Documente Academic
Documente Profesional
Documente Cultură
PII: S1049-9644(17)30139-1
DOI: http://dx.doi.org/10.1016/j.biocontrol.2017.07.005
Reference: YBCON 3614
Please cite this article as: Oskiera, M., Szczech, M., Stępowska, A., Smolińska, U., Bartoszewski, G., Monitoring
of Trichoderma species in agricultural soil in response to application of biopreparations, Biological Control (2017),
doi: http://dx.doi.org/10.1016/j.biocontrol.2017.07.005
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers
we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and
review of the resulting proof before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Monitoring of Trichoderma species in agricultural soil in response to application of
biopreparations
Oskiera M.*1, Szczech M.1, Stępowska A.2, Smolińska U.1, Bartoszewski G.3
Poland.
Skierniewice, Poland.
1
ABSTRACT
Strains of Trichoderma are used in crop plant production as plant growth promoters
and biological control agents. In this study, strains of T. atroviride and T. harzianum,
lettuce cultivation, and their population levels were monitored over time. A newly
confirm the increased abundance of T. atroviride and T. harzianum in the soil after
untreated soil. The results of multiplex-PCR were confirmed by standard plating and
however, their abundance was estimated to be relatively low 103 CFU, when compared to
105 CFU g-1 of dry soil, after biopreparations application, and these fungi persisted at this
2
INTRODUCTION
Overuse of pesticides in agriculture can have negative impacts on human health and
plant pathogens (Aktar et al. 2009; Damalas and Eleftherohorinos, 2011). Thus, limiting
the use of chemical pesticides and implementing novel strategies for pathogen control are
critical for improvement of crop production. One of the most promising strategies to
minimize pesticide use is biological control that utilizes beneficial microorganisms. For
example, Trichoderma fungi are used worldwide as biological control agents (BCA) and
rhizosphere (Harman, 2000, 2006). Selected Trichoderma strains can stimulate plant
growth, increase the root surface area to allow better access to nutrients, and enhance
plant resistance to pathogens (Harman et al. 2004; Djonović et al. 2007). Recently, a
functional genomics analysis showed that different Trichoderma lineages exert their
beneficial effects via distinct biocontrol-related mechanisms, and it was suggested that
application of different strain mixtures could improve biocontrol efficacy (Atanasova et al.
2013).
Many studies have aimed to increase the efficiency and safety of biocontrol fungi
application (reviewed by Błaszczyk et al. 2014). For example, several research groups
3
investigated the effectiveness of Trichoderma application in plant cultivation by studying
fungal application methods, dosages, survival rates, and the effects on plants and other
microbes (Abbasi et al. 1999; Hermosa et al. 2001; Dodd et al. 2004; Savazzini et al.
2008, 2009; Longa et al. 2009). High densities of Trichoderma spp. are typical for
suppressive composts (Nelson et al. 1983) and are associated with suppression of
pathogenic Rhizoctonia spp. (Kuter et al. 1983). Because BCA density is critical in
pathogen suppression, methods to trace and quantify these agents in the soil and in the
rhizosphere have become important subject areas in the crop science literature (Abbasi et
Traditional tools for fungal monitoring in soil require a cultivation step, if plating
techniques and colony forming unit counting are used. However, cell culturing can be
al. 1996; Lübeck and Jensen, 2002). So far, several molecular markers have been
developed for Trichoderma spp. identification and detection in soil (Abbasi et al. 1999;
Hermosa et al. 2001; Dodd et al. 2004; Naeimi et al. 2011). Abbasi et al. (1999)
complex environments such as field soil or compost (Abbasi et al. 1999). Species- or
even strain-specific PCR-based markers have also been developed based on genetic
variability of different coding or non-coding genomic regions, for example ITS1 and
ITS2, the 42-kDa endochitinase gene (ech42, actually chi18-5), the G protein α subunit
4
gene (tga3) and other regions (Hagn et al. 2007; Savazzini et al. 2008; Meincke et al.
2010; Naeimi et al. 2011; Friedl and Druzhinina, 2012; Skoneczny et al. 2015). Several
markers were used with quantitative Real-Time PCR to measure fungal DNA levels in
soil extracts (Rubio et al. 2005; Cordier et al. 2007; Savazzini et al. 2008, 2009;
The aim of this study was to detect and quantify active strains of T. atroviride
(TRS25 and TRS43) and T. harzianum sensu stricto (TRS59 and TRS85) which had been
cultivated lettuce. The methods employed included dilution plating (CFU counting),
field experiments of at least ten weeks’ duration, one of which was multi-seasonal, lasting
detect and monitor T. atroviride and T. harzianum sensu stricto in the soil environment,
Trichoderma strains
Four Trichoderma strains, TRS25, TRS43, TRS59 and TRS85, were used in field
experiments with lettuce cultivation. Strains TRS25 and TRS85 were isolated from a
growing hall for mushroom production. They were confirmed as not pathogenic for the
5
cultivated mushroom as described by Szczech et al. (2008). Strain TRS43 was isolated
from forest soil and TRS59 from agricultural soil. Molecular classification of these
strains was carried out by DNA barcoding, based on the sequences of ITS1 and ITS2 of
the ribosomal RNA gene cluster and on the sequences of translation elongation factor 1
alpha (tef1), chitinase 18-5 (chi18-5), and RNA polymerase II subunit (rpb2) genes
(Oskiera et al. 2015). According to this classification, strains TRS25 and TRS43 belong
to T. atroviride clade A and strains TRS59 and TRS85 to T. harzianum sensu stricto.
