Sunteți pe pagina 1din 118

MANUAL PRÁTICO DE MICROBIOLOGIA

Nuno Taveira
Inês Bártolo

2014
Índice Geral

CAPÍTULO 1- Segurança biológica em laboratórios de microbiologia ....................................................................... 3


1.1. Introdução .......................................................................................................................................................... 3
1.2. Princípios de segurança biológica ...................................................................................................................... 4
1.3. Níveis de segurança biológica ........................................................................................................................... 8
1.4. A segurança biológica em laboratório de ensino da Microbiologia ................................................................. 11
CAPÍTULO 2- Estudo da célula bacteriana por microscopia óptica: exame a fresco e após coloração. .................... 13
2.1. Introdução ........................................................................................................................................................ 13
Coloração da cápsula .................................................................................................................................................. 16
2.2 - Protocolos experimentais................................................................................................................................ 17
2.3. Resultados e discussão ..................................................................................................................................... 20
CAPÍTULO 3- Cultura e isolamento de bactérias ...................................................................................................... 21
3.1 - Introdução....................................................................................................................................................... 21
3.2 - Protocolos experimentais................................................................................................................................ 27
3.3 – Resultados e discussão ................................................................................................................................... 28
CAPÍTULO 4- Transformação genética da estirpe de E. coli HB101 pelo plasmídio pGLO.................................... 29
4.1 - Introdução....................................................................................................................................................... 29
4.2 - Protocolo experimental ................................................................................................................................... 33
4.3 – Resultados e discussão ................................................................................................................................... 35
CAPÍTULO 5- Estudo da susceptibilidade bacteriana aos antibióticos ...................................................................... 36
5.1 - Introdução....................................................................................................................................................... 36
5.2 - Protocolos experimentais................................................................................................................................ 43
5.3 – Resultados e discussão ................................................................................................................................... 45
CAPÍTULO 6- Estudo morfológico e bioquímico de fungos unicelulares e filamentosos.......................................... 46
6.1 - Introdução....................................................................................................................................................... 46
6.2 - Protocolos experimentais................................................................................................................................ 50
6.3 – Resultados e discussão ................................................................................................................................... 51
CAPÍTULO 7- Estudo bioquímico e metabólico de cocos de Gram positivo............................................................. 53
7.1 - Introdução....................................................................................................................................................... 53
7.2 - Protocolos experimentais................................................................................................................................ 61
7.3 – Resultados e discussão ................................................................................................................................... 63
CAPÍTULO 8- Estudo bioquímico e metabólico de bacilos de Gram negativo.......................................................... 64
8.1 - Introdução....................................................................................................................................................... 64
8.2 - Protocolos experimentais................................................................................................................................ 72
8.3 – Resultados e discussão ................................................................................................................................... 74
CAPÍTULO 9- Isolamento de bacteriófagos de águas de superfície ......................................................................... 75
9.1 – Introdução ...................................................................................................................................................... 75
9.2- Protocolo Experimental ................................................................................................................................... 76
9.3- Resultados e discussão..................................................................................................................................... 79
CAPÍTULO 10- Estudo do microbioma oral por exame microscópico direto e cultura ............................................. 80
10.1 Introdução ....................................................................................................................................................... 80
10.2. Protocolos Experimentais .............................................................................................................................. 91
10.3. Resultados e discussão ................................................................................................................................... 93
CAPÍTULO 11- Identificação e caracterização de estreptococos orais ...................................................................... 96
11.1- Introdução...................................................................................................................................................... 96
11.2- Protocolos Experimentais .............................................................................................................................. 98
CAPÍTULO 12- Estudo do micobioma oral ............................................................................................................. 101
12.1 Introdução ..................................................................................................................................................... 101
12.2. Protocolos Experimentais ............................................................................................................................ 108
CAPÍTULO 13- Detecção do serotipo B de Aggregatibacter actinomycetemcomitans em bolsas periodontais por
amplificação por PCR ............................................................................................................................................... 110
13.1- Introdução.................................................................................................................................................... 110
13.2- Protocolos Experimentais ............................................................................................................................ 115
Bibliografia ............................................................................................................................................................... 118

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 2


CAPÍTULO 1- Segurança biológica em laboratórios de microbiologia

1.1. Introdução
Os laboratórios de microbiologia são ambientes de trabalho especiais em que as pessoas que neles
trabalham estão sujeitas a contrair doenças infecciosas que podem constituir risco de vida. São inúmeros
os trabalhos publicados desde o início do século descrevendo casos de doenças associadas ao trabalho
laboratorial, incluindo a febre tifoide (causada pela Salmonella typhi), cólera (causada pelo Vibrio
cholerae), brucelose (causada pela Brucella abortus), hepatite B, shigelose (causada por algumas
espécies de Shigella spp.), tuberculose (causada pelo Mycobacterium tuberculosis), arboviroses, tétano
(causada pelo Clostridium tetani) e SIDA (causada pelo HIV) (Tabela 1.1).

Tabela 1.1. Casos de SIDA ou infecções por HIV contraídas profissionalmente até Setembro de 1992
nos Estados Unidos1
Profissão No. de transmissões profissionais (%)
• Técnico de laboratório 25 (24.8)
• Enfermeiro 26 (25.7)
• Médico 13 (12.8)
• Técnico biomédico/paramédicos 7 (6.9)
• Dentista/técnico dentista 6 (5.9)
• Recepcionista/auxiliares 6 (5.9)
• Trabalhadores de limpeza/manutenção 6 (5.9)
• Técnico morgue 3 (3.0)
• Técnico/terapeuta 3 (3.0)
• Terapeuta respiratório 2 (2.0)
• Técnico cirúrgico 2 (2.0)
• Outros trabalhadores em saúde 2 (2.0)
Total 101
1
Adaptado de: Sewell, D.L. 1995. Laboratory-associated infections and biosafety. Clin. Microbiol.
Reviews 8: 389-405.

Nalguns casos as infecções terão sido associadas à simples manipulação de culturas microbianas ou
amostras clínicas, ou ainda inalação de pó ou aerossóis contendo microrganismos patogénicos. Noutros
casos, as infecções foram associadas à utilização de técnicas incorrectas e descuidadas de manuseamento
de materiais infecciosos (Tabela 1.2). Neste contexto são tristemente famosas as infecções mortais
adquiridas por iminentes cientistas como H.T. Ricketts, S.J.M. von Prowazek e E. Weil, durante os seus
estudos das doenças provocadas por Ricktesias spp.

Tabela 1.2. Tipos de acidentes associados com infecções de origem laboratorial1


Acidentes No. de infecções (%)
• Salpicos e aerossóis 188 (26.7)
• Perfuração/ferida com agulha 177 (25.2)
• Perfuração/ferida com objectos 112 (15.9)
pontiagudos
• Mordedura ou arranhão de animal ou 95 (13.5)
ectoparasita
• Pipetação à boca 92 (13.1)
• Outros (desconhecidos) 39 (5.5)
Total 703
1
Adaptado de: Sewell, D.L. 1995. Laboratory-associated infections and biosafety. Clin. Microbiol.
Reviews 8: 389-405.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 3


Estes estudos sugeriram que os indivíduos que trabalham em laboratórios de microbiologia correm o
risco efectivo de ser infectados pelos agentes que manipulam. Em contraste, estudos semelhantes
demonstraram que os laboratórios que trabalham com agentes infecciosos não constituem uma ameaça
para a comunidade, havendo a registar somente casos esporádicos de infecções comunitárias que terão
sido transmitidas por trabalhadores deste tipo de laboratórios.
De forma a minorar ou eliminar a ocorrência de doenças infecciosas associadas a actividades
laboratoriais, foram elaborados alguns manuais de segurança por diversas organizações, incluindo a
Organização Mundial de Saúde e o Center for Disease Control dos Estados Unidos, que descrevem as
Boas Práticas de Laboratório e as instalações requeridas para trabalhar em segurança com materiais
infecciosos. Este capítulo sistematiza e resume a informação sobre segurança microbiológica, contida
nestes manuais e em outras publicações, que é directamente relevante para minimizar ou eliminar os
perigos associados ao manuseamento de culturas bacterianas e fúngicas nas aulas práticas laboratoriais
de Microbiologia para que estas aulas não constituam risco de segurança biológica para os alunos,
professores, pessoal de limpeza e manutenção, e restante comunidade do ISCSS.

1.2. Princípios de segurança biológica


O termo ‘contenção do risco biológico’ (ou simplesmente ‘contenção biológica’) utiliza-se para
descrever métodos seguros de gestão de agentes infecciosos no meio ambiente laboratorial em que são
produzidos, manuseados ou conservados. Os objectivos das medidas de ‘contenção biológica’ são a
redução ou eliminação da exposição a agentes potencialmente patogénicos por parte de técnicos
laboratoriais e pessoal auxiliar, comunidade e meio ambiente geral extra-laboratorial.
Entende-se por ‘contenção primária’, a protecção de pessoal e meio ambiente laboratorial da exposição
a agentes infecciosos. A ‘contenção primária’ obtém-se aplicando boas técnicas microbiológicas e
utilizando equipamento de segurança apropriado. A utilização de vacinas pode também aumentar o nível
de protecção pessoal.
Entende-se por ‘contenção secundária’ a protecção do meio ambiente externo ao laboratório da
exposição a materiais infecciosos. A ‘contenção secundária’ obtém-se recorrendo a uma combinação de
práticas operacionais específicas e desenho adequado de instalações.

Os três elementos que permitem definir o tipo de ‘contenção do risco biológico’ incluem, portanto, a
técnica e prática laboratorial, o equipamento de segurança, e o desenho de instalações. A análise de
risco do trabalho a efectuar com um agente específico determinará a apropriada combinação destes três
elementos.

1. Técnica e prática laboratorial


O elemento mais importante da ‘contenção biológica’ é a aderência estrita a práticas e técnicas
microbiológicas seguras e padronizadas. Os indivíduos que trabalham com agentes infecciosos ou
materiais potencialmente infectados devem conhecer os potenciais riscos envolvidos na sua actividade, e
devem ser treinados e proficientes na execução das técnicas e práticas requeridas para manusear de forma
segura tais materiais. O director ou pessoa a cargo do laboratório é responsável pelo treino apropriado do
pessoal.
Cada laboratório deve desenvolver ou adoptar um manual de segurança biológica ou de operações que
identifique os perigos que poderão ser encontrados e quais as práticas específicas e procedimentos a
adoptar para minimizar ou eliminar riscos (Tabela 1.3).
O pessoal deve ser alertado para perigos especiais e deve ser compelido a ler e a seguir as práticas e
procedimentos requeridos para os evitar. O laboratório deve ser dirigido por um cientista conhecedor das
técnicas laboratoriais apropriadas, procedimentos de segurança, e perigos associados com o
manuseamento de agentes infecciosos. Quando as práticas laboratoriais padronizadas se revelem
insuficientes para controlar os perigos associados com um agente particular ou procedimento
laboratorial, podem ser necessárias medidas adicionais. O director de laboratório é responsável pela
selecção de práticas de segurança adicionais, que devem ser coerentes com os perigos associados com o
agente ou procedimento em causa.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 4


O pessoal de laboratório, as medidas de segurança, e técnicas devem ser suplementadas pelo desenho
apropriado de instalações e por características próprias de engenharia, equipamento de segurança, e
práticas de gestão.

Tabela 1.3. Vias de exposição a microrganismos patogénicos em ambiente laboratorial1


Via Prática microbiológica
Ingestão • Pipetação à boca
• Salpicos de material infeccioso para a boca
• Colocação de artigos contaminados ou dedos
na boca
• Consumo de alimentos no laboratório
Inoculação • Acidentes com agulhas
• Cortes
• Mordeduras de insecto e arranhões
Contaminação da pele e membranas mucosas • Derrames ou salpicos para os olhos, boca, e
nariz
• Derrames ou salpicos em pele intacta ou pele
lesada
• Superfícies, equipamento, e material
contaminados
Inalação • Numerosos procedimentos que produzem
aerossóis
1
Adaptado de: Sewell, D.L. 1995. Laboratory-associated infections and biosafety. Clin. Microbiol. Reviews 8: 389-
405.

2. Equipamento de segurança_ barreiras primárias_


O equipamento de segurança inclui câmaras de segurança biológica, recipientes fechados, e outras
soluções de engenharia desenhadas para eliminar ou minimizar a exposição a materiais biológicos
perigosos. As câmaras de segurança biológica são os principais equipamentos utilizados para
possibilitar a contenção de derrames infecciosos ou aerossóis gerados por muitos procedimentos
microbiológicos (Tabelas 1.4 e 1.5).

Tabela 1.4- Identificação de actividades laboratoriais geradoras de aerossóis1


Actividades laboratoriais Práticas microbiológicas
Manipulação de ansas de inoculação • Inoculação de meios de cultura bacterianos
• Arrefecimento de ansas nos meios de cultura
• Chamejamento de ansas contaminadas
Pipetação • Agitação de suspensões bacterianas
• Derrames em superfícies sólidas
Manuseamento de agulhas e seringas • Expelir ar
• Retirar tampa da agulha
• Injectar animais
• Retirar a agulha da a seringa
Outras • Centrifugação
• Utilização de misturadores, agitadores,
sonicadores
• Adição ou decantação de fluídos
• Abertura de frascos de cultura
• Derrames de materiais infecciosos
• Liofilização e filtração sobre vácuo
• Inoculação de ovos e posterior colheita de
fluídos contendo vírus
1
Adaptado de: Sewell, D.L. 1995. Laboratory-associated infections and biosafety. Clin. Microbiol. Reviews 8: 389-
405.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 5


Tabela 1.5. Exemplos de aerossóis infecciosos produzidos por algumas técnicas bacteriológicas comuns1
Procedimento laboratorial No. médio de colónias em amostras de ar
Aglutinação em lâmina 0-0.7
Injecção de animal sem desinfectar o local de
15-16
inoculação
Tubo partido em rotor de centrífuga com tampa 0-20
Tubo partido em rotor de centrífuga sem tampa
80-1800
(derrame de líquido para fora da centrífuga)
Uma gota de Salmonella indica depositada à altura de
cerca de 10 cm sobre:
Aço inox 0.2-4.7
Toalha de mãos seca 0-0.4
Toalha molhada com fenol (5%) 0-0.1
Inserção de uma ansa quente num caldo de cultura 0.7-25
Inserção de uma ansa fria em caldo de cultura 0-0.2
Quebra de ampola contendo S. indica liofilizada 1939-2040
Inoculação de agar solidificado com ansa 7-73
Utilização de misturador mal vedado 77-1246
Abertura de garrafas com tampa de rosca 0-45
1
Adaptado de: Chatigny MA and Clinger DI. Contamination control in aerobiology. In: Dimmick, R.L:, and AB.
Akers (Eds.) 1969. An introduction to experimental aerobiology, pp. 194-263. Wiley-Interscience, New-York.

Existem três tipos de câmaras de segurança biológica utilizadas em laboratórios de microbiologia:


câmaras de classe I , II e III. As câmaras de classe I (Fig. 1.1) e classe II (Fig. 1.2) são câmaras abertas
que oferecem níveis significativos de protecção ao pessoal de laboratório e ao meio ambiente quando
utilizadas em conjunto com boas técnicas microbiológicas. As câmaras de classe II também protegem
contra a contaminação externa de materiais (e.g. culturas de células, stocks microbianos) que são
manipulados dentro da câmara. As câmaras de classe III (Fig. 1.3), câmaras fechadas, são estanques a
gases e constituem o mais alto nível de protecção alcançável actualmente para o pessoal e para o meio
ambiente.

Figura 1.1. Diagrama de uma câmara de segurança biológica de classe I. A) Abertura frontal; B)
Superfície de trabalho; C) Janela; D) Coluna de exaustão; E) Filtro HEPA.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 6


Figura 1.2. Diagrama de uma câmara de segurança biológica de classe II, tipo A. A) Ventilador; B)
Coluna de exaustão; C) Filtro HEPA de entrada; D) Exaustor; E) Vidro; F) Superfície de trabalho.

Figura 1.3. Diagrama de uma câmara de segurança biológica de classe III. A) Mesa de apoio; B)
Compartimento das luvas; C) O-ring para ligação das luvas; D) Janela de vidro; E) Filtro HEPA de saída;
F) Filtro HEPA de exaustão (embora sejam necessários dois filtros HEPA consecutivos de exaustão o
segundo filtro não está representado na figura); G) Autoclave com duas saídas.

Outro exemplo de barreira primária é a tampa dos rotores de centrífuga que impedem a libertação de
aerossóis formados durante a centrifugação. Para minimizar este perigo potencial, sobretudo quando se
manuseiam agentes infecciosos que podem ser transmitidos por via respiratória após exposição a
aerossóis, deve também efectuar-se o trabalho laboratorial em câmaras de segurança biológica.
O equipamento de segurança pode também incluir itens para protecção pessoal tais como luvas, batas,
tocas, sapateiras, botas, respiradores, máscaras faciais, vidros protectores, ou óculos. O equipamento de
protecção pessoal é muitas vezes utilizado conjuntamente com câmaras de segurança biológica e outros

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 7


dispositivos de contenção dos agentes, animais ou materiais infecciosos que estão a ser manipulados. Em
algumas situações em que é pouco prático trabalhar em câmaras de segurança biológica, o equipamento
de protecção pessoal pode constituir a primeira barreira entre o pessoal e os materiais infecciosos (ex.
actividades relacionadas com a manutenção de equipamentos).

3. Desenho de instalações _barreiras secundárias_


O desenho das instalações pode constituir uma importante barreira de protecção do pessoal intra- e extra-
laboratorial e da comunidade em geral, dos agentes infecciosos que podem ser acidentalmente libertados
do laboratório. A direcção do laboratório é responsável pela disponibilização de instalações adequadas à
função do laboratório e ao nível de segurança recomendado para os agentes efectivamente manipulados.
As barreiras secundárias recomendadas dependem do risco de transmissão do agente específico. Por
exemplo, os riscos de exposição para a maior parte do trabalho laboratorial em instalações de nível 1 e 2
de segurança biológica são o contacto directo com os agentes, ou o contacto inadvertido através do meio
ambiente de trabalho contaminado. As barreiras secundárias nestes laboratórios podem incluir a
separação da área de trabalho laboratorial do acesso público, existência de equipamento para
descontaminação (ex. autoclave) e locais para lavagem de mãos.

À medida que o risco de transmissão dos microrganismos por aerossóis aumenta, tornam-se necessários
níveis mais elevados de contenção primária e múltiplas barreiras secundárias para impedir a saída de
agentes infecciosos para o meio ambiente. As características do desenho das instalações podem então
incluir:
♦ sistemas de ventilação especializados que assegurem fluxo de ar direccionado,
♦ sistemas de tratamento do ar laboratorial para descontaminar ou remover agentes do ar contaminado
(ar expelido),
♦ zonas de acesso controlado,
♦ isolamento do laboratório em edifícios ou módulos separados

1.3. Níveis de segurança biológica


Existem quatro níveis de segurança biológica (NSB) que são definidos pela utilização combinada de
diferentes práticas e técnicas laboratoriais, equipamento de segurança, e instalações laboratoriais. Cada
combinação é especificamente apropriada para as operações efectuadas, as vias de transmissão
conhecidas ou suspeitadas de cada agente infeccioso, e para a função ou actividade do laboratório
(Tabela 1.6). O director do laboratório é responsável pela análise de riscos associados ao trabalho
laboratorial com um determinado agente microbiano e pela aplicação apropriada dos níveis de segurança
biológica recomendados para esse agente microbiano.

1. Nível 1 de segurança biológica (NSB –1)


As práticas, o equipamento e as instalações deste nível de segurança são apropriadas para laboratórios de
ensino (de nível básico introdutório, caso da Microbiologia Geral), outras instalações em que seja
efectuado trabalho com estirpes bem definidas e caracterizadas de microrganismos viáveis que
sejam inócuos para o adulto saudável. O Bacillus subtilis e a Escherichia coli K12, a Naegleria
gruberi, e o vírus da hepatite canina são exemplos representativos de microrganismos que satisfazem
estes critérios. Muitos agentes que não estão normalmente associados a doença no homem adulto são, no
entanto, patogénios oportunistas e podem causar infecções no jovem, no idoso, e nos indivíduos
imunodeficientes ou imunosuprimidos.
Este nível de biosegurança representa um nível básico de contenção biológica que assenta em práticas
microbiológicas padronizadas não sendo recomendadas barreiras primárias ou secundárias especiais, a
não ser a existência de um lavatório para lavagem de mãos.

2. Nível 2 de segurança biológica (NSB-2)


As práticas, equipamento, e instalações deste nível de segurança são apropriadas para laboratórios de
diagnóstico, laboratórios de ensino ( onde se manipule produtos biológicos, caso da Bacteriologia
Clínica) e ainda outras instalações em se trabalhe com uma grande variedade de microrganismos de

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 8


risco moderado naturalmente presentes na comunidade e associados com doenças humanas de
maior ou menor severidade. Com a adopção de boas técnicas microbiológicas, estes agentes podem ser
manuseados com segurança em bancadas abertas, desde que se assegure que o potencial formador de
aerossóis, derrames e salpicos, resultante dessas actividades é baixo. O vírus da hepatite B, as Salmonella
spp., e os Toxoplasma spp. são exemplos de microrganismos que devem ser trabalhados nestas condições
de segurança. O nível 2 de segurança biológica é apropriado para trabalho com fluidos e tecidos
corporais e produtos derivados do sangue humano, produtos biológicos em que a presença de um agente
infeccioso pode ser desconhecida.

Os perigos primários para o pessoal que trabalha com estes agentes relacionam-se com exposições
percutâneas ou exposições acidentais das membranas mucosas, ou ainda com a ingestão de materiais
infecciosos. Deve ter-se precauções extremas com agulhas contaminadas ou instrumentos ponteagudos.
Embora os organismos manipulados em instalações de nível 2 de segurança biológica (NSB-2) não se
transmitam normalmente por via aerossol, todos os procedimentos que possam aumentar o risco de
exposição do pessoal a aerossóis devem ser efectuados em/com equipamento ou utensílios de contenção
primária como são as câmaras de segurança biológica e as tampas dos rotores de centrífugas. Outras
barreiras primárias podem ser utilizadas quando tal seja apropriado: escudos contra derrames e salpicos,
protecções faciais, luvas e toucas.
Para reduzir a potencial contaminação ambiental devem sempre existir e estar disponíveis e em
funcionamento, barreiras secundárias tais como lavatórios e instalações ou equipamento para
descontaminação dos resíduos infectados.

3. Nível 3 de segurança biológica (NSB-3)


As práticas, equipamento, e instalações deste nível de segurança biológica são apropriadas para
laboratórios de diagnóstico, de ensino, de investigação e de produção industrial em se trabalhe com uma
grande variedade de microrganismos indígenas ou exóticos com potencial para transmissão
respiratória via aerossóis, e que podem causar infecções sérias e potencialmente letais. Exemplos de
microrganismos que devem ser trabalhados a este nível de segurança são: Mycobacterium tuberculosis,
vírus da encefalite de St. Louis, e Coxiella burnetii. Os perigos primários para o pessoal que trabalhe
com estes agentes relacionam-se com a auto-inoculação, ingestão, e exposição a aerossóis infecciosos.
No nível 3 de segurança biológica, mais ênfase é colocado na utilização de barreiras primárias e
secundárias para protecção do pessoal que trabalhe em áreas contíguas, protecção da comunidade, e
protecção do ambiente, contra a exposição a aerossóis potencialmente infecciosos. Por exemplo, todas as
manipulações devem ser efectuadas numa câmara de segurança biológica ou outro equipamento fechado.
As barreiras secundárias incluem:
♦ Acesso controlado ao laboratório
♦ Sistema de ventilação especializado que minimize a libertação de aerossóis infecciosos

4. Nível 4 de segurança biológica (NSB-4)


È o nível mais elevado de segurança biológica. As práticas, equipamento, e instalações deste nível de
segurança biológica são apropriadas para o trabalho com microrganismos perigosos e exóticos que
constituam um elevado risco individual de contrair uma doença mortal, que podem ser
transmitidos por aerossóis, e para os quais não existe vacina ou terapia. Adicionalmente, agentes
microbianos com um perfil antigénico semelhante ou igual à dos agentes deste nível de segurança
biológica devem igualmente ser manuseados neste nível de segurança. Exemplos de microrganismos que
têm de ser manuseados neste nível de segurança são os vírus de Marburg e da febre hemorrágica do
Congo-Crimeia.

Os riscos primários para o pessoal que trabalhe neste nível de segurança são a exposição respiratória a
aerossóis infecciosos, exposição das membranas mucosas a gotículas infecciosas, e auto-inoculação.
Todas as manipulações de materiais de diagnóstico potencialmente infecciosos, microrganismos isolados,
e animais natural ou experimentalmente infectados constituem um risco de exposição e infecção para o
pessoal laboratorial, a comunidade, e o meio ambiente.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 9


A protecção completa do trabalhador contra o material infeccioso aerossolizado é obtida efectuando o
trabalho em câmaras de segurança biológica de classe III ou utilizando um fato individual com
fornecimento autónomo de ar e pressão positiva. As instalações de nível de segurança 4 são normalmente
um edifício separado ou uma zona completamente isolada equipada com complexos sistemas
especializados de ventilação e de gestão de resíduos para prevenir a libertação de agentes viáveis para o
meio ambiente.

Em todos os casos, o director do laboratório é o primeiro responsável pela operação em segurança do


laboratório. O seu conhecimento e julgamento são críticos na análise de riscos e aplicação apropriada
destas recomendações. Os níveis de segurança recomendados representam as condições de trabalho
que, uma vez adoptadas, permitem o trabalho em segurança com os diversos microrganismos. As
características particulares do agente usado, o treino e a experiência do pessoal, e a natureza ou
funções do laboratório podem também influenciar o director na aplicação destas recomendações.

Tabela 1.6. Resumo dos níveis de segurança biológica recomendados para agentes infecciosos
Equipamento de Instalações
Nível de segurança
Agentes Práticas segurança (barreiras
biológica (NSB)
(barreiras primárias) secundárias)
Práticas
Não causam doença Obrigatória bancada
NSB-1 microbiológicas Não requerido
em adultos saudáveis aberta com lavatório
padronizadas
• Associados com Práticas de NSB-1 • Utilização de NSB-1 mais:
doenças mais: câmaras de
humanas. • Acesso segurança • Autoclave
limitado biológica de disponível
• Perigos • Sinais classe I ou II
primários: auto avisadores de para
inoculação, perigo manipulações
ingestão, • Precauções de agentes que
exposição das contra originem
membranas objectos salpicos e
NSB-2 mucosas pontiagudos formação de
• Manual de aerossóis de
segurança material
biológica infeccioso.
definindo • Batas,
métodos de • Luvas,
descontaminaç • Protecção
ão de resíduos facial quando
e políticas de necessária
vigilância
médica
• Agentes Práticas de NSB-2 • Utilização de NSB-2 mais:
indígenas ou mais: câmaras de • Separação
exógenos com • Acesso segurança física dos
potencial para controlado, biológica de corredores
transmissão por • Descontamina classe I ou II gerais de
NSB-3 aerossóis; ção de todos para a acesso
os resíduos manipulação de • Acesso com
• A doença • Descontamina todos os portas duplas e
provocada pelos ção das vestes agentes que se fechem
microrganismos laboratoriais • Bata, automaticament
pode ter antes de as • Luvas, e

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 10


consequências lavar, • Protecção • Ar exaurido
sérias ou mesmo • Obtenção de respiratória não reciclável
mortais um colheita de quando • Fluxo de ar
soro para necessário com pressão
determinar negativa para
níveis de base. dentro do
laboratório
• Agentes Práticas de NSB-3 • Todos os NSB-3 mais:
perigosos/exótic mais: procedimentos • Edifício
os que efectuados em separado ou
provocam • Troca de câmaras de zona isolada
doenças mortais, roupa antes de segurança • Sistemas
infecções entrar biológica de dedicados de
transmitidas por • Duche à saída classe III fornecimento e
aerossóis; • Todo o ou exaustão de ar ,
material • Todos os de vácuo, e de
ou descontaminad procedimentos descontaminaçã
o à saída das efectuados em o
NSB-4 • Agentes instalações câmaras de • Outros
relacionados segurança de requerimentos
com vias de classe I ou II descritos no
transmissão em combinação texto
desconhecidas com a
utilização de
fatos pessoais
de corpo
inteiro, com
fornecimento
de ar e pressão
positiva

1.4. A segurança biológica em laboratório de ensino da Microbiologia


Para o ensino laboratorial de cursos de nível introdutório de Microbiologia Geral, em que se manuseia
essencialmente estirpes bem definidas e caracterizadas de microrganismos viáveis que são inócuos para o
adulto saudável e constituem um perigo mínimo para o pessoal laboratorial e para o meio ambiente, são
apropriadas práticas, equipamento e instalações de Nível 1 de Segurança Biológica (NSB-1). O trabalho
é geralmente conduzido em bancada aberta usando práticas microbiológicas padronizadas. Geralmente
não é necessário nem utilizado equipamento de contenção especial nem edifícios especiais. Os alunos, o
pessoal auxiliar e de limpeza, e o pessoal de manutenção, devem ter treino específico nos procedimentos
efectuados no laboratório, e a sua actividade tem de ser supervisionada por um cientista ou professor com
treino geral em microbiologia ou ciência relacionada.

