Journal of Biotechnology 271 (2018) 8–16

Contents lists available at ScienceDirect

Journal of Biotechnology
journal homepage: www.elsevier.com/locate/jbiotec

Construction of a high-efficiency cloning system using the Golden Gate T

method and I-SceI endonuclease for targeted gene replacement in Bacillus
anthracis
⁎
Tiantian Wang, Dongshu Wang, Yufei Lyu, Erling Feng, Li Zhu, Chunjie Liu, Yanchun Wang ,
⁎ ⁎
Xiankai Liu , Hengliang Wang
State Key Laboratory of Pathogens and Biosecurity, Beijing Institute of Biotechnology, 20 Dongdajie Street, Fengtai District, Beijng 100071, China

A R T I C L E I N F O A B S T R A C T

Keywords: To investigate gene function in Bacillus anthracis, a high-efficiency cloning system is required with an increased
Bacillus anthracis rate of allelic exchange. Golden Gate cloning is a molecular cloning strategy allowing researchers to simulta-
Golden Gate neously and directionally assemble multiple DNA fragments to construct target plasmids using type IIs restriction
Allelic exchange enzymes and T4 DNA ligase in the same reaction system. Here, a B. anthracis S-layer protein EA1 allelic exchange
I-SceI
vector was successfully constructed using the Golden Gate method. No new restriction sites were introduced into
this knockout vector, and seamless assembly of the DNA fragments was achieved. To elevate the efficiency of
homologous recombination between the allelic exchange vector and chromosomal DNA, we introduced an I-SceI
site into the allelic exchange vector. The eag gene was successfully knocked out in B. anthracis using this vector.
Simultaneously, the allelic exchange vector construction method was developed into a system for generating B.
anthracis allelic exchange vectors. To verify the effectiveness of this system, some other allelic exchange vectors
were constructed and gene replacements were performed in B. anthracis. It is speculated that this gene knockout
vector construction system and high-efficiency targeted gene replacement using I-SceI endonuclease can be
applied to other Bacillus spp.

1. Introduction
DNA recombination technology emerged in the early 1970s.
Restriction digestion and ligation is the most commonly used cloning
method in the construction of recombinant DNA molecules. This
method is one of the most basic molecular biology techniques, in which
restriction endonucleases and DNA ligase are used to clone the gene(s)
of interest into a vector. However, this method has its limitations.
Specifically, when multi-target DNA fragments are ligated, they then
need to be inserted into the vector step-by-step, which can be a tedious
and time-consuming procedure; in addition, restriction endonuclease
sites are retained between target DNA fragments in the final construct
(Goff and Berg, 1976).
Approximately 20 years ago, the development of site-specific re-
combination cloning technology provided a new, rapid, and effective
method of constructing DNA recombinants in vitro, such as the Gateway
cloning system developed by Invitrogen (Hartley et al., 2000; Walhout
et al., 2000), the Creator cloning system by Clontech (Sternberg et al.,
1981), and the Univector cloning system by Stephen Elledge’s labora-
tory (Liu et al., 1998; Liu et al., 2000). With these cloning techniques,
target fragments can be simply, efficiently, and accurately fused to
specific vectors. However, specific recombination site sequences are
retained and cannot be eliminated from the constructs developed using
this cloning method, so extra amino acids are added into the expression
products if these sites are located in an expression sequence.
In 2008, Engler et al. reported a cloning strategy mediated by the
type IIs restriction enzyme, known as the IIs cloning method or the
Golden Gate cloning method (Engler et al., 2008, 2014), which has
been applied in many fields. In 2011, Weber and colleagues used the
Golden Gate cloning method to create three dTALEs to activate a re-
porter construct (Weber et al., 2011). In 2014, Terfrüchte and cow-
orkers established a versatile Golden Gate cloning system for genetic
engineering in fungi (Terfrüchte et al., 2014), and Engler and cow-
orkers used the Golden Gate cloning method to construct multigene
constructs for plant transformation (Engler et al., 2009). In 2016, Vad-
Nielsen and colleagues used the Golden Gate cloning method to

⁎
Corresponding authors.
E-mail addresses: con_an@126.com (T. Wang), wangdongshu@foxmail.com (D. Wang), flygogo.cool@163.com (Y. Lyu), fengel@sohu.com (E. Feng), jewly54@126.com (L. Zhu),
liucj@nic.bmi.ac.cn (C. Liu), springwyc@gmail.com (Y. Wang), liuxk007@163.com (X. Liu), wanghl@nic.bmi.ac.cn (H. Wang).

