86:4001.
19. Welker M., A. Orian, J.A. Grim, R.N. Eisenman
and B.E. Clurman. 2004. A nucleolar isoform of the
Fbw7 Ubiquitin ligase regulates c-Myc and cell size.
Curr. Biol. 14:1852.
20. Prochownik E.V. 2004. c-Myc as a therapeutic
target in cancer. Expert Rev. Anticancer Ther. 4: 289.
21. Sears R.C. 2004. The life cycle of c-Myc: from
synthesis to degradation. Cell Cycle 3:3.
22. Knies-Bamforth U.E., S.B. Fox, R. Poulsom, G.I.
Evan and A.L. Harris. 2004. c-Myc interacts with
hypoxia to induce angiogenesis in vivo by a vascular
endothelial growth factor-dependent mechanism.
Cancer Res. 64:6563.
23. Oh H.S., A. Moharita, J.G. Potian, I.P.
Whitehead, J.C. Livingston, T.A. Castro, P.S.
Patel and P. Rameshwar. 2004. Bone marrow
stroma influences transforming growth factor-beta
production in breast cancer cells to regulate c-myc
activation of the preprotachykinin-I gene in breast
cancer cells. Cancer Res. 64:6327.
24. Iba T., J. Kigawa, Y. Kanamori, H. Itamochi, T.
Oishi, M. Simada, K. Uegaki, J. Naniwa and N.
Terakawa. 2004. Expression of the c-myc gene as
a predictor of chemotherapy response and a
prognostic factor in patients with ovarian cancer.
Cancer Sci. 95:418.
25. Stachurska A., M. Dudkowska, A. Czopek, M.
Manteuffel-Cymborowska and B. Grzelakowska-
Sztabert. 2004. Cisplatin up-regulates the in vivo
biosynthesis and degradation of renal polyamines and
c-Myc expression. Biochim. Biophys. Acta 1689:259.
26. Cheung W.C., J.S. Kim , M. Linden, L. Peng, B.
Van Ness, R.D. Polakiewiczand and S. Janz. 2004.
Novel targeted deregulation of c-Myc cooperates
with Bcl-X(L) to cause plasma cell neoplasms in
mice. J. Clin .Invest. 113:1763.
27. Marinkovic D., T. Marinkovic, B. Mahr, J. Hess
and T. Wirth. 2004. Reversibile lymphomagenesis
in conditionally c-Myc expressing mice. Int. J.
Cancer 110:336.
28. Nesbit C.E., S. Fan, H. Zhang and E.V.
Prochownik. 1998. Distinct apoptotic responses
imparted by c-myc and max. Blood 92:1003.
29. Niimi S., K. Nakagawa, J. Yokota, Y. Tsunokawa,
K. Nishio, Y. Terashima, M. Shibuya, M.Terada
and N. Saijo. 1991. Resistance to anticancer drugs
in NIH3T3 cells transfected with c-myc and/or c-H-
ras genes. Br. J. Cancer 63:237.
 Int. J. Immunopathol. Pharmacol.
30. Biroccio A.M., B. Benassi, F. Fiorentino and G.
Zupi. 2004. Glutathione depletion induced by c-Myc
downregulation triggers apoptosis on treatment with
alkylating agents Neoplasia 6:195.
31. Li J., S.L. Huang and Z.G. Guo. 2000. Platelet-
derived growth factor stimulated vascular smooth
muscle cell proliferation and its molecular
mechanism. Acta Pharmacol. Sin. 21:340.
32. Paulsson Y., M. Bywater, C.H. Heldin and B.
Westermark. 1987. Effects of epidermal growth
factor on c-fos and c-Myc mRNA levels in normal
human fibroblasts. Exp. Cell. Res.171:186.
33. Yu S., P.Pu, D. Jiang, Y. Cheng, T. An and X. Guan.
1999. Observations on expression of c-fos and c-myc
genes and activity of PDGFBB autocrine loop in 67
human gliomas. Zhonghua Bing Li Xue Za Zhi. 28:182.
34. Alexandrakis M.G., F.H. Passam, C.A. Pappa, C.
Dambaki, G. Sfakiotaki, A.G. Alegakis, D.S.
Kyriakou and E. Stathopoulos. 2004. Expression
of prolipherating cell nuclear antigen (PCNA) in
multiple myeloma: its relationship to bone marrow
microvessel density and other factors of disease
activity. Int. J. Immunopathol. Pharmacol. 16:49.
35. Iavarone C., A. Catania, M.J. Marinissen, R.
Visconti, M. Acunzo, C. Tarantino, M.S.
Carlomagno, C.B. Bruni, J.S. Gutkind and M.
Chiariello. 2003. The platelet-derived growth
factor controls c-myc expression through a JNK-
and AP-1 dependent signaling pathway. J. Biol.
79
Chem. 278:50024.
36. Uramoto H., A. Hackzell, D. Wetterskog, A.
Ballagi, H. Izumi and K. Funa. 2004. PRb, Myc
and p53 are critically involved in SV40 large T
antigen repression of PDGF beta-receptor
transcription. J. Cell. Sci. 117:3855.
37. Hackzell A., H. Uramoto, H. Izumi, K. Kohno and
K. Funa. 2002. P73 independent of c-Myc represses
transcription of platelet-derived growth factor beta-
receptor through interaction with NF-Y. J. Biol.
Chem. 277:39769.
38. Aref S., M. Mabed, K. Zalata, M. Sakrana and H.
El Askalany. 2004. The interplay between c-myc
oncogene expression and circulating vascular
endothelial growth factor (sVEGF), its antagonist
receptor, soluble Flt-1 in diffuse large B cell
lymphoma (DLBCL): relationship to patient
outcome. Leuk. Lymphoma 45:499.
39. Molostvov G., A. Morris, P. Rose, S. Basu and G.
Muller. 2004. The effects of selective cytokine
inhibitory drugs (CC-10004 and CC-1088) on VEGF
and IL-6 expression and apoptosis in myeloma and
endothelial cell cocultures. Br. J. Haematol. 124:366.
40. Uneda S., H. Hata, F. Matsuno, N. Harada, Y.
Mitsuya, F. Kawano and H. Mitsuya. 2003.
Macrophage inflammatory protein-1 alpha is
produced by human multiple myeloma (MM) cells
and its expression correlate with bone lesions in
patients with MM. Br. J .Haematol. 120:53.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 81-96 (2006)

THE EXPRESSION OF CD154 BY KAPOSI’S SARCOMA CELLS MEDIATES THE

ANTI-APOPTOTIC AND MIGRATORY EFFECTS OF HIV-1-TAT PROTEIN
V. CANTALUPPI, M.C. DEREGIBUS, L. BIANCONE, I. DEAMBROSIS, B. BUSSOLATI, A.
ALBINI1 and G. CAMUSSI

Renal and Vascular Immunopathology Laboratory, Research Center for Experimental Medicine
(CeRMS), Department of Internal Medicine, University of Torino, Italy; 1Molecular Oncology
Laboratory, National Institute for Cancer Research, Genova, Italy

Received April 8, 2005 – Accepted October 7, 2005

Kaposi’s sarcoma (KS) is a malignancy associated to conditions of immune system impairment such
as HIV-1 infection and post-transplantation therapy. Here we report that HIV-1-Tat protein, at
concentrations well below those detected in AIDS patients, up-regulates the expression of both CD40
and CD154 on KS cells. This occurred also in the presence of vincristine, that at doses shown to induce
apoptosis decreased the expression of both CD40 and CD154 on KS cells. The treatment with a soluble
CD40-muIg fusion protein (CD40 fp) that prevents the binding of CD154 with cell surface CD40, as
well as the transfection with a vector for soluble CD40 (KS sCD40), decreased the anti-apoptotic effect
of Tat. Moreover, Tat-induced motility of KS cells was inhibited by soluble CD40 fp. Tat also enhanced
the expression of intracellular proteins known to transduce signals triggered by CD40 engagement, in
particular TRAF-3. Tat as well as soluble CD154 (sCD154) prevented vincristine–induced reduction of
TRAF-3 in KS cells transfected with a vector for neomycin resistance (KS psv-neo), but not in KS
sCD40. Immunoprecipitation studies showed that Tat induced CD40 / TRAF-3 association and that this
binding was abrogated upon the incubation with the soluble CD40 fp. These data suggest that Tat
activates the CD40-CD154 pathway by enhancing the membrane expression of CD40 and in particular
of CD154, and by activating the TRAF-3-dependent signaling pathway of CD40. These findings
indicate that the CD40-CD154 pathway mediates the anti-apoptotic and migratory effects of HIV-1-
Tat, suggesting the potential therapeutic benefits of blocking CD40 activation in HIV-1-associated KS.

Kaposi’s sarcoma (KS) is an angioproliferative helper-1 cytokine microenvironment allows HHV-8

disorder often associated with conditions of immune
system impairment such as HIV-1 infection or post-
transplantation therapy (1-4). A human herpesvirus
known as HHV-8 or KSHV that is detected in all
forms of KS appears to play a pivotal role in KS
pathogenesis (5-6). It has been suggested that an
immune response dysregulation, together with a T
reactivation, dissemination and cellular infection
along with endothelial activation and inflammatory
cells extravasation that contribute to the formation
of spindle-shaped cells and of areas of intense
angiogenesis (7-8). KS tumorigenesis is a multi-step
process characterized by changes of expression of
several oncogenes and oncosuppressor genes

