Talanta 197 (2019) 444–450

Contents lists available at ScienceDirect

Talanta
journal homepage: www.elsevier.com/locate/talanta

An fluorescent aptasensor for sensitive detection of tumor marker based on the

FRET of a sandwich structured QDs-AFP-AuNPs
a,b,1 ⁎
Lu Zhou , Feihong Jic,1, Tao Zhangd, Feng Wangb, Yuchuan Lia, Zhixin Yua, Xiaoping Jinb, , Bing
a,⁎
Ruan
a
State Key Laboratory for Diagnosis and Infectious Diseases, The First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou 310003, Zhejiang, China
b
Department of Neurology, Affiliated Taizhou Hospital of Wenzhou Medical University, Taizhou 317000, China
c
Department of Gastroenterology, The First Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou 310003, China
d
Department of Medicine, Suzhou Genhouse Pharmaceutical Co., Ltd, Suzhou, Jiangsu, China

ARTICLE INFO ABSTRACT

Keywords: The detection of alpha-fetoprotein (AFP) is of great importance for hepatocellular carcinoma (HCC) diagnosis, but it needs
to be further improved because of poor sensitivity and complicated operating steps. In this paper, a simple and sensitive
Alpha fetoprotein (AFP) homogeneous apatasensor for AFP has been developed based on Förster resonance energy transfer (FRET) where the AFP
Förster resonance energy transfer (FRET) aptamer labeled luminescent CdTe quantum dots (QDs) as a donor and anti-AFP antibody functional gold nanoparticles
(AuNPs) as an acceptor. In the presence of AFP, the bio-affinity between aptamer, target, and antibody made the QDs
Fluorescent aptasensor and AuNPs close enough, thus the fluorescence of CdTe QDs quenched though the FRET between QD and AuNP. The
Hepatocellular carcinoma fluorescent aptasensor for AFP showed a concentration- dependent decrease of fluorescence intensity in the low
nanomolar range and a detecting linear range of
Biomarker 0.5–45 ng mL−1, with a detection limit of 400 pg mL−1. Moreover, this homogeneous aptasensor is simple and reliable, and
obtained satisfying results for the detection of AFP in human serum samples. With more and more aptamers for biomarkers
have been selected gradually, this approach could be easily extended to detection of a wide range of biomarkers. The
proposed aptasensor has great potential for carcinoma screening in point-of-care testing and even in field use.

1. Introduction
Hepatocellular carcinoma (HCC) is one of the major malignant
diseases with high morbidity and mortality, and seriously endangers human
lives and health all over the world [1]. Early detection of HCC can significantly
improve patient diagnosis and outcome and alleviate their suffering [2,3].
However, available techniques such as imaging and histology methods can
only work at the late stage of HCC [4]. Detection of serological tumor
biomarkers was a powerful therapeutic method to allow accurate diagnosis
of cancers and post-operative management [5]. Thus, analysis of the most
commonly used serological protein biomarker alpha-fetoprotein (AFP) has
attracted great attention [6]. So far, several methods can be used for AFP
analysis, for instance enzyme-linked immunoassay, affinity chromatography,
affinity im- printing [7–9], however, most of them show many shortcomings
in clinical practice, such as need sophisticated instruments, complex op-
erating steps, and low sensitivity, etc. Therefore, a simple, sensitive, and
easily operated method for the detection of AFP is highly required for
HCC diagnosis.
Recently, biosensors based on energy transfer in nanoscale donor-
acceptor associated with specific molecular recognition events have
been attracted much attention in DNA hybridization and protein in-
teraction study, and have been used for quantitative analysis of protein
biomarkers as well. Nonradiative energy transfer from an excited donor
to an acceptor molecule by a long-range dipole-dipole interaction is
well known as Förster resonance energy transfer (FRET) [10]. An ap-
preciable spectral overlap and separation distance between the donor
and acceptor are paramount to high FRET efficiency. Quantum dots
(QDs) have become the most used energy donor instead of traditional
organic dye molecules because of their unique attractive features such
as high quantum yields, excellent photo and chemical stability, size-
dependent, broad absorption with large molar extinction coefficients,
and narrow symmetric emission spectra [11,12]. Especially, some FRET
systems between QDs and dyes have been designed for immunoassay