https://doi.org/10.1016/j.jbiotec.2018.02.006
Received 24 May 2017; Received in revised form 8 February 2018; Accepted 9 February 2018
Available online 10 February 2018
0168-1656/ © 2018 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
T. Wang et al.
assemble a CRISPR gRNA expression array to simultaneously target
multiple genes (Vad-Nielsen et al., 2016). However, this method has not
yet been applied for constructing the allelic exchange vectors used in
Bacillus anthracis.
The method of gene knockout in B. anthracis is based on the prin-
ciple of homologous recombination, which usually uses a suicide
plasmid to construct an allelic exchange vector carrying the upstream
part of a target gene, an antibiotic resistance cassette, and the down-
stream part of the target gene. The most commonly used method to
construct B. anthracis homologous recombination vectors is restriction
digestion and ligation, which can involve multiple steps and can be
tedious and time-consuming. In this study, we attempted to use the
Golden Gate cloning method to build a knockout vector in B. anthracis,
thereby allowing high-efficiency one-step subcloning, without the in-
clusion of any additional nucleotides in the final cloned product. This
greatly improves the efficiency of producing the allelic exchange
vector, and we believe that this system could also be applied to con-
struct allelic exchange vectors for other Bacillus spp., such as B. subtilis,
B. cereus, and B. thuringiensis.
For B. anthracis, gene replacements for some loci have been re-
ported, but the methods used to obtain the desired gene replacement
strains are often time-consuming and labor-intensive. This is owing to
the lack of a counterselection scheme to deal with the low efficiency of
homologous recombination between the target plasmids and the chro-
mosomal DNA in B. anthracis. An alternative to such counterselection
schemes involves the use of the intron-encoded homing restriction en-
zyme I-SceI, which can cleave a unique introduced site in a genome;
this property has been exploited in the promotion of homologous re-
combination in organisms as diverse as bacteria, Drosophila, and other
higher eukaryotes (Choulika et al., 1995; Rong et al., 2002; Schmidt-
Puchta et al., 2004). In 2006, Stibitz and colleagues used the I-SceI
enzyme to promote allelic exchange in B. anthracis and, in 2015, this
group improved this method further (Janes and Stibitz, 2006; Schuch
et al., 2015). In this report, we describe further modification of this
methodology using the I-SceI enzyme to facilitate homologous re-
combination in B. anthracis. We introduced an I-SceI site into our allelic
exchange vector as a counterselection marker. This greatly elevated the
efficiency of homologous recombination in our study.
2. Materials and methods
2.1. Materials
2.1.1. Bacterial strains and plasmids
Plasmid pKSV7 contains temperature-sensitive replication functions
derived from pE194ts (permissive temperature, 30 °C; restrictive tem-
perature, 37 °C and above; Table 1). It also contains an ampicillin re-
sistance gene for selection in Escherichia coli, and a chloramphenicol
resistance gene for selection in B. anthracis. The pMAD vector contains a
bgaB gene encoding a thermostable β-galactosidase from Bacillus
stearothermophilus, which is expressed from a constitutive promoter
recognized in Gram-positive and Gram-negative bacteria. The pSET4s
vector contains a spectinomycin resistance gene. This vector could be
propagated at 37 °C in E. coli. The pGEM-T easy vector is a linearized
vector with a single 3ʹ-terminal thymidine at both ends. B. anthracis
vaccine strain A16R (pXO1+, pXO2−; Table 1) was derived from
strain A16 by UV irradiation.
2.1.2. Enzymes and biochemical reagents
2xEs Taq Master Mix (Dye) (Beijing ComWin Biotech, Beijing,
China), Cobuddy High-Fidelity Rapid DNA polymerase (Beijing
ComWin Biotech), Fast Digest EcoRI (Thermo Fisher Scientific,
Rockford, IL, USA), Fast Digest BamHI (Thermo Fisher Scientific), T4
DNA ligase (Thermo Fisher Scientific), BsaI (New England Biolabs,
USA), and ATP (10 mM; New England Biolabs, Beverly, MA, USA) were
used in this study.
9
Journal of Biotechnology 271 (2018) 8–16
2.1.3. Primers
The primers used in this study are listed in Table 2. Primers were
designed according to the DNA sequences of target gene fragments and
plasmids, with the addition of BsaI restriction sites (lowercase italic
letters) and other required restriction sites (underlined).
2.2. Construction of the entry vectors of pGEM-U, pGEM-D, and pGEM-S
The sequences of eagup (947 bp) and eagdn (811 bp), that is, the
upstream and downstream parts of the eag gene sequence, were am-
plified with two pairs of specifically designed primers, eagup_F/R and
eagdn_F/R, using the B. anthracis strain A16R genome as a template.
The spectinomycin resistance gene (spcr, 1155 bp) was amplified using
the primer pair spc_F/R and the pSET4s plasmid as a template. Each of
the three DNA fragments was flanked by two BsaI sites.
The three PCR-amplified fragments eagup, eagdn and spc were li-
gated to the pGEM-T easy vector using T4 DNA ligase, resulting in three
entry vectors designated pGEM-U, pGEM-D and pGEM-S, respectively.
2.3. Construction of the acceptor vector of pKMBKI
To successfully implement the Golden Gate cloning protocol and
introduce a counterselectable marker, the shuttle plasmid pKSV7 was
first modified. An internal BsaI site in the pKSV7 plasmid was destroyed
by the introduction of a point mutation to prevent unwanted plasmid
cleavage in the subsequent digestion, giving plasmid pKMU7.
The exogenous 2259-bp fragment of pclpB-bgaB was amplified by
PCR from pMAD plasmid DNA using the bgaB_F/R primer pair and the
Cobuddy high-fidelity enzyme. Furthermore, the exogenous 1315-bp
fragment of Tn5 neomycin phosphotransferase (containing the kana-
mycin resistance gene, kanr) was amplified by PCR from pKD4 plasmid
using the kan_F/R primer pair. Then, the pclpB-bgaB and kanr DNA
fragments were cloned between EcoRI and BamHI restriction sites in
pKMU7 using the Seamless Cloning Kit (Beijing Taihe Biological
Technology, Beijing, China), resulting in the vector pKMBK.
The I-SceI site was amplified using the primers I-SceI_F/R and in-
serted into the SalI site of pKMBK using the Gibson assembly method,
resulting in the acceptor vector pKMBKI (Fig. 1).
2.4. Subcloning the entry DNA fragments into the acceptor vector pKMBKI
to construct the recombinant allelic exchange vector
The scheme for subcloning the entry DNA fragments into the ac-
ceptor vector pKMBKI is illustrated in Fig. 2. First, the concentration of
each plasmid (pGEM-U, pGEM-S, pGEM-D and pKMBKI) was measured
using a NanoDrop spectrophotometer. The reaction mixture comprised:
50 ng of each entry vector and the acceptor vector together with 2.5
units of BsaI enzyme, 2.25 units of T4 DNA ligase, 1 μl of CutSmart
buffer, 1 μl of ATP (10 mM), and ddH2O up to a final volume of 10 μl.
The restriction–ligation procedure was performed in accordance with
the following program: The mixture was incubated in a water bath at
37 °C for 30 min, followed by heating at 50 °C for 5 min to redigest and
eliminate any plasmid that might still contain a BsaI restriction site and
then 80 °C for 5 min to inactivate both restriction enzyme and ligase. A
5-μl restriction–ligation product was then added to 50 μl of DH5α
chemically competent cells, which were subsequently incubated in an
ice-bath for 30 min, followed by a 90-s thermal shock at 42 °C, then
another 2 min in the ice-bath, followed by 1-h incubation at 30 °C with
shaking at a speed of 225 r/min. Then, 300 μl of bacterial culture was
plated on Luria–Bertani (LB) agar plates containing X-Gal (40 μg/ml)
and kanamycin (50 μg/ml) and the plates were incubated at 30 °C
overnight. Twenty white colonies were picked, streaked onto LB agar
plates, and incubated at 30 °C for 10 h. Single clones were analyzed by
colony PCR to determine whether the three entry DNA fragments had
been inserted into the acceptor vector pKMBKI using three pairs of
primers: eagup_F/R, eagdn_F/R and spcin_F/R. The recombinant
T. Wang et al. Journal of Biotechnology 271 (2018) 8–16