These strains were applied as biopreparations to the soil, and their presence and density in
cultivated fields were monitored in the studies. Twenty taxa of Trichoderma were used
all the strains has been performed and was described earlier by Oskiera et al. (2015).
Trichoderma strains TRS25, TRS43, TRS59 and TRS85 were prepared for soil
organic waste (onion rind, apple and strawberry pomace, rapeseed meal), was granulated
and inoculated with spore suspensions of Trichoderma strains. Each strain was inoculated
separately at a density of 107 spores ml-1, and a dose of 5 ml l-1 of the granulate.
Inoculated granules were kept in plastic bags for 14 days at room temperature to
overgrow the carrier by Trichoderma. The final density of fungal propagules in the
preparations was about 107 CFU g-1. Prior to field application, the preparations were
6
mixed in equal portions (vol: vol). Two mixtures were prepared: mixture v1 consisting of
strains TRS25 and TRS59, and mixture v2 consisting of strains TRS43 and TRS85.
were performed in the years 2012–2014 at the experimental field of the Research Institute
locations within the field to avoid cross-contamination of the soil by the various applied
Trichoderma preparations. Experiment I was conducted for two years at the same site,
from June 2012 to July 2014, to examine the Trichoderma population in the soil during
more than one vegetative season. In this experiment, after the lettuce harvest, the soil was
left fallow with only regular weed cutting. The duration of experiments II and III was
limited to the vegetative season for lettuce: May to July 2013 for experiment II and July
– soil amended with granulated carrier without Trichoderma; v1 – soil amended with v1
omitted. Each variant was prepared in four replications – four plots of 4.5 m2 each. The
The cultivation practices employed in the experiments were similar to those used in
applied to the soil two weeks before lettuce planting, except for experiment I, where they
were added immediately before planting. The granulates were mixed with a 10-cm layer
7
of the soil. The dose of the preparations was 10 t ha-1. Fifty transplants of iceberg lettuce
cv. ‘Elenas’ (Rijk Zwaan BV, The Netherlands) were planted on each plot at a distance of
30 cm. The plants were cultivated for 8 weeks until harvest. Weeds were hand removed.
For each experiment, the first soil samples were collected before application of the
two and nine weeks after lettuce planting (2 wpa, 9 wpa), after lettuce harvest (12 wpa),
at the end of growing season 2012 (October - 15 wpa), and then twice in the season 2013
(May - 45 wpa, October - 69 wpa), and finally two years after Trichoderma application in
July 2014 (106 wpa). In experiments II and III, soil samples were collected two weeks
after lettuce planting (6 wpa), and 1 - 2 weeks after lettuce harvesting (10-12 wpa). One
sample consisted of fifteen sub-samples of the upper soil layer (15 cm deep), collected
randomly from one plot using an agronomic soil tube sampler. The samples were briefly
air-dried, mixed and sieved through 1-mm mesh. For plate colony counting of
Trichoderma spp., the soil was analyzed immediately after sampling. For DNA isolation,
soil samples were stored at -80 °C until extraction. Ten grams of each representative soil
sample were dried at 105 °C to determine soil dry weight for subsequent calculations.
DNA isolation
For DNA isolation from Trichoderma, the fungi were grown in PDB liquid medium
(Sigma-Aldrich, USA) for one week on a shaking incubator (GFL 3031, Germany) at
25 °C with orbital motion speed 80 rpm. The fungal cells were collected and DNA was
8
isolated as described by Oskiera et al. (2015). For DNA isolation from soil, 500 mg of
instrument (MP Biomedicals, USA) in Lysing MatrixE tubes (MP Biomedicals, USA).
DNA was isolated using a NucleoSpin®Soil kit (Macherey-Nagel, Germany). SL1 lysis
buffer with Enhancer SX was used according to the manufacturer’s instructions. DNA
concentration in the samples obtained from soil was also measured by using PicoGreen
ng/µl.
Germany). Standard PCR mixture (20 µl) contained: 1× PCR buffer, 1.5 mM MgCl2, 0.25
Lithuania), and 20 ng of DNA template. Amplification was carried out with an initial
annealing for 30 s at a temperature appropriate for the primer combination (Table 1 and
2), extension for 1 min at 72 °C, and a final extension for 10 min at 72 °C. Three methods
Table S2), were performed for identification of fungi isolated from soil samples.