As práticas microbiológicas padronizadas e específicas, equipamento de segurança e instalações são as


aplicadas a agentes de nível 1 de segurança biológica:

Práticas Microbiológicas Padronizadas


1. O acesso ao laboratório é limitado ou restrito à discrição do director do laboratório quando estão em
curso experiências ou trabalho com culturas e amostras de microrganismos.
2. As mãos devem ser lavadas:
• Após lidar com materiais contendo microrganismos viáveis
• Após lidar com animais,
• Após a remoção das luvas,
• Antes de deixar o laboratório.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 11


3. Comer, beber, fumar, manusear lentes de contacto, e aplicar cosméticos não são permitidos nas áreas
de trabalho onde exista a possibilidade de exposição, mesmo que remota, a materiais infecciosos.
4. Os indivíduos que utilizam lentes de contacto no laboratório devem usar óculos ou uma máscara
facial.
5. Os alimentos são guardados e conservados fora da área de trabalho em armários e frigoríficos
utilizados somente com este objectivo.
6. A pipetação à boca é proibida; têm de ser utilizados dispositivos de pipetação automática.
7. Todos os procedimentos são executados cuidadosamente para evitar a libertação de aerossóis,
salpicos ou derrames.
8. As superfícies de trabalho deverão ser descontaminadas pelo menos uma vez por dia e após qualquer
derrame de material infeccioso.
9. Todas as culturas, stocks, e outros resíduos infecciosos formados deverão ser descontaminados antes
da sua rejeição por um método de descontaminação aprovado (ex. autoclavagem).
10. Os materiais a descontaminar fora da área do laboratório devem ser colocados num contentor
durável, à prova de fugas, que deverá ser fechado antes do transporte. A embalagem e transporte final
dos lixos infecciosos devem obedecer às regulamentações exigidas pelas autoridades locais.
11. Deverá ser implementado um programa de controlo de insectos e roedores.

Práticas microbiológicas específicas


Não são requeridas nenhumas práticas microbiológicas específicas.

Equipamento de segurança (barreiras primárias)


1. Não são geralmente requeridos dispositivos ou equipamentos especiais de segurança para a
manipulação de agentes microbianos de NSB-1.
2. Deve ser utilizada bata ou uniforme para prevenir a contaminação das roupas. A bata deve ser vestida
à entrada do laboratório e retirada à saída do laboratório.
3. Devem ser utilizadas luvas no caso de haver feridas nas mãos ou quando a pele das mãos está gretada
ou queimada.
4. Devem ser utilizados dispositivos de protecção dos olhos (óculos ou máscaras) quando se antecipa
que o trabalho laboratorial poderá provocar derrames, salpicos ou aerossóis infecciosos.

Instalações laboratoriais (barreiras secundárias)


1. Cada laboratório deve ter um lavatório de mãos.
2. O desenho laboratorial é de molde a que seja facilmente limpo. Não devem existir tapetes porque a
sua descontaminação é muito difícil.
3. Os tampos das bancadas devem ser impermeáveis à água e resistentes aos ácidos, bases, solventes
orgânicos, e calor moderado.
4. O mobiliário laboratorial deve ser rígido e duradouro. Os espaços entre as bancadas, e entre os
equipamentos deve ser acessível para limpeza.
5. No caso do laboratório ter janelas que abrem, estas devem estar equipadas com mosquiteiros.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 12


CAPÍTULO 2- Estudo da célula bacteriana por microscopia óptica: exame a fresco e após
coloração.

2.1. Introdução
O exame microscópico é a primeira etapa do estudo e identificação de um microrganismo e permite
observar e analisar a forma, tamanho e organização/agrupamento dos microrganismos. Alguns destes
parâmetros são mais característicos e mais fáceis de observar quando os microrganismos estão no seu
habitat natural do que quando estão em cultura in vitro à longo tempo. Em materiais ou produtos que
contenham uma flora microbiana múltipla e complexa o exame microscópico directo pode permitir
determinar a proporção relativa das espécies microbianas presentes.

Exame a fresco
No exame a fresco, os microrganismos em suspensão em água, soro fisiológico, meio de cultura, produto
biológico, etc, são colocados entre lâmina e lamela e observados ao microscópio utilizando normalmente
a objectiva de 40X, o condensador em baixo e o diafragma ligeiramente fechado de modo a que não entre
demasiada luz. O exame a fresco permite uma primeira observação da morfologia e modo de
agrupamento dos microrganismos (Fig. 1.1). Uma vez que as células são observadas vivas, o exame a
fresco permite ainda o estudo da eventual mobilidade bacteriana.

• Morfologia e tipo de agrupamento

Figura 1.1 - Formas bacterianas mais comuns e tipos de agrupamento

• Mobilidade bacteriana
De um modo geral, a mobilidade das bactérias deve-se à existência de flagelos. Bactérias sem flagelos
são normalmente imóveis (ex. Klebsiella spp, Moraxella spp). A disposição dos flagelos é característica
das diferentes espécies bacterianas e determina o tipo de mobilidade. Uma bactéria monótrica possui um
único flagelo; se o flagelo está disposto num dos pólos da bactéria a flagelação é polar (ex. Pseudomonas
spp) (Fig. 1.2.a). Uma bactéria anfítrica possui um único flagelo em cada um dos pólos. As bactérias
lofótricas possuem um tufo de flagelos num dos pólos ou em ambos os pólos bacterianos (Fig. 1.2.b). As
bactérias perítricas possuem flagelos dispersos por toda a célula (ex. E. coli, Proteus spp., Salmonella
spp.) (Fig. 1.2.c).

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 13


(a) (b) (c)

Figura 1.2 – Localização dos flagelos. (a) flagelação polar; (b) flagelação lofótrica; (c) flagelação
perítrica.

A bactéria move-se quando o flagelo entra em rotação. A direcção da rotação flagelar determina a
natureza da movimentação bacteriana (Fig. 1.3). A movimentação para a frente das bactérias monótricas
ocorre quando o flagelo roda no sentido contrário ao dos ponteiros do relógio; invertendo o sentido da
rotação flagelar a bactéria pára e roda sobre si própria. Um mecanismo semelhante determina a
mobilidade para a frente das bactérias perítricas.

Frente
(a)
Sobre si
própria
(b)
Frente
(c)

Sobre si
(d) própria

Figura 1.3 – Movimentação flagelar. Relação entre rotação flagelar e mobilidade bacteriana. (a) e (b)
ilustram a mobilidade de bactérias monótricas, polares. (c) e (d) ilustram a mobilidade de bactérias
perítricas.

É necessário saber distinguir se a mobilidade bacteriana observada microscopicamente é real, se é


provocada por correntes de convexão, caso em que todas as bactérias se movimentam numa única
direcção e sentido, ou se é um simples movimento Browniano em que as bactérias oscilam mas não se
deslocam.

Também se pode verificar se determinada bactéria é móvel ou imóvel por inoculação por picada central
de um meio de cultura semi-sólido em tubo, por exemplo o meio de manitol-mobilidade. A bactéria
móvel irá multiplicar-se em todo o meio turvando completamente o meio; o crescimento das bactérias
imóveis irá confinar-se ao local da inoculação.

Exame após coloração


Nas colorações são usados corantes que tingem as células aumentando o seu contraste, o que permite
melhor observação ao microscópio óptico. As técnicas são executadas sobre esfregaços secos e fixados
pelo calor ou pelo álcool. Nestes esfregaços as formas vegetativas bacterianas morrem, tornam-se
permeáveis aos corantes e aderem à lâmina devido à precipitação do material proteico do citoplasma.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 14


O exame após coloração permite obter uma definição mais precisa da morfologia microbiana, diferenciar
algumas bactérias devido a diferentes afinidades por corantes e ainda evidenciar detalhes da estrutura
bacteriana.
Os corantes são compostos orgânicos e têm afinidades específicas para cada tipo de material celular. Os
mais comuns são os corantes catiónicos que se combinam com constituintes celulares carregados
negativamente (ex. ácidos nucleicos e polissacáridos acídicos). Como as superfícies das células são
geralmente carregadas negativamente estes corantes são também bons corantes gerais (as células ficam
todas da mesma cor).
A observação microscópica é sempre feita com a objectiva de imersão (100x), usando óleo de imersão,
com o condensador em cima e o diafragma aberto.

a) Coloração simples - usa-se um só corante que confere a mesma cor a todos os microrganismos, é de
execução técnica simples e rápida e, como não danifica muito as células, é utilizada principalmente para
estudos morfológicos.

Coloração pelo azul-de-metileno:


O corante único (catiónico) combina-se com os grupos negativos do protoplasma bacteriano,
especialmente com os grupos fosfato dos ácidos nucleicos, e essa ligação mantém-se mesmo após a
remoção do excesso de corante por lavagem com água.

b) Coloração diferencial - como o nome indica permite diferenciar bactérias que não coram do mesmo
modo, sendo utilizado mais do que um corante e, necessariamente, uma solução de descoloração. A mais
comum é a coloração de Gram.

Coloração de Gram:
Foi descoberta pelo médico Dinamarquês Christian Gram em 18831 (Anexo 1) e baseia-se na diferença de
composição química e espessura das paredes bacterianas que condiciona a permeabilidade ao álcool e à
acetona e, em consequência, a dissolução mais ou menos rápida de complexos corados formados no
citoplasma.
Esta coloração permite dividir as bactérias em dois grandes grupos: as bactérias Gram (+) e as bactérias
Gram (-). As bactérias Gram (+), quando tratadas por um corante p-rosanilina trimetilmetano como o
violeta de metilo, o cristal violeta, ou o violeta de genciana (mistura dos dois primeiros) e seguidamente
por uma solução contendo iodo que genericamente se designa de mordente e que permite permite a
melhor penetração do corante (ex. lugol no caso da coloração de Gram), fixam o corante de tal modo que
este não é removido pela solução de descoloração, o álcool-acetona. Exemplos: Staphylococcus sp.,
Streptococcus sp., Bacillus sp..
As bactérias Gram (-), pelo contrário, são descoradas pela solução de álcool-acetona, porque o complexo
violeta/iodeto formado é dissolvido e extraído através de membrana externa. Para que depois se possam
observar melhor, são novamente coradas por um corante de contraste, geralmente vermelho-rosa (fucsina
diluída), que as distingue das bactérias Gram (+), corados de violeta. Exemplos: Famílias
Enterobacteriaceae e Pseudomonadaceae.
A coloração de Gram depende da idade da cultura bacteriana. Assim, a positividade ao Gram enfraquece
com o envelhecimento de forma que, por ex., uma cultura de bacilos Gram (+), apresenta sempre alguns
elementos Gram (-). Existem ainda bactérias Gram intermediárias que se descoram facilmente, e
bactérias Gram variáveis em que coexistem elementos bacterianos Gram (+) e elementos Gram (-).

c) Colorações especiais - a sua aplicação permite pôr em evidência detalhes da estrutura bacteriana
(flagelos, cápsulas, esporos núcleos ou inclusões citoplasmáticas), e ainda corar bactérias não coráveis ou
dificilmente coráveis pelas técnicas habituais. São geralmente mais complexas e morosas.

1
Gram, C. 1884. Ueber die isolirte Farbung der Schizomyceten in SchnittÄund Trockenpraparaten. Fortschritte der
Medicin, Vol. 2: 185-189.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 15


Coloração de Micobactérias de Ziehl-Neelsen e de Kinyoun
A superfície bacteriana das bactérias do género Mycobacterium é rica em ácidos micólicos (lípidos
complexos, ramificados, com cadeias longas). Estes lípidos tornam a membrana das Micobactérias pouco
permeável aos corantes usuais do Gram e impermeável a uma solução de descoloração constituída por
etanol e ácido clorídico. Diz-se assim que estas bactérias são álcool-ácido resistentes. A única maneira de
corar o protoplasma destas bactérias é usando uma solução de fucsina em fenol (fucsina de Ziehl
contendo 8% de fenol ou fucsina de Kenyoun contendo 5% de fenol). Uma vez coradas com fucsina as
micobactérias resistem à descoloração com uma solução constituída por etanol e ácido clorídico. A
solução de álcool-ácido consegue penetrar em todas as outras células, bacterianas ou não (não ácido-
álcool resistentes), removendo a fucsina; estas células são posteriormente coradas pelo azul-de-metileno.
A coloração de Kinyoun, ao contrário da de Ziehl-Neelsen, é efectuada a frio. Nestas duas colorações as
Micobactérias apresentam-se como finos bacilos vermelho-rosa, ligeiramente encurvados, que se
destacam nitidamente do fundo azul da lâmina.

Coloração da cápsula
Muitas bactérias segregam à sua superfície substâncias viscosas de composição variável, constituídas por
polissacáridos, glicoproteínas, poliálcoois e açúcares aminados que podem ser espessas ou finas, rígidas
ou flexíveis, dependendo da natureza química, e que têm funções de aderência a superfícies, protecção
bacteriana contra dessecação, contra as células do sistema imunológico, e contra outras agressões
exteriores.

A cápsula é uma secreção que adere à célula sob a forma de uma camada externa, disposta de modo
compacto em torno da superfície celular. É possível visualizar a cápsula, pela coloração negativa pela
tinta-da-china por via húmida, dado que a cápsula rejeita as partículas de tinta-da-china. As células
produtoras de cápsula vêem-se (com a objectiva de 40x), descoradas sobre fundo negro.
Pode ainda observar-se a cápsula utilizando uma variante da coloração anterior em que se aplica fucsina
diluída sobre um esfregaço seco das células, com tinta-da-china. As células produtoras de cápsula vêem-
se (com a objectiva de 100x), coradas de rosa, rodeadas por halos incolores, sobre fundo negro.

Coloração de endosporos
O endosporo bacteriano representa uma forma de resistência a condições ambientais desfavoráveis. Os
géneros Bacillus, Clostridium e Sporosarcina são caracteristicamente esporulados. No exame a fresco os
esporos são visíveis através da sua refringência e como são impermeáveis aos corantes habituais,
aparecem como zonas transparentes no interior da bactéria em preparações coradas.
É possível no entanto, corar endosporos, recorrendo à coloração de Möller, muito semelhante à
coloração de Ziehl-Neelsen, dado que também os endosporos são ácido resistentes. Após a coloração,
visualizam-se os esporos corados de vermelho e o protoplasma de azul.

Coloração de flagelos
Os flagelos bacterianos são orgãos de locomoção (Fig. 1.2). São muito finos (10 - 30 nm de diâmetro) e
só podem ser vistos directamente em microscopia electrónica. Para serem observados ao microscópio
óptico o diâmetro dos flagelos tem que ser aumentado. Para isso são revestidos com mordentes como, por
exemplo, o alúmen de potássio, e posteriormente corados com fucsina (método de Gray) ou nitrato de
prata (método de West). Estas colorações permitem observar a disposição flagelar o que é importante na
identificação de algumas espécies bacterianas.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 16


2.2 - Protocolos experimentais
Os alunos irão realizar o exame a fresco entre lâmina e lamela de algumas espécies bacterianas
(Escherichia coli, Proteus mirabilis, Pseudomonas sp., Staphylococcus epidermidis) com a finalidade de
fazer os respectivos estudos de mobilidade e morfologia. Aprofundarão o estudo da morfologia
realizando uma coloração simples pelo azul-de-metileno e uma coloração diferencial (coloração de
Gram), aprendendo também a classificar as bactérias como Gram (+) ou Gram (-). Os alunos irão também
realizar a coloração da cápsula (Klebsiella pneumoniae) e a coloração de Ziehl-Neelsen para
micobactérias (Mycobacterium smegmatis).

Durante as manipulações microbiológicas é fundamental evitar a contaminação dos instrumentos, dos


meios de cultura estéreis, e das próprias culturas microbianas com microrganismos do meio ambiente, de
objectos não estéreis, das mãos, etc. Isto implica trabalhar sempre junto à chama de um bico de bunsen,
ou numa câmara de segurança biológica. As caixas contendo meios de cultura não devem ser abertas
senão no momento da sua inoculação, e devem ser imediatamente fechadas após a inoculação. Quando se
abre um frasco estéril deve passar-se o gargalo à chama do bico de bunsen para eliminar microrganismos
contaminantes do ar, etc. Todas as manipulações efectuadas no laboratório de microbiologia devem,
portanto, ser manipulações assépticas.

Exame a fresco e após colorações pelo azul-de-metileno e pelo método de Gram

1) Escolher um tubo com meio BHI previamente inoculado com uma das bactérias a estudar e que estará
supostamente, em fase exponencial de crescimento.

2) Em cada uma de três lâminas, e usando uma ansa, colocar 3 ou 4 gotas de cultura.

3) Na 1ª lâmina realizar o exame a fresco:


• Cobrir com uma lamela e observar ao microscópio óptico com a objectiva de 40x

4) Na 2ª lâmina realizar a coloração pelo azul-de-metileno:


• Espalhar com a ansa e deixar secar (esfregaço)
• Fixar à chama
• Deixar arrefecer
• Corar com azul de metileno durante 3 minutos
• Lavar e secar
• Observar ao microscópio óptico com a objectiva de imersão (100x)

5) Na 3ª lâmina realizar a coloração de Gram:


• Espalhar com a ansa e deixar secar (esfregaço)
• Fixar à chama
• Deixar arrefecer
• Lavar com água
• Corar com cristal violeta durante 1 minuto
• Rejeitar o cristal violeta utilizando o lugol e deixar actuar durante 1 minuto
• Lavar a pinça com que se segura a lâmina, com álcool-acetona, e depois com água
• Lavar o reverso da lâmina com álcool-acetona, e depois com água
• Lavar o esfregaço com álcool-acetona durante 3 ou 4 segundos
• Lavar com água
• Corar com fucsina diluída durante 1 minuto
• Lavar e secar
• Observar ao microscópio óptico com a objectiva de imersão (100x)

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 17


Colorações da cápsula
1) Escolher um tubo com meio BHI previamente inoculado com Klebsiella pneumoniae.
2) Usando uma ansa, colocar 2 ou 3 gotas de cultura em duas lâminas.
3) Numa das lâminas realizar a coloração da cápsula (coloração negativa pela tinta da china):
• Depositar na lâmina uma gota de tinta-da-china ao lado das gotas de cultura
• Cobrir com uma lamela e comprimir entre folhas de papel absorvente até a camada de líquido ser
tão fina que fique só levemente corada, e as células bacterianas imobilizadas entre lâmina e lamela
• Observar ao microscópio óptico com a objectiva de (40x)
4) Na 2ª lâmina realizar a coloração da cápsula pelo método da tinta-da-china e fucsina diluída:
• Depositar na lâmina uma gota de tinta-da-china ao lado das gotas de cultura
• Fazer deslizar uma lâmina sobre a primeira fazendo um esfregaço
• Secar ao ar
• Corar com fucsina diluída durante 2 minutos
• Lavar cuidadosamente com água
• Secar
• Observar ao microscópio óptico com a objectiva de imersão (100x)

Coloração de Micobactérias pelo método de Ziehl-Neelsen


1) Escolher um tubo com meio BHI previamente inoculado com Mycobacterium smegmatis.
2) Realizar a coloração de Ziehl-Neelsen:
• usando uma ansa, colocar 5 ou 6 gotas de cultura numa lâmina
• espalhar com a ansa e deixar secar (esfregaço)
• fixar à chama
• deixar arrefecer
• corar com fucsina de Ziehl aquecendo até à emissão de vapores mas sem deixar entrar em ebulição
• repetir 3 vezes totalizando cerca de 10 minutos (se necessário adicionar mais fucsina)
• lavar com água
• descorar com uma mistura álcool-ácido durante 5 minutos (de minuto a minuto lavar e renovar o
álcool-ácido)
• lavar com água
• corar com azul de metileno durante 30 segundos
• lavar e secar
• observar ao microscópio óptico com a objectiva de imersão (100x)

Coloração de Micobactérias pelo método de Kinyoun (a frio)


1. Preparar um esfregaço homogéneo, delgado e identificado numa lâmina nova desengordurada, limpa
e seca;
2. Deixar secar à temperatura ambiente;
3. Fixar o material do esfregaço passando 3 a 4 vezes pela chama do bico de Bunsen;
4. Cobrir a totalidade da superfície do esfregaço com solução de Fucsina fenicada (fucsina de Kinyoun)
previamente filtrada, deixando agir por cerca de 5 minutos, adicionando mais corante se preciso
dentro deste período, evitando que a lâmina seque;
5. Lavar em água corrente para eliminar a fucsina.
6. Cobrir toda a superfície do esfregaço com a solução de álcool-ácido. Tomar a lâmina entre o polegar
e o indicador e fazer um movimento de vai-e-vem, de modo que o álcool-ácido vá descorando
suavemente a fucsina. Se o esfregaço estiver ainda com a cor vermelha ou rosada, descora-se
novamente. Considera-se descorado o esfregaço, quando suas partes mais grossas conservarem
somente um ligeiro tom rosado. Essa operação dura, em geral, dois minutos;
7. Terminada a fase de descoloração e eliminado o álcool-ácido, lavar a lâmina da mesma forma como
se procedeu depois da coloração com a fucsina, com cuidado para não desprender a película;

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 18


8. Cobrir toda a superfície do esfregaço com solução de azul de metileno durante 30 segundos a 1
minuto;
9. Lavar, da mesma forma como se indicou para a fucsina, tanto o esfregaço como a parte inferior da
lâmina;
10. Colocar a lâmina com o esfregaço para cima sobre papel limpo para secar à temperatura ambiente ou
estufa a 35º C;
11. Observar ao microscópio com objectiva de imersão (100 x).

Fucsina fenolada de Kinyoun


Fucsina básica 4 gr dissolvida em 20 ml de etanol 90-95%. Juntar 100 ml de solução aquosa de fenol a
8%.

Observação de endosporos e flagelos bacterianos


Escolher uma lâmina previamente preparada com coloração de endosporos e também uma lâmina com
coloração de flagelos e observar ao microscópio óptico com a objectiva de imersão (100x).

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 19


2.3. Resultados e discussão
1 - Observe e anote a forma e o tipo de movimento (se for móvel) das bactérias que estudou no exame a
fresco.
2 - Confirme a forma e observe o tipo de agrupamento das mesmas bactérias recorrendo à coloração pelo
azul-de-metileno.
3 - Classifique as bactérias estudadas como Gram (+) ou Gram (-).
4 - Classifique os bacilos estudados como ácido-álcool resistentes ou não.
5- Classifique as bactérias estudadas em relação à cápsula.
6 - Anote as suas observações sobre o número e localização dos endosporos e sobre a o número e
localização dos flagelos.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 20


CAPÍTULO 3- Cultura e isolamento de bactérias
3.1 - Introdução
Generalidades
A maior parte das técnicas bacteriológicas (conservação, isolamento, identificação, ou contagem de
bactérias), exigem a utilização de meios de cultura, sendo a composição dos meios de cultura função dos
conhecimentos sobre os princípios de nutrição microbiana. Os meios de cultura devem conter, de uma
forma utilizável, os nutrientes necessários ao crescimento das bactérias, nomeadamente, macronutrientes
(C, H, N, O, P, S, K, Mg, Na, etc.), micronutrientes (Fe, Cu, Zn, etc.), e factores de crescimento (por ex.
vitaminas e aminoácidos). Para que se observe crescimento bacteriano há ainda que incubar os meios em
condições adequadas de pH, tensão de oxigénio e temperatura.
Somente em casos excepcionais, se pode identificar uma bactéria pelos seus caracteres morfológicos. É
portanto essencial obtê-la em cultura em meio artificial e, na hipótese de estarem presentes diversas
espécies, separá-las ou isolá-las em cultura pura, para se poderem efectuar testes de identificação de
natureza bioquímica.
Para cultivar uma espécie bacteriana deve adicionar-se a um meio de cultura estéril adequado uma
pequena amostra contendo células vivas da espécie. A essa amostra chama-se inóculo, e à adição desse
inóculo ao meio, chama-se inoculação. O meio inoculado é então incubado em condições convenientes
de temperatura, humidade, etc., durante um certo tempo.
Durante a incubação, as bactérias multiplicam-se e formam uma cultura, o que se define como uma
população de bactérias (organismos) que se desenvolve num meio ou à sua superfície.

Classificação dos meios de cultura


Os meios de cultura podem ser classificados em função da sua consistência, composição e tipo de
utilização.

a) Consistência

Existem meios de cultura em três estados físicos:


• líquido
• semi-sólido
• sólido

Os meios líquidos, como os caldos nutritivos de crescimento, podem ser utilizados para a multiplicação
de microrganismos em estudos de fermentação e em vários testes bioquímicos. Apresentam no entanto,
dois inconvenientes: 1) as culturas desenvolvidas não revelam em geral quaisquer características
especiais e portanto o seu valor é limitado na identificação de bactérias; 2) é impossível a separação de
espécies bacterianas que se encontrem em misturas.
Ao contrário dos meios líquidos, os meios sólidos e semi-sólidos contêm um agente solidificante,
normalmente o agar. O agar é um polissacárido complexo extraído de uma alga marinha (agar-agar) e
tem várias propriedades que o tornam um agente solidificante ideal, incluindo ficar transparente no ponto
de ebulição da água, não ser um nutriente para a maior parte dos microrganismos e não ser metabolizado
durante o crescimento microbiano.
Os meios semi-sólidos (aos quais são adicionados geralmente 5 g/l de agar) podem ser utilizados em
estudos de fermentação, estudos de mobilidade bacteriana (ex.: meio manitol-mobilidade) e na promoção
do crescimento de bactérias anaeróbias.
Os meios sólidos (aos quais são adicionados geralmente 15 g/l de agar) permitem observar as colónias
das diferentes bactérias que se desenvolvem à superfície (e por vezes no interior) do meio e que mostram
muitas vezes aspecto e cor diferentes, auxiliando a sua posterior identificação. São praticamente
indispensáveis à obtenção de culturas puras. São ainda utilizados para a conservação de culturas, e
permitem observar determinadas reacções bioquímicas específicas (ver meios diferenciais).

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 21


Uma colónia é um número elevado de células bacterianas (109) em meio de cultura sólido que é visível a
olho nú como uma entidade discreta. Assume-se que uma colónia provém de uma única célula e portanto
representa um clone de uma cultura pura.

b) Composição
Os microrganismos podem ser cultivados utilizando dois tipos diferentes de meios. Os meios sintéticos,
ou quimicamente definidos que são compostos por produtos químicos bem definidos e dissolvidos em
água destilada em proporções determinadas, de modo a constituir uma solução de nutrientes devidamente
tamponada (ex. meio de citrato de Simmons), e os meios complexos, compostos por uma variedade de
substâncias nutricionalmente indefinidas, de origem animal, vegetal ou microbiana como por exemplo,
extracto de carne, peptonas, e extracto de levedura, que são naturalmente ricos em nutrientes e vitaminas.
Como exemplos destes meios têm-se as geloses de McConkey, Drigalsky ou Endo.

c) Tipo de utilização

Meios de isolamento
Os meios de isolamento permitem a obtenção de culturas puras e podem ser de vários tipos:

Meios basais - Permitem o crescimento de bactérias pouco exigentes. Não existe um meio de cultura
universal (ex. caldo nutritivo, água peptonada, triptona sal, gelose nutritiva).

Meios selectivos - Permitem o crescimento só de um tipo de bactérias em detrimento das outras cujo
crescimento é inibido. Torna-se útil, no caso de uma população plurimicrobiana, porque permite
favorecer a cultura preferencial de certas bactérias.

Meios diferenciais - São utilizados quando se pretende diferenciar entre vários microrganismos
presentes no meio de cultura. Por exemplo, no caso da gelose sangue, dado que algumas bactérias
produzem enzimas (hemolisinas) que vão lisar os glóbulos vermelhos enquanto outras não; dependendo
do padrão de hemólise pode-se distinguir entre bactérias hemolíticas (Streptococcus pyogenes) e não
hemolíticas.

Meios selectivos e diferenciais - Alguns meios de cultura são simultaneamente selectivos e diferenciais.
São sobretudo utilizados em microbiologia clínica e na área da saúde pública, como por exemplo na
determinação da qualidade da água ou num surto de intoxicações alimentares. Temos como exemplos
deste tipo de meio:
a. gelose de McConkey - É um meio selectivo, uma vez que contém sais biliares e cristal violeta
que inibem o crescimento das bactérias Gram positivas, permitindo o crescimento, apenas das bactérias
Gram negativas. É diferencial porque a lactose está presente neste meio e permite diferenciar entre as
bactérias Gram negativas que utilizam a lactose como substrato fermentativo e as que não utilizam. As
bactérias Gram negativas fermentadoras de lactose, tornam o meio ácido e o indicador de pH do meio de
cultura (vermelho de metilo) em meio ácido fica vermelho. As bactérias Gram negativas que não
fermentam a lactose, não acidificam o meio, e este permanece da cor original.
b. gelose de Drigalsky - É um meio muito semelhante ao anterior e contém, igualmente, lactose,
indicador de pH (azul de bromotimol), cristal violeta (inibidor das bactérias Gram positivas). Permite
distinguir também entre bactérias Lac + (fermentadoras de lactose) e Lac - (não fermentadoras de
lactose). As primeiras originam colónias de cor amarela (o pH do meio baixa devido à acumulação de
produtos de fermentação e o indicador “vira” para amarelo); as segundas originam colónias azuis (a cor
original do meio).
c. Meio de Chapman - É um meio selectivo para os estafilococos devido à elevada concentração
de cloreto de sódio (7.5 %) que somente aquelas bactérias suportam. Por conter manitol (um poliálcool
derivado de um açúcar - a manose) é também, diferencial (por ex.) para Staphylococcus aureus, uma vez
que as espécies potencialmente patogénicas do género Staphylococcus são fermentadoras de manitol. A
acumulação dos produtos de fermentação acidifica o meio, e o indicador de pH (vermelho de fenol)

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 22


“vira” de vermelho (cor original do meio) para amarelo, originando colónias amarelas rodeadas de um
halo também amarelo. As espécies de estafilococos não fermentadoras de manitol apresentam neste meio,
colónias incolores (ex. S. epidermidis).

Meios enriquecidos - Os ambientes naturais são geralmente habitados por populações de vários tipos de
bactérias. Quando uma espécie com especial interesse e nutricionalmemte exigente, se encontra presente
num determinado produto mas em número muito baixo, é fundamental a utilização de um meio muito
rico nutricionalmente e em que nenhum agente inibidor se encontre presente. Estes meios enriquecidos
são meios basais adicionados de produtos biológicos ricos em nutrientes como o soro, ovo ou sangue.
Exemplos: gelose sangue, gelose chocolate, “brain heart infusion” (BHI).