Key words: AIDS, Kaposi’s sarcoma, CD40, apoptosis

Mailing address:
Dr. G. Camussi, - Cattedra di Nefrologia,
Dipartimento di Medicina Interna,
Ospedale Maggiore S. Giovanni Battista,
Corso Dogliotti 14, 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
10126, Torino, Italy This publication and/or article is for individual use only and may not be further
Tel: +39-011-6336708, - Fax: +39-011-6631184. reproduced without written permission from the copyright holder.
E-mail: giovanni.camussi@unito.it 81 Unauthorized reproduction may results in financial and other penalties
82 V. CANTALUPPI ET AL.
throughout the activation of both extracellular and
intracellular signaling pathways that finally lead to
the transformation of the early inflammatory lesions
in a true sarcoma. Indeed, in AIDS-associated KS, a
particularly aggressive form of this neoplasm, some
HIV-1 products such as Tat seem to cooperate with
HHV-8 factors and inflammatory cytokines to
induce tumorigenesis and resistance to
chemotherapeutic drugs (9).
Several studies suggest a primary role for the
protein encoded by the Tat gene of HIV-1 in the
induction and in the development of KS in patients
affected by AIDS (10). HIV-1-Tat gene transgenic
mice have been shown to develop Kaposi’s sarcoma-
like skin lesions (11-13). Furthermore, Tat has been
shown to activate the vascular endothelial growth
factor (VEGF) receptor 2/ KDR (VEGFR2) (14-15)
and to exhibit potent angiogenic properties. Tat,
VEGF and basic Fibroblast Growth Factor (bFGF)
were shown to synergize in the induction of KS (16).
KS tumorigenesis has been ascribed not only to
the dysregulation of cellular proliferation, but also to
the resistance against apoptotic signals derived from
the activation of endogenous or exogenous
execution death programs. Recently, we found that
Tat is a survival factor for KS and endothelial cells
and induces transcription of several genes that
modulate apoptosis (9). Since we previously found
that CD40 engagement stimulates survival, invasion
and vascularization of KS (17), we evaluated
whether HIV-1-Tat stimulation may interfere with
CD40-mediated signaling.
CD40 is a 50-kDa transmembrane glycoprotein of
the TNF-superfamily expressed in a multitude of
different cell types, including B cells, monocytes,
dendritic, endothelial and KS cells (18-21). CD154,
the ligand of CD40, is a type II integral membrane
protein related to Tumor Necrosis Factor (TNF) and
Fas-Ligand (Fas-L) (22). CD40 engagement by
CD154 conveys signals regulating diverse cellular
responses, ranging from proliferation and
differentiation to growth suppression and apoptosis
(23-25). The CD40 cytoplasmic C terminus lacks
intrinsic kinase activity and adapter proteins of the
TNF-receptor-associated factor (TRAF) family appear
to mediate the activation of CD40 signaling cascade
(26-28). Despite its potential importance, the
functional role of CD40 in cancer development is
still controversial regarding its effects on tumor cell
survival and apoptosis. CD40-mediated signaling has
been reported to induce cell death and apoptosis when
expressed in certain transformed cells of mesenchymal
origin as well as in carcinomas of the breast (29) and
of the lung (30). In contrast, it has been demonstrated
that CD154 is an important anti-apoptotic molecule in
Hodgkin disease Reed-Stenberg cells through the up-
regulation of Bcl-XL (31). Moreover, Jakobson et al.
demonstrated that CD40 stimulation inhibited Fas-
mediated apoptosis in human bladder carcinoma cells
(32) and we have recently shown a similar protective
effect of CD40 in KS cells (17) and in renal
carcinomas (33). In addiction, CD40-dependent
signaling appears to be involved in melanoma cells
proliferation, suggesting an important role of this
pathway in tumor progression (34).
The aim of this study was to investigate whether
HIV-1-Tat modulates the expression of CD40 and
CD154 by KS cells and whether the activation of the
CD40-CD154 pathway may contribute to the anti-
apoptotic effect of HIV-1-Tat on KS cells.
MATERIALS AND METHODS
Reagents
Purified HIV-1-Tat was purchased from Intracell
(London, UK). Vincristine was obtained from Sigma (St.
Louis, MO) and anti-TRAF-1-2-3 mouse monoclonal
antibodies from Santa Cruz Biotechnology (Santa Cruz,
CA). Anti CD40 FITC-conjugated and anti CD154 FITC-
conjugated antibodies were purchased from Euroclone
(Celbio srl, Milan, Italy). Soluble CD154 (sCD154) and
its enhancer (cross-linking antibodies) were obtained
from Alexis Corporation (Nottingham, UK). Purified
CD40 mu-Ig fusion protein (CD40-fp) was obtained from
Ancell (Bayport, MN).
KS cell lines and transfectants
KS tr primary culture obtained by a cutaneous biopsy
of a kidney graft recipient and a previously characterized
(35-36) spontaneously immortalized KS cell line (KS
imm) were cultured with RPMI 1640 (GIBCO, Grand
Island, NY) containing 10% FBS (Hyclone, Logan, Utah)
and 2mM glutamine (GIBCO BRL, Gaithersburg, MD).
KS imm cells were transfected with the psv-2 vector
(Invitrogen, San Diego, CA) containing the neomycin
resistance gene (KS psv-neo) or with psv vector and
cDM8 expressing a soluble form of CD40 (sCD40)-Ig
fusion protein (KS-sCD40) and propagated as previously
 Int. J. Immunopathol. Pharmacol.
described (17). Transfectants were generated by
electroporation (Gene Pulser, Bio-Rad Laboratories,
Richmond, CA) at 250 V and 960 µF in 4-mm
electroporation cuvettes. Selection of KS clones was
made by introduction of 1 mg/ml G418 (Boehringer-
Mannheim, Indianapolis, IN) in normal culture medium.
Transfectants were then tested for soluble fusion protein
expression as previously described (17).
Characterization of KS tr and KS imm cell lines
For phenotypic characterization, KS imm and KS tr
cells were detached from tissue culture plates with EDTA,
washed twice with PBS and stained for 1 hour at 4° C
with different monoclonal antibodies directed to
vimentin, CD145 (P1H12 antibody), von Willebrand
factor (vWF), myeloperoxidase, SMC alpha-actin,
VEGFR2 and CD40. Cells were washed twice with PBS
and counterstained with an appropriate FITC-conjugated
secondary antibody for 30-45 minutes. All incubation
periods were performed using a medium containing
0.25% BSA and 0.016 % sodium azide. At the end of
staining, cells were newly washed three times with PBS,
fixed in 1% paraformaldehyde and subjected to FACS
analysis (Becton Dickinson, Mountain View, CA) or
analyzed under a UV microscope.
Gene array technology
Nonrad GEArray kits were used to detect on KS cells
the differential expression of multiple genes involved in a
specific signal transduction pathway through
chemiluminescent analysis of biotinylated cDNA. In
particular we compared the expression of genes related to
the TNF superfamily and to intracellular signaling on
untreated or treated with 10 ng/ml Tat KS cells through
side-by-side hybridization according to the
manufacturer’s instructions. The kit included duplicate
spots of 23 genes and two housekeeping genes (actin and
GAPDH). Briefly, KS cells were grown on tissue culture
flasks without FBS for 12 hours and incubated with
vehicle alone or with 10 ng/ml Tat for 12 hours. Cells
were then collected and total RNA extracted by the
guanidium thyocyanate phenol-clorophorm method,
precipitated with isopropanol and resuspended in sterile
RNase free water. For probe synthesis, 5 µg of RNA were
pre-warmed at 70°C for 2 minutes and subsequently
incubated at 42°C for 2 hours in a reaction mix containing
50 units/µl MMLV Reverse Transcriptase (Promega,
Madison, WI), 1 mM biotin-16-dUTP (Roche, Germany)
and 8U of RNase inhibitor (Promega) to obtain specific
complementary DNA (cDNA). At the same time, after an
extensive wash in deionised water, membranes were
subjected to prehybridization at 68° C for 1-2 hours of
continuous agitation at 5-10 rpm/minute with a specific
83
solution containing 100 µg/ml of salmon sperm DNA
(Amersham, Buckinghamshire, U.K) previously heat-
denatured at 100 °C and quickly chilled on ice to block non-
specific hybridization. After discarding the prehybridization
solution the denatured cDNA probe (100 µl) was mixed
with a specific pre-warmed hybridization solution
overnight, followed by washing with 2x SSC/ 1% SDS and
then with 0.1 % SSC/ 1% SDS solutions for 30 minutes with
agitation at 30-40 rpm/minute. Membranes were then
washed in blocking solution, incubated with alkaline
phosphatase-conjugated streptavidin 1:5000, washed again
and incubated with CDP-Star chemiluminescent substrate
for 2 minutes with gentle shaking and exposed to X-ray
film. Each membrane was spotted with a negative control of
pUC18 DNA as well as two positive control genes beta-
actin and GADPH. The G axis served as an internal
hybridization control.
Western blot and Immunoprecipitation analysis
For Western blot analysis of the expression of CD40,
CD154, TRAF-1, TRAF -2, TRAF-3 and Bcl-XL by KS
cells in culture either unstimulated or stimulated with 10
ng /ml Tat, cells were detached with EDTA and lysed for
1 hour at 4° C with a 50 mM Tris-HCl lysis buffer
containing 1% Triton-X-100, 10 µM/ml leupeptin, 10 µM
phenylmethylsulfonyl fluoride (PMSF) and 100 U/ml
aprotinin. Immunoprecipitation with anti-CD40 goat
polyclonal IgG cross-linked to Sepharose-Protein A was
also performed. After centrifugation of cell lysates at
15000 x g, protein contents of the supernatants and of the
immunoprecipitates were measured by the Bradford
method: 30 µg of protein per lane were then subjected to
sodium dodecyl sulfate (SDS)-10 % polyacrylamide gel
electrophoresis (PAGE) and electroblotted onto
nitrocellulose membrane filters. The blots were
subsequently blocked with 5 % nonfat milk in 20 mM
Tris-HCl (pH 7.5), 500 mM NaCl, plus 0.1 % Tween. The
membranes were then incubated overnight at 4° C with
specific antibodies at a concentration of 0.5 µg/ml. After
extensive washing with 0.1 % Tween, the blots were
stained for 1 hour at room temperature with peroxidase-
conjugated protein A (200 ng/ml, Amersham,
Buckingamshire, U.K.), washed again with 0.1 % Tween,
developed with ECL detection reagents (Amersham
Buckingamshire, U.K) for 1 minute and exposed to X-
Omat film (Eastman Kodak, Rochester, NY).
FACS analysis of CD40 and CD154 modulation on
KS cells
The modulation of the expression of CD40 and
CD154 by KS cells was evaluated by FACS. Briefly, after
appropriate stimulations, KS cells were detached from
tissue culture plates with EDTA, washed twice with PBS
84 V. CANTALUPPI ET AL.
and stained for 45 minutes at 4° C with 10 µg/ml of anti-
human CD40 FITC-conjugated or anti-human CD154
FITC-conjugated antibodies. All incubation periods were
performed using a medium containing 0.25% BSA and
0.016 % sodium azide. At the end of staining the cells
were newly washed three times with PBS, fixed in 1%
paraformaldehyde and subjected to FACS analysis
(Becton Dickinson, Mountain View, CA). FITC-
conjugated IgG were used as negative control.
Determination of cell viability and detection of
apoptosis in KS cells and transfectants
a) XTT assay
Mitochondrial dehydrogenases of viable cells cleave
the tetrazolium ring of the sodium salt of XTT (2,3-bis-(2-
methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-
carboxanilide), (Sigma) generating orange crystals
soluble in water (37). KS tr and KS imm cells were
cultured in 24-well flat-bottomed microtiter plates
(Falcon Labware, Oxnard, CA) at a concentration of 5 x
104 cells/well for 24 hours, washed twice with PBS and
incubated at 37°C with appropriate agonists and 250
µg/ml XTT in a medium without phenol red. All the
experiments were performed in triplicate. After 12-24
hours of incubation, the absorption values at 450 nm were
measured in an automated enzyme-linked immunosorbent
assay (ELISA).
b) TUNEL assay
KS imm and KS tr cells were subjected to TUNEL
assay (terminal deoxynucleotidyltransferase (TdT)-
mediated dUTP nick end labeling) (ApopTag, Oncor,
Gaithersburg, MD) as follows: the cells were plated on
tissue culture flasks with different agonists, washed in
PBS, fixed in 1 % paraformaldehyde in PBS, pH 7.4 for
15 minutes at 4° C, and post-fixed in pre-cooled ethanol-
acetic acid 2:1 for 5 minutes at –20°C. The fixed cells
were incubated with TdT enzyme in a humidified
chamber at 37° C for 1 hour, washed twice with PBS, and
counterstained with warmed anti-digoxigenin-FITC
antibody and with propidium iodide (1 µg/ml) dissolved
in PBS. At the end of treatment, the samples were
analyzed under a UV light microscope with an
appropriate mounting medium. Green-stained apoptotic
cells were counted in different microscopic fields (38).
c) Propidium iodide nuclear staining
Fluorescence microscopy evaluation after propidium
iodide staining was used to identify changes in the DNA
fragmentation of apoptotic KS tr and KS imm cells. The
cells were plated on tissue culture dishes, washed in PBS,
incubated overnight with specific stimuli and cytospinned
at 1500 rpm at room temperature for 5 minutes after
extensive washing with PBS. Cells were then fixed with 3
% paraformaldehyde in PBS and stained for 20 minutes at
room temperature with a solution containing 50 µg/ml
propidium iodide (Sigma), 0.1 % sodium citrate (Sigma),
0.1 % Triton-X-100 (Sigma) and 20 µg/ml DNase-free
RNA (Sigma) diluted in sterile water. The samples were
examined with a UV fluorescence-equipped microscope
counting nuclei with chromatin fragmentation.
d) DNA laddering analysis
A quick apoptotic DNA Ladder kit (BioVision
Research Products, Mountain View, CA) was used to
identify intranucleosomal DNA fragmentation, a typical
feature of apoptotic cells. Briefly, KS imm cells were
cultured in tissue culture flasks, grown without FBS for
12 hours and incubated with different stimuli. The cells
were detached, washed once with PBS, centrifuged and
resuspended in Tris-EDTA lysis buffer. After 2 different
enzymatic procedures, 5µl of ammonium acetate solution
and 100 µl of absolute ethanol were added to each sample
which was then centrifuged for 10 minutes to precipitate
DNA. Samples were then washed with 70% ethanol,
centrifuged, air-dried after removal of supernatants,
resuspended in a specific buffer and loaded onto a 1%
agarose gel containing 0.5 µg/ml ethidium bromide. The
gel was run at 5V/cm for 1 hour. Trans-illumination with
UV light showed ethidium bromide-stained DNA.
Caspase 3-8-9 activities detection
The activation of caspase 3-8 and 9 was assessed by a
colorimetric assay (Chemicon International, Temecula,
CA) based on spectrophotometric detection of the
cromophore p-nitroanilide (pNA) after cleavage from the
labeled substrate DEVD-pNA which is recognized by
caspases (39). Lysates of KS imm cells were diluted with
the appropriate reaction buffer and DEVD-pNA was
added at a final concentration of 50 mM. The samples
were incubated for 1 hour at 37° C and analyzed in an
automated ELISA reader at a wave length of 405 nm.
Each experiment was done in triplicate.
Cell motility assay
KS imm cells and KS transfectants were plated on
tissue culture flasks and incubated for 12 hours without
FBS, then washed twice with PBS and stimulated
overnight with RPMI containing different agonists. Cell
motility was observed over an 8 hour incubation period
under a Nikon Diaphot inverted microscope with a 10x
phase-contrast objective in an attached, hermetically
sealed Plexiglas Nikon Np-2 incubator at 37°C. The
migration of KS imm cells and transfectants was analyzed
after recording on a JVC-ICCD video camera with digital
recording of images at 30 minute intervals using the
 Int. J. Immunopathol. Pharmacol. 85

