DNA-based Computation

Abstract
Computing Science is in the middle of a major paradigm shift, driven by
Molecular Biology. Adleman by his breath-taking paper announced the arrival of
computers based on biochemical operations and has showed that a large class of
difficult and computationally hard problems is best solved not by pushing electrons
through wires in a computing laboratory, but by mixing solutions in test tubes in a
molecular biology laboratory. As the computationally hard problems are the
stumbling blocks for the contemporary Von Neumann computers, the DNA based
computation is poised to play a greater role in computing. This article discussed about
this novel idea of DNA based computation.

1. Introduction
Today's computers are millions of times more powerful than their crude
ancestors in the 40's and 50's. Almost every two years, computers have become twice
as fast whereas their components have assumed only half the space and however, it
has also been realized that integrated circuit-technology is running against its limits
and it has been a hotly debated question whether computers of an entirely new kind,
quantum-mechanical computers or computers based on Molecular Biology is in the
offing. One of the recently introduced unconventional paradigms, which promises to
have a tremendous influence on the theoretical and practical progress of computer
science is DNA computing, which under some circumstances might be an elegant
alternative to the classical Turing/Von Neumann notion of computing. It is sure that
the union of two of science's most fertile fields, molecular biology and computer
science is to produce some remarkable offsprings.

In 1994, Adleman invented a method for solving a small instance of a Directed

Hamiltonian Path (DHP) Problem by an in vitro DNA-recombination assay which he
performed experimentally using hybridization, several agarose-gel separations, and
PCR by handling DNA sequences in a test tube. Before discussing about this
experiment, here is an overview about DNA molecules, which make the way for this
sort of innovative computing model.

2. The Structure and manipulation of DNA

DNA (deoxyribonucleic acid) encodes the genetic information of cellular
organisms. It consists of polymer chains, commonly referred to as DNA strands. Each
strand may be viewed as a chain of nucleotides, or bases. An n-letter sequence of
consecutive bases is known as an n-mer or an oligonucleotide of length n. The four
DNA nucleotides are adenine, guanine, cytosine and thymine, commonly abbreviated
to A,G,C and T respectively.

Each strand has, according to chemical convention, a 5' and a 3' end, thus any
single strand has a natural orientation. The classical double helix of DNA is formed
when two separate strands bond together. Bonding occurs by the pairwise attraction of
bases; A bonds with T and G bonds with C. The pairs (A,T) and (G,C) are therefore
known as Watson-Crick complementary base pairs.

Thus a hypothetical DNA molecule sequence is

AACGCGTACGTACAAGTGTCCGAATGGCCAATG
TTGCGCATGCATGTTCACAGGCTTACCGGTTAC

3. Operations on DNA sequences

The following operations can be done on DNA sequences in a test tube to
program the DNA computer

Synthesis: synthesis of a desired strand

Separation: separation of strands by length
Merging: pour two test tubes into one to perform union
Extraction: extract those strands containing a given pattern
Melting/Annealing: break/bond two single strand DNA molecules with
complementary sequences.
Amplification: use PCR to make copies of DNA strands
Cutting: cut DNA with restriction enzymes
Ligation: Ligate DNA strands with complementary sticky ends using ligase.
Detection: Confirm presence/absence of DNA in a given test tube.

The Hamiltonian Path Problem(HPP) may be phrased as follows: given a set of

n cities connected by one-way and two-way roads, does there exist a path through this
network starting at the first city and ending at the last city such that each city is visited
once and only once?.

The problem is deceptively easy to describe, but in fact belongs to the notoriously
intractable class of NP-complete problems, which signifies the class of problems
solvable in Nondeterministic Polynomial(NP) time. Typically, these problems involve
a search where at each point in the search there is an exponential increase in the
number of possibilities to be searched through, but where each possibility can be
searched through polynomial time.

Consider a map with five cities linked by one-way and two-way roads.
Adleman's approach was to encode each city and each route between two cities in
DNA strands, put into a test tube.

For example, the strand coding for cities 1 and 2 could be AATGCCGG,
TTTAAGCC respectively. A road from city 1 to 2 is encoded in such a way that the
first part is the complementary strand to the second half of strand for city 1, and the
second part is the complementary strand to the first half of the strand for city 2, i.e.
GGCCAAAT.

That is, GGCC is the complementary version of the last four bases of city 1,
and AAAT is the complementary version of the first four bases of city 2. Thus the
edge joining the cities 1 and 2 is being encoded as follows.