Table 1
Bacterial strains and plasmids used in this study.

Plasmids and strains Relevant genotype and characteristics Source

pKSV7 Shuttle vector, temperature-sensitive, Ampr in E. coli and Cmr in B. anthracis This lab(Smith and Youngman,
1992)
pMAD Shuttle vector, Apr in E. coli; Emr in B. subtilis; containing pclpB-bgaB fragment This lab(Arnaud et al., 2004)
pKMU7 Derive from pKSV7 by destroying a BsaI site in it. This work
pKD4 Containing kanamycin resistant gene This lab
pKMBK Constructed by inserting pclpB-bgaB and Kanr fragments into pKMU7 This work
pKMBKI Constructed by inserting I-SceI fragment into pKMBK This work
pKMUSD The production of “Golden Gate” cloning with the upstream part of the target gene, the spectinomycin resistance This work
cassette, and the downstream part of the target gene inserting into the vector pKMBKI
pGEM-T easy Ampr in E. coli, with single 3’-T overhangs This lab
pGEM-U Constructed by inserting eagup fragment into pGEM-T easy This work
pGEM-D Constructed by inserting eagdn fragment into pGEM-T easy This work
pGEM-S Constructed by inserting Spcr cassette fragment into pGEM-T easy This work
pSET4s Shuttle vector,Spcr both in E. coli and B. anthracis This lab (Takamatsu et al.,
2001)
pSS4332 expressing endonuclease I-SceI, Kanr in B. anthracis and Ampr in E. coli, is relatively unstable in B. anthracis This lab (Cybulski et al., 2009)
allowing rapid loss by segregation after removal of selection.
E. coli DH5α F-,ϕ80d/lacZΔM15, Δ(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17(rk-,mk+),phoA,supE44λ-, thi-1, This lab
gyrA96,relA1
E. coli JM110 rpsL (Str R) thr leu thi-1 lacY galK galT ara tonA tsx dam dcm supE44 Δ(lac-proAB) /F′[traD36 proABlacIq This lab
lacZΔM15]
B. anthracisA16R Vaccine strain; pXO1+, pXO2- This lab
B.anthracisA16R△eag::spc A16R with eag gene knocked out and Spcr gene instead This work

Note: Ampr, ampicillin resistance; Cmr, chloramphenicol resistance; Emr, erythromycin resistance; Spcr, spectinomycin resistance; Kanr, kanamycin resistance.

Table 2
Primers used in this study.

Name Sequences

bgaB_F TGACATGATTACGAATTCTGACAgagaccGTCTAGTTAATGTGTAACG
bgaB_R AGTGCTTGCGGCAGCGTGACCAAAgagaccGCATATTATGTTGCCAAC
kan_F TCACGCTGCCGCAAGCACTCAGGGCGCAAGGGCTGC
kan_R GTCGACTCTAGAGGATCCTGGGCGAAGAACTCCAGCAT
I-SceI_F CAAGCTTGCATGCCTGCAGGTCGACTAGGGATAACAGGGTAATGTCGACTCTAGAG
I-SceI_R TTCGCCCAGGATCCTCTAGAGTCGACATTACCCTGTTATCCCTAG
eagup_F TTTggtctcATGACCTTATCTGTTGATGGTGTACC
eagup_R TTTggtctcACTCCCTCCTTCAGGAATATGCTACT
eagdn_F TTTggtctcAATCGCGAATCACTATACACGAACA
eagdn_R TTTggtctcACCAACCAATCCATGCCTGCTAT
spc_F TTTggtctcAGGAGCTAGTGTTCGTGAATACATG
spc_R TTTggtctcACGATTATGCCGATAACTAG
eagin_F CAATGACAGCAGCAATGG
eagin_R TCAACATCAGCGTTACCTT
eagus_F GAAGTAGACGCAACTGATG
eagus_R GCTCTTGTAACCATTCTCC
eagsd_F GGCTGAATCTTCTCCATTA
eagsd_R CATACTAGAACTTGCACCAA
spcin_F TGATGTGAGAAGAGCCATTA
spcin_R CTCCAAGATAACTACGAACTG
pKSV7_F ATCGTTGTCAGAAGTAAGTTGG
pKSV7_R TGGCGTAATAGCGAAGAGG

Note: Underlined sequences indicate restriction sites; lower-case italic sequences indicate BsaI restriction sites.