⁎
Corresponding authors.
E-mail addresses: jinxp@enzemed.com (X. Jin), ruanbing@zju.edu.cn (B. Ruan).
1
these authors contributed equally to this study.
https://doi.org/10.1016/j.talanta.2019.01.012
Received 7 September 2018; Received in revised form 22 December 2018; Accepted 2 January 2019
Available online 03 January 2019
0039-9140/ © 2019 Published by Elsevier B.V.
L. Zhou et al.
[13]. For example, the FRET process from dyes to QDs was observed after
addition of FITC labeled goat anti-human IgG to human IgG CdSe/ ZnS QDs
[14]. The bioaffinity between antigen and antibody could also make two kinds
of QDs close enough to initiate FRET. For example, a high-sensitive QDs-
based FRET immunoassay has been developed by using mouse IgG
conjugated 532 nm-emitting CdTe QDs as the donor and goat anti-mouse IgG
conjugated 632 nm-emitting CdSe/ZnS QDs as the acceptor [15]. In another
hand, gold nanoparticles (AuNPs) have been widely used as the efficient
energy acceptors to substitute for organic dyes in the QDs-based energy
transfer study [16–18]. As a re- presentative of semiconductor-nanometal
system, QDs-AuNPs pair has been used to assemble specific
immunosensors based on long-range signal quenching of QDs. In a preliminary
scheme, Kim and co-workers demonstrated that mixing streptavidin-QDs with
biotinylated AuNPs resulted in efficient quenching of QDs’ PL due to the
formation of QDs- AuNPs conjugate pairs. The quenching efficiency was
more effective than that measured with dye acceptors in the same construct
[19]. They further developed an inhibition assay to detect protein
glycosylation based on rate changes of energy transfer between
carbohydrate-con- jugated QDs and lectin-conjugated AuNPs [20].
Aptamers, which are short structured, single-stranded DNA or RNA
evolved by an in vitro process known as SELEX (systematic evolution of ligands
by exponential enrichment) [21,22], have become attractive alternatives as
molecular affinities. Apart from the considerate affinity and specificity as
traditional antibodies, aptamers also have other ad- vantages, such as low
cost, ease of synthesis and modification, rela- tively low molecular weight,
low immunogenicity, long-term stability, reversible denaturation, rapid tissue
penetration, and low variability between different batches, etc [23–26]. Due
to their considerable ad- vantages as biorecognition elements, aptamers
provide a feasible al- ternative in designing numerous types of biosensing
platforms in a variety of fields such as analytical chemistry, biochemistry,
and de- tection science. Some aptamers for AFP have been selected [27–29],
for example, Lee et al. have selected a DNA aptamer for AFP with high
specific binding ability, which has been used to design biosensors for AFP
detection [27].
In this paper, in order to detect AFP more sensitively and simpler,
we developed a fluorescent aptasensor based-on FRET between QDs-
AuNPs conjugate pairs through the bio-affinity of aptamer-AFP-anti-
body. Specifically, the AFP aptamer was covalently conjugated with the
donor CdTe QDs, which were coated on the surface of monodispersed
SiO2 nanospheres to avoid particle agglutination and enhance sensi-
tivity, while the anti-AFP monoclonal antibody was coupled on 13 nm
AuNPs. When the functionalized QDs and AuNPs were incubated with
AFP, the specific binding of aptamer-AFP-antibody made the QDs and
AuNPs close enough to initiate FRET. The PL properties associated with
the target concentration in our system could be easily transformed into
fluorometric variation and monitored by a home-made image analysis
software. The advantages, such as simple and reliable, made the pro-
posed assay configuration attractive for carcinoma screening or single
sample in point-of-care testing, and even field use.
2. Experimental
2.1. Reagents and materials
Alpha-fetoprotein (AFP), monoclonal mouse anti-AFP antibody (Ab),
and carcinoembryonic antigen (CEA) were purchased from Abcam, Inc.
(Shanghai, China). Mouse IgG antigen was obtained from Signalway
Antibody Co. (Nanjing, China). Human serum albumin (HSA) was
purchased from Solarbio (Beijing, China). Hydrogen tetra- chloroaurate (III)
trihydrate (HAuCl4·3H2O), 3-mercaptopropionic acid (MPA), 1-ethyl-3-(3-