GGCCAAAT
AATGCCGGTTTAAGCC

Similarly the DNA molecules strands can be formed for all the nodes and edges
representing all possible routes in the directed graph in the test tube. The first stage of
Adleman's computation was to extract those long strands which start with city 1 and
store these in a separate test tube.

The second stage was to extract those strands which corresponded to a certain
length which signified exactly 5 cities being passed through. If each city is
represented by 8 DNA bases, all strands of 40 bases would be extracted and stored in
a separate test tube.

The third stage is to extract all those strands containing the DNA sequence for
city 1, then those containing the DNA sequence for city 2, and so on. If there is a
solution to this route problem, it will be found in the strands extracted for the last city
5.

4. The case for DNA computing

The possible advantages of DNA-based computer architecture became
immediately apparent:

Computing with DNA offers the advantage of massive degrees of

miniaturization and parallelism over conventional silicon-based machines. For
example, a square centimeter of silicon can currently support around a million
transistors, whereas current manipulation techniques can handle to the order of 1020
strands of DNA.

Size: the information density could go up to 1 bit/nm3.

High parallelism: every molecule could act as a small processor on nano-scale
and the number of such processors per volume would be potentially enormous.
In an in vitro assay we could handle easily with about 1018 processors working
in parallel.
Speed: although the elementary operations(electrophoretic separation, ligation,
PCR-amplifications) would be slow compared to electronic computers, their
parallelism would strongly prevail, so that in certain models the number of
operations per second could be of order 1018 operations per second, which is at
least 100,000 times faster than the fastest supercomputers existing today.
Energy efficiency: 1019 operations per Joule. This is about a billion times more
energy efficient than today's electronic devices.

The research in this field had both experimental and theoretical aspects. The
experiments that have actually been carried out are not numerous so far. P.Kaplan
replicated Adleman's experiment, a Wisconsin team of computer scientists and
biochemists made a partial progress in solving a 5-variable instance of SAT problem,
an another NP-complete problem, by using a surface-based approach. F.Guarnieri and
his team have used a horizontal chain-reaction for DNA-based addition.

Also, various aspects of the implementability of DNA computing have been

experimentally investigated: the effect of good encodings on the solutions of
Adleman's problem were addressed; the complications raised by using the Polymerase
Chain Reaction (PCR) were studied; the usability of self-assembly of DNA was
studied; the experimental gap between the design and assembly of unusual DNA
structures was pointed out; joining and rotating data with molecules was reported;
concatenation with PCR was studied; evaluating simple Boolean formulas was started;
ligation experiments in computing with DNA were conducted.

The theoretical work on DNA computing consists, on one side, of designing

potential experiments for solving various problems by means of DNA manipulation.
Descriptions of such experiments include the Satisfiability Problem, breaking the Data
Encryption Standard (DES), expansions of symbolic determinants, matrix
multiplication, graph connectivity and knapsack problem using dynamic
programming, road coloring problem, exascale computer algebra problems, and
simple Horn clause computation.
 On the other side, the theoretical research on DNA computing comprises
attempts to model the process in general, and to give it a mathematical foundation. To
this aim, models of DNA computing have been proposed and studied from the point
of view of their computational power and their in-vitro feasibility. Some of them are
given below.

5. Models and Formats of DNA Computation

In the two years that followed, a lot of theoretical work has been done on
generalizing Adleman's approach in order to define a general-purpose DNA-based
molecular computer that could also be implemented by an in vitro system. Lipton
generalized Adleman's model and showed how his model can encompass solutions to
other NP-complete problems. The other model is by splicing operation proposed by
Head and vigrously followed by many researchers using formal language theory. It is
shown that the generative power of finite extended splicing systems is equal to that of
Turing Machines. Afterwords, Paun and others introduced the so-called sticker model.
Unlike previous models, the sticker mode has a memory that can both read and
written to, and employs reusable DNA. Also there is a proposal about the tendency of
DNA structures to self-assemble as a computational tool. They show that the self-
assembly of complex branches known as double cross-overs into two-dimensional
sheets or three-dimensional solids is a computationally powerful model.

