Sunteți pe pagina 1din 323

T. A.

BROWN
Professor of Biomolecular Archaeology,
Department of Biomolecular ScÌences,
UMISI Manchester, UK

CLONAGEM
/\

GENICA
E ANALISE DE DNA
Uma introdução
4a Edição

Tiadução:
Henrique Bunselmeyer Ferreira
Biólogo, Universidade Federal do Rio Grande do Sul (UFRGS).
Mestre em Genética, UFRGS.
Doutor em Genética e Biologia Molecular, UFRGS.
Pós-Doutorado no Albert Einstein coltege of Medicine, Nova Iorque, EUA.
Professor adjunto IV do Departamento de Biologia Molecular e Biotecnologia, uFRGS.
orientador do Programa de Pós-Graduação em Biologia celular e Molecular, UFRGS.
Pesquisador associado do Centro de Biotecnologia, UFRGS.

Luciane Maria Pereira Passaglia


Bióloga. UFRGS.
Doutora em Genética e Biologia Molecular, UFRGS.
Pós-Doutorada na Universidade da Califómia, Berkeley, EUA.
Professora adjunta IV do Departamento de Genética, UFRGS.
orientadora do Programa de Pós-Graduação em Genética e Biotogia Molecular, UFRGS.
Pesquisadora associada do centro de Biotecnologia, UFRGS, na âreade Fixação
Biológica do Nitrogênio, e do Departamento de Genética, UFRGS, nas iíreas de
Genética Molecular de Microrganismos e Genética e Biotecnologia vegetal.

2003
1a Edição Sumário

do DNA recombi- Parte 1


ias sobre esses as-
For parte do leitor - Princípios Básicos da Clonagem Gênica e da
de um estudan- Análise de DNA... .... 11
to A em Biologia.
os termos não- 1 Por que a Clonagem Gênica e aAnálise de DNA São Importantes............... 13
e reforçar o tex-
el.
2 Veículos pata a Clonagem Gênica: Plasmídeos e Bacteriófagos ............. ...... 25

r anos de bioquími- 3 Purificação de DNA a Vivas..........


Partir de Células .................. 39
p'ara alguns pesqui-
número de biólo- i 4 Manipulação de DNA Purificado........... .................. 63
cionagem gênica po- 5 Introdução de DNA em Células Vivas ......... ............ 95
,
texto poderá ser-
recombinante, para
,I
6 Vetores de Clonagem para E. coli............. ............. 115
I 7 Vetores de Clonagem para Eucariotos .............. .....I3-9
s excelentes livros-
ito considerável pe- 8 Como Obter um Clone de um Gene Específico........... ............. 165
livros-texto
esses t
9 A Reação em Cadeia da Polimerase............... ....... 187
s. quejá tiveram al- I
I
fornecer. Minha
,,

o livro de Old e
t Parle2
devo agradecer avár
I

projeto seguisse o * Aplicações da Clonagem Gênica e da Análise de


DNA na Pesquisa
s-ì

\ottingham, e com .203


: todos os effos e
a maior parte 10 Gene
Estudando aLocalizaçáo e a Estrutura do ....205
certa ou a frase ade-
11 Estudando a Expressão e a Função dos Genes.. .....225
ry
12 Estudando Genomas ........253

T. A. Brown

:.:f \^-F! o

t!
*úi 9
t
II
':ì-r::-.:!ì-':::.:.--i:i::::l::orit:l::Ììtrt:a\ì::-li)iìlia,'::l:i:.',:r:.:::!tt:\' IE
L
m"uçn mu anb erp m1-3su LìqTuq m : .*'"ro, oç,.rq *qp:q apn,J 1c o :nb eç u:1-eu-orsrq ssou Ep oeienmuo-- e a a:o-r :nb:od
:qì EWi ; G
ìsfllmç r[T ;ru a5-ç;NJ úuü-ì trF trf 'Lìcmü oË roro r zFruÈ"r r:nu m. ?]lo-r l-ã,.l-aF J Ì:!'w :ná o otrro anb rç "c:1'o-remq m lL ruE:p o
rc xmìh o *F'dng.süJd:u:[ì ro ? ilLìü-'rìÊq;E oE\ LìIEãF5 ü':(JÉa èuou o zra\ Eol rti(ì Lì':-Èqutu\..-o-\Lì::'{-ni n:s o on:nb \TtÍ" ü:r rl
10 SuMÁRto

Parte 3
Aplicações da Clonagem Gênica e da Análise de
DNA na Biotecnologia........ ..2ls
13 Produção de Proteínas a partir de Genes Clonados ..................277
t4 Clonagem Gênica e Análise de DNA na Medicina ...................2gg
15 Clonagem Gênica e Análise de DNA naAgricultura................................... 319
I6 Clonagem Gênica e Análise de DNA na Ciência Forense ........ 335
Glossrário .................... .......347
Índice ............367

c
z

t!
*FÍ 9


'::::r1nor rrrd ocinri: J^il oru .rl3 :nb ttcl o :.rc1os oqlg o t.ltd :ur:u atur 1i IE
i.:lf:r:J:r:ìirnrlì-ìaruo--1 lrr.ftf,u!-rJsrreieuos::tì:oPL{netlïopu?nÒ,.'ossrnoursuããuuanberolrog'oqlg'?rPoJlnoun::duasualsel4i'oroq: L
Jp srp g w'â^oq: uau anb rrp uaa'ãtsÌJl oqlfq un e sru'€f,oJ ?Ì opuq rrqll:q apod 1os o anb erp uaa'zr:olsrq rssou tp otSrnurluo: r 9 a:ol anb:o6 G
opuuãs uJ âf,o,\ 9s'sss: ouor serp ug opunu op roreu r'rpn8e rzalsrr Bun ú1lo^ :J ze;s:p as rapur anb o opnl anb erp uaa'o:unq un eru rr:8ap
a: anb o opnl atuada: ap g'rr:uasnr ens e ef,orl3 op€qes op oÌf,uâFs Õ'âlep ãuou o zrp ?JoJ 9Ì Ìos o'ãlâqueurv'of,sriu?f,1 'Ied nas o oes anb stlp uãL,
n
a
PARTE 1

PRINCIPIOS BASICOS DA
I ....277
L................ .... zes CLONAGEM GÊNICA E DA
L ... 3re
ANALISE DE DNA
t
;
.... 33s

l--................ .... 367


I

r..i(a:Ilf \ì[t-
I
'o:srrtrer3 r.reiì
|

G
t

',r:::qno: r:;r1 ocillã] Ja?t oru :l: :nb rrd o :-r1os oqlg o r;rrC ;ro::sa aru y
; f::orlru I cnuuuo-r ouro: ':rci{r:rrr:d suaSnros::t{ sop urn etPi opuLn}
,.'ossr noursua au uenb a:ol rog
'oq[g'?Ìp oJlno un a:duas ual s?W o]oql L
âp srp â w'J^oq: uau:nb rrp uea'âtsÌr] oqlrq un â stu'uoJ el opurl Jrqprq apodlos o anb erp uaa'euglsrq essou ep og5rnurluo: r a a:ol anb:o4 G
'opnuãs uJ aJo os'sss ouof, serp ug'opunu op rowu e'epn8e ezalsrrl Bun Btlo
ua anb o opnt aguada: ap g'tr:uasn€ Bns r eJoq3 op?q?s op orJuâlÌs o'âlâp ãuou
ï zrgsep as rapue anb o opnt anb rrp uãJ'o)€Jnq un erl er:8ap
o zrp ef,oJ el Ìos o'âtrãrlueuryo:sr:ue:g'red nas o ogs anb sap ue1,,
It
a
CnpÍrulo 1

Por Que a Clonagem Gênica e a


Análise de DNA São lmPortantes

O desenvolvimento inicial da genética' I 3 Pol quea clonagem gênica e a PCR são tão

O advento da clonagem gênica e da reação em cadeia importantes, l6


da polìmerase, 14 Como encontrar o seu caminho ao longo deste livro,
O que é clonagem gênica?. I 5 22
OqueéPCR?,16

Em meados do século XIX, Gregor Mendel formulou um conjunto de regras para explicar a
herança de características biológicas, as quais assumiam' basicamente, que cada propriedade
trerediìrária de um organismo é controlada por um fator, chamado de gene, que é uma partícu-
la física presente em algum local na célula. A redescoberta das leis de Mendel, em 1900, mar-
cou o nascimento da genética, a ciência que busca o entendimento do que são esses genes e
de como eles funcionam exatamente.

1.1 O desenvolvimento inicial da genética


Em seus primeiros 30 anos de vida, a nova ciência cresceu a uma velocidade espantosa. A
idéia de que os genes residem em cromossomos foi proposta porW. Sutton' em i903' e fece-
beu suporte experimental de T. H. Morgan, em 1910. Morgan e colaboradores desenvolveram,
então, as técnicas paÍa mapeamento gênico, e, até I922,já haviam produzido uma análise
abrangente das posições relativas de mais de 2.000 genes nos quatro cromossomos da mosca-
das-frutas, a Drosophila melanogaster.
Apesar do brilhantismo desses estudos genéticos clássicos, não houve um real entendi-
mento da natwezamolecular do gene até a década de 1940. De fato, apenas após os experi-
mentos de Avery, Macleod e Mccarty, em 1944, e de Hershey e chase, em 1952, alguém pas-
sou a acreditar que o ácido desoxirribonucléico (DNA) era o material genético: até então, era
geralmente aceito que as proteínas constituíam os genes. A descoberta da função do DNA foi
um grande estímulo para a pesquisa genética, e muitos biólogos famosos (Delbrück, Chargaff,

IE

'l::or1uo: uetl or{ru;l Jr3:Ì oïu álã :nb ttrì o a,it1o: oqly o r::rd malr:: atul 1- IE
L
anb erp u:1'âtsrft oqlrrq un â s?u'rloJ eI opurJnql:q apod 1os o anb zrp ruaa'rtrglsrq essou ep ot5tnurluo: t a ::ol enbrod
IE
âp
"Ìp
â
.oppuJs
w.â.\oq: ueu
aJ JJoÀ gs.sssâ ouoJ srrp ug.opunu op Jorru r'epn8e ezatsrll ?un €tlo^ g'zgsap as reput anb o opnt anb erp uâJ oseJnq un ?JIa el:8ap o
aa anb o opn1 atuader ap g.er:uasn? €ns € eJorÌf, op?qgs op orJuãÌrs o'âlãp ãuou o zlp tfoJ tl Ios o'âf,âqü€uv'otrsltruerJ'red nes o ots anb selp uaa,,
a
14 T. A. Bnowr.r

Crick e Monod estavam entre os mais influentes) contribuíram para a segunda grande era da
genética. Em 14 anos - de 1952 a1966 a estrutura do DNA foi elucidada, o código genéti-
13 O qut
-
co decifrado e os processos de transcrição e de tradução descritos.
!\$ ü$

1.2 O advento da clonagem gênica e da reação em rlt


cadeia da polimerase
Esses anos de atividade e descoberta foram seguidos por um peíodo de calmaria, um anticlí-
max, no qual parecia, para alguns biólogos moleculares (como a nova geração de geneticistas
se autodenominava), que havia poucos aspectos de importância fundamental ainda não-escla-
recidos. Na verdade, havia uma frustração em função de as técnicas experimentais disponíveis
no final da década de 1960 não serem suficientemente sofisticadas para permitir o estudo dos
genes com maiores detalhes.
Depois, nos anos de l91I a 1913, a pesquisa genética foi novamente acelerada por uma re-
volução na biologia experimental, conforme descrito na época. Uma metodologia completa-
mente nova começou a ser desenvolvida, viabilizando o planejamento e a realizaçãq se não
com façilidade, pelo menos com sucesso, de experimentos previamente impossíveis. Tais mé-
todos, chamados de tecnologia de DNA recombinante ou de engenharia genética, com ba-
se essencialmente no processo de clonagem gênica, abriram uma nova grande era para a ge-
nética, conduzindo a rápidas e eficientes técnicas de seqüenciamento de DNA, as quais per-
mitiram que as estruturas de genes individuais fossem determinadas. Isso culminou, na déca-
da de 1990, com os projetos de seqüenciamento massivo de genomas, incluindo o projeto hu-
mano, que foi completado em 2000. A partir daí, foram desenvolvidos procedimentos para o
estudo da regulação de genes individuais, o que permitiu que os biólogos moleculares enten-
dessem como aberrações na regulação gênica podem resultar em doenças humanas, como o
câncer. Essas técnicas geraram a biotecnologia moderna, que coloca os genes em funciona-
mento para a produção de proteínas e de outros compostos necessários à medicina e aos pro-
cessos industriais.
Durante a década de 1980, quando o entusiasmo gerado pela revolução da clonagem gê-
nica estava no seu auge, parecia quase impossível imaginar que estava prestes a surgir mais
um processo igualmente inovador e revolucionário. De acordo com o folclore do DNA, Kary
Mullis inventou a reação em cadeia da polimerase (PCR) durante uma viagem de carro aà
longo da costa da Califórnia, em uma noite de 1985. A sua idéia genial foi a concepção de
uma técnica relativamente simples, que funciona como um complemento perfeito para a clo-
nagem gênica. A PCR tornou mais fáceis muitas das técnicas que antes, apesar de possíveis,
eram de difícil execução, quando dependendo apenas da clonagem gênica. Ela estendeu o al-
cance da análise de DNA e fez com que a biologia molecular encontrasse novas aplicações,
inclusive em áreas fora do seu campo tradicional, de medicina, agricultura e biotecnologia. A
ecologia molecular, a arqueologia biomolecular e a ciência forense de DNA são apenas três
das novas disciplinas que surgiram como uma conseqüência direta da invenção da pCR, e os
biólogos moleculares estão buscando novas maneiras de utilizar o DNA para responder ques-
tões sobre a evolução humana e o impacto de mudanças ambientais na biosfera. Trinta ãnos
após a revolução da clonagem gênica, ainda estamos andando em uma montanha-russa,
sem
previsão de final para a excitação provocada por ela.

ilro@üÉs
[lsl

i;r'.::fll \-ìf!- I 'o-rsr:rurr1 r-rciì


Ò
z
*ç,: o
r! 6

',r;:orluor trrti oeìlüi:t J:\:ìl ()ïu .rl3 .rnb rt.l o o:qos oqlq o urd :l:r:s: :rru y t!
; ruol\:u : .!ìilnü()-ì r)ruor ':EiìDUr,rd suaSn:osrrtl sop ür1ì rtr,l opurnl; ,.'ossr noursua eu uanb elol roJ 'oql5 '?Ip ôJlno un arduas ual sEW of,oqj L
ap fip â w:âroq: ueu:nb erp uaa'âtsrJt oqlrlq un ã sru'?]oJ €I opur1:eqp:q apod 1os o anb erp uaa er:gtsrq msou rp oe5rnunuo: r a a:ol anb:od G
'oPnuãs uJ 3f,o^ os'sassã ouof, serp ug'opunu op Jorru e'epn8e ezatsrJl ?un ?lÌo
ua anb o opru atuad:: ep g'er:uasn€ ?ns ? eJor{r op?qgs op oÌJuãÌrs o'elâp êuou
![ ze;sap as raput anb o opnl anb erp uãJ oJ?f,nq un erra err8ap
o zrp rfoJ gl Ios o'âJãqu€ury'otrsrfurJC'Ìrd nas o oes anb serp ruea,,
o
a
Ct-onncev GÊNtcA E Ar'rÁlrse oe DNA 15

Erande era da 1.3 O que é clonagem gênica?


código genéti-
As etapas básicas de um experimento de clonagem gênica são descritas a seguir (Figura 1.1).