dimethylaminopropyl) carbodiimide hydrochloride (EDC), N-
hydroxysuccinimide (NHS), (3-aminopropyl)-triethoxysilane (APTS), PEG NHS
ester disulfide (4, 7, 10, 13, 16, 19, 22, 25, 32, 35, 38,
41, 44, 47, 50, 53-hexadecaoxa-28, 29-dithiahexapentacontanedioic
445
Talanta 197 (2019) 444–450
acid di-N-succinimidyl ester, NHS-PEG-S-S-PEG-NHS, n = 7,
MW=1109.26), O-(2-mercaptoethyl)-O′-methyl-hexa(ethylene glycol) (mPEG-
SH), and bovine serum albumin (BSA) were purchased from Sigma-Aldrich
(USA). Phosphate buffer (PBS, 0.01 M, pH 7.4) was prepared by mixing
NaH2PO4 and Na2HPO4. 5′-Amino modified AFP aptamer (5′-NH2-
GGCAGGAAGACAAACAAGCTTGGCGGCGGGAAGGT
GTTTAAATTCCCGGGTCTGCGTGGTCTGTGGTGCTGT-3′) was synthe-
sized by Sangon Biotechnology (Shanghai, China). All other chemical
reagents were analytical grade and purchased from Sinopharm
Chemical Reagent (Shanghai, China). Milli-Q water (18.2 MΩ cm) was used
throughout the study.
2.2. Synthesis of AFP antibody modified AuNPs
13 nm gold nanoparticles (AuNPs) were prepared by the reduction of
hydrogen tetrachloroaurate with citrate in aqueous solution according to the
classic Frens-Turkevich method [30,31]. AFP antibody was conjugated to AuNPs
surfaces using bifunction PEG linkers (NHS-PEG-S-S-PEG-NHS) according to
previous literatures with minor modification [32–35]. Briefly, the AFP antibody was
incubated with NHS-PEG-S-S-PEG-NHS at a molar ratio of 1:1 in sterilized
HEPES buffer (10 mM HEPES, 100 mM NaCl, pH
7.4) overnight at 4 °C, then mixed with AuNPs (6 nM) at a molar ratio of
300:1 in 1.8 mM potassium carbonate for 4 h. Subsequently, mPEG-SH was
introduced to the mixture solution with a molar ratio of 10,000:1 to AuNPs
to further stabilize AuNPs. The antibody modified AuNPs were purified by
repeated centrifugation (10,000 rpm, 15 min, 3 times), and resuspended in
0.01 M PBS and stored at 4 °C. The as-prepared AFP antibody functional
AuNPs were named as Ab-AuNPs.
2.3. Preparation of AFP aptamer functional QDs probes
The monodispersed SiO2 nanoparticles were prepared according to the
classic seed-growth methods with minor modification [36,37]. Briefly, 80 mL
of ethanol, 4.85 mL of H2O, and 3.6 mL of ammonia were mixed and heated
gradually to 55 °C with vigorous stirring. Then a mixture solution of 3.1 mL
of tetraethoxysilane (TEOS) and 8 mL of ethanol was added quickly and
incubated at 55 °C for 5 h to obtain the seeds (i.e. 42 ± 5 nm SiO2
nanoparticles). 10 mL of above seeds was mixed with 80 mL of ethanol, 13
mL of H2O, and 7.5 mL of ammonia firstly, then 1 mL of TEOS was added
dropwise following by continuous stirring for 5 h, repeat this step until a total of
4 mL TEOS was added. The SiO2 nanoparticles were washed with ethanol
four times by cen- trifugation and dried under vacuum. The diameter of the
as-prepared SiO2 nanoparticles was determined to be 145 ± 10 nm by TEM.
CdTe QDs were synthesized according to previous reports [38–41].
Briefly, MPA was added into 10 mM CdCl2 solution to a final con-
centration of 15 mM, then NaOH was added to the mixture solution
gradually to adjust pH to 11.9. Then the mixture (solution a) was
transferred to a flask to remove O2 and protected with N2. 0.03 g Te
powder and 0.03 g NaBH4 were mixed in 4 mL of H2O and reacted
under N2 protection to colorless (solution b). 2 mL of solution b was
quickly added to solution a, and the mixture was heated to 115 °C under
N2 protection. A series of CdTe QDs with different colors were obtained
by changing the reaction time (20, 40, 60, 80, 100, and 120 min, re-
spectively). The QDs were further purified by ultrafiltration.
CdTe QD-coated SiO2 nanoparticles were prepared as following,
20 mg SiO2 nanoparticles were dispersed in 2 mL ethanol and incubated
with 0.4 mL APTS with stirring for 6 h. After washed with ethanol 4
times by centrifugation, the amino-functionalized SiO2 nanoparticles
were re-dispersed in a mixture of 2 mL of CdTe QDs and 1 mL EDC
(20 mg mL−1) and stirred at 4 °C for 12 h. Finally, the as-prepared CdTe
QD-coated SiO2 nanoparticles were washed 3 times with water by
centrifugation to remove unbound QDs and re-dispersed in 1 mL H2O,
named as QD-SNPs.
AFP aptamer functional probes were generated as following, 1 mL of