plasmid was confirmed by DNA sequencing using an ABI Prism Model
3730XL DNA analyzer (Applied Biosystems, Carlsbad, CA, USA) and the
resulting plasmid was designated pKMUSD (Fig. 2).
2.5. Measurement of the effects of restriction enzyme I-SceI on the
elimination kinetics of the allelic exchange vector pKMUSD
For plasmid elimination, B. anthracis strain A16R (pKMUSD) was
grown in LB medium without kanamycin and A16R
(pKMUSD + pSS4332) was grown in LB medium with kanamycin at
42 °C for 12 h. Then, the samples were diluted and plated onto LB agar
with or without spectinomycin. The plates were incubated at 30 °C until
colonies appeared. Both strains were passaged up to four times in the
same medium and the plasmid elimination rates of each generation
were analyzed as described previously (Wolfson et al., 1982).
2.6. Deletion of theeag gene from B. anthracis
The allelic exchange vector pKMUSD extracted from DH5α was
introduced into the dam−dcm− E. coli host strain JM110 by electro-
poration (1.8 kV, 25 μF, 200 Ω) using a Gene Pulser II electroporator
(Bio-Rad, Hercules, CA, USA) to obtain demethylated plasmid DNA for
transformation into B. anthracis strain A16R. Electroporation-compe-
tent cells of B. anthracis strain A16R were prepared as described pre-
viously. Then, 5 μl of plasmid DNA (1 μg in water) was added to a 50-μl
aliquot of competent cells and pulsed (2.5 kV, 25 μF, 200 Ω) in a 0.2-cm
gap cuvette (Shatalin and Neyfakh, 2005). The cells were resuspended
in 1 ml of brain–heart infusion supplemented with 0.5% glycerol and
incubated for 3 h at 30°C with aeration. The recovered cells were spread
onto LB agar plates containing spectinomycin. Spectinomycin-resistant
colonies were picked, and PCR was performed using the primer pair

10
T. Wang et al. Journal of Biotechnology 271 (2018) 8–16

Fig. 1. Construction of the acceptor vector pKMBKI.

A point mutation was introduced into plasmid pKSV7 to create plasmid pKMU7 lacking the BsaI site. Then, pKMU7 was digested with EcoRI and BamHI enzymes. The pclpB-bgaB and kanr
DNA fragments were amplified using the primer pairs bgab_F/R and kan_F/R, respectively. Then, the pclpB-bgaB and kanr DNA fragments were cloned between the EcoRI and BamHI
restriction sites of pKMU7 using the Seamless Cloning Kit, to create plasmid pKMBK. Finally, the I-SceI site was inserted into the SalI site of pKMBK using the Gibson assembly method,
resulting in acceptor vector pKMBKI.

11
T. Wang et al.
pKSV7_F/R to confirm that recombinant pKMUSD had been introduced
into B. anthracis strain A16R. This strain was then electroporated with
pSS4332, which contains the gene encoding the I-SceI enzyme. The
transformants were selected at 30 °C on LB medium containing specti-
nomycin and kanamycin. Fluorescent colonies carrying pSS4332 were
visible after 16–20 h.
B. anthracis mutants were constructed by replacing coding se-
quences with the spcr cassette, which confers spectinomycin resistance.
Transformation and the selection of transformants in B. anthracis were
conducted as described previously. A single colony of A16R
(pKMUSD + pSS4332) was transferred into liquid medium with kana-
mycin and incubated with shaking for 8 h at 30 °C; then, the cultures
were shifted to 37 °C for 8 h. After three passages in the same medium,
serial dilutions of the culture were plated onto LB agar plates containing
spectinomycin and kanamycin, and incubated overnight at 37 °C. At
least 50 colonies were screened for spectinomycin resistance and
chloramphenicol sensitivity (SpcrCms). Colonies (SpcrCms) thought to
have undergone a double-crossover recombination event were vali-
dated by PCR analysis using three pairs of primers, eagus_F/R, eagsd_F/
R and eagin_F/R, and DNA sequencing. Strains with the desired gene
replacement were passaged up to three times in the absence of anti-
biotics to ensure the loss of pSS4332, which was confirmed by the loss
of fluorescence. The eag gene deletion was further verified by western
blot analysis using an antibody against EA1 protein. The resulting
colony was designated A16R△eag::spc.
3. Results and discussion
3.1. Efficiency of Golden Gate restriction–ligation and identification of the
recombinant allelic exchange vector
When the acceptor vector pKMBKI was introduced into E. coli DH5α
cells, all transformants were blue because of the reaction between the β-
12
Journal of Biotechnology 271 (2018) 8–16
Fig. 2. Cloning strategy for constructing the recombinant allelic ex-
change vector.
Entry vectors pGEM-U, pGEM-S and pGEM-D and acceptor vector
pKMBKI were mixed together along with BsaI and ligase. The mixture
was incubated in a water bath at 37°C for 30 min followed by heating
at 50℃ for 5 min and then at 80°C for 5 min. Next, the mixture was
transformed into DH5α chemically competent cells. X-Gal and kana-
mycin were used for the selection of correct clones, white kanamycin-
resistant colonies were picked out, and the recombinant allelic ex-
change vector pKMUSD was successfully identified.
galactosidase expressed by the pclpB–bgaB gene cassette on the acceptor
vector pKMBKI and the X-Gal on the plate. When the Golden Gate re-
striction–ligation product was transformed into E. coli DH5α cells, al-
most all of the transformants were white, indicating that the three entry
DNA fragments had been inserted into acceptor vector pKMBKI in the
designed order, replacing the original pclpB–bgaB gene cassette on the
acceptor vector. This indicated that this cloning system had high effi-
ciency and the blue/white colors enabled easy screening of the re-
combinant clones.
Twenty white colonies were picked up and analyzed by colony PCR
using three pairs of primers, eagup_F/R, eagdn_F/R and spcin_F/R. In
these reactions, genomic DNA of B. anthracis strain A16R and plasmid
DNA of pSET4s were used as positive control templates to amplify the
DNA fragments of eagup, eagdn and spcin. Genomic DNA of strain DH5α
was used as a negative control template in all tests. The results showed
that all of the colonies except for No. 8 and No. 20 contained the correct
eagup amplified fragment (Fig. 3A). For the spcin DNA fragment, 19 of
the 20 colonies contained the correct amplified DNA bands (Fig. 3B).
For the eagdn DNA fragment, 18 of the 20 white colonies contained the
correct amplified DNA bands (Fig. 3C). In total, 17 of the 20 colonies
possessed the desired ligation of the three entry fragments eagup, spc
and eagdn into the acceptor vector pKMBKI, giving a success rate of
85% (Fig. 3).
To further test the restriction–ligation efficiency, two types of re-
striction–ligase buffer, namely, ligase buffer from Promega and ligase
buffer from New England Biolabs, were also tested. The amount of T4
DNA ligase used in the reaction was also tested in the range of
1.125–2.25 units. Although increasing the amount of T4 DNA ligase
slightly enhanced the restriction–ligation efficiency, no significant dif-
ference was detected between any of the treatments, indicating a degree
of flexibility in the choice of ligase buffer and amount of ligase used in
this restriction–ligation cloning system. Engler et al. had already proved
that incubation for 30 min was optimal for experiments in which three
T. Wang et al. Journal of Biotechnology 271 (2018) 8–16