Gelose Chocolate - É um meio enriquecido com sangue previamente sujeito a aquecimento a 80ºC
durante 20 minutos o que promove a lise dos glóbulos vermelhos e lhe confere a cor castanha,
responsável pelo nome atribuído. A lise dos glóbulos vermelhos liberta para o meio extracelular,
proteínas, cujos cofactores são importantes factores de crescimento para bactérias muito exigentes (ex. o
grupo heme é fundamental para o crescimento de Haemophilus influenzae, agente importante de
meningites bacterianas em crianças).

Meios de enriquecimento
São meios líquidos, que favorecem o crescimento de determinadas espécies aumentando a sua quantidade
relativamente a outras, podendo conduzir depois a culturas puras por sobreposição de espécies (ex. meio
de enriquecimento para organismos fotoautotróficos - meio sem fonte de carbono adicionada; ex. caldo
de selenito de sódio para enriquecimento de fezes em Salmonella e Shigella, agentes causadores de
intoxicações alimentares).

Meios de transporte
Servem para o transporte de um determinado material biológico a partir do qual se propõe isolar um ou
mais organismos. É então importante manter a viabilidade dos microrganismos nele existentes sem que
haja multiplicação dos mesmos (durante um período de 48 a 72 horas) e também a sua quantidade
relativa no produto biológico para que depois a inoculação dos meios origine resultados que reflictam a
proporção relativa dos microrganismos nesse produto biológico (ex. meio de Stuart).

Meios de identificação
São meios que permitem pôr em evidência as características bioquímicas das bactérias e, por
conseguinte, resolver os problemas de identificação postos entre espécies (ex. meio Clark-Lubs - permite
distinguir entre bactérias que fazem a fermentação butanodiólica da glucose e bactérias que fazem a
fermentação ácida mista da glucose).

Meios de conservação
São meios que permitem a manutenção das bactérias num estado de vida latente durante meses, anos ou
décadas.

Reconstituição de meios de cultura (esquema geral)

a) Pesagem do meio liofilizado ou, no caso dos meios sintéticos, dos vários compostos químicos.
b) Adição de água destilada.
c) Dissolução completa dos componentes em banho-maria agitando periodicamente.
d) Esterilização (geralmente em autoclave).
e) Adição da fonte de carbono esterilizada por filtração, no caso dos meios sintéticos, uma vez que
soluções concentradas de glúcidos não devem ser submetidas a temperaturas elevadas porque
caramelizam.
f) Distribuição em tubos ou caixas de Petri após arrefecimento a 40 - 45º C.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 23


Técnicas de inoculação ou sementeira de meios de cultura sólidos

a) Inundação
É utilizada uma suspensão (que pode previamente ser submetida a várias diluições), com que se inunda a
superfície do meio sólido a usar. O excesso de inóculo é removido por sucção a vácuo após agitação e a
superfície do meio é deixada secar ao ar em atmosfera asséptica.

b) Espalhamento
É utilizada para contagem de colónias e o inóculo (suspensão) é, neste caso, aplicado à superfície de
meio sólido com um espalhador em L ou, simplesmente, com uma pipeta de Pasteur dobrada a quente, ou
ainda por intermédio de uma zaragatoa.

c) Estrias
A inoculação por estrias é realizada com a finalidade de obter colónias isoladas, e realiza-se à superfície
de meio sólido, com uma ansa de Henle, a partir de uma suspensão ou de uma colónia isolada (Fig. 3.1).

Figura 3. 1. Esquema da inoculação de meios de cultura sólidos pela técnica das estrias.

d) Incorporação
A inoculação por incorporação é utilizada para contagem de colónias à superfície e no interior de meio
sólido e realiza-se por incorporação do inóculo (suspensão) no meio, enquanto quente (não mais do que
40ºC para não destruir o inóculo) e portanto ainda liquefeito.

e) Picada central
Este tipo de inoculação é utilizado por exemplo, no estudo da mobilidade bacteriana e realiza-se por
picada central com a ansa de Henle, ou pipeta de Pasteur fechada, num meio gelosado em tubo.

Incubação dos meios de cultura inoculados


Após a inoculação e a devida identificação dos tubos ou caixas de Petri, os meios de cultura devem ser
incubados, isto é, colocados em estufas próprias para o efeito, em condições adequadas de temperatura,
humidade e tempo (geralmente em microbiologia clínica, 37ºC/24h, uma vez que quase todos os agentes
patogénicos são organismos mesófilos).

Leitura dos resultados


A observação dos resultados deve ser feita tendo em conta alguns aspectos como a densidade da cultura,
presença de pigmentos solúveis, a presença de odor característico e o aspecto da cultura, e
nomeadamente em meio sólido, a existência de colónias isoladas e suas características particulares (ver
3.1.7).

Aspecto das colónias crescidas em meio sólido (Fig. 3.2)

a) Tamanho
• Colónias pequenas - diâmetro (d) < 1 mm

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 24


• Colónias médias - 1.5 < d < 3 mm
• Colónias grandes - d > 3 mm

b) Forma geral
• Desenho dos contornos:
Bordos lisos regulares
Bordos irregulares
Bordos dentados
Bordos com prolongamento

• Forma de relevo:
Lisas
Convexas
semi-convexas
acuminadas
mamelonadas
umbilicadas

c) Transparência:
• Transparentes
• Translúcidas
• Opacas
• Lactescentes

d) Aspecto da superfície:
• Colónias lisas
Bordos regulares
Superfície lisa e brilhante por vezes
Consistência cremosa
Suspensão homogénea
Muitas vezes semi-convexas

• Colónias rugosas
Bordos muitas vezes dentados
Superfície rugosa, baça
Consistência pulvurulenta
Suspensão heterogénea
Sobretudo lisas

• Colónias mucosas
Bordos lisos e regulares
Convexas
Superfície lisa e brilhante
Suspensão heterogénea

e) Pigmentação:

A elaboração de um pigmento por certas bactérias pode ser um elemento precioso de identificação.
Exemplos:
Serratia marcescens - colónias vermelhas
Pseudomonas aeruginosa - colónias verdes azuladas (pigmentos - pioverdina e piocianina)

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 25


Forma
Forma
Ponto
Ponto Circular
Circular Filamentosa
Filamentosa Irregular
Irregular Rizoidal
Rizoidal Fuso
Fuso

Elevação
Elevação
Achatada
Achatada Elevada
Elevada Convexa
Convexa Pulverulenta
Pulverulenta Umbilical
Umbilical

Margem
Margem
Inteira
Inteira Ondulada
Ondulada Lobulada
Lobulada Erusionada
Erusionada Filamentosa
Filamentosa Encaracolada
Encaracolada

Figura 3. 2. Representação esquemática da forma, elevação e margem das colónias bacterianas


obtidas em meio sólido.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 26


3.2 - Protocolos experimentais

Utilizando bactérias em meio líquido:


1) No meio de tripticase-soja-agar (TSA), inocular por espalhamento E. coli, utilizando uma pipeta
Pasteur como espalhador.
2) No meio de Drigalsky, dividir a placa em duas partes e inocular Proteus spp. e E. coli por estrias,
usando a ansa de Henle.
3) No meio de Chapman, dividir a placa em duas partes e inocular Staphylococcus spp. e E. coli por
estrias, usando a ansa de Henle.

4) Na gelose chocolate, dividir a placa em três partes e inocular por estrias, utilizando uma zaragatoa as
seguintes bactérias: E. coli, Proteus spp. e Staphylococcus spp.
5) Nos tubos de manitol-mobilidade, com a ansa de Henle, inocular Staphylococcus spp. e Proteus spp
por picada central.

Utilizando bactérias isoladas em meio sólido:

1) Com a ansa de Henle retirar 3 ou 4 colónias:


• de uma das bactérias inoculadas no meio de Drigalsky e suspender em soro fisiológico (SF) ou
meio BHI
• de uma das bactérias inoculadas no meio de Chapman e suspender em SF ou BHI

2) Com a ansa, tirar 4 ou 5 gotas das suspensões anteriores para lâminas, fazer esfregaços, e realizar para
cada uma a coloração de Gram.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 27


3.3 – Resultados e discussão

1) Classifique quanto à mobilidade as bactérias que inoculou no meio manitol-mobilidade.

2) Identifique as bactérias fermentadoras e não fermentadoras de lactose.

3) Identifique as bactérias fermentadoras e não fermentadoras de manitol.

4) Identifique a morfologia e o modo de agrupamento das bactérias estudadas.

5) Classifique as bactérias estudadas como Gram (+) ou Gram (-).

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 28


CAPÍTULO 4- Transformação genética da estirpe de E. coli HB101 pelo plasmídio pGLO

4.1 - Introdução

Definições
Genoma - Conjunto de genes
Genótipo - Conjunto de genes específicos de um organismo que determina um fenótipo (conjunto de
características físicas e biológicas observáveis).
Recombinação Genética - Processo pelo qual é formado um novo genoma recombinante que resulta da
combinação do material genético de dois organismos. Obtém-se um novo genótipo e, por vezes um novo,
um novo fenótipo.
A transferência de informação genética de uma célula dadora para uma célula receptora pode dar-se
segundo três processos:
Conjugação - Transferência de ADN entre bactérias em contacto físico através de um pili sexual.
Transdução - Transferência de ADN entre bactérias mediado por bacteriófagos.
Transformação - Transferência directa de um fragmento livre de ADN presente no meio ambiente. As
células receptoras têm obrigatoriamente que estar num estado de competência.
Estado de competência - Estado fisiológico em que são expressos receptores envolvidos na captação do
ADN e em que a célula bacteriana pode adquirir ADN exógeno e ser transformada. É um estado
complexo em que, por exemplo, é segregada uma proteína (factor de competência) que estimula a
produção de 8 a 10 novas proteínas necessárias à transformação. A frequência de transformação natural
pode ser muito aumentada tratando as células com cloreto de cálcio a frio.
O ADN transmitido por transformação pode ser de origem:
• Cromossomal - quando por exemplo células mortas sofrem lise nas proximidades de células
potencialmente receptoras.
• Plasmídico (Fig. 4.1)

Figura 4.1 – Representação esquemática da


transformação de bactérias por ADN plasmídico

Plasmídios bacterianos
São moléculas de ADN circular que podem existir nas bactérias ou fungos independentemente do ADN
cromossomal. Os plasmídios têm as suas próprias origens de replicação e portanto exibem replicação
autónoma. Têm geralmente poucos genes (< 30) e a informação que contêm não é, normalmente,
essencial à bactéria hospedeira. Pode existir um elevado número de cópias em cada célula bacteriana
(500 - 1000) ou apenas uma só cópia por célula. Os plasmídios podem ser eliminados por exposição a
agentes que inibem a sua replicação (radiações ultra violeta, radiações ionizantes _raios γ e X) ou por
crescimento a temperaturas acima da óptima. Este processo designa-se por cura plasmídica.
Os plasmídios podem ser de vários tipos:
• Factor F, factor de fertilidade ou plasmídio F - fundamental na conjugação bacteriana.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 29


• Plasmídios Col - conferem à bactéria hospedeira vantagens competitivas; codificam para pequenos
polipéptidos (bacteriocinas) que destroem outras bactérias que não a bactéria produtora.
• Plasmídios de virulência - tornam os seus hospedeiros mais virulentos (ex: há estirpes de E. coli que
têm plasmídios que codificam enterotoxinas que provocam diarreia).
• Plasmídios metabólicos - têm genes que codificam para enzimas que degradam determinados
substratos (lactose, tolueno, pesticidas).
• Plasmídios que conferem resistências a antibióticos (factor R, plasmídio R ou factor de resistência) -
têm genes que codificam enzimas que destroem ou modificam os antibióticos. O mesmo plasmídio
pode possuir vários genes de resistência, conferindo portanto resistência a vários antibióticos.

No laboratório, o ADN plasmídico pode ser introduzido em bactérias pelo processo artificial de
transformação, processo esse que é necessariamente iniciado pela extracção e purificação do ADN
plasmídico.

Regulação da expressão genética no operão arabinose


O operão arabinose é constituído por três genes designados araA, araB e araD que codificam para três
enzimas envolvidas na degradação catabólica da arabinose, um açúcar que é uma fonte de energia e
carbono para as bactérias (Figura 4.2). Estes genes são transcritos a partir de um único promotor, PBAD. A
transcrição dos três genes requer a presença simultânea da ARN polimerase, da proteína araC, uma
proteína de ligação ao ADN produzida pelo gene araC, e da arabinose. Quando existe arabinose, a
bactéria internaliza a arabinose que vai interagir directamente com a proteína araC. Esta interação faz
com que a araC altere a sua conformação o que favorece a ligação da ARN polimerase ao promotor PBAD
e, consequentemente, a transcrição dos genes araA, araB e araC. As três enzimas hidrolíticas catalizadas
por estes genes são produzidas e vão degradar a arabinose. Quando a arabinose se esgota a proteína araC
volta à sua forma original e deixa de ocorrer transcrição dos genes do operão arabinose.

Figura 4.2- Composição, estrutura e


regulação da expressão do operão
arabinose.

O plasmídio pGLO
O plasmídio pGLO tem 5,4 kpb, contém a origem de replicação ori, o gene GFP que codifica para a
green fluorescent protein, o gene bla que codifica para a β-lactamase e o gene araC que codifica para a
proteína araC (Fig. 4.3).

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 30


A GFP é uma proteína que quando exposta à luz ultravioleta liberta energia sob a forma de luz verde
visível. O gene que codifica para a GFP provém originalmente da anémona bioluminescente da espécie
Aequoria victoria. No pGLO, a expressão do gene GFP está sob o controlo do promotor PBAD.
A β -lactamase é uma proteína que confere resistência ao antibiótico ampicilina; a β-lactamase é
produzida e secretada pelas bactérias que contêm o plasmídio pGLO e inactiva a ampicilina adicionada
ao meio de cultura permitindo que estas bactérias cresçam na presença de ampicilina. As bactérias não
transformadas, que não contêm o plasmídio pGLO, não vão crescer em meio com ampicilina. Desta
forma o gene bla de resistência à ampicilina permite seleccionar as bactérias transformantes.

Figura 4. 3- Mapa físico do plasmídio pGLO

O sistema de regulação da expressão da GFP no pGLO é semelhante ao do operão arabinose uma vez que
está sob o controlo do promotor deste operão PBAD e da proteína araC. A expressão do gene GFP, e
consequente produção da proteína GFP, pode ser activada nas células transformadas pelo plasmídio
pGLO por adição da arabinose ao meio de cultura (Fig. 4.4). Na presença de arabinose, a proteína araC
vai recrutar a ARN polimerase para o promotor PBAD e a GFP é produzida. As células emitem tanto mais
fluorescência quanto mais GFP possuírem. Na ausência de arabinose, a araC não facilita a ligação da
ARN polimerase ao promotor e não há produção de GFP. As células não emitem fluorescência. Assim,
no meio de cultura sem arabinose as células transformadas aparecerão brancas (cor natural); no meio de
cultura com arabinose as células transformadas aparecerão verde fluorescente quando expostas aos raios
ultravioleta.

Figura 4.4- Expressão da GFP no plasmídio pGLO.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 31


Transformação Genética

A transformação genética envolve a inserção de um novo ADN em células receptoras (ex. E. coli) onde o
será expresso fazendo com que as bactérias transformantes adquiram uma nova característica fenotípica.
O processo de transformação requer que as células estejam em estado de competência em que exprimem
na sua parede proteínas receptoras do ADN. O estado de competência pode ser natural ou induzido
dependendo das bactérias.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 32


4.2 - Protocolo experimental
Pretende-se que os alunos executem uma experiência de transformação por ADN plasmídico. Para isso
serão fornecidas células competentes de E. coli HB101 e uma solução a 30 ng/µl do plasmídio pGLO.
Foram feitas algumas adaptações à técnica usual de transformação, de acordo com as condições das aulas
práticas.

1) Marque um tubo eppendorf com +pGLO e outro com –pGLO e ponha os tubos fechados nos suportes
de espuma ou esferovite.
2) Abra os tubos e, com uma pipeta Pasteur estéril, transfira 250 µl de solução de transformação (CaCl2)
para dentro de cada tubo.
3) Coloque os tubos em gelo.
4) Com a ansa descartável estéril retire uma única colónia isolada do meio de cultura e coloque no fundo
do tubo marcado +pGLO, rodando a ansa entre os dedos até que toda a colónia esteja bem dispersa no
meio de transformação. Coloque de novo o tubo no gelo. Repita o procedimento com o tubo marcado –
pGLO utilizando uma nova ansa estéril.
5) Insira uma nova ansa estéril no tubo contendo solução stock de ADN plasmídico pGLO. Retire a ansa
cheia de solução plasmídica, insira-a no tubo eppendorf rotulado +pGLO e rode lentamente a ansa no
fundo do tubo de forma a misturar o plasmídio com as células.
6) Incube os tubos rotulados +pGLO e –pGLO no gelo durante 10 min.
Durante esta fase o ADN plasmídico vai ligar-se a proteínas de transformação presentes na superfície das
células competentes com ajuda do CaCl2 que vai atenuar a natural repulsão electrostática existente entre
o ADN e moléculas existentes na superfície celular contendo carga negativa (ex. LPS).
7) Marque as caixas de Petri contendo as diversas versões de meio de Luria sólido (ML). Para cada
experiência deverá marcar:
a) Uma caixa de ML com –pGLO
b) Uma caixa de ML com ampicilina com +pGLO e uma outra com –pGLO.
c) Uma caixa de ML com ampicilina e arabinose (ara) com +pGLO.
8) Transfira os suportes com os tubos do gelo para o banho de água a 42oC e incube durante exactamente
50 segundos. Imediatamente, transfira de novo os tubos para o gelo e incube durante mais 2 minutos.
Durante este período ocorre o choque térmico essencial para que a célula internalize o plasmídio.
9) Retire o suporte contendo os tubos do gelo e coloque-o na bancada. Adicione a cada tubo, com a ajuda
de uma nova pipeta Pasteur estéril, 250 µl de meio L líquido. Feche os tubos e incube os tubos durante 10
min. à temperatura ambiente.
10) Agite levemente os tubos com os seus dedos e, com uma nova pipeta Pasteur estéril, transfira 100 µl
das suspensões para cada uma das placas de Petri contendo os diferentes ML sólidos que previamente
rotulou. Deverá transferir 100 µl de suspensão de -pGLO para as duas placas rotuladas com –pGLO (ML
e ML com ampicilina) e 100 µl de suspensão de +pGLO para as duas placas rotuladas com +pGLO ((ML
com ampicilina e ML com ampicilina e arabinose).
11) Espalhe as suspensões bacterianas por toda a área do meio de cultura utilizando para o efeito uma
nova ansa estéril.
12) Incube as placas a 37oC até ao dia seguinte.

Exemplo de cálculo da eficiência de transformação

Concentração do stock de ADN plasmídico 0.03µg/µl


Volume de solução de plasmídio utilizado na 10 µl
transformação (0.3 µg)
Volume de solução de transformação 250 µl
Volume de meio L 250 µl
Volume inoculado 100 µl
Volume total 510 µl

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 33


Nº de transformantes obtidos numa hipotética experiência – 190 colónias

Eficiência de transformação = nº de transformantes por µg ADN plasmídico

= 190 (colónias) x 5 (factor de diluição) x 1/0.3 (µg de ADN plasmídico) = 3166 ≈ 3,2 x 103
transformantes / µg de ADN plasmídico

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 34


4.3 – Resultados e discussão

1) Observe as 4 caixas e anote:

Se houve ou não crescimento


Tubo Meio Sim Não O que deveria observar
+pGLO LB/amp Nestas caixas devem crescer
+pGLO LB/amp/ara múltiplas colónias
-pGLO LB/amp Não deve haver crescimento
-pGLO LB Deve formar-se um tapete de colónias

Cor das bactérias


Tubo Meio Luz natural Luz UV O que deveria observar
+pGLO LB/amp Colónias brancas na luz natural
+pGLO LB/amp/ara Colónias verde fluorescente nos UV
-pGLO LB Colónias brancas na luz natural

Contar o nº de colónias em cada caixa de Petri


Tubo Meio Colónias O que deveria observar
+pGLO LB/amp Deve haver aproximadamente
+pGLO LB/amp/ara 75-300 Colónias
-pGLO LB Não se conseguem contar as colónias

2) Calcule a eficiência de transformação.

3) Discuta os resultados obtidos e apresente as suas conclusões.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 35


CAPÍTULO 5- Estudo da susceptibilidade bacteriana aos antibióticos

5.1 - Introdução

Definições
Antisépticos – Substâncias químicas com propriedades antimicrobianas com mecanismos de acção
inespecíficos e que podem ser utilizadas sobre os tecidos vivos (pele e membranas mucosas).
Desinfectantes – Substâncias químicas com propriedades antimicrobianas utilizadas sobre materiais
inertes, normalmente tóxicas para a pele e membranas mucosas.
Compostos antimicrobianos – Substâncias de origem natural, sintética, ou semi-sintética, que destroem
ou inibem os microrganismos exercendo a sua acção a nível molecular, num processo metabólico ou
numa estrutura celular concreta dos microrganismos.

Durante muito tempo foram denominados antibióticos todos os compostos antimicrobianos produzidos
por microrganismos, fungos (Penicillium, Cephalospurium) ou bactérias (Bacillus ou Streptomyces), que
inibiam o crescimento ou destruiam outros microrganismos. Esta definição é hoje muito restritiva e deve
ser abandonada porque as moléculas obtidas por síntese, ou por modificação química de uma molécula
natural, podem originar as mesmas propriedades.
Um antibiótico é actualmente definido como uma substância de origem biológica ou sintética que actua
especificamente sobre uma etapa essencial do metabolismo das bactérias (agentes antibacterianos que
podem ser classificados de acordo com a sua estrutura química ou modo de acção sobre as bactérias) ou
dos fungos (agentes antifúngicos). Esta definição abrange todos os compostos antimicrobianos com
excepção dos anti-sépticos e desinfectantes, qualquer que seja a sua origem.
Os antibióticos são utilizados na terapêutica de numerosas doenças infecciosas, daí serem também
designados por agentes quimioterapêuticos antimicrobianos.

O espectro de acção antimicrobiano dos antibióticos é o seu grau de eficácia antimicrobiana. No caso de
antibióticos de largo espectro significa que são activos contra um grande número de bactérias Gram (+)
e Gram (-). Os de baixo espectro são activos unicamente contra certas bactérias Gram (+) ou Gram (-)

Mecanismos de acção dos antibióticos


Os antibióticos actuam em geral (com excepção das polimixinas) sobre uma etapa essencial do
metabolismo bacteriano, principalmente sobre as reacções de síntese de:

• Proteínas (ex. tetraciclina)


• Peptidoglicano (ex. ampicilina)
• Ácidos nucleicos (ex. rifampicina)
• Folatos (ex. sulfonamidas)

Estudo da actividade de um antibiótico in vitro


As definições de efeito bacteriostático e de efeito bactericida de um antibiótico baseiam-se em estudos
experimentais. Coloca-se a bactéria em contacto com o antimicrobiano e estuda-se a sua sobrevivência
em função do tempo, fazendo variar a concentração de antibiótico (Fig. 5.1).

Efeito bacteriostático de um antibiótico - Para baixas concentrações de antibiótico observa-se uma


diminuição do crescimento bacteriano; no entanto o número final de bactérias é igual ou superior ao
número inicial. Este efeito resulta de um retardamento do tempo de divisão da bactéria. Existe um
equilíbrio entre o crescimento normal e a destruição das bactérias. Os antibióticos bacteriostáticos
induzem bloqueios reversíveis da síntese proteica dos microrganismos. Este fenómeno impede a
proliferação das bactérias no organismo e este depois encarrega-se de eliminar as bactérias por
intermédio de mecanismos imunológicos.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 36


Exemplos:
- Tetraciclinas
- Cloranfenicol
- Macrólidos (ex. eritromicina)
- Rifamicinas

Efeito bactericida de um antibiótico – Verifica-se ao longo do tempo uma redução do número de


microrganismos que será tanto mais marcada quanto maior for a concentração do antibiótico. Os
antibióticos bactericidas podem inibir a síntese proteica dos microrganismos, ou podem destruir a
membrana citoplasmática provocando lesões profundas e irreversíveis nas células bacterianas.

Exemplos:
- Penicilinas e cefalosporinas
- Aminoglicosidos (ex. gentamicina)
- Polimixinas

Por vezes a acção antimicrobiana é parcial e depois de uma diminuição precoce do número de bactérias
observa-se crescimento bacteriano. Este fenómeno pode ser devido a uma instabilidade do antibiótico in
vitro, a uma heterogeneidade da população bacteriana, que pode comportar um número de bactérias
genotipicamente mais resistentes que a maioria da população, ou ainda, devido a uma indução da
produção de enzimas que conferem resistência ao antibiótico.

Figura 5.1 – Efeito de um antibiótico no


crescimento bacteriano.

A acção de um antimicrobiano sobre uma estirpe bacteriana pode ser caracterizada por dois parâmetros:

• CMI (Concentração Mínima Inibitória) – A mais baixa concentração de antibiótico que inibe a
multiplicação das bactérias (bacteriostase), em 18-24h. A CMI exprime-se em µg/ml.

• CMB (Concentração Mínima Bactericida) – A mais baixa concentração de antibiótico capaz de


matar, após 18 horas de contacto a 37ºC, uma população bacteriana. A CMB exprime-se em µg/ml.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 37


Se a CMB de um antibiótico sobre uma estirpe bacteriana é próxima da CMI (CMB/CMI = 1 ou 2), o
antibiótico é considerado bactericida.
Se a CMB de um antibiótico é muito elevada em relação à CMI (CMB/CMI = 4 a 16), o antibiótico é
considerado bacteriostático.

Métodos de determinação da susceptibilidade bacteriana aos antibióticos – o antibiograma

O estudo do comportamento de uma bactéria face aos antibióticos, pelo crescimento de uma população
bacteriana em presença de gradientes de concentração de diferentes de antibióticos, permite determinar a
sua sensibilidade ou resistência a esses antibióticos. Este teste designa-se por antibiograma. Para
realizar um antibiograma podem usar-se os seguintes métodos:

1) Métodos de diluição (em meio de cultura líquido ou sólido) – São métodos quantitativos,
considerados de referência, para determinar a sensibilidade das bactérias aos antibióticos. Baseiam-se no
emprego de diluições progressivas do antimicrobiano, que é adicionado ao meio de cultura onde se irá
inocular a bactéria a estudar. Podem realizar-se em meio líquido ou sólido. Estes métodos permitem
determinar a CMI e a CMB.

2) Métodos de difusão (em meio sólido) - O método de difusão em agar é uma prova qualitativa
adequada para estudar a sensibilidade das bactérias de crescimento rápido. Não é adequada para as
bactérias de crescimento lento e baterias anaeróbias, nem para os antibióticos que difundem com
dificuldade. É uma técnica sensível e flexível no que diz respeito às substâncias que podem ser
estudadas. Permite classificar o microrganismo em sensível, intermédio ou resistente.

Técnicas de determinação da CMI de um antibiótico

Método de diluição em meio líquido:


1) Colocar em tubos de ensaio, concentrações crescentes de antibiótico.
2) Adicionar a cada um dos tubos uma cultura de bactérias em fase exponencial de crescimento diluída
de forma a obter uma concentração final de 106 cél./ml (0.5 ml de suspensão após 18 horas de
incubação).
3) Incubar durante 18 horas, ao fim das quais se verifica qual a concentração de antibiótico que inibe a
multiplicação bacteriana visível.

Método de diluição em meio sólido (Fig. 5.2):


1) Incorporar no meio de Mueller-Hinton concentrações crescentes de antibiótico.
2) Deixar secar e semear uma cultura de bactérias em fase exponencial de crescimento, diluída de forma
a obter uma concentração final de 106 cél./ml.
3) Incubar durante 18 horas, ao fim das quais se observa qual a concentração antibiótica que inibe a
multiplicação bacteriana visível.

Este método tem a vantagem de possibilitar o estudo de um grande número de espécies bacterianas em
simultâneo.

Método de difusão em gelose ou método dos discos (Fig. 5.2):


Nesta técnica, discos de papel impregnados com uma quantidade definida de antibiótico são dispostos à
superfície de um meio gelosado de Mueller-Hinton previamente semeado por zaragatoa ou por inundação
com uma suspensão de bactérias em fase exponencial de crescimento. A partir do disco, o antibiótico
difunde na gelose. Após a incubação do meio de cultura 18h a 37ºC, verifica-se que cada disco está
envolvido por uma zona de inibição.
A sensibilidade ou a resistência de cada estirpe bacteriana é deduzida a partir de um parâmetro da
multiplicação bacteriana: o diâmetro da zona de inibição à volta dos discos de antibióticos. Um bom

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 38


antibiograma deverá, à volta de cada disco, ter um halo bem definido, no qual se pode medir
rigorosamente o diâmetro.

Figura 5.2 – Representação esquemática da determinação da CMI de um antibiótico por um método de


difusão.

Para cada antibiótico, mede-se o diâmetro de inibição do crescimento bacteriano e deduz-se o valor
(aproximado) da CMI do agente antimicrobiano em função da espécie estudada (Fig.5.3). Com efeito,
para um determinado antibiótico, existe uma relação entre o valor do diâmetro de inibição de crescimento
e o da CMI. Este é estabelecido por estudos comparativos previamente estabelecidos sobre um grande
número de espécies bacterianas.

Figura 5.3 - Relação entre a CMI e


os diâmetros dos halos de de
inibição.

Hoje em dia, o método dos discos é o mais utilizado e o mais rigoroso se forem respeitados três
parâmetros:
1) Meio de cultura
O meio de cultura a utilizar deve ter de espessura 4 mm e de diâmetro 9 cm. O pH deve ser igual a 7.3.
Geralmente usa-se o meio de Mueller-Hinton que apresenta as seguintes vantagens:

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 39


• Não é antagonista dos principais agentes antibacterianos.
• Não é sujeito a grandes variações de pH.
• É aproximadamente isotónico com o sangue, podendo ser adicionado de 5% de sangue para bactérias
mais exigentes.