Micro-Image analysis system (Casti Imaging srl, Venezia, KS imm KS tr

Italy) and an IBM compatible system equipped with a Vimentin +++ +++
video card (Targa Vision 2000, Santa Clara, CA). Cellular P1H12 ++ ++
migration was evaluated by the Micro-Image software by vWF _ _
marking the position of the nucleus of more than 50 cells
Myeloperoxidase + +/_
per microscope field for each experimental condition.
SMC alpha-actin ++ +
Average speed expressed in micrometers/hour was
VEGFR-2 + +
calculated as the ratio of straight-line distance between
the starting and the end point of observation divided by CD40 + +

the time of observation. Table I. Phenotypic characterization of KS imm and KS tr

RESULTS
Cells derived by KS lesions often reveal a peculiar
antigenic profile characterized by the expression of
endothelial, macrophage and mesenchymal markers
(9, 35, 36). As reported in Table I, KS tr and KS imm
share the expression of myeloperoxidase (a
macrophage marker) and the typical strong positive
vimentin staining (a mesenchymal marker) such as
other KS lines already characterized (9). In addition,
KS tr and KS imm expressed the endothelial marker
CD145 detected by the anti-P1H12 monoclonal
antibody, but not vWF.
We previously demonstrated that CD40 supports
cells in normal culture conditions detected by
immunofluorescence or FACS studies. The expression of the
different antigens was classed as absent (-), scarce (+/ -),
mild (+), moderate (+ +) or strong (+ + +) staining. Both
KS cell lines showed the typical strong staining for vimentin
(mesenchymal marker), a scarce or mild expression of
myeloperoxidase (macrophage marker) and a moderate
positivity for CD145 after the staining with anti-P1H12
monoclonal antibody (endothelial marker), despite the
absence of von Willebrand Factor (vWF). Both cell lines
express CD40 antigen.
the survival, growth and neo-vascularization of KS
(17). As shown by Western blot (Fig. 1A and B) and
FACS analysis (Fig.1C), KS imm, after overnight

GenBank Protein/gene Hybridization Hybridization

no name intensity intensity
Table II. Analysis by
Vehicle alone Tat (10 ng/ml)
gene array technology of
NM001250 CD40 67 116 different genes expressed
LO7414 CD154 58 123 by KS cells cultured with
U66789 Bad 35 31 vehicle alone or with 10
ng/ml HIV-1-Tat protein.
M14745 Bcl-2 76 79
The stimulation with 10
Z23115 Bcl-XL 72 109 ng/ml HIV-1-Tat induced
AF042083 Bid 99 96 an increase of gene
X63717 Fas (CD95) 63 66 expression in particular
U59863 TRAF family 52 94
of CD40, CD154, Bcl-XL
and TRAF-3 (see Results
member-
section). No significant
associated nf- differences in house-keeping
kb activator genes (GAPDH, β-actin)
NM 005658 TRAF-1 56 111 were noted. Intensity of
pUC18 (negative control)
U12597 TRAF-2 61 96
resulted undetectable. Data
NM 003300 TRAF-3 58 132 are expressed as average
X00351 _-actin
beta-actin 98 96 of hybridization intensity
M33197 GAPDH 112 115 comparing unstimulated
pUC18 0 0
versus 10 ng/ml HIV-1-Tat
stimulated KS imm cells
86 V. CANTALUPPI ET AL.

Fig. 1. Panel A: representative Western blot analysis of CD154 and CD40 expression by KS imm cells. Lanes 1: vehicle
alone. Lanes 2: incubation with 250 ng/ml vincristine for 12 hours. Lanes 3: incubation with the same amount of
vincristine plus 10 ng/ml Tat for 12 hours. Lanes 4: incubation with vehicle plus 10 ng/ml Tat for 12 hours. Beta-actin
expression, used as control for the equal amount of protein loading, was comparable in all different experimental
conditions (data not shown). Panel B: relative percentage of variation in respect to unstimulated control (Lanes 1) of
the average densitometric intensity of CD154 (black) and CD40 (gray) in the experimental conditions indicated above.
Three different experiments were performed with similar results. ANOVA with Newmann-Keuls’ multicomparison test
was performed: *=p<0.05 vincristine or vehicle + Tat vs vehicle alone; #=p<0.05 vincristine + Tat vs vincristine.
Panel C: representative FACS analysis of CD154 and CD40 expression by KS imm cells. Staining with anti-CD154 and
anti-CD40 monoclonal antibodies (solid curves) showed a positive pattern in respect to a control antibody (open
curves). Incubation with 10 ng/ml of Tat for 12 hours resulted in an increase of surface expression of both CD154 and
CD40 (open curves). Three experiments were performed with similar results. In each experiment the Kolmogorov-
Smirnov statistic analysis was significant (p < 0.001).
 Int. J. Immunopathol. Pharmacol. 87

Fig. 2. Panels A and B: effect of HIV-1-Tat and sCD154 on cell viability determined by the XTT-based assay of KS imm
(A) and KS tr (B). O.D. variation showed a slight proliferative effect of Tat in comparison to baseline conditions, a
reduction of about 60-70 % of cellular viability after the incubation with 250 ng/ml vincristine for 12 hours and a marked
restoration of cell viability both by 10 ng/ml Tat and 100 ng/ml sCD154 (plus 1000 ng/ml enhancer) stimulation. Cellular
viability was not enhanced by the co-incubation with Tat and sCD154 in respect to the data obtained with the individual
stimulation. By contrast, pre-incubation with 20 ng/ml of CD40 fp abrogated the protective effect of Tat on cell viability.
Results were similar for both KS cell types. Data are expressed as mean + SD of three different experiments. Panels C
and D: effect of HIV-1-Tat and sCD154 on apoptosis induced by 250 ng/ml vincristine incubation for 12 hours of KS
imm (C) and KS tr (D) evaluated by TUNEL assay. Vincristine induced a strong apoptotic effect on both KS cell types:
Tat (10 ng/ml) as well as 100 ng/ml of sCD154 (plus 1000 ng/ml enhancer) inhibited apoptosis induced by vincristine.
The addition of 20 ng/ml of CD40 fp abrogated the anti-apoptotic effect of Tat. Resistance to apoptosis was not enhanced
by the co-incubation with Tat and sCD154 in respect to individual stimulation. Results were similar for both KS imm and
KS tr cells. Data are expressed as percentage of apoptotic cells (mean + SD of three different experiments). ANOVA with
Newmann-Keuls’ multicomparison test was performed: *=p<0.05 Vincristine vs vehicle alone; #=p<0.05 Vincristine +
Tat or Vincristine + sCD154 vs Vincristine; §=p<0.05 Vincristine + Tat + CD40 fp vs Vincristine + Tat.

deprivation of FBS, exhibited a slight expression of (250 ng/ml) previously shown to induce apoptosis of
CD154 on their surface, whereas CD40 was well- KS imm cells (9), decreased the expression of both
represented. The treatment with vincristine at a dose CD40 and CD154 in respect to untreated cells (Fig.
88 V. CANTALUPPI ET AL.

1A and B). Treatment with 10 ng/ml Tat enhanced
the gene (Table II) and protein expression (Fig. 1A
and B) of CD40 and in particular of CD154. This
effect also occurred in the presence of vincristine
A
B The co-stimulation with Tat and sCD154 did not
C resistance to apoptosis was confirmed by the results
(Fig. 1A and B). Similar results were obtained on KS
tr (data not shown). These observations prompted us
to investigate whether the anti-apoptotic effect of Tat
might be mediated by the CD40-CD154 pathway.
Both Tat and sCD154 protected KS imm and KS tr
cells from apoptosis induced by vincristine as
detected by the XTT-based cell viability assay (Fig.
2A and B), Tunel assay (Fig. 2C and D) and DNA
laddering (Fig. 3A). The treatment with CD40 fp,
which interferes with the CD40-CD154 pathway by
preventing the binding of CD154 to cell surface
CD40, diminished the anti-apoptotic effect of Tat.
induce a significant increase in the resistance to
apoptosis in either of the KS cell lines. These results
were confirmed by fluorescence microscopy
analysis after propidium iodide staining of KS imm
and KS tr, a technique that identifies the presence of
“apoptotic bodies”, index of chromatin
fragmentation (data not shown). We found that the
anti-apoptotic effect of Tat was dose dependent in
the range of 0.1-10 ng/ml and reached a plateau in
the range of 10-100 ng/ml (data not shown).
The role of CD40 stimulation in Tat-induced
obtained by measuring the activity of caspase-3, 8
and 9 on KS imm cells (Fig. 3B). Tat and sCD154
prevented the increase of all caspases activity,
whereas the CD40 fp abrogated this effect. Further
evidence for a role of CD40 engagement in the anti-
apoptotic effect of Tat was obtained by generating a
KS transfectant (KS sCD40) that releases soluble

Fig. 3. Panel A: detection of DNA fragmentation, indicator of cellular apoptosis, after DNA extraction and electrophoresis on
2 % agarose gel (see Experimental Procedures). Lane 1: KS imm cells incubated with vehicle alone; Lane 2: DNA fragmentation
after incubation with 250 ng/ml vincristine; Lane 3: Vincristine-treated KS imm cells in the presence of 10 ng/ml Tat; Lane 4:
Vincristine-treated KS imm cells in the presence of 100 ng/ml of sCD154 (plus 1000 ng/ml enhancer); Lane 5: re-establishment
of DNA fragmentation with the addition of 20 ng/ml of CD40 fp to 10 ng/ml Tat and 250 ng/ml vincristine. The micrograph is
representative of three experiments performed with similar results. Panel B: ELISA test of caspase-3, 8 and 9 activities evaluated
on lysates of KS imm cells incubated with different stimuli. Treatment with 250 ng/ml vincristine induced a marked increase in
the activity of caspase-3, 8 and 9. Tat (10 ng/ml) and sCD154 (100 ng/ml plus 1000 ng/ml enhancer) induced a 2-fold decrease
of caspase-3, 8 and 9 activity. The inhibitory effect of Tat was abrogated by treatment with 20 ng/ml of CD40 fp. Data are
expressed as mean + SD of O.D. variation in three different experiments. ANOVA with Newmann-Keuls’ multicomparison test
was performed: *=p<0.05 Vincristine vs vehicle alone; #=p<0.05 Vincristine + Tat or Vincristine + sCD154 vs Vincristine.
Panel C: apoptosis of KS transfectants detected by TUNEL assay. Incubation with 250 ng/ml vincristine induced apoptosis of
more than 50 % of both KS psv-neo and KS sCD40 cells in culture. The addition of Tat (10 ng/ml) prevented apoptosis induced
by vincristine in KS psv-neo, but with a less marked effect in KS sCD40. Data are expressed as mean ± SD of percentage of
apoptotic cells in three different experiments. ANOVA with Newmann-Keuls’ multicomparison test was performed: *=p<0.05
Vincristine vs vehicle alone; #=p<0.05 Vincristine + Tat vs Vincristine.
 Int. J. Immunopathol. Pharmacol.
89

Fig. 4. Micrograph representative of time-lapse analysis of KS imm cells motility. Motility was performed by digital
saving at 30 minute intervals. Migration tracks (magnification x 120) were generated by marking the position of the
nucleus of individual cells in each image (see Materials and Methods). KS imm cells were stimulated for 8 hours at 37°
C with vehicle alone (A), with 10 ng/ml Tat (B), with 100 ng/ml sCD154 plus 1000 ng/ml enhancer (C), or with 10 ng/ml
Tat plus 20 ng/ml CD40 fp. Both Tat and sCD154 induced a marked increase in cellular migration. This effect was
abrogated with the addition in culture medium of 20 ng/ml CD40 fp.