overhangs were carefully designed. Theoretically, 256 different over-

hangs can be created using a type IIs restriction endonuclease that
produces a 4-nt overhang, 16 of which are palindromic sequences that
were excluded in our cloning strategy to reduce the possibility of self-
ligation, leaving 240 possible 4-nt overhangs from which selection
could be made. For each additional site to be selected, the 4 nt of
previously selected sites or their complement should be excluded. In
this study, we applied strict criteria and designed a set of recombination
sites in which none of the sites shared three consecutive nucleotides
with any other selected site, and thereby achieved seamless ligation
without introducing any new restriction sites in a single step and a
single tube.
To enable antibiotic screening of the transformants, the entry vector
and the acceptor vector should contain different antibiotic resistance
genes. In this study, the pGEM-T easy vector used as the entry vector
and the pKSV7 used as the acceptor vector contained the same ampi-
Fig. 3. PCR identification of the recombinant allelic exchange vector. cillin resistance gene, which made it difficult to screen the recombinant
(A) All colonies except No. 8 and No. 20 possessed the correct eagup amplified fragment. transformants. Therefore, we amplified the Tn5 neomycin phospho-
(B) For the spcin DNA fragment, 19 of the 20 colonies possessed the correct amplified DNA transferase-encoding kanamycin resistance gene from the pKD4 plasmid
bands. No amplification products were obtained with colony No. 8. (C) For the eagdn DNA
and inserted it into pKMU7 adjacent to plcpB–pgaB, resulting in the
fragment, 18 of the 20 white colonies possessed the correct amplified DNA bands. No
amplification products were obtained with colonies No. 6 and No. 8. Overall, the success
acceptor vector pKMBK.
rate of ligation of the three entry fragments eagup, spc and eagdn into the acceptor vector When applying this cloning system for high-efficiency gene re-
pKMBKI was 85% (17/20 colonies). +: the positive controls, −: the negative controls. placement in B. anthracis described here, the only requirement is that
the upstream and downstream regions of the target gene are inserted
into the pGEM-T easy vector. This greatly improves the efficiency of
inserts were inserted into an acceptor vector. The ratios of white/blue
producing the allelic exchange vector. In our study, we applied this
colonies were 24/0 and 27/1 in their two repeated trials under these
system to construct a range of allelic exchange vectors for B. anthracis,
conditions (Engler et al., 2008), which are similar to our results.
all of which were successfully implemented. Because the backbone
Regarding the conventional process to construct an allelic exchange
plasmid pKSV7 is an E. coli–B. subtilis shuttle vector, we believe that this
vector, the upstream and downstream regions of the target gene, the
system could also be applied to construct allelic exchange vectors for
antibiotic resistance gene and the acceptor vector are subjected to a
other Bacillus spp., such as B. subtilis, B. cereus and B. thuringiensis. We
series of enzyme digestion and ligation steps to insert these three DNA
also believe that, through a design with a series of flexible 4-nt over-
fragments into the acceptor vector, which could be time-consuming and
hangs, more than three DNA fragments could also be easily inserted
tedious, until type IIs restriction enzymes started to be used to design
into the pKSV7.
the linker of ligation. Type IIs restriction enzymes can specifically
identify recognition sites and nonspecifically cleave the DNA double
3.2. Loss of effectiveness of the allelic exchange vector using I-SceI
strand outside of the recognition sequences, resulting in 5′ or 3′ over-
endonuclease and verification of eag gene replacement with the spcr cassette
hangs that may consist of any nucleotide. The 4-nt overhang can be
designed and several DNA fragments with complement overhang ends
We tested the elimination rate of the allelic exchange vector when I-
can be ligated using a ligase according to an established order into a
SceI endonuclease was expressed in the host strains. The kinetics of
vector without restriction enzyme recognition sites. These properties
allelic exchange vector pKMUSD elimination from B. anthracis strain
have been used to develop protocols for the efficient assembly of
A16R was analyzed according to a previously published method
multiple DNA fragments in a single seamless ligation reaction
(Wolfson et al., 1982). The expression of I-SceI endonuclease resulted in
(Szybalski et al., 1991). Engler and colleagues developed the Golden
rapid elimination of allelic exchange vector pKMUSD. The rate of
Gate cloning strategy based on the use of type IIs restriction enzymes,
elimination of pKMUSD after one passage was 97.5% when pSS4332
which allowed one-step subcloning of a DNA fragment from one
was present, whereas > 50% of bacteria contained vector pKMUSD
plasmid to another with high efficiency (Engler et al., 2008; Engler
when pSS4332 was absent (Fig. 4). This suggested that allelic exchange
et al., 2014). Since then, the Golden Gate cloning strategy has been
between the allelic exchange vector pKMUSD and the genome of the
applied in many microorganisms to subclone multiple DNA fragments
host is greatly accelerated.
from multiple entry plasmids into an acceptor vector in a one-step re-
Next, we used this allelic exchange vector to knock out the eag gene
action (Agmon et al., 2015; Terfrüchte et al., 2014). This prompted us
on the chromosome of A16R. PCR analysis was performed using two
to construct a multiple DNA fragment subcloning system to be used for
pairs of external identification primers eagus_F/R and eagsd_F/R and
allelic exchange in B. anthracis. We attempted to modify the tempera-
one pair of internal identification primers eagin_F/R (Table 1, Fig. 5A)
ture-sensitive E. coli–B. subtilis shuttle vector pKSV7 into an acceptor
to determine whether the eag gene had been replaced by the spcr cas-
vector to facilitate the screening of transformants (Smith and
sette. The results indicated that the eag gene was present in wild-type
Youngman, 1992). First, we analyzed the sequence of pKSV7 and found
strain A16R but not in A16RΔeag::spc. The two pairs of external primers
an internal BsaI site. Then, we mutated the BsaI site using a point
specifically amplified PCR bands in A16RΔeag::spc (Fig. 5A). Sequen-
mutation kit, resulting in pKMU7 lacking this site. To enable blue/white
cing data obtained using the PCR fragments amplified with the two
colony screening, a promoterless bgaB gene from Bacillus stear-
external primers were consistent with the eag gene being replaced by
othermophilus encoding a thermostable β-galactosidase and a con-
the spcr gene (Fig. 5A). Western blot analysis using the anti-EA1 anti-
stitutive pclpB promoter was amplified from the pMAD plasmid and
body indicated that there was a specific protein band in the B. anthracis
inserted into the pKMU7 plasmid (Arnaud et al., 2004). The BsaI re-
A16R strain that was not present in A16R△eag::spc. Taken together,
striction sites flanking pclpB–bgaB would be recognized and cleaved by
these results indicated that the eag gene had been replaced by the spcr
the BsaI restriction enzyme, allowing them then to accept a set of entry
gene (Fig. 5B).
DNA fragments designed to have compatible 4-nt restriction overhangs.
In 2006, Brian K. and coworkers deleted the plcR, pagA, lef, cya and
To enhance the restriction–ligation efficiency, the 4-nt restriction
spo0A genes of B. anthracis using allelic-exchange schemes driven by I-