However, there are some impediments to effective computation by these

models. It is a common feature of all the proposed implementations that the biological
operations to be used are assumed to be error-free. An operation central to and
frequently employed in most models is the extraction of DNA strands containing a
certain sequence (known as removal by DNA hybridization). The most important
problem with this method is that extraction is not 100% efficient and may at times
inadvertently remove strands that do not contain the specified sequence. Especially for
a large problem, the number of extractions required may run into hundreds, or even
thousands resulting a high probability of incorrect hybridization.

Thus, a novel error-resistant model of DNA computation has been proposed by

Alan Gibbons and his team that obviates the need for hybridization extraction within
the main body of the computation.

Like previous models, this model is particularly effective for algorithmic

description. It is sufficiently strong to solve any of the problems in the class NC and
the authors have given DNA algorithms for 3-vertex-colorability problem,
Permutations Problem, Hamiltonian Path Problem, the Subgraph isomorphism
problem, and the Maximum clique and maximum independent set problem.
 There are two general formats in which complex combinatorial sets of DNA
molecules may be manipulated.

• in solution ( solution-phase format)

• attached to a surface (solid-phase format)

The solid-phase format possesses many important advantages over the

solution-phase format.

 Facilitated sample handling. With the DNA molecules attached to a

support, the experimental manipulations are very simple. They are addition of a
solution to the support and removal (washing) to a solution from the support.
These steps are readily automated.
 Decreased losses during sample handling
 Reduction of interference between oligonucleotides
 Solid-phase chemistry permits facile purification of the DNA molecules
at every step of the process.

6. Pitfalls of DNA Computing

The idea of using DNA to solve computational problems is certainly intriguing
and elegant, and DNA does provide a massive parallelism far beyond what is
available on existing silicon-based computers. However, there are many technological
hurdles to overcome. We give below one of the huge fundamental problem to be
solved to attain the goal of designing universally programmable molecular computer.

The fundamental problem is that, the function of 2n is exponential whether it

counts time or molecules. It has been estimated that Adleman's Hamiltonian path
problem, if enhanced to 50 or 100 cities, would require tons of DNA. The minimum
amount of required DNA for Lipton's SAT method needs a few grams of DNA
molecules for 70 variables. If this is increased to 100 variables, the minimum DNA
requirement of millions of kilograms.

Thus raw idea of brute-force enumeration is not going to work beyond modest
problem sizes. Thus it is imperative to bring forth new revolutionary ideas to make
this notion of DNA-based computing to work realistically. Only time and investment
will tell where the initial ideas for DNA computing from those experts will lead.
Many enhancive ideas have been published but all of them suffer under this
fundamental problem. Hopefully the future molecular computation methods may
bring forth new revolutionary ideas to overcome this very fundamental as well as
significant hurdle
7. The future of DNA Computing
The significance of this research is two-fold: it is the first demonstrable use of
DNA molecules for representing information, and also the first attempt to deal with an
NP-complete problem. But still much more work needs to be done to develop error-
resistant and scalable laboratory computations. Designing experiments that are likely
to be successful in the laboratory and algorithms that proceed through polynomial-
sized volumes of DNA is the need of the hour. It is unlikely that DNA computers will
be used for tasks like word processing, but they may ultimately find a niche market
for solving large-scale intractable combinatorial problems. The goal of automating,
miniaturizing and integrating them into a general-purpose desktop DNA computer
may take much longer time.

DNA computing
From Wikipedia, the free encyclopedia

Jump to: navigation, search

DNA computing is a form of computing which uses DNA, biochemistry and molecular
biology, instead of the traditional silicon-based computer technologies. DNA computing, or,
more generally, biomolecular computing, is a fast developing interdisciplinary area. Research
and development in this area concerns theory, experiments and applications of DNA computing.

History

This field was initially developed by Leonard Adleman of the University of Southern
California, in 1994.[1] Adleman demonstrated a proof-of-concept use of DNA as a form of
computation which solved the seven-point Hamiltonian path problem. Since the initial Adleman
experiments, advances have been made and various Turing machines have been proven to be
constructible.[2] [3]

In 2002, researchers from the Weizmann Institute of Science in Rehovot, Israel, unveiled
a programmable molecular computing machine composed of enzymes and DNA molecules
instead of silicon microchips.[4] On April 28, 2004, Ehud Shapiro, Yaakov Benenson, Binyamin
Gil, Uri Ben-Dor, and Rivka Adar at the Weizmann Institute announced in the journal Nature
that they had constructed a DNA computer coupled with an input and output module which
would theoretically be capable of diagnosing cancerous activity within a cell, and releasing an
anti-cancer drug upon diagnosis. [5]

