Documente Academic
Documente Profesional
Documente Cultură
Viruses in Prokaryotes
Rodolphe Barrangou, et al.
Science 315, 1709 (2007);
DOI: 10.1126/science.1138140
Updated information and services, including high-resolution figures, can be found in the online
version of this article at:
http://www.sciencemag.org/cgi/content/full/315/5819/1709
Information about obtaining reprints of this article or about obtaining permission to reproduce
this article in whole or in part can be found at:
http://www.sciencemag.org/about/permissions.dtl
Science (print ISSN 0036-8075; online ISSN 1095-9203) is published weekly, except the last week in December, by the
American Association for the Advancement of Science, 1200 New York Avenue NW, Washington, DC 20005. Copyright
c 2007 by the American Association for the Advancement of Science; all rights reserved. The title SCIENCE is a
registered trademark of AAAS.
REPORTS
Fig. 3. Drag coefficient as x 10
−3 4. M. D. Powell, P. J. Vickery, T. A. Reinhold, Nature 422,
4 279 (2003).
a function of wind speed. CD
5. E. D. Fernandez et al., J. Geophys. Res. 111, C08013
is shown for an observation- 10.1029/2005JC003048 (2006).
based resistance coefficient, 6. I. J. Moon, I. Ginis, T. Hara, J. Atmos. Sci. 61, 2334 (2004).
r = 0.02 cm s−1. The red 7. J. A. T. Bye, A. D. Jenkins, J. Geophys. Res. 111, C03024
open circles are the eval- 3 10.1029/2005JC003114 (2006).
uated CD from the current 8. K. Emanuel, J. Atmos. Sci. 60, 1420 (2003).
and wind observations, the 9. D. A. Mitchell, W. J. Teague, E. Jarosz, D. W. Wang,
Drag Coefficient (C )
D
Geophys. Res. Lett. 32, L11610 10.1029/2005GL023014
solid red line is a fitted (2005).
quadratic curve to the CD 10. D. W. Wang, D. A. Mitchell, W. J. Teague, E. Jarosz,
2
estimates, and the red M. S. Hulbert, Science 309, 896 (2005).
dashed lines are the 95% 11. W. J. Teague, E. Jarosz, D. W. Wang, D. A. Mitchell,
confidence limits for this J. Phys. Oceanogr., in press.
12. W. J. Teague, E. Jarosz, M. R. Carnes, D. A. Mitchell,
quadratic curve. The black
P. J. Hogan, Cont. Shelf Res. 26, 2559 (2006).
dotted lines represent the 1
13. J. F. Price, T. B. Sanford, G. Z. Forristall, J. Phys.
window for CD reported in Oceanogr. 24, 233 (1994).
(6), whereas the blue dots 14. Materials and methods are available as supporting
represent CD reported in (4). material on Science Online.
15. G. T. Mitchum, W. Sturges, J. Phys. Oceanogr. 12, 1310
0 (1982).
S2
L 1 2 WTΦ858+S1S2
hypotheses have been put forward proposing
roles for CRISPR and cas genes, which include
S3
L 1 2 WTΦ858+S3
providing immunity against foreign genetic ele-
S4
L 1 2 WTΦ2972+S5
We analyzed the CRISPR sequences of vari-
S6
L 1 2 WTΦ2972+S7
iants (fig. S1). Differences in the number and
type of spacers were observed primarily at the
S8
L 1 2 WTΦ2972+S8
CRISPR1 locus. Notably, phage sensitivity ap-
S11
S10
S12
S9
S14
L 1 2 WTΦ858Φ2972+S13S14
identical between parental strains and phage-
resistant derivatives, except for additional spacers Fig. 1. Streptococcus thermophilus CRISPR1 locus overview, newly acquired spacers in phage-
present in the latter. These findings therefore resistant mutants, and corresponding phage sensitivity. The CRISPR1 locus of DGCC7710 (WT) is at
suggest a potential relation between the presence the top. The repeat-spacer region of WT is in the middle: repeats (black diamonds), spacers
of additional spacers and the differences ob- (numbered gray boxes), leader (L, white box), and terminal repeat (T, black diamond). (Bottom left)
served in the phage sensitivity of a given strain. The spacer content on the leader side of the locus in phage-resistant mutants is detailed, with
This observation prompted us to investigate the newly acquired spacers (white boxes, S1 to S14). (Bottom right) The sensitivity of each strain to
origin and function of additional spacers present phages 858 and 2972 is represented as a histogram of the efficiency of plaquing (EOP), which is
in phage-resistant mutants. the plaque count ratio of a mutant strain to that of the wild-type.