QD-SNPs were mixed with 1 mL of AFP aptamer (1 μM in PBS), then
L. Zhou et al.
100−1μL of freshly prepared EDC (20 mg mL−1 in PBS) and 100 μL of NHS (10 mg
mL in PBS) were added and incubated at room temperature (RT) for 2 h.
Finally, the aptamer functional nanoparticles were washed with PBS 3 times
by centrifugation to remove free aptamer and re- suspended in 5 mL of 1%
BSA solution for 2 h to block the excess amino group and nonspecific binding
sites. After being centrifuged and wa- shed with PBS, the as-prepared
aptamer functional probes were re- suspended in 5 mL PBS and stored at 4 °C
for later use, named as apt- QD-SNPs.
2.4. Fluorescence measurements
The fluorescence spectra were obtained at RT by Hitachi F-4600
(Hitachi, Japan) under excitation of 485 nm and an emission range from
500 to 650 nm. Slit widths for the excitation and emission were both set at 10
nm.
The apt-QD-SNPs were incubated with various concentrations
(0.5–45 ng mL−1) of AFP at 37 °C for 40 min to let AFP bind to its ap-
tamer firstly. After that, the resultant complexes were centrifuged and
washed with PBS, then 50 μL of Ab-AuNPs was added to it and in-
cubated at 37 °C for another 40 min, allowing Ab-AuNPs to bind to
aptamer functional Si/Cd nanoparticles through immunoreaction.
Finally, the mixture was diluted with PBS to a final volume of 100 μL for
fluorescence measurements.
2.5. Preparation of real samples
The human serum samples from healthy adults were filtered
through a 0.45 µm membrane and centrifuged at 12,000 rpm for
20 min, and the supernatants were diluted 10 t using 0.01 M PBS before
measurement.
3. Results and discussion
3.1. FRET biosensor design
In this paper, a sandwich aptasensor was designed based on FRET
system between QDs-AuNPs conjugate pairs for AFP detection, and the
Fig. 1. Scheme of the fluorescent sensor.
446
Talanta 197 (2019) 444–450
scheme was shown in Fig. 1. Specifically, the AFP specific aptamer was
covalently conjugated with the donor CdTe QDs, while the anti-AFP
monoclonal antibody was coupled with the acceptor AuNPs. In order to avoid
the agglutination of QDs and purify the aptamer functional QDs more easily,
QDs were coated on the SiO2 nanoparticles. When the QDs labeled aptamer
and AuNPs labeled antibody were incubated with their target AFP, the bio-
affinity between aptamer-AFP-antibody made the QDs and AuNPs close
enough to initiate FRET. Without sophisticated instrumentations, the PL
properties associated with the target con- centration in our system could be
easily transformed into fluorometric variation. The advantages, such as simple
and high-throughput multi- channel analysis, made the proposed assay
configuration attractive for carcinoma screening or single sample in point-of-
care testing, and even field use.
3.2. Synthesis of antibody functional AuNPs
As shown in Fig. 1, the antibody functional AuNPs are synthesized
according to previous literatures with minor modifications [32–35]. Here, a
bifunctional PEG (NHS-PEG-S-S-PEG-NHS) was used for the conjugation of
antibody and AuNPs. Briefly, the antibody bound to PEG by the reaction of
primary and secondary amines with terminal NHS group of PEG. Then the
complex conjugated to AuNPs by the formation of Au-S covalent bond from the
cleaved internal S-S group on PEG and AuNPs. Besides, the PEG chain can
be used as a spacer to enlarges the distance between antibody and AuNPs as
well, which may improve the efficiency of antigen-antibody interaction. In
addition, to be better applied to complex biological environments with high
concentration of salt ions and other interfering molecules, mPEG-SH was
further in- troduced to the reaction mixture to improve the stability of the
anti- body functional AuNPs since the mPEG-SH is able to block the re-
maining nonspecific adsorption sites on the AuNPs surface and inhibit the
AuNPs aggregation.
The synthesis of AFP antibody functional AuNPs was determined by
UV–vis spectroscopy and TEM. As shown in Fig. 2a, the citrate reduc-
tion AuNPs show a sharp absorption peak at518 nm, after conjugated
with AFP antibody, the peak red shift to 539 nm, confirming the for-
mation of Ab-AuNPs. As shown in the TEM image in Fig. 2b, after
L. Zhou et al. Talanta 197 (2019) 444–450