13
T. Wang et al.
Fig. 4. Kinetics of plasmid pKMUSD elimination fromBacillus anthracis strain A16R.
B. anthracis strain A16R (pKMUSD) was grown in LB medium without kanamycin and
A16R (pKMUSD + pSS4332) was grown in LB medium with kanamycin at 42 °C for 12 h.
The samples were diluted and plated onto LB agar. At each time point, the colonies were
counted and scored for the elimination of the plasmid. Plasmid elimination rate (PER)
was calculated based on the following equation: PER= (1 − N/N0)×100%. Note: N0,
total colonies tested; N, plasmid-containing colonies (spcr).
SceI nuclease at rates of 20%–100% (Janes and Stibitz, 2006; Tischer
et al., 2006). Using the protocol developed in this study, the ideal
mutants were obtained after only three passages by screening 50 clones.
Three independent experiments indicated that approximately
85%–100% (43/50, 45/50, 50/50) of the spcrcms clones had eag re-
placed by the spcr cassette in the correct manner. We also deleted
several other B. anthracis genes, such as BA2380, atxA, mntA, qoxA,
abrB, and sigF, using this method, with a rate of allelic exchange similar
to that in the case of eag deletion. That our method has a higher rate of
allelic exchange of the spcrcms clones may be because we used the
double-antibiotic screen.
For Gram-positive bacteria, homologous recombination, transposi-
tion mutagenesis, and group II intron-based insertion mutagenesis have
been used for gene inactivation. However, the most commonly used
method of mutagenesis is homologous recombination. This is usually a
rare event, so strategies to enhance the efficiency of homologous re-
combination are vital (Janes and Stibitz, 2006; Schuch et al., 2015;
Shatalin and Neyfakh, 2005). Many methods have been proposed that
artificially increase the efficiency of endogenous homologous re-
combination. The success of the λ Red recombination system for re-
combineering in E. coli provided the basis for initial experimental de-
signs (Datsenko and Wanner, 2000; Tischer et al., 2006). Using
mycobacteriophage-encoded recombination proteins, a recombineering
system for mycobacteria was developed based on the RecE/T system
(Van Kessel and Hatfull, 2007). The same protocol has also been ap-
plied in lactic acid bacteria and B. subtilis (Van Pijkeren and Britton,
2012; Van Pijkeren et al., 2012; Wang et al., 2012). However, for B.
anthracis, there is no effective method for transforming single-stranded
DNA into competent cells and then ensuring its stability in B. anthracis
14
Journal of Biotechnology 271 (2018) 8–16
cells. Thus, it is difficult to use the RecE/T system in this case. As such,
research has focused on increasing the allelic exchange efficiency be-
tween the chromosome and the target plasmid. Plasmids usually used in
B. anthracis based on the widely used pE194ts replicon (e.g., pMAD,
pKSV7) were able to replicate in B. anthracis, but curing was inefficient
even at the highest temperature tolerated by this bacterium (44 °C), at
which more than 50% of the cells retained the plasmid in free form. The
pWV01 replicon-based plasmids also require more than 20 passages to
lose the target plasmids, which is impractical and even then does not
guarantee success (Shatalin and Neyfakh, 2005). Thus, maintenance at
a nonpermissive temperature is critical during the passage of cells in the
absence of antibiotic selection conferred by the plasmid. The approach
to facilitating this recombination event involves the use of site-specific
cleavage, mediated by the restriction enzyme I-SceI, of a cognate I-SceI
site present in the allelic exchange vector but not elsewhere in the
bacterial chromosome. This method was originally used in E. coli, and
adapted for use in B. anthracis by Stibitz and coworkers (Janes and
Stibitz, 2006; Schuch et al., 2015).
To address this problem, we introduced an I-SceI site into the allelic
exchange vector. After the allelic exchange vector was transformed into
B. anthracis, a second plasmid, pSS4332, which expressed endonuclease
I-SceI, was introduced to digest the first plasmid resulting in a linear
allelic exchange vector during passaging. The linear allelic exchange
vector was forced to incorporate into the chromosome by growth at
elevated temperatures concomitant with selection for spectinomycin as
a consequence of a first homologous recombination event. The loss rate
of the final allelic exchange vector improved significantly using this
method. This method can also simulate gene targeting using linear DNA
fragments to some extent and increase the homologous recombination
efficiency greatly. This approach will also facilitate the second re-
combination event by both selecting against bacteria in which the
chromosome has been damaged and stimulating recombination of the
flanking homologous sequences to repair the lesion. Repair of this break
by a second recombination event results in loss of the integrated
plasmid and the desired gene replacement strains can then be obtained
by appropriate antibiotic resistance screening (Fig. 6).
In the present study, an I-SceI site, which was situated outside the
two homologous genomic sequences, was introduced into the target
plasmid. Recombination between the target plasmid and genomic DNA
was forcibly induced by three factors, namely, the induction of en-
donuclease I-SceI to initiate site-specific cleavage, a nonpermissive
temperature, and an antibiotic. Using this strategy, eag and several
other genes of B. anthracis were deleted extremely efficiently within
approximately 3 weeks with less screening work. B. anthracis, B. wei-
henstephanensis, B. mycoides, B. pseudomycoides, B. cereus, and B. thur-
ingiensis all belong to the B. cereus group, which are found in diverse
habitats. Although the B. cereus group is phenotypically and genetically
heterogeneous overall, strikingly, strains of the different constitutive
species are closely related at the chromosomal level. Therefore, we
speculated that the high-efficiency allelic exchange driven by I-SceI
Fig. 5. Verification ofeag gene replacement by the spcr cassette in B.
anthracis strain A16R.
1: B. anthracis strain A16R△eag::spc, 2: B. anthracis strain A16R. (A)
The results indicated that the eag gene was present in wild-type strain
A16R but not in A16RΔeag::spc because the eagin fragment was only
amplified in the wild-type strain. Furthermore, two specific PCR bands
were amplified by the external primers in A16RΔeag::spc and sequen-
cing results were consistent with the eag gene being replaced by the
spcr gene. (B) Western blot analysis using anti-EA1 antibody revealed a
specific protein band in B. anthracis strain A16R that was not present in
A16R△eag::spc.
T. Wang et al. Journal of Biotechnology 271 (2018) 8–16