First, we tested the hypothesis that CRISPR
loci are altered during the natural generation S9 S11 S3 S12 S5* S1 S4* S13
of phage-resistant mutants. A phage-host model
system was selected, consisting of a phage- Φ858 12 3 4 5 6 7 8 9 10 11
12131415161718 19 20 21 22 23225
426
272829303132
33435
3 36 37 38 39 40 4142
43444546
1
Danisco USA Inc., 3329 Agriculture Drive, Madison, WI S14 S7 S10 S2* S8 S6
1 kb
53716, USA. 2Danisco France SAS, Boîte Postale 10, F-86220
Dangé-Saint-Romain, France. 3Département de Biochimie et
Fig. 2. S. thermophilus phage genome maps with the position of sequences similar to the acquired
de Microbiologie, Faculté des Sciences et de Génie, Groupe
de Recherche en Ecologie Buccale, Faculté de Médecine CRISPR1 spacers of the phage-resistant mutants. Spacers shown above and below the genome maps
Dentaire, Félix d’Hérelle Reference Center for Bacterial indicate that the spacer matches a sequence on the (+) and on the (–) strand, respectively. An
Viruses, Université Laval, G1K 7P4 Québec, Canada. asterisk indicates the existence of a SNP between the spacer sequence and that of the phage
*To whom correspondence should be addressed. E-mail: genome (fig. S1). The genome sequences of phage 2972 (accession number AY699705) and phage
philippe.horvath@danisco.com 858 are 93% identical.
L 1 2
S2
L T L 1 2
synthesis and/or insertion of new spacers and
cas5 cas1 cas6 cas7 pORI ORF
III. additional repeats.
When we tested the sensitivity of the phage-
S1
S2
S4
S2
L 1 2
pORI cas1 cas6 cas7 ORF phage variants derived from phage 858 that
V. retained the ability to infect WTФ858+S1S2. In par-
ticular, we investigated the sequence of the ge-
S2
S1
L 1 2
nome region corresponding to additional spacers
cas5 cas1 cas6 pORI ORF
VI. S1 and S2 in two virulent phage variants. In both
cases, the genome sequence of the phage var-
Sensitivity to Φ858 Sensitivity to Φ2972 iant had mutated, and two distinct SNPs were
10-7 10-6 10-5 10-4 10-3 10-2 10-1 1 10-7 10-6 10-5 10-4 10-3 10-2 10-1 1
identified in the sequence corresponding to
I. WTΦ858+S1S2 spacer S1 (fig. S3).
II. WTΦ858+S1S2∆CRISPR1 Overall, prokaryotes appear to have evolved
a nucleic acid–based “immunity” system where-
III. WTΦ858+S1S2::pR
by specificity is dictated by the CRISPR spacer
IV. WTΦ2972+S4::pS1S2 content, while the resistance is provided by the
V. WTΦ858+S1S2::pcas5– Cas enzymatic machinery. Additionally, we spec-
ulate that some of the cas genes not directly
VI. WTΦ858+S1S2::pcas7–
providing resistance are actually involved in the
Fig. 3. CRISPR spacer engineering, cas gene inactivation, and corresponding phage sensi- insertion of additional CRISPR spacers and re-
tivity. I, mutant WT F858+S1S2; II, mutant WT F858+S1S2DCRISPR1 in which CRISPR1 was deleted; peats, as part of an adaptive “immune” response.
III, mutant WTF858+S1S2::pR in which CRISPR1 was displaced and replaced with a unique repeat; Further studies are desired to better characterize
IV, WTF2972+S4::pS1S2, mutant of strain WTF2972+S4 in which CRISPR1 was displaced and re- the mechanism of action and to identify the
placed with a version containing S1 and S2; V, WTF858+S1S2::pcas5– with cas5 inactivated; VI, specific function of the various cas genes. This
WTF858+S1S2::pcas7– with cas7 inactivated. pORI indicates the integrated plasmid (12). The phage nucleic acid–based system contrasts with amino
sensitivity of each strain to phages 858 and 2972 is represented at the bottom as a histogram of acid–based counterparts in eukaryotes through
the efficiency of plaquing (EOP). which adaptative immunity is not inheritable.