In 2009, biocomputing systems were coupled with standard silicon based chips for the
first time. In this experiment, an enzyme based OR-Reset/AND-Reset logic system was achieved
using field-effect Silicon chips. This advancement could yield great potential in the fields of
Synthetic Biology, and Biomedical Engineering, as it marks the integration of biological and
electro-mechanical systems on a sub-cellular level. [6]

[edit] Capabilities

DNA computing is fundamentally similar to parallel computing in that it takes advantage

of the many different molecules of DNA to try many different possibilities at once.[7]

DNA computing also offers much lower power consumption than traditional silicon
computers. DNA uses adenosine triphosphate (ATP) as fuel to allow ligation or as a means to
heat the strand to cause disassociation.[8] Both strand hybridization and the hydrolysis of the
DNA backbone can occur spontaneously, powered by the potential energy stored in DNA.
Consumption of two ATP molecules releases 1.5 x 10−19 J. Even with a large number of
transitions per second using two ATP molecules, power output is still low. For instance, Kahan
reports 109 transitions per second with an energy consumption of 10−10 W,[9] and similarly
Shapiro reports a system producing 7.5 x 1011 outputs in 4000 sec resulting in an energy
consumption rate of ~ 10−10 W.[10]

For certain specialized problems, DNA computers are faster and smaller than any other
computer built so far. Furthermore, particular mathematical computations have been
demonstrated to work on a DNA computer. As an example, Aran Nayebi[11] has provided a
general scalable implementation of Strassen's matrix multiplication algorithm on a DNA
computer.

But DNA computing does not provide any new capabilities from the standpoint of
computability theory, the study of which problems are computationally solvable using different
models of computation. For example, if the space required for the solution of a problem grows
exponentially with the size of the problem (EXPSPACE problems) on von Neumann machines, it
still grows exponentially with the size of the problem on DNA machines. For very large
EXPSPACE problems, the amount of DNA required is too large to be practical. (Quantum
computing, on the other hand, does provide some interesting new capabilities.)

DNA computing overlaps with, but is distinct from, DNA nanotechnology. The latter
uses the specificity of Watson-Crick basepairing and other DNA properties to make novel
structures out of DNA. These structures can be used for DNA computing, but they do not have to
be. Additionally, DNA computing can be done without using the types of molecules made
possible by DNA nanotechnology.

[edit] Methods

There are multiple methods for building a computing device based on DNA, each with its
own advantages and disadvantages. Most of these build the basic logic gates (AND, OR, NOT)
associated with digital logic from a DNA basis. Some of the different bases include DNAzymes,
deoxyoligonucleotides, enzymes, DNA tiling, and polymerase chain reaction.
[edit] DNAzymes

Catalytic DNA (deoxyribozyme or DNAzyme) catalyze a reaction when interacting with

the appropriate input, such as a matching oligonucleotide. These DNAzymes are used to build
logic gates analogous to digital logic in silicon; however, DNAzymes are limited to 1-, 2-, and 3-
input gates with no current implementation for evaluating statements in series.

The DNAzyme logic gate changes its structure when it binds to a matching
oligonucleotide and the fluorogenic substrate it is bonded to is cleaved free. While other
materials can be used, most models use a fluorescence-based substrate because it is very easy to
detect, even at the single molecule limit.[12] The amount of fluorescence can then be measured to
tell whether or not a reaction took place. The DNAzyme that changes is then “used,” and cannot
initiate any more reactions. Because of this, these reactions take place in a device such as a
continuous stirred-tank reactor, where old product is removed and new molecules added.

Two commonly used DNAzymes are named E6 and 8-17. These are popular because
they allow cleaving of a substrate in any arbitrary location.[13] Stojanovic and MacDonald have
used the E6 DNAzymes to build the MAYA I[14] and MAYA II[15] machines, respectively;
Stojanovic has also demonstrated logic gates using the 8-17 DNAzyme.[16] While these
DNAzymes have been demonstrated to be useful for constructing logic gates, they are limited by
the need for a metal cofactor to function, such as Zn2+ or Mn2+, and thus are not useful in vivo.[12]
[17]

A design called a stem loop, consisting of a single strand of DNA which has a loop at an
end, are a dynamic structure that opens and closes when a piece of DNA bonds to the loop part.
This effect has been exploited to create several logic gates. These logic gates have been used to
create the computers MAYA I and MAYA II which can play tic-tac-toe to some extent.[18]