CD40 into the cell microenvironment, an approach
that was previously shown to inhibit the signaling of
CD154 by interfering with its interaction with
membrane-expressed CD40 (17). In KS sCD40 cells
the protective effect of Tat on apoptosis induced by
vincristine was consistently decreased (Fig. 3C). In
contrast, the action of Tat was maintained on control
transfectant (KS psv-neo). Both KS transfectants
(KS psv-neo and KS sCD40) showed similar growth
under normal culture conditions (data not shown).
We also evaluated whether the activation of
CD40 contributed to Tat-induced motility of KS
cells, an indicator of tumor invasiveness. The
baseline migration rate, corresponding to the
spontaneous motility of unstimulated resting KS
imm cells was first measured and found to remain
constant for the whole period of observation, never
exceeding 2.8 micrometers/hour in an 8-hour
observation period. Stimulation with Tat or sCD154
induced a marked acceleration of cellular migration
peaking at 1-2 hours and remaining significantly
higher compared to unstimulated KS cells
throughout the whole period of observation. Pre-
incubation with CD40 fp inhibited the migration of
KS imm induced by Tat (Fig. 4 and 5A). Similar
inhibition was observed in KS sCD40 transfectant
but not in KS psv-neo transfectant stimulated with
Tat (Fig. 5B).
Taken together, these results indicate that Tat
activates the CD40-CD154 pathway by enhancing
the membrane expression of CD40 and in particular
of CD154. Furthermore, both Tat and sCD154 were
90 V. CANTALUPPI ET AL.
Fig. 5. Time-lapse analysis of motility of KS imm and
KS transfectants. Panel A: time course of KS imm cells
motility after treatment with vehicle alone, 10 ng/ml
Tat, 100 ng/ml sCD154 plus 1000 ng/ml enhancer and
10 ng/ml Tat plus 20 ng/ml CD40 fp for 8 hours at 37°
C (same experimental conditions reported in Figure 4).
ANOVA with Newmann-Keuls’ multicomparison test
was performed: #=p<0.05 Tat or CD154 vs vehicle
alone; *=p<0.05 Tat + CD40 fp vs Tat. Panel B:
evaluation of cellular motility of KS transfectants after
2 hours of stimulation with vehicle alone or 10 ng/ml
Tat. Tat exerted a marked increase of KS psv-neo
migration as reported for KS imm cells, in contrast to
KS sCD40 transfectant. Data of all experiments are
expressed as mean + SD of speed average
(micrometers/hour) of three different experiments.
ANOVA with Newmann-Keuls’ multicomparison test
was performed: #=p<0.05 Tat vs vehicle alone;
*=p<0.05 KS sCD40 vs KS psv-neo.
able to stimulate the same intracellular pathways
that lead to the resistance to apoptotic stimuli as
shown by Western blot analysis of Bcl-XL (Fig. 6).
Indeed, the expression of Bcl-XL was reduced by
vincristine and enhanced both by Tat and sCD154.
Tat and sCD154 also prevented the reduction of Bcl-
XL induced by vincristine. No variations in Bcl-2
expression were noted as Bcl-2 was found to be
already unregulated in resting KS cells.
Tat also increased the expression of intracellular
proteins that are known to transduce signals
triggered by CD40 engagement. As shown in Table
II, the treatment with Tat enhanced the expression of
genes coding for TRAF family members. By
Western blot analysis, we found that vincristine
reduced the expression of TRAF-3, whereas Tat, as
well as sCD154, prevented this reduction and
enhanced its expression (Fig. 7A). The effect on
TRAF-1 and TRAF-2 expression was present but
less marked. Moreover, in KS sCD40 cells Tat
stimulation of vincristine-treated cells did not induce
an increased expression of TRAF-3 whereas this
occurred normally in the KS psv-neo control
transfectant (Fig. 7B). Immunoprecipitation of
CD40 followed by Western blotting for TRAF-3
showed that stimulation with Tat and sCD154
induced the association of CD40 with TRAF-3 and
that this binding was abrogated after the incubation
with the CD40 fp (Fig. 7C).
DISCUSSION
Kaposi’s sarcoma (KS) tumorigenesis seems to
be related to a combination of several factors
including impairment of immune mechanisms,
HHV-8 infection, a cytokine-rich microenvironment
and some HIV-1 proteins such as Tat. These factors
lead to the phenotypic changes of endothelial cells
into spindle-shaped cells, formation of areas of
intense neoangiogenesis and tumor dissemination.
Although HHV-8 plays a key role in the first steps of
KS lesion formation with a probable “hit and run”
mechanism that induces a self-propagating alteration
of endothelial cells in a permissive cytokine
microenvironment (40-41), some other factors must
influence the clinical history of this neoplasm. In
particular, HIV-1-Tat has been shown to accelerate
the tumorigenesis induced by HHV-8, enhancing
cellular infection and gene activation (42).
Furthermore, tumor growth is related not only to
the dysregulation of cellular proliferation, but also to
the resistance to apoptotic signals. HHV-8 itself
encodes for anti-apoptotic genes such as v-FLIP
 Int. J. Immunopathol. Pharmacol.
Fig. 6. Representative Western blot analysis of Bcl-XL
expression on KS imm cells after incubation for 12 hours
at 37° C with different stimuli. Lane 1: vehicle alone; Lane
2: 250 ng/ml vincristine; Lane 3: 10 ng/ml Tat; Lane 4:
100 ng/ml sCD154 and 1000 ng/ml enhancer; Lane 5: 250
ng/ml vincristine plus 10 ng/ml Tat; Lane 6: 250 ng/ml
vincristine plus 100 ng/ml sCD154 and 1000 ng/ml
enhancer. Data are expressed as relative percentage of
variation in respect to unstimulated control (Lane 1) of the
average densitometric intensity of Bcl-XL in the
experimental conditions indicated above. Beta-actin
expression, used as control for the equal amount of protein
loading, was comparable in all different experimental
conditions (data not shown). Two experiments were
performed with similar results.
(43). Moreover, KS cells derived from AIDS
patients often show multiple resistances to drugs
commonly used in chemotherapy (44-45) and HIV-
1-Tat is probably one of the most important proteins
involved in the regulation of programmed death in
KS cells. In a previous study, we observed that Tat
exerts an anti-apoptotic effect on vincristine-treated
KS cells at concentrations well below those detected
in the circulation of AIDS patients (9). Tat may act
on different cellular lines with opposite effects.
Thus, it has been described that Tat induces
apoptosis of uninfected T-lymphocytes (46) whereas
it prevents cell death in HIV-1-infected T cells (47).
Furthermore, Tat is able to prevent apoptosis of
several tumor cell lines of lymphoid, epithelial and
neuronal origin (48). This protein may allow the
transcription of both pro- and anti-apoptotic genes
and the autocrine and paracrine production of
cytokines and growth factors that influence the
sensitivity to apoptosis. Tat is able to bind to and to
activate VEGFR2 expressed on endothelial and KS
cells (14). VEGFR2 binding by Tat directly activates
the PI3K/Akt survival pathway in KS cells (15).
91
Moreover, Tat induces the production of IGF-I and
IL-3 that, together with VEGF, may contribute to
sustain PI3K/Akt pathway activation and KS cells
survival (49). We have also confirmed that Tat
caused a marked increase in the expression of the
proto-oncogene Bcl-XL which probably induced a
decrease in caspase-3 activity (50).
In the present study we investigated whether the
anti-apoptotic effect of Tat was mediated by the
CD40-CD154 pathway on KS cells. Indeed, the
disruption of CD40-CD154 interaction in KS tumor
implanted in SCID mice has been shown to lead to the
formation of several areas of necrosis with a large
number of cells with apoptotic features and
disorganized vascularization. Moreover, CD40 was
found to stimulate neoangiogenesis and to protect KS
cells by vincristine-induced apoptosis in vitro (17). We
recently found that CD40-dependent activation of
PI3K/Akt pathway mediated endothelial cell survival
and in vitro angiogenesis (51).
In this study we showed that Tat increased the
gene and the cell surface expression of CD40 and in
particular of CD154. The enhanced expression of
CD40 and CD154 was associated with Tat-induced
resistance to apoptosis and with the concomitant
decrease of caspase-3, 8 and 9 activities. The
involvement of a homeotropic interaction between
CD40 and CD154 in Tat-induced resistance to
apoptosis is suggested by the inhibitory effect of
CD40 fp, a protein that interferes with the CD40-
CD154 pathway by preventing the binding of
CD154 to membrane CD40. Therefore, the
enhanced expression of CD40 and CD154 induced
by Tat may contribute to transduce its anti-apoptotic
effect on KS cells. Further evidence for a role of
CD40 engagement was obtained by using a KS imm
transfectant that releases soluble CD40 in the cell
microenvironment (KS sCD40) preventing the
binding of CD154 (17). In these cells the protective
effect of Tat on apoptosis was decreased. In our
previous studies, we demonstrated that CD40
stimulation induced KS cell motility (17). Here, we
observed that Tat-induced cell migration was
inhibited in KS cells pre-incubated with CD40 fp as
well as in the KS sCD40 transfectant. These results
indicate that the increased capacity of invasiveness
of KS cells after the stimulation with Tat is mediated
by the CD40-CD154 pathway.
92 V. CANTALUPPI ET AL.

Taken together, these results indicate that Tat

activates the CD40-CD154 pathway by enhancing
the membrane expression of CD40 and in particular
of CD154. Moreover, we observed that Tat also
enhanced the expression of intracellular proteins that
are known to transduce signals triggered by CD40
engagement. Tat induced an increased expression of
TRAF family proteins such as TRAF-1, TRAF-2
and in particular TRAF-3, one of the key factors in
the regulation of CD40 intracellular signaling (52).
The TRAF family is composed of six signal-
transducing adapter proteins that connect the cytosolic
domains of TNFR to downstream signalling pathways
regulating cellular homeostasis. It has been shown that
TRAFs may regulate apoptotic processes through
modulation of NF-kB and that the activation of this
factor induces the expression of anti-apoptotic proteins
of the Bcl-2 family (53). In recent years, the role of
TRAFs has been further elucidated, showing a normal
pattern of expression in vivo in lymphoid,
haematopoietic and other types of tissues also of tumor
origin (54-55). The up-regulation of TRAFs expression
is often associated with malignancies, producing
opportunities for modulating tumor cell growth and
sensitivity to apoptotic agents such as chemotherapy
drugs. In particular, TRAF-1 interacts with the latent
membrane protein 1 (LMP1), an EBV protein involved
in the immortalization of B cells and expressed in
Hodgkin lymphoma cells (56). TRAF-4 is expressed in