Fig. 2. The Uv–vis spectra of 13 nm gold nanoparticles (AuNPs) and AFP antibody functional AuNPs (Ab-AuNPs) (a). TEM image of Ab-AuNPs (b).

Fig. 3. TEM image (a) and high solution TEM image (b) of CdTe QDs. the photos (c) and fluorescence spectra (d) of a series of CdTe QDs obtained from different reaction times.
The reaction time was 20, 40, 60, 80, 100, 120 min, from left to right, respectively.

conjugated with antibody, the AuNPs still presents monodispersity and spheric
shape. Moreover, according to the inserted photo in the upper right corner,
Ab-AuNPs maintain monodisperse state even in PBS buffer, showing
classic wine red color, which further confirmed the formation of Ab-
AuNPs.
3.3. Synthesis of AFP aptamer functional QDs probes
The overlapping between the emission spectra of donor and the
absorption spectra of acceptor in the corresponding spectra was es- sential
for a FRET system. Good spectral overlap between donor
emission and acceptor absorption is significant to get a higher energy transfer
efficiency, thus improve the detection sensitivity of the FRET system. And to
achieve this, we synthesized a series CdTe QDs with different colors by
changing the reaction time (from 20 to 60 min) as previous reports. The
synthesized CdTe QDs were determined by fluorescence spectroscopy,
imaging, XRD and high resolution TEM. As shown in Fig. 3, with the
increased reaction time, the emission spectra gradually red shift, from 526 to
616 nm, and the color gradually dee- pened as well.
The SiO2 nanoparticles (SNPs) were synthesized according to the
classic seed-growth method [36]. The TEM images showed that the as-

447
L. Zhou et al.
Fig. 4. UV–vis spectrum and fluorescence spectrum of CdTe QDs 1 (a). The fluorescence spectra of SiO2 nanoparticles (line a), CdTe QDs 1 (line b), CdTe QD1/SiO2
particles (line c) and aptamer-QD1/SiO2 (line d).
Fig. 5. UV–vis spectrum of Ab-AuNPs (line a), and the fluorescence spectra of
aptamer-QD1/SiO2 (line b), aptamer-QD2/SiO2 (line c), and aptamer-QD3/SiO2 (line d).
prepared silica nanoparticles displayed a chemically clean and homo-
genized structure with a diameter of 145 ± 10 nm (Fig. S1 in ESI). CdTe
QDs were coated onto the surface of SNPs through the formation of amide
bond by EDC chemistry. APTS was first coupled to the surface hydroxyl group
on SNPs to yield an amino-terminated layer. Subse- quently, the carboxylic
groups of CdTe QDs were reacted with the amino distal points to form
CdTe QDs-coated silica nanoparticles. The coating of CdTe QDs on silica
nanospheres was further demonstrated by the color change of the solutions,
UV–vis spectra, and fluorescence
Fig. 6. The relationship between the energy transfer efficiency (E) and AFP concentrations (a). Linear calibration curve (0.5–45 ng mL−1) (b). E = 1-F′/F0, F0 and F′ represent the
fluorescence intensity of aptamer-QD1/SiO2 and Ab-AuNPs system in the absence and presence of AFP, respectively. The standard deviations were obtained from three separate
trials.
448
Talanta 197 (2019) 444–450
spectra (Fig. 4).
The absorption maximum at 471 nm and fluorescence emission peak
at 526 nm (ex = 380 nm) indicated the consequence of quantum con-
finement. As shown in Fig. 4b, SiO2 nanoparticles without coating QDs
displayed no fluorescence emission peak (line a), the resultant Si/Cd
nanospheres displayed a strong fluorescence emission peak at 539 nm
(line c), there was a red shift compared with the free CdTe QDs (line b).
All these results confirmed that CdTe QDs had been successfully planted
onto the surface of SNPs. The MPA on CdTe QDs’ surface was then used
to react with the amino group in aptamer in the presence of EDC and
NHS as activating reagents. This led to the immobilization of antibodies
onto the surface of silica nanospheres. After conjugated with aptamer,
the resultant Si/Cd nanoprobes displayed a strong fluorescence emis-
sion peak at 539 nm (line c), which was similar to free Si/Cd nano-
spheres, indicating that the conjugation of aptamer did not affect the
fluorescence property of CdTe QDs obviously.
3.4. Homogeneous detection of AFP based on FRET
To choose the best matched donor-acceptor pair, the spectroscopic
characteristics of antibody/aptamer functional QDs and AuNPs probes was
further investigated by fluorescence spectroscopy. As shown in Fig. 5, the
fluorescence spectrum of aptamer functional QD1 was best matching to the
absorption spectrum of antibody functional AuNPs, so apt- apt-QD1-SNPs was
chosen for AFP detection.
In addition, the FRET based biosensor was established for AFP de-
tection. As shown in Fig. 6, a detecting linear range from 0.5 to
45 ng mL−1 was obtained (R2 = 0.989). The limit of detection was
L. Zhou et al. Talanta 197 (2019) 444–450