Fingerprints were performed using the following primers: ERIC1R and ERIC2, a single
primer BOXA1R, and two primers REP1R-I and REP2-I (Louws et al. 1994; Versalovic
9
et al. 1991). The PCR mixture contained: 1× Dream Taq Green buffer, 0.25 mM dNTPs,
0.5 µM each primer, 4 µg bovine serum albumin (BSA), 1 U Taq DNA Polymerase
The amplified products were separated by electrophoresis in the gel containing ethidium
To design species-specific PCR primers, sequences of ITS1 and ITS2, tef1, rpb2 and
chi18-5, previously described by Oskiera et al. (2015), and SCAR sequences B07, Q01
and X18, described by Skoneczny et al. (2015), were mapped to publicly available
Trichoderma genome sequences (Supplemental Table S3). Our and matched genome
sequences were aligned and regions unique to T. atroviride and T. harzianum were
identified and used to design PCR primers. The sequences were mapped, aligned and
primers designed using CLC Genomics Workbench 7.5 (CLCBio, Denmark). Primers
1999; Kullnig-Gradinger et al. 2002; Bhat, 2007) were also used in this study and are
listed in Table 1. All primers were synthesized at Genomed S.A. (Warsaw, Poland).
Primer sets were tested for their species-specific DNA amplification to select the
best-performing primers, as follows. Firstly, PCR was performed with two annealing
temperatures (50 ºC and 60 ºC) and T. atroviride (IMI206040) and T. harzianum sensu
stricto (TRS59) DNA, and only the primer sets which produced a single amplicon of the
correct size were chosen for further evaluation. Next, optimal annealing temperatures
were defined for each primer pair based on the results of gradient PCR. Finally, the best
10
primer pairs were validated for specificity by PCR using as template DNA of 20
Trichoderma taxa (Supplemental Table S1) and their pooled DNA. Multiplex-PCR was
0.85% NaCl solution, and shaken (150 rpm) for 20 minutes at room temperature on a
laboratory shaker type 358S (Elpin Plus, Poland). Then, ten-fold serial dilutions (10-2,
10-3 10-4 and 10-5) were made, and the aliquots (100 µl) were spread onto plates with Rose
Bengal agar medium containing streptomycin (Martin, 1950), in three replications. The
plates were incubated in the dark at 25 °C. Colonies showing the characteristics of
Trichoderma were counted after 3 and 6 days of incubation, and colony forming units
(CFU) were calculated for 1 g of dry weight of the soil. Representative fungal colonies
grown on the plates were transferred to fresh medium and were collected for further
in this study) and rep-PCR. The identification was conducted as follows: in the first step
rep-PCR and multiplex-PCR were used to identify and to group genetically similar strains.
Grouping of the resulting rep-PCR profiles was made by visual inspection, implemented
with UPGMA clustering and computed using VisionWorks LS 6.7.4 software (UVP,
11
Upland, CA, USA). Further, tef1 sequences were obtained for detailed identification of
isolates representative for the soil samples and rep-PCR profiles. DNA/PCR preparations
S5 and S6.
RESULTS
Alignment of ITS1 and ITS2, tef1, rpb2, chi18-5 and SCAR sequences revealed in
PCR markers. The T. atroviride-specific markers Tatef and Tachi were developed based
on tef1 and chi18-5 gene sequences, respectively. Also, the markers TaB and TaQ, which
were designed based on published SCAR sequences (Skoneczny et al. 2015), allowed the
identification of T. atroviride isolates, whereas the marker TaX was specific to clade A
distinguished from other T. atroviride strains (Figure 1, Table 1). Development of markers
specific to T. harzianum sensu stricto was challenging because there are many related
species and lineages in the T. harzianum species complex (Chaverri et al. 2015).
Alignments of ITS1 and ITS2, tef1, chi18-5, and rpb2 sequences of representatives of
these strains were not sufficient to distinguish specific primers for T. harzianum sensu
stricto. However, the ThQ marker specific to T. harzianum sensu stricto was identified
based on the T. atroviride SCAR Q01 sequence. Marker Tschi, specific to T. simmonsii,
12
was designed based on chi18-5 gene sequences. Marker Thstef, specific to T. harzianum
sensu stricto and T. simmonsii, was designed based on analysis of tef1 gene sequences.
The TVD marker, developed by Bhat (2007), was also tested in this study and found to be
specific for T. harzianum sensu stricto and T. atrobrunneum. Marker ThsaQ enabled T.
harzianum sensu stricto, T. simmonsii and T. atrobrunneum (which all belong to the same
Development of multiplex-PCR
stricto were combined with primer pairs specific to Trichoderma spp. or generally to the
fungi, in a single PCR. Many combinations of primers were tested in multiplex-PCR, and
the best ones for detection and identification of T. atroviride and T. harzianum are listed
in Table 2.
specific to T. atroviride clade A, the TaB marker specific to T. atroviride species, the
chitinase gene fragment (Tachi) specific for Trichoderma spp., and the fungal ITS region.
Trichoderma spp. and four primer pairs specific for T. harzianum (ThQ, ThsaQ, Thstef,
TVD).
13
For T. atroviride detection in soil samples a maximum of three pairs of primers were
fungi (multiplex-PCR SA1 and 2). For T. harzianum identification and its detection in
soil samples, only two primer pairs were combined in multiplex-PCR (SH1 and 2).
Primers specific to the β-tubulin gene of Trichoderma spp. were used as a control.
Trichoderma spp. were not detected with the newly developed multiplex-PCR
technique in field soil, that had been sampled prior to application of the Trichoderma
Trichoderma strains TRS25, TRS43, TRS59 and TRS85 (Figure 2). Analysis revealed the
presence of T. atroviride and T. harzianum strains in soil samples after their application.