(1) Um fragmento de DNA, contendo o gene a ser clonado, é inserido em uma molécula de
DNA, chamada de vetor, para produzir uma quimera ou molécula de DNA recombi-
nante.

um anticlí-
de geneticistas
1Construção de uma molécula de
não-escla-
DNA recombinante
disponíveis

p
o estudo dos

por uma re-


completa-
se nao
eis. Tais mé-
comba-
era para a ge-
.,,"["*
de DNA
O +
rf:ïï'*i*"o*

as quais per-
na déca-
o projeto hu-
para o
lares enten- Bactéria
como o 2Transporte para o interior da
célula hospedeira
em funciona- o
e aos pro-
3 Multiplicação da molécula
de DNA recombinante Bactéria portadora
clonagem gê- da molécula de
a surgir mais oo DNA recombinante
doDNA, Kary _OO
OÔ^
de carro ao
r:ncepção de
ro para a clo- 4 Divisão da
de possíveis, célula
hospedeira
OO oì
o'
estendeu o al-
o oo
aplicações, 6(

apenas três
5 Numerosas divisões /
da PCR, e os
celulares I
)noer ques- resultando I

Trinta anos em-7)um clone {


sem

Figura 1.1 Colônias bacterianas


As etapas básicas da clo- crescendo em meio sólido
nagem gênica.

ïoriF:J xìv 'o:st:rUe:; r::ed o


z

IE
M: o
t

õ

'-r:::r1uo: L:re d odlü"ìl J^âl o?u Jlã inb r:d o :.rqos oqlg o r:r:d ;l.r:ls: erx y
;f lroilitl I :nuuuo-ì oulol
strcirur-r.J su;Snrol:ci :op Lrnr rtlq oputn|.. oss noursuâ âu uanb e:ol rog oqlll'prp oJlno un ::duas ua1 st141.o:oq: L
âp rrp J w'â^oq: uau anb zrp uaa'âlsrrt oq1rrqun a stu'rro; ?I opuÌl f,eqprq apod 1os o anb erp ual.rrrgtsrq essou ep or5rnuquo: e e atol anb:o4 G
'opnuâs uJ ef,o
9s'sJss3 ouof, stq) ug opunu op roreu e'epn8t ezalsrJt run Bllo^ :J'ze;sap :s rapue anb o opnl anb etp uãJ'of,?f,nq un eJtl err8ap t,l
ua anb o opru atuada: ap g tr:uesn€ Bns E rfoqf, opeqes op orf,uâ[s o 'ãIâp ãuou o zrp BfoJ BI Ios o'âtrâÌ{uúuy'of,srf,u?JJ 'r?d nas o oes anb serp ruaa,,
a
16 T. A. Bnowru

(2) O vetor funciona como um veículo que transporta o gene para o interior de uma célula
hospedeira, a qual é, em geral, uma bactéria, embora outros tipos de células vivas pos-
sam tambóm ser utilizados.
(3) No interior da célula hospedeira, o vetor multiplica-se, produzindo numerosas cópias
idênticas não apenas de si próprio, mas também do gene que ele caÍrega.
(4) Quando a célula hospedeira se divide, cópias da molécula de DNA recombinante são
passadas à progênie, na qual o vetor replica-se novamente.
(s) Depois de um grande número de divisões celulares, é produzida uma colônia, ou clone,
de células hospedeiras idênticas. Cada célula do clone contém uma ou mais cópias da
molécula de DNA recombinante; diz-se, então, que o gene carregado pela molécula de
DNA recombinante está clonado.

1.4 O que é PCR?


A reação em cadeia da polimerase é muito diferente da clonagem gênica. Em vez de utilizar
uma série de manipulações envolvendo células vivas, a PCR é executada em um único tubo
de ensaio, a partir da mistura de DNA com um conjunto de reagentes e da sua colocação em
um termociclador, um equipamento que permite que a mistura seja incubada em uma série de
temperaturas que são variadas de uma maneira pré-programada. As etapas básicas de um ex-
perimento de PCR são as seguintes (Figura 1.2):

(1) A mistura é aquecida a94"C, temperatura na qual as pontes de hidrogênio, que mantêm
unidas as duas cadeias da molécula de DNA de fita dupla, são rompidas, causando a
desnaturação da molécula.
(2) A mistura é resfriada a 50 a 60'C. As duas fitas de cada molécula poderiam reunir-se a
essa temperatura, mas a maioria não o faz porque a mistura contém um grande excesso
depequenasmoléculasdeDNA,chamadasdeoligonuclffi
anelam com as moléculas de DNA em posições específicas.
(3) A temperaturaé elevada até 74oC,,con_s_ideradg-óqrlq4!a&_4 atividade da DNA-polime-
.ase a"ffiqËËffi-ËË"na mistura. Ãp;"ndo"-;; mais sobré DNÃìõ'timèi;
ses na página 67. Neste estágio, tudo o que precisamos para entender o processo é que,
durante essa etapa da PCR, a DNA-polimerase de Taqliga-se a uma extremidade de ca-
da iniciador e sintetiza novas fitas de DNA, complementares às moléculas de DNA.
molde. Agora, temos quatro fitas de DNA, em vez das duas com as quais iniciamos a
reação.
(4) A temperatura é novamente elevada até94"C.As moléculas de DNA de fìta dupla, cada
uma das quais consistindo em uma fita da molécula original e uma nova fita de DNA,
desnaturam, gerando fitas simples. Isso inicia um segundo ciclo de desnaturação-anela-
mento-síntese, ao final do qual existem oito fitas de DNA. Com a repetição do ciclo por
,..
| 25 vezes, a molécula de fita dupla com a qual iniciamos é convertida em mais de 50 mi-
i ttrOes de novas moléculas de DNA de fita dupla, cada uma delas uma cópia da região da
{ molécula inicial delimitada pelos sítios de anelamento dos dois iniciadores.

1.5 Por que a clonagem gênica e a PcR são tão importantes


Frguna
A clonagem gênica e a PCR são procedimentos relativamente simples
(Figuras 1.1 e 1.2). Por ns eüapas hási
que, então, elas são consideradas de tanta importância na biologia? Isso se explica principal- darea@ em
ohe da @inreÍË

1j!ìiTf \ìrt- 'o:sr,rrrelJ t:ril o


z
*Ë5
a
G
t

';;:e rluo: rred odrurl r ?t o?u âlJ ;rb rcd o orqos oqlg o utd .u:::rs: cru: y
i r:f orirl- : rnuuuo-. ouro:'srrrÌr:ur-Ìd suf,aflrosrrd sop uirì rÌif,} opu?n|
,.'ossr noursua au uanb a:ol roJ
'oq[g'erp oJ]no un arduas ual s?W oroqJ L
âp Erp J seutã oq: uau anb erp ua1'âtsÌrt or{lrJq un ã seu'€roJ ?l opuq rrqg:q apod 1os o enb np uaa zt:gtsrq essou tp oeSenunuo: e e elol anbrod G
'opuuâszJJro^os'sssâouof,serpug'opunuopf,oreue'epn€trzalsrJl?unBllo gzrgsapasrapueenboopntanbrrpuâJo:?f,nqunef,rlerrSap
ua anb o opu aluadar ap g'zr:uasnr sns r rJorlJ op?qgs op oÌJue[s o'ãIãp âuou o zrp aoJ el Ios o'ãJâr{wuy'o:snuerg'rcd nas o oes anb serp u:a,,
It
a
CLorunoeu GÈrurcn e ANÁLrsE oe DNA 17

o interior de uma célula


s de çélulas vivas pos- 3', c
DNA-molde
5', 3',
indo numerosas cópias
e ciuTega. 1 Desnaturação do
DNA recombinante são DNA-molde - 94'C

uma colônia, ou clone,


uma ou mais cópias da 3', 5',
pela molécula de

5', 3',

2 Anelamento dos
oligonucleotídeos iniciadores
Em vez de utilizar - 50-60"c
em um único tubo
ufun sua colocação em
3', 5'.
em uma série de
hásicas de um ex- ttt
5' \'--lniciadores ^\ 5'
T--f-ï

5', 3',

3 Síntese de novo
DNA - 74.C
reunÍ-se a
EXCCSSO
3', 5',
foiciadores, que
llllltttttrrrrr
5', .J

3' 5'

5', 3',

& fita dupla, cada


fita de DNA,
3', 5',

do ciclo por
nrais de 50 mi- 5', o
ia da região da 3' 5',

5', 3',

Figura 1.2
l.l e 1.2). Por As etapas básicas
i
principal- da reação em ca-
deia da polimerase. 4 Repetição do ciclo 25-30 vezes

?_:.rrli:l \ìt. 'o:struc-r; tred


o
z
**,ï ô
G G

'-r:::tluo:r

L::rd odlsit J at o?rl 3[3 -]nb rrd o c,rty-rs oq15 o r:r:d :,r::rsa :rxr ç G
L
ãp eÌp â wrã^oq: uau anb ap uaa'ãlsrf,l oqlrq un ê s?u'Bf,oJ ?Ì opuq r?qyrq apod 1os o anb erp ual
errglsrq rssou ep oeóenuquo: e : a:ol anbro4
opeues uJ âtro^ gs'sâssâ ouoJ s€rp ug opunu op Joreu r'epn8e ezalsut eun Btlo !J ze;sap as rapur anb o opnl enb erp uâJ'of,anq un ?f,rl er:8ap
ue anb o opnt atu:d:: ap g'er:uasn€ €ns € ?Joqtr op?qgs op ortru?Ìrs o'elâp âuou o zrp eroJ gÌ Ios o'ãJãqueuryoisÌ3ueJ{'r€d nes o oes anb srrp ua1,,
ItG
a
18 T. A. Bnowr'r

mente porque elas permitem a obtenção de uma Íìmostra pura de um gene individual, separa- dual- d
do de todos os outros genes da célula. conjun
gene d
1.5.1 lsolamento de genes por clonagem e SUaS i

Para entender exatamente como a clonagem pode produzir uma amostra pura de um gene, Na
considere o experimento básico da Figura 1.1, mas desenhado de maneira um pouco diferen- é acap
te (Figura 1.3). Nesse exemplo, o fragmento de DNA a ser clonado é um dos membros de uma clones
mistura de muitos fragmentos diferentes, cada um dos quais é portador de um gene diferente que c0
ou de parte de um gene diferente. Na realidade, essa mistura poderia ser todo o complemento sanimÍ
genético de um organismo - de um humano, por exemplo. Cada um desses fragmentos é in- gura l.
serido em uma molécula de vetor distinta, para produzir uma famflia de moléculas de DNA
recombinante, uma das quais é portadora do gene de interesse. Geralmente, apenas uma mo-
lécula de DNA recombinante é transportada para o interior de uma célula hospedeira indivi-

ox7
Frasmentosde DNA
aì "/

(
\---,/ ) \ construeão de moléculas
Vetores Oru recombinantes
\e

oo Cada recombinante
carrega um
fragmento diÍerente

/
lntrodução em bactérias

I
Plaqueamento

ooo
Cada colônia contém múltiplas Figura 1.3
cópias de apenas uma molécula A clonagem permite que
de DNA recombinante fragmentos de DNA indivi- Figur
duais sejam puriÍicados. O proden
sd(

iloriF:l \-H\ 'o:srruu3 e:rd :e


.. E

IE
ffi.5
I i:g


';;:e :1uo: r::etì odrüât ãÀ?:ì oNU ala .rnb rtci o :;qos oqlg o t-rtc{ .r,r;r:sa oru: y IE
: rrlolirq r Enuuuo-. ouro:'scdr:rrr-rd su:6nrosr.rd sop uirÌ tÌir,Ì oplrïnf ,.'ossr noursua au uanb a:ol toJ 'oq1g'elp orlno un a:dues ual s?W of,orlj L
Jpsrpgw'J oq:tuauanbr4ruaa'âtsÌrtoqlrqrunâs?u'?JoJeiopuq:rqpqapodlosoanberpua;'er:gtsrqrssoutpor5tnurtuo:r9a:olanb:o4 G
'opuuâs zÍJ ãlo gs'sJssâ ouo: serp ug opunu op f,oreu r'epn€e rzalsrr eun BtloÀ [ zegsap :s rapue enb o opnl anb erp uãJ'otr?Jnq un eJrl tr:8ap Uì
ua anb o opnt atuada: ap g'a:uasnr Ens E uorlJ oprqrs op orruãls o'âÌâp ãuou o zrp efoJ elÌos o'ã]ãÌ{u?urv'otrsrf,u?JJ'Ied n:s o ops anb strp uaa,,
a
Ct-orueeeu GÊNtcA E AruÁuse oe DNA 19

individual, separa- dual, de modo que cada clone contém múltiplas cópias de apenas uma molécula, embora o
conjunto final de clones possa conter muitas moléculas de DNA recombinante diferentes. O
gene de interesse está agora separado de todos os outros genes presentes na mistura original
e suas características específicas podem ser estudadas detalhadamente.
pura de um gene, Na prática, a chave para o sucesso ou o fracasso de um experimento de clonagem gênica
ira um pouco diferen- é a capacidade de identificar um determinado clone de interesse em meio aos muitos outros
dos membros de uma clones diferentes que são obtidos. Se considerarmos o genoma da bactéria Escherichia coli,
de um gene diferente que contém pouco mais de 4.000 genes diferentes, poderíamos, em princípio, considerar de-
todo o complemento sanimadora a tarefa de encontrar um determinado gene dentre todos os clones possíveis (Fi-
fragmentos é in- gura 1.4). O problema torna-se ainda mais assustador se lembrarmos que as bactérias são or-
de moléculas de DNA
, apenas uma mo-
la hospedeira indivi-

Uma porção muito


ÍrPE pequena do genoma
de E. coli
trpD

trN

trpB

trpA
\
O gene a ser
clonado

I
9
- =t unav

k
&--rry!é
tpE trpD
.
gsP A-. L

o
trpA

Figura 1.4 Como podemos selecionar


sejam purificados. O problema da ou identificar apenas um gene?
seleção.

srorlPl xuv 'orsouug errd

G

ra:oquo: r:.rcil odul?: a ãrl o?u .r13 :nb lzd o o;qos oqqg o r*d au:sa arur y IE
;Erro,rill s?nuuuo: ouro:'srzdr:uxd suaSmos;arÌ sop Mn elpJ opu?n|1.;ossr noursua auruanb elol rog'oqlll'Erp oJìno un::duas uet s?W'oJor{) L
Jp srp â mb^oq: uau anb erp uaa'âtsrn oqlrJqrun ã s?ru'?JoJ gl opurr reqp:q apod 1os o anb erp ua; er:91srq essou rp oe5rnuquo: e a a:ol anb:o4 IE
'oprluszq;âro^os'sssouoJserpug'opunuopJoreue'epnãrezalsrl?un?llo ll'ztysapasrapueanboopntenberpueaore:nqunuuer:8ap
era enb o opnl aluadar ep g'er:uasn? ?ns r €ior{f, op?q?s op or:uâIs o'âIâp âruou o zrp BJoJ gI Ios o '3Jâr{rnuv'oJsr:uerJ'r?d
rt
nes o oes anb serp ruaa,,

a
20 T.A.BRowN

ganismos relativamente simples e que o genoma humano contém aproximadamente 10 vezes cleotíden
mais genes. Contudo, conforme explicado no Capítulo 8, vrírias estratégias diferentes podem tas ofiia
ser utilizadas para assegurar a obtenção do gene correto ao final de um experimento de clona-
memo&
gem. Algumas dessas estratégias envolvem modificações do procedimento básico de clona- tmatfoã
gem, de modo a determinar que somente células contendo a molécula de DNA recombinante Umr
desejada possam dividir-se, fazendo com que o clone de interesse seja automaticamente sele-
de rmg
cionado. Outros métodos envolvem técnicas que viabilizam a identificação do clone a paÍir
aindaé r
de uma mistura de muitos clones diferentes.
Depois da sua clonagem, praticamente não existem limites pÍÌra as informações que po-
(r) nr
EN
dem ser obtidas a respeito da estrutura ou da expressão de um gene. A disponibilidade de ma-
frN
terial clonado estimulou o desenvolvimento de métodos analíticos para o estudo de genes,
com a introdução constante de novas técnicas. Os métodos para o estudo da estrutura e da ex-
ft
(F
pressão de um gene clonado são descritos nos Capítulos 10 e 11, respectivamente.
€$Ú

1.5.2 Isolamento de genes Por PCR (?JHá


FC
A reação em cadeia da polimerase também pode ser utilizada para a obtenção de uma amos- ctÍt
tra pura de um gene. Isso ocorre porque a região da molécula de DNA de partida que é copia- sÊÉ
da durante a PCR é o segmento delimitado pelas posições de anelamento dos dois oligonu- hü
Eo

Ack
ca fran
Frexer
.det."n
trpE
q[Ecrdg
fd isoh
trpD cmobs
trú E-
AlÉr
trpB de groc
õ€ryk
$Qts mmial
é ftÍrrl- 1
aro'f
Inffidos
gwllam
Reação em cadeia Lllmr
da polimerase
DIIìIA&
ewe&l
ção em
gEnl OE
mime
ft mnm
&{azo
dtir,furl I

Figura 1.5 rmml


x vários milhões
lsolamento de ge-
nes por PCR.