Table 1 Zhejiang the Natural Science Foundation of Zhejiang Province Basic

Determination of AFP in real samples. Public Welfare Projects (Grant number LGF18H200007) and Zhejiang
Samples Added Founda Recovery (%) RSDb Medical and Health Science and Technology Project (Grant number
(ng mL−1) (ng mL−1) (n = 3, %) 2018KY888).

1 10.0 10.4123 104.1 3.9

Appendix A. Supporting information
2 50.0 49.4256 98.9 2.2
3 100.0 103.6367 103.6 3.0
4 200.0 204.3471 102.2 2.5 Supplementary data associated with this article can be found in the
5 400.0 412.0329 103.0 1.2 online version at doi:10.1016/j.talanta.2019.01.012.
a
Mean values of three determinations. References
b
Standard deviation.
[1] R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, 2016, CA Cancer J. Clin. 66 (1) (2016) 7–
30.
[2] Z.V. Fong, K.K. Tanabe, The clinical management of hepatocellular carcinoma in the
United States, Europe, and Asia: a comprehensive and evidence‐ based com- parison and
review, Cancer 120 (18) (2014) 2824–2838.
[3] F. Trevisani, M.C. Cantarini, A.M. Labate, S. De Notariis, G. Rapaccini, F. Farinati, P. Del
Poggio, M.A. Di Nolfo, L. Benvegnù, M. Zoli, Surveillance for hepatocellular carcinoma in
elderly Italian patients with cirrhosis: effects on cancer staging and patient survival, Am. J.
Gastroenterol. 99 (8) (2004) 1470–1476.
[4] A.B. Benson III, T.A. Abrams, E. Ben-Josef, P.M. Bloomston, J.F. Botha, B.M. Clary, A. Covey,
S.A. Curley, M.I. D′Angelica, R. Davila, Hepatobiliary cancers: clinical practice guidelines in
oncology™, J. Natl. Compr. Cancer Netw. 7 (4) (2009) 350.
[5] M.S. Pepe, R. Etzioni, Z. Feng, J.D. Potter, M.L. Thompson, M. Thornquist,
M. Winget, Y. Yasui, Phases of biomarker development for early detection of cancer,
J. Natl. Cancer Inst. 93 (14) (2001) 1054–1061.
[6] J. Li, T. Gao, S. Gu, J. Zhi, J. Yang, G. Li, An electrochemical biosensor for the assay
of alpha-fetoprotein-L3 with practical applications, Biosens. Bioelectron. 87 (2017)
352–357.
[7] Y. Wu, W. Guo, W. Peng, Q. Zhao, J. Piao, B. Zhang, X. Wu, H. Wang, X. Gong,
J. Chang, Enhanced fluorescence ELISA based on HAT triggering fluorescence “turn
on” with enzyme-antibody dual labeled AuNP probes for ultrasensitive detection of
AFP and HBsAg, ACS Appl. Mater. Interfaces 9 (11) (2017) 9369–9377.
[8] W.-H. Zhang, W. Ma, Y.-T. Long, Redox-mediated indirect fluorescence im-
munoassay for the detection of disease biomarkers using dopamine-functionalized
quantum dots, Anal. Chem. 88 (10) (2016) 5131–5136.
[9] S. Ahn, P. Zhang, H. Yu, S. Lee, S.H. Kang, Ultrasensitive detection of α-fetoprotein
Fig. 7. Specificity of the fluorescent aptasensor. The concentration of AFP was by total internal reflection scattering-based super-resolution microscopy for su-
0.2 nM and the concentrations of the other proteins (BSA, HAS, IgG, CEA) were perlocalization of nano-immunoplasmonics, Anal. Chem. 88 (22) (2016)
all 2 nM. E = 1-F′/F0, F0 and F′ represent the fluorescence intensity of aptamer- 11070–11076.
QD1/SiO2 and Ab-AuNPs system in the absence and presence of different pro- [10] A.R. Clapp, I.L. Medintz, H. Mattoussi, Förster resonance energy transfer in-
vestigations using quantum‐ dot fluorophores, ChemPhysChem 7 (2005) 47–57.
teins, respectively. The standard deviations were obtained from three separate
[11] H. Yao, Y. Zhang, F. Xiao, Z. Xia, J. Rao, Quantum dot/bioluminescence resonance
trials. energy transfer based highly sensitive detection of proteases, Angew. Chem. Int. Ed.
46 (2007) 4346–4349.
0.4 ng mL−1 for AFP based on a signal-to-noise ratio (S/N) of 3. [12] X.Y. Huang, J.C. Ren, Nanomaterial-based chemiluminescence resonance energy
In order to further explore the potential applications in real sample transfer: a strategy to develop new analytical methods, Trends Anal. Chem. 40