The results of multiplex-PCR analysis were confirmed by dilution plating and colony
counting. The number of Trichoderma spp. that naturally inhabit the soil of the
experimental field reached up to 103-104 CFU g-1 soil (Figure 3). After soil amendment
number of Trichoderma spp. colonies increased to 105-106 CFU g-1 soil. In all
fungi in the soil compared to application of v1 (Figure 3 and Supplemental Table S4). At
the first soil sampling after lettuce planting, the numbers of Trichoderma spp. in the
experiment I were 7.8×105 and 11.9×105 CFU g-1 soil for v1 and v2, respectively. In the
14
experiment II they were 1.0×105 and 1.3×105 CFU g-1 soil, and in the experiment III
0.1×105 and 2.3×105 CFU g-1 soil (Supplemental Table S4). Similar levels of
Trichoderma in the amended soil were detected after lettuce harvest (10 – 12 wpa). In the
3.4×105 and 3.9×105 CFU g-1 soil for v1 and v2, respectively. In the experiment II they
were 1.7×105 and 2.6×105 CFU g-1 soil, and in the experiment III 0.4×105 and 1.0×105
CFU g-1 soil (Supplemental Table S4). In the course of long-time monitoring, conducted
in the experiment I, decline of Trichoderma spp. abundance was observed after the
winters in 2012 and 2013 (between 15 - 45 wpa and 69 - 106 wpa). However, two years
after fungal application, Trichoderma soil population was still maintained at relatively
high level 8×104 and 9×104 CFU g-1 soil for v1 and v2, respectively (Figure 3).
Three hundred fifty six fungal isolates obtained from soil samples, collected before
and after Trichoderma application in the three experiments, were subjected to the newly
developed typing procedures. Among these 267 isolates were identified as Trichoderma
spp. and the remaining 89 as members of other genera. Most of the fungal strains isolated
(79 strains) or T. harzianum sensu stricto (49 strains). The remaining strains were much
less abundant. Tef1 sequence-based identification was performed for 117 representative
Trichoderma species were identified in soil samples collected from the experimental field
before application of the Trichoderma preparations (Supplemental Table S5). Nearly all
15
strains isolated from soils amended with Trichoderma preparations were identified as T.
atroviride (41) and T. harzianum sensu stricto (32). Only two strains (among 75 studied
virens (TRS897). The typing analyses (multiplex-PCR, rep-PCR, tef1) confirmed that
strains applied to the experimental field soil were present in the post-application soil
samples. The non-Trichoderma isolates obtained from the soil were mostly members of
Scopulariopsis and three strains with identical tef1 sequence were not identified
DISCUSSION
In this study, selected strains of T. atroviride and T. harzianum sensu stricto were
monitored under field conditions after their application to the soil in the form of
preparations based on organic waste materials. Two techniques, dilution plating on agar
media and molecular methods, were used to monitor the introduced fungi during the
period of lettuce cultivation, and in two subsequent vegetative seasons after lettuce
harvest. Species-specific markers for T. atroviride and T. harzianum sensu stricto were
developed and combined in multiplex-PCR together with markers universal for general
fungi and for Trichoderma spp. The method successfully detected these species in the
soil, when their abundance reached above 1×104 CFU g-1 soil. Moreover, the studies
showed that the proposed multiplex-PCR method can quickly reveal successful outcomes
harzianum could be confirmed with this approach in just one day and at compromised
16
cost. The method, therefore, should allow for efficient monitoring of alterations in the
understand their role and impact in nature (Jansson and Prosser, 1997). Expression of the
beneficial effects of these microorganisms requires their presence at sufficient density and
their ability to adapt to new conditions. Thus, data concerning the fate of inoculated
organisms are necessary for evaluating the activity and efficacy of biopreparations.
strains in the soil was maintained at elevated levels of 105 - 106 CFU g-1 soil for at least
10 weeks after fungal application in all three experiments. In the v1 variant of the
experiment III, the granulate was less overgrown with Trichoderma compared to the other
variants, what could explain the lower population abundance detected in the amended soil
(1 - 4 ×104 CFU g-1 soil). In the control plots and before Trichoderma application, strains
of the species T. atroviride and T. harzianum sensu stricto were isolated from the soil as
indigenous fungi, but their abundance was low, and overall Trichoderma spp. population
was estimated at a maximum of 103 - 104 CFU g-1 soil. The limit of detection of the
developed multiplex-PCR method was determined to be above 1×104 CFU g-1 soil.
Efficient isolation of good quality DNA from the soil samples is crucial for successful
application of the method. For some types of soils difficulties with DNA isolation can
indigenous Trichoderma spp. with the new method. Cordier et al. (2007) monitored the
17
population dynamics of T. atroviride strain T1 in soil by using Real-Time PCR and
detected the strain at a concentration as low as 1×103 CFU g-1 soil. Similarly, Savazzini et
al. (2008) used Real-Time PCR to detect and quantify T. atroviride strain SC1 in soil, and
the limit of detection in their study ranged from 8.5×103 to 1.2×104 CFU g-1 soil.