G
t
'::::rpro: L:,rrcl ocirÍit 3Àãt cd o ::r1os oqlg o r:vd aru:sr aru y
olu â[3 Jnb 'õ
ir:JÕì![Ì r Enuuuo,r ouro: 'sr:dr:rrr-rd su:5:losr:d sop [rn E]ieJ opu€n],, ossr noursuo au uanb a:ol ro{ oql5'rrp oJrno un ::duas ua1 s?W'oJorll L
Jp Brp â sm'â^og: uau anb erp uraa.âlsrrt oqllq un 9 s?u,rroJ gÌ opuqrnlprq apodlos o anb rrp uaa.errgtsrq essou €p o€5enuquo: r a a:ol anb:o4 G
'opnus zJ ?tro^ 9s'sssã ouof, s?rp uã opunu op roreu r'epn8e zalsrrt ?un etlo !J'zeJsap as rapur anb o opnl enb erp ua;'orernq un r:rl er:8ap Uì
ua anb o opru aluadar ep g'a:uasnr ?ns e ?Joqf, op?qes op ortruâ[s o'âlâp ãuou o zÌp ?]oJ EI los o'â3ârlueuryo3sr3u?f,J'Ìed nas o oes anb s€Ip uâL,
a
Clotueev GÊrurcn e ANÁLtsE DÊ DNA 21

.10
vezes cleotídeos iniciadores. Se os iniciadores anelam de ambos os lados do gene de interesse, mui-
diferentes podem tas cópias do mesmo serão sintetizadas (Figura 1.5). O resultado é o mesmo de um experi-
de clona- mento de clonagem gênica, mas o problema de seleção não existe, pois o gene desejado ã au-
ml básico de clona- tomaticamente "selecionado", em conseqüência das posições de anelamento dos iniciadores.
D\A recombìnante Um experimento de PCR pode ser completado em poucas horas, ao passo que a obtenção
:,maticamente sele- de um gene por clonagem pode levar semanas ou meses. Por que, entãã, a clonagem gênica
r do clone a partir ainda é uÍilizada? Isso se deve a duas limitações da pCR:

que po- (l) Para que os iniciadores posicionem-se corretamente, em ambos os lados do gene de in-
ilidade de ma- teresse, as seqüências desses sítios de anelamento devem ser conhecidas. É fácit sinteti-
!ì estudo de genes, zar um iniciador com uma seqüência predeterminada (ver p. 1g0), mas se as seqüências
'J,À estrutura e da ex- dos sítios de anelamento são desconhecidas, é impossível a produção de iniciadores ade-
rÊmente. quados. Isso significa que a PCR só pode ser utilizada para isolar genesjá previamente
estudados - o que deve ser feito por clonagem.
(2) Há um limite para a extensão de seqüências de DNA, as quais podem ser copiadas por
:ão de uma amos-
PCR. Cinco quilobases (kb) podem ser copiadas com relativa facitidade e pode-se lidar
com segmentos de até 40 kb com atilizaçáo de técnicas especializadas. Entretanto, tais
urtida que é copia-
segmentos são mais curtos do que a extensão de muitos genes, especialmente aqueles de
r dos dois oligonu-
humanos ou de outros vertebrados. Se é necessária uma versão intacta de um gene lon-
go, a clonagem deve ser utilizada.

A clonagem gênica é, portanto, a única maneira de isolar genes longos ou genes que nun-
ca foram estudados anteriormente. Mas a PCR ainda possui muitas aplicações impórtantes.
Por exempl_o, I4e-g$_o_que_g..qg$êlcia de q,p_ggng seja descoqhecida, ainda pode sei possível
adetgrminação de sgqgp.q-gla-s_.g2ropriadas para um par de iniciadóreg, ô9m uãsê no quêãõ
nheçld.q99tre,,9.geqtiQry.iggggggeqe eqq!y,91_qtte g{Lqm grgatilgg qlt"rylÈ. um
lene que
foi isolado e seqüenciado a partir de, digamos, ôaúunaongoì"ããii",'lìõ.tãrto, ser utilizado
como base para projetar um par de iniciadores pÍÌra o isolamento do gene humano equivalen-
te.
Além disso, existem muitas aplicações nas quais é necessário o isolamento ou a detecção
de genes cujas seqüências já são conhecidas. uma pCR de genes de globina humanos, por
exemplo, é úilizada em testes para verificação da presença de mutações que podem causar a
anemia hemolítica chamada talassemia. A projeção de iniciadores adequados para essa pCR
é fâcil, pois as seqüências dos genes de globina humanos são conhecidui. RpOr a pCR, as có-
pias dos genes são seqüenciadas ou estudadas de alguma outra maneira para determinar
se al-
guma mutação talassêmica está presente.
Uma outra aplicação clínica da PCR envolve a utilização de iniciadores específicos para o
DNA de um vírus patogênico. Um resultado positivo indica que uma amostra contém o vírus
e que a pessoa que a forneceu deve ser tratada para evitar o estabelecimento da
doença. A rea-
ção em cadeia da polimerase é exrremamente se-nsívrel: png_g_Ìg{Ì-tgg-e1q-_cui$-4$_o-p.g de C.e,eç4q
seia -qs4.+!!-*de-.s-d-""tççfues_de*_D']jÃËss'_q_qúgõ-bí;pêÃ".-,]-ã-ãolécuta de DNA na
mt"q191a rniqlll. rltq.pig{t"ifi-q"-a"que
t|í.c"!ig? é -c-gpaz dedetectar vírus nôs estágios mais iniciais
de uma infecção, arlm.qllan$o.as ôtranceJaè r"Càtro no t utu-ónto. Èsu gãno.
sensibilida-
de faz com que a PCR taúbèm possa ser utilizada com DNA proveniente de amostras
de me-
dicina legal, como cabelo ou manchas de sangue secas, ou até mesmo de ossos de pessoas
Figura 1.5 mortas há bastante tempo (Capítulo 16).
lsolamento de ge-
nes por PCR.

r.':::f \ì{Y 'r)-ì:tlu?-i:l ì'lr(l


o
z
*ú: o
IE @

'.r;r;r1tlr: rrerï ocìtt-ìJ 3af,1oÌu il3 Jnb ird o:;qos oqlg



o ur:d:,r.r:rsr::ri y G
ãp Erp ã w:à\oq:
L
uau anb erp uaa'âlsrrt oqluq un e seu'uoJ gl opuq:rqp:q apod 1os o :nb rrp ue1'euotsrq rssou rp oe5enurluo: r e a:ol anb:od IE
'oPuues uJ âJo^ os'sâssã ouoJ sEIp ug'opunu op roreu e'epn8e ezalstJl ?un
€lÌo iJ'zrgsap as rapur anb o opnt anb erp uaa.o:r:nq un r:n eu8ap
ua anb o opru aluad:r ap E-rr:uasnB ens ? ef,oqtr op€q€s op orJuãIrs o 'âlap âuou o zÌp eloJ ?l
o
los o.âJârlueuv.of sÌJuef,J,rrd nes o ots anb s"p *".1^,

a
20 T. A. Bnowlr 22 T. A. Bnowrrr

gamsr 1.6 como encontrar o seu caminho ao rongo deste Iivro tc*i
mais 1

uti
ser
Este livro explica como a clonagem gênica, a pcR e outras técnicas de análise de llnmrlllt,
gem.. executadas e descreve as aplicações dessas técnicas na biologia moderna. As apli llllhÌru

gem' I
cobertas nas segunda e terceira partes do livro. A Parte2 descreve como genes e ge i$nnuurrn:,

desejr estudados, enquanto a Parte 3 considera as diversas aplicações da clonagem gênica e LrulilltliltüÌi

ciona na biotecnologia, na medicina, na agricultura e na ciência forense.


ïllllrruurLrdurn

de un
lLtì1ffiÌltilíiilrÍrrL

Na Parte 1, abordamos os princípios básicos. A maioria dos nove capítulos é <


Dr clonagem gênica, pois essa técnica é mais complicada que a pcR. euando você ti iililìtlúillliliïj
dem s
dido como é realizadauma clonagem, játeráentendido muitos dos princípios básicos
terial todologia de análise do DNA. No capítulo 2, tratamos do componente central de um
'ltlìrurmnrunr

ihttut
com a
mento de clonagem - o veículo - que transporta o.gene para o interior de uma célula
pressí
deira e é responsável pela sua replicação. Para funcionar como um veículo de c
molécula de DNA deve ser capaz de entrar em uma célula hospedeira e, uma vez no
1.5.2 lsolar da mesma, deve replicar-se para produzir múltiplas cópias de si mesma. Dois tipos
A rea culas de DNA que ocoÍïem naturalmente satisfazem essas exigências:
tra pu
da du (1) Plasmídeos, que são pequenos círculos de DNA encontrados em bactérias e em
outros organismos. os plasmídeos podem replicar-se independentemente do
mo da célula hospedeira.
(2) cromossomos virais, em especial os cromossomos de bacteriófagos, que são
infectam especificamente bactérias. Durante a infecção, a molécula de DNA
riófago é injetada na céluÌa hospedeira, onde irá replicar-se.

o capítulo 3 descreve como o DNA é purificado a partir de células vivas - tanto


que será clonado quanto o DNA do vetor - e o capítulo 4 cobre as várias técnicas
nipulação em laboratório de moléculas de DNA purificadas. Existem muitas técnicas
so, mas duas são particularmente importantes para a clonagem gênica. A primeira é
gem de um vetor em um ponto específico e a segunda, a sua reparação, de modo a i
gene no veículo previamente clivado (Figura 1.1). Essas e outras técnicas de manipu
DNA foram desenvolvidas como subprodutos de pesquisa básica sobre a síntese e a
ção de DNA em células vivas, sendo que a maioria delas faz uso de enzimas puri
jas propriedades e modo como são utilizadas em estudos envolvendo DNA são
Capítulo 4.
Depois de uma molécula de DNA recombinante ter sido construída, ela deve ser
célula hospedeira, de modo que a replicação possa acontecer. o transporte para o inter
lula hospedeira faz uso de processos naturais para a incorporação de moléculas de D
midial ou viral, os quais, assim como o modo como eles são utilizados na clonagem g,
descritos no capítulo 5. Nos capítulos 6 e 7, são apresentados os tipos mais importan
tores de clonagem e discutidas as suas utilizações. Para concluir a cobertura da clon
nica, tratamos, no Capítulo 8, do problema da seleção (Figura 1.4), antes de
Capítulo 9, a uma descrição mais detalhada da PCR e das técnicas relacionadas a ela

:-j I '\ >: ri :ì'.lJ i,Ìl'!j o


2

t!
*t: 9
t

':;:rrlrro: r;rr1 oc{ur:t f,,\31 otu f,13 Jrrb trrl l lrlor or11rq o t.ttcl:,r:::s: ettrt y
L
ftu'ê-\oq: uau anb erp u:1 âlsrtrt oq[]q un e s?ru'eroJ el opuq reql:q epod yos o enb erp uaa trrglsrq essou tp ot5tnurluo: t a acol anbro6
ap rrp ã G
opuuâs z,J âro-\ os'sãssã ouof, srrp ug'opumu op rorru r'rpn8r rz:tsrrt ?un ttlo :J'ze3sap as rapur enb o opnt anb trp uãI ofernq [Ín €f,Il er:8ap UI
a: :nb o opn: :ru:d:: ap E tr:uasnE Èns È eroqf, opeqgs op oÌf,uêIs o'âlâp auoü o zrp €loJ €l Ios o ':lâqu?uv otrsllutrJ 'Ied nas o oes anb s?IP uãJ!,
a
Cnpírurc 2
Veículos para a Clonagem Gênica:
Plasm ídeos e Bacteriófagos

Plasmídeos. 25 Bacteriófagos, 30

Para ser capaz de afuar como um veículo para a clonagem gênica é necessário que uma molé-
cula de DNA apresente viírias características. Ainda mais importante é que tenúa capacidade
de replicar-se nointerior da célula hospedeira, de modo que numerosas cópias da moiécula de
DNA recombinante pobsam-se*qroduzidas e passadas às células-filhas. Um veículo de clona-
gem também deve ser relativameàte pequeno, preferencialmente com um tamanho inferior a
10 kb, pois grandes moléculas tendem a quebrar-se durante a purificação e são mais dificeis
de ser manipuladas. Dois tipos de moléculas de DNA que satisfazem esses critérios podem ser
encontrados em células bacterianas: plasmídeos e cromossomos bacterianos. Embora os plas-
mídeos sejam utilizados com mais freqüência como vetores de clonagem, dois dos mais im-
portantes tipos de vetor em uso atualmente são derivados de bacteriófagos.