2) Densidade do inóculo
O inoculo tem de ser estandardizado pois uma má estandardização deste leva a uma grande variabilidade
dos diâmetros das zonas de inibição. O inoculo é estandardizado com base na escala de McFarland:

• 0.5 para as enterobactérias


• 1.0 para os estafilococos

A escala de McFarland (que está compreendida entre 0 e 5 unidades) é efectuada com cloreto de bário e
mede o grau de turvação da suspensão bacteriana.

Se a concentração do inóculo for elevada a sementeira é muito densa, não se destinguem as colónias - má
difusão do antibiótico.
Se a concentração do inóculo for baixa as colónias surgem muito dispersas - o antibiótico difunde-se
demasiadamente bem aparecendo uma zona de actuação muito grande que é falsa.
Se a concentração do inóculo for ideal todas as colónias são visíveis apesar de juntas - neste caso a
difusão é correcta e o disco fica envolvido por uma zona bem definida.

3) Concentração de antibiótico
A concentração de antibiótico deve ser sempre a mesma para que possam ser usadas as tabelas de
resultados. A conservação deve ser feita no frigorífico e o controlo de qualidade, realizado com estirpes
padrão E. coli, S. aureus e P. aeruginosa.

Causas de erro mais comuns:


1 -Alteração dos discos por conservação não adequada. Pode verificar-se um decréscimo das zonas de
inibição para estirpes de controlo.
2 -Inoculo demasiado concentrado ou diluído, originando assim, diminuição ou aumento das zonas de
inibição.
3 - Variação ou contaminação da estirpe bacteriana.
4 - Leitura incorrecta dos diâmetros dos halos de inibição.
5 - Transcrição errada dos resultados.

Técnica de Kirby-Bauer de execução de um antibiograma


(Adaptada pela FDA e aconselhada pela OMS)

Meio de cultura
O meio de cultura a utilizar é agar Mueller-Hinton. O pH do meio deve ser entre 7.2 e 7.4, verificado
sempre para cada lote do meio. Nas placas, o meio deve ter uma superfície plana e uma altura uniforme
de 4mm aproximadamente. As placas de meio devem ser conservadas no frigorífico. Quando vão ser
inoculadas as placas não devem apresentar gotas de água à superfície do meio nem na tampa, para o que
são postas a secar na estufa a 35 - 37ºC, geralmente 15 a 30 minutos.

Preparação do inóculo
A partir de uma cultura pura do microrganismo em estudo, em fase exponencial de crescimento,
escolhem-se 4 ou 5 colónias isoladas, morfologicamente semelhantes com que se prepara uma suspensão
em 5 ml de caldo nutritivo. Incubar 2 a 4h a 35 - 37º C até obter turvação compatível à unidade 0.5 da
escala de McFarland. Diluir em seguida com soro fisiológico do seguinte modo:

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 40


Staphylococcus - 1 : 2
Enterobacteriaceae - 1 : 5

Inoculação das placas


Com uma zaragatoa previamente mergulhada na suspensão bacteriana, tendo tido o cuidado de a apertar e
rolar contra as paredes do tubo para expelir o líquido em excesso, semeiam-se por estrias apertadas as
placas de agar Mueller-Hinton em duas direcções ou mais, por toda a superfície do meio e passando no
final a zaragatoa a toda a volta da placa. Deixa-se secar o inóculo durante 5 a 10 minutos.

Aplicação dos discos de antibióticos


Os discos devem ser conservados no frigorífico em embalagens bem fechadas. Estas devem ser retiradas
do frigorífico e aguardar à temperatura ambiente 1 a 2 horas, de tal modo que quando seja necessário
abri-las, os discos já tenham atingido a temperatura ambiente. Os discos são aplicados sobre a superfície
do meio inoculado com um distribuidor mecânico ou com uma pinça, tendo o cuidado de exercer sobre
cada um deles uma ligeira pressão para assegurar um perfeito contacto com o meio. Deixar pré-difundir
durante cerca de 15 minutos. Os discos devem ser colocados a mais de 15 mm do bordo da placa e
distanciados uns dos outros de modo a evitar sobreposição das zonas de inibição. Colocar as placas a 37º
C.

Leitura dos resultados


Após 16 - 18 horas de incubação a 37º C, medem-se os diâmetros das zonas de inibição, com a ajuda de
uma régua, craveira ou compasso. Deve observar-se a placa fechada invertida debaixo de luz reflectida
sob um fundo negro. De acordo com a inibição de crescimento observada, a bactérias é classificada como
Sensível, Intermédia ou Resistente, de acordo com tabelas publicadas.

Técnicas de determinação da CMB de um antibiótico

Método de diluição em meio líquido (Fig. 5.4):

1) Colocar em tubos de ensaio, concentrações crescentes de antibiótico.


2) Adicionar a cada um dos tubos uma cultura de bactérias em fase exponencial de crescimento diluída
de forma a obter uma concentração final de 106 cél./ml (0.5 ml de suspensão após 18 horas de
incubação).
3) Incubar durante 18 horas, ao fim das quais se verifica qual a concentração de antibiótico que inibe a
multiplicação bacteriana visível.
4) Fazer uma sementeira em gelose nutritiva do 1º tubo contendo antibiótico em que não se verifica, a
olho nú, crescimento bacteriano.
5) Incubar 18h/37º C e verificar se há crescimento ou não.
6) Caso haja crescimento, deve-se fazer o mesmo teste no tubo de concentração imediatamente a seguir, e
assim sucessivamente, até encontrar o tubo para o qual não há crescimento em sementeira. Essa é a
concentração que dá a CMB.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 41


Figura 5.4- Representação esquemática da determinação da CMB de um antibiótico pelo método de
diluição em meio líquido.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 42


5.2 - Protocolos experimentais
Pretende-se que os alunos executem um antibiograma utilizando uma técnica habitual em laboratórios de
Microbiologia Clínica. Será também sumariamente estudado o efeito de dois desinfectantes comuns
(lixívia e desinfectante para bancadas utilizado diariamente pelos alunos) sobre duas espécies
bacterianas.

1) Execução de antibiograma segundo a técnica de Kirby-Bauer:

• A partir de culturas em fase exponencial de crescimento preparar suspensões em SF ou ADE de:


Escherichia coli (0.5 na escala de McFarland)
Staphylococcus aureus (1 na escala de McFarland)
Pseudomonas aeruginosa (1 na escala de McFarland)

• Embeber uma zaragatoa na suspensão de bacteriana e inocular uma placa de meio de Mueller-Hinton
por estrias apertadas (em duas direcções, ou mais) por toda a superfície do meio.
• Deixar secar 2ou 3 minutos ao bico de Bunsen (5-10 min.)
• Colocar em cada placa um máximo de sete discos dos antibióticos com uma pinça ou um aplicador
mecânico. Deixar difundir 10-15 min.
• Incubar as placas a 37ºC durante 24 horas.
• Medir o diâmetro do halo de inibição de crescimento existente ao redor de cada antibiótico utilizando
uma régua.

Exemplos de antibióticos a utilizar:


Escherichia coli:
AMC, NET, NA,CXM, AMX, NOR, SXT, CPX,GM, F-

Staphylococcus aureus:
P, KN, GM, E, NET, AMX, AMC, TRT, F, VN-

Pseudomonas aeruginosa:
TIC, PIP, IMI, CAZ, TBR, GM, NET, CL, CPX-

Acrónimos dos antibióticos:


OFX - ofloxacina
E - eritromicina
NOR - norfloxacina
CXM - cefuroxima
AMX - amoxicilina
P - penicilina G
NA - ác. nalidíxico
SXT - trimetroprim-sulfametoxazole
CAZ - cefatazidima
NET - netilmicina
AM - ampicilina
GM - gentamicina
AMC - augmentin (amoxacilina + ác. clavulânico)
F- Furandantina (nitrofurantoína)

2) Estudo do efeito de uma solução de desinfectante para bancadas e do hipoclorito de sódio sobre
duas espécies bacterianas
• Colocar 5 ml de desinfectante em dois tubos estéreis
• Adicionar a um dos tubos 500 µl de suspensão de P. aeruginosa

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 43


• Adicionar ao segundo tubo 500 µl de suspensão de S. aureus
• Marcar em cada tubo o nome do desinfectante e o nome da espécie bacteriana utilizada
• Em intervalos de 5 minutos, aos 5, 10,e 15 minutos, transferir 100 µl para placas de gelose
tripticase-soja (gelose simples) e inocular por espalhamento
• Incubar 24h/37ºC.
• Verificar se houve ou não crescimento bacteriano nas placas contendo os desinfectantes.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 44


5.3 – Resultados e discussão

5.3.1 - Anote o diâmetro dos halos de inibição obtidos para Escherichia coli e o resultado final (Sensível
– S;Intermédio – I; Resistente – R)

AMC-
NET -
NA -
CXM -
AMX -
NOR -
SXT -
CPX-
GM-
F-

5.3.2 - Anote o diâmetro dos halos de inibição obtidos para o Staphylococcus aureus
e o resultado final (Sensível – S;Intermédio – I; Resistente – R)

P -
KN-
GM -
E-
NET -
AMX -
AMC -
TRT-
F-
VN-

5.3.3 - Anote o diâmetro dos halos de inibição obtidos para a Pseudomonas aeruginosa e o resultado
final (Sensível – S;Intermédio – I; Resistente – R)

TIC-
PIP-
IMI-
CAZ-
TBR-
GM-
NET-
CL-
CPX-

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 45


CAPÍTULO 6- Estudo morfológico e bioquímico de fungos unicelulares e filamentosos

6.1 - Introdução
Generalidades
As infecções causadas pelos fungos são denominadas micoses. Apenas uma pequena minoria das cerca
de 100000 espécies de fungos existentes são patogénicas para os seres humanos. Apesar de não serem tão
predominantes como as infecções bacterianas ou virais, a incidência das micoses superficiais e sistémicas
tem crescido recentemente. Factores iatrogénicos, tais como tratamentos com fármacos imunosupressores
em transplantados e doentes com cancro, a nutrição parental, o aumento do número de indivíduos com
SIDA, e o uso indiscriminado de antibióticos, têm sido responsabilizados por este aumento do número de
casos.
Com poucas excepções, os fungos associados com doenças em seres humanos são membros saprofíticos
das comunidades microbianas encontradas nos solos. Outras espécies são comensais na pele humana,
intestino e mucosas que em determinadas condições (ex. imunodeficiências) assumem o carácter
patogénico.

A célula fúngica
Um fungo é um eucariota definido pela ausência de organização tecidular e de clorofila. A célula fungica
é frequentemente limitada por uma parede rígida de natureza celulósica ou quitinosa.
A maior parte dos fungos de importância médica apresenta um de dois tipos de morfologia celular. As
formas celulares esferoidais ou ovais são típicas de leveduras (fungos leveduriformes) e possuem o
diâmetro de 5 a 25 µm. As células tubulares ou filamentosas são características das hifas, que constituem
os fungos filamentosos (ou bolores). Uma única célula pode possuir o comprimento de 5 a 50 µm por 2 a
5 µm de diâmetro.
As leveduras aparecem isoladas ou em grupos de duas a três células, com uma delas distintamente maior
do que as outras.
As células das hifas podem ou não ser compartimentadas por meio de estruturas semelhantes a paredes
cruzadas denominadas septos. Um conjunto de hifas forma um micélio.
Alguns fungos são dimórficos, ou seja, podem proliferar como leveduras ou como bolores. Todos os
fungos dimórficos são patogénicos para o homem, apresentando a forma de levedura no interior do nosso
organismo e a forma filamentosa no exterior (no meio ambiente).

Reprodução dos fungos


Os fungos podem reproduzir-se sexuada ou assexuadamente.

Reprodução assexuada:
• Por divisão binária (por fissão)
• Por divisão binária (por gemulação)
• Por produção de esporos assexuados.

Exemplos de esporos assexuados:


Artrosporos – obtidos por fragmentação da hifa formando células que se comportam como esporos.
Clamidosporos - Esporos rodeados por uma parede grossa antes da fragmentação. São esporos de
resistência.
Esporangiosporos - Esporos que se desenvolvem em estruturas específicas na extremidade das hifas
(esporângios).
Conidiosporos - Esporos produzidos nas extremidades das hifas (conidióforos).
Blastosporos - Esporos produzidos por gemulação de uma célula não vegetativa.

Reprodução sexuada:

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 46


Envolve a união de núcleos compatíveis e pode envolver também a formação de esporos sexuados:
zigosporos, ascosporos, basidiosporos.

Leveduras
As leveduras são fungos unicelulares, redondos ou ovais, de parede fina ou espessa. São normalmente 5 a
10 vezes maiores do que as bactérias. Multiplicam-se normalmente por fissão binária (reprodução
assexuada); quando as leveduras se multiplicam sexuadamente produzem vários tipos de esporos que
podem ser úteis na sua identificação. As suas actividades metabólicas também são utilizadas para
classificação da espécie e do género.
O isolamento de leveduras é feito em meio de Sabouraud com ou sem adição de antibióticos
antibacterianos (ex. cloranfenicol). A adição de antibióticos antibacterianos pode ser fundamental para o
isolamento de espécies de crescimento lento. O meio de Sabouraud é um meio selectivo que contém 4%
de glucose (os fungos toleram pressões osmóticas elevadas), e um valor de pH baixo (5.2), o que vai
inibir o crescimento de outros microrganismos (bactérias). As colónias de leveduras são semelhantes às
colónias bacterianas. Têm uma consistência cremosa e crescimento rápido, em 2 a 4 dias.

Bolores (fungos filamentosos)


Microscopicamente, os filamentos ou hifas são tubos curvados ou sinuosos, limitados por uma parede.
Apresentam ramificações e mais correntemente septos transversais. Um conjunto de filamentos é
denominado micélio (ou talo).
O isolamento de fungos filamentosos é também realizado em Meio de Sabouraud (ou meio análogo),
sendo o crescimento lento, de dias a semanas. As colónias filamentosas de crescimento centrífugo
apresentam-se quer como bolores com filamentos aéreos enredados, mais ou menos longos, quer sob a
forma de uma camada compacta imberbe ou recoberta com uma penugem de filamentos. As hifas podem
ser rizoidais, ou seja, encontrar-se dentro de meio de cultura (ou por ex. no solo).

Estudo do género Candida

• Candida albicans
• Candida glabrata (torulopsis glabrata)
• Candida tropicalis
• Candida guilhermondii
• cândida parapsilosis

a) Isolamento: meio de Sabouraud


b) Taxa de crescimento: crescimento rápido (1-3 dias)
c) Aspecto macroscópico: colónias cremosas, branco porcelana
d) Aspecto microscópico: formas redondas ou ovais, algumas em divisão, ausência de cápsula, algumas
são filamentadas (Fig. 6.1).

Figura 6.1 - Aspecto microscópico da morfologia de Candida


albicans

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 47


Procedimentos para a identificação de leveduras:

1) Prova da blastése
Só a Candida albicans é capaz de produzir tubos germinativos no soro humano fresco num período de
três horas. Os tubos germinativos são o início de hifas verdadeiras e aparecem como filamentos que não
estão constritos ao ponto de origem da célula mãe.

Prova da blastese positiva → Candida albicans


Prova da blastese negativa → posterior identificação

Técnica:
a) Execução de uma suspensão em tubo contendo soro humano com 3 ou 4 colónias.
b) Incubação 3 horas/37ºC.
c) Leitura por observação microscópica dos tubos germinativos (Fig. 6.2).

Figura 6.2 - Aspecto microscópico de tubos germinativos


(Candida albicans)

2) Testes de assimilação de açúcares

São testes de identificação bioquímica de leveduras que se baseiam na sua capacidade de utilização por
via aeróbia ou fermentativa de açúcares.

Auxonograma - Capacidade da levedura utilizar os açúcares na presença de oxigénio (respiração


aeróbia).

Zimograma - Capacidade da levedura utilizar os açúcares na ausência de oxigénio (fermentação).

Hoje em dia a maior parte dos laboratórios usam sistemas automatizados, vendidos comercialmente, para
executar os testes de assimilação dos açúcares e outros testes de identificação bioquímica de leveduras.
Os mais correntemente usados são: API 20C (bioMérieux) e Minitek (BBL).

Estudo do género Aspergillus

• Aspergillus flavus
• Aspergillus niger
• Aspergillus fumigatus
• Aspergillus versicolor
• Aspergillus candidum

a) Isolamento: meio de Sabouraud/malt agar/PDA

b) Taxa de crescimento: crescimento geralmente rápido (3 dias), no entanto algumas espécies são mais
lentas (semanas).

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 48


c) Aspecto macroscópico: a superfície é inicialmente branca e com o tempo fica amarelada, verde,
castanha ou preta, dependendo da espécie. A textura é aveludada. O reverso é branco, dourado ou
castanho.

d) Aspecto microscópico: As hifas são septadas (2.5-8.0 µm de diâmetro) e contêm as cabeças


aspergilares que são as vesículas na extremidade dos conidióforos que dão origem aos esporos
externos alongados (fiálides), que por sua vez dão origem aos conídios (Fig. 6.3).

Figura 6.3 - Aspecto microscópico das


estruturas de frutificação de Aspergillus spp.

e) Patogenicidade: Os membros deste género causam um grupo de doenças conhecido como


aspergiloses. A doença pode aparecer na sua forma invasiva (micose sistémica), como toxicose ou
ainda como alergia. As espécies deste género são patogénicas oportunistas, originando infecções em
indivíduos com baixa resistência devido a tratamentos imunosupressores ou por serem portadores de
imunodeficiência (ex. SIDA). Os fungos do género Aspergillus estão espalhados no meio ambiente e
são frequentemente encontrados como contaminantes de culturas.

Estudo do género Penicillium

• Penicillium notatum

a) Isolamento: meio de Sabouraud


b) Taxa de crescimento: crescimento geralmente rápido (24-48h).
c) Aspecto macroscópico: As colónias apresentam cor branca ou creme com o reverso castanho.
d) Aspecto microscópico: É semelhante ao do Aspergillus, diferenciando-se pela observação da
estrutura de frutificação em forma de pincel, formadas por artigos micelianos digitiformes
denominados metulas, que dão as fiálides (forma de garrafa) que por sua vez dão origem aos conídios.

Figura 6.4 - Aspecto microscópico das estruturas de frutificação de


Penicillium spp.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 49


6.2 - Protocolos experimentais
Cultura
1) Inocular o meio de Sabouraud pelo método de estrias, dividindo a placa em três partes. Em cada
parcela inocular:

Candida albicans
Candida tropicalis
Geotrichum sp.

2) Incubar 24 - 48 h/37ºC.

Prova da blastése
1) Executar a prova da blastése, com colónias de Candida albicans e de Candida tropicalis:

• Em 2 tubos com soro humano fresco, suspender 3 - 4 colónias


• Incubar 3 h/37ºC
• Ler da prova da blastése por observação microscópica.

Exame a fresco e após coloração


1) Executar o exame a fresco com azul de lactofenol a partir de:

• Colónias de Candida albicans


• Cultura de Aspergillus spp. e/ou Penicillium spp.

2) Executar a coloração de Gram, a partir do meio de Sabouraud de Candida spp. e Geotrichum sp.

Pesquisa de C. albicans na região posterior da língua:

• Colheita por intermédio de zaragatoa


• Inocular a zaragatoa (por estrias) no meio de Sabouraud
• Incubar 24 - 48 h/37ºC
• Observação da placa de Sabouraud

Execução demonstrativa dos testes de assimilação de açúcares (API 20C) para:

• Candida tropicalis
• Geotrichum sp.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 50


6.3 – Resultados e discussão

Leveduras (anote os resultados):

a) Observação macroscópica:

b) Observação microscópica:

• Exame a fresco • Coloração de Gram

(obj.40x) (obj.100x)

c) Prova da blastése:

• Positiva -
• Negativa -

(Obj.40x)

d) Interpretação da pesquisa de fungos da face interna da língua:

e) Leitura do API 20C:

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 51


Fungos filamentosos:

a) Observação macroscópica:

Aspergillus ______________ Penicillium ___________

• Odor_________· • odor______________
• Extensão do crescimento_________ • extensão do crescimento_______
• Pigmentação do verso__________ • pigmentação do verso_________
• Pigmentação do reverso__________ • pigmentação do reverso_______
• Presença de hifas aéreas_________ • presença de hifas aéreas_______

b) Observação microscópica:

• Estruturas de frutificação do Aspergillus _________

(Obj.40x)

• estruturas de frutificação do Penicillium ___________

(Obj.40x)

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 52


CAPÍTULO 7- Estudo bioquímico e metabólico de cocos de Gram positivo

7.1 - Introdução

Generalidades
Os cocos Gram positivos são espécies bacterianas constituídas por células de forma arredondada (cocos)
e imóveis.
A família Micrococcaceae é constituída por vários géneros, sendo o género Staphylococcus o mais
importante em termos clínicos. Dele fazem parte 41 espécies e 24 subespécies. O S. aureus pode ser
isolado das narinas e do períneo é a espécie mais importante em termos médicos porque causa
frequentemente infecções (pneumonia, intoxicação alimentar, sindroma do choque tóxico, endocardite e
abcessos). S. epidermidis faz parte da flora normal da pele,narinas e axilas podendo ser patogénico em
situações de compromisso imunológico do hospedeiro. S. saprophyticus, normalmente é comensal,
podendo no entanto ser responsável por infecções do tracto urinário em mulheres jovens.

A família Streptococaceae é constituída pelo género Streptococcus. Os estreptococos são classificados


de acordo com a sua actividade hemolítica, propriedades imunológicas (classificação serológica de
Lancefield), e resistência a factores físicos e químicos. As espécies consideradas classicamente
significativas em termos clínicos, são o S. pyogenes (agente etiológico de faringite estreptocócica,
escarlatina, febre reumática e vários tipos de infecções de pele), o S. agalactiae (meningite, sepsis
puerperal) e o S. pneumoniae (pneumonia).
Os Enterococcus (Streptococcus do grupo D segundo a classificação de Lancefield) são isolados como
flora normal do tracto gastrointestinal.
Os S. viridans fazem parte da flora oral normal assim como da flora do tracto gastrointestinal e
urogenital.

Família Micrococcaceae

Género Staphylococcus

Exemplos das espécies mais comuns:


• Staphylococcus aureus
• Staphyloccus epidermidis
• Staphyloccus saprophyticus

Características gerais:
• São cocos Gram positivos, imóveis, anaeróbios facultativos.
• Microscopicamente, aparecem agrupados caracteristicamente em “cacho de uva”.
(grego staphylé - cacho de uvas)
• Algumas estirpes podem apresentar cápsula.
• Os membros deste género bacteriano fermentam a glucose e produzem catalase.
• As colónias em meio sólido aparecem bem definidas, redondas, convexas.

Família Streptococaceae

Géneros Streptococcus e Enterococcus

• Streptococcus pyogenes
• Streptococcus pneumoniae
• Enterococcus faecalis

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 53


Características gerais:
• São cocos Gram positivos, imóveis e anaeróbios aerotolerantes.
• Microscopicamente, ocorrem isoladamente, como diplococos, ou agrupados em cadeia, dependendo
do meio ambiente.
• Algumas estirpes podem apresentar cápsula.
• Não produzem catalase.
• São culturalmente exigentes - requerem gelose de sangue.

Classificação:
• São classificados em 21 grupos (Grupos de Lancefield: A-U), distinguidos serologicamente por
pequenas diferenças específicas dos carbohidratos da parede celular.
• Também podem ser classificados de acordo com o tipo de lise enzimática dos glóbulos vermelhos
(hemólise), produzida em placas de gelose sangue:

Alfa (αα) hemolíticos - caracterizam-se por uma hemólise incompleta com difusão de pigmento verde à
volta da colónia.
Beta (ββ ) hemolíticos - caracterizam-se por hemólise completa, com libertação da hemoglobina e uma
zona clara à volta da colónia.
Gama (γγ) hemolíticos - caracterizam-se pela ausência de hemólise.

Estreptococos do grupo A de Lancefield:


• A espécie prototípica é o Streptococcus pyogenes.
• Possuem o carbohidrato específico do grupo A e vários antigénios proteicos (antigénio M, T e R)
na sua parede celular.
• São sensíveis à bacitracina, um polipéptido antibacteriano, em contraste com os outros
estreptococos.
• Raramente se tornam resistentes à penicilina.
• Produzem várias enzimas e toxinas, como a estreptoquinase, hialuronidase, nucleases e toxina
eritrogénica.
• São β - hemolíticos produzindo duas hemolisinas:

Estreptolisina S – Estável ao oxigénio. Responsável pela β - hemólise em gelose sangue.


Estreptolisina O – Lábil ao oxigénio. Tem propriedades imunogénicas, induzindo a formação de
anticorpos anti-estreptolisina, o que neutraliza o seu efeito. Esta acção pode ser medida no soro e é
denominada de Titulação de anticorpos anti-estreptolisina O (TASO).

O TASO é um teste utilizado em rotina, quando se pretende diagnosticar uma infecção recente por
estreptococos e evitar a possibilidade de complicações pós-infecção estreptocócica, como a febre
reumática ou glomerulonefrite. Após uma infecção devida a estreptococos do grupo A, os anticorpos
anti-estreptolisina O começam a aumentar ao fim de 2-3 semanas surgindo a máxima quantidade ao fim
de 5-6 semanas. O título de anticorpos anti-estreptolisina O é medido em unidades Todd. Um título
superior a 200 unidades Todd sugere uma infecção recente por estreptococos do grupo A.

Enterococcus (classificação serológica: grupo D):


• A espécie protótipo é o Enterococcus faecalis.
• Ocorrem como parte da flora intestinal e oral normal, em humanos e animais.
• Produzem hemólise variável mas a maioria é α e γ hemolítico.
• São caracterizados pela reactividade com o antisoro do grupo D
• São resistentes à bacitracina
• Crescem em meios de cultura com 4% de bílis ou a pH 9.6.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 54


Testes microbiológicos para a identificação de cocos Gram positivos

Tabela 1- Algumas características fenotípicas que permitem distinguir S. aureus dos Streptococcus spp.
Característica S. aureus Streptococcus spp.
Meio de manitol Cresce e fermenta Não cresce e não fermenta (em geral)
Catalase Produz Não produz
Tipo de hemólise β α, β, ausência
Glucose Fermenta fermenta

Pesquisa de catalase:

• Fundamento
Em aerobiose, as bactérias utilizam normalmente o oxigénio como aceitador terminal de electrões pela
via oxidativa directa (fosforilação oxidativa).

Substrato → Flavoproteínas → H2O2 → H2O

As flavoproteínas são auto-oxidáveis e os átomos de hidrogénio libertados fixam-se directamente sobre o


oxigénio molecular (O2), levando à formação de peróxido de hidrogénio (H2O2) ou do ião superóxido
(O2-). Estes acumulam-se nas células, sendo letais para as bactérias se não forem imediatamente
degradados pelas enzimas superóxido dismutase e/ou catalase:

superóxido dismutase
2 O2- + 2H+ → O2 + H2O2

catalase ou peroxidase
2 H2O2 → 2 H2O + O2

As bactérias aerotolerantes têm a superóxido dismutase mas não têm catalase, enquanto as bactérias
facultativas têm ambas.

• Técnica

a) Colocar 2 gotas de H2O2 fresca numa caixa de Petri.

b) Com uma pipeta Pasteur fechada retirar uma colónia de uma caixa de Petri e tocar na água
oxigenada.

c) Observar ou não a produção de O2 (bolhas de gás).

• Leitura

Catalase (+)- efervescência (libertação de O2)


Catalase (-)- não há efervescência (não há libertação de O2)

• Interpretação

Os estafilococos são catalase positivos enquanto que os estreptococos são catalase negativos.
Estudo microbiológico do género Staphylococcus

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 55


Isolamento:

• Meio de Cultura - Chapman

Composição:

Peptona (1%)
Extracto de carne (0.1%)
NaCl (7.5%)
Manitol (1%)
Agar (1.5%)
Vermelho de fenol (0.0025%)

O meio de Chapman tem um elevado conteúdo em NaCl, e contém ainda manitol e vermelho de fenol.
Este meio permite o isolamento selectivo de estafilococos com base na sua tolerância a um elevado teor
em NaCl e na diferenciação da espécie de S. aureus, pela fermentação do manitol e consequente viragem
do indicador de pH.

Outras espécies como o Streptococcus do grupo D e Bacillus sp. podem desenvolver-se neste meio. No
entanto o aspecto das colónias permite distingui-las facilmente.

• Técnica:
Sementeira - por estrias
Incubação - 24h/37ºC

• Leitura e interpretação:
- Os estafilococos potencialmente patogénicos fermentam o manitol e acidificam o meio cuja cor vira
para amarelo;

S. aureus - manitol (+)

- Os estafilococos não patogénicos não modificam a cor do meio que permanece vermelha ou seja,
não fermentam o manitol.

S. epidermidis - manitol (-)

Estudo do poder patogénico:

Pesquisa de estafilocoagulase

• Fundamento
A coagulase é um produto extracelular que tem a característica única de coagular vários plasmas de
mamíferos. A coagulase reage com um factor plasmático, formando a estafilotrombina que converte o
fibrinogénio em fibrina (que é insolúvel) e que cobre a célula, defendendo-a das defesas do hospedeiro.
A determinação da actividade da coagulase é utilizada para distinguir entre espécies patogénicas e não
patogénicas embora ainda não esteja provado que haja correlação entre a coagulase e o poder patogénico.

• Técnica:
a) Num tubo de hemólise colocar cerca de 500 µl de plasma de coelho (ou humano) diluído a 1/5.
b) Adicionar 500µl de uma cultura de 24h.
c) Incubar os tubos 37ºC/24h.

• Leitura e Interpretação (Fig. 7.1):

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 56


Figura 7.1 - Leitura e
interpretação do teste da
Negativo Positivos coagulase.

+1 +2 +3 +4

Negativo  Não se forma fibrina


Positivo +1  Coágulos pequenos desorganizados
Positivo +2  Coágulos pequenos organizados

Positivo +3  Coágulos grandes organizados


Positivo +4  Todo o conteúdo coagula e não se
solta quando o tubo é invertido

a) Os estafilococos patogénicos originam a coagulação do plasma num tempo que vai dos 30 minutos
às 24 horas.
b) As leituras devem ser efectuadas de hora a hora durante as primeiras 5 horas.