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
1
2
3
4
5
6
7
8
9
Accession
LMD-9 CP000419 A L l u u u u u u n u u n u u u u u
DGCC7689 EF434458 A L l u u u u u u n u u n u u u u u
DGCC778 EF434459 A1 BIM of LMD-9 L u l u u u u u u n u u n u u u u u
120-9 EF434460 A2 BIM of LMD-9 L u u l u u u u u u n u u n u u u u u
DGCC8769 EF434461 A3 BIM of LMD-9 L u u l u u u u u u n u u n u u u u u
DGCC1086 EF434462 A L u u u u u u u n u u n u u u u u
¦ ¦ ¦ ¦ ¦ ¦ ¦ ¦ ¦ ¦
SMQ-301 EF434463 B L u l u u l u u n u u n u u u u u
DGCC855 EF434464 B1 L u u u l u u l u u n u u n u u u u u
DGCC1443 EF434465 B2 L u u l u u u u u l u u l u u n u u n u u u u u
¦ ¦ ¦
DGCC8234 EF434466 C L u u l u u u l u u n u u u u u l u u u u l u u l
DGCC7973 EF434467 C1 L u u u u u l u u x x xx x x u u u u u l u u l
DGCC7699 EF434479 G L u u u u u u u u l u x u u u u
DGCC86 EF434480 G1 L u x u u u u l u x u u u u
DGCC8170 EF434481 G2 L u u u u u u u u u x u u u u u u u
DGCC8168 EF434482 G3 L u u u u u l u u u u u u u
DGCC48 EF434483 G3 L u u u u l u u u u u u u
DGCC103 EF434488 K L u u u u l u u u u u u x x x x u u u u u x
CNRZ1202 DQ072989 n.d. L u u u u u l u u u u u u u u x u u u u u u u x x u £
1205.3 DQ073005 n.d. L u u u u u l u u u u u u u u x x x x x x u x x x x £
CNRZ1205 DQ073004 n.d. L u u u u u l u u u u u u u u x x x x x x u x x x x £
¦
DGCC7842 EF434489 M L u u u u l u u u u u u
DGCC7967 EF434493 Q L u u u u u u u u x l u u x u n u u l
DGCC938 EF434494 Q1 L l n u u u u u u u u u u u u u x n u l u u x u n u u l
CNRZ389 DQ072987 n.d. L u u u u u u u u l u u u u u u u u u u l n u u x u
LMG18311 CP000023 n.d. L u u u u u u u u u n u u u u u l u x x x x u u u u u u u l u u u u n x x x x x x x u u l
CNRZ1100 DQ072988 n.d. L u u u u l n u u u u u u u u u l u u u u n u l u u x u n u u l
DGCC7785 EF434495 Q2 L u u u x x x x x x x x x x x x x x x x u n u l u u x u n u u l
CNRZ388 DQ072986 n.d. L u u n u u u u u l u n u u l u u u u u l n u u u u u u u u x x x u u u n u l u u x u n u u l
DGCC292 EF434496 Q3 L l u u u x x u u u u u u u u £ u l u u u u u u u u u u u x x x x x x x x x x x l
¦ ¦ ¦ ¦ ¦ ¦
DGCC47 EF434497 R L u u u u u u u u u u u u l u u u u u u u u u u u l u u x x n u u l
DGCC7806 EF434498 R L u u u u u u x x u u u u l u u u u u u u u u u u l u u x x n u u l
JIM70 DQ073000 n.d. L u u l u l x x u u u u l u u u u u u u u u u u l u u x u n u u l
DGCC7981 EF434499 R1 L u u l u l x x u u u u x u u u u u u u u u u u l u u x u n u u l
DGCC66 EF434500 R2 L u u l u l x x u u u u l u u u u u u u u u u u l u u x u n u u l
JIM72 DQ073002 n.d. L u u l u l x x u u u u l u u u u u u u u u u u l u u l u n u u l
DGCC7984 EF434501 S L u u u u u u u u u u u u n u n u u u u u u u u
DGCC8191 EF434502 T L u u u u u u u u u u
DGCC5472 EF434503 T L u u u u u u u u u
DGCC3367 EF434504 U L u u
Fig. S1. Graphic representation of CRISPR1 spacers across a variety of S. thermophilus strains.
Repeats are not included, only spacers are represented. Each spacer is represented by a combination of
one select character in a particular font color, on a particular background color. The color combination
allows unique representation of a particular spacer, whereby squares with similar color schemes
(combination of character color and background color) represent identical spacers, whereas different
color combinations represent distinguishable spacers. Missing spacers are represented by crossed
squares. L (blue): CRISPR leader sequence. In the third column, a letter indicates strain lysotype,
whereby the lysotype is defined as the spectrum of sensitivity of the strain to a set of phages; lysotypes
that show minor differences for specific phages are distinguished by an additional number. n.d.: not
determined. BIM: bacteriophage insensitive mutant.