Fig. 6. Potential schematic of endonuclease I-SceI-mediated allelic-exchange procedure.

This protocol used the endonuclease I-SceI to cleave the target plasmid or genomic DNA in vivo. (I) The plasmid pSS4332 was transformed into B. anthracis containing pKMUSD, which
was then grown at a permissive temperature. (II) pKMUSD was integrated into the chromosome in some bacterial cells while free plasmid also existed in many other cells. (III) The
endonuclease I-SceI expressed and cleaved the target sites on the integrated plasmid, broke the chromosome or cleaved the target sites on pKMUSD, and linearized it. (IV) The
chromosome was damaged by endonuclease I-SceI, followed by recombination repair resulting in loss of the integrated plasmid or the occurrence of homologous recombination between
linear plasmid DNA and chromosome. (V) Both of these different pathways result in replacement of the targeted gene (eag) by spcr cassette. The red diamond denotes the I-SceI site.

endonuclease described here could be applied in other species of the B.
cereus group.
The flexibility, speed and efficiency of the multiple DNA fragment
cloning and gene replacement technique reported here should make it a
valuable tool to investigate gene function in B. anthracis and other
species of the B. cereus group.
Funding sources
This work was supported by the National Natural Science
Foundation of China (grant numbers 81571958, 81601739, and
81671979) and the State Major Science and Technology Special
Projects of China (grant number 2017ZX10104002).

4. Conclusion
In this study, we constructed a high-efficiency cloning system using
the Golden Gate method and introduced an I-SceI site into our allelic
exchange vector as a counterselection marker to elevate the homo-
logous recombination efficiency for targeted gene replacement in B.
anthracis. The efficiency of using the Golden Gate method to build a
knockout vector is more than 85%. We proved that the expression of I-
SceI endonuclease greatly promoted homologous recombination. eag
and several other genes of B. anthracis were deleted using the technique
described here. That the Golden Gate method and the counterselectable
marker were combined innovatively greatly shortens the time required
for gene knockout in B. anthracis. It is speculated that this gene
knockout vector construction system and high-efficiency targeted gene
replacement driven by I-SceI endonuclease can be applied to other
Bacillus spp.
Conflict of Interest
The authors declare no conflicts of interest.
References
Agmon, N., Mitchell, L., Cai, Y., Ikushima, S., Chuang, J., Zheng, A., Choi, W., Martin, J.,
Caravelli, K., Stracquadanio, G., Boeke, J., 2015. Yeast Golden Gate (yGG) for the
efficient assembly of S. cerevisiae transcription units. ACS Synth. Biol. 4 (7),
853–859.
Arnaud, M., Chastanet, A., Debarbouille, M., 2004. New vector for efficient allelic re-
placement in naturally nontransformable, low-GC-content, gram-positive bacteria.
Appl. Environ. Microbiol. 70 (11), 6887–6891.
Choulika, A., Perrin, A., Dujon, B., Nicolas, J., 1995. Induction of homologous re-
combination in mammalian chromosomes by using the I-SceI system of
Saccharomyces cerevisiae. Mol. Cell. Biol. 15 (4), 1968–1973.
Cybulski Jr., R.J., Sanz, P., Alem, F., Stibitz, S., Bull, R.L., O’Brien, A.D., 2009. Four
superoxide dismutases contribute to Bacillus anthracis virulence and provide spores
with redundant protection from oxidative stress. Infect. Immun. 77 (1), 274–285.
Datsenko, K., Wanner, B., 2000. One-step inactivation of chromosomal genes in