Species-specific primers developed in the present study can be converted and used in
introduced Trichoderma strains to the field soil environment and climatic conditions.
After two years, the fungi were detected in soil at concentrations of 8×104 and 9×104 CFU
g-1 soil for v1 and v2, respectively. These values were significantly higher than for control
soil (0.48×104 CFU g-1 soil). Applied strains maintained a fairly stable presence and
tolerated the winter temperatures, although a steady, nearly linear decline in population
size was evident beginning 9 weeks and ending 106 weeks after preparation application
(the Trichoderma spp. density decreased from 3.9×105 to 0.8×105 CFU g-1 soil for the v1
mixture and from 4.6×105 to 0.9×105 CFU g-1 soil for v2; Figure 3A). Nonetheless, the
Trichoderma counts were high compared to those for untreated soil. These results
confirmed the findings of Smolińska et al. (2014), who have shown that addition of
conditions. Longa et al. (2009) monitored T. atroviride SC1 in field soil for more than
two years and observed good adaptation of the applied strain to the environment.
However, after two years the concentration of T. atroviride SC1 in soil was only 103 CFU
g-1.
18
In the present study, quantification of Trichoderma spp. with colony counting using
the dilution plating method was improved by molecular identification of fungal strains
(rep-PCR), and tef1 sequence analyses. Multiplex-PCR protocols allowed for fast and
atrobrunneum (Table 1). Rep-PCR was used for grouping strains, to select representatives
for tef1 sequencing, and for detailed identification. Thirteen indigenous Trichoderma spp.
(see Table 4) were identified in the experimental soil samples. The study also showed for
the first time that T. rossicum, T. brevicompactum, T. velutinum and T. cerinum inhabit
An interesting finding of our study is that the diversity of fungal species in the soil
v2 (Supplemental Tables S4 and S5). The species recovered from the amended soil
samples were identified mainly as T. atroviride and T. harzianum sensu stricto, i.e., these
were the ones added to the biopreparations. However, Trichoderma fungi tend to
overgrow on artificial media, thus determination of their numbers using plating can be
challenging. At the same time, isolation and quantification of fungi of the other
evaluate possible side effects. However, long-term monitoring of field-soil fungi after
increased over time, while the abundance of Trichoderma spp. decreased (data not
19
shown).
PCR-based methods. However, both techniques have their own inherent limitations. For
example, the dilution plating technique lacks strain or species specificity. It is not
rapidly growing organisms (Feng et al. 2011). Some fungal cells such as chlamydospores
are viable but nonculturable on agar medium (Baek et al. 1998). Also, a single hypha
contains several nuclei, but may not form more than a single colony (Weaver et al. 2005;
differences in DNA extraction efficiency for varied fungal structures, e.g., between spores
and mycelia (Fredricks et al. 2005). There is also no discrimination between DNA from
alive and dead cells in PCR (Carini et al. 2016), which may lead to an overestimation of
the live populations present in soil (Pujol et al. 2006). Conversely, inhibition of
The protocols developed in the present study allow for fast detection and monitoring
of T. atroviride and T. harzianum sensu stricto biocontrol strains TRS25, TRS43, TRS59,
and TRS85, after they were introduced into the soil environment. Combining classic
gives a fast and reliable procedure to identify fungal species composition in field soil.
20
Multiplex-PCR used with DNA obtained directly from soil samples can provide useful
estimates of the quantity of the applied beneficial fungi at detection levels ≥1×104
Trichoderma CFU per gram of dry soil. Progress in molecular biological techniques and
opportunities for further study of the soil microbiome. With new sequencing methods and
metagenomics approaches, quantification of all fungal species in soil may be possible and
thus provide precise information about microbial species interactions and population
ACKNOWLEDGEMENTS
The authors thank Dominik Skoneczny of the School of Agricultural and Wine Sciences,
Charles Sturt University, Australia for critical reading of the manuscript, and Olga
Medical Research Centre, Polish Academy of Sciences, Warsaw, Poland for help in
fluorometric DNA measurements. This work was conducted as part of the project “Polish
Trichoderma strains in plant protection and organic waste management” Priority 1.3.1,
subject area “Bio”, co-financed by the European Union through the European Regional
REFERENCES
Abbasi, P.A., Miller, S.A., Meulia, T., Hoitink, H.A., Kim, J.M., 1999. Precise detection
and tracing of Trichoderma hamatum 382 in compost-amended potting mixes by using
molecular markers. Applied and Environmental Microbiology 65, 5421-5426.
21
Aktar, M.W., Sengupta, D., Chowdhury, A., 2009. Impact of pesticides use in agriculture:
their benefits and hazards. Interdisciplinary Toxicology 2, 1-12.
Atanasova, L., Le Crom, S., Gruber, S., Coulpier, F., Seidl-Seiboth, V., Kubicek, C.P.,
Druzhinina, I.S., 2013. Comparative transcriptomics reveals different strategies of
Trichoderma mycoparasitism. BMC Genomics 14, 1.
Baek, J.M., Kenerley, C.M., 1998. Detection and enumeration of a genetically modified
fungus in soil environments by quantitative competitive polymerase chain reaction.