Fig. 7. Effect of Tat and sCD154 on TRAF expression. Panel A: densitometric analysis and representative Western blot
analysis of TRAF-1, 2 and 3 expression on KS imm cells after incubation for 12 hours at 37° C with different stimuli.
Lane 1: vehicle alone; Lane 2: 250 ng/ml vincristine; Lane 3: 250 ng/ml vincristine plus 10 ng/ml Tat; Lane 4: 250 ng/ml
vincristine plus 100 ng/ml sCD154 and 1000 ng/ml enhancer; Lane 5: 10 ng/ml Tat; Lane 6: 100 ng/ml sCD154 and
1000 ng/ml enhancer. Vincristine induced a reduction in particular of TRAF-3. Restoring of TRAF-3 expression after
incubation with 10 ng/ml Tat or sCD154 was observed. In lines 5 and 6 slight up-regulation of TRAF-3 after the addition
to normal culture medium of Tat and sCD154 was detected. Beta-actin expression used as control for equal amount of
protein loading was comparable in all different experimental conditions (data not shown).
Panel B: detection by Western blot analysis of TRAF-3 expression on KS transfectants in different experimental
conditions. Lanes: 1-3 KS psv-neo transfectant; Lanes: 4-6 KS sCD40 transfectant. In comparison to basal conditions
(lanes 1 and 4), vincristine reduced the expression of TRAF-3 (lanes 2 and 5), while Tat induced a marked increase of
this protein in KS psv-neo (lane 3) but not in KS sCD40 (lane 6) transfectant in vincristine-treated cells. Beta-actin
expression, used as control for the equal amount of protein loading, was comparable in all different experimental
conditions (data not shown).
Panel C: immunoprecipitation (IP) of CD40 followed by Western blotting for TRAF-3 on KS imm cells. Lane 1: vehicle
alone; Lane 2: 10 ng/ml Tat; Lane 3: 100 ng/ml sCD154 plus 1000 ng/ml enhancer; Lane 4: Tat plus 20 ng/ml CD40
fp; Lane 5: CD154 plus 20 ng/ml CD40 fp. The CD40 immunoprecipitates probed with antibodies to TRAF-3 showed a
positivity after stimulation with Tat and sCD154 in comparison to vehicle alone. This effect was abrogated by adding
CD40 fp. Three different experiments were performed with similar results.
 Int. J. Immunopathol. Pharmacol.
breast cancer (57) and TRAF-3 co-immunoprecipitates
with EBV-LMP1 protein, leading to a proliferative
effect on EBV-positive lymphoblastoid and
nasopharyngeal carcinoma cells (58).
We recently found that in endothelial cells the
activation of PI3K/Akt survival pathway was
dependent on the association of CD40 with TRAF6,
c-Cbl and the p85 subunit of PI3K (51). In the
present study, we demonstrated the up-regulation of
TRAF-3 with a concomitant recovering from
apoptosis of KS cells. Immunoprecipitation studies
showed the association of TRAF-3 with CD40 after
stimulation with Tat and sCD154. HIV-1-Tat acts as
an intracellular transcription factor and as an
extracellular cytokine that favours both the viral
spread and the pathogenesis of KS and other AIDS-
associated syndromes. Moreover, Tat can deregulate
the genes involved in cellular proliferation/apoptosis
pathways and can enhance the production of
cytokines such as TNF-alpha, diverse interleukins
and TGF-beta (59).
In conclusion, our results indicate that HIV-1-Tat
is also able to up-regulate the expression of CD40
and of CD154 on KS cells, and that the blockade of
CD40-CD154 interaction inhibits the anti-apoptotic
and pro-invasive effect of Tat. The co-stimulation
with Tat and sCD154 did not enhance the resistance
to apoptotic signaling and caspases activity,
suggesting an action on the same intracellular
pathways. Indeed, Tat was found to stimulate the
synthesis of TRAF-3, a protein involved in the
transduction of CD40-mediated signaling and to
induce CD40-TRAF-3 association.
These results suggest that strategies aimed to
interfere with the CD40-CD154 signaling pathway may
be beneficial to avoid KS growth and dissemination in
HIV-1-positive patients, offering a new potential
therapeutic tool to control the marked aggressiveness of
the AIDS-associated form of this neoplasm.
ACKNOWLEDGEMENTS
This work was supported by the Istituto
Superiore di Sanità (Targeted project AIDS, 40F.19),
by the Associazione Italiana per la Ricerca sul
Cancro (AIRC), by the National Research Council
(CNR), Targeted Project “Biotechnology”, by the
Italian Ministry of University and Research FIRB
93
Project (RBNE 01HRS5-001), COFIN04 and by
Oncology Project San Paolo and ricerca scientifica
applicata regione Piemonte. VC and MCD equally
contributed to this work.
REFERENCES
1. Gallo R.C. 1988. The enigma of Kaposi’s sarcoma.
Science 282:1837.
2. Mitsuyasu R.T. 2000. Update on the pathogenesis
and treatment of Kaposi’s sarcoma. Curr. Opin.
Oncol. 12:174.
3. Ensoli B., G. Barillari and R.C. Gallo. 1992.
Cytokines and growth factors in the pathogenesis of
AIDS-associated Kaposi’s sarcoma. Immunol. Rev.
127:147.
4. Ensoli B., G. Barillari, L. Buonaguro and R.C.
Gallo. 1991. Molecular mechanisms in the
pathogenesis of AIDS-associated Kaposi’s sarcoma.
Adv. Exp. Med. Biol. 303:27.
5. Chang Y., E. Ceserman, M.S. Pessin, F. Lee, J.
Culpepper, D.M. Knowles and P.S. Moore. 1994.
Identification of herpesvirus-like DNA sequences in
AIDS-associated Kaposi’s sarcoma. Science
266:1865.
6. Boshoff C. and R.A. Weiss. 1996. Kaposi’s sarcoma-
associated herpesvirus. Adv. Cancer Res. 75:57.
7. Flore O., S. Rafii, S. Ely, J.J. O’ Leary, E.M.
Hyjek and E. Ceserman. 1998. Transformation of
primary human endothelial cells by Kaposi’s
sarcoma-associated herpesvirus. Nature 394:588.
8. Moses A.V., N.K. Fish, R. Ruhl, P.P. Smith, J.G.
Strussenberg, L. Zhu, B. Chandran and J.A.
Nelson. 1999. Long-term infection and
transformation of dermal microvascular endothelial
cells by human herpesvirus-8. J. Virol. 73:6892.
9. Cantaluppi V., L. Biancone, M.R. Boccellino, S.
Doublier, R. Benelli, S. Carlone, A. Albini and G.
Camussi. 2001. HIV type 1 Tat protein is a survival
factor for Kaposi’s sarcoma and endothelial cells.
AIDS Res. Hum. Retrov. 17:965.
10. Albini A., R. Benelli, M. Presta, M. Rusnati, M.
Ziche, A. Rubarteli, G. Paglialunga, F. Bussolino
and D. Noonan. 1996. HIV-1-Tat protein is a heparin-
binding angiogenic growth factor. Oncogene 12:289.
11. Vogel J., S.H. Hinrichs, R.K. Reynolds, P.A.
94 V. CANTALUPPI ET AL.
Luciw and G. Jay. 1988. The HIV tat gene induces
dermal lesions resembling Kaposi’s sarcoma in
transgenic mice. Nature 335:606.
12. Corallini A., G. Altavilla, L. Pozzi, F. Bignozzi, M.
Negrini, P. Rimessi, F. Gualandi and G. Barbanti-
Brodano. 1993. Systemic expression of HIV-1 tat
gene in transgenic mice induces endothelial
proliferation and tumors of different histotypes.
Cancer Res. 53:5569.
13. Samaniego F., P.D. Markham, R. Gendelman,
R.C. Gallo and B. Ensoli. 1997. Inflammatory
cytokines induce endothelial cells to produce and
release basic fibroblast growth factor and to promote
Kaposi’s sarcoma-like lesions in nude mice. J.
Immunol. 158:1887.
14. Albini A., R. Soldi, D. Giunciuglio, E. Girando, R.
Benelli, L. Primo, D. Noonan, M. Salio, G.
Camussi, W. Buckl and F. Bussolino. 1996. The
angiogenesis induced by HIV-1-tat is mediated by
the Flk-1/KDR receptor on vascular endothelial
cells. Nat. Med. 2:1371.
15. Ganju R.K., N. Munsi, B.C. Nair, Z.Y. Liu, P. Gill
and J.E. Groopman. 1988. Human
immunodeficiency virus tat modulates the Flk-
1/KDR receptor, mitogen-activated protein kinases,
and components of focal adhesion in Kaposi’s
sarcoma cells. J. Virol. 72:6131.
16. Ensoli B., R. Gendelman and P. Markham. 1994.
Synergy between basic fibroblast growth factor and
HIV-1-tat protein in induction of Kaposi’s sarcoma.
Nature 371:674.
17. Biancone L., V. Cantaluppi, M.R. Boccellino, L.
Del Sorbo, S. Russo, A. Albini, I. Stamenkovic
and G. Camussi. 1999. Activation of CD40 favors
the growth and vascularization of Kaposi’s sarcoma.
J. Immunol. 163:6201.
18. Pammer J., A. Plettenberg, W. Weninger, B.
Diller, M. Mildner, A. Uthman, W. Issino, M.
Sturzl and E. Tschachler. 1996. CD40 antigen is
expressed by endothelial cells and tumor cells in
Kaposi’s sarcoma. Am. J. Pathol. 148:1387.
19. Thomas W.D., M.J. Smith, Z. Si and P. Hersey.
1996. Expression of the co-stimulatory molecule
CD40 on melanoma cells. Int. J. Cancer 68:795.
20. Cognasse F., P. Chavarin, S. Acquari, O. Sapido,
L. Beniguel, C. Genin, Y. Richard and O.
Garraud. 2005. Differential downstream effects of
CD40 ligation mediated by membrane or soluble
CD40L and agonistic Ab: a study on purified human
B cells. Int. J. Immunopathol. Pharmacol. 18:65.
21. Kaneider N.C., A. Kaser, H. Tilg, G. Ricevuti and
C.J. Wiedermann. 2003. CD40-ligand-dependent
maturation of human monocyte-derived dendritic
cells by activated platelets. Int. J. Immunopathol.
Pharmacol. 16:225.
22. Hollenbaugh D., L.S. Grosmaire, C.D. Kullas,
N.J. Chalupny, R. Braesch-Andersen, J. Noell, I.
Stamenkovic, A. Ledbetter and A. Aruffo. 1992.
The human T cell antigen gp39, a member of the
TNF gene family, is a ligand for the CD40 receptor:
expression of a soluble form of gp39 with B cell co-
stimulatory activity. EMBO J. 11:4313.
23. Hess S. and H. Engelman. 1996. A novel function
of CD40: induction of cell death in transformed
cells. J. Exp. Med. 183:159.
24. Biancone L., V. Cantaluppi and G. Camussi.
1999. CD40-CD154 interaction in experimental and
human disease. Int. J. Mol. Med. 3:343.
25. Stamenkovic I., F.A. Clark and A. Seed. 1989. B-
lymphocyte activation molecule related to the nerve
growth factor receptor and induced by cytokines in
carcinomas. EMBO J. 8:1403.
26. Bradley J.R. and J.S. Pober. 2001. Tumor necrosis
factor-associated factors (TRAFs). Oncogene 20:6482.
27. Wernenburg B.G., S.J. Zoog, T.T. Dang, M.R.
Kehry and J.J. Crute. 2001. Molecular
characterization of CD40 signaling intermediates. J.
Biol. Chem. 276:43334.
28. Chung J.Y., Y.C. Park, H. Ye and H. Wu. 2002.
All TRAFs are not created equal: common and
distinct molecular mechanisms of TRAF-mediated
signal transduction. J. Cell. Sci. 115:679.
29. Hirano A., D.L. Longo, D.D. Taub, D.K. Ferris,
L.S. Young, A.G. Eliopoulos, A. Agathaggelou, N.
Cullen, J. MaCartney, W.C. Fanslow and W.J.
Murphy. 1999. Inhibition of human breast
carcinoma growth by a soluble recombinant human
CD40 ligand. Blood 93:2999.
30. Yamada M., T. Shiroko, Y. Kawaguchi, Y.
Sugiyama, N.K. Egilmez, F.A. Chen and B.B.
 Int. J. Immunopathol. Pharmacol.
Bankert. 2001. CD40-CD40 ligand (CD154)
engagement is required but not sufficient for
modulating MHC class I, ICAM-1 and Fas
expression and proliferation of human non-small cell
lung tumors. Int. J. Cancer 92:589.
31. Metkar S.S., P.P. Manna, M. Anand, K.N. Naresh,
S.H. Advani and J.J. Nadkarni. 2001. CD40
ligand: an anti-apoptotic molecule in Hodgkin’s
disease. Cancer Biother. Radiopharm. 16:85.
32. Jakobson E., G. Jonsson, P. Bjorck and S. Paulie.
1998. Stimulation of CD40 in human bladder
carcinoma cells inhibits anti-Fas/APO-1 (CD95)-
induced apoptosis. Int. J. Cancer 77:849.
33. Bussolati B., S. Russo, I. Deambrosis, V.
Cantaluppi, A. Volpe, U. Ferrando and G.
Camussi. 2002. Expression of CD154 on renal cell
carcinomas and effect on cell proliferation, motility
and platelet-activating factor synthesis. Int. J.
Cancer 100:654.
34. Pirozzi G., V. Lombari, D. Zanzi, F. Ionna, M.L.
Lombardi, S. Errico, G. Ruggiero and C. Manzo.
2000. CD40 expressed on human melanoma cells
mediates T cell co-stimulation and tumor cell
growth. Int. Immunol. 12:787.
35. Benelli R., A. Albini, C. Parravicini, S. Carlone,
L. Repetto, G. Tambussi and A. Lazzarin. 1996.
Isolation of spindle-shaped cell populations from
primary cultures of Kaposi’s sarcoma of different
stage. Cancer Lett. 100:125.
36. Benelli R., L. Repetto, S. Carlone, C. Parravicini
and A. Albini. 1994. Establishment and
characterization of two new Kaposi’s sarcoma cell
cultures from an AIDS and a non-AIDS patients.
Res. Virol. 145:251.
37. Roehm N.W., G.H. Rodgers, S.M. Hatfield and
A.L. Glasebrook. 1991. An improved colorimetric
assay for cell proliferation and viability utilizing the
tetrazolium salt XTT. J. Immunol. Methods 142:257.
38. McGabon A.J., S.J. Martin and R.P. Bissonette.
1995. The end of the (cell) line: methods for the study
of apoptosis in vitro. Methods Cell. Biol. 46:153.
39. Tafani M., T.G. Schneider, J.G. Pastorino and
J.L. Farber. 2000. Cytochrome c-dependent
activation of caspase-3 by tumor necrosis factor
requires induction of the mitochondrial permeability
95
transition. Am. J. Pathol. 156:2111.
40. Yang T.Y., S.C. Chen, M.W. Leach, D. Manfra, B.
Homey, M. Wiekowski, L. Sullivan, C.H. Jenh,
S.K. Narula, A.W. Chensue and S.A. Lira. 2000.
Transgenic expression of the chemokine receptor
encoded by human herpesvirus 8 induces an
angioproliferative disease resembling Kaposi’s
sarcoma. J. Exp. Med. 191:445.
41. Cesarman E., E.A. Mesri and M.C. Gershengorn.
2000. Viral G-protein coupled receptor and Kaposi’s
sarcoma: a model of paracrine neoplasia? J. Exp.
Med. 191:417.
42. Guo H.G., S. Pati, M. Sadowska, M. Charurat and
M. Reitz. 2004. Tumorigenesis by human herpesvirus
8 vGPCR is accelerated by human immunodeficiency
virus type 1 Tat. J. Virol. 78:9336.
43. Liu L., M.T. Eby, N. Rathore, S.K. Sinha, A.
Kumar and P.M. Chaudhary. 2002. The human
herpesvirus 8-encoded viral FLICE inhibitory
protein physically activates the I-kappa B kinase
complex. J. Biol. Chem. 277:13745.
44. Sgadari C., E. Toschi, C. Palladino, G. Barillari,
D. Carnei, A. Ceresetto, C. Cioccolella, R.
Yarchoan, P. Monini, M. Sturzl and B. Ensoli.
2000. Mechanism of paclitaxel activity in Kaposi’s
sarcoma. J. Immunol. 165:509.
45. Mori S., K. Murakami-Mori, S. Nakamura, A.
Ashkenazi and B. Bonavida. 1999. Sensitization of
AIDS Kaposi’s sarcoma cells to Apo-2 ligand-induced
apoptosis by actinomycin D. J. Immunol. 162:5616.
46. Li C.J., D.J. Friedman, C. Wang, V. Metelev and
A.B. Pardee. 1995. Induction of apoptosis in
uninfected lymphocytes by HIV-1-Tat protein.
.Science 268:429.
47. McCloskey T.W., M. Ott, T. Tribble, S.A. Khan, S.
Teichberg, M.O. Paul, S. Pahwa, E. Verdin and N.
Chirmule. 1997. Dual role of HIV-1-Tat in regulation
of apoptosis in T cells. J. Immunol. 158:1014.
48. Zauli G., D. Gibellini, D. Milani, M. Mazzoni, P.
Borgatti, M. La Placa and S. Capitani. 1993.
Human immunodeficiency virus type 1 protein
protects lymphoid, epithelial and neuronal cell lines
from death by apoptosis. Cancer Res. 53:4481.
49. Deregibus M.C., V. Cantaluppi, S. Doublier, M.F.
Brizzi, I. Deambrosis, A. Albini and G. Camussi.
96 V. CANTALUPPI ET AL.
2002. HIV-1-Tat protein activates phosphatidylinositol
3-kinase/AKT-dependent survival pathways in
Kaposi’s sarcoma cells. J. Biol. Chem. 277:25195.
50. Foreman K.E., T. Wrone-Smith, L.H. Boise, C.B.
Thompson, P.J. Polverini, P.L. Simonian, G.
Nunez and B.J. Nickoloff. 1996. Kaposi’s sarcoma
tumor cells preferentially express Bcl-XL. Am. J.
Pathol. 149:795.
51. Deregibus M.C., S. Buttiglieri, S. Russo, B.
Bussolati and G. Camussi. 2003. CD40-dependent
activation of phosphatidylinositol 3-kinase/AKT
pathway mediates endothelial cell survival and in
vitro angiogenesis. J. Biol. Chem. 278:18008.
52. Ni C.Z., K. Welsh, E. Leo, C.K. Chiou, H. Wu,
J.C. Reed and K.R. Ely. 2000. Molecular basis for
CD40 signaling mediated by TRAF-3. Proc. Natl.
Acad. Sci. USA 97:10395.
53. Wang C.Y., D.C. Guttridge, M.W. Mayo and A.S.
Baldwin Jr. 1999. NF-kappaB induces expression of
the Bcl-2 homologue A1/Bfl-1 to preferentially
suppress chemotherapy-induced apoptosis. Mol.
Cell. Biol. 19:5923.
54. Zapata J.M., M. Krajewska, S. Krajewski, S.
Kitada, K. Welsh, A. Moonks, N. McCloske, J.
Gordon, Y.J. Kipps, R.D. Gascoyne, A. Shabaik
and J.C. Reed. 2000. TNFR-associated factor
family protein expression in normal tissues and
lymphoid malignancies. J. Immunol. 165:5084.
55. Sawanobori M., S. Yamaguchi, M. Hasegawa, M.
Inoue, K. Suzuki, R. Kamiyama, K. Hirokawa
and M. Kitagawa. 2003. Expression of TNF
receptors and related signaling molecules in the bone
marrow from patients with myelodysplastic
syndromes. Leuk. Res. 27:583.
56. Siegler G., E. Kremmer, R. Gonnella and G.
Niedobitek. 2003. Epstein-Barr virus encoded latent
membrane protein 1 (LMP1) and TNF receptor
associated factors (TRAFs): colocalisation of LMP1
and TRAF-1 in primary EBV infection and in EBV-
associated Hodgkin lymphoma. Mol. Pathol. 56:156.
57. Tomasetto C., G.H. Regnier and M.C. Rio. 1998.
TRAF-4 expression in breast carcinomas. Am. J.
Pathol. 153:2007.
58. Ardila-Osorio H., B. Clausse, Z. Mishal, J. Wiels,
T. Tursz and P. Busson. 1999. Evidence of LMP1-
TRAF-3 interactions in glycosphingolipidic rich
complexes of lymphoblastoid and nasopharyngeal
carcinoma cells. Int. J. Cancer 81:645.
59. Hulgen M.C.D.G., W. Kamp and H.S.L.M.
Nottet. 2004. Multiple effects of HIV-1 trans-
activator protein on the pathogenesis of HIV-1
infection. Eur. J. Clin. Invest. 34:57.
INTERNATIONAL JOURNAL OF IMMUNOPATHOLOGY AND PHARMACOLOGY Vol. 19, no. 1, 97-104 (2006)