S1 CAACACATTCAACAGATTAATGAAGAATAC
Φ858 .............................. 31381 - 31410 (+)
Φ2972 ....GAT.GATTTC.....T.AC...GA.. 30702 - 30731 (+)
S2 TCCACTCACGTACAAATAGTGAGTGTACTC
Φ858 .......................C...... 25442 - 25471 (-)
Φ2972 .......................C...... 25432 - 25461 (-)
S3 TTACGTTTGAAAAGAATATCAAATCAATGA
Φ858 .............................. 17215 - 17244 (+)
Φ2972 .............................. 17202 - 17231 (+)
S4 CTCAGTCGTTACTGGTGAACCAGTTTCAAT
Φ858 ......T..............T..G.TGG. 32292 - 32321 (+)
Φ2972 .............................. 31582 - 31611 (+)
S5 AGTTTCTTTGTCAGACTCTAACACAGCCGC
Φ858 G..............T.............. 22124 - 22153 (+)
Φ2972 .............................. 22075 - 22104 (+)
S6 GCCCTTCTAATTGGATTACCTTCCGAGGTG
Φ858 .............................. 35334 - 35363 (-)
Φ2972 .............................. 34492 - 34521 (-)
S7 AAGCAAGTTGATATATTTCTCTTTCTTTAT
Φ858 .............................. 10280 - 10309 (-)
Φ2972 .............................. 10270 - 10299 (-)
S8 CGTTTTCAGTCATTGGTGGTTTGTCAGCG
Φ858 .T.C...CTCAC.AAA..T......TTTA 30680 - 30708 (-)
Φ2972 ............................. 29988 - 30016 (-)
S9 TTACTAGAGCGTGTCGTTAACCACTTTAAA
Φ858 .............................. 7882 - 7911 (+)
Φ2972 .............................. 7874 - 7903 (+)
S10 TTCGTTAAAGTCACCTCGTGCTAGCGTTGC
Φ858 .............................. 20670 - 20699 (-)
Φ2972 .............................. 20621 - 20650 (-)
S11 ATAACGGTAGCAAATATAAACCTGTTACTG
Φ858 .............................. 8368 - 8397 (+)
Φ2972 .............................. 8360 - 8389 (+)
S12 GAAGTAGCCATACAAGAAGATGGATCAGCA
Φ858 .............................. 19047 - 19076 (+)
Φ2972 .............................. 18998 - 19027 (+)
S13 GATGTCACTGAGTGTCTAAGCATTGCGTAC
Φ858 .............................. 34444 - 34473 (+)
Φ2972 .............................. 33602 - 33631 (+)
S14 TGAATAAGCAGTTCTTGACGACCAACCGAC
Φ858 .............................. 4809 - 4838 (-)
Φ2972 .............................. 4801 - 4830 (-)
Fig. S2. Alignment of the acquired CRISPR spacers with the corresponding genomic region of phage
858 and phage 2972. Identical bases are indicated by a dot, whereas nucleotide polymorphisms are
specified. Positions (bp) and DNA strand relative to the phage genomes are indicated on the right.
S1 CAACACATTCAACAGATTAATGAAGAATAC
Φ858 ..............................
Φ858-A ............A.................
Φ858-B ............................C.
Fig. S3. Alignment of CRISPR spacer S1 with the corresponding genomic region of phage 858 and the
two mutant phages that have circumvented the CRISPR resistance of strain WTΦ858+S1S2.
S1
S2
S2
T
P1 P2 P3 P4
S1
S2
S2
T
P1 P4
S1S2 construct: L
S1
S2
Fig. S4. Schematic representation of the PCR strategy followed to generate the S1S2 construct.
Genomic DNA of strain WTΦ858+S1S2 was used as a template in two distinct PCR reactions with primer
pairs P1-P2, and P3-P4, respectively. The two PCR products were mixed and subjected to a third PCR
reaction in the presence of primers P1 and P4.
WTΦ858+S1S2
cas5 cas1 cas6 cas7 repeat/spacer region ORF
WTΦ858+S1S2::pR
cas5 cas1 cas6 cas7 pORI repeat/spacer region ORF
Plasmid excision
pORI repeat/spacer region with deletion
of CRISPR1
WTΦ858+S1S2∆CRISPR1
cas5 cas1 cas6 cas7 ORF
Fig. S5. Diagram representing the homologous recombination events that led to mutants
WTΦ858+S1S2::pR and WTΦ858+S1S2∆CRISPR1. Strain WTΦ858+S1S2::pR was generated through integration
of the pR plasmid into cas7. Subsequently strain WTΦ858+S1S2∆CRISPR1 was obtained after plasmid
excision via homologous recombination at the 3' end of ORF.
SUPPORTING REFERENCES
1. C. Lévesque et al., Appl. Environ. Microbiol. 71, 4057 (2005).
2. S. Moineau, J. Fortier, H.-W. Ackermann, S. Pandian. Can J. Microbiol. 38, 875 (1992).
3. W. M. Russell, T. R. Klaenhammer, Appl. Environ. Microbiol. 67, 4361 (2001).