FEMS Microbiology Ecology 25, 419-428.
Bálint, M., Schmidt, P.A., Sharma, R., Thines, M., Schmitt, I., 2014. An Illumina
metabarcoding pipeline for fungi. Ecology and Evolution 4, 2642-2653.
Bhat, G., 2007. Cloning and functional characterization of endochitinase gene from
Trichoderma spp. Dissertation, University of Agricultural Sciences, Dharwad.
Błaszczyk, L., Siwulski, M., Sobieralski, K., Lisiecka, J., Jędryczka, M., 2014.
Trichoderma spp.–application and prospects for use in organic farming and industry.
Journal of Plant Protection Research 54, 309-317.
Bowen, J.K., Franicevic, S.C., Crowhurst, R.N., Templeton, M.D., Stewart, A., 1996.
Differentiation of a specific Trichoderma biological control agent by restriction fragment
length polymorphism (RFLP) analysis. New Zealand Journal of Crop and Horticultural
Science 24, 207-217.
Carini, P., Marsden, P.J., Leff, J.W., Morgan, E.E., Strickland, M.S., Fierer, N., 2016.
Relic DNA is abundant in soil and obscures estimates of soil microbial diversity. Nature
Microbiology 2, 16242.
Chaverri, P., Branco-Rocha, F., Jaklitsch, W., Gazis, R., Degenkolb, T., Samuels, G.J.,
2015. Systematics of the Trichoderma harzianum species complex and the
re-identification of commercial biocontrol strains. Mycologia 107, 558-590.
Chen, X., Romaine, C.P., Ospina-Giraldo, M.D., Royse, D.J., 1999. A polymerase chain
reaction-based test for the identification of Trichoderma harzianum biotypes 2 and 4,
responsible for the worldwide green mold epidemic in cultivated Agaricus bisporus.
Applied Microbiology and Biotechnology 52, 246-250.
Cordier, C., Edel-Hermann, V., Martin-Laurent, F., Blal, B., Steinberg, C., Alabouvette,
C., 2007. SCAR-based real time PCR to identify a biocontrol strain (T1) of Trichoderma
atroviride and study its population dynamics in soils. Journal of Microbiological Methods
68, 60-68.
Damalas, C.A., Eleftherohorinos, I.G., 2011. Pesticide Exposure, Safety Issues, and Risk
Assessment Indicators. International Journal of Environmental Research and Public
Health 8, 1402-1419.
Djonović, S., Vittone, G., Mendoza-Herrera, A., Kenerley, C.M., 2007. Enhanced
biocontrol activity of Trichoderma virens transformants constitutively coexpressing β‐1,
3‐and β‐1, 6‐glucanase genes. Molecular Plant Pathology 8, 469-480.
22
Dodd, S.L., Hill, R.A., Steward, A., 2004. Monitoring the survival and spread of the
biocontrol fungus Trichoderma atroviride (C65) on kiwifruit using a molecular marker.
Australasian Plant Pathology 33, 189-196.
Feng, X.M., Holmberg, A.I.J., Sundh, I., Ricard, T., Melin, P., 2011. Specific SCAR
markers and multiplex real-time PCR for quantification of two Trichoderma biocontrol
strains in environmental samples. Biocontrol 56, 903-913.
Fredricks, D.N., Smith, C., Meier, A., 2005. Comparison of six DNA extraction methods
for recovery of fungal DNA as assessed by quantitative PCR. Journal of Clinical
Microbiology 43, 5122-5128.
Friedl, M.A., Druzhinina, I.S., 2012. Taxon-specific metagenomics of Trichoderma
reveals a narrow community of opportunistic species that regulate each other’s
development. Microbiology 158, 69-83.
Geistlinger, J., Zwanzig, J., Heckendorff, S., Schellenberg, I., 2015. SSR Markers for
Trichoderma virens: their evaluation and application to identify and quantify
root-endophytic strains. Diversity 7, 360-384.
Hagn, A., Wallisch, S., Radl, V., Munch, J.C., Schloter, M., 2007. A new cultivation
independent approach to detect and monitor common Trichoderma species in soils.
Journal of Microbiological Methods 69, 86-92.
Harman, G.E., 2000. Myths and dogmas of biocontrol changes in perceptions derived
from research on Trichoderma harzinum T-22. Plant Disease 84, 377-393.
Harman, G.E., Howell, C.R., Viterbo, A., Chet, I., Lorito, M., 2004. Trichoderma
species-opportunistic, avirulent plant symbionts. Nature Reviews Microbiology 2, 43-56.
Harman, G.E., 2006. Overview of Mechanisms and Uses of Trichoderma spp.
Phytopathology 96. 190-194.
Hermosa, M.R., Grondona, I., Díaz-Mínguez, J.M., Iturriaga, E.A., Monte, E., 2001.
Development of a strain-specific SCAR marker for the detection of Trichoderma
atroviride 11, a biological control agent against soilborne fungal plant pathogens. Current
Genetics 38, 343-350.
Jansson, J.K., Prosser, J.I., 1997. Quantification of the presence and activity of specific
microorganisms in nature. Molecular Biotechnology 7, 103-120.