[edit] Enzymes

Enzyme based DNA computers are usually of the form of a simple Turing machine; there
is analogous hardware, in the form of an enzyme, and software, in the form of DNA.[19]

Shapiro has demonstrated a DNA computer using the FokI enzyme[10] and expanded on
his work by going on to show automata that diagnose and react to prostate cancer: under
expression of the genes PPAP2B and GSTP1 and an over expression of PIM1 and HPN.[5] His
automata evaluated the expression of each gene, one gene at a time, and on positive diagnosis
then released a single strand DNA molecule (ssDNA) that is an antisense for MDM2. MDM2 is
a repressor of protein 53, which itself is a tumor suppressor.[20] On negative diagnosis it was
decided to release a suppressor of the positive diagnosis drug instead of doing nothing. A
limitation of this implementation is that two separate automata are required, one to administer
each drug. The entire process of evaluation until drug release took around an hour to complete.
This method also requires transition molecules as well as the FokI enzyme to be present. The
requirement for the FokI enzyme limits application in vivo, at least for use in “cells of higher
organisms”.[9] It should also be pointed out that the 'software' molecules can be reused in this
case.
[edit] Toehold exchange

DNA computers have also been constructed using the concept of toehold exchange. In
this system, an input DNA strand binds to a sticky end, or toehold, on another DNA molecule,
which allows it to displace another strand segment from the molecule. This allows the creation of
modular logic components such as AND, OR, and NOT gates and signal amplifiers, which can
be linked into arbitrarily large computers. This class of DNA computers does not require
enzymes or any chemical capability of the DNA.[21]

[edit] Algorithmic self-assembly

DNA arrays that display a representation of the Sierpinski gasket on their surfaces.
Click the image for further details. Image from Rothemund et al., 2004.[22]

Main article: DNA nanotechnology: Algorithmic self-assembly

DNA nanotechnology has been applied to the related field of DNA computing. DNA tiles
can be designed to contain multiple sticky ends with sequences chosen so that they act as Wang
tiles. A DX array has been demonstrated whose assembly encodes an XOR operation; this allows
the DNA array to implement a cellular automaton which generates a fractal called the Sierpinski
gasket. This shows that computation can be incorporated into the assembly of DNA arrays,
increasing its scope beyond simple periodic arrays.[22]

ARTICLE
Even as you read this article, computer chip manufacturers are furiously racing to
make the next microprocessor that will topple speed records. Sooner or later,
though, this competition is bound to hit a wall. Microprocessors made of silicon will
eventually reach their limits of speed and miniaturization. Chip makers need a new
material to produce faster computing speeds.

You won't believe where scientists have found the new material they need to build the next
generation of microprocessors. Millions of natural supercomputers exist inside living organisms,
including your body. DNA (deoxyribonucleic acid) molecules, the material our genes are made
of, have the potential to perform calculations many times faster than the world's most powerful
human-built computers. DNA might one day be integrated into a computer chip to create a so-
called biochip that will push computers even faster. DNA molecules have already been harnessed
to perform complex mathematical problems.

While still in their infancy, DNA computers will be capable of storing billions of times more
data than your personal computer. In this article, you'll learn how scientists are using genetic
material to create nano-computers that might take the place of silicon-based computers in the
next decade.

DNA Computing Technology

DNA computers can't be found at your local electronics store yet. The technology is still
in development, and didn't even exist as a concept a decade ago. In 1994, Leonard Adleman
introduced the idea of using DNA to solve complex mathematical problems. Adleman, a
computer scientist at the University of Southern California, came to the conclusion that DNA
had computational potential after reading the book "Molecular Biology of the Gene," written by
James Watson, who co-discovered the structure of DNA in 1953. In fact, DNA is very similar to
a computer hard drive in how it stores permanent information about your genes.

Adleman is often called the inventor of DNA computers. His article in a 1994 issue of the
journal Science outlined how to use DNA to solve a well-known mathematical problem, called
the directed Hamilton Path problem, also known as the "traveling salesman" problem. The
goal of the problem is to find the shortest route between a number of cities, going through each
city only once. As you add more cities to the problem, the problem becomes more difficult.
Adleman chose to find the shortest route between seven cities.