SOLUBLE CD30 AND LYMPHOCYTE ACTIVATION GENE-3 (CD223), AS POTENTIAL

SEROLOGICAL MARKERS OF T HELPER-TYPE CYTOKINE RESPONSE INDUCED
BY ACELLULAR PERTUSSIS VACCINE
C. M. AUSIELLO, R. PALAZZO, F. SPENSIERI, F. URBANI, M. MASSARI1, F. TRIEBEL2, M.
BENAGIANO3, M. M. D’ELIOS3, G. DEL PRETE3 and A. CASSONE

Department of Infectious, Parasitic and Immune-mediated Diseases, and 1National Centre for
Epidemiology, Surveillance and Health Promotion, Istituto Superiore di Sanità, Rome, Italy; 2E.A.
35.45, Faculte de Pharmacie, Chatenay-Malabry, France; 3Department of Internal Medicine,
University of Florence, Florence, Italy

Received April 26, 2005 – Accepted January 12, 2006

T cell responses are involved in vaccine-induced immunity to pertussis but no easy-to-monitor,

serological markers are available to assess these responses. The lymphocyte activation gene-3 (CD223)
molecule is present on, and released by, activated T helper (Th) 1 cells, whereas CD30 molecules have
been associated with Th2 immune responses. Starting from the recent knowledge of the cytokine profile
induced by pertussis vaccination, we examined the levels of soluble (s)CD223 and sCD30 proteins in
child recipients of acellular pertussis (aP) and diphtheria-tetanus (DT) vaccines and in children
receiving DT vaccine only, as control. The correlation of the two proteins with specific antibody and T
cell responses was assessed. The main findings are: i) sCD223 and sCD30 levels are inversely related,
suggesting that the two markers are the expression of different and counter-regulated T-cell responses;
ii) sCD30 level correlated with induction of T cell proliferation to pertussis vaccine antigens and
antibody response to pertussis toxin. Overall, sCD30 and sCD223 levels seem to be promising candidate
markers to assess the induction of Th-type responses in vaccine recipients.

The mechanisms underlying induction of
immune protection from Bordetella pertussis
infection are not completely understood (1). Data
from experimental infections and, in part, clinical
studies suggest that natural immunity as well as T
and B memory cell compartments are involved, but
the differential contribution of each of these
components in the protection induced by vaccination
or disease-free natural exposure to B. pertussis or the
disease itself remains largely undetermined (1-10).
A correlation between high titers of antibodies
against some B. pertussis antigens and protection of
household contacts of pertussis cases has been found
(11-13), nevertheless, no direct correlation between
serum antibody levels and protection from pertussis
was found in several clinical trials with extended,
carefully investigated, follow-up periods (14-18).
Since the discovery of T helper (Th)1 and Th2
lymphocyte subsets and their role in the regulation of
immune response, studies have been intensely focused
on the possibility of discriminating the prevalent
expansion of CD4 lymphocytes with Th1 or Th2