Kullnig-Gradinger, C.M,, Szakacs, G., Kubicek, C.P., 2002. Phylogeny and evolution of
the genus Trichoderma: a multigene approach. Mycological Research 106, 757-767.
Kuter, G.A., Nelson, E.B., Hoitink, H.A.J., Madden, L.V., 1983. Fungal populations in
container media amended with composted hardwood bark suppressive and conducive to
Rhizoctonia damping-off. Phytopathology 73, 1450-1456.
Longa, C.M.O., Savazzini, F., Tosi, S., Elad, Y., Pertot, I., 2009. Evaluating the survival
and environmental fate of the biocontrol agent Trichoderma atroviride SC1 in vineyards
in northern Italy. Journal of Applied Microbiology 106, 1549-1557.
23
López-Mondéjar, R., Antón, A., Raidl, S., Ros, M., Pascual, J.A., 2010. Quantification of
the biocontrol agent Trichoderma harzianum with real-time TaqMan PCR and its
potential extrapolation to the hyphal biomass. Bioresource Technology 101, 2888-2891.
Louws, F.J., Fulbright, D.W., Stephens, C.T., de Bruijn, F.J., 1994. Specific genomic
fingerprints of phytopathogenic Xanthomonas and Pseudomonas pathovars and strains
generated with repetitive sequences and PCR. Applied Environmental Microbiology 60,
2286-2295.
Lübeck, M., Jensen, D.F., 2002. Monitoring Trichoderma strains using dilution plating
and UP-PCR fingerprinting in glasshouses of nursery gardens that apply commercial
biocontrol agents. Biocontrol Science and Technology 12, 371-380.
Martin, J.P., 1950. Use of acid, rose bengal, and streptomycin in the plate method for
estimating soil fungi. Soil Science 69, 215-232.
Meincke, R., Weinert, N., Radl, V., Schloter, M., Smalla, K., Berg, G., 2010.
Development of a molecular approach to describe the composition of Trichoderma
communities. Journal of Microbiological Methods 80, 63-69.
Naeimi, S., Kocsubé, S., Antal, Z., Okhovvat, S., Javan-Nikkhah, M., Vágvölgyi, C.,
Kredics, L., 2011. Strain-specific SCAR markers for the detection of Trichoderma
harzianum AS12-2, a biological control agent against Rhizoctonia solani, the causal agent
of rice sheath blight. Acta Biologica Hungarica 62, 73-84.
Nelson, E.B., Kuter, G.A., Hoitink, H.A.J., 1983. Effects of fungal antagonists and
compost age on suppression of Rhizoctonia damping-off in container media amended
with composted hardwood bark. Phytopathology 73, 1457-1462.
Oskiera, M., Szczech, M., Bartoszewski, G., 2015. Molecular identification of
Trichoderma strains collected to develop plant growth-promoting and biocontrol agents.
Journal of Horticultural Research 23, 75-86.
Pujol, M., Badosa, E., Manceau, C., Montesinos, E., 2006. Assessment of the
environmental fate of the biological control agent of fire blight, Pseudomonas fluorescens
EPS62e, on apple by culture and real-time PCR methods. Applied and Environmental
Microbiology 72, 2421-2427.
Rademaker, J.L., de Bruijn, F.J., 1997. Characterization and classification of microbes by
rep-PCR genomic fingerprinting and computer assisted pattern analysis. DNA Markers:
Protocols, Applications and Overviews 1, 151-171.
Rubio, M.B., Hermosa, M.R., Keck, E., Monte, E., 2005. Specific PCR assays for the
detection and quantification of DNA from the biocontrol strain Trichoderma harzianum
2413 in soil. Microbial Ecology 49, 25-33.
Savazzini, F., Longa, C.M.O., Pertot, I., Gessler, C., 2008. Real-time PCR for detection
and quantification of the biocontrol agent Trichoderma atroviride strain SC1 in soil.
Journal of Microbiological Methods 73, 185-194.
Savazzini, F., Longa, C.M.O., Pertot, I., 2009. Impact of the biocontrol agent
24
Trichoderma atroviride SC1 on soil microbial communities of a vineyard in northern Italy.
Soil Biology Biochemistry 41, 1457-1465.
Skoneczny, D., Oskiera, M., Szczech, M., Bartoszewski, G., 2015. Genetic diversity of
Trichoderma atroviride strains collected in Poland and identification of loci useful in
detection of within-species diversity. Folia Microbiologica 60, 297-307.
Smolińska, U., Kowalska, B., Kowalczyk, W., Szczech, M., 2014. The use of
agro-industrial wastes as carriers of Trichoderma fungi in the parsley cultivation. Scientia
Horticulturae 179, 1-8.
Szczech, M., Staniaszek, M., Habdas, H., Uliński, Z., Szymański, J., 2008. Trichoderma
spp. – the cause of green mold on Polish mushroom farms. Vegetable Crops Research
Bulletin 69, 105-114.
Versalovic, J., Koeuth, T., Lupski, R., 1991. Distribution of repetitive DNA sequences in
eubacteria and application to finerpriting of bacterial genomes. Nucleic Acids Research
19, 6823-6831.