You could probably draw this problem out on paper and come to a solution faster than
Adleman did using his DNA test-tube computer. Here are the steps taken in the Adleman DNA
computer experiment:

1. Strands of DNA represent the seven cities. In genes, genetic coding is

represented by the letters A, T, C and G. Some sequence of these four letters
represented each city and possible flight path.
 2. These molecules are then mixed in a test tube, with some of these DNA
strands sticking together. A chain of these strands represents a possible
answer.
3. Within a few seconds, all of the possible combinations of DNA strands, which
represent answers, are created in the test tube.
4. Adleman eliminates the wrong molecules through chemical reactions, which
leaves behind only the flight paths that connect all seven cities.

Surpassing Silicon?

Although DNA computers haven't overtaken silicon-based microprocessors, researchers have made some
progress in using genetic code for computation. In 2003, Israeli scientists demonstrated a limited, but
functioning, DNA computer. You can read more about it at National Geographic.

The success of the Adleman DNA computer proves that DNA can be used to calculate
complex mathematical problems. However, this early DNA computer is far from challenging
silicon-based computers in terms of speed. The Adleman DNA computer created a group of
possible answers very quickly, but it took days for Adleman to narrow down the possibilities.
Another drawback of his DNA computer is that it requires human assistance. The goal of the
DNA computing field is to create a device that can work independent of human involvement.

Three years after Adleman's experiment, researchers at the University of Rochester

developed logic gates made of DNA. Logic gates are a vital part of how your computer carries
out functions that you command it to do. These gates convert binary code moving through the
computer into a series of signals that the computer uses to perform operations. Currently, logic
gates interpret input signals from silicon transistors, and convert those signals into an output
signal that allows the computer to perform complex functions.

The Rochester team's DNA logic gates are the first step toward creating a computer that
has a structure similar to that of an electronic PC. Instead of using electrical signals to perform
logical operations, these DNA logic gates rely on DNA code. They detect fragments of genetic
material as input, splice together these fragments and form a single output. For instance, a
genetic gate called the "And gate" links two DNA inputs by chemically binding them so they're
locked in an end-to-end structure, similar to the way two Legos might be fastened by a third
Lego between them. The researchers believe that these logic gates might be combined with DNA
microchips to create a breakthrough in DNA computing.

DNA computer components -- logic gates and biochips -- will take years to develop into
a practical, workable DNA computer. If such a computer is ever built, scientists say that it will
be more compact, accurate and efficient than conventional computers. In the next section, we'll
look at how DNA computers could surpass their silicon-based predecessors, and what tasks these
computers would perform.
Silicon vs. DNA Microprocessors

Silicon microprocessors have been the heart of the computing world for more than 40
years. In that time, manufacturers have crammed more and more electronic devices onto their
microprocessors. In accordance with Moore's Law, the number of electronic devices put on a
microprocessor has doubled every 18 months. Moore's Law is named after Intel founder Gordon
Moore, who predicted in 1965 that microprocessors would double in complexity every two
years. Many have predicted that Moore's Law will soon reach its end, because of the physical
speed and miniaturization limitations of silicon microprocessors.

DNA computers have the potential to take computing to new levels, picking up where
Moore's Law leaves off. There are several advantages to using DNA instead of silicon:

• As long as there are cellular organisms, there will always be a supply of DNA.
• The large supply of DNA makes it a cheap resource.
• Unlike the toxic materials used to make traditional microprocessors, DNA
biochips can be made cleanly.
• DNA computers are many times smaller than today's computers.

DNA's key advantage is that it will make computers smaller than any computer that has
come before them, while at the same time holding more data. One pound of DNA has the
capacity to store more information than all the electronic computers ever built; and the
computing power of a teardrop-sized DNA computer, using the DNA logic gates, will be more
powerful than the world's most powerful supercomputer. More than 10 trillion DNA molecules
can fit into an area no larger than 1 cubic centimeter (0.06 cubic inches). With this small amount
of DNA, a computer would be able to hold 10 terabytes of data, and perform 10 trillion
calculations at a time. By adding more DNA, more calculations could be performed.

Unlike conventional computers, DNA computers perform calculations parallel to other

calculations. Conventional computers operate linearly, taking on tasks one at a time. It is parallel
computing that allows DNA to solve complex mathematical problems in hours, whereas it might
take electrical computers hundreds of years to complete them.