1 Plasmídeos
Garacterísticas básicas dos plasmídeos
Plasmídeos são moléculas de DNA circulares que têm uma existência independente na célu-
la bacteriana (Figura 2.1). Os plasmídeos quase sempre são portadores de um ou mais genes,
que, com freqüência, são responsáveis por características úteis apresentadas pela
bactériã hos-
pedeira. Por exemplo, a capacidade de sobreviver em concentrações normalmente tóxicas
de
antibióticos, como cloranfenicol ou ampicilina, é muitas vezes devida à presença na bactéria
de um plasmídeo portador de genes de resistência a antibiótico. Em laboratório, a resistência
a antibiótico é freqüentemente utilizada como um marcador selecionável paÍa
assegurar que
as bactérias em cultura contêm um determinado plasmídeo (Figura2.2).

urotrF:[ ruv 'o:srrurr; ert;d

G
::::quo:r J ;t orÌr :13 êab

r::ecl oc{rüât rtd o arqos oqlg o txd a,r:r:s: :ru y G
i rtrosÍq p Enunuo: ouro: 'srcdnur-rd suaisrros::d sop urn elïE_l opu:n|1.,.ossr nounua aur uanb ero,t rog .oq1g."rp orraà *.lld*",
-.r ,"ry.-oq, L
âPZIP â sru'ã^oq: uau enb erp uaa'ãlsrll oqlrJq un g s€u'Er.lt opurr:eqprq apodlos o anb rrp uea'euorsrq essou ep otSenuDuo: r a a:ol anb:o4
'opqus zçâJo^ os'sas ourotr seÌp ug.opunu op Joreur e,rpn8e9l ezelsrJl Eun
r!
?lÌo^ A.zJsap es rapue anb o opnr enb rlp uaJ.orerrq *o ,r^ ,rÉr[
aa enb o opru elueda: ap g'er:uasn€ ens ? BJoqf, op?qrs op orJuãlrs o'ãlãp âuou o zrP ?rcJ o'arrqr"rry.o:sr:uag,rud nas o oes anb wrp uraa,,
rt
911o,

a
26 T. A. Bnowru

frtuo
ÍsrDlI
Plasmídeos nr-ËEfiü

nepüçi
Plasmídeos
roçcooü
nfunr1
Figura 2.1
rt4õmcr
Plasm ídeos: elementos genéti- @ffir
Cromossomo bacteriano cos independentes encontra- E&NmlÍI
dos em células bacterianas. CUECNÍrc
EisdcÍe$r
-
Tlgúor
-
Otmanlnr
Resistência à ampicilina Ftuàdm
mhoid
(TftlaLl)

Resistência à tetraciclina

Células de E. coli,

o O 6., algumas contendo RP4

o oox
O \-i @Cétutas com o plasmídeo
\ OCétutas sem o ptasmídeo
\
/ \

Figura2.2
O uso de resistência a antibióti-
co como um marcador selecio-
nável para um plasmídeo. O
plasmídeo RP4 (no topo) é por-
-_,,.7t, tador de genes de resistência à
Meio de Meio de multiplicação
ampicilina, à tetraciclina e à ca- nln23
multiplicação
normal -
+ 50 pg/ml
tetraciclina
namicina. Somente as células EffiS
sem antibiótico de E coli que contêm RP4 (ou
I
I
I um plasmídeo aparentado) são ttslrm
V
Todas as células
V
Somente células contendo
capazes de sobreviver e multi- ffio
plicar-se em um meio com
capazes de RP4 podem multiplicar-se
multiplicar-se quantidades tóxicas de um ou úGüíbil
mais desses antibióticos.

)
erorrp:l Xuv | 'o:sr:uer3 e.rrcl

G
':c:cquo:r urtl odu!ât 3Àat o!ü âlã .nb nd o ::cps oqlg o ur:d u:::s: :rru y

IE
jEriotìtÌ Ë Enuuuo: orro:'srzdr:ur,rd suaËerros-rar{ sop rtrÌÌ r:t.ir-} opu?n},.'ossr noursua au uanb a:ol rog'oq[g'erp o]lno m a:dures ural s€W.oroq3 L
.p 9-*'*oqr
'orj'ilB
"gp
zg eJo
uau uaa'ãlsrrl oÌIprq un e sru'BroJ ?l opuq reqprq apod 1os o anb rrp uaa'errgrrrg
anb rrp
"rror "p
ogì".rrrro, . .ro rràrod
ouotr srD ugopunü op Jorcu e'epnBe ezalsrt Eún w)o g'zglsap as.rtpue anb o opnl anb grp sal'otetng "un u.u euãelt
gs'sâssâ
$
ttt
aa anb o opnl aluada: ap g'enuasne ens ? eroqJ opeqús op ortruâIs o 'êlãp âruou o zrp eJoJ 9l Ios o 'âlâquBuy'o:sr:uerg 'red nas o oes anb serp ruaa,,
a
Croruaeeu GÊNlcA E AuÁrtse oe DNA 27

o
ra a produção de suas cópias, enquanto alguns dos plasmídeos maiores são portadores de ge-
nes que codificam enzimas especiais, as quais são específicas para a replicação plasmidial.
Alguns poucos tipos de plasmídeos são também capazes de replicar-se a partir da ry3 in
serção no cromossomo bacteriano (Figura 2.3b). Tais plasmídeoíìãtegratFõíouffisoirios
elementos genéti- porí aol@
encontra- R ïndepénilãntêíã ïméghção támbéú
células bacterianas. ïõrnossornõí'dè baciêriófago3, que serão descritos
mais detalhadamente quando forem considerados (p. 31 ).

2;Nz Tamanho e número de cóPias


O tamanho e o número de cópias de um plasmídeo são importantes sobretudo no que diz res-
peito à clonagem. Já foi mencionada a relevância do tamanho do plasmídeo e afirmado ser um
tamanho inferior a l0 kb desejável para um vetor de clonagem. O tamanho dos plasmídeos
(Iabela 2.1) vana entre aproximadamente 1,0 kb, para os menores, até mais de 250 kb, para

(a)Plasmídeonão-integrativosmídeos

ffilW oâ
o-
,
Cromossomo bacteriano

(b) Epissomo

)-O
Cromossomo Portador
Cromossomo bacteriano do plasmídeo integrado
PlasmÍdeo

a antibióti-
nrmarcador selecio-
plasrnídeo. O
{no topo) é por-
Á,u,"^o""rrr\

@@
de resistência à
eaca- Figura 2.3 /\
as células Estratégias
RP4 (ou de replicação
sao de (a) um
e multi- plasmídeo
com não-integrati-
de um ou vo e de (b)
um epissomo.

o
.- z

IE
*g'i o
6

'-r-rf,3rìtror l:rd ocitur.l il:l oru r1o :nb ltrl o o;qos ot115 o r:rd rrsllsf, JtÌll V G
L
oqlrq un 3 sru'eroJ ?Ì opurT rtqprq apod 1os o anb rrp uaa er:91srq tssou ep og5tnurluo: t a a:ol anb:od G
,p rrn t o-.1-q: uau anb erp uaa'ãtsrJl
.opouãs zJ âf,o gs,sãsse ouof, serp uã opunu op rowu e'epn8t ezatsrrt Eun ?tlo
:J'zegsap :s reput anb o opnl anb ap uâI'of,?f,nq un ?rn er:8ap
rt
aa anb o ãpnr aruadar ap g a:uasne Ens e eJoqtr oprqrs op orJuâ[Is o'ãlâp âuou o zrp ?troJ 9l los o 'â]equeuv oJsrf,utrg 'Ied nes o ots enb sEIp ueJ,,
a
28 ï A. Bnowlr

Tabela 2.1 Tamanhos de plasmídeos representativos

Tamanho
Extensão de Massa molecular
Plasmídeo nucleotídeos (kb) (MDa) Organismo

pUCS 2,1 1,8 E. coli


lilffirglci
ColEl 6,4 4,2 E. coli
odhnkh
fim.ttl A$cÉf
RP4 54 36 Pseudomonas e outros lürafË
F 95 63 E. coli ummmfi"rrt
TOL rt7 78 Pseudomonas putida Mrlegrb n
pTiAch5 213 142 A g ro b ac t e rium tumefac ie ns ,ffiXra-l
íih@E€ntËi
üllfhmceff
rffitËr
os maiores, de modo que apenas poucos deles são úteis para autilizaçáo em clonagem. Entre- ffiria- n
tanto, conforme descrito no Capítulo 7, plasmídeos maiores podem, sob alçumas circunstân- @mfirmítnd
cias, ser adaptados para a clonagem. @uffiGWE*
a ürrlllEnF pe
O número de cópias refere-se ao número dè-moléculas de um determinado plasmídeo que
são encontradas normalmente em uma célula bacteriana individual. Os fatores que controlam o 'ffi@Err
número de cópias não são bem-compreendidos, mas sabe-se que cada plasmídeo possui um va-
lor característico, que pode ser de apenas um (em especial para as moléculas grandes) ou igual
ou maior do que 50. Via de regra, um vetor de clonagem útil deve esta.r presente na célula em
múltiplas cópias, para que grandes quanúdades da molécula de DNA recombinante possÍìm ser 'elí Classific
obtidas.
A classifir
trcrí$[iqa cl
2.1.3 Conjugação e compatibilidade
ffiffiõs
Os plasmídeos são divididos em dois g*po!.onlugativos e não-conjugativos. Os plasmí-
deos conjugativos são çarccÍeizados pela capacidade de promover a conilgação sexual en- íll Ph
tre células bacterianas (Figura 2.4),umprocesso que pode resultar na propagação do plasmí- üÍn
deo conjugativo de uma célula para todas as outras células de uma cultura bacteriana. A con- jus
jugação e a transferência do plasmídeo são controladas por um conjunto de genes de trans- í!) Ph
lt
ferência, ou tra, que estão presentes em plasmídeos conjugativos, mas ausentes no tipo não- resis
I conjugativo. Um plasmídeo não-conjugativo pode, contudo, sob algumas circunstâncias, ser oÍr
co-transferido juntamente com um plasmídeo conjugativo, quando ambos estão presentes na pÍop
mesma célula. tlËtx
Vários tipos difererltes de plasmídeos podem ser encontrados em uma mesma célula ao n4s-
l
I mesmo tempo, incluúe mais de um plasmídeo conjugativo diferente. De fato, sabe-se que
células de E. coli podem conter simultaneamente até sete plasmídeos diferentes. para serem
Étfr
I
Cotr
i
ii
capazes de coexistir na mesma célula, os plasmídeos diferentes devem ser compatíveis. Se l{l Plas
l dois plasmídeos são incompatíveis, então um ou outro será rapidamente perdido pela célu- tïnu
Ì
I
la. Diferentes tipos de plasmídeo podem, portanto, ser classificados dentro de ãiferentes l5l Ptrn
grupos de incompatibilidade, com base na possibilidade ou não de coexistirem na mesma pbfl
t
célula. Os plasmídeos de um mesmo grupo de incompatibilidade são freqüentemente simi- tas d
I

I lares entre si quanto a vários aspectos. A base da incompatibilidade não é bem-compreen-


I'
dida, mas acredita-se que eventos que ocoffem durante a replicação são os responsáveis pe-
Ì

1o fenômeno.
2.15 Plasmídc
l

','
O fam de(
qrs ela ta
t 7âÍto é o d
È_
r.roìrrf y >rv -..,''
| ',,'., , '.r,'.,
o
2
*Ë5g
G 6

'-r:::rluo: rrcd ocftü.r:l ã^Jl olu Jla inb rrd o :;qos



oq13 o r;rrd :,r.r::sl aru y G
ep eÌp e sstu 'ã oq: uau enb rrp ua; elslr oqIJq un ã s?u'BroJ
L
9l opu-ÌÌ leqyrq apod 1os o anb erp uaa er:grsrq essou rp oeórnurluo: r a a:o,r anbro4 G
'opÊuâs zJ âro^ os'sãssa ouotr srrp ug.opunu
ao enb o opnl aluadar ap g'tr:uasnt
op rorrur e,epn8r ezatsrJt ?un €lÌo
?ns 3 ?Jorp op€qts op orf,uãÌrs
:[.ze;sap :s repuÃnb o opìl ..b rrp *ea.o:ernq urn r:n er:5ap
o'âlâp ãuou o zÌp rrog o..Dqreurv.o3sÌJw.rJ,red nas o on anb selp uâL,
rt
"11o,
a
Ct-oruncev GÊurcn e ANÁLtsE oe DNA 29

Célula doadora Célula receptora

Íganismo

Figura2.4
coli TransÍerência de plasmídeo entre
coli células bacterianas por conjuga- Plasmídeo conjugativo
ydomonas e outros ção. As células doadora e recep-
nli tora fixam-se uma à outra por
domonas putida uma Íímbria, um apêndice oco
presente na supedície da célula
fucreium tumefaciens doadora. Uma cópia do plasmÊ
deo é, então, passada paraacé-
lula receptora. Acredita-se que a
transÍerência ocorra através da
Ìão em clonagem. Entre_ fímbria, mas isso ainda não Íoi
l $ob algumas circunstân_ comprovado. A transÍerência por
J

rnunado pÌasmídeo que


tuores que controlam o
outros meios (por exemplo, dire- i
tamente pelas paredes celulares !
das bactérias) permanece sendo
o o
,
uma possibitidade.
possui um va- J
las grandes) ou igual
u'esente na célula em
binante possÍÌm ser 2,1.4 Classificação dos plasmídeos
A classificação mais útil dos plasmídeos de ocorrência natural é baseada na principal carac-
terística codificg!3leleqggng!{lasmidiais. os cinco principais ripos de plasmídeo,
de acor-
do com essa classificação, são osiegÍúteì:-
_sú"rtlos. Os plasmí_
\
sexual en- (l) Plasmídebs de fertilidade ou "F' cÍìrregam apenas genes trae não possuem qualquer
ão do plasmí- outra caracteística além da capacidadei€ promoverem a transferência plasmidial con-
:ucteriana. A con_ jugativa. Exemplo: plasmídeo F de E. coli.
re *genes de trans_ (2) Plasmídeos de resistência ou "R" caÍïegam genes que conferem à bactéria hospedeira
s no tipo não_ resistência a um ou mais agentes antibacterianos, como o cloranfenicol, a
iïrürostâncias, ser ampicilina ou
o mercúrio. Plasmídeos R são muito importantes para a microbiologia cÍnìca, pois
a
presentes na propagação dos mesmos em populações naturais pode ter sérias conseqüências
no trata-
mento de infecções bacterianas. Exemplo: Rp4, comumente encontrà do em pseudomo_
ürmsúna célula ao ^-- -
') (3)
ocorre_ndg rambém em muiras oìúãÀ uâòieú;
ii,uru,r" sabe-se que "ry.ryas
Plasmïiteós-eol codificam ôôtiõinas. pïoti:inas-qìé mã.ram outras bacrérias. Exemolo
Exemplo:
Para serem ColEl de E. coli.
(4) Plasmídeos degradativos permitem que a bactéria hospedeira metabolize
moléculas in-
pela célu- comuns, como o tolueno e o ácido salicílico. Exemplo: ToL de pseudomonas putida.
üe diferentes (s) Plasmídeos de virulência conferem patogenicidade à bactéria hospedeira.
Exemplo:
na mesma plasmídeos Ti Agrobacterium tumefociens,que induzem
de to-or", de galha em plan-
slml- tas dicotiledôneas.
n-
els pe-
2.1-5 Plasmídeos em outros organismos que não bactérias
O fato de os plasmídeos serem bastante comuns em bactérias não implica, de
maneira alguma,
que eles também o sejam em outros organismos. O plasmídeo eucariótico
mais bem caracteri-
zado é o círculo de 2 pm, que ocoÍïe em muitas linhagens da levedura
Saccharomyces cerevi-

IE
*çi o
t
if::''r]:-!.:ì:::rLro-ìoliior's.r.r,ur-rtÌs,e.ruos'rlserprunrrr.lopurnf;]ï:i:::lr:l*tff;:'":ï;'iulfïJ;iï:'ji::Í;üïr"r: 'õ
Jp Erp ã su:âaoq: uau anb erp uaa âlslr oqll]q un t"*'".ã-1^91 opt.r1*qprq
9 apodlos o anb erp uaa.rr:grsrq essou ep or5rnurruo: t a
L
'oPÌluâs nJ JJo-\ os'sessâ ouof, e:ol anb:od G
s'rp uA.opunu op ror"-
ae :nb o opru aluada: ap g'er:uasne Ens t ef,oqtr op"q", "."p.3" "r.lrr, "*. "rio^
g.r"3r.p ., ,.prÃrt á op.r ..b
op oìrr"1* o'ayap aurouo zrp r.áj "rp,ra1.o:rrnq
o,...qr?uv.ofsrJurf,J,red
un rru.r8ap
nas o ors anb selp uq1 ..
o
"11o,
a
30 T. A. Bnowrrr

siae. A descoberta do plasmídeo de 2 1tm teve um impacto bastante positivo, pois permitiu a
construção de vetores para a clonagem de genes utilizando esse organismo de grande importân-
cia industrial como hospedeiro (p. 140). Contudo, a busca de plasmídeos em outros eucariotos
(como, por exemplo, fungos filamentosos, vegetais e animais) mostrou-se infrutífera, suspeitan-
do-se que muitos organismos superiores simplesmente não abrigam plasmídeos no interior de
suas células.