Coagulase (+) - estafilococos patogénicos (ex. S. aureus)


Coagulase (-) - proceder à pesquisa de DNase

Pesquisa de desoxirribonuclease (DNase)

• Fundamento
Certas bactérias são capazes de hidrolisar o ácido desoxirribonucleico, graças a uma enzima por elas
produzida, a DNase. Após cultura sobre gelose nutritiva contendo ácido desoxiribonucleico, pesquisa-se
a presença de ADN graças a um reagente revelador, o HCl ou azul de toluidina.

• Meio de cultura

Composição:

ADN (0.2%)
Peptona (0.5%)
Triptona (1.5%)
Cloreto de sódio (0.5%)
Agar (1.5%)

• Técnica:
a) Semear cada estirpe por estria espessa em caixas de meio sólido contendo ADN (normalmente de
esperma de salmão).
b) Incubar 24h/37ºC.
c) No dia seguinte revelar, inundando a superfície do meio com uma solução 1 N de HCl ou com uma
solução a 0.1% de azul de toluidina.
d) Esperar 5 a 10 minutos.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 57


• Leitura e Interpretação:

Reacção DNase positiva:


- revelação com HCl - zona transparente ao redor da estria, o resto da caixa fica opaco por precipitação
do ADN contido no meio.
- revelação com o azul de toluidina - zona rósea em torno da estria e todo o resto do meio azul, dado que
o azul de toluidina tem afinidade para o ADN nele contido.

Pesquisa de hemolisinas

• Fundamento
As hemolisinas são exotoxinas que provocam a destruição dos glóbulos vermelhos. Pode classificar-se o
tipo de hemólise consoante o tipo de ataque que a bactéria faz aos glóbulos vermelhos.

• Técnica:
a) Inocular por estrias as estirpes a estudar em meio gelosado contendo 5% de sangue de carneiro.
b) Incubar 24h/37ºC.

• Leitura e interpretação
Para os estafilococos patogénicos, observa-se hemólise β ou seja, hemólise completa em que se forma
uma zona mais clara à volta da colónia. Este fenómeno deve-se a uma toxina (hemolisina) libertada pelas
espécies patogénicas de origem humana.

7.1.6 - Estudo microbiológico dos géneros Streptococcus e Enterococcus

Isolamento:

• Meios de cultura:

- gelose sangue - meio nutritivo para o crescimento de estreptococos do grupo A

Composição:
Triptona (0.3%)
Peptona (1%)
Cloreto de sódio (0.5%)
Sangue de carneiro (5%)
Extracto de carne (1%)
Amido (1%)
Cloreto de sódio (5%)
Agar (1.3%)

- D-Coccosel - meio selectivo para Enterococcus


Composição:
Extracto de levedura (0.5%)
Tripcase (1.7%)
Peptona (0.3%)
Bílis (1%)
Azida sódica (0.025)
Esculina (0.1%)
Citrato de sódio (0.1%)
Cloreto de sódio (0.5%)
Citrato de ferro amoniacal (0.05%)
Agar (1.3%)

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 58


A bílis vai seleccionar os Enterococcus, que são os únicos a tolerar grandes concentrações em ácidos
biliares. A azida sódica inibe as bactérias Gram negativo. A esculina vai ser hidrolisada pelos
Enterococcus em glucose e esculatina, esculatina essa que vai reagir com o citrato de ferro presente no
meio originando um complexo negro.

• Técnica:
Sementeira - por estrias
Incubação - 24h/37ºC

• Leitura:
Só os enterococos se multiplicam neste meio, com o aparecimento de colónias pequenas, translúcidas,
com um halo negro.

Pesquisa de hemolisinas:

• Fundamento
As hemolisinas são exotoxinas que provocam a destruição dos glóbulos vermelhos do sangue, podendo
classificar-se o tipo de hemólise consoante o tipo de ataque que a bactéria faz aos glóbulos vermelhos.

• Técnica:
a) Inocular as estirpes a estudar em gelose de sangue, pelo método de estrias.
b) Incubar 24h/37ºC.

• Leitura:
- Hemólise β (hemólise total): halo claro e transparente à volta da colónia.
- Hemólise α (hemólise parcial): zona verde acastanhada à volta da colónia.
- Hemólise γ (ausência de hemólise).

Testes de sensibilidade aos antibióticos

1) Teste de sensibilidade à bacitracina (B):

• Técnica:
a) Inocular uma placa de gelose sangue com estreptococos.
b) Colocar um disco impregnado com bacitracina no centro.
c) Incubar 24h/37ºC.

• Leitura:
O aparecimento de uma zona de inibição à volta do disco de bacitracina, quer dizer que a bactéria lhe
é sensível, permitindo desta forma identificar os estreptococos do grupo A. Todos os outros
estreptococos são resistentes à bacitracina (Tabela 2).

2) Teste de sensibilidade ao trimetoprim-sulfametoxazol (SXT):

• Técnica:
a) Inocular uma placa de gelose sangue com estreptococos.
b) Colocar um disco impregnado com SXT no centro.
c) Incubar 24h/37ºC.

• Leitura:
Só se verifica o aparecimento de uma zona de inibição à volta do disco quando se trata de
estreptococos do grupo C ou estreptococos viridans (Tabela 2).

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 59


• Testes de diferenciação para as espécies de estreptococos:

Tabela 2- Testes de diferenciação diagnostica de Streptococcus e Enterococcus spp.


Grupos de Lancefield Hemólise Bacitracina SXT
A (ex. S. pyogenes) β S R
B (ex. S. agalactiae) β R R
C (ex. S. equi) β R S
D (ex. E. faecalis) α ou γ R R
Nenhum (ex. grupo mitis, onde se encontram S.
pneumoniae, S. mitis, S. oralis, S. sanguinis e S.
α ou γ R S
gordonii, e grupo mutans onde se encontram S.
mutans e S. sobrinus)

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 60


7.2 - Protocolos experimentais
Pretende-se que os alunos aprendam a isolar e identificar algumas bactérias Gram (+).

1) Dividir ao meio uma placa de meio de Chapman e inocular pelo método de estrias as seguintes
bactérias:

• Staphylococcus aureus
• Staphylococcus epidermidis

2) Dividir ao meio uma placa de TSA e inocular pelo método de estrias com as seguintes bactérias:

• Staphylococcus aureus
• Staphylococcus epidermidis

3) Dividir em quatro uma placa de gelose de sangue e inocular pelo método de estrias as seguintes
bactérias:

• Staphylococcus aureus
• Staphylococcus epidermidis
• Streptococcus pyogenes
• Enterococcus faecalis

4) Dividir ao meio uma placa meio de D-Coccosel, e inocular pelo método de estrias as seguintes
bactérias:

• Enterococcus faecalis
• Streptococcus pyogenes

5) Proceder à colheita por intermédio de zaragatoa (previamente embebida em soro fisiológico estéril) da
pele do antebraço e inocular uma placa de gelose de sangue ou manitol.
6) Incubar todos os meios de cultura a 24h a 37oC.

No dia seguinte (segundo dia):

1) Ler e interpretar o crescimento no meio de Chapman.


2) Proceder ao teste da catalase a partir de colónias de estafilococos (meio de Chapman) e estreptococos
(D-Coccosel):

• colocar 2 gotas de H2O2 fresca numa caixa de Petri.


• com uma pipeta Pasteur fechada retirar uma colónia de uma caixa de Petri e tocar na água
oxigenada.
• observar ou não a produção de O2 (bolhas de gás).

3) Executar uma suspensão em água destilada estéril com colónias de S. aureus e a partir dela realizar o
teste da coagulase:

• num tubo de hemólise colocar cerca de 500 µl de plasma de coelho (ou humano) diluído a 1/5.
• adicionar 500µl da suspensão
• incubar os tubos 37ºC/24h

4) A partir da suspensão anterior realizar também o teste da DNase:

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 61


• semear por estria espessa numa caixa de meio sólido contendo ADN
• incubar 24h/37ºC

5) Ler e interpretar o crescimento em gelose sangue.

6) Ler e interpretar o crescimento no meio D-Coccosel.

7) Executar duas suspensões em água destilada estéril, uma com colónias de S. pyogenes e outra com
colónias de E. faecalis.

8) A partir das suspensões anteriores realizar os testes de sensibilidade aos antibióticos (B e SXT):

• Dividir uma placa de gelose sangue ao meio e inocular cada metade, por estrias apertadas, com as
suspensões anteriormente preparadas
• Colocar um disco impregnado com bacitracina e também um disco impregnado com SXT sobre
cada metade
• Incubar 24h/37ºC

9) Executar a título demonstrativo um teste rápido de assimilação de açúcares para identificação de


espécie, para S. pyogenes e E. faecalis - API Strep (inocular com 1 unidade de McFarland).

10) De acordo com as técnicas adquiridas, identifique a espécie de estafilococos isolado a partir da pele
do antebraço (obviamente se tiver obtido crescimento).

No dia seguinte (terceiro dia):

1) Leitura das provas de patogenicidade do S .aureus:

• Coagulase → leitura directa


• DNase → revelação pelo HCl (1N)

2) Leitura e interpretação dos testes de sensibilidade aos antibióticos (B e SXT).

3) Identificação de S. pyogenes e E. faecalis, por leitura do API Strep.

4) Observação dos resultados obtidos a partir da pele do antebraço.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 62


7.3 – Resultados e discussão

Anote os resultados dos testes bioquímicos para o género Staphylococcus:

S. aureus S. epidermidis

• Teste da Catalase ____________ __________________

• Fermentação do manitol ____________ __________________

• β - hemólise ____________ __________________

• Actividade da coagulase ____________ __________________

• Actividade da DNase ____________ __________________

Anote os resultados dos testes de identificação para o género Streptococcus:

S. pyogenes E. faecalis

• Teste da Catalase _____________ __________________

• Padrão de hemólise _____________ __________________

• Crescimento em D-Coccosel _____________ __________________

• Sensibilidade à bacitracina _____________ __________________

• Sensibilidade ao SXT _____________ __________________

Anote o nome da espécie isolada a partir da pele do antebraço.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 63


CAPÍTULO 8- Estudo bioquímico e metabólico de bacilos de Gram negativo

8.1 - Introdução

Bacilos Gram (-) relacionados com o tracto entérico


As bactérias pertencentes à família Enterobactereaceae (genericamente designadas por enterobactérias)
formam um grande grupo de bacilos Gram (-) encontrados principalmente no cólon dos seres humanos e
outros animais, sendo em muitos casos constituintes da flora normal. As enterobactérias são os principais
anaeróbios facultativos do intestino grosso. No entanto, encontram-se em número relativamente baixo
quando comparados com as bactérias anaeróbias estritas como por exemplo os Bacteroides sp.
Outra família importante e com significado médico, é a Pseudomonadaceae. Os membros desta família
são bacilos Gram negativos semelhantes às enterobactérias do ponto de vista morfológico sendo, no
entanto, aeróbios estritos isto é, obtêm a sua energia apenas por oxidação dos açúcares não tendo a
capacidade de os fermentar. O membro mais importante desta família é a Pseudomonas aeruginosa cujo
principal habitat é o solo e água podendo ainda encontrar-se como comensal do cólon em cerca de 10%
da população.
Dada a semelhança entre os bacilos Gram (-) das famílias Enterobactereaceae e Pseudomonadaceae,
torna-se necessário recorrer a testes bioquímicos, após isolamento em meios de cultura selectivos, para
proceder à sua identificação.

Meios de cultura selectivos

Gelose de Drigalsky

a) Composição
peptona 1.5%
extracto de carne 0.3%
extracto de levedura 0.3%
desoxicolato de sódio 0.1%
tiossulfato de sódio 0.1%
lactose 1.5%
cristal violeta 0.0005%
azul de bromotimol 0.008%
agar 1.1%

b) Sementeira: por estrias, para isolamento.


c) Incubação: 37ºC/24h.
d) Aspecto das colónias: colónias de aspecto variável, incolores para espécies não fermentadoras de
lactose; ou de cor amarela para espécies fermentadoras de lactose.

Gelose de McConkey

a) Composição:
peptona 2 %
lactose 1 %
mistura de sais biliares 0.15 %
cloreto de sódio 0.5 %
vermelho neutro 0.003 %
cristal violeta 0.0001 %
agar 1.3 %

b) Sementeira: por estrias, para isolamento.


c) Incubação: 37ºC/24h

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 64


d) Aspecto das colónias: colónias de aspecto variável, incolores para espécies não fermentadoras de
lactose; ou de cor vermelha com precipitado em redor para espécies fermentadoras de lactose.

Testes bioquímicos para identificação de bacilos Gram (-)

1) Provas do metabolismo glucídico

Fermentação de lactose
Este teste é realizado pela observação directa da alteração da cor dos meios selectivos que contêm lactose
e um indicador de pH. Pretende verificar-se se as bactérias metabolizam a lactose por via fermentativa.

Técnica:
• inoculação, por ex., de uma placa de gelose de Drigalsky, por estrias
• incubação a 37ºC/24h

Leitura:
lactose (+) - colónias amarelas
lactose (-) - colónias incolores

Pesquisa de β -galactosidase
Para que a degradação da lactose por uma bactéria seja possível é necessário, em primeiro lugar, que
aquele dissacárido penetre na célula por acção de uma permease e que no seu interior exista outra
enzima, a β -galactosidase, que catalize a hidrólise da lactose em dois açúcares simples, a glucose e a
galactose. A bactéria catabolizará depois ambos os monossacáridos pelas vias metabólicas apropriadas,
com produção de energia. Tanto a β-galactosidase como a permease são enzimas produzidas pelo operão
lactose. Todas as bactérias capazes de metabolizar a lactose terão o operão lactose funcional.

Para espécies bacterianas classificadas como lactose negativas (ou seja, que aparentemente não
fermentam a lactose) deve fazer-se a pesquisa directa da β -galactosidase, uma vez que essas espécies
bacterianas podem ser lactose tardias, ou seja, ter dificuldade em metabolizar a lactose, não devido à
ausência do operão lactose, mas devido à baixa produção da enzima permease. Neste teste, as bactérias
previamente induzidas pela lactose (presente no meio selectivo) são lisadas com clorofórmio ou tolueno e
os lisados (contendo ou não a β-galactosidase) são colocados na presença de orto-nitrofenil-β β -D-
galactopiranósido (ONPG), um composto que tem uma estrutura análoga à lactose e que é hidrolizado
pela β-galactosidase em orto-nitrofenol e galactose. O orto-nitrofenol apresenta cor amarela que é
facilmente visualizada a olho nú.

Técnica:
• a partir de colónias multiplicadas em meio selectivo (contendo lactose) fazer uma suspensão
bacteriana em soro fisiológico estéril num tubo de hemólise
• adicionar uma gota de tolueno ou clorofórmio
• agitar (para auxiliar a lise das bactérias)
• colocar um disco de ONPG
• incubar a 37º/24h

Leitura:
ONPG (+) - coloração amarela
ONPG (-) - incolor

Teste do vermelho de metilo (VM)


Este teste é usado para determinar se um microrganismo crescendo num meio peptonado, glucosado e
tamponado (meio de Clark e Lubs) é capaz de produzir ácidos em quantidade suficiente para baixar o

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 65


pH para valores abaixo de 4.4, revelado pela viragem do indicador de pH, vermelho de metilo,
adicionado no fim do período de incubação. Se tal se verificar, significa que o microrganismo em questão
fermentou a glucose por fermentação ácida mista cujos produtos são uma mistura de ácidos (ácido
fórmico, acético, láctico, succínico).

Técnica:
• inocular o meio Clark e Lubs
• incubar a 37ºC/24h
• revelar com solução alcoólica de vermelho de metilo

Leitura:
VM (+) - meio vermelho
VM (-) - meio da cor original (amarelo muito claro)

Teste de Voges-Proskauer (VP)


As bactérias fermentadoras de glucose podem fazê-lo por fermentação ácida mista ou, alternativamente,
por fermentação butanodiólica:

glucose + ½ O2


2 piruvato


α-acetolactato + CO2


acetil-metil-carbinol (acetoína) + CO2


2,3-butanodiol

É possível verificar se ocorre fermentação butanodiólica pelo teste de VP em que a acetoína é feita reagir
com o α-naftol em meio alcalino formando-se a creatina que tem uma cor rosa/vermelho:

KOH 40%
acetoína + α-naftol → diacetil + creatina (coloração rosa/vermelho)
etanol

Técnica:
• inocular o meio Clark e Lubs
• incubar a 37ºC/24h
• revelar com as soluções VP1 (KOH a 40%) e VP2 (α-naftol a 6%)
Leitura:
VP (+) - meio rosa/vermelho
VP (-) - meio da cor original (amarelo muito claro)

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 66


Crescimento no meio de Hajna-Kligler-Rolland
O meio de Hajna-Kligler-Rolland é um meio complexo que permite estudar simultaneamente vários
aspectos da metabolização da glucose e da lactose, facilitando a identificação de enterobactérias.

Composição:
extracto de carne 0.3 %
extracto de levedura 0.3 %
peptona 1.5 %
lactose 1 %
glucose 0.1 %
sulfato ferroso 0.02 %
cloreto de sódio 0.5 %
tiosulfato de sódio 0.03 %
vermelho de fenol 0.0024 %
agar 1.2 %

Técnica:
• inoculação do meio por picada central no fundo do tubo, e por estrias na rampa
• incubação a 37ºC/24h

Leitura do fundo:
• Fermentação de glucose - cor amarela
Se a bactéria fermentar a glucose os produtos de fermentação (ácidos) acidificam o meio fazendo o
indicador de pH (vermelho de fenol) virar para amarelo.

• Produção de gás (CO2 ou H2) - formação de bolhas ou fissuras na gelose


A fermentação é acompanhada de maior ou menor produção de gás que é detectada pela formação de
bolhas ou mesmo fissuras na gelose.

• Formação de H2S - cor negra


O metabolismo de aminoácidos contendo enxofre (cisteína) origina a formação de gás sulfídrico (H2S). O
meio de Kligler contém peptonas ricas em cisteína e tiossulfato de sódio como substratos. As bactérias
com capacidade de utilizar estes substratos irão fazê-lo com produção de H2S que, ao reagir com sulfato
ferroso, origina um precipitado negro insolúvel (sulfureto ferroso).

Leitura da rampa:
• Após algumas horas, oxidação da glucose - cor amarela
• Após 24h:

Glucose (+); lactose (-) - A glucose esgota e a lactose não é fermentada; a bactéria recorre à
catabolização de aminoácidos com formação de produtos que alcalinizam
o meio (ex. NH3) fazendo o indicador de pH virar para vermelho.
ou

Glucose (+); lactose (+) - A glucose esgota e a lactose é fermentada; os produtos de fermentação
acidificam o meio e o indicador de pH permanece amarelo

2) Provas do metabolismo respiratório

Teste da oxidase
Como já foi referido as espécies da família Enterobacteriaceae são aeróbias anaeróbias facultativas
enquanto que as espécies da família Pseudomonadaceae são aeróbias estritas. O teste da oxidase permite

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 67


destinguir as duas famílias pela pesquisa da enzima citocromo oxidase do tipo aa3 que cataliza o último
passo da cadeia respiratória (as bactérias aeróbias estritas são oxidase positivas; as bactérias aeróbias
anaeróbias facultativas são oxidase negativas):

citocromo oxidase aa3


2 cit c reduzido +2H + 1/2 O2 → 2 cit c oxidado + H2O
+

O teste da oxidase é realizado recorrendo ao composto tetrametil-p-fenilenodiamina que na presença da


citocromo oxidase é oxidado pelo citocromo c a um composto de cor púrpura designado por azul de
Wurster:

citocromo oxidase
2 citocromo c oxidado + tetrametil-p-fenilenodiamina →

→ 2 citocromo c reduzido + tetrametil-p-fenilenodiamina oxidada (azul de Wurster)

Técnica:
• com uma pipeta Pasteur fechada, colocar uma colónia sobre um disco do teste da oxidase
previamente humedecido com água destilada estéril dentro de uma caixa de Petri vazia

Leitura:
oxidase (+) - coloracão púrpura
oxidase (-) - coloracão rosa

Caso o teste da oxidase seja positivo, a bactéria em estudo pertence à família Pseudomonadaceae. Uma
identificação complementar deve ser feita pela observação de pigmento de cor verde em placas de gelose
simples, assim como pela detecção de um cheiro característico a flores. A P. aeruginosa produz dois
pigmentos, a piocianina (azul) e a pioverdina (verde). A tonalidade esverdeada das colónias deve-se à
difusão dos dois pigmentos na gelose.

3) Provas do metabolismo proteico

Teste da urease
Este teste é realizado no meio ureia-indol (que contém ureia, L-triptofano, tampão fosfato, glucose e
vermelho de fenol) e é pesquisada a enzima urease, responsável pela hidrólise da ureia (produto do
metabolismo dos aminoácidos) com obtenção de amónia:

urease
ureia + 2 H2O → CO2 + H2O + 2NH3

Dado que a amónia alcaliniza o meio, o indicador de pH nele contido (vermelho de fenol) vira para a cor
alcalina (rosa cereja).

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 68


Técnica:
• Inocular o meio ureia-indol
• Incubar a 37ºC/24h

Leitura:
urease (+) - meio rosa cerise
urease (-) - meio da cor original (amarelo)

Pesquisa da triptofano-desaminase (TDA)


Se a bactéria em estudo possuir uma triptofano-desaminase irá desaminar o L-triptofano, presente no
meio ureia-indol, originando ácido indol-pirúvico:

TDA
L-triptofano → ácido indol-pirúvico

A presença de ácido indol-pirúvico será revelada por um reagente contendo percloreto de ferro em
solução ácida (HCl) que origina um composto castanho.

Técnica:
• Inocular o meio ureia-indol
• Incubar a 37ºC/24h
• Revelar com o reagente de TDA

Leitura:
TDA (+) - meio castanho escuro
TDA (-) - meio da cor anterior à adição do reagente de TDA

Determinação da produção de indol


Algumas bactérias desaminam e hidrolizam o L-triptofano com obtenção de indol e ácido pirúvico:

TDA
L-triptofano → ácido indol-pirúvico

hidrólise
ácido indol-pirúvico → indol + ácido pirúvico + amónia

A presença de indol será neste teste revelada por adição do reagente de Kovacs (p-
dimetilaminobenzaldeído em solução de HCl e álcool isoamílico) originando um composto de cor
vermelho cereja, o corante de Rosindol, que fica na fase orgânica.

Técnica:
• Inocular o meio ureia-indol
• Incubar a 37ºC/24h
• Revelar com o reagente de Kovacs

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 69


Leitura:
indol (+) - anel vermelho à superfície do meio (fase orgânica)
indol (-) - anel acastanhado à superfície do meio (fase orgânica)

4) Provas de utilização substratos específicos

Teste do citrato
Este teste é utilizado para definir se a bactéria em estudo tem capacidade (por acção das enzimas citrato
permease e citrase) para usar o citrato como única fonte de carbono e energia, e um sal de amónia como
fonte de azoto, contidos no meio de Citrato-Simmons (composição: dihidrogeno fosfato de amónia,
fosfato dipotássio, cloreto de sódio, citrato de sódio, sulfato de magnésio, azul de bromotimol, agar).

Se a bactéria possuir as enzimas referidas:

citrato
permease
citrato de sódio → ácido pirúvico + ácido oxaloacético + CO2
citrase

O dióxido de carbono produzido forma carbonato de sódio (com o excesso de sódio proveniente do
citrato de sódio) que por sua vez alcaliniza o meio de cultura fazendo virar o indicador de pH para azul:

CO2 + H2O + Na+ → Na2CO3 (alcalino)

Técnica:
• Inocular o meio de Citrato-Simmons, por estrias
• Incubar a 37ºC/24h

Leitura:
citrato (+) - meio azul
citrato (-) - meio da cor original (verde)

Sistemas automatizáveis de identificação bacteriana: o sistema API 20E ou BBL™ Crystal™


Enteric/Nonfermenter ID Kit

O API 20E é um sistema estandardizado e comercializado (bioMerieux) para a identificação de


Enterobacteriaceae e outros bacilos Gram negativos de crescimento não fastidioso, sendo uma versão em
miniatura dos procedimentos bioquímicos convencionais. É um sistema de microtubos pronto a usar, em
que se realizam simultaneamente vinte e dois testes bioquímicos standardizados utilizando como inóculo
suspensões em solução salina (0.85%) de culturas bacterianas puras.
O sistema é constituído por uma galeria contendo vinte câmaras, cada uma das quais constituída por um
microtubo e uma cúpula. Os microtubos contêm os substratos das reacções bioquímicas na sua forma
desidratada, sendo estes rehidratados pela adição da suspensão bacteriana salina.
De forma a criar uma atmosfera de anaerobiose, fundamental para a realização de reacções fermentativas,
é adicionado a alguns microtubos (enchimento da cúpula), óleo mineral ou parafina líquida. As galerias
são incubadas 18-24h a 35-37ºC. A leitura dos testes bioquímicos da galeria é feita pela observação da
modificação da cor, após os vários sistemas indicadores terem sido afectados pelos metabolitos

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 70


bacterianos ou pelos reagentes adicionados. A identificação de bactérias desconhecidas é então feita
recorrendo a tabelas ou sistemas automatizados, fornecidos pela casa comercial.
A lista completa de bactérias que é possível identificar através deste sistema, encontra-se no Anexo 2.

Interpretação dos testes do sistema API 20E ou BBL

ONPG: A β-galactosidase hidroliza o ONPG com libertação do ortonitrofenol (cor amarela).


ADH: A arginina dihidrolase transforma a arginina em ornitina, amónia e dióxido de carbono o que
provoca um aumento de pH e o indicador vira de amarelo para vermelho.
LDC: A lisina descarboxilase transforma a lisina numa amina primária, a cadaverina. Esta amina
provoca um aumento de pH e consequente mudança do indicador de amarelo para vermelho.
ODC: A ornitina descarboxilase transforma a ornitina numa amina primária, a putrescina. Esta amina
causa uma subida do pH e como tal uma mudança do indicador de amarelo para vermelho.
CIT: O citrato é a única fonte de carbono. Da utilização do citrato resulta uma subida de pH e uma
mudança do indicador de verde para azul.
H2S: O sulfureto de hidrogénio é produzido a partir do tiossulfato. O sulfureto de hidrogénio reage com
os sais de ferro produzindo um precipitado negro.
URE: A urease liberta amónia a partir da ureia; a amónia provoca uma subida de pH e mudança do
indicador de amarelo para vermelho.
TDA: A triptofano desaminase forma o ácido indol-pirúvico a partir do triptofano. O ácido indol-
pirúvico produz uma cor castanha na presença do cloreto férrico.
IND: O metabolismo do triptofano resulta na formação de indol. O reagente de Kovacs forma um
complexo corado (vermelho-rosa) com o indol.
VP: A acetoína, um metabolito intermediário da fermentação butanodiólica da glucose é produzida a
partir de piruvato de sódio e evidenciada pela formação de um complexo corado.
GEL: A gelatina é uma mistura solúvel de polipeptídeos obtida por ebulição do colagénio em água.
Algumas bactérias hidrolizam a gelatina por acção de uma enzima proteolítica, a gelatinase,
sendo os aminoácidos resultantes posteriormente metabolizados. Uma vez hidrolizada a gelatina
liquefaz-se. A liquefacção da gelatina é revelada pela difusão de um pigmento negro quando na
presença do reagente de Kohn.
GLU, MAN, INO, SOR, RHA, SAC, MEL, AMY, ARA: A utilização destes carbohidratos resulta na
formação de ácidos e consequente baixa de pH. O indicador muda de azul para amarelo.
NO3-: Algumas bactérias (aeróbias estritas) têm a capacidade de utilizar os nitratos como aceitador final
de electrões da cadeia respiratória reduzindo-os a nitritos, quando não existe oxigénio disponível, ou seja,
em anaerobiose.

Os nitritos formam um complexo vermelho com o ácido sulfanílico e a N, N-dimetilalfanaftilamina,


usados para revelar este teste. No caso da reacção ser positiva, confirma-se a utilização de nitratos como
aceitador de electrões (ex. E. coli):

nitrato redutase
nitratos → nitritos

No caso da reacção ser negativa, a adição de zinco confirma a presença de nitratos não reduzidos,
reduzindo-os a nitritos (cor laranja-rosa). Se não houver alteração de cor após a adição de zinco significa
que houve uma redução completa dos nitratos (nitratos → nitritos → azoto gasoso), (ex. Pseudomonas
sp):

nitrito redutase
nitritos → N2↑

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 71


8.2 - Protocolos experimentais

Pretende-se que os alunos aprendam a identificar algumas bactérias Gram negativas. Utilizarão técnicas
de exame microscópico, de cultura bacteriana e do estudo do metabolismo através da realização de
alguns testes bioquímicos.

1) No meio de tripticase-soja agar inocular pelo método de estrias:

• Pseudomonas aeruginosa

2) Em duas placas de meio de Drigalsky, inocular pelo método de estrias:

• E. coli
• Klebsiella oxytoca
• Proteus mirabilis
• Proteus vulgaris
• Pseudomonas aeruginosa
• Enterobacter cloacae

3) Incubar a 37ºC/24h.

