Identicación molecular de bacterias mediante amplificación y secuenciación

del gen 16S del ARNr

La identicación molecular de las cepas bacterianas seleccionadas se realizará mediante la amplificación

por PCR de un fragmento de ADN de 1001 pb interno del gen 16S del ARNr empleando la GoTaq Green
Master Mix (Promega Corp. USA).
CONDICIONES DEL TERMOCICLADOR
Pre-
Referencia Desnaturalización Hibridación Extensión final Ciclos
Desnaturalización
IKIAM 95 0C durante 5 min 95 0C durante 30 s 60 0C durante 30 s 72 0C durante 10 min 30
Leon et al,
95 0C durante 5 min 95 0C durante 30 s 57 0C durante 30 s 72 0C durante 5 min 35
(2009)
Lázaro et al.
94 0C durante 6 min 94 0C durante 50 s 57 0C durante 40 s 72 0C durante 3 min 35
(2012)
Molecular 72 0C durante
30 G1, G2 y G3
Biology One 94 0C durante 5 min 95 0C durante 30 s 59 0C x 1 min 5 min G1, G2 y G3
35 G4, G5 y G6
Research Team 10 min G4, G5 y G6

Los productos de PCR serán purificados con el kit Wizard PCR Purification System (Promega Corp. USA)

BioMath
NCBI Oligo Calc
Promega
Concentración Nombre del Tm G+C Tm G+C Tm G+C
Secuencia de ADN
Stock Madre Oligonucleótido (oC) (%) (oC) (%) (oC) (%)

200 Molar Primer 16S-F 5’- GGAGGCAGCAGTAGGGAATA -3’ 58.58 55 60.5 55 64 55

200 Molar Primer 16S-R 5’- TGACGGGCGGTGAGTACAAG -3’ 62.15 60 62.5 60 67 60

NOTA: Las secuencias de ADN no forman dímeros de primers.

Campylobacter pinnipediorum subsp. pinnipediorum strain RM17260 16S ribosomal RNA, partial
sequence: 1041 pb

PCR assays were performed using the modified protocol of Persson and Olsen (2005). Briefly, a total
reaction volume of 25 μL containing 1x of Platinum® PCR Supermix (20 mM Tris/HCl, 50 mM KCl, 1.5 mM
MgCl2, 200 μM dNTP, 20U Platinum Taq Polymerase) (Invitrogen), 0.4 μM asp (Linton et al., 1997), 0.2 μM
hipO and 0.05 μM 16S rDNA primers (Table 1) were prepared as a master mix while 10% of total reaction
volume was used as template for each suspected positive isolation (Lázaro et al. 2012).

PCR amplification was carried out in a PTC-200 Peltier Thermal Cycler (MJ Research, California, USA) using
an initial denaturation step of 94°C for 6 min, followed by 35 cycles of denaturation at 94°C for 50 s;
annealing at 57°C for 40 s and extension at 72°C for 50 s. After the last cycle, a final extension step of 72°C
for 3 min was added (Linton et al., 1997). PCR products were analyzed by 1.5% agarose gel electrophoresis
and stained with ethidium bromide.

PREMISAS:

- Tiempo de extensión 1 minuto cada 1 kb

- Tm: menos 5 0C del oligo con menos Tm.
- ADN molde debe ser el <10% del Vf
- Primers deben ser el <5-10% del Vf
- 100.000 nM = 100 M (Primers)

la GoTaq Green Master Mix (Promega Corp. USA) Kit

 Buffer: 2X la Grenn GoTaq Reaction Buffer (pH 8.5)

 dNTPs 400 M
 MgCl2 3 mM
 2 Colorantes para electroforesis en gen de agarosa.
 La enzima o Mix se añade de último (si la Polimerasa se suministra aparte).

Reaction for 25 l volumen:

 GoTaq Green Master Mix 2X 12.5 l Cf: 1X
 Primer Fwd 0.25-2.5 l Cf: 0.1-1.0 M
 Primer Rev 0.25-2.5 l Cf: 0.1-1.0 M
 DNA template < 250 ng
 Nuclease free water <250 l

Reaction for 250 l volumen (10X):

 GoTaq Green Master Mix 2X 125 l Cf: 1X
 Primer Fwd (10 M) 25 l Cf: 1.0 M
 Primer Rev (10 M) 25 l Cf: 1.0 M
 DNA template < 250 ng
 Nuclease free water <250 l