15
T. Wang et al.
Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97 (12),
6640–6645.
Engler, C., Gruetzner, R., Kandzia, R., Marillonnet, S., 2009. Golden gate shuffling: a one-
pot DNA shuffling method based on type IIs restriction enzymes. PLoS One 4 (5),
e5553.
Engler, C., Kandzia, R., Marillonnet, S., 2008. A one pot, one step, precision cloning
method with high throughput capability. PLoS One 3 (11), e3647.
Engler, C., Youles, M., Gruetzner, R., Ehnert, T., Werner, S., Jones, J., Patron, N.,
Marillonnet, S., 2014. A golden gate modular cloning toolbox for plants. ACS Synth.
Biol. 3 (11), 839–843.
Goff, S., Berg, P., 1976. Construction of hybrid viruses containing SV40 and lambda phage
DNA segments and their propagation in cultured monkey cells. Cell 9 (4 PT 2),
695–705.
Hartley, J., Temple, G., Brasch, M., 2000. DNA cloning using in vitro site-specific re-
combination. Genome Res. 10 (11), 1788–1795.
Janes, B.K., Stibitz, S., 2006. Routine markerless gene replacement in Bacillus anthracis.
Infect. Immun. 74 (3), 1949–1953.
Liu, Q., Li, M., Leibham, D., Cortez, D., Elledge, S., 1998. The univector plasmid-fusion
system, a method for rapid construction of recombinant DNA without restriction
enzymes. Curr. Biol. 8 (24), 1300–1309.
Liu, Q., Li, M., Liu, D., Elledge, S., 2000. Rapid construction of recombinant DNA by the
univector plasmid-fusion system. Meth. Enzymol. 328, 530–549.
Rong, Y., Titen, S., Xie, H., Golic, M., Bastiani, M., Bandyopadhyay, P., Olivera, B.,
Brodsky, M., Rubin, G., Golic, K., 2002. Targeted mutagenesis by homologous re-
combination in D. melanogaster. Genes Dev. 16 (12), 1568–1581.
Schmidt-Puchta, W., Orel, N., Kyryk, A., Puchta, H., 2004. Intrachromosomal homologous
recombination in Arabidopsis thaliana. Methods Mol. Biol. 262, 25–34.
Schuch, R., Plaut, R.D., Stibitz, S., 2015. Improvements to a markerless allelic exchange
system for Bacillus anthracis. PLoS One 10 (12), e0142758.
Shatalin, K.Y., Neyfakh, A.A., 2005. Efficient gene inactivation in Bacillus anthracis.
FEMS Microbiol. Lett. 245 (2), 315–319.
Smith, K., Youngman, P., 1992. Use of a new integrational vector to investigate com-
partment-specific expression of the Bacillus subtilis spoIIM gene. Biochimie 74 (7-8),
705–711.
16
Journal of Biotechnology 271 (2018) 8–16
Sternberg, N., Hamilton, D., Austin, S., Yarmolinsky, M., Hoess, R., 1981. Site-specific
recombination and its role in the life cycle of bacteriophage P1. Cold Spring Harb.
Symp. Quant. Biol. 45 (Pt 1), 297–309.
Szybalski, W., Kim, S., Hasan, N., Podhajska, A., 1991. Class-IIS restriction enzymes—A
review. Gene 100, 13–26.
Takamatsu, D., Osaki, M., Sekizaki, T., 2001. Thermosensitive suicide vectors for gene
replacement in Streptococcus suis. Plasmid 46 (2), 140–148.
Terfrüchte, M., Joehnk, B., Fajardo-Somera, R., Braus, G., Riquelme, M., Schipper, K.,
Feldbrügge, M., 2014. Establishing a versatile Golden Gate cloning system for genetic
engineering in fungi. Fungal Genet. Biol. 62, 1–10.
Tischer, B., von Einem, J., Kaufer, B., Osterrieder, N., 2006. Two-step red-mediated re-
combination for versatile high-efficiency markerless DNA manipulation in
Escherichia coli. Biotechniques 40 (2), 191–197.
Vad-Nielsen, J., Lin, L., Bolund, L., Nielsen, A.L., Luo, Y., 2016. Golden Gate assembly of
CRISPR gRNA expression array for simultaneously targeting multiple genes. Cell Mol.
Life Sci. 73 (22), 4315–4325.
Van Kessel, J.C., Hatfull, G.F., 2007. Recombineering in Mycobacterium tuberculosis.
Nat. Methods 4 (2), 147–152.
Van Pijkeren, J.P., Britton, R.A., 2012. High efficiency recombineering in lactic acid
bacteria. Nucleic Acids Res. 40 (10) e76-e76.
Van Pijkeren, J.P., Neoh, K.M., Sirias, D., Findley, A.S., Britton, R.A., 2012. Exploring
optimization parameters to increase ssDNA recombineering in Lactococcus lactis and
Lactobacillus reuteri. Bioengineered 3 (4), 209–217.
Walhout, A., Temple, G., Brasch, M., Hartley, J., Lorson, M., van den Heuvel, S., Vidal, M.,
2000. GATEWAY recombinational cloning: application to the cloning of large num-
bers of open reading frames or ORFeomes. Meth. Enzymol. 328, 575–592.
Wang, Y., Weng, J., Waseem, R., Yin, X., Zhang, R., Shen, Q., 2012. Bacillus subtilis
genome editing using ssDNA with short homology regions. Nucleic Acids Res. 40 (12)
e91-e91.
Weber, E., Gruetzner, R., Werner, S., Engler, C., Marillonnet, S., 2011. Assembly of de-
signer TAL effectors by Golden Gate cloning. PLoS ONE 6 (5), e19722.
Wolfson, J., Hooper, D., Swartz, M., McHugh, G., 1982. Antagonism of the B subunit of
DNA gyrase eliminates plasmids pBR322 and pMG110 from Escherichia coli. J.
Bacteriol. 152 (1), 338–344.