No dia seguinte (segundo dia):


Identificar uma bactéria de cada família estudada (Pseudomonadaceae e Enterobactereaceae). Para isso
realizar o exame a fresco, a coloração de Gram e os seguintes testes:

1) Teste da oxidase
• Raspar um bastonete impregnado de tetrametil parafenilenodiamina (Oxoid) nas bactérias isoladas em
meio de cultura sólido. Incubar à temperatura ambiente.
• Observar a mudança de cor ao fim de 5 minutos.

oxidase (+) - coloracão púrpura (Pseudomonas aeruginosa)


oxidase (-) - coloracão rosa (enterobactéria → prosseguir os testes)

2) Pesquisa de β -galactosidase
• A partir de colónias lactose (-), multiplicadas em meio selectivo (contendo lactose), fazer uma
suspensão bacteriana em soro fisiológico estéril num tubo de hemólise
• Adicionar uma gota de tolueno ou clorofórmio
• Agitar
• Colocar um disco de ONPG
• Incubar a 37º/24h

3) Testes do VM e de VP
• Inocular 2 tubos com o meio Clark e Lubs
• Incubar a 37ºC/24h

4) Teste do citrato
• Inocular o meio de Citrato-Simmons, por estrias
• Incubar a 37ºC/24h

5) Teste da urease, TDA e indol:


• Inocular o meio ureia-indol

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 72


• Incubar a 37ºC/24h
6) Meio de Hajna-Kligler
• Inoculação do meio por picada central no fundo do tubo, e por estrias na rampa
• Incubação a 37ºC/24h

7) Inocular uma galeria Api 20E ou BBL seguindo as instruções do fabricante

No dia seguinte (terceiro dia)

1) Observar e registar os resultados do teste do ONPG e do citrato


2) Revelar o teste do VM

• Adicionar 5 gotas de vermelho de metilo


• Observar a coloração obtida

3) Revelar o teste do VP

• Adicionar 2 ou 3 gotas de VP1 e agitar


• Adicionar 2 ou 3 gotas de VP2 e agitar
• Esperar 15-30 minutos à temperatura ambiente em suporte inclinado com o tubo aberto
• Observar a coloração obtida

4) Observar e registar os resultados do teste da urease e do Kligler

5) Revelar o teste do TDA

• Adicionar 2-3 gotas de reagente de TDA e agitar


• Observar alteração de cor

6) Revelar o teste do indol

• Adicionar 5 gotas de reagente de Kovacs


• Agitar e deixar separar fases
• Observar o resultado

7) Ler a galeria API ou BBL seguindo as instruções do fabricante

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 73


8.3 – Resultados e discussão

Construa uma tabela com os resultados obtidos relativamente a todas as bactérias estudadas.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 74


CAPÍTULO 9- Isolamento de bacteriófagos de águas de superfície

9.1 – Introdução
Os bacteriófagos podem ser isolados a partir de muitos ambientes diferentes. Será de esperar encontrá-los
em grandes quantidades sempre que se estiver na presença de uma densa população bacteriana, como por
exemplo na água de esgoto.
Dado que a concentração de bacteriófagos específicos para um determinado hospedeiro pode ser
relativamente baixa, o primeiro passo no processo de isolamento é o de enriquecimento. Quando a
amostra é incubada com a população bacteriana respectiva, os fagos específicos para aquela bactéria vão
multiplicar-se em larga escala, sendo mais fáceis de isolar.
Para o isolamento dos fagos, as bactérias podem ser mortas e lisadas por um tratamento com
clorofórmio. Em seguida é efectuada uma filtração em membranas que serve para remover os resíduos de
células e as bactérias sobreviventes. O filtrado que contém os bacteriófagos pode ser armazenado no
frigorífico (2-8ºC) durante meses.
Os fagos do filtrado podem ser isolados misturando uma pequena quantidade de filtrado com uma cultura
em fase exponencial de crescimento da bactéria hospedeira. A mistura é então inoculada na superfície de
uma caixa de Petri contendo agar nutritivo. A esta técnica chama-se cultura em dupla camada.

Na prática, os vírus e as bactérias estão misturados com o meio de agar liquefeito (gelose mole)- agar da
camada de cima, sendo colocados sob a forma de camada fina na superfície do agar base (meio de
Luria-Bertani). Quando o agar da camada de cima gelifica, os vírus e as bactérias são imobilizados. O
fago, pelo facto de estar embebido na gelose e ter a sua mobilidade severamente restrita, infecta somente
as bactérias que lhe estão adjacentes. O fago vai reproduzir-se e, eventualmente, lisar a célula
hospedeira. A partícula viral irá dar origem a milhões de novos viriões, aparecendo então uma zona clara
de bactérias lisadas que se irá desenvolver na camada bacteriana. Esta zona clara, observada a olho nú, é
denominada de placa fágica (Fig. 9.1).
Amostras de cada placa podem ser retiradas e posteriormente utilizadas para cultivar grandes quantidades
de um único tipo de vírus.
Porque cada placa provém de uma única partícula viral, a contagem do número de placas irá permitir
calcular a concentração do vírus na amostra original. Uma vez que a eficiência do plaqueamento
raramente é próxima dos 100%, quando se utiliza o método das placas para quantificar os vírus, é mais
correcto exprimir a concentração (o título) da suspensão viral não como números absolutos de unidades
de viriões mas como números de unidades formadoras de placas (UFP).

Figura 9.1 - Placas de lise produzidas por dois colifagos (T1 e T2). Notar as diferenças no aspecto das
duas placas lise.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 75


9.2- Protocolo Experimental

Pretende-se que os alunos pesquisem a presença de bacteriófagos em águas com elevada carga orgânica,
como por exemplo a água do esgoto, poço ou lago. No final desta aula os alunos deverão saber isolar e
titular fagos de E. coli e P. aeruginosa.

1) Centrifugar cerca de 10-25 ml de água de esgoto ou de


poço durante 10 minutos/ 4000 rpms. A centrifugação facilita
a filtração subsequente: evita a colmatação do filtro e acelera
o processo de filtração.

2) Filtrar o sobrenadante através de um filtro de 0.45 µm, para


remover as bactérias.

3) Adicionar o filtrado a 20 ml de meio de cultura LB (Luria-Bertani) líquido

4) Adicionar a esta mistura 1 ml de E.coli ou P. aeruginosa em


fase exponencial de crescimento (109 UFC/ml).

5) Incubar a 35-37ºC/24 h, com agitação.

6) Num tubo contendo 10 ml de meio LB líquido adicionar 100 µl da mesma cultura de E. coli ou
P.aeruginosa usada anteriormente e incubar a 37ºC/24h (vai servir de cultura em fase exponencial de
crescimento para o dia seguinte).

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 76


No dia seguinte (segundo dia):

1) Parar a incubação da mistura (bactéria e filtrado)


adicionando 1 ml de clorofórmio (utilizar uma
pipeta estéril).

2) Filtrar a mistura por filtro de 0.45 µm para um tubo


de rosca estéril. Este filtrado constitui a solução stock
de fagos.

3) Preparar a partir deste stock uma diluição fágica a 10-2 (Fig. 9.2)

0.1 ml

Adicionar 0,1 ml de
bactéria indicadora em fase
exponencial de
crescimento. 9.9 ml
0.1 ml 0.1 ml SF

Stock Diluição
-2
fágico 10
Bactéri

o
Banho a 48 C

3 ml 3 ml

o
Incubar 24h/ 37 C

Figura 9.2- Isolamento e titulação de bacteriófagos. Protocolo de preparação das diluições virais e da
infecção das bactérias alvo.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 77


No dia seguinte (terceiro dia)
1) Observar as placas de lise formadas e contar o nº de placas em cada caixa. Utilizar as caixas com o nº
de placas mais favorável, entre 25 e 250 colónias.
2) Determinar o nº de bacteriófagos por 1 ml da amostra enriquecida, tendo em conta a diluição
efectuada.

Fórmula utilizada no cálculo do título fágico:

UFP/ml = nº de placas x factor diluição

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 78


9.3- Resultados e discussão

1) Determine o número de fagos de Escherichia coli e Pseudomonas aeruginosa presentes num mililitro
de água de esgoto enriquecida. Apresente os cálculos efectuados.

2) Verifique a existência ou não de variações no tamanho das placas lise e morfologia das mesmas, para
a Escherichia coli e Pseudomonas aeruginosa.

3) Desenhe a morfologia das placas. Procure encontrar explicação para as diferentes morfologias das
placas.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 79


CAPÍTULO 10- Estudo do microbioma oral por exame microscópico direto e cultura

10.1 Introdução
A cavidade oral é formada por um conjunto de tecidos, com numerosos microrganismos associados a
eles, constituindo um ecossistema. Quando este sistema ecológico se encontra em equilíbrio denomina-se
de eubiose, quando ocorrem alterações passa a chamar-se disbiose ou seja uma cavidade oral doente.
A flora oral é um dos mais complexos ecossistemas associados com superfícies biológicas. É responsável
pela formação da placa dentária, um biofilme que se forma na superfície do dente e compreende uma
diversidade de microrganismos, sobretudo bactérias, envolvidas numa matriz de polímeros de origem
quer microbiana, quer do hospedeiro. Estes biofilmes encontram-se geralmente num equilíbrio dinâmico
com o hospedeiro e são compatíveis com a manutenção da integridade dos tecidos colonizados. Em
presença de alterações do ambiente oral, esta microflora causa cárie e doença periodontal. Torna-se
então, absolutamente necessário, perceber a ecologia da flora oral, para explicar a etiologia da doença
oral.

A flora oral é muito complexa podendo ser isoladas > 500 espécies distintas de microrganismos_
bactérias, fungos, protozoários e, ocasionalmente, vírus_ numa mesma cavidade oral humana. A maioria
dos microrganismos existe apenas de forma transitória na cavidade oral. Alguns exemplos de
microrganismos existentes na cavidade oral:

• Cocos Gram positivos: os Streptococcus viridans são os mais isolados;

• Cocos Gram negativos: Neisseria spp. (aeróbia) e Veillonella spp. (anaeróbia);

• Bacilos Gram positivos: podem ser isolados numerosos bacilos Gram positivos e filamentosos
pleormórficos, dos quais se destacam diversas espécies de Actinomyces, Lactobacillus e Bifidobacterium;

• Bacilos Gram negativos: Prevotella, Porphyromonas, Fusobacterium, Eikenella e Haemophilus;

• Outros microrganismos: Espiroquetas comensais, Candida spp. e alguns protozoários como a


Trichomonas tenax e Entamoeba gingivalis.

As principais superfícies de colonização microbiana na cavidade oral incluem a superfície da língua, a


mucosa oral, as superfícies dentárias, o sulco gengival e matérias biocompatíveis. Estes nichos
ecológicos ou ecossistemas primários possuem diferentes características químicas, físicas e
nutricionais, que irão permitir o desenvolvimento de diferentes espécies microbianas.

• Dorso da língua: ocorre colonização bacteriana, sendo cerca de 45% cocos Gram positivos anaeróbios
facultativos (ex: S. salivarius) seguindo-se com cerca de 16% os cocos Gram negativos anaeróbios
estritos (ex: Veillonella) e por fim os bacilos Gram positivos anaeróbios facultativos (ex: Actinomyces).

• Mucosa: a sua microflora, com excepção dos lábios e da gengiva é essencialmente constituída por
cocos Gram positivos anaeróbios facultativos, especialmente pelos estreptococos.

• Superfícies dentárias: vão oferecer superfícies muito estáveis para a colonização microbiana e a
composição do biofilme vai depender dos diferentes tipos de placa estabelecidos. A placa pode ter dois
tipos de localização; acima da gengiva, placa supragengival, ou por baixo da gengiva, placa subgengival.

• Sulco gengival: num estado de saúde periodontal, predominam os cocos Gram positivos anaeróbios
facultativos (50%) e os bacilos Gram positivos anaeróbios facultativos (18%).

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 80


• Saliva: não se encontra uma flora microbiana própria. Todos os microrganismos isolados apresentam
um carácter transitório e vão depender dos outros ecossistemas primários.

Métodos de estudo da flora oral

A cavidade oral desenvolve uma flora microbiana característica que varia de local para local. Esta flora
vive em harmonia com o hospedeiro e é designada por flora comensal ou nativa. A flora comensal tem
várias funções entre elas a prevenção da colonização por organismos potencialmente patogénicos. Os
organismos patogénicos são aqueles capazes de iniciar doença num individuo saudável. Contudo quando
o estado do hospedeiro se modifica (idade, administração de drogas, alterações no seu estado
imunológico) alguns comensais tornam-se oportunistas e provocam infecções. A maioria das infecções
orais provém de patogéneos oportunistas e não de verdadeiros organismos patogénicos.

A etiologia microbiana das patologias orais, tais como, cárie dentária, gengivite, periodontite, pulpite e
abcessos periapicais é complexa e está directamente relacionada com a microflora oral. Em determinadas
situações sabe-se que alguns microrganismos apresentam um papel bastante específico em alguns destes
processos patológicos (Tabela 1)

Tabela 1 - Principais bactérias envolvidas em patologias infecciosas da cavidade oral


Patologia Bactérias Odontogénicas
Cárie dentária S. mutans, L. casei
Gengivite P. intermedia, espiroquetas
Periodontite:
- adulto P. gengivalis, P. intermedia, B. forsythus
- jovem A. actinomycetemcomitans
Pulpite P. endodontalis
Processos purulentos F. nucleatum spp., Phorphyromonas e Prevotella
pigmentadas, Actinomyces spp.
Bactérias Não Odontogénicas
Estomatite ulcerativa e gangrenosa T. vicentii, F. nucleatum spp., P. melaninogenica
Parotidite aguda S. aureus

1. Colheitas
No estudo dos microrganismos orais e das patologias infecciosas da cavidade oral podem utilizar-se
diferentes tipos de amostras. O tipo de amostra estará condicionado pelo processo que se vai estudar e
pelo tipo de análise que se pretende realizar.
As amostras para exame microbiológico são muitas vezes obtidas com técnica inadequada, de um local
impróprio, e em quantidade insuficiente. Muitas delas são, também, comprometidas devido à demora e
aos inadequados acondicionamento e transporte para o laboratório, o que promove a distorção da
quantidade relativa de microorganismos presentes: morte dos mais sensíveis, que são normalmente os
responsáveis pela infecção, e proliferação exagerada dos mais resistentes, que muitas vezes não são mais
do que a flora autóctone.
Na colheita de amostras orais deve evitar-se tanto quanto possível a contaminação da amostra por flora
indígena oral.

1.1 Regras gerais para colheita de amostras para exame bacteriológico

1 - Obter produto antes do tratamento antibiótico;

2 - Colher do local onde o agente etiológico é mais frequentemente encontrado;

3 - Colher durante a fase aguda;

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 81


4 - Colher quantidade suficiente para permitir um exame completo;

5 - Fornecer ao laboratório as informações clinicas indispensáveis;

6 - Colher com técnica adequada, evitando a contaminação da amostra com a flora autóctone;

7 - Transporte para o laboratório em tempo adequado e em recipiente próprio;

1.2 Tipos de amostra

- Lesões da mucosa (Fig.1A-D)


- Abcessos com supuração
- Infeções das glândulas salivares
- Infeções endodônticas
- Biópsias de tecidos
- Sangue (soro)
- Placa supragengival (Fig.1E)
- Bolsas periodontais (placa subgengival – Fig.1F)

A B
C D

Figura 1 – Tipos de amostras. Lesões da mucosa oral (A-D), placa supragengival (E), placa subgengival
(F).E F
A colheita de saliva é um método indirecto de colheita das bactérias dos dentes. Requer apenas que o
indivíduo mastigue um objecto (geralmente uma pastilha de parafina) que desaloja as bactérias dos
dentes e cuspa a saliva para um copo de recolha estéril.

As colheitas da mucosa oral e placa subgengival são feitas recorrendo normalmente a zaragatoas de
algodão esterilizadas, que são posteriormente colocadas em meio de transporte ou colocadas numa
solução de soro fisiológico para posterior inoculação de meios de cultura próprios.

A colheita de amostras da placa subgengival pode fazer-se com recurso a uma cureta (Fig. 1F), mas como
é fisicamente impossível inserir uma cureta a mais de 6 mm de profundidade há dificuldades em retirar

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 82


amostras de bolsas periodontais profundas em doentes com doença periodontal. A alternativa à colheita
com cureta é o uso dos cones de papel endodônticos (Fig. 2).

Figura 2 – Cones endodônticos de diferentes diâmetros.

Os cones podem ser inseridos nas bolsas periodontais ficando embebidos no fluido que contém as
bactérias (Fig. 3). São depois retirados e colocados num tubo contendo uma solução salina ou aquosa ou
em meio de transporte.

Figura 3- Colheita microbiológica de placa subgengival com cones


endodônticos.

As colheitas feitas a partir da cavidade oral devem ter em conta que a maioria dos microrganismos são
anaeróbios e como tal as amostras devem ser processadas com os cuidados requeridos para anaeróbios.

2. Transporte
Quando as amostras colhidas não podem ser imediatamente semeadas torna-se necessário um meio de
transporte. Idealmente o meio de transporte evita o contacto da amostra com o oxigénio, impede a
dissecação da amostra e evita que os microrganismos presentes na mesma se multipliquem. Desta forma
não há alterações no número de bactérias na amostra.

2.1 Exemplos de meios de transporte

Meio de Stuart
O meio de transporte de Stuart (Fig. 4) é recomendado para a conservação e transporte de um grande
número de microrganismos patogénicos, incluindo anaeróbios. Exemplos de microrganismos que podem

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 83


ser conservados e transportados neste meio: Neisseria gonorrhoeae, Heamophilus influenzae,
Corynebacterium diphteriae, Trichomonas vaginalis, Streptococcus sp., Salmonella sp., Shigellas sp. O
meio mantém a viabilidade dos microrganismos sem permitir a sua multiplicação.
Este meio foi desenvolvido originalmente por Stuart enquanto estudava gonococos. Mais tarde Ringertz
incluiu o tioglicolato como agente redutor no meio em vez do carvão originalmente presente. É um meio
quimicamente definido, semi-sólido e não nutritivo. A multiplicação microbiana é impedida devido a
falta de azoto no meio. Contudo, os microrganismos permanecem viáveis ≥ 24 horas.

Figura 4- Aspecto do meio de transporte de Stuart em que são


visíveis os diferentes tipos de zaragatoas.

Portagerm Amies Agar

O Portagerm (Fig. 5) é um meio redutor sólido tamponado para o transporte de aeróbios e anaeróbios. O
agar contido no meio impede a difusão do oxigénio que é levado durante a colheita. Os agentes redutores
combinam-se com o oxigénio livre para manter a anaerobiose. O indicador de oxido-redução permite
visualizar a presença ou ausência de oxigénio: coloração azul-lavanda-presença de oxigénio; sem
coloração: ausência de oxigénio. Qualquer que seja a origem a viabilidade da maior parte dos
microorganismos aeróbios e anaeróbios é mantida 48 horas a 20-25ºC.

Figura 5 – Modo de funcionamento do Portagerm.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 84


Alguns meios de transporte também contêm grãos de vidro (Ex. VMGA III) que facilitam a dispersão das
bactérias no vórtex ou por sonicagem. As amostras dispersas são então semeadas em meios apropriados.

3. Processamento de amostras da placa dentária


Para a identificação dos microrganismos presentes na placa é necessário um transporte e um
processamento adequados das amostras colhidas.

Parâmetros importantes no processamento de amostras da placa dentária

3.1 Anaerobiose
Uma vez que a placa dentária, sobretudo a placa subgengival, contém bactérias anaeróbias é importante
que o meio de transporte seja apropriado para anaeróbios.

3.2 Dispersão
As bactérias da placa dentária tendem a formar aglomerados pelo que a amostra deve ser dispersada antes
do exame cultural para que se obtenham resultados representativos.

3.3 Diluição
O número de microrganismos presentes na placa é muito elevado (109-1012). Por essa razão a amostra
deve ser diluída antes do exame cultural de forma a permitir contagens precisas do número de colónias.

3.4 Incubação
Como a maioria dos microrganismos orais são anaeróbios as amostras devem ser incubadas em atmosfera
de anaerobiose. Se existir a suspeita da presença de bactérias aeróbias ou microaerófilas a amostra deve
ser incubada nesse tipo de ambiente.

4. Métodos de detecção e identificação dos microrganismos existentes na cavidade oral

4.1 Exame microscópico direto

- Exame a fresco
É um método rápido e barato para rastrear os diferentes tipos de morfologia microbiana. Pode recorrer-se
a microscopia de contraste de fase ou de fundo escuro. São distinguíveis quatro grandes grupos
morfológicos: cocos, bacilos imóveis, bacilos móveis e espiroquetas. A sua maior desvantagem é a
incapacidade para identificar espécies específicas. Certas formas atípicas de Streptococcus mutans
podem ser erradamente identificados como bacilos.

- Exame após coloração


A coloração de Gram para amostras orais permite fazer a distinção entre Gram positivos e Gram
negativos. Esta propriedade pode ser importante em microbiologia periodontal em que os organismos
Gram positivos estão principalmente associados com a saúde e os organismos Gram negativos estão
associados com gengivite ou periodontite. Contudo, lâminas de Gram de amostras orais são difíceis de
interpretar porque muitas vezes organismos Gram positivo velhos ou mortos perdem a sua capacidade
para reter o cristal violeta. Uma vez que exige a fixação das amostras, a coloração de Gram não permite
obter informação sobre o tipo de mobilidade bacteriana.

4.2 Cultura e isolamento dos microrganismos


Permite identificar ao nível do género os principais constituintes do microbioma oral, em particular
bactérias e fungos patogénicos, e é um pré-requisito para a determinação da suscetibilidade microbiana
aos antibióticos. Contudo, muitas espécies bacterianas existentes na cavidade oral não são facilmente
cultiváveis com os meios de cultura existentes.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 85


Tipos de meio de cultura usados em microbiologia oral

Meios não selectivos - permitem o crescimento dos microrganismos nas mesmas proporções em que se
encontram na amostra. Os meios não selectivos usados em microbiologia oral são meios simples
enriquecidos com extratos de tecidos ricos em proteínas suplementados com 5% a 10% de sangue
desfibrinado de cavalo, hemina, vitamina K e outros factores nutricionais que são importantes para o
crescimento de várias espécies orais. Ex. Tripticase soja agar.

Meios selectivos - Contém compostos que permitem apenas o crescimento de um determinado tipo ou
grupo de microrganismos. Exs. Meio ROGOSA SL, Mitis Salivarius Bacitracina Agar, Chromo ID
Candida.

Meio ROGOSA SL
O meio ROGOSA SL é usado como meio sólido seletivo para o isolamento de lactobacilos orais ou
fecais que apesar de terem pouco significado clínico podem ser confundidos com estreptococos.

Composição do meio ROGOSA (g/litro)


Peptonas da caseína (10 g); extracto de levedura (5 g); D (+) glucose (20 g); fosfato de potássio (6 g);
citrato de amónia (2 g); Tween R 80 (1 g); acetato de sódio (15 g); sulfato de magnésio (0,575 g); sulfato
de ferro (II) (0,034 g); sulfato de manganésio (0,12 g); agar-agar (15 g).

As baixas concentrações de magnésio, manganésio e ferro asseguram o crescimento óptimo de


lactobacilos. O extrato de levedura é uma fonte de vitaminas, particularmente do grupo B, que são
indispensáveis para o crescimento deste tipo de bactérias; o Tween 80 é a fonte de ácidos gordos
necessários para o desenvolvimento de lactobacilos. O citrato de amónia e o acetato de potássio inibem o
desenvolvimento da maioria dos contaminantes, incluindo estreptococos e fungos. O pH ácido resultante
da adição de ácido acético favorece o crescimento de lactobacilos e inibe o crescimento de outras
bactérias.
O meio é de cor âmbar e os lactobacilos aparecem como colónias esbranquiçadas, grandes (2-3 mm),
lisas e circulares.

Figura 6- Colónias de Lactobacillus acidophilus em meio ROGOSA SL.

Meio Mitis salivarius Agar


Meio recomendado para isolamento e diferenciação de culturas mistas de estreptococos (Fig. 7),
especialmente Streptococcus mitis, Streptococcus salivarius e Enterococcus spp. que apresentam reações
alfa- e beta-hemolíticas em gelose sangue, em estudos epidemiológicos de placas dentárias e cáries a
partir de amostras salivares. Estas três bactérias fazem parte da microflora humana normal. S. mitis e S.
salivarius são estreptococos do grupo viridans. Estes organismos têm um papel importante na
cariogénese e na endocardite infecciosa e causam um número cada vez maior de bacteriémias. Os
enterococos causam infecções do trato urinário, infeções em feridas e bacteriémia, e podem colonizar a
pele e as membranas mucosas.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 86


Composição:
Caseína enzimática hidrolisada (15 g/L), péptidos que resultam da digestão de tecido animal (5 g/L),
dextrose (1 g/L), sacarose (50 g/L), fosfato dipotássico (4 g/L), azul tripan (0,075 g/L), cristal violeta
(0,0008 g/L), agar (15 g/L). pH final (a 25ºC): 7,0 ± 0,2.

Os produtos da digestão da caseína e dos tecidos animais fornecem carbono, azoto e aminoácidos usados
como requerimentos gerais para o crescimento bacteriano. O fosfato dipotássico e o agente tamponante.
O cristal violeta e o azul tripan inibem o crescimento da maioria dos bacilos Gram negativos e das
bactérias Gram positivas excepto os estreptococos. O azul tripan é absorvido pelas colónias produzindo
uma cor azul. A sacarose e a dextrose são utilizadas como fonte de energia. A sacarose permite que o
Streptococcus salivarius desenvolva colónias mais exuberantes que o Streptococcus oralis ou o
Enterococcus faecalis.

Streptococcus salivarius Colónias grandes, azuis claras, opacas, mucóides, 2-5 mm,
lisas ou rugosas, elevadas, brilhantes, com aspeto clássico
de “goma”, devido a formação de levanos a partir da
sacarose
Streptococcus mitis Colónias azuis, planas, pequenas, rijas, com cercar de 0.2
mm com centro em cúpula.
Streptococcus mutans Colónia elevada, convexa, ondulada, opaca, azul clara, 0.5-
1 mm, com margem rugosa; granular com aspecto de ”
vidro fosco”. Podem exibir uma bolha brilhante na
superfície da colónia ou ao longo dela devido a excessiva
síntese de glucanos a partir da sacarose.
Streptococcus sanguis Colónia elevada, lisa, rija, cravada no agar, adere á
superfície do meio e não é facilmente removida.
Enterococcus spp Colónia azul enegrecida, reluzente e levemente elevada, 1-2
mm com periferia bem delineada.

Figura 7 – Mitis Salivarius agar incubado com diferentes bactérias

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 87


Meio Mitis Salivarius Bacitracina Agar
O Mitis Salivarius Bacitracina Agar é um meio selectivo desenvolvido para o isolamento de
Streptococcus mutans da placa dentária humana. Baseia-se no meio Mitis Salivarius mas tem 20% de
sacarose (em vez de 5% do meio original) e tem ainda 0,2 unidades/ml de bacitracina.
Por vezes há crescimento de enterococos ou leveduras quando se faz cultura direta de amostras da placa
de crianças com lesões dentárias avançadas.

Atmosfera de incubação
A cultura de anaeróbios é baseada na exclusão de oxigénio da atmosfera e produção de um baixo
potencial de oxidação-redução no meio de cultura. Para isso a incubação dos meios de cultura tem de ser
feita em câmaras de anaerobiose ou em caixas de anaerobiose, caixas hermeticamente fechadas em
que se elimina o oxigénio através de uma reacção química com hidrogénio que dá origem a água (Fig. 8).

Figura 8 – Caixas de anaerobiose.

4.3 Identificação dos microrganismos existentes na cavidade oral

A identificação de muitas espécies orais é em geral presuntivamente efectuada por testes de identificação
semi-automatizados que põem em evidência características bioquímicas e/ou metabólicas das bactérias.
Exs. Sistemas API ou BBL. Contudo, a identificação definitiva de muitas espécies pode requerer um
estudo bioquímico aprofundado dos produtos finais do metabolismo ou o estudo do perfil proteico da
bactéria ou a caracterização genómica.

Critérios utilizados para caracterização de bactérias orais

Morfologia das colónias


- Diâmetro
- Forma
- Superfície
- Densidade
- Consistência
- Cor
- Hemólise
- Aderência

Exame microscópico
- Gram
- Fresco: - Mobilidade

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 88


- Morfologia
- Agrupamento
- Endosporos

Tolerância ao oxigénio
- Anaeróbios estritos
- Anaeróbios aerotolerantes
- Anaeróbios facultativos
- Microaerófilos
- Aeróbios estritos

Caracterização bioquímica
- Catalase
- Redução dos nitritos
- Oxidase
- Reacções de fermentação
- Análise dos produtos finais de fermentação
- Perfil proteico da membrana celular por SDS PAGE
- Reacções de hidrólise

Outros testes de identificação

Testes de imunodiagnóstico
A detecção dos antigénios bacterianos com recurso a anticorpos específicos pode ser importante para a
melhor caracterização de algumas espécies patogénicas da cavidade oral. Há ainda testes imunológicos
que permitem determinar os níveis de anticorpos anti-bacterianos na saliva, fluido gengival e soro.
Os testes imunológicos têm particular importância para a identificação de organismos que têm
dificuldade em crescer nos meios de cultura tradicionais uma vez que não requerem nem a viabilidade
destes organismos, nem manuseamento asséptico da amostra. Por outro lado, podem fornecer importantes
dados epidemiológicos mesmo na ausência de cultura bacteriana.

Tipos de testes de imunodiagnóstico

Ensaios de imunofluorescência
Os ensaios de imunofluorescência são baseados na ligação específica de um anticorpo primário aos
determinantes antigénicos na superfície do microrganismo em estudo. Um fluorocromo pode ser
acoplado a um anticorpo secundário que se liga ao anticorpo primário sendo a imunofluorescência
indirecta; alternativamente, o fluorocromo pode ser acoplado ao anticorpo primário sendo a
imunofluorescência directa.

Ensaios imunoenzimáticos (ELISA)


Em microbiologia oral, os ensaios ELISA são usados para determinar níveis de anticorpos anti-
bacterianos na saliva ou fluido gengival; no entanto tem um uso limitado para a identificação de
organismos específicos.