2.2 Bacteriófagos
2.2.1 Características básicas dos bacterióÍagos F

Bacteriófagos ou fagos, como são comumente conhecidos, são vírus que infectam especifica- Os dois tipos prit
estrutuÍa de Íagos: (i
mente bactérias. Como todoyos vírus, os fagos possuem uma estrutura bastante simples. Eles
e cauda (por exe
consistem meraríente eì-íma molécula de DNA (ou, ocasionalmente, de ácido ribonucléico
{b) filamentoso (po,r
IRNAI) portadora de alguns genes, inclusive vários para a replicação do fago, envolvida por
uma cobertura protetora ou capsídeo, formada por moléculas protéicas (Figura 2.5).
O padrão geral de infecção, que é o mesmo para todos os tipos de fago, é um processo de
três etapas (Figura 2.6).

(1) A partícula do fago fixa-se na superfície externa da bactéria e injeta o seu cromossomo
de DNA no interior da célula.
i

I
(2) A molécula de DNA do fago é replicada, leralmente por enzimas específicas, codifica-
das por genes do seu próprio cromossomo.
(3) Outros genes do fago dirigem a síntese dos componentes protéicos do capsídeo e novas
I partículas virais são montadas e liberadas da bactéria.

Com alguns tipos virais, todo o ciclo de infecção é completado de forma muito rápida,
I possivelmente em menos de 20 minutos. Esse tipo de infecção rápidaé chamado de ciclo líti-
i co, pois a liberação das novas paqtículas virais está associada à lise da célula bacteriana. O as-
I pecto mais caraóterístico de umficlo de infecção lítico é oÉìo Ua síntese das proteínas do
I
capsídeo ocoÍrer imediatamente após a replicação do DNA do fago, cujas moléculas nunca
são maltidas em uma condição estável na célula hospedeira.

2.2.2 Fagos lisogênicos


Diferentemente de um ciclo lítico, a infecção lisogênica é caracteizada pela retenção da molé-
cula de DNA do fago na bactéria hospedeira, possivelmente ao longo de muitos milhares de di-
visões celulares. Com muitos fagos lisogênicos, o DNA viral é inserido no genoma bacteriano,
de uma maneira similar à inserção epissômica (Figura 2.3b). Aforma integrada do DNA do fa-
go (chamada de profago) é quiescente e a bactéria portadora (referida como um lisógeno) é, em
geral, fisiologicamente indistinguível de uma célula não-infectada. Entretanto, o profago acaba
sendo liberado do genoma da bactéria hospedeira e o fago reverte para o modo lítico, lisando a
Fïgura 2
célula. O ciclo de infecção O" l"-Ua. (I),rlq&gg lirgJgqqslpic!, q lqoJg$_qe_ryegra21_
O padrão geral de i
Um número limitado de fagos lisogênicos segue um ciclo de infecção diferente. Quanclo bcçao de uma célu
M13 ou um fago aparentado a ele infecta E. coli, novas partículas virais são continuamente bacteriana por u
montadas e liberadas da célula. O DNA de Ml3 não é integrado no genoma bacteriano e não se bacteÍióúag
torna quiescente. Com esses fagos, a lise celular nunca ocoffe e a bactéria infectada pode conti-
nuar a crescer e a dividir-se, embora a uma velocidade menor do que a de células não-infecta-
das. A Fìgura 2.8 mostra o ciclo de infecção de Ml3.

ri(\rIÊ:l \ìy 'o..r'.'u".t, L'r,'a


|
IE

'-r::oririo: ilê .rnb ttd o lqos ot11g o t:r:d :,ur:sr azur tr
rrecl ocirs:rt 3:\a] oïrr IE
; r: joljrrl r ErÌunllo-ì ouio: 'sietl:ur-rd su:5aros;rrì sop urn et1:,y opu:n)., ossÍ noursuâ ãu uanb a:ol rog or{Ig'trp oflno un a:duas uet se141'oroq: L
âp srp J ffi'â^oq: uau anb erp uaa'ãtsrrt orÌlrJq un ã s?u'?JoJ gl opu{reqp:q apod 1os o anb zrp u:1'er:otsrq tssou ep ot5enuguo: e a a:ol anb:o4 G
'opnuâs uJ âJo^ os'sossâ ourof, sBrp ug'opunu op Jomu e'rpn-8e ezatsrJt ?un ?lIo g'ze3sep as rapue anb o opnt anb erp uâJ'o3ef,nq un ËJrl er:8ap o
aa :nb o opru aluadu ap g'rt:uasn? Bns r eJorlf, opeqgs op oÌiualÌs o'alãp ãruou o zlp ef,o; 9l Ios o 'alãqueuv'of,slf,uef,C 'Ed nes o ots anb sap uaa,,
a
Cr-orueceu GÊuca e ANÁLtsE oe DNA 31

positivo, pois permitiu a


de grande importân-
em outros eucariotos
infrutífera, suspeitan-
no interior de Moléculas
de proteína
(capsídeo)

Figura 2.5 Molécula de DNA


infectam especifica- (ls dois tipos principais de
bastante simples. Eles ffrürra de Íagos: (a) cabeça
de ácido ribonucléico .- ccilrda (por exemplo, l,) e
,ffi flamentoso (por exemplo, (a) Cabeça e cauda (b) Fitamentoso
do fago, envolvida por
M13).
(Figura 2.5).
fago, é um processo de

o seu cromossomo

específicas, codifica- Partícula do fago


DNA
do capsídeo e novas

1 O Íago Íixa-se à bactéria


de forma muito rápida, e injeta o seu DNA
é chamado de ciclo líti-
bacteriana. O as-
tese das proteínas do
cujas moléculas nunca

pela retenção da molé-


muitos milhares de di-
no genoma bacteriano,
do DNA do fa-
3 Os componentes do capsídeo são sintetizados,
componentes I
novas partículas são montadas e liberadas
umlisógeno) é, em do capsÍdeo i
o profago acaba
modo lítico, lisando a
Figura 2.6
na 2.7.
Opdrão geral de in-
diferente.
lhçãode uma célula
is são continuamente bacteriana por um
bacteriano e não se bacterióÍago.
ia infectada pode conti-
de células não-infecta-

ËoriFf l(ìlv 'o:souer3 r:ecí

IE
t
'-rr:;rJuo: e:ecl ocini:t eÀãt olu âlê f,nb rttl o c;qos oq15 o r:rrJ:,r;::sa azur y 'õ
;trfo, rsq E ?nuuuo: ouro:'stednur-rd suaâuuosr:d soF rrrn e.Ìp; opu?n)., ossr noursua au uanb a:ol ro{ oqlg '?rp oJlno urn a:duas ual sBW'oJor{J L
aP srP â s?rrr'â^oqr tuau anb erp uaa'ãtslr oq1rrqun â seu'ef,oJ ?l opuÌT Jeqp:q epod 1os o enb rrp uea'errgtrsrq essou ep orSenurluoc e 9 a:ol anb:o4 G
'opÌluszqtâtro^c'ssouolseÌpug'opunuoproÌeur'epn8eezalsr:teunello
ua enb o optu eluadar ap g'tnuesne ens ? ?Jor{J op?q?s op onuãTrs
!J'zeJsapasrapuzanboopnlenberpuaa'o:anqunerler:8ap
o'ãlâp ãuou o zrp eroJ gl los o 'ãtrâr{ueulr'otrsrtru?J{'red nes o oes enb serp uaa,,
o
a
32 ï. A. Bnowlt

{
I Apesar de haver uma variedade muito grande de bacteriófagos, somente À e M13 chegaram .A n,ljr,à
a desempenhar papéis importantes como vetores de clonagem. As propriedades desses dois fa- lïÌlbfitulr&. flq
I gos serão agora consideradas com maiores detalhes. ,dirr**:'- ts f,c
I
I
\, 'cudus
F:gu
Organização gênica na molécula de DNA de ?', lrtrTars.lË I
gf:ïi3ì ;ü'É i
O l, é um exemplo típico de fago de cabeça e cauda (Figura 2.5a). O DNA está contido na es-
trutura poliédrica da cabeça e a cauda serve para fixar o fago à superfície bacteriana e injetar
o DNA na célula (Figura2.1).

Uma partícula do fago À


fixa-se a uma célula de
E. coli e injeta o seu DNA

-{ï de ì" circulariza DNA de À

Cromossomo bacteriano

/\
/ \ Divisão celular
/ \_
Fr$üe Zg
ffiii,iurrMtM m nitsaÇe':
üm Mrnercfu3r
rirri' :? .

lndução:
\
A O DNA de À desliga-se do
cromossomo bacteriano

B Novas partículas do fago sãd


produzidas (ver etapas 2 e 3
da Fig.2.6)

Gs' Êigura2.7
O ciclo de inÍecção lisogêni-
ca do bacterióÍago 1".
@
i nnwopr

uEÍ'Ës
nm ftLrr"ncËes
Ftgul
!E..l€tco
rÍíIrÌ0ffir,."arl* as Dí35
pgr3rri"a.!
acs
r,"enmcs de
ag
g

. ::il \ì\' I

|
'o...r..rir'.r1 , rlcÌ
o

ÍE
*s1 o
6
ì
',Lr:-.orÌuo: u:rlcdÌu;t J ìl oru Ji3 Jnb re d o ::qos or11ll o urd ;r:::rs.. :rut y 'õ
L
ãp Erp: su'â-\oq: ueu anb erp ual otsrJt or{lrf,q un ê sBu'ero.1 e[ opurT Jeqp:q apod 1os o anb erp ua1'er:glsrq rssou ep oe5enuquo: e a elol enb;o4 IE
oprluas ze_ì JJo-\ os'sâssê ouof, srrp ug'opunu op Jorru e'epn8e ezalsrJl ?un €tIo^ ã zt;sap as repur anb o opnt enb trp uaa o:z:nq un un er:8ap
e:e anb o opn: atu:d:: :p E rr:uasn€ €ns € rroqf, op€qgs op oÌJuaps o'âIep ãuou o zrp uoJ rl Ios o'elêquelüV'otrsnueq'rrd nas o ors anb s?lp u{,,
o
a
Cronneenit GÊnrcn e AruÁuse oe DNA 33

somenteÀeMl3chegaram A molécula de DNA de ì", que tem um tamanho de 49 kb, vem sendo extensivamente es-
ropriedades desses dois fa- tudãATõiËõììõïEhãËëãfu-dõ'€êÌfi õÕ6sõq*ri-en6iã*;íàa"ïm.Emconseqüência
disso, as posições e as identidades da maioria dos genes da molécula de DNA de l, sãoionhe-
cidas (Figura 2.9).Uma característica do mapa genético de À é que os genes relacionados em
termos de função estão agrupados em regiões específicas do genoma. Por exemplo, todos os
O DNA está contido na es- genes que codificam componentes do capsídeo estão agrupados no terço esquerdo da molécu-
perffcie bacteriana e injetar

Fago M13

Fímbria-- DNA de M1 3

O fago M13 fixa-se a uma


fímbria de uma célula de
E. coli e injeta o seu DNA

do DNA de Mt3

Novos fagos Ml3


,rã.ffi"
\enlicaeão
tt
são continuamente f o o" ìm È"go.

::iJ#ff":iii"U% - M13

,m#
de M13
I \ o..u,,ll'i.ïl:ï;"."-^
ffi / \:ïllïïã,i3crescer

\...-
Figura 2.8
O clclo de inÍecção
do bacteriófago
M13.

Figura 2.9
O mapa genético de À,
mostrando as posições
2.7 dos genes importantes e
de infecção lisogêni- o 2 4 6 810 12 14 16 1820222426?83032343638404244464849kb
as Íunções dos agrupa-
do bacterióÍago ),. mentos de genes.
íü u;

:_iLìtil:J \ìlv o

IE
#*Ë
'o

t

'::::r1rro:r L:,rrci ociltJl oÀJt Õïu ilo .lnb rrii <t ottlos or11g o :-lrd art;rsr ::ur y
L
âp arp â sru 'a oqr uau anb erp uaa.ãlsrrt orl1uq un 9 s?u,ero; ?l opuq reqp:q apod 1os o anb erp uaa.rr:glsrq essou ep orSenu4uo: r a a:ol anb;o4 IE
'oPDu$ zJ âloÀ os'sâssâ ouof, s?Ip ug opunu op forru r'epn8e rzalsut eun Btlo UI
!J'ze3sap as rapur anb o opnl anb rrp ual'otr€Jnq un ?Jrl er:Sep
na :nb o optu aluada: ap g'trtuasm Bns e ?f,oqJ op?q9s op ortruâls o'âlâp ãuou o zÌp eJoJ €Ì Ios o'â]âqueruy'ofsrfu?:{'red nes o ors anb srlp uJL,
a
34 T. A. Bnowlr

la e os genes que controlam a integração do profago no genoma do hospedeiro estão agrupa-


dos na sua região central. O agrupamento de genes relacionados é extremamente importante
paÍa o controle da expressão do genoma de À, pois ele permite que os genes sejam ativados ou
inativados em grupo, e não individualmente. O agrupamento também é importante pata a
construção de vetores de clonagem derivados de ì, (descritos no Capítulo 6).