(2012) 77–89.
analysis, we applied this biosensor to detect AFP in human serum [13] Q. Wei, M. Lee, X. Yu, E.K. Lee, G.H. Seong, J. Choo, Y.W. Cho, Development of an
samples. Then the standard addition experiments were used to detect open sandwich fluoroimmunoassay based on fluorescence resonance energy
AFP in serum samples. The final results were summarized in Table 1. transfer, Anal. Biochem. 358 (2006) 31–37.
[14] J.H. Wang, T.C. Liu, Y.C. Cao, X.F. Hua, H.Q. Wang, H.L. Zhang, X.Q. Li, Y.D. Zhao,
The recovery of AFP in the five different samples for each sample was in
Fluorescence resonance energy transfer between FITC and water-soluble CdSe/ZnS
the range of 98.9–104.1%, and all the relative standard deviations quantum dots, Colloid Surf. A 302 (2007) 168–173.
(RSD) were lower than 5.0%. These satisfactory results revealed this [15] Y.Q. Li, J.H. Wang, H.L. Zhang, J. Yang, L.Y. Guan, H. Chen, Q.M. Luo, Y.D. Zhao,
High-sensitivity quantum dot-based fluorescence resonance energy transfer bioa-
method could be used to detect AFP in biological samples.
nalysis by capillary electrophoresis, Biosens. Bioelectron. 25 (2010) 1283–1289.
[16] H. Liu, G. Liang, E.S. Abdel-Halimb, J.J. Zhu, A sensitive and selective quantum
3.5. Selectivity dots-based FRET biosensor for the detection of cancer marker type IV collagenase,
Anal. Methods 3 (2011) 1797–1801.
[17] M. Lunz, V.A. Gerard, Y.K. Gun’ko, V. Lesnyak, N. Gaponik, A.S. Susha, A.L. Rogach,
To further determine the specificity of this aptasensor, the fluores- cence A.L. Bradley, Surface plasmon enhanced energy transfer between donor and ac-
intensity of the complex was measured when incubation with four other
proteins (BSA, HSA, IgG and CEA). Fig. 7 showed the com- parison of the ceptor CdTe nanocrystal quantum dot monolayers, Nano Lett. 11 (2011)
fluorescence changes after incubation with AFP and other common proteins. 3341–3345.
The results indicated that this aptasensor has ex- cellent selectivity to AFP [18] W.W. Zhao, J. Wang, J.J. Xu, H.Y. Chen, Energy transfer between CdS quantum dots
against other interfering proteins tested.
and Au nanoparticles in photoelectrochemical detection, Chem. Commun. 47
(2011) 10990–10992.
4. Conclusions [19] E. Oh, M.Y. Hong, D. Lee, S.H. Nam, H.C. Yoon, H.S. Kim, Inhibition assay of
biomolecules based on fluorescence resonance energy transfer (FRET) between
quantum dots and gold nanoparticles, J. Am. Chem. Soc. 127 (2005) 3270–3271.
Based on the selection of specific aptamers for biomarkers, it is pre- dictable [20] E. Oh, D. Lee, Y.P. Kim, S.Y. Cha, D.B. Oh, H.A. Kang, J. Kim, H.S. Kim,
that a great deal of biosensing platforms5,6 can be directly de- veloped for the
quantitative analysis of AFP, which plays an important role in early diagnosis of Nanoparticle‐ based energy transfer for rapid and simple detection of protein gly-
cancer and assessment of treatment efficacy. cosylation, Angew. Chem. Int. Ed. 45 (2006) 7959–7963.
[21] C. Tuerk, L. Gold, Systematic evolution of ligands by exponential enrichment: rna
ligands to bacteriophage T4 DNA polymerase, Science 249 (1990) 505–510.
Acknowledgements [22] A.D. Ellington, J.W. Szostak, In vitro selection of RNA molecules that bind specific
ligands, Nature 346 (1990) 818–822.
This paper was funded by the National Keystone Basic Research [23] M. Famulok, J.S. Hartig, G. Mayer, Functional aptamers and aptazymes in bio-
Program of China (973 program), Grant No. 2013CB531401, the technology, diagnostics, and therapy, Chem. Rev. 107 (2007) 3715–3743.
[24] W. Tan, M.J. Donovan, Jiang, Aptamers from cell-based selection for bioanalytical
applications, J. Chem. Rev. 113 (2013) 2842–2862.