Ensaios de aglutinação
Na aglutinação em látex, os anticorpos específicos são ligados a partículas de látex em poliestireno e o
contacto com o antigénio homólogo vai induzir à formação de uma rede de aglutinação. Aglutinação em
látex tem vindo a ser utilizado para identificar P. gingivalis, A. actinomycetemcomitans e serotipos de
Streptococcus sp.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 89


Testes com ácidos nucleicos

A aplicação de testes com ácidos nucleicos no diagnóstico de infecções microbianas baseia-se no facto
de todos os organismos vivos terem um material genético único que os distingue de todos outros. Ao
contrário do exame cultural, não são necessários organismos vivos e ao contrário das técnicas
imunoenzimáticas a identificação é independente das reações antigénio-anticorpo. A maior vantagem da
identificação pelos ácidos nucleicos é a possibilidade de distinção entre espécies de maior ou menor
potencial patogénico. A sua limitação principal é que apenas os microrganismos para os quais já existem
sequências de DNA disponíveis podem ser conclusivamente identificados. Estes métodos permitem
também obter alguma informação sobre padrões de susceptibilidade aos antibióticos com base em
mutações de resistência conhecidas. Contudo, nem todas as mutações de resistência são conhecidas pelo
que nem sempre é possível obter informação conclusiva sobre a susceptibilidade dos microrganismos aos
antibióticos por esta via. Têm vindo a ser desenvolvidos testes com ácidos nucleicos para identificação e
caracterização de P. gingivalis, Peptostreptococcus micros e A. actinomycetemcomitans, entre outros.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 90


10.2. Protocolos Experimentais

1º Dia – Colheita para meio de transporte

Placa Supragengival

Raspar as zonas de retenção com uma zaragatoa e em seguida colocá-la em tubo com meio de transporte.

Dorso da língua

Raspar o terço posterior do dorso da língua com uma zaragatoa e em seguida colocá-la em tubo com
meio de transporte.

Mucosa Oral

Raspar a face interna da bochecha com uma zaragatoa e em seguida colocá-la em tubo com meio de
transporte.

2º Dia - Exame microscópico directo após coloração de Gram

Placa Supragengival

Raspar as zonas de retenção com uma zaragatoa e em seguida colocá-la em tubo com 0,5 ml de SF (soro
fisiológico). Dispersar os microrganismos agitando o tubo (zaragatoa + SF) em vórtex durante 1 minuto e
em seguida preparar um esfregaço em lâmina e executar a coloração de Gram.

Dorso da língua

3.1 Colheita
Raspar o terço posterior do dorso da língua com uma zaragatoa e em seguida colocá-la em tubo com
0,5 ml de soro fisiológico. A partir da zaragatoa em soro fisiológico preparar um esfregaço em lâmina e
executar a coloração de Gram.

Mucosa Oral

Raspar a face interna da bochecha com uma zaragatoa e em seguida colocá-la em tubo com 0,5 ml de
soro fisiológico. A partir da zaragatoa em soro fisiológico preparar um esfregaço em lâmina e executar a
coloração de Gram.

Saliva

Recolher a ≥ 1 ml de saliva para recipiente graduado mastigando uma pastilha de parafina. Agitar o
recipiente em vórtex durante 1 minuto para dispersão. A partir da saliva recolhida preparar um esfregaço
em lâmina e executar a coloração de Gram.
Nota: Conservar a amostra no frio depois de a utilizar.

Fixação e coloração de Gram:

• Fazer um esfregaço em lâmina e secar;


• Fixar à chama (3 passagens lentas sobre a chama);
• Corar com cristal violeta abundante durante 1 min; lavar com água
• Adicionar lugol abundante e deixar actuar 1 min; lavar com água;

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 91


• Lavar o esfregaço com solução de álcool-acetona durante 5 seg; lavar com água;
• Corar com fucsina diluída - 1 min; lavar com água e secar;
• Observar ao microscópio óptico (objectiva de 100x e óleo de imersão);

3º Dia - Inoculação de meios de cultura com amostras da placa supragengival, dorso da língua,
mucosa oral e saliva

Realizar colheita e dispersão (quando necessário) tal como na aula anterior.


A partir da zaragatoa em soro fisiológico executar exame a fresco.

Inocular os meios de cultura descritos em baixo por estrias utilizando a zaragatoa colocada no meio de
transporte (placa supragengival, dorso da língua e mucosa oral). No caso da saliva, molhar uma zaragatoa
na saliva colhida.

Meios de cultura a inocular:


- Mitis Salivarius Agar
- Mitis Salivarius Bacitracina Agar
- Gelose sangue
- Chapman

Incubar as placas, 37ºC/3-4 dias em aerobiose (MSA e MSBA em atmosfera de microaerofília).

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 92


10.3. Resultados e discussão

Placa Supragengival

Exame Microscópico Directo

Exame a fresco

Células inflamatórias ----------------------------------------------------------


Quantidade relativa de microrganismos ------------------------------------
Mobilidade dos microrganismos --------------------------------------------
Fungos e protozoários -------------------------------------------------------

Coloração de Gram

Proporção Gram-/Gram+ ---------------------------------------------------------


Estruturas de coagregação ------------------------------------------------------

Exame Cultural

Exame macroscópico

- Abundância da cultura
- Presença de cultura pura, predominante ou mista
- Aspecto das colónias em predomínio:
Gelose de Sangue ------------------------------------------------------------------------
Meio Mitis Salivarius Agar------------------------------------------------------------
Meio Mitis Salivarius Bacitracina Agar---------------------------------------------
Meio de Chapman ------------------------------------------------------------------------

Exame microscópico
Coloração de Gram das colónias em predomínio:--------------------------------

Testes de identificação

Teste da catalase
Resultado: -----------------------------------------------------------------------------

Galeria de identificação API20Strep


Identificação de: ----------------------------------------------------------------------

Tipagem de Estreptococos
Teste de aglutinação em látex – Classificação de Lancefield (Slidex Strepto Kit)
Resultado: ------------------------------------------------------------------------------

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 93


Saliva

Exame Microscópico Directo

Exame a fresco
Células inflamatórias ----------------------------------------------------------
Quantidade relativa de microrganismos ------------------------------------
Mobilidade dos microrganismos --------------------------------------------
Fungos e protozoários -------------------------------------------------------

Coloração de Gram

Proporção Gram-/Gram+ ---------------------------------------------------------


Estruturas de coagregação ------------------------------------------------------

Exame Cultural

Exame macroscópico

- Abundância da cultura
- Presença de cultura pura, predominante ou mista
- Aspecto das colónias em predomínio:
Gelose de Sangue -------------------------------------------------------------------------
Meio Mitis Salivarius Agar---------------------------------------------------------
Meio Mitis Salivarius Bacitracina Agar----------------------------------------------
Meio de Chapman ---------------------------------------------------------------------

Exame microscópico
Coloração de Gram das colónias em predomínio:--------------------------------

Dorso da língua

Exame Microscópico Directo

Exame a fresco

Células inflamatórias ----------------------------------------------------------


Quantidade relativa de microrganismos ------------------------------------
Mobilidade dos microrganismos --------------------------------------------
Fungos e protozoários -------------------------------------------------------

Coloração de Gram

Proporção Gram-/Gram+ ---------------------------------------------------------


Estruturas de coagregação ------------------------------------------------------

Exame Cultural

Exame macroscópico

- Abundância da cultura

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 94


- Presença de cultura pura, predominante ou mista
- Aspecto das colónias em predomínio:
Gelose de Sangue ----------------------------------------------------------------------------
Meio Mitis Salivarius Agar---------------------------------------------------------
Meio Mitis Salivarius Bacitracina Agar----------------------------------------------
Meio de Chapman ---------------------------------------------------------------------

Exame microscópico
Coloração de Gram das colónias em predomínio:--------------------------------

Mucosa Oral

Exame Microscópico Directo

Exame a fresco

Células inflamatórias ----------------------------------------------------------


Quantidade relativa de microrganismos ------------------------------------
Mobilidade dos microrganismos --------------------------------------------
Fungos e protozoários -------------------------------------------------------

Coloração de Gram

Proporção Gram-/Gram+ ---------------------------------------------------------


Estruturas de coagregação ------------------------------------------------------

Exame Cultural

Exame macroscópico

- Abundância da cultura
- Presença de cultura pura, predominante ou mista
- Aspecto das colónias em predomínio:
Gelose de Sangue -----------------------------------------------------------------------
Meio Mitis Salivarius Agar---------------------------------------------------------
Meio Mitis Salivarius Bacitracina Agar----------------------------------------------
Meio de Chapman ---------------------------------------------------------------------

Exame microscópico
Coloração de Gram das colónias em predomínio:--------------------------------

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 95


CAPÍTULO 11- Identificação e caracterização de estreptococos orais

11.1- Introdução
O género Streptococcus engloba os estreptococos piogénicos (β-hemolíticos), os estreptococos orais e
vários outros estreptococos não agrupáveis. Os Streptococcus fazem parte da flora comensal humana e de
outros animais e encontram-se na pele, nas mucosas da nasofaringe, no canal alimentar e no trato
urogenital. A boca é o maior habitat das espécies orais que parecem estar bem adaptadas para colonizar a
mucosa oral (S. salivarius) ou as superfícies duras (S. sanguinis e S. mutans encontram-se no esmalte
dentário). Na cavidade oral, o S. mutans tem sido considerado o principal responsável por cáries
dentárias. A cariogenicidade deste microrganismo é atribuída à produção de ácido láctico que vai
dissolver o esmalte do dente; a produção de polissacáridos extracelulares na presença de sacarose é o
factor principal na colonização do dente por este organismo e contribui para iniciar a cárie. Em relação à
doença periodontal, algumas espécies como o S. sanguis podem ter um papel protetor.
Os estreptococos orais são os componentes maioritários da placa supragengival e também são
encontrados na placa subgengival.

Streptococcus orais

Grupo viridans (S. mutans, S. sanguinis, S. salivarius, S. mitis e S. oralis)


Os estreptococos anaeróbios facultativos são o grupo mais numeroso na cavidade oral sendo referidos
coletivamente como o grupo viridans. Este grupo é constituído maioritariamente por estirpes α-
hemolíticas mas algumas estirpes podem ser γ-hemolíticas (não apresentar hemólise).
Estes estreptococos estão claramente implicados na colonização de superfícies duras e moles do dente. O
seu significado patogénico está ligado à formação de placa, génese da cárie, gengivite, periodontite e
outros processos odontológicos (abcessos periapicais, periodontais e pulpite).

Como factores de virulência apresentam:


-Síntese de polissacáridos extracelulares solúveis e insolúveis
- Síntese de polissacáridos intracelulares
- Capacidade de se desenvolverem a pH ≈ 5

Streptococcus mutans - São os principais responsáveis por cáries dentárias. O potencial cariogénico é
primariamente expresso na capacidade para fermentar açúcares até ácido lático (acidogenicidade láctica)
e na tolerância a valores baixos de pH, que são necessários para a desmineralização do dente. S. mutans
também consegue aderir à superfície de esmalte e produzir extracelularmente os glucanos resultantes da
polimerização da glucose.

Factores de virulência de S. mutans


1- Síntese de glucanos insolúveis em água
2- Síntese de polissacáridos intracelulares (IPS)
3- Tolerância à acidez
4- Acidogenicidade lática
5- Produção de endodextranase

Streptococcus sanguinis - Distinguem-se dos outros estreptococos orais porque são incapazes de
fermentar o manitol ou sorbitol e na sua apetência para produzir amónia e dióxido de carbono a partir da
arginina. A maior parte das estirpes isoladas produzem glucanos extracelulares a partir da glucose. Estas
bactérias conseguem aderir à película de esmalte e pensa-se que esta espécie seja a primeira
recolonizadora da superfície dentária limpa durante a iniciação da placa dentária.

Streptococcus salivarius - Ocorre regularmente na boca humana independentemente da idade. O seu


habitat é na superfície da língua e é frequentemente a bactéria predominante na saliva.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 96


Streptococcus mitis e Streptococcus oralis – São normalmente considerados comensais da cavidade oral
humana mas em determinadas circunstâncias podem também ter acção patogénica. Os estreptococos
orais, incluindo S. mitis e S. oralis, estão associados com endocardite bacteriana, especialmente em
doentes com válvulas cardíacas. Além disso, S. mitis e S. oralis são frequentemente causadores de
infeções em doentes imunocomprometidos, particularmente após transplante de tecidos e em doentes
com cancros neutropénicos.

Outros Streptococcus

Streptoccocus pyogenes - Os estreptococos piogénicos não são encontrados frequentemente na cavidade


oral; quando isolados na boca geralmente provém de uma infeção oro-nasofaríngea e não devem ser
considerados como fazendo parte da flora oral normal.

Enterococcus faecalis - Os enterococos podem estar presentes em cerca de 75% da população mas
sempre em pequenas quantidades.

Streptococcus pneumoniae – Esta bactéria não faz parte da flora oral normal mas encontra-se presente
nas secreções oro-nasofaríngeas de alguns indivíduos.

Diagnóstico laboratorial

1. Cultura
Para a cultura destas bactérias recorre-se a meios de cultura selectivos para estreptococos orais
adicionados de 5% de sacarose (TYC;MSB;GSTB;TYCSB). Estes meios também ajudam a diferenciar as
diferentes espécies de estreptococos orais com base na sua morfologia. Ex. Mitis Salivarius Bacitracina
Agar.

2. Identificação
Para a identificação destas bactérias recorre-se aos seguintes métodos:
- Coloração de Gram
- Teste da catalase
- Estudo do padrão de hemólise
- Teste de sensibilidade à bacitracina e sulfametoxazol-trimetoprim (SXT)
- Agrupamento de acordo com a classificação serológica de Lancefield:
Grupo A – S. pyogenes
Grupo B – S. agalactie
Grupo A, C, F ou G – Grupo S. anginosus
Grupo D – E. faecalis
Não agrupáveis – S. pneumoniae
- Grupo viridans

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 97


11.2- Protocolos Experimentais

1º Dia – Identificação bioquímica, metabólica e serológica de estreptococos orais isolados em meio


de cultura e análise da sua susceptibilidade antibiótica

1) Análise do crescimento em cultura

Fazer a avaliação macroscópica das colónias obtidas em todos os meios inoculados na semana anterior
(MSA, MSBA, Gelose sangue e Chapman). Anotar especificamente os seguintes aspectos:
- Abundância da cultura
- Presença de cultura pura, predominante ou mista
- Aspecto das colónias em predomínio:
- Tamanho
- Cor
- Mucóides
- Aderentes ao agar
- Brilhantes

2) Coloração de Gram, teste da catálase e análise da capacidade hemolítica

No meio MSA e MSBA, escolha o tipo de colónia em predomínio e efectue os seguintes procedimentos.

a. Coloração de Gram seguido de exame microscópico

b. Teste da catalase:
• Colocar 2 gotas de água oxigenada (H2O2) numa caixa de petri ou lâmina;
• Com uma pipeta de Pasteur fechada retirar 2 colónias bacterianas e colocá-las sobre a água
oxigenada.

c. Para a análise da capacidade hemolítica, repicar as colónias de interesse do meio MSA e MSBA para
uma placa de gelose sangue (se necessário dividir a caixa em vários sectores). Incubar a 37oC
overnight.

3) Análise da susceptibilidade antibiótica dos estreptococos orais: execução de um antibiograma

O antibiograma será efectuado com Streptococcus mutans e Streptococcus pyogenes.

1. Preparar suspensões bacterianas em soro fisiológico ou água destilada estéril. A suspensão tem de ter
turvação 1 na Escala de McFarland.

2. Embeber uma zaragatoa na suspensão bacteriana e inocular uma placa de meio Mueller-Hinton por
estrias apertadas (em 2 direcções ou mais) por toda a superfície do meio.

3. Deixar secar as placas 2 a 3 min ao bico de bunsen.

4. Colocar em cada placa os discos dos antibióticos respectivos com uma pinça ou com um aplicador
mecânico. Discos de antibióticos: amoxicilina; amoxicilina com ácido clavulânico; azitromicina;
eritomicina; tetraciclina; cefuroxima; penicilina; ciprofloxacina. Deixar difundir os antibióticos
durante 10 min.

5. Incubar as placas a 37ºC durante 24h com 5% de CO2.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 98


2º dia - Realização de um API 20Strep para identificação dos estreptococos orais

1) Inoculação de uma galeria de identificação API 20Strep

Cada grupo pode fazer o teste a partir das colónias isoladas na aula anterior em gelose sangue
(fazer teste da catalase para confirmar se são estreptococos)

Preparação da galeria:
• Montar a galeria (câmara e tampa)
• Identificar a galeria com o nome da bactéria, nome do grupo e turma
• Colocar 5ml de água nos alvéolos de modo a proporcionar uma atmosfera húmida durante a incubação

Preparar o inóculo:
• Realizar uma suspensão bacteriana densa (4 McFarland), utilizando uma ampola de meio de
suspensão ou ABE.

Inoculação da galeria:
• Na 1ª metade (testes VP a ADH) distribuir a suspensão com uma pipeta estéril
• Para os testes VP a LAP encher tubo e cúpula
• Encher apenas o tubo para o teste ADH
• Na 2ª metade da câmara (testes RIB a GLYG), abrir uma ampola de meio API GP, e transferir o resto
da suspensão bacteriana anterior (cerca de 0,5ml), misturar bem
• Encher apenas os tubos de todos os testes
• Encher as cúpulas dos testes que têm o nome sublinhado com parafina líquida
• Fechar a câmara com a tampa e incubar a 37ºC/24h

2) Leitura do antibiograma

3º dia - Serotipagem de Estreptococos orais com teste de aglutinação em látex e leitura do API 20
Strep

1) Realização de teste de aglutinação em látex – Classificação de Lancefield (Slidex Strepto Kit)

Bactérias a utilizar:
- Streptococcus mutans
- Streptococcus pyogenes
- Streptococcus agalactie

1.1- Preparação do extrato


a) Colocar num tubo de hemólise vazio, 400µl de solução de enzima de extracção (a enzima já está
distribuída);
b) Suspender 2 colónias na solução de enzima de extracção;
c) Incubar 10-15 min./37ºC.

1.2- Determinação do grupo


a) Homogeneizar bem as suspensões de látex;
b) Colocar numa placa, uma gota de cada látex, nos círculos correspondentes;
c) Com uma pipeta Pasteur de plástico, colocar uma gota do extracto ao lado de cada suspensão de látex;
d) Com ajuda de um palito, misturar as duas gotas utilizando toda a superfície de cada círculo;
e) Agitar a placa, com movimento de rotação, durante 2 minutos;

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 99


f) Observar a olho nú, a presença ou ausência (suspensão homogénea) de aglutinação.

2) Leitura do API 20 Strep

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 100


CAPÍTULO 12- Estudo do micobioma oral

12.1 Introdução

Os fungos são membros normais, embora minoritários, da flora microbiana oral. O fungo mais
frequentemente isolado da cavidade oral humana é a Candida albicans. Este organismo é um comensal
em aproximadamente 20-40% dos indivíduos saudáveis. Os fungos podem no entanto causar doenças da
mucosa oral particularmente em indivíduos imunocomprometidos. A infeção fúngica oral mais comum é
a candidíase que tem várias apresentações.

A célula fúngica
Um fungo é um eucariota definido pela ausência de organização tecidular e de clorofila. A célula fúngica
é frequentemente limitada por uma parede rígida de natureza celulósica ou quitinosa.
A maior parte dos fungos de importância médica apresenta um de dois tipos de morfologia celular. As
formas celulares esferoidais ou ovais são típicas de leveduras (fungos leveduriformes) e possuem o
diâmetro de 5 a 25 µm. As células tubulares ou filamentosas são características das hifas que constituem
os fungos filamentosos (ou bolores). Uma única célula pode possuir o comprimento de 5 a 50 µm por 2 a
5 µm de diâmetro. As leveduras aparecem isoladas ou em grupos de duas a três células, com uma delas
distintamente maior do que as outras. As células das hifas podem ou não ser compartimentadas por meio
de estruturas semelhantes a paredes cruzadas denominadas septos. Um conjunto de hifas forma um
micélio. Alguns fungos são dimórficos, ou seja, podem proliferar como leveduras ou como bolores.
Todos os fungos dimórficos são patogénicos para o homem, apresentando a forma de levedura no interior
do nosso organismo e a forma filamentosa no exterior (no meio ambiente).

Reprodução dos fungos


Os fungos podem reproduzir-se sexuada e/ou assexuadamente.

Reprodução assexuada:
• Por divisão binária (por fissão)
• Por divisão binária (por gemulação)
• Por produção de esporos assexuados.

Exemplos de esporos assexuados:


Artrosporos – obtidos por fragmentação da hifa formando células que se comportam como esporos.
Clamidosporos - Esporos rodeados por uma parede grossa antes da fragmentação. São esporos de
resistência.
Esporangiosporos - Esporos que se desenvolvem em estruturas específicas na extremidade das hifas
(esporângios).
Conidiosporos - Esporos produzidos nas extremidades das hifas (conidióforos).
Blastosporos - Esporos produzidos por gemulação de uma célula não vegetativa.

Reprodução sexuada:
Envolve a união de núcleos compatíveis e pode envolver também a formação de esporos sexuados:
zigosporos, ascosporos, basidiosporos.

Crescimento e identificação de fungos

Leveduras
As leveduras são fungos unicelulares, redondos ou ovais, de parede fina ou espessa. São normalmente 5 a
10 vezes maiores do que as bactérias. Multiplicam-se normalmente por fissão binária (reprodução
assexuada); quando as leveduras se multiplicam sexuadamente produzem vários tipos de esporos que

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 101


podem ser úteis na sua identificação. As suas actividades metabólicas também são utilizadas para
classificação da espécie e do género.
O isolamento de leveduras é feito em meio de Sabouraud com ou sem adição de antibióticos
antibacterianos (ex. cloranfenicol). A adição de antibióticos antibacterianos pode ser fundamental para o
isolamento de espécies de crescimento lento. O meio de Sabouraud é um meio selectivo que contém 4%
de glucose (os fungos toleram pressões osmóticas elevadas) e um valor de pH baixo (5.2), o que vai inibir
o crescimento de outros microrganismos (bactérias).
As colónias de leveduras são semelhantes às colónias bacterianas. Têm uma consistência cremosa e
crescimento rápido, em 1 a 4 dias.

Bolores (fungos filamentosos)


Microscopicamente, os filamentos ou hifas são tubos curvados ou sinuosos, limitados por uma parede.
Apresentam ramificações e mais correntemente septos transversais. Um conjunto de filamentos é
denominado micélio (ou talo).
O isolamento de fungos filamentosos é também realizado em meio de Sabouraud (ou meio análogo)
sendo o crescimento lento, de dias a semanas. As colónias de crescimento centrífugo apresentam-se quer
como bolores com filamentos aéreos enredados mais ou menos longos, quer sob a forma de uma camada
compacta imberbe ou recoberta com uma penugem de filamentos. As hifas podem ser rizoidais, ou seja,
encontrar-se dentro de meio de cultura (ou por ex. no solo).

Estudo do género Candida


• Candida albicans
• Candida krusei
• Candida glabrata
• Candida tropicalis
• Candida guilhermondii
• Candida parapsilosis

a) Isolamento: meio de Sabouraud


b) Taxa de crescimento: crescimento rápido (1-3 dias)
c) Aspecto macroscópico: colónias cremosas, branco porcelana
d) Aspeto microscópico: formas redondas ou ovais, algumas em divisão, ausência de cápsula, algumas
são filamentadas (Fig. 1).

Figura 1 - Aspeto microscópico da morfologia de Candida albicans

e) Patogenicidade: A candidíase oral é a infecção fúngica oral mais comum. As apresentações da


candidíase oral incluem candidíase pseudomembranosa, candidíase eritmatosa, candidíase em placas ou
nodular, queilite angular e glossite rombóide mediana (Fig.2). A queilite angular, candidíase crónica
eritmatosa (estomatite dentária) e glossite rombóide mediana podem ter uma etiologia mista bacteriana e

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 102


fúngica pelo que são consideradas lesões associadas a Candida. A classificação das infecções orais e
periorais por Candida é dada na Tabela 1.

Figura 2 – Candidíase oral. (a) Lesões de candidíase pseudomembranosa no palato; (b) candidíase
crónica eritmatosa na mucosa palatal de um doente sem dentes com dentadura completa; (c) candidíase
em placas ou nodular na união dos lábios superior e inferior (superfícies mucosas); (d) queilite angular
nas uniões da boca, envolvendo a pele.

Tabela 1 – Classificação das infeções por Candida confinadas aos tecidos orais e periorais.

Infeção por Candida Apresentação clínica


Pseudomembranosa aguda Múltiplas placas brancas não aderentes
Eritematosa aguda Vermelhidão generalizada dos tecidos
Placas ou nodular crónica Placas brancas aderentes nas uniões
Eritematosa crónica Vermelhidão generalizada dos tecidos na
superfície de encaixe da dentadura superior
Pseudomembranosa crónica Múltiplas placas brancas não aderentes
Queilite angular associada a Candida Fissuras nos ângulos da boca
Glossite rombóide mediana Lesões fixas vermelhas/brancas no dorso da
língua

Procedimentos para a identificação do género Candida:

1) Prova da blastese ou de filamentação


Só a Candida albicans é capaz de produzir tubos germinativos no soro humano fresco num período de
três horas. Os tubos germinativos são o início de hifas verdadeiras e aparecem como filamentos que não
estão constritos ao ponto de origem da célula mãe.

Prova da blastese positiva - Candida albicans


Prova da blastese negativa - posterior identificação

Técnica:
a) Execução de uma suspensão em tubo contendo soro humano com 3 ou 4 colónias.
b) Incubação 3 horas/37ºC.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 103


c) Leitura por observação microscópica dos tubos germinativos (Fig. 3).

Figura 3 - Tubos germinativos de Candida albicans (aspeto microscópico)

2) Testes de assimilação de açúcares


São testes de identificação bioquímica de leveduras que se baseiam na sua capacidade de utilização por
via aeróbia ou fermentativa de açúcares.

Auxonograma - Capacidade da levedura utilizar os açúcares na presença de oxigénio (respiração


aeróbia).
Zimograma - Capacidade da levedura utilizar os açúcares na ausência de oxigénio (fermentação).

Hoje em dia a maior parte dos laboratórios usam sistemas automatizados, vendidos comercialmente, para
executar os testes de assimilação dos açúcares e outros testes de identificação bioquímica de leveduras.
Os mais correntemente usados são: API (BioMerieux) e Minitek (BBL).

Api Candida
Sistema de identificação padronizado, destinada à identificação em 18-24h das leveduras mais
frequentemente encontradas em microbiologia clínica.
A galeria Api Candida engloba 10 tubos que contêm substratos desidratados para efectuar 12 testes de
identificação (acidificação de açúcares ou reacções enzimáticas). As reacções produzidas durante a
incubação traduzem-se por mudanças de cor espontâneas (Fig. 4).
A leitura das reacções é efectuada visualmente com o quadro de leitura e a identificação obtém-se por
consulta do sistema de identificação.

Figura 4 – Galeria API Candida após 24h de incubação

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 104


3) Meios selectivos cromogénicos
Existem vários meios selectivos que permitem a identificação de diferentes espécies de Candida de
acordo com a cor das colónias. Por exemplo o meio Chromo ID Candida da BioMerieux, o CHROMagar
Candida Medium da BD ou o Brilliance Candida Agar da Oxoid.

Chromo ID Candida (Can2)


O Chromo ID Candida (Can2) e um meio seletivo para isolamento de leveduras e identificação direta de
Candida albicans. As colónias de Candida albicans ficam coradas de azul pela hidrólise específica do
substrato cromogénico hexosaminidase (Fig. 5). A hidrólise de um segundo substrato (coloração rosa)
permite a diferenciação de culturas mistas e orienta a identificação de colónias de outras espécies. Apesar
da Candida albicans continuar a ser uma das leveduras patogénicas mais comuns, é importante
identificar outras espécies de Candida resistentes que causam infecções superficiais e/ou invasivas como,
por exemplo, Candida glabrata e Candida krusei.

Vantagens:
• Identificação imediata de C. albicans = colónias azuis.
• Diferenciação de culturas mista através do aspeto das colónias
• Orientação na identificação de outras espécies de Candida (C. tropicalis, C. lusitaniae e C. kefyr) =
colónias rosa
• Elevado nível de seletividade para inibir bactérias
• O aspecto característico das colónias permite a orientação na identificação de fungos filamentosos e C.
krusei.

Figura 5 - Aspeto e coloração das colónias de diferentes tipos de Candida sp. no meio Chromo ID
Candida (BioMerieux).

Estudo do género Aspergillus


• Aspergillus flavus
• Aspergillus niger
• Aspergillus fumigatus
• Aspergillus versicolor
• Aspergillus candidum

a) Isolamento: meio de Sabouraud/malt agar/PDA

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 105


b) Taxa de crescimento: crescimento geralmente rápido (3 dias); no entanto algumas espécies são de
crescimento mais lento (semanas).
c) Aspecto macroscópico: a superfície é inicialmente branca e com o tempo fica amarelada, verde,
castanha ou preta, dependendo da espécie. A textura é aveludada. O reverso é branco, dourado ou
castanho.
d) Aspecto microscópico: As hifas são septadas (2,5-8,0 µm de diâmetro) e contêm as cabeças
aspergilares que são as vesículas na extremidade dos conidióforos que dão origem aos esporos externos
alongados (fiálides), que por sua vez dão origem aos conídios (Fig. 6).

Figura 6 – Aspeto microscópico das estruturas de frutificação de Aspergillus spp.

e) Patogenicidade: Os membros deste género causam um grupo de doenças conhecido como


aspergiloses. A doença pode aparecer na sua forma invasiva (micose sistémica), como toxicose ou ainda
como alergia. As espécies deste género são patogénicas oportunistas, originando infecções em indivíduos
com baixa resistência devido a tratamentos imunossupressores ou por serem portadores de
imunodeficiência (ex. SIDA). Os fungos do género Aspergillus estão espalhados no meio ambiente e são
frequentemente encontrados como contaminantes de culturas. Os locais de envolvimento oral incluem o
palato mole, a língua e a gengiva.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 106


Outras condições clínicas

Criptococose
A criptococose raramente envolve a cavidade oral. A doença é causada por Cryptococcus neoformans e
os doentes imunocomprometidos estão em risco de doença disseminada. As lesões apresentam-se como
úlceras ou nódulos na língua, palato, gengiva ou no alvéolo do dente. O diagnóstico é confirmado por
biópsia.