As Íormas linear e circular do DNA de ?u

Uma segunda característica de À, relevante para a construção de vetores de clonagem, é a con-


formação da molécula de DNA. A molécula mostrada na Figura 2.9 éltnear, com duas extre-
midades livres, e representa o DNA presente na estrutura da cabeça do fago. Essa molécula li-
near consiste em duas fitas de DNA complementares, com bases pareadas de acordo com as
regras de \üatson-Crick (isto é, DNA de fita dupla). Entretanto, em.cada extremidade da
molécula existe um segmento curto, de 12 nucleotídeos, no qual o DNA é de fita simples (Fi-
gura 2.10a). As duas fitas simples são complementaÍes e, portanto, capazes de parear suas ba-
ses entre si para formar uma molécula circular totalmente de fita dupla (Figura 2.10b).
Fitas simples complementares são, com freqüência, referidas como extremidades
ttade'
sivastt ou extremidades coesivas, porque o pareamento de bases entre elas pode unir as duas
extremidades de uma molécula de DNA (ou as extremidades de duas moléculas de DNA di-
ferentes). As extremidades coesivas de 1" são chamadas de sítios cos e têm duas funções dis-
tintas durante o ciclo de infecção de ì,. Primeiramente, elas permitem que a molécula de DNA
linear injetada na célula seja circularizada, o que é um pré-requisito para a inserção no geno-
ma bacteriano (Figura 2.7).
A segunda função dos sítios cos é um pouco diferente e necessária depois que o profago
foi removido do genoma hospedeiro. Nesse estágio, é produzido um grande número de novas
moléculas de DNA de l" pelo mecanismo de replicação por círculo rolante (Figura 2.10c), no
qual uma fita de DNA contínua é "rolada paraforc" da molécula-molde. O resultado é um ca-
tenano, que consiste em uma série de genomas lineares de À unidos pelos seus sítios cos, cu-
ja função é agoraatuar como seqüências de reconhecimento pÍÌra uma endonuclease, que cli-
va o catenano nos sítios cos, produzindo genomas de l" individuais. Essa endonuclease, que é
o produto do gene Á da molécula de DNA de À, cria as extremidades coesivas de fita simples,
além de agir em conjunto com outras proteínas pa.ra empacotar cada genoma de À em uma es-
trutura de cabeça do fago.
( Como se verá no Capítu\6. os processos de clivagem e empacotamento reconhecem ape-
nas os sítios cos e as seqüênciàs imediatamente adjacentes a eles. A mudança da estrutura das
I
J regiões internas degenoma de À, por exemplo, pela inserção de novos genes, não tem efeito
I sobre esses eventos, desde que o tamanho total do genoma de l, não seja demasiadamente al-
I terado.
L
M13: um fago filamentoso
M13 é um exemplo de fago filamentoso (Figura 2.5b) epossui uma estrutura completamente
Frgur
distinta daquela de À. Ademais, a molécula de DNA de M13 é muito menor do que o genoma Asbr
de À, com uma extensão de 6.407 nucleotídeos. Ela é circular e tem a característica incomum siyas
de consistir inteiramente em DNA de fita simples. na br
ÍìorÍÉts
cto ht

o
2

G
*ú5o
t

ô

'-n::t1rn: rrecl ociurJl oaãl ÕÈu â13 ânb r;d o :lqos oqyq o urd ut:rs: :rrrr y
L
Jp BTp â w'â,\oq: u:u anb erp uaa.ãlsrrl orlTrrq un ã sru.eJoJ gl opuqrrqprq apod 1os o anb rrp ual.errglsrq rssou rp or5enurluo: e a a:ol anbro4 G
'opuuas uJ âf,o^ os'Fsse ouof, serp uã opunu op roreu r'epn8r zalsrrt ?un etlo
u'ze;sap as rapur anb o opnl snb erp uãI'oJ€fnq un eJrl err8ap
u::nb o opru etuadar:p g'rr:uasna ?ns ? uorÌJ oprqts op ortruâlrs o'âlâp ãuou o zrp eloJ €l Ios o'âiâr{ueu\r'o:sriutf,J'red nes o oes anb sBIp uâJ,,
o
a
Croneeeu GÊrurcn e ANÁLtsE oe DNA 35

hospedeiro estão agruPa-


(a) A Íorma lineaÍ da molécula de DNA de À
é extremamente imPortante
os genes sejam ativados ou Extremidade coesiva esquerda Extremidade coesiva direita
é importante para a CCCGCCGCTGGA
6). GGGCGGCGACCT
::::-

(b) A Íorma circular da molécula de DNA de l"

declonagem,éacon-
2.9 élinear, com duas extre-
do fago. Essa molécula li-
pareadas de acordo com as
em cada extremidade da
o DNA é de fita simPles (Fi-
capazes de parear suas ba-
dupla (Figura 2.10b).
ttade'
como extremidades
entre elas pode unir as duas
duas moléculas de DNA di-
cos e têm duas funções dis- (c) Replicação e empacotamento do DNA de À
que a molécula de DNA
para a inserção no geno-
cos cos O catenano
rola para fora
da molécula
depois que o profago de DNA de l.

qT-
um grande número de novas
rolante (Figura 2.10c), no
. O resultado é um ca- A endonuclease
codiÍicada pelo
pelos seus sítios cos, cu-
gene A cliva o
uma endonuclease, que cli- catenano nos
. Essa endonuclease, que é sítios cos
coesivas de fita simples
u-u
o HH
ì
genoma de l,

l"'
"- "rl
o o'
I
mento reconhecem ape-
A mudança da estrutura das H
novos genes, não tem efeito Componentes protéicos
I não seja demasiadamente al- do capsídeo
ççç
Novas partículas de
Íagos são montadas

uma estrutura comPletamente Figura 2.10


muito menor do que o genoma As Íormas linear e circular do DNA de À. (a) A forma linear, mostrando as extremidades
coe-
e tem a caracteística incomum sivas esquerda e direita. (b) O pareamento de bases entre as extremidades coesivas resulta
na forma circular da molécula. (c) A replicação por círculo rolante produz um
catenano de
novas moléculas de DNA linear de À, que são empacotadas individualmente nas
cabeças
do fago à medida que novas partículas de À são montadas.

e"lril-nTrf xì{!- -o-utirr:l er:ii

G
t
'-rr:;r1to: trec{ ocÌru.ìl ãÀ?t oxu èla ênb trt{ o :rqos oqlq o r:L:d :,r:::sl crur y 'õ
; ruoì!ìI{ E Ènu!u!ì-ì o[ro] 'q€dIf,tIud su:SRros:.rcl sop uin rtle,] opuxn.)., ossr noursua au uanb a:ol roJ or{ig '?rp oJtno un e:duas ua1 sEW.o]oql L
JP zp â sw:Nqr uau anb np uaa'elsJl oqprq un ã s?u'BroJ gl opurT Jeql:q apod 1os o anb rrp uaa rr:glsrq essou ep or5enurluo: e a e:ol anb:o4 G
'oPuuszgJ.fo^c's3ssâouof,ffÌpuA'opunuoptroreue'epn8ezalsr:tBun€llo Uì
!J'zeJsapasrapuranboopnlanberpuraa'o:unqunerner:8a1t
u: anb o opm eluadu:p E'muasnt ens B ef,oqf op?q?s op orJuâÌrs o'ãIãp âuou o zrp eJoJ ?l los o'âlâqu?uy'o:sr:ue:g'red nas o ors anb serp uaa,,

a
36 T.A. BRowN

O tamanho menor da molécula de Ml3 implica possuir espaço paÍa um número menor de
genes do que o genoma de À. Isso é possível porque o capsídeo de M13 é construído a partir
de múltiplas cópias de apenas três proteínas (requerendo apenas três genes), ao passo que a
síntese da estrutura de cabeça e cauda de l, envolve mais de 15 proteínas diferentes. Além dis-
so, Ml3 segue um ciclo de infecção mais simples que o de À e não necessita de genes para a
inserção no genoma do hospedeiro.
A injeção de uma molécula de DNA de M13 em uma célula de E. coli ocoÍïe através da
frmbria, a estrutura que conecta duas células durante a conjugação sexual (Figura2.4).Uma
vez no interior da célula, a molécula de fita simples atua como molde para a síntese de uma
fita complementar, resultando em uma molécula de fita dupla normal (Figura 2.11a). Essa
molécula não é inserida no genoma bacteriano, sendo, emvez disso, replicada até que mais de
100 cópias estejam presentes na célula (Figura 2.1 1b). Quando abacténa se divide, cada cé-
lula-filha recebe cópias do genoma do fago, que continua a replicar-se, mantendo, assim, o
seu número total por célula. Conforme mostrado na Figura 2.11c, novas partículas do fago são
continuamente montadas e liberadas, com aproximadamente 1.000 novos fagos sendo produ-
zidos a cada geração de uma célula infectada.

As vantagens de Ml3 como um veículo de clonagem {ü

f V,arios aspectos tornam M13 atraente como base para um veículo de clonagem. Seu genoma
Jt é menor do que 10 kb, um tamanho bem dentro da faixa ideal para um vetor em potencial.
Alé- do que, a forma replicativa (RF) de fita dupla comporta-se de maneira bastante simi-
lar a um plasmídeo e pode ser tratada como tal para propósitos experimentais. Ela é prepara-
da facilmente a partir de uma cultura de células de E. coli infectadas (p. 59-60) e pode ser
**iiff
iÍï:ï|,ffilï::T tg;t 1ll, gene s clonado s em um veror derivado de M 1 3 pode --
rem ser obtidos na forma de DNA de fita simples. Versões de fita simples de genes clonados j
são úteis para viírias técnicas, especialmente para seqüenciamento de DNA e mutagênese ir
,'
vitro (p.212 e243). A utilização de um vetor derivado de M13 é uma maneira fácil e confiá- i
vel para a obtenção de DNA de fita simples para esse tipo de trabalho. )

2.2.3 Vírus como veículos de clonagem para


outros organismos (cl

A maioria dos organismos vivos é infectada por vírus e, por isso, é natural que haja um
grande interesse na possibilidade de que vírus possam ser utilizados como veículos de clo-
nagem para organismos superiores. Isso é especialmente importante quando lembramos que
plasmídeos não são comumente encontrados em oulros organismos. que não bactérias e le-
veduras (p. 31).
De fato, os vírus possuem um potencial considerável como vetores de clonagem para al-
guns tipos de aplicação com células de animais. Os vírus de mamíferos, como o simian vi-
rus 40 (SV40), os adenovírus e os retrovírus, além dos baculovírus, de insetos, são aque-
les que receberam mais atenção até agora. Esses vírus são discutidos com maior profundi-
dade no Capítulo 7.
Figura I
O ciclo r
rem. (a)
replicati
Molécnl
montagí

o
z

IE
*t: o


G
T
NOJECI JJOA
V
EI Jols I q tp elr€d 3nb tuã L
IE
t,ì
a
Croruncev GÊurcn p AruÁrrse oe DNA 37

um número menor de
(a) lnjeção de DNA de
13éconstruídoapartir A partícula de
Íita simples na célula
genes), ao passo que a M13 injeta seu
hospedeira, seguida
diferentes. Além dis- pela síntese da DNA na célula

necessita de genes para a segunda Íita

DNA de fita
E. coli ocorre através da simples
sexual (Figura 2.4). U ma
para a síntese de uma
(Figura 2.11a). Essa
icada até que mais de
ria se divide, cadacé-
-se, mantendo, assim, o
partículas do fago são
DNA de fita dupla:
fagos sendo produ- lorma replicativa (RF)

(b) Replicação da RF
para produzir novas
clonagem. Seu genoma moléculas de Íita dupla
um vetor em potencial.
7^\

oxo
maneira bastante simi-
imentais. Ela é prepara-
(p. 59-60) e pode ser

derivado de Ml3 pode]


ples de genes clonados \\/^/
DNA e mutagênese in /{
maneira fâcil e confrá-)

A RF replica pelo mecanismo de círculo rolante


para produzir DNA de Íita simples linear

(c) Produção contínua


de Íagos M13

% -##
maduros
é natural que haja um
como veículos de clo- DNA circularizado
quando lembramos que
que não bactérias e le-

de clonagem para al-


ros. como o srmtan vb
, de insetos, são aque-
com maior profundi- Partículas maduras do fago

Figura 2.11
O ciclo de inÍecção de M13, mostrando os diÍerentes tipos de replicação do DNA que ocor-
rem. (a) Após a infecção, a molécula de DNA de Íita simples de M13 é convertida na forma
replicativa (RF) de fita dupla. (b) A RF replica para produzir múltiplas cópias de si própria. (c)
Moléculas de Íita simples são sintetizadas por replicação por círculo rolante e utilizadas na
montagem de novas partículas de M13.

::È
::.=
ë
:.::::':::r:
IE È

€d eroA ztrgrslq €p elred anb r$E G
IE
L

a
Cnpírulo 3
uma descrição deta-

Dubuque. [Uma boa in- Purificação de DNA a Partir de Células Vivas

Preparação de DNA celular total, 39 Preparação de DNA de bacteriófagos, 55


Preparação de DNA plasmidial, 47

/ A engenharia genética demanda, em diferentes momentos, a preparação de pelo menos três ti-
I pos distintos de DNA. Primeiramente, um DNA celular total, muitas vezes necessário como
\ ura fonte de material a partir do qual são obtidos os genes a serem clonados. O DNA celular
I total pode ser aquele conseguido a partir de uma cultura de células bacterianas, vegetais ou
,l animais ou de qualquer outro tipo de organismo em estudo.

\ O segundo tipo é um DNA plasmidial puro, cuja preparação dá-se a partir de uma cultura
I bacteriana, seguindo as mesmas etapas básicas que a purificação do DNA celular total, com a
I diferença crucial de que, em algum estágio, o DNA plasmidial deve ser separado do compo-
nente principal de DNA cromospômico também presente na célula.
I
\ Finalmente, PNA de fago é breciso se um veículo de clonagem derivado de bacteriófago
for utilizado. DNA de fago é em geral preparado a partir de partículas virais e não a partir de
células infectadas, de modo que inexiste problema associado à contaminação com DNA bac-
teriano. Entretanto, são imprescindíveis técnicas espeliais para a remoção do capsídeo viral.
Uma exceção é a forma replicativa de fita dupla Oe Mt:, a qual éprep arada apartir de célu-
las de E coli, damesma maneira que um plasmídeo bactenanor/

Preparação de DNA celular total


Os fundamentos da preparação de DNA são mais facilmente compreendidos se for considera-
do primeiramente o tipo mais simples de procedimento de purificação, utilizado quando todo
o complemento de DNA de uma célula bacteriana é necessário. As modificações que se im-
põem para a preparação de DNA de plasmídeos e de fagos podem, então, ser descritas mais
tarde.

t!

t!
e NOJ€d e30 AE TJ ols I q ep 3lr€d 3nb ruã L
G
o
a
40 T. A. Bnowlr

O procedimento paÍa a preparação de DNA total a partir de uma cultura de células bacte-
nitrr
rianas pode ser dividido em quatro estágios (Figura 3.1).
fato
aoì
(1) As células bacterianas são cultivadas e depois recuperadas da cultura e concentradas.
sad
(2) As células são rompidas para liberar seu conteúdo. rl
(3) Este extrato celular é tratado para a remoção de todos os seus componentes, exceto o i
ì indr
DNA. {
) conl
(4) A solução de DNA resultante é concentrada. I

\ extr
lida,
3.1.1 Multiplicação bacteriana em cultura e recuperação trat(
das células cultivadas ade
A maioria das bactérias pode ser multiplicada sem maiores dificuldades em um meio líquido com
(caldo de cultura). O meio de cultura deve prover uma mistura eqirilibrada dos nutrientes es- uma
senciais, ein concentrações que permitirão o desenvolvimento e a divisão eficiente das bacté-
rias. Os dois meios de cultura típicos são detalhados na Tabela 3.1 .
Tab
M9 é um exemplo de meio definido, no qual todos os componentes são conhecidos. Esse
meio contém uma mistura de nutrientes inorgânicos para prover elementos essenciais, como Mei

Mei

1 As bactérias são cultivadas em


2 As células são recuperadas
meio de cultura e recuperadas
do meio e rompidas para gerar
por centriÍugação um extrato celular

-9'íì-
ï-:'t"f
/\fl CentriÍugação

/\
/--:-- \
= ---
(.-:___:J \Extrato celular
Cultura bacteriana

ì
diçó
send
) quad
uma
-R
tt tos. i

tt
L]
lt ',tl
Ìas/n
sldac
Dfi
\:-r'---DNA puro P
lume
ODNAé O DNA é puriÍicado a Velor
concentrado paÍtir do extrato celular do dr
téria:
pensi
Figura 3.1
As etapas básicas para a preparação de DNA celular total a partir de uma cultura bacteriana.