Keywords: lymphocyte activation gene-3 (CD223), soluble CD30, Bordetella pertussis, acellular pertussis vaccines, T
helper (Th) 1 and Th2
Mailing address:
Dr. Clara Maria Ausiello, Ph.D.
Anti-Infectious Immunity Unit
Department of Infectious, Parasitic and Immuno-mediated Diseases
Istituto Superiore di Sanità; 0394-6320 (2006)
Copyright © by BIOLIFE, s.a.s.
Viale Regina Elena, 299; 00161 ROME Italy This publication and/or article is for individual use only and may not be further
Tel.: +39-06-4990-2890; Fax: +39-06-4990-3168; reproduced without written permission from the copyright holder.
E-mail: ausiello@iss.it 97 Unauthorized reproduction may results in financial and other penalties
98 C.M. AUSIELLO ET AL.
profile, in consideration to the differential role of each
subset for vaccine efficacy. Th1 or Th2 are mainly
discriminated through the pattern of their secreted
cytokines, in that Th1 subsets secrete interferon gamma
(IFN-γ) but not IL-4, while Th2 subsets secrete IL-4,
IL-5, IL-6, IL-10 and IL-13 but not IFN-γ However, a
mixed pattern of cytokines is often secreted by a CD4
subset defined as Th0 (19-20).
In the specific case of pertussis vaccines, the
complexity of the mechanisms underlying immune
protection following vaccination is demonstrated by
the observation that equally protective primary
vaccinations such as those achieved by whole cell
(wP) or acellular (aP) vaccines induce different Th
cytokine profiles (3, 6-7, 9-10). Particularly, our
previous data from the double blind, randomized,
controlled clinical trial of pertussis vaccine efficacy in
Italy, where children received an aP or a wP vaccine,
highlighted a higher Th2 response in aP-vaccine
recipients (3). In contrast, a fairly polarized Th1
response, somewhat mimicking the immunity induced
by natural infection, was measured in wP vaccines (3-
4, 6, 10, 21-23). In this context, the availability of
serological markers of T cell responses would be of
great help.
Several surface molecules have been reported to be
differentially expressed by Th1 and Th2 cells. In
particular, the lymphocyte activation gene-3 (CD223)
molecule has been shown to be expressed on, and
released by, activated IFN-γ producing Th1 cells (24),
whereas the CD30 molecule has been shown to be
expressed on, and released by, activated IL-4
producing CD4+ Th2 cells (25-26). The determination
of these soluble factors could provide insight into
immune responses to vaccines in general, and
particularly help clarify differences in the mechanisms
of pertussis vaccines, which can induce both Th1 and
mixed Th1/Th2 responses (3, 6-7, 9-10). Despite this,
to our knowledge, neither factor has ever been
determined in the context of infant vaccination.
Thus, the aims of this study were, first, to
determine whether soluble (s) CD223 and sCD30
were present and measurable in early childhood;
second, to examine whether sCD223 and sCD30
levels were related to adaptive immune responses
against B. pertussis antigens in vaccine recipients;
third, to examine modulations of these soluble factors
in relation to vaccination against pertussis.
MATERIALS AND METHODS
Subjects
Plasma and sera were collected from children
participating in the double blind, randomized controlled
clinical trial of pertussis vaccine efficacy performed in Italy.
The general study design and details of this benchmark
clinical trial has been reported elsewhere (2, 14, 18). For the
present study, two groups of children were randomly
selected for assessment of sCD30 and sCD223 markers
from all those participating in a clinical trial of pertussis
vaccine efficacy (2, 14), i.e. 76 children who received the
aP-DT vaccine and 30 who received the DT vaccine only.
Informed, written consent was obtained by parents or
guardians of the children enrolled in this study. The original
study was approved by the bioethical committee of the
Italian Trial of Pertussis Vaccine Efficacy.
The pertussis vaccine contained chemically inactivated
pertussis toxin (PT), filamentous haemagglutinin (FHA)
and pertactin (PRN) at 25, 25 and 8 µg, respectively, while
the DT vaccine component contained 25 Lf of diphteria
toxoid and 10 Lf of tetanus toxoid. Sera or plasma were
collected before vaccination, at 2 months of age, and one
month after the completion of the primary vaccination
schedule, when the children were 7 months old.
T cell mediated immune (CMI) and antibody response
definitions
CMI response, measured as antigen specific T cell
proliferation (2), was assayed in 43 children, 33 aP-DT- and
10 DT- vaccine recipients (2). A CMI response was
considered positive when the difference between the
antigen-stimulated PBMC culture and the unstimulated one
was at least 3x103cpm, and the mean stimulation index was
at least 4.
The serological response was measured in 106 children,
76 aP-DT- and 30 DT- vaccine recipients (2, 18). A
serologic response to each pertussis antigen was defined as
positive when the Enzymatic Immune Assay (EIA) value
was 4 times higher than the minimal level of detection. The
minimal level of detection was set at 2 U/ml for IgG to PT
and FHA and 3 U/ml for IgG to PRN (2, 18).
Determination of sCD223 and sCD30
Serum sCD223 level was assessed by an
immunoenzymatic assay, with little modification, from
a previously reported protocol (27). Briefly, purified
anti-CD223 11E3 (IgG1) monoclonal antibody (mAb)
(IMMUTEP, Orsay, France) was used as capture
antibody and anti-CD223 17B4 (IgG1) biotinylated
mAb as revealing antibody (courtesy of Michel Dreano,
Serono International SA, Switzerland). Purified CD223
protein was used as reference standard (IMMUTEP,
 Int. J. Immunopathol. Pharmacol.
Orsay, France) and data are expressed as ng/ml. The
ELISA sensitivity was 0.07 ng/ml corresponding to
0.163 ± 0.004 O.D. (mean ± SE of 9 determinations).
sCD30, was measured by commercial ELISA from
Dako (Glostrup, Denmark). Data are expressed as U/ml,
the lower sensitivity limit (1 U/ml) corresponding to the
mean absorbance plus 2 SD of 20 measurement of the 0
U/ml standard, as indicated in the ELISA data sheet. In
preliminary experiments, sCD223 and sCD30 levels
were compared in serum and plasma from the same
subjects collected at the same time: the ELISA values
were comparable.
Statistical analyses
All data were recorded on a computerized database.
Results are reported as mean ± standard error (SE).
Statistical analyses were carried out using the SPSS
software (version 11; SPSS Inc., Chicago, Ill., USA). To
study the association between sCD223 and sCD30 and
between sCD30 and IgG PT, a linear regression model
was applied and the Pearson correlation coefficient was
calculated. For comparing overall differences of Th1 and
Th2 parameters between the trials and between the
positive or negative CMI response, the non-parametric
Mann-Whitney U test was performed. Pre/post
vaccination differences of Th1 and Th2 parameters within
the trials were evaluated by the non-parametric Wilcoxon
Paired-Sample Test. P values lower than 0.05 were
considered to indicate statistical significance and all
reported P values are two-sided.
RESULTS
sCD223 and sCD30 levels are inversely related
To examine whether there was any relationship
between the levels of sCD223 and sCD30, and
immune responses to vaccination, we determined
both the baseline value of the above factors in pre-
vaccinated children and their values after
vaccination, irrespective of the type of vaccine
administered, i.e, aP-DT or DT. Both sCD30 and
sCD223 were indeed measurable, before
vaccination, in 2 month-old children. These levels
ranged from 27.8 to 187 U/ml and from 0 to14.2
ng/ml, respectively. Similarly, the post-vaccination
levels of sCD30 also varied from 32.6 to 153.3 U/ml
while that of sCD223 varied from 1.03 to 12.7
ng/ml. Remarkably, there was a clear-cut inverse
association in the level of these two markers, both
before (r = - 0.99, P < 0.0001) and after (r = - 0.95,
P < 0.0001) vaccination (Fig. 1A, B).
99
Table I. Pre- and post-vaccination levels of sCD30 and
sCD223 in children within the Italian pertussis vaccine
efficacy trial.
a
sCD30 (U/ml) and sCD223 (ng/ml) values were
determined by ELISA in the plasma samples obtained
before (pre) and after (post) vaccination, as specified in
the Materials and Methods section.
b
in parenthesis, the number of children tested.
The differences between the two groups (aP-DT, DT) of
vaccine recipients were assessed by Mann-Whitney U Test.
The pre- post-vaccine differences in the same group of
subjects were assessed by Wilcoxon Paired-Sample Test.
*Statistical significance (P = 0.008) relative to post-
vaccination sample between aP- DT and DT recipients;
** statistical significance (P = 0.028) relative to pre/post-
vaccination sample in DT recipients;
*** statistical significance (P = 0.015) relative to post-
vaccination sample between aP-DT and DT recipients.
We next compared sCD30 and sCD223 values in
aP-DT or DT recipients. We noticed a statistically
significant decrease in the sCD30 marker between
pre- and post-vaccination levels in DT but not in aP-
DT vaccines, suggesting that the presence of
pertussis antigens in the vaccine was somewhat
instrumental in preventing a fall of sCD30. Overall,
in the post-vaccine assay, the highest amount of
sCD30, and conversely, the lowest amount of
sCD223 were measured in children receiving the
pertussis vaccine, with a significant difference as
compared with DT vaccine recipients (sCD30: P =
0.008; sCD223: P = 0.015) (Table I).
Relationship between sCD223 and sCD30 levels
and CMI or antibody responses
Since: i) not all child recipients of the aP-DT
vaccine raised a measurable CMI proliferative
response against B. pertussis antigens early after
post-primary vaccination (2, 3); ii) the aP-DT CMI-
responsive children demonstrated the prevalence of
 C.M. AUSIELLO ET AL.
100
Table II. sCD30 and sCD223 levels in children
participating in the Italian pertussis vaccine efficacy
trial: evaluation in children displaying positive or
negative CMI responses to PT or PRN antigens.
a
sCD30 (U/ml) and sCD223 (ng/ml) values were
determined by ELISA in the plasma samples obtained
before (pre) and after (post) vaccination, as specified in
the Materials and Methods section.
b
in parenthesis, the number of children tested.
The differences between the two groups (CMI-positive
and CMI-negative) were assessed by Mann-Whitney U
Test:*statistical significance (P = 0.034) relative to post-
vaccination sample between positive and negative CMI
responders.
an antigen-dependent Th2 cytokine profile (3), we
next examined whether the production of the above
markers was associated with CMI positive response.
Interestingly, the population examined appeared to
be composed of two groups, one constituted by the
17 CMI responders who showed an increase of
sCD30 value (from 88 ± 8.7 to 101.2 ± 5) and the
other 16 CMI negative children who showed a
decrease of sCD30 (from 98.3 ± 8.2 to 84.2 ± 6.8).
The difference in the post-vaccination values of this
marker between the two groups is statistically
significant (P = 0.034). As expected from the above
data, an inverse behavior was shown by the sCD223
marker (Table II). Although no differences here
reached statistical significance, it is worth noting
that CMI-responsive aP-DT vaccine recipients had
the lowest post-vaccination value of sCD223 (7.1 ±
0.6 pg/ml) among all children examined. Overall,
the results observed in CMI negative children
closely mimicked those seen in DT only recipients
(cfs Table II and Table I).
The levels of soluble markers were also examined
in relation to the antibody titers against pertussis
vaccine antigens (PT, PRN, or FHA). No association
was generally found in the levels of sCD30 or sCD223
and the antibody titers, with the exception of a positive
association between high sCD30 and high anti-IgG PT
antibody titers (Figure 2).
DISCUSSION
The issue of easily measurable serological
markers of a protective T cell response in infants
receiving primary vaccination warrants attention for
monitoring the vaccine-induced T cell response.
This is of special relevance for vaccines, like the
pertussis ones, which, though inducing both high
antibody levels and strong T cell responses, have no
apparent correlates or surrogates of protection. Thus,
chemokines, cytokines and soluble receptors
associated with induction of memory T helper
responses are primary candidates for the critical
roles of these responses in protection. Among these
factors, IFN-γ and IL-4/IL-5 would theoretically
represent the best tool for tracking Th1/Th2
responses in vivo. However, since these cytokines
are short-range molecules which are rapidly bound
by their receptors and/or inactivated by proteases,
their levels in the plasma are not reliable to assess
the Th1/Th2 balance in vivo. On the other hand, T
cell responses in pertussis vaccine recipients can be,
and indeed have been, studied with the use of
peripheral blood mononuclear cells (3, 6-7, 9-10)
but the limitations of sequential blood sampling in
very young children are rather obvious.
Along these lines, sCD30 and sCD223 molecules
have been considered of particular relevance for
their apparent association with Th2 and Th1
polarized response patterns, which are differently
stimulated by the different pertussis vaccines (3, 6-
7, 9-10). Namely, membrane expression and release
of CD30 in soluble form in the blood has been
suggested to be associated with preferential
activation of Th2 cytokine production, whereas
activated Th1 cells express on the membrane, and
release the CD223 molecule (24-25, 28). In
particular, CD30 expression is restricted to B and T
lymphocytes and is dependent on cell type and
activation (29-30). The truncated and soluble form
of CD30 is preferentially expressed and released by
human T-cell clones with a Th2/Th0 phenotype in
vitro (25). High serum levels of sCD30 have been
prevalently found in Th2-dominated disorders,
however they have also been found in subjects with
 Int. J. Immunopathol. Pharmacol. 101

Fig. 1. Linear regression analysis of sCD30 and sCD223 markers. The values of sCD30 and sCD223 were determined
by ELISA, as specified in the Materials and Methods section, in the plasma samples obtained before (panel A) and after
(panel B) vaccination, irrespective of the vaccine received. An evident inverse association (panel A: r = - 0.99, P <
0.0001; panel B: r = - 0.95, P < 0.0001) in the level of these two parameters was found.