The first DNA computers are unlikely to feature word processing, e-mailing and solitaire
programs. Instead, their powerful computing power will be used by national governments for
cracking secret codes, or by airlines wanting to map more efficient routes. Studying DNA
computers may also lead us to a better understanding of a more complex computer -- the human
brain.

Enter your search terms Submit search

Search
form
 We www.seminartopics-
b sinil.blogspot.com

DNA Based Computing

Biological and mathematical operations have some
similarities, despite their respective complexities:

1. The very complex structure of a living being is the

result of applying simple operations to initial
information encoded in a DNA sequence;

2. The result f(w) of applying a computable function to

an argument w can be obtained by applying a
combination of basic simple functions to w.

For the same reasons that DNA was presumably selected

for living organisms as a genetic material, its stability and
predictability in reactions, DNA strings can also be used
to encode information for mathematical systems.

To solve the Hamiltonian Path problem, the objective is

to find a path from start to end going through all the points
only once. This problem is difficult for conventional
computers to solve because it is a 'non-deterministic
polynomial time problem' (NP). NP problems are intractable
with deterministic (conventional/serial) computers, but can
be solved using non-deterministic (massively parallel)
computers. A DNA computer is a type of non-deterministic
computer. Dr. Leonard Adleman (1994) was struck with the
idea of using sequences of stored nucleotides (Adenine (A),
Guanine (G), Cytosine (C), Thymine (T)) in molecules of
DNA to store computer instructions and data in place of the
sequences of electrical, magnetic or optical on-off states
(0, 1 – Boolean Logic) used in today’s computers.
The Hamiltonian Path problem was chosen because it is
known as 'NP-complete'; every NP problem can be reduced
to a Hamiltonian Path problem.

The following algorithm solves the Hamiltonian Path

problem:

1. Generate random paths through the graph.

2. Keep only those paths that begin with the start city
(A) and conclude with the end city (G).

3. If the graph has n cities, keep only those paths with n

cities. (n = 7)
 4. Keep only those paths that enter all cities at least
once.

5. Any remaining paths are solutions.

Unrestricted model of DNA computing is the key to

solve the problem in five steps in the above algorithm.
These operations can be used to 'program' a DNA
computer.

o Synthesis of a desired strand

o Separation of strands by length

o Merging: pour two test tubes into one to perform

union

o Extraction: extract those strands containing a

given pattern

o Melting/Annealing: break/bond two ssDNA

molecules with complementary sequences

o Amplification: use PCR to make copies of DNA

strands

o Cutting: cut DNA with restriction enzymes

 o Ligation: Ligate DNA strands with complementary
sticky ends using ligase

o Detection: Confirm presence/absence of DNA in a

given test tube

Since Adleman's original experiment, several methods to

reduce error and improve efficiency have been developed.
The Restricted model of DNA computing solves several
physical problems with the Unrestricted model. The
Restricted model simplifies the physical obstructions in
exchange for some additional logical considerations. The
purpose of this restructuring is to simplify biochemical
operations and reduce the errors due to physical
obstructions.

The Restricted model of DNA computing:

o Separate: isolate a subset of DNA from a sample

o Merging: pour two test tubes into one to perform

union

o Detection: Confirm presence/absence of DNA in a

given test tube
 Despite these restrictions, this model can still solve
NP-complete problems such as the 3-colourability problem,
which decides if a map can be coloured with three colours
in such a way that no two adjacent territories have the
same colour. Error control is achieved mainly through
logical operations, such as running all DNA samples
showing positive results a second time to reduce false
positives. Some molecular proposals, such as using DNA
with a peptide backbone for stability, have also been
recommended.

DNA computing brings great optimism to revolutionize the

computer industry in the use of molecules of DNA in a
computer, in place of electronics, circuits and magnetic or
optical storage media. Obviously, to perform one
calculation at a time (serial logic), DNA computers are not
a viable option. However, if one wanted to perform many
calculations simultaneously (parallel logic), a computer
such as the one described above can easily perform 1014
million instructions per second (MIPS). DNA computers also
require less energy and space. In DNA computers data are
entered and coded into DNA by chemical reactions and
retrieved by synthesizing a key data and make them react
with existing strands. Here the key DNA will stick to the
required DNA strands containing data.

In short, in a DNA computer, the input and output are both

strands of DNA. Furthermore, a computer in which the
strands are attached to the surface of a chip (DNA chip)
can now solve difficult problems quite quickly