IE

in oJSd 330,\ Bï r9lslq ?p alr€d enb ruã IE
L
G
rt
a
Croruncev GÊuce e ANÁLtsE DE DNA 41

de células bacte- nitrogênio, magnésio e cálcio' além de glicose, como fonte


de carbono e energia. Na prática,
fatores de crescimento adicionais, como elementos-traço e vitaminas,
devem ser adicionados
ao M9 para que ele seja capaz de sustentar o desenvolvimento
e concentradas. bacteriano. A definição preci-
sa dos elementos necessários depende da espécie a ser
cultivada.
O segundo meio descrito na Tabela 3.1, o de Luria-Bertani (LB),
exceto o é um pouco diferente, é
.' indefinido ou complexo, o que significa que a identidade e a quuíiaud" precisas
componentes são desconhecidas. Isso ocorre porque dois dos
dos seus
seus ingredientes, a triptona e o
. extrato de levedura, são misturas complexas, de compostos químicos desconhecidos.
Na rea-
lidade, a triptona supre as bactérias com aminoácidoì e pequenos peptídeos,
enquanto o ex_
trato de levedura (uma preparação seca de células ae levèdura puúui-.nt.
alg".iJury *p."
a demanda por iritrogênio, açúcares e nutrientes orgânicos
e inorgânicos. Meios complicados
:nì um meio líquido como o LB não necessitam de suplementação adiciorial e sustentam
o desenvolvimento de
dos nutrientes es- uma ampla gama de espécies bacterianas.
eficiente das bacté-

Tabela 3.1 A composição de dois meios típicos para o cultivo de


çio conhecidos. Esse células bacterianas
os essenciais, como Meio Componente g/l de meio
Meio M9 NarHPO. 6,0
NH2PO4 3,0
NaCl 0,5
NH4Ct 1,0
MgSO, 0,5
Glicose 2,0
CaCl., 0,015
LB (meio de Luria-Bertani) Triptona 10
Extrato de levedura 5
NaCl 10
-(fato celular

Meios definidos devem ser utilizados quando as bactérias


têm de ser cultivadas sob con-
dições precisamente controladas. Isso, contudo, não énecessário
quando as bactérias estão
sendo cultivadas simplesmente como uma fonte de DNA
no u- meio completo é ade_
quado. Em meio LB, a 37"c e.coT proporcionada", por"uro,
agiiaçao a 150 a 250 rpm em
uma plataforma rotatória. células de çraeão
\ coti dividem-se à*oã" o-u u", a cada 20 minu-
tos, até que a cultura atinja uma densidade máxima de"-
aproximadam*,"_k_:-^^l-_d*;r";
las/ml. o aumenro do nú-mero de célul-as na culrura. po$g. ^gr
10nf-tgr+.g.g p_e. l.p_ lpituta .da den_-
.
iooõ
I*,Ëffiï;õôi 'i;ÌËiãüã'r.ãi,póiiln"ur"
DO corresponde a aproximadamente
compripento de onda, uma unidade; de--
:' i
'
0,g x lOe células/ml. '

Pâra aprêtriáfãçãõõe"üffiëitiàtõïelïilái;ãfëïffiilffim esrar concentradas no menor vo-


lume possível. Por isso' as células da cultura são sedimentadas
por centrif'ugação (Figura 3.3).
velocidades de centrifugação moderadas são suficientes para
r"di-"nt- as bactérias no fun-
do de um tubo de centífuga, o que permite que o meio
de cultura seja removido. Assim, bac-
térias oriundas de 1.000 ml de uma cultura càm densidade
celular -á*i-u podem ser ressus-
pensas em um volume de l0 ml ou menos.

cultura bacteriana.

*ú,=
.,
,v
-'r70-red JJOA e{-{ols t q Yp rlred 3nb urã ít
8l
( [f*\ I \t \\ ..\
rl
Clorunceu GÊHtca e ANÁLlsE oe DNA 43

em uma

óptica (DO). (a)


passa luz de um
da cultura é medi-
- -log,o (intensidade
. em um espectro-

a partir de uma
cr.rlturas com densida- Figura 3.3
Sedimentação de bacté-
rias por centrif ugação.

quais a lise celular é causada pela exposição a agentes químicos que afetam a integridade das
baneiras celulares. Os métodos químicos são mais comumente utilizados quando as células
- por sua vez, é envol- bacterianas devem ser liSadas visando à preparação de DNA.
coli, aprópia parede A lise química via de regra envolve um agente que ataca a parede celular e um outro que
Todas essas barreiras rompe a membrana da célula (Figura 3.4a). Os agentes químicos a serem utilizados dependem
da
da espécie de bactéria envolvida. PanE. colí e organismos aparentados, o enfraquecimento
ididas em métodos fí- paredì celular é, em geral, feito com lisozima, tetracetato de etilenodiamina (EDTA) ou uma
nÉtodos químicos, nos iombinação de ambos. A lisozima é uma enzima que está presente na clara do ovo e em secre-

o
mmmmmrnur4 rruou'd
.z
xtulffi
*ia,ãa
G
.z
o t'lr:d :luf,si 3nÍ V IE
o.iill:t :-\.al (ìru :1e :tlh itJ o :rqus
::--:::--:.:,- ::rl
c'q1t1
L
;*ì[ -- -
,rosmu:r;r;-:rr'r:Ì:-:::--::f,-ossrnous:auuanbetro^tol'oqllI'?rp""""Ïl-::|ï^t::tÏ:ï^:i::i IE
It
ìi
* **atql o anb trpuaa'tr:glqqes
Eopourqprqapodlos
rtprrst u:"r- *".ó;'-J*p ã ory
*-"Ï::{:::::"ï:"":Hll:ï-
*;l ;r "r";"p'Ã'b
p mmm
nas o ots anb strp ual,,
ffiffiï ;ï;1" ;;õ;J;ã ;'ârãrru'urv'of, slruerg'nd
a
44 T. A. Bnowlr

ções como alâgnmae a saliva, sendo capaz de digerir os compostos


poliméricos que conferem A
ngidez à parede celular. O EDTA, por sua vez, remove íons de magnésio essenciais à preserva- ra de
ção da estrutura global do envoltório celular, além de, também, inibir enzimas celulares capa- ácido
zes de degradar DNA. Sob certas condições, o enfraquecimento da parede celular com lisozi- lentat
ma e EDTA é suficiente para romper as células bacterianas, mas, em geral, um detergente, co- cas fi
mo o dodecilsulfato de sódio (SDS), também é adicionado. Detergentes auxiliam no processo lada I
de lise removendo moléculas de lipídeos, o que provoca o rompimento das membranas celula- com l
res.
Depois de as células terem sido lisadas, a etapa final da preparação do extrato é a remoção
dos resíduos celulares insolúveis. Componentes como frações da parede celular parcialmente
digeridas podem ser sedimentados por centrifugação (Figura 3.4b), deixando o extrato celu-
lar como um sobrenadante razoavelmente limpo.

3.1.3 Purificação de DNA a partir de um extrato celular


Além do DNA, um extrato celular bacteriano contém'quantidades significativas de proteínas
e RNA. Para deixar o DNA em uma forma pura, vários procedimentos podem ser utilizados
na remoção desses contaminantes. Figura 3.5
Remoção de
contaminan-
tes protéicos
por eldração
(a) Lise das células com Íenol.

Rompimento da parede celular


Er
com Í
Rompimento da
probk
membrana celular
mas ir
_-_
?---- Extrato cel u la r
n€Ìs m
moa
l- ç-- l^ Polip'r
--\D AI
vidas
A únir
cleasr

81"4 Conct
(b) CentriÍugação para remoção dos resíduos celulares
Com Í
não nt
ções d
ÕÕ ção dc
I l :l centriÍugação.
l---- I '--
DNA' RNA' ProteÍnas
Or
Na pn
5Jilil:1É' q Nalr
ácidos
Resíduos celulares
tado sr

- celent,
lução i

Figura 3.4 srrreti


Preparação de um extrato celular: (a) lise das células e (b) centrifugação do extrato celular
para remoção de resíduos insolúveis.

LìüE Ior-r4E]rorElC Til[i . :z


*rãË
.q
G

'::--+:iio: r,rrd odruèt 31rl oru .iã ênb rt.ì o :.tqos oqlg o urd :l::rs: otut y IE
ss;6ffas;ç:'i i:r -:r i:a: : l::r rìì -.'os nomsua au uanb afo^ Ìol 'oq[g'?Ip o:lno un arduas uâ] sBW'oloqtr L
M @qmFrq r wruJ g[ op,rrrl rtqgrq apod 1os o anb erp u:1'er:91m4 essou ep or5enuuuo: t a a:ol anb:od t!
ryrryr rp^ utpnsr u:rm zun E{o.\ f 'zejsp âs lapw anb o opnt anb erp uea'o:anq un an er:8ap It
uory oçGqtr €p o!ru3q-s o'aIãP :üou o zrp EoJ El los o 'âleqmuv'of,srJwrJ 'red nas o oes anb seIP uâL,
a
CLoruneetr GÊnrcn e AruÁuse oe DNA 45

:,:[iméricos que conferem


A maneira-padrão de desproteinizar um extrato celular é adicionar fenol ou uma mistu-
io essenciais à preserva-
ra de fenol e clorofórmio 1:1. Tais solventes orgânicos precipitam proteínas, mas deixam
: enzimas celulares capa- os
ácidos nucléicos (DNA e RNA) em solução aquosa. Assim, se o eitrato celular é misturado
:e.arede celular com lisozt-
lentamente com o solvente e as fases são separadas por centrifugação, as moléculas protéi-
geral. um detergente, co-
cas ltcam na interface entre as camadas aquosa e orgânica, na forma de uma massa coagu-
l;es auxiliam no processo
lada branca (Figura 3.5). A solução aquosa de ácidos nucléicos pode então ser removida
: rlas membranas celula-
com uma pipeta.

doextratoéaremoção
Ftr:de celular parcialmente
. Jeirando o extrato celu-

Fase aquosa
(DNA + RNA)

lnterface
-.-------------
slsnificativas de proteínas (proteínas
ros podem ser utilizados coaguladas)
Fïgura 3.5
Fenol
Hernoção de
ounüaminan- Extrato celular
hs protéicos Mistura com Separação das Íases
por extração fenol por centrifugação
corn Íenol.

Em alguns extratos celulares, o conteúdo protéico é tão grande que uma única extração
com fenol mostra-se insuficiente para purificar completamente os ácidos nucléicos. Esse
problema poderia ser resolvido pela realização de várias extrações sucessivas com fenol,
mas isso não é desejável, pois cada etapa de mistura e de centrifugação resulta em quebras
____\ nas moléculas de DNA. A solução é, então, tratar o extrato celular com uma protease,
-_ co-
:-_I Extrato celular mo a pronase ou a proteinase K, antes da extração com fenol. Essas enzimas quebram os
,-+ polipeptídeos em unidades menores, as quais são mais facilmente removidas pelo fenol.
Algumas moléculas de RNA, especialmente de RNA-mensageiro (mnNÀ), são remo-
vidas pelo tratamento com fenol, mas a maioria permanece com o DNA na solução aquosa.
A única maneira eficiente de remover o RNA é trataÍ a preparação com a enzima ribonu-
clease, que degrada rapidamente tais moléculas em suas subunidades ribonucleotídicas.

S.1.4 Concentração de amostras de DNA


com freqüência, uma preparação bem-sucedida resulta em uma solução densa de DNA, que
não necessita de qualquer concentração adicional. Entretanto, às vezes, são
obtidas solu-
ções diluídas, sendo, então, importante considerar métodos para o aumento da concentra-
ìNA, proteínas ção do DNA.
O método de concentração utilizado iom mais freqüôncia é a precipitação com etanol.
Na presença de sal (estritamente falando, cátions monovalenter, .o-o os íons de sódio
i [Na-]) e a uma temperatura de -20'C ou menos, o etanol absoluto precipita com eficiência
ácidos nucléicos poliméricos. com uma solução densa de DNA, o etanol pode
I ser deposi_
tado sobre a amostra, provocando a precipitação das moléculas na interfa.ô.
Fes U- truqul ex-
celente consiste em empurrar um bastão de vidro pelo etanol para que ele
mergulhe na so-
I lução de DNA. Quando o bastão é removido, as moléculas de DNA aderem a ele podem
e
ser retiradas da solução na forma de uma longa fibra (Figura 3.6a). Alternativamenre,
lrifugação do extrato celular sã o eta-

G
*sl 2

,:
: ìnn:.FJ.r ,i;.ir::*::: rr,::.::-. G
rü ..,,..5,,'";ì'ìïiìi:ï*Ì;ff;:tïï;'.:,ilf.:",i;:ïìï:ïff::.:'1,':ilï,.r: L
m mffi upm}.[.::ssr ürrìluq rm: *ütro,l EI opuqnqprq apod los o a.b erp uaa'Àorrril o":".rrtro, e r rro^ ,.brr4 IE
LMliãff* mmmJ 5@ì mf ìoçmnIE oP loro e'zpn8e ezarsut Bun rtlo^ "rror "p
ã'ze;sap as rapur anb o opnl anb erp u:a.o:e:nq un an err3afi
m'dal:g tr'mmosmm r uog-ì oP"qË op oDuJIs o'JIâp Juou o zrp ero; rl
Ios o'ãtrâr{uruv.o:sr:uerg,red nas o ors anb srrp rr"a,,
o
a
46 T. A. Bnowlr

A mul
sar de as r
Figura 3.6 tes em hir
Coleta do DNA por pre- rompirner
Bastão de vidro cipitação com etanol. rianas r-ia
(a) Etanol absoluto é
ta células
depositado sobre uma
de parede
solução concentrada
de DNA do com al
de DNA. As fibras de
DNA podem ser recu- rede celul
peradas com um bas- LÌma r

tão de vidro. (b) Para p@


soluções menos con- nentq!i!
centradas, o etanol é uma ex.tr8
Solução de DNA adicionado (em uma cõm_-d[õi
concentrada proporção de 2,5 volu- tëm qúanì
DNA precipitado
coletado por mes de etanol absolulo não ser su
centriÍugação para 1 volume de solu-
te íìspecto
ção de DNA) e o DNA morìdos
precipitado é coletado 1

por centriÍugação. u*m dc


(CTABt-r
nado a rrrr
nol é misturado com uma solução de DNA diluída, o precipitado pode ser coletado por cen- boidraros-
trifugação (Figura 3.6b) e depois novamente dissolvido em um volume adequado de água. A pois- colet
precipitação com etanol tem a vantagem adicional de deixar cadeias curtas e componentes complero
monoméricos de ácidos nucléicos em solução. Assim, nesse estágio, ribonucleotídeos produ- o RNA po
zidos por tratamento com ribonuclease são perdidos. Um se
sui duas p
3.1.5 Medição da concentração do DNA dissolr,e tr
5er utilizã
É crucial conhecer exatamente quanto do DNA está presente em uma solução quando da exe-
presença (
cução de um experimento de clonagem gênica. Felizmente, a concentração de uma solução de
_ì-8ar. pen
DNA pode ser precisamente medida pela espectrofotometria de absorbância de ultraviole-
químiss5 1

tâ (UV). A quantidade de radiação IfV absorvida por uma solução de DNA é diretamente pro-
lular. mes
porcional à quantidade de DNA na amostra. Via de regra, a absorbância é medida a260 nme,
carìe na cc
nesse comprimento de onda, uma absorbância (Aruo) de 1,0 corresponde a 50 pg de DNA de
lica e é re:
fita dupla por ml.
rnente por
A absorbância de ultravioleta também pode ser utilizada para a verificação da pureza de \-
uma preparação de DNA. Com uma amostra pura de DNA, arazão das absorbâncias a 260 nm
., Euanirlina
moléculas
e a 280 nm (Aruo/Arro) é 1,8. Razões menores que 1,8 indicam que a preparação está contami-
nada com proteínas ou com fenol.