449
L. Zhou et al.
[25] A. Ozer, J.M. Pagano, J.T. Lis, New technologies provide quantum changes in the scale,
speed, and success of SELEX methods and aptamer characterization, Mol. Ther. Nucleic
Acids 3 (2014) e183.
[26] C.L. Esposito, S. Catuogno, V. de Franciscis, L. Cerchia, New insight into clinical
development of nucleic acid aptamers, Discov. Med. 11 (2011) 487–496.
[27] C.-J. Huang, H.-I. Lin, S.-C. Shiesh, G.-B. Lee, An integrated microfluidic system for
rapid screening of alpha-fetoprotein-specific aptamers, Biosens. Bioelectron. 35
(2012) 50–55.
[28] Y.J. Lee, S.-W. Lee, Regression of hepatocarcinoma cells using RNA aptamer specific
to alpha-fetoprotein, Biochem. Biophys. Res. Commun. 417 (2012) 521–527.
[29] L. Dong, Q. Tan, W. Ye, D. Liu, H. Chen, H. Hu, D. Wen, Y. Liu, Y. Cao, J. Kang,
J. Fan, W. Guo, W. Wu, Screening and identifying a novel ssDNA aptamer against
alpha fetoprotein using CE-SELEX, Sci. Rep. 5 (2015) 15552.
[30] J. Turkevich, P.C. Stevenson, J. Hillier, A study of the nucleation and growth
processes in the synthesis of colloidal gold, Discuss. Faraday Soc. 11 (1951) 55–75.
[31] G. Frens, Controlled nucleation for the regulation of the particle size in mono-
disperse gold suspensions, Nat. Phys. Sci. 241 (1973) 20–22.
[32] L.R. Hirsch, J.B. Jackson, A. Lee, N.J. Halas, J.L. West, A whole blood immunoassay
using gold nanoshells, Anal. Chem. 75 (2003) 2377–2381.
[33] C. Loo, A. Lowery, N. Halas, J. West, R. Drezek, Immunotargeted nanoshells for
integrated cancer imaging and therapy, Nano Lett. 5 (2005) 709–711.
[34] S. Lee, S. Kim, J. Choo, S.Y. Shin, Y.H. Lee, H.Y. Choi, S. Ha, K. Kang, C.H. Oh,
450
Talanta 197 (2019) 444–450
Biological imaging of HEK293 cells expressing PLCγ1 using surface-enhanced
Raman microscopy, Anal. Chem. 79 (2007) 916–922.
[35] J. Wang, D. Liu, Z. Wang, Synthesis and cell-surface binding of lectin-gold nano-
particle conjugates, Anal. Methods 3 (2011) 1745–1751.
[36] S.M. Chang, M. Lee, W.-S. Kim, Preparation of large monodispersed spherical silica
particles using seed particle growth, J. Colloid Interface Sci. 286 (2005) 536–542.
[37] Z. Lei, Y. Xiao, L. Dang, M. Lu, W. You, Fabrication of ultra-large mesoporous
carbon with tunable pore size by monodisperse silica particles derived from seed
growth process, Microporous Mesoporous Mater. 96 (2006) 127–134.
[38] H.F. Qian, C.Q. Dong, J.F. Weng, J.C. Ren, Facile one‐ pot synthesis of luminescent,
water‐ soluble, and biocompatible glutathione‐ coated CdTe nanocrystals, Small 2
(2006) 747–751.
[39] H. Zhang, D.Y. Wang, B. Yang, H. Mohwald, Manipulation of aqueous growth of
CdTe nanocrystals to fabricate colloidally stable one-dimensional nanostructures, J.
Am. Chem. Soc. 128 (2006) 10171–10180.
[40] H.F. Qian, X. Qiu, L. Li, J.C. Ren, Microwave-assisted aqueous synthesis: a rapid
approach to prepare highly luminescent ZnSe (S) alloyed quantum dots, J. Phys.
Chem. B 110 (2006) 9034–9040.
[41] A. Shavel, N. Gaponik, A. Eychmuller, Efficient UV-blue photoluminescing thiol-
stabilized water-soluble alloyed ZnSe (S) nanocrystals, J. Phys. Chem. B 108 (2004)
5905–5908.