Histoplasmose
É endémica nos Estados Unidos e apresenta-se como uma doença pulmonar aguda ou crónica ou doença
disseminada progressiva. A histoplasmose oral pode ocorrer como histoplasmose pulmonar ou
disseminada ou como uma lesão primária em indivíduos saudáveis. O palato, língua, mucosa oral,
gengiva e lábios são locais frequentes de lesões. O diagnóstico pode ser estabelecido a partir de biópsia,
cultura, exame direto de esfregaços ou testes complementares de fixação.

Blastomicose
É uma infecção fúngica crónica causada por Blastomyces dermatidis. Ocorre principalmente na América
do Norte e ocasionalmente em África. Podem ocorrer lesões orais proliferativas ou ulceradas no palato
duro, gengiva, língua ou lábios. O diagnóstico é feito através de cultura ou de biópsia.

Paracocidioidomicose
A paracocidioidomicose ou blastomicose sul-americana é uma doença crónica provocada por
Paracoccidioides brasiliensis. Homens adultos de áreas rurais são os mais afectados com lesões
envolvendo a boca e a faringe. As lesões orais podem ser granulares e apresentar-se ulceradas, e resultam
de infecções primárias ou secundárias. Locais de envolvimento incluem a gengiva, palato, lábios e
mucosa oral. O diagnóstico é normalmente feito por biópsia.

Mucormicose
A mucormicose é uma doença rara mas com significado pois está frequentemente associada a um
desfecho fatal. É uma infecção oportunista normalmente envolvendo indivíduos debilitados. A doença é
causada por fungos da família Mucoraceae, principalmente Rhizopus e Mucor. A necrose dos tecidos
pode causar ulceração palatal e perfuração. A biópsia e os esfregaços são testes laboratoriais apropriados.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 107


12.2. Protocolos Experimentais

1º Dia – Colheitas e cultura

1) Colheita e cultura a partir de lavado oral

1.1 Colheita
- Bochecho com 5 ml de solução salina, durante 60 segundos, e expetoração do lavado para o mesmo
recipiente.

1.2 Processamento da amostra


- Passar a saliva para tubo de 15 ml;
- Centrifugar o lavado oral a 1500 rpm durante 10 minutos;
- Rejeitar o sobrenadante e ressuspender o precipitado em 1 ml de soro fisiológico (SF);

1.3 Cultura para quantificação do número de colónias


-Diluir o lavado oral após concentração em SF em séries de 10 (tubos com 900 µl de SF + 100 µl do
lavado oral), 10-1, 10-2.
-Inocular alíquotas de 100 µl de cada diluição assim como da suspensão inicial não diluída, por
espalhamento nos seguintes meios de cultura:
- Gelose Sabouraud suplementada com cloranfenicol (0,1mg/ml)
- Chromo ID Candida (Can2)
-Incubar ambos os meios de cultura a 35ºC durante 24/48 horas.

2) Exame Microscópico Directo

A partir do lavado oral após centrifugação executar:


- Exame a fresco
- Coloração de Gram

3) Inocular uma placa de meio de Sabouraud e uma de Chromo ID Candida pelo método de
estrias e incubar 24h a 37ºC.

Dividir as placas em 3 partes e inocular:


- Candida albicans
- Outra Candida sp
- Geotrichum sp.

2º Dia – Identificação

1) Prova da blastese (filamentação em soro fresco)


Utilizando uma das candidas que semeou na aula anterior realize a prova da blastese seguindo os
seguintes passos:
- Execução de uma suspensão de 3 ou 4 colónias em tubo contendo soro humano ou de cavalo;
- Incubação um mínimo de 3h a 37ºC;
- Observação ao microscópio óptico na objectiva de 40x;

2) Inoculação de uma galeria API Candida

Preparação da galeria:
• Montar a galeria (câmara e tampa)
• Identificar a galeria com o nome da bactéria, nome do grupo e turma

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 108


• Colocar 5ml de água nos alvéolos de modo a proporcionar uma atmosfera húmida durante a incubação

Preparar o inóculo:
• Realizar uma suspensão fúngica homogénea, utilizando uma ampola de soro fisiológico e colónias de
uma levedura (turvação 3 McFarland) retirada do meio de Sabouraud inoculado na aula anterior.

Inoculação da galeria:
• Utilizando uma micropipeta (P1000) encher de suspensão fúngica unicamente os tubos de todos os
testes evitando a formação de bolhas
• Cobrir as cúpulas dos 5 primeiros testes (GLU a RAF) e do último (URE) com parafina líquida
• Fechar a câmara com a tampa e incubar a 37ºC/18-24h em aerobiose

3) Exame a fresco com azul de lactofenol

Fazer a coloração a partir de colónias de Candida sp e de Geotrichum sp retiradas do meio de Sabouraud


inoculado na aula anterior seguindo os seguintes passos:
- colocar uma colónia de levedura no centro da lâmina;
- corar com azul de lactofenol (dissolver);
- colocar uma lamela e comprimir com cuidado para não partir a lamela;
- observar ao microscópio ótico na objectiva de 40x;

3º Dia – Leitura dos resultados e caracterização macroscópica e microscópica de fungos


filamentosos

1) Leitura da prova da blastese


- Observação da presença de tubos germinativos ao microscópio ótico na objectiva de 40x;

2) Determinação do grau de colonização


- Contar o número de colónias leveduriformes provenientes do lavado oral nos dois tipos de meio
inoculados e nas várias diluições;
- As contagens do total de microrganismos viáveis devem ser expressas em unidades formadoras de
colónias por 1 ml (UFC/ml);

UFC/ml = nº de colónias leveduriformes


volume inóculo (ml) x factor de diluição

3) Exame a fresco com azul de lactofenol de fungos filamentosos

Fazer a coloração a partir de culturas de Aspergillus spp seguindo os seguintes passos:


- colocar um pedaço de fungo no centro da lâmina;
- corar com azul de lactofenol (utilizar o corante para dissolver a levedura em vez de água);
- colocar uma lamela e comprimir com cuidado para não partir a lamela;
- observar ao microscópio ótico na objectiva de 40x;

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 109


CAPÍTULO 13- Detecção do serotipo B de Aggregatibacter actinomycetemcomitans em bolsas
periodontais por amplificação por PCR

13.1- Introdução

Até há relativamente pouco tempo o estudo do bacterioma da boca era limitado porque requeria o
isolamento das bactérias da boca em cultura e sua posterior identificação e classificação com recurso a
colorações e testes de metabolismo. Pela análise de ADN bacteriano presente na boca depressa se
percebeu que há muito espécies orais que não são cultiváveis nos meios disponíveis. Deste modo, hoje
em dia é comum recorrer-se a métodos moleculares baseados no ADN para identificar de forma
qualitativa e quantitativa as bactérias da boca. Pode assim saber-se se determinada bactéria existe na
bochecha, na língua ou na saliva dos indivíduos saudáveis, se está presente na placa subgengival ou
supragengival, se causa cárie, periodontite ou endodontite, etc. O ADN bacteriano pode ser obtido por
métodos simples a partir de todo o tipo de amostras orais e, em geral, a reação de PCR é a mais utilizada
na análise deste ADN logo seguida da sequenciação dos genes e análise filogenética das sequências
obtidas.

Doenças periodontais
O termo “doença periodontal” refere-se a um vasto grupo de alterações patológicas do tecido periodontal.
As formas mais comuns da doença são a gengivite e a periodontite. A periodontite é uma infeção baseada
na inflamação das estruturas de suporte do dente e é caracterizada pela destruição progressiva do
ligamento periodontal e osso alveolar que pode resultar na perda do dente. A periodontite é causada por
uma bactéria ou grupos de bactérias encontrados no biofilme da placa dentária. As duas formas distintas
de periodontite que ocorrem em indivíduos saudáveis são a periodontite crónica e a periodontite
agressiva, e estas duas condições têm sido o foco da maioria dos estudos de patogénese. Uma terceira
forma da doença ocorre em indivíduos com doenças sistémicas, mais frequentemente doenças genéticas
ou hematológicas que comprometem profundamente a resposta do hospedeiro a uma infecção bacteriana.

Periodontite agressiva localizada (PAL)

Aggregatibacter actinomycetemcomitans, um cocobacilo Gram negativo, imóvel, capnofílico, é


considerado o principal agente etiológico da periodontite agressiva localizada (PAL). A.
actinomycetemcomitans da cavidade oral é classificado em seis serotipos (A-F) caracterizados por
antigénios O estruturalmente e antigenicamente distintos. Estudos de prevalência indicam que os
serotipos A-C são mais frequentes nos isolados orais do que os serotipos D e E e que o serotipo B é o
mais frequente em indivíduos com PAL enquanto os serotipos A e C são mais comuns em indivíduos
diagnosticados com periodontite crónica.
Os indivíduos com PAL causado por A. actinomycetemcomitans serotipo B têm níveis elevados de
anticorpos contra o antigénio polissacarídico específico (APE) do serotipo B. Este antigénio que se supõe
existir no LPS na membrana externa parece ser um dos antigénios imunodominantes deste
microrganismo. A deteção de A. actinomycetemcomitans em jovens periodontalmente saudáveis pode
servir como um marcador de iniciação da PAL.
O cluster de genes que codifica para o antigénio polissacarídico específico (APE) dos diferentes
serotipos de A. actinomycetemcomitans varia de tamanho em determinadas regiões. Usando a reação de
PCR é possível amplificar fragmentos de ADN deste cluster de genes com diferentes dimensões nos
diferentes serotipos de A. Actinomycetemcomitans sendo assim possível classificar de forma molecular os
diferentes serotipos desta bactéria.

Colheita de placa subgengival


A colheita de amostras da placa subgengival pode fazer-se com recurso a uma cureta (Fig. 1), mas como
é fisicamente impossível inserir uma cureta a mais de 6 mm de profundidade há dificuldades em retirar
amostras de bolsas periodontais profundas em doentes com doença periodontal.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 110


Figura 1 – Colheita microbiológica de placa subgengival com recurso a uma cureta.

A alternativa à colheita com cureta é o uso dos cones de papel endodônticos (Fig. 2). Os cones podem ser
inseridos nas bolsas periodontais ficando embebidos no fluido que contém as bactérias (Fig. 3). São
depois retirados e colocados num tubo eppendorf contendo numa solução salina ou aquosa a partir da
qual se extrai o ADN bacteriano.

Figura 2 – Cones endodônticos de diferentes diâmetros.

Figura 3- Colheita microbiológica de placa subgengival com cones endodônticos.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 111


Isolamento de ADN bacteriano pelo método do Chelex

O Chelex 100 é uma resina composta por copolímeros do divinilbenzeno contendo iões iminodiacetato
emparelhados que atuam como grupos quelantes. O Chelex permite realizar uma extracção de ADN
rápida, barata e eficiente. O Chelex tem sido usado para extrair ADN a partir de uma grande variedade de
produtos biológicos (sangue periférico, sémen, lavados bucais, etc). A extração de ADN cromossomal
envolve normalmente a fervura de suspensões celulares numa suspensão de 5% de Chelex. A
alcalinidade das suspensões de Chelex (pH 10-11) e a exposição a temperaturas de 100oC leva à lise das
membranas celulares e desnaturação do ADN. O Chelex remove os iões metálicos divalentes que podem
atuar como catalisadores na degradação hidrolítica do ADN que pode ocorrer a temperaturas elevadas em
soluções de baixa força iónica. O ADN resultante neste processo é desnaturado (em cadeia única).

A reação de PCR

Entre 1983 e 1985, Kary Mullis desenvolveu a técnica de amplificação enzimática em cadeia (PCR) que
tornou possível amplificar milhões de vezes um fragmento de ADN e assim sintetizar grandes
quantidades de ADN. O primeiro passo do PCR é selecionar e sintetizar dois primers (oligonucleótidos
monocatenários) com sequência complementar à da extremidade 3´e 5´do ADN em dupla cadeia a
amplificar. Cada primer hibridiza somente numa das cadeias e funciona como iniciador da síntese do
ADN pelas ADN polimerases, o que significa que os fragmentos de ADN amplificados serão sempre
delimitados pelos primers utilizados no PCR.

O PCR ocorre em ciclos, cada um deles com três passos que se processam sequencialmente: desnaturação
do ADN alvo, hibridização dos primers e elongação.

Desnaturação do ADN alvo - O ADN alvo contendo a sequência a amplificar é desnaturado (separação
das duas cadeias por quebra das ligações de hidrogénio) por aquecimento a 94-96 oC.

Hibridização dos primers - Os primers, normalmente em excesso, ligam-se por complementaridade ao


ADN alvo em ambas as cadeias. A temperatura de hibridização dos primers é escolhida em função da
temperatura de fusão dos primers (Tm) ou seja a temperatura que determina o desemparelhamento dos
primers do seu molde. Esta temperatura é função da concentração em G+C dos primers e da
concentração salina em que decorre a reação (quanto menor mais baixa é a Tm).

Elongação – Nesta fase dá-se a síntese de múltiplas cópias da sequência de ADN alvo. A ADN
polimerase usa os primers como iniciadores da polimerização do ADN em cada cadeia. Para isso são
necessários os quatro dNTPs (dATP, dGTP, dCTP e dTTP), o tampão apropriado para a atividade da
enzima e a temperatura ótima de funcionamento da enzima. A temperatura ótima de funcionamento da
enzima mais utilizada no PCR, a Taq ADN polimerase, é de 72 oC.

Estes três passos repetem-se um número limitado de vezes, normalmente 35 vezes, em aparelhos
apropriados designados de termocicladores. Teoricamente, 20 ciclos irão produzir cerca de um milhão de
cópias da sequência alvo de ADN.

Parâmetros que afetam as reações de PCR

1. Componentes da reação de PCR

A - ADN polimerase
Na técnica de PCR só podem ser utilizadas polimerases termoestáveis. A polimerase mais popular é a
Taq ADN polimerase da bactéria termófila Thermus aquaticus. A Thermus aquaticus vive na água a
temperaturas de 75ºC. A sua polimerase, a Taq ADN polimerase, tem uma temperatura ótima de atuação

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 112


aos 72ºC e é razoavelmente estável a 94ºC. Esta enzima poderá ser adicionada no início da reação e
permanecerá ativa durante todos os ciclos de amplificação.

B - Primers
Dos muitos fatores que influenciam a eficiência e a especificidade da reação de amplificação nenhum é
mais crucial que o desenho dos primers. O desenho cuidado dos primers é necessário para se obter os
produtos desejados em grande quantidade, para suprimir a amplificação de sequências não requeridas e
para facilitar a consequente manipulação dos produtos amplificados. Cada primer deve ter 20-30
nucleótidos de comprimento e conter aproximadamente um nº igual dos quatro dNTPs, com uma
distribuição equilibrada de resíduos G e C e uma baixa propensão para formar estruturas secundárias
estáveis. Os primers podem ser seleccionados e analisados em programas de computador específicos
(exs. Oligotech e PerlPrimer).

C - Deoxirribonucleósidos trifosfatados (dNTPs)


Um PCR padrão contém quantidades equimolares de dATP, dCTP, dGTP e dTTP. São recomendadas
concentrações de 200-250 µm de cada dNTP para a Taq ADN polimerase, em reações contendo MgCl2 a
1,5 mM. Concentrações de dNTPs superiores a 4 mM são inibitórias, provavelmente pela captura de iões
Mg2+ que são necessários para a função da enzima. É de salientar, no entanto, pode ser produzida uma
quantidade satisfatória dum produto de PCR com≈1kb com concentrações de dNTPs tão baixas como 20
µm a 1 pm.

D - Catiões divalentes
Todas as ADN polimerases termoestáveis requerem para a sua atividade catiões divalentes livres,
normalmente Mg2+. Devido à fixação do Mg2+ pelos dNTPs e primers a concentração molar do catião
deve exceder a concentração molar dos grupos fosfato fornecidos pelos dNTPs e primers. É impossível
recomendar uma concentração de Mg2+ que seja ótima em qualquer circunstância. No entanto, a
concentração de 1,5 mM é usada em rotina. A concentração óptima de Mg2+ deve ser determinada
empiricamente para cada combinação de primers e cadeia de ADN.

E - Tampão
O tampão é utilizado para manter o pH estável durante a reação. Normalmente utiliza-se o tampão Tris-
HCl com o pH ajustado entre 8,3 - 8,8 à temperatura ambiente (TA) a uma concentração de 10 mM.
Quando incubado a 72 ºC, temperatura normalmente usada na elongação, o pH da mistura de reação
baixa mais de 1 unidade produzindo um pH ≈ 7,2.

F - Catiões monovalentes
Os tampões de PCR contêm KCl 50 mM e funcionam bem para fragmentos de ADN superiores a 500 pb.
Aumentando a concentração de KCl para 70-100 mM, em geral, aumenta a eficiência do PCR para
fragmentos de ADN curtos.

G - ADN alvo a amplificar


O ADN alvo a amplificar por PCR pode ser linear ou circular. Cadeias de ADN circular são amplificadas
menos eficientemente que cadeias lineares. O tamanho da cadeia de ADN não é crítico. A amplificação
de sequências de elevada dimensão (>10Kb) a partir de um ADN circular (ex. plasmídio) pode ser
melhorada por linearização do ADN alvo após digestão com uma enzima de restrição que não corte na
sequência alvo.
Quando otimizado, o PCR requer apenas uma única cópia da sequência alvo. No entanto, é mais
frequente haver várias centenas de cópias do ADN alvo na reação. Para amplificar genes humanos (ou
fragmentos de genes) utiliza-se normalmente 1 µg de ADN genómico (existente em cerca de 150000
células) que contém ≈ 3 x105 cópias de um gene autossómico de cópia única. Para ADN de plasmídios,
bactérias e leveduras usa-se, respectivamente, 1 pg, 1 ng e 10 ng por reação de PCR.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 113


2. Passos da reação de PCR

Desnaturação
ADNs de cadeia dupla desnaturam a uma temperatura (Tm) que é determinada em parte pelo seu
conteúdo em G + C. Quanto maior for o conteúdo em G + C maior será a temperatura necessária para se
separar as duas cadeias da molécula de ADN. Quanto mais longa for a molécula de ADN maior terá que
ser o tempo necessário para separar completamente as duas cadeias à temperatura de desnaturação
escolhida. Quando a temperatura é reduzida nos dois passos subsequentes do PCR (hibridização e
elongação), as cadeias de ADN voltam a ligar-se retomando a sua forma nativa. Em PCRs catalisados
pela Taq ADN polimerase a desnaturação ocorre a 94-96 ºC. No 1º ciclo de PCR, a desnaturação ocorre
durante 5 minutos para aumentar a probabilidade de total desnaturação de moléculas de ADN longas.
Nos ciclos seguintes o tempo de desnaturação pode ser diminuído para 30 seg - 1 min.

Temperatura de hibridização dos primers


A temperatura utilizada para o passo de hibridização é crítica. Se a temperatura é muito elevada, muito
próxima ou superior ao Tm dos primers, os primers ligam-se mal ou não se ligam e a amplificação é
muito baixa ou inexistente. Se a temperatura é muito baixa, pode ocorrer uma ligação inespecífica dos
primers, resultando na amplificação de fragmentos não pretendidos. A hibridização é normalmente
efectuada 5-10 ºC abaixo da temperatura de fusão (Tm) dos primers. Pode-se melhorar a especificidade
do PCR alterando a temperatura de hibridização dos primers em gradientes controlados de temperatura
(incrementos sucessivos de 0.5-1 oC).

Elongação
A elongação ocorre à temperatura ótima para a síntese de ADN catalisada pela polimerase termoestável,
que no caso da Taq ADN polimerase é de 72-78ºC. Nos dois primeiros ciclos a elongação a partir de um
dos primers forma um produto de sequência complementar à cadeia que vai para lá do local de ligação do
outro primer. No ciclo seguinte, são produzidas as 1as moléculas cujo comprimento é igual ao do
segmento de ADN delimitado pelos locais de ligação dos primers. A partir do 3º ciclo, este segmento de
ADN é amplificado exponencialmente. No último ciclo de PCR usa-se normalmente um tempo de
elongação três vezes superior aos dos ciclos anteriores, para permitir a completa elongação de todas as
moléculas amplificadas.

Controlo de contaminação na reação de PCR

Uma vez que a reação de PCR é capaz de amplificar milhões de vezes uma única molécula de ADN
devem ser tomadas precauções para evitar contaminações da amostra com ADN exógeno. Estas
precauções tornam-se essenciais quando as sequências a amplificar estão presentes em baixa
concentração. Algumas precauções elementares a tomar para evitar contaminações no PCR são:
* Preparar e efetuar a mistura de reação de PCR numa câmara de fluxo laminar equipada com luz
ultra-violeta. A luz deve ser ligada antes e depois do trabalho, de modo a manter o ambiente estéril;
* Utilização de material descartável, como as luvas;
* Utilização de micropipetas que só servem para fazer as misturas de reação para o PCR e pontas
com filtro;
* Os reagentes para efetuar as misturas de reação do PCR não deverão ser usados para outros fins.
Na preparação destes reagentes deve-se usar material que não tenha sido utilizado nem exposto a outros
ADNs;
* Quando se adiciona a amostra de ADN à mistura de reação deve ter-se o cuidado de evitar a
formação de aerossóis que possam vir a contaminar outras reações; esta adição deve ser efetuada num
local diferente do da preparação da mistura de reação;
* Verificar sempre se os tubos se encontram bem fechados;
* Incluir sempre, pelo menos, um controlo negativo que irá conter todos os componentes da reação
com excepção do ADN que será substituído por água.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 114


13.2- Protocolos Experimentais
Como vimos anteriormente o cluster de genes que codifica para o antigénio polissacarídico específico
(APE) dos diferentes serotipos de A. actinomycetemcomitans varia de tamanho em determinadas regiões.
Usando a reação de PCR é possível amplificar fragmentos de ADN deste cluster de genes com diferentes
dimensões nos diferentes serotipos de A. Actinomycetemcomitans sendo assim possível classificar de
forma molecular os diferentes serotipos desta bactéria. Assim, na presença de bactérias do serotipo B
será amplificado um fragmento de ADN com 333 pares de bases; se o serotipo for o A será amplificado
um fragmento com 293 pb; no serotipo C será amplificado um fragmento com 268 pb; no serotipo D será
amplificado um fragmento com 411 pb; no serotipo E será amplificado um fragmento com 311 pb; e no
serotipo F será amplificado um fragmento com 232 pb. Os produtos amplificados serão analisados num
gel de agarose a 2%.

1º Dia - Extração de ADN a partir de amostras de placa subgengival (fluido gengival) pelo método do
Chelex 100.

Colheita e extração de ADN


1- Limpeza da placa supragengival com o rolo de papel.
2- Introduzir o cone de papel numa bolsa periodontal; retirar após 10 segundos e colocar em tubo
eppendorf contendo 1ml de água mili-Q (ver Figura 3).
3- Incubar à temperatura ambiente durante 15 min. (idealmente seriam 30 min).
4- Agitar no vórtex, durante 10 seg., utilizando uma rotação muito baixa.
5- Centrifugar os tubos a 14000 rpm/3 min. em microcentrífuga (preferencialmente a 20 ºC).
6- Retirar 950 µl de sobrenadante, sem perturbar o pellet (os 950 µl de sobrenadante são rejeitados para
recipiente de lixos contaminados).
7- Adicionar 180 µl de solução de Chelex a 5%. (a solução de Chelex deve ser homogeneizada no
momento em que é aspirada).
8- Colocar em banho-maria a 56 ºC, durante 15 min.
9- Agitar no vórtex a alta velocidade, durante 10 seg.
10- Fazer um furo com agulha esterilizada na tampa do tubo.
11- Colocar o tubo em suporte flutuante e levar à água em ebulição durante 8 min. (! os 8 minutos não
devem ser ultrapassados!)
12- Agitar no vórtex a alta velocidade, durante 10 seg.
13- Centrifugar os tubos a 14000 rpm/3 min., em microcentrífuga (preferencialmente a 20 ºC).
14- Conservar a – 20ºC. Sempre que for necessário amplificar, deixar descongelar à temperatura
ambiente, sem perturbar o pellet, e utilizar 1 µl do sobrenadante.

Preparação do Chelex100 a 5%:


Pesar 2,5 g de Chelex 100 num pequeno copo de vidro e adicionar 50 ml de água mili-Q. Colocar a agitar
com agitador magnético.

2ºDia – Execução de uma reação de PCR para amplificação de um fragmento do gene do antigénio
polissacarídico específico do serotipo B de A. actinomycetemcomitans

Mistura de reação para PCR num volume de 25 µl:

Reagente Concentração final Volume (por reação)


Primer1 (5µM) 0,25 µM 1,25 µl
Primer 2 (5 µM) 0,25 µM 1,25 µl
DNA bacteriano - 1 µl
ABDE - qb para 25 µl (21,5 µl)

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 115


- Adicione os reagentes na ordem indicada aos tubos puReTaqReady-To-Go PCR Beads (GE
Healthcare) e agite suavemente com o dedo e depois em vórtex.
- Centrifuge e coloque no termociclador.

O protocolo de PCR é o seguinte:

95 ºC- 4 min- 1 ciclo


94ºC –30 seg
55ºC – 30 seg 35 ciclos
72ºC – 30 seg
72ºC – 10 min- 1 ciclo

Sequência dos primers utilizados:

Primer 1 - P14 5´ ARAAYTTYTCWTCGGGAATG 3´


Primer 2 - P11 5´ TCTCCACCATTTTTGAGTGG 3´

3º Dia - Electroforese em gel de agarose

O PCR realizado amplifica um fragmento de ADN com 333 pares de bases no serotipo B. Os produtos
amplificados serão analisados num gel de agarose a 2%. Os resultados esperados estão indicados na
Figura 4.

333

Figura 4 – Fotografia de electroforese em gel de agarose dos produtos de amplificação por PCR de um
fragmento do gene que codifica para o antigénio polissacarídico específico (APE) de diferentes subtipos
de A. actinomycetemcomitans. O serotipo B origina um fragmento com 333 pb.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 116


Preparação de um gel de agarose

Figura 5 – Preparação de um gel de agarose para electroforese

1. Tapar as extremidades laterais da cama do gel com fita adesiva e colocar o pente de modo a que os
dentes não toquem no fundo da cama.
2. Preparar quantidade suficiente de tampão de electroforese (TBE 0,5X ou TAE 1X) para encher a tina
de electroforese e fazer o gel.
3. Preparar a solução de agarose em tampão de electroforese a 2%
4. Dissolver no microondas até obter uma solução cristalina.
ATENÇÃO: A solução de agarose pode ficar superaquecida e entrar em ebulição. Cuidado ao tirar do
microondas.
5. Arrefecer o erlenmeyer em água corrente. Adicionar 5µlde gel rede misturar cuidadosamente.
6. Verter cuidadosamente a agarose na cama do gel, evitando a formação de bolhas.
7. Deixe solidificar completamente o gel e retire com cuidado o pente e a fita adesiva
8. Coloque a cama na tina de electroforese e tape completamente o gel com TBE 0,5X.
9. Prepare as suas amostras para aplicar no gel. Num tubo eppendorf adicionar10 µl do produto de PCR e
2 µl de tampão de aplicação de amostra.
10.Com cuidado aplique a mistura no poço do gel usando uma micropipeta.
11. Feche a tampa da tina e aplique um campo eléctrico que fará o ADN migrar do polo negativo para o
positivo. Corra o gel até o azul de bromofenol e o xileno de cianol terem migrado a uma distância
apropriada no gel.
12. Desligue a fonte de electroforese
13. Observe à luz ultravioleta e fotografe.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 117


Bibliografia

Chatigny, M.A, and D.I. Clinger. Contamination control in aerobiology. In: Dimmick, R.L:, and AB.
Akers (Eds.) 1969. An introduction to experimental aerobiology, pp. 194-263. Wiley-Interscience, New-
York.
Sewell, D.L. 1995. Laboratory-associated infections and biosafety. Clin. Microbiol. Reviews 8: 389-405.
Fleming, D.O, J.H. Richardson, J.J. Tulis, and D. Vesley. 1995. Laboratory safety. Principles and
practices. Second Edition. ASM Press.
Strain, T.A, and D.H.M. Groschel. Laboratory safety and infectious waste management. In: Murray,
P.R., E.J. Baron, M.A Pfaller, F.C. Tenover, and R.H. Yolken (Eds.) 1995. Manual of clinical
microbiology, pp.75-85. Sixth Edition. ASM Press.
Center for Disease Control and Prevention/National Institutes of Health. 2007. Biosafety in
microbiological and biomedical laboratories, 5th ed. HHS publication no. (CDC) 93-8395. Public Health
Service, U.S. Department of Health and Human Services, Washington, D.C.
Prescott, L.M., and J.P. Harley. 1993. Laboratory Exercises in Microbiology. 2nd edition. W.C. Brown.
Ripp, S. and R.V. Miller.1997. The role of pseudolysogeny in bacteriophage-host interactions in a natural
freshwater environment. Microbiology 143, 2065-2070.
Walsh PS, Metzger DA, Higuchi R.Chelex 100 as a médium for simple extraction of DNA for PCR-based
typing from forensic material.Biotechniques; 1991 10(4):506-13.
Kaplan JB, Perry MB, MacLean LL, Furgang D, Wilson ME, Fine DH. Structural and genetic analyses of O
polysaccharide from Actinobacillus actinomycetemcomitans serotype f. Infect Immun. 2001, 69:5375-84.
Fine DH, Markowitz K, Furgang D, Fairlie K, Ferrandiz J, Nasri C, McKiernan M,Gunsolley J.
Aggregatibacter actinomycetemcomitans and its relationship to initiation of localized aggressive
periodontitis: longitudinal cohort study of initially healthy adolescents. J Clin Microbiol. 2007, 45:3859-69.
Yoshida Y, Nakano Y, Yamashita Y, Koga T. Identification of a genetic locus essential for serotype b-
specific antigen synthesis in Actinobacillus actinomycetemcomitans. Infect Immun. 1998, 66:107-14.

Taveira & Bártolo, Manual Prático de Microbiologia, ISCSEM, 2014 118