Weaver, M., Vedenyapina, E., Kenerley, C.M., 2005. Fitness, persistence, and
responsiveness of a genetically engineered strain of Trichoderma virens in soil
mesocosms. Applied Soil Ecology 29, 125-134.
25
FIGURE CAPTIONS
Figure 3. Trichoderma spp. monitoring in the soil in open-field lettuce cultivation based
on colony counting. Y axis - Trichoderma cfu x 104 with standard deviation (bars); X axis
- date and sampling time: bpa – before Trichoderma-preparation application, wpa –
weeks after preparation application. Time plot computed with ggplot2 (R package).
26
Table 1. Description of the markers used in this study.
Marker Targeted Amplicon size Annealing
Marker specificity Primer name Sequence [5`-3`] References
name gene/region [≈bp] temperature [‐]
A_tef1f GACTGTTCCAATACCACC
Tatef tef1 450 55 This study
A_tef1r CGCTTTTCCTCATTGATACT
A2_chi2f GAGTACCCCGCCGATAATA
Tachi chi18-5 320 60 This study
A2_chi1r GAAAGCTCGTCCGTAGATG
B07_1F ACCAACACGCATTGCCTGACT
TaB SCAR B07 730 64 This study
B07_1R TTCCTGTCAACGACGGTCCTC
Q01_3F AAGCAAGGGGGTTGGCAAGTA
T. atroviride 760 60 This study
Q01_3R GAGAAGGGGTTCCCTGCAGAA
TaQ SCAR Q01
Q01_4F GCACACCAACTGCTGGAGCTT
1017 64 Skoneczny et al. 2015
Q01_4R CACGCTGACAATGACCGACAC
X18_1F GACTAGGTGGTCACAGACGAAA
SCAR X18 630 64 This study
X18_3R GGAAACTCCATCACAAATCCA
TaX
X18_4F ATGCTGCCGGGATTAATCTAT
SCAR X18 750 64 This study
X18_3R GGAAACTCCATCACAAATCCA
QTh_8F CATGGAAACACAGACGGA
T. harzianum sensu stricto ThQ SCAR Q01 200 64 This study
QTh_3R AGATAGAGATGGAGAGAAAG
H2_chi_4F32 ATTGATATCGACTGGGAGTA
T. simmonsii Tschi chi18-5 380 60 This study
H2_chi_1r GGTGTTCTGGAATGATCT
T. harzianum sensu stricto, H2_tef_1f AACCGTTCCAATACCACC
Thstef tef1 700 64 This study
T. simmonsii H2_tef_1r TCCCAGCCATCATTCAAC
T. harzianum sensu stricto, QTh_5F GGGTTGTTCGGATGGAAG
ThsaQ SCAR Q01 2000 60 This study
T. simmonsii, T. atrobrunneum QTh_4R GTTGGAGATGGGAGGAAGA
T. harzianum sensu stricto, TVD_If CGTTGGTTCCCATTCAGCGCTTC
TVD chit46 1500 68 Bhat, 2007
T. atrobrunneum TVD_Ir TCCAAGAGCATTTCCCCGCAACA
β-tub-F GTTGGTTCTGCCTTCTGG
Tub β-tub 369 60 Chen et al. 1999
β-tub-R AACAGCTGGCCAAAGGGG
Trichoderma spp.
chit42_1af AGCWAGCACSGATGCCAAC Kullnig-Gradinger et
chit42 chi18-5 800 64
chit42_2ar AGGTTCTGAGTYGWGTCCA al. 2002
ITS2 and 5.8SR TCGATGAAGAACGCAGCG
Fungi ITS 1400 64 Vilgalys lab
LSU LR6 CGCCAGTTCTGCTTACC
27
Table 2. The best primer pair combinations and PCR cycling conditions used in
multiplex-PCR for T. atroviride and T. harzianum sensu stricto identification and
detection.
Annealing
Type of Species Multiplex Amplicon
temperature Primer pairs
application detection PCR name
[‐]
TaX X18_4F/X18_3R
T. atroviride
TaB B07_1F/B07_1R
T. atroviride CA1 64
Chit chit42_1af/chit42_2ar
clade A
ITS 5.8SR/LR6
ThQ QTh_8F/ QTh_3R
CH1 64
Tub Btub_F/Btub_R
Fungal cultures
Thstef H2_tef_1f/ H2_tef_1r
CH2 60
Tub Btub_F/Btub_R
T. harzianum
ThsaQ QTh_8F/ QTh_4R
CH3 60
Tub Btub_F/Btub_R
TVD TVD_If/TVD_Ir
CH4 60
Tub Btub_F/Btub_R
TaX X18_1F/X18_3R
SA1 64 Tachi chit42_1af/chit42_2ar
ITS 5.8SR/LR6
T. atroviride
TaQ Q01_3F/Q01_3R
SA2 64 chit42 chit42_1af/chit42_2ar
Soil samples
ITS 5.8SR/LR6
TVD TVD_If/ TVD_Ir
SH1 60
Tub Btub_F/ Btub_R
T. harzianum
ThQ QTh_5F/ QTh_4R
SH2 60
Tub Btub_F/ Btub_R
28
29
30
31
Highlights
32