rheumatoid arthritis, a disease ascribed to Th1-
induced mechanisms (19, 26, 31).
A complex role for CD223 has been proposed
(32). The binding of CD223 to its MHC class II
ligand on activated T cells negatively regulates T
cell function through the CD223/TCR transduction
pathway (33). As a recombinant soluble molecule,
sCD223 binds with high avidity MHC class II
molecules expressed by dendritic cells (DC) (34).
This binding leads to DC maturation, migration to
the lymph nodes and enhanced cross-presentation of
exogenous proteins to the MHC class I pathway
(34). Recently, it has been reported that LAG-3
efficiently promotes intra-tumoural recruitment,
activation, and Th1 commitment of APCs, and leads
to a wide intra-tumoural influx of non-specific and
specific reactive cells and to the release of
immunoregulatory and cytotoxic mediators (35).
On these premises, the levels of sCD223 and
sCD30 in recipients of an acellular pertussis vaccine
in the Italian trial of pertussis vaccine
immunogenicity and efficacy (2, 14, 36) were
assessed. To our knowledge, these soluble potential
indicators of distinct Th responses and cellular
activation have never been sequentially assessed in
children beginning from 2 months of age, and have
not been determined in relation to any primary
vaccination. In the present study, these soluble
factors were measured in sera collected during a
double-blind randomized trial, in which the subjects
were under tight surveillance for pertussis (and other
childhood diseases). During the trial, T cell
proliferation, Th1/Th2 cytokines and antibody
responses to the various vaccine antigens were
assessed longitudinally in vaccine recipients of a
sub-population of vaccines (2-3). All this provided
us with an important clue for the evaluation of
potential relationship between soluble markers of T
cell response and vaccine immunogenicity. In
addition, the results obtained in the recipients of the
aP vaccine were compared with a perfectly matched
group of children who were not vaccinated against
pertussis but received the DT vaccine only. Last, but
not least, the above markers could also be measured
before vaccination, in children of only two months
of age, thus providing the necessary baseline values.
The main results of our investigation can be
summarized as follows: i) there is a clear-cut inverse
relationship between sCD30 and sCD223 in
children, both before and after vaccination, strongly
suggesting that the two markers are indeed the
expression of different and counter-regulated T-cell
responses; ii) the level of sCD30 decreased
significantly from pre- to post-vaccination
measurement in children receiving the DT vaccine
but not in those receiving the DT plus aP vaccine,
suggesting that the presence of pertussis antigens in
the vaccine was somewhat inductive of sCD30; iii)
102 C.M. AUSIELLO ET AL.
Fig. 2. Linear regression analysis of sCD30 and anti-IgG
PT levels in aP-DT vaccine recipients. The values of
sCD30 and anti- IgG PT were determined by ELISA, as
specified in the Materials and Methods section, in samples
obtained one months after vaccination in 76 recipients of
aP-DT vaccine. A positive association was found: r =
0.519, P < 0.001.
the increased sCD30 level in the aP-DT vaccine
recipients was bound to induction of CMI and anti-
IgG PT. In particular, the children who did not
acquire a measurable CMI response to pertussis
antigens at the post- vaccination assay showed a
decrease of sCD30 level, exactly as did the children
who received the DT vaccine only.
The inverse correlation between sCD223 and
sCD30 has never been previously reported either in
vaccinated or unvaccinated subjects. In principle, it
would be in accordance with the role assigned to
these two parameters as indicators of distinct
function of Th cell profiles. Thus, low levels of
sCD223 and high levels of sCD30 would be typical
of a Th2-oriented response while the inverse would
be typical of a Th1 response. A mixed Th0 response
would be conceivable with intermediate levels of
sCD223/sCD30.
A recent study, where sCD223 and sCD30 blood
levels were measured in HIV-negative tuberculosis
patients and in healthy household and community
controls from Gambia and Guinea, has shown that
high levels of sCD223 are present in both healthy
exposed contacts and in tuberculosis patients, with
favorable outcome. In contrast, the levels of markers
of Th2 activity, such as sCD30 and IgE, were high in
untreated tuberculosis patients and low in healthy
exposed contacts and in patients successfully cured,
thus again demonstrating an inverse relationship
between the two parameters and their association
with Th1 and Th2 oriented responses (37).
Overall, the highest sCD30 and the lowest
sCD223 values, indicative of a preferential Th2
pattern, were detected in CMI-responsive children
receiving the aP-DT vaccine. These data are well in
accordance with the ability of this pertussis vaccine
to induce pertussis antigen-specific proliferation and
preferentially a Th2 or a Th2/Th0 cytokine pattern in
primary vaccination (3, 7), strongly suggesting that
modulation of sCD30 and sCD223 markers could
indeed be associated with vaccine immunogenicity.
The limitations inherent in the low number of
subjects studied and the retrospective nature of this
study are to be emphasized here. Nonetheless, our
results do clearly invite further, extended
investigations aimed at determining the true value of
soluble Th markers for estimating the
immunogenicity of vaccination in children.
ACKNOWLEDGEMENTS
Supported by grants from the Istituto Superiore
di Sanità (AIDS project # 40F/A), from the Ministry
of Health, (# 4AM/FI) and from ISS-NIH (USA)
scientific cooperation agreement (# 5303). Our
thanks are expressed to Michel Dreano, Ares Serono
International SA, Switzerland, for providing anti-
CD223 17B4 (IgG1) mAb. The authors are grateful
to the “Progetto Pertosse” study group for
cooperation in recruiting children for this study and
to Giorgio Fedele, Paola Mastrantonio and Stefania
Salmaso (Istituto Superiore di Sanità, Roma, Italy)
for their constructive comments. The editorial
assistance of Adam Nixon is gratefully
acknowledged.
REFERENCES
1. Mills K.H. 2001. Immunity to Bordetella pertussis.
Microbes Infect. 3:655.
2. Cassone A., C.M. Ausiello, F. Urbani, R. Lande,
M. Giuliano, A. La Sala, A. Piscitelli and S.
Salmaso. 1997. Cell-mediated and antibody responses
to Bordetella pertussis antigens in children vaccinated
with acellular or whole-cell pertussis vaccines. The
 Int. J. Immunopathol. Pharmacol.
Progetto Pertosse-CMI Working Group. Arch. Pediatr.
Adolesc. Med. 151:283.
3. Ausiello C.M., F. Urbani, A. la Sala, R. Lande and
A. Cassone. 1997. Vaccine- and antigen-dependent
type 1 and type 2 cytokine induction after primary
vaccination of infants with whole-cell or acellular
pertussis vaccines. Infect. Immun. 65:2168.
4. Ryan M., G. Murphy, L. Gothefors, L. Nilsson, J.
Storsaeter and K.H. Mills. 1997. Bordetella
pertussis respiratory infection in children is
associated with preferential activation of type 1 T
helper cells. J. Infect. Dis. 175:1246.
5. Miller E., L.A. Ashworth, K. Redhead, C.
Thornton, P.A. Waight and T. Coleman. 1997.
Effect of schedule on reactogenicity and antibody
persistence of acellular and whole-cell pertussis
vaccines: value of laboratory tests as predictors of
clinical performance. Vaccine 15:51.
6. He Q., N.N. Tran Minh, K. Edelman, M.K.
Viljanen, H. Arvilommi and J. Mertsola. 1998.
Cytokine mRNA expression and proliferative
responses induced by pertussis toxin, filamentous
hemagglutinin, and pertactin of Bordetella pertussis
in the peripheral blood mononuclear cells of infected
and immunized schoolchildren and adults. Infect.
Immun. 66:3796.
7. Ryan M., G. Murphy, E. Ryan, L. Nilsson, F.
Shackley, L. Gothefors, K. Oymar, E. Miller, J.
Storsaeter and K. H. Mills. 1998. Distinct T-cell
subtypes induced with whole cell and acellular
pertussis vaccines in children. Immunology 93:1.
8. Ausiello C.M., R. Lande, F. Urbani, B. Di Carlo,
P. Stefanelli, S. Salmaso, P. Mastrantonio and A.
Cassone. 2000. Cell-mediated immunity and
antibody responses to Bordetella pertussis antigens
in children with a history of pertussis infection and
in recipients of an acellular pertussis vaccine. J.
Infect. Dis. 181:1989.
9. Zepp F., M. Knuf, P. Habermehl, J.H. Schmitt, C.
Rebsch, P. Schmidtke, R. Clemens and M. Slaoui.
1996. Pertussis-specific cell-mediated immunity in
infants after vaccination with a tricomponent
acellular pertussis vaccine. Infect. Immun. 64:4078.
10. Mascart F., V. Verscheure, A. Malfroot, M. Hainaut,
D. Pierard, S. Temerman, A. Peltier, A.S. Debrie, J.
Levy, G. Del Giudice and C. Locht. 2003. Bordetella
103
pertussis infection in 2-month-old infants promotes
type 1 T cell responses. J. Immunol. 170:1504.
11. Storsaeter J., H.O. Hallander, L. Gustafsson and
P. Olin. 1998. Levels of anti-pertussis antibodies
related to protection after household exposure to
Bordetella pertussis. Vaccine 16:1907.
12. Cherry J.D., J. Gornbein, U. Heininger and K.
Stehr. 1998. A search for serologic correlates of
immunity to Bordetella pertussis cough illnesses.
Vaccine 16:1901.
13. Cherry J.D. and P. Olin. 1999. The science and
fiction of pertussis vaccines. Pediatrics 104:1381.
14. Greco D., S. Salmaso, P. Mastrantonio, M.
Giuliano, A.E. Tozzi, A. Anemona, M.L. Ciofi
degli Atti, A. Giammanco, P. Panei, W.C.
Blackwelder, D.L. Klein and S.G. Wassilak. 1996.
A controlled trial of two acellular vaccines and one
whole-cell vaccine against pertussis. Progetto
Pertosse Working Group. N. Engl. J. Med. 334:341.
15. Olin P., F. Rasmussen, L. Gustafsson, H.O.
Hallander and H. Heijbel. 1997. Randomised
controlled trial of two-component, three-
component, and five-component acellular pertussis
vaccines compared with whole-cell pertussis
vaccine. Ad Hoc Group for the Study of Pertussis
Vaccines. Lancet 350:1569.
16. Simondon F., M.P. Preziosi, A. Yam, C.T. Kane, L.
Chabirand, I. Iteman, G. Sanden, S. Mboup, A.
Hoffenbach, K. Knudsen, N. Guiso, S. Wassilak and
M. Cadoz. 1997. A randomized double-blind trial
comparing a two-component acellular to a whole-cell
pertussis vaccine in Senegal. Vaccine 15:1606.
17. Cherry J.D. 1997. Comparative efficacy of acellular
pertussis vaccines: an analysis of recent trials.
Pediatr. Infect. Dis. J. 16(S):90.
18. Giuliano M., P. Mastrantonio, A. Giammanco, A.
Piscitelli, S. Salmaso and S. G. Wassilak. 1998.
Antibody responses and persistence in the two
years after immunization with two acellular
vaccines and one whole-cell vaccine against
pertussis. J. Pediatr. 132:983.
19. Romagnani S. 1997. The Th1/Th2 paradigm.
Immunol. Today 18:263.
20. Perussia B. and M.J. Loza. 2003. Linear “2-0-1”
lymphocyte development: hypotheses on cellular
bases for immunity. Trends Immunol. 24:235.
 104 C.M. AUSIELLO ET AL.
21. Ausiello C.M., R. Lande, A. la Sala, F. Urbani and
A. Cassone. 1998. Cell-mediated immune response
of healthy adults to Bordetella pertussis vaccine
antigens. J. Infect. Dis. 178:466.
22. Ausiello C.M., R. Lande, F. Urbani, A. la Sala, P.
Stefanelli, S. Salmaso, P. Mastrantonio and A.
Cassone. 1999. Cell-mediated immune responses in
four-year-old children after primary immunization with
acellular pertussis vaccines. Infect. Immun. 67:4064.
23. Fedele G., P. Stefanelli, F. Spensieri, C. Fazio, P.
Mastrantonio and C.M. Ausiello. 2005. Bordetella
pertussis-infected human monocyte-derived
dendritic cells undergo maturation and induce Th1
polarization and interleukin-23 expression. Infect.
Immun. 73:1590.
24. Annunziato F., R. Manetti, I. Tomasevic, M.G.
Guidizi, R. Biagiotti, V. Gianno, P. Germano, C.
Mavilia, E. Maggi and S. Romagnani. 1996.
Expression and release of LAG-3-encoded protein
by human CD4+ T cells are associated with IFN-
gamma production. Faseb J. 10:769.
25. Del Prete G., M. De Carli, M.M. D’Elios, K.C.
Daniel, F. Almerigogna, M. Alderson, C.A. Smith, E.
Thomas and S. Romagnani. 1995. CD30-mediated
signaling promotes the development of human T helper
type 2-like T cells. J. Exp. Med. 182:1655.
26. D’Elios M. M., P. Romagnani, C. Scaletti, F.
Annunziato, M. Manghetti, C. Mavilia, P.
Parronchi, C. Pupilli, G. Pizzolo, E. Maggi, G.F. Del
Prete and S. Romagnani. 1997. In vivo CD30
expression in human diseases with predominant
activation of Th2-like T cells. J. Leukoc. Biol. 61:539.
27. Amedei A., C. Romagnani, M. Benagiano, A.
Azzurri, F. Fomia, F. Torrente, A. Plebani, M.M.
D’Elios and G. Del Prete. 2001. Preferential Th1
profile of T helper cell responses in X-linked (Bruton’s)
agammaglobulinemia. Eur. J. Immunol. 31:1927.
28. Del Prete G., M. De Carli, F. Almerigogna, C.K.
Daniel, M.M. D’Elios, G. Zancuoghi, F. Vinante,
G. Pizzolo and S. Romagnani. 1995. Preferential
expression of CD30 by human CD4+ T cells
producing Th2-type cytokines. Faseb J. 9:81.
29. Ellis T.M., P.E. Simms, D.J. Slivnick, H.M. Jack
and R.I. Fisher. 1993. CD30 is a signal-transducing
molecule that defines a subset of human activated
View publication stats
CD45RO+ T cells. J. Immunol. 151:2380.
30. Nakamura T., R.K. Lee, S.Y. Nam, B.K. Al-
Ramadi, P.A. Koni, K. Bottomly, E.R. Podack
and R.A. Flavell. 1997. Reciprocal regulation of
CD30 expression on CD4+ T cells by IL-4 and IFN-
gamma. J. Immunol. 158:2090.
31. Gerli R., C. Lunardi, F. Vinante, O. Bistoni, G.
Pizzolo and C. Pitzalis. 2001. Role of CD30+ T cells
in rheumatoid arthritis: a counter-regulatory paradigm
for Th1-driven diseases. Trends Immunol. 22:72.
32. Triebel F. 2003. LAG-3: a regulator of T-cell and
DC responses and its use in therapeutic vaccination.
Trends Immunol. 24:619.
33. Hannier S., M. Tournier, G. Bismuth and F.
Triebel. 1998. CD3/TCR complex-associated
lymphocyte activation gene-3 molecules inhibit
CD3/TCR signaling. J. Immunol. 161:4058.
34. Avice M.N., M. Sarfati, F. Triebel, G. Delespesse
and C.E. Demeure. 1999. Lymphocyte activation
gene-3, a MHC class II ligand expressed on activated
T cells, stimulates TNF-alpha and IL-12 production by
monocytes and dendritic cells. J. Immunol. 162:2748.
35. Carlo E.D., P. Cappello, C. Sorrentino, T.
D’Antuono, A. Pellicciotta, M. Giovarelli, G.
Forni, P. Musiani and F. Triebel. 2005.
Immunological mechanisms elicited at the tumour
site by lymphocyte activation gene-3 (LAG-3)
versus IL-12: sharing a common Th1 anti-tumour
immune pathway. J. Pathol. 205:82.
36. Salmaso S., P. Mastrantonio, S.G. Wassilak, M.
Giuliano, A. Anemona, A. Giammanco, A.E.
Tozzi, M.L. Ciofi degli Atti and D. Greco. 1998.
Persistence of protection through 33 months of age
provided by immunization in infancy with two three-
component acellular pertussis vaccines. Stage II
Working Group. Vaccine 16:1270.
37. Lienhardt C., A. Azzurri, A. Amedei, K. Fielding,
J. Sillah, O.Y. Sow, B. Bah, M. Benagiano, A.
Diallo, R. Manetti, K. Manneh, P. Gustafson, S.
Bennett, M.M. D’Elios, K. McAdam and G. Del
Prete. 2002. Active tuberculosis in Africa is
associated with reduced Th1 and increased Th2
activity in vivo. Eur. J. Immunol. 32:1605.