3.1.6 Preparação de DNA celular total de outros organismos t2 Preparaq


que não bactérias
.+prific'a
Bactérias não são os únicos organismos cujo DNA pdde ser necessrírio. DNA celular total de, lal ilg rrma
por exemplo, plantas ou animais pode ser fundamental se o objetivo do projeto de engenharia líquido- x
genética for a clonagem de genes de tais organismos. Embora as etapas básicas da purificação cnraro é d
de DNA sejam as mesmas para qualquer organismo, a introdução de algumas modificações piÍação c-o
pode ser exigida em decomência das características especiais das células que estão sendo uti- qídeos e a
lizadas.

t!

'-r:::tiuo:r trrd ocltrtal J ôl olu Jli ìrtb rcd o ::qos oqltl o urd ;rat:rsl arnt y IE
rrruil: -ir.:flJf,:tr;1i11s'r;.:j;..;rrinr:luopurn|.;os$nou$uãêuuanberolrog'oq[g'?IpoJlnounerduasua]s2141'o:oq: L
fubrr4, mrn1-ax-n oqlrq tm 9 su'soJ gl opurlr?rilrrq apod 1os o enb ?Ip uâJ'ttf,otslq ?ssou ep otSenurluo: t a a:ol anb:o4 t!
Lmxw Lionmcr-ì súp u:I -opmü op roro r'epn8e ezatsrJl ?un etlo !J'ze;s:p as rapw :nb o opnl anb erp u3l'otrunq un eiln rr:8ep o
rudm:ry' g-m:uasrc rur EoqJ opeqrs op ortruâIs o'âlâp âuou o zrp ef,oJgÌIos o 'êlâqu?uryorsrf,uttrg'red n:s o oes anb srrp uaa,,
a
Cr-oruncev GÊrurcn e ANÁLrsE DE DNA 47

A multiplicação das células em meio líquido pode, muitas vezes, não ser adequada, ape-
sar de as culturas de células vegetais e animais estarem se tornando cadavez mais importan-
3.6 Ìes em biologia. Entretanto, as principais modificações são, em geral, exigidas na etapa de
do DNA por pre- nompimento das células. Os agentes químicos utilizados para o rompimento de células bacte-
com etanol.
rianas via de regra não funcionam com outros organismos: a lisozima, por exemplo, não afe-
absoluto é
ta células vegetais. Há enzimas degradantes específicas disponíveis para a maioria dos tipos
sobre uma
de parede celular, mas, muitas vezes, técnicas físicas, como a trituração do material congela-
As Íibras de do com almofariz e gral, são mais eficientes. Células animais, por sua vez, r,áo possuem pa-
IïtA podem ser recu- rede celular e podem ser lisadas por um simples tratamento com detergente.
:eradas com um bas- Uma outra consideração impgrt4nte diz respeito ao conteúdo bioquímico das células a
5o de vidro. (b) Para partiidãs qqAiq_q PNe gs!4 $endo _extraído. Na maioria das bactérias, os principais compo-
soluções menos con- q911e9 b-!og{mi,c-g-q p_{e_sgllgq ell,um extrato celular são pqot_9in4q, DNA e RNA, de modo que
:entradas, o etanol é uma extração com fenol e/ou um tratamento com protease, qe€_ullo pql3,Igfnoç{o_ {o RNA
:dicionado (em uma com rlbonüõléadõarõãüãïmãmostra d;DNCp*". E tr"t-t"J" tu*té-.õn-
:rcporção de 2,5 volu- ^ "él"l'
têm quantidaaeísìÉíìfiiãtliãi-tie õúïioJ"óãmpõtèntãs bioquímicos, esses tratamentos podem
-es de etanol absoluto não ser suficientes para liberar DNA puro. Tecidos vegetais são particularmente difíceis nes-
:ara 1 volume de solu-
re aspecto, pois mg-ip.9*y9_ze_s_g59it9{q1_g-rqndgs ggantidqdes de carboidratos, que não são re-
:áo de DNA) e o DNA
movidos por qx-trgç{g deve ser utilizada.
:recipitado é coletado -c_gq.le_19!_P*ol-t!p-o.933*4b-oldggem $jerryti,va
:,:,r centriÍugação. Um dos métodos disponíveis usa um detergente chamado brometo de cetiltrimetilamônio
{CTAB), que forma um complexo insolúvel com ácidos nucléicos. Quando o CTAB é adicio-
nado a um extrato celular vegetal, o complexo ácido nucléico-CTAB precipita, deixando car-
:er coletado por cen- boidratos, proteínas e outros contaminantes no sobrenadante (Figura 3.7). O precipitado é,de-
adequado de água. A pois. coletado por centrifugação e ressuspenso em NaCl (cloreto de sódio) lM, que desfaz o
:'Jrtas e componentes complexo. Os ácidos nucléicos podem então ser concentrados por precipitação com etanol e
r :n:,nucleotídeos produ- o RNA pode ser removido por tratamento com ribonuclease.
Um segundo método envolve um composto denominado tiocianato de guanidina, que pos-
sui duas propriedades que o tornam útil para a purificação de DNA. Primeiro, ele desnafura e
dissolve todos os compostos bioquímicos que não são ácidos nucléicos, podendo, portanto,
ser utilizado para liberar DNA de virtualmente qualquer tipo de tecido. Em segundo lugar, na
i{tú.icão quando da exe-
presença de tiocianâto de guanidina, o DNA liga-se fortemente a partículas de sílica (Figura
r de uma solução de
-1.$s). permitindo que o DNA seja facilmente recuperado da mistura de outros compostos bio-
de ultraviole-
químicos desnaturados. Uma das possibilidades é a adição de sílica diretamente ao extrato ce-
'\Â é diretamente pro-
lular. mas é mais conveniente que seja utilizada uma coluna cromatográfica. A sflica é colo-
;i' s :úedida a 260 nm e,
cada na coluna e o extrato celular, então, adicionado a ela (Figura 3.8b). O DNA liga-se à sí-
-t 50 pg de DNA de
lica e é retido na coluna, enquanto os compostos bioquímicos desnaturados passam direta-
a:ação da pureza de mente por ela. Depois da lavagem dos últimos contaminantes com a solução de tiocianato de"ì

ubs.rrbâncias a 260 nm . _suanidina, o DNA é recuperado pela adição de água, que desestabiliza as interações entre as -
moléculas de DNA e a sílica.
;ão está contami-

3-2 Preparação de DNA plasmidial


,\ purificação de plasmídeos a partirde uma cultura bacteriana envolve a mesma estratégia ge-
lN-{ celular total de, ral de uma preparação de DNA total. As células contendo plasmídeos são cultivadas em meio
rrüeto de engenharia líquido, sedimentadas por centrifugação e rompidas para a preparação do extrato celular. O
rr',,usicas da purifi cação -rtrato é desproteinizado, o RNA removido e o DNA provavelmente concentrado por preci-
"!lLt FúÍnas modifi caçõe s pitação com etanol. Entretanto, existe uma importante distinção entre a purificação de plas-
,JÌre estão sendo uti- mídeos e a de DNA celular total. Em uma preparação de plasmídeos é sempre necessário se-

*ú:
G

,F: ,: ì i :j, ,,;:;ì"1ï*:ì;ìj":ïl:#.:1i:,ï:ï':?iJ:::ïï;Ë: G
L
ItG
ü5üN'Ld: l:milmhrçr ro-I:rrcrquJ:-::ro-rro-IEI opuqrrqÌuqâpodloso:nbrrpueaerf,otsÌrìEssouepoe5enuguo:eea:olanbro4
tlq0il, r 'inwt ilru I itrr:r Ef lcLr= L1Ìr lomu t'e1nËr ez:tsrfl run ello^ E zrJsap as r:pur anb o opnl anb erp uãJ oJ?Jnq un ef,rl err8ap
qF!@ tiluiuI;ru *F ì EE--lrr r-5 r ïlo:-ì opeqõ op ottruâFs o 'JÌâp ãuou o zrp rrÕJ tl los o 'âf,equruv'oJsr:ue:g'ftd nas o ors anb serp uea,,

a
48 T. A. Bnowlr

CTAB

\Complexo ácido
Extrato celular
Complexo ácido
nucléico-CTAB precipitado

Precipitação
DNA puro i?[,itli'3;", <--
ribonuclease

Figura 3.7
O método do CïAB para puriÍicação de DNA de vegetais.

parÍÌr o DNA plasmidial da grande quantidade de DNA cromossômico bacteriano que também
está presente nas células.
,\ A separação de ambos os tipos de DNA pode ser bastante difícil, embora essencial se os
t.',

plasmídeos serão utilizados como veículos de clonagem. Mesmo a presença de quantidades
.. r:
mínimas de DNA bacteriano contaminante em um experimento de clonagem pode levar a re-
o,l.
sultados indesejáveis. Felizmente, há vários métodos disponíveis para a remoção de DNA
,\"
bacteriano durante a purificação de plasmídeos e o uso dos citados métodos, individualmente
"J ou combinados, pode resultar no isolamento de DNA plasmidial bastante puro.
"ï:,'\ , z
3'\\':' I Os métodos são báseados nas várias diferenças físicas existentes entre o DNA plasmidial

"t
r-l e o bacteriano, sendo a mais óbvia o tamanho. Os maiores plasmídeos possuem apenas 87o do
tamanho do cromossomo de E coli e amaiona deles é muito menor do que isso. Técnicas ca-
í-ì pazes de separar moléculas de DNA pequenas de rÌroléculas de DNA grandes deveriam, por-
l! tanto, ser capazes de purificar plasmídeos eficientemente. Figur
\
Além de diferirem no tamanho, plasmídeos e DNA bacteriano também diferem quanto à Purifir
sua conformação. Quando aplicado a um polímero, como o DNA, o termo conformação re- tiociar
fere-se à configuração espacial total da molécula, com as duas conformações mais simples coluni
sendo a linear e a circular. Os plasmídeos e o cromossomo bacteriano são circulares, mas, du-

lir:lfi|qi 10'nÌtiE]@Ìf".,jl.j flrll:l .. o


z
*Ë: g
ÍE
t

6

'::-.:rilro: t-rrcl odtuèl â.\)ì o?u JIJ "ìnb ltd o o;qos or1lg o urcl :l:::s: :tul y
.mdr,n;j .:t!:ru-.:; j i.; .::: i::-l ,ìai:E:ìò. oss nouÌsuã ãuuanb a:ol rog oqlg'Brp ollno um e:duas ual st141'o:oq: L
'ruir:
rfficry, 1.;qml ory:qm 9 wu'aà-1g oprq *qptq rpod 1os o anb rrp ue.L errolsrq tssou ?p oe5znurluo: t e a:ol anbro4 G
ronmrffqldÍlltçìunúopro*"'"paã"zãlsreunt1Ìo ã'ze3sâpãsIJpu?anboopruanbtrpuâJ'o3?Jnqunerntrr8ap
t,
JW,lmJuiEmmr mqtr op"q6 op oDualrs o.ãlâp âuoü o zlp €loJ 9l los o'ã3âqu?uvoJsr:uag'rzd nas o ots anb serp ruaa,,
a
Clorunceu GÊNrcA E ANÁLrsE oe DNA 49

(a) Ligação do DNA a partículas de sílica

/r-:x @-'t=
Partículas de sílica -'@ .@' Moléculas de DNA

\6\y
\

@
(b) Purificação de DNA por coluna de cromatograÍia

Extrato celular

+ffi
Partículas
Agua
de sílica

W} w ô

ìul
bacteriano que também

difícil, embora essencial se os


l,l
H
a presença de quantidades
de clonagem pode levar a re-
is para a remoção de DNA
métodos. individualmente
bastante puro.
entre o DNA plasmidial
Compostos
bioquímicos
desnaturados
-_ ti-"i-.-/
\:-7 H DNA
possuem apenas 87o do
do que isso. Técnicas ca- Descarte

DNA grandes deveriam, por- i

Figura 3.8
também diferem quanto à Purificação de DNA pelo método do tiocianato de guanidina e da sílica. (a) Na presença do
A, o termo conformação re- tiocianato de guanidina, o DNA liga-se a partículas de sílica. (b) O DNA é puriÍicado em uma
conformações mais simples ooluna crornatográf ica.
no são circulares, mas, du-

IE

-1p-.sq1rs3
rrrd odruèl o?u âla .lnb cd o o:qos oqlg o :;ud lursr orur y t!
rm: mihrmld çmiru!çi !{ìl iiÌn r:g,t oprnn}..'os$ noÌnffâ ãru uãnb"^ât
a:ol rog oqlg'etp ortno un a:duâs u3l sery'oJoÌ{f L
ffirpmq:m-ooryqrmâ szu?ro;yloprqnq1uq apod 1os o anb ap uâI'?rrotsrq?ssouep oe5znurtuo: r a a:olanb:o4 G
rqlnpslmoprow
JÍDg-EJÍryrt lnr r cloqJ opeqìgs
e?pn8e rzatsut erlm etlo^ A zr;sap es rapue anb o opnl anb ap uaa'orernqun an er:8ap
op oouâIs o'âlâp âuou o zrp úroJ el los o râf,Jrlu?uy'o]sr:urtg'rcd nas o ogs anb serp uaa,,
o
a
50 T. A. Bnowrrr

rante a preparação do extrato celular, o cromossomo é sempre quebrado e gera fragmentos


li- :Ìe. Bm r,l
neares. Um método para separação de moléculas circulares de lineares resultará, pãr1anto,
em 1rÌ{ ilir FlÌ
plasmídeos puros. ^E:1i{

;ttl"'t ,Ufittr

3.2.1 Separação com base no tamanho Slll:. ruLl


-ïii,ufillt üf
Em geral, o fracionamento por tamanho é executado no estágio de preparação do extrato
ce- illlutllf iltfi ültff'lìto:

lular. Se as células são lisadas sob condições cuidadosamente controladìs, ocorre apenas uma
-.rmmu
quantidade mínima de quebra do DNA cromossômico. Os fragmentos de DNA resultantes ìr
são ;lr &ú,fuS]!Ì
ainda muito grandes - muito maiores que os plasmídeos e podem ser removidos, juntamen-
- llJ{l tÌIuÍxlLijul
te com os resíduos celulares, por centrifugação. Esse processo é também facilitado pelo fato ,*,tt!tLf:*ringr,ffro

de que o cromossomo bacteriano está fisicamente fixado ao envoltório celular, de modo que r,lii!ffiiirf,$ úe
os fragmentos cromossômicos sedimentam com os resíduos celulares se essa interação nãã
é
rompida. t,e e SWtç
O rompimento das células deve, portanto, ser executado de maneira bastante branda para
4rìilfü$
impedir a quebra generalizada do DNA bacteriano. Paru E. coli e espécies aparentadas a ela. Ítrüt

tllf tiitmliÌ Írìrìriïìtú


a lise controlada é executada conforme mostiado na Figura 3.9. o tratamento com EDTA
e li-
ihdldurmuln
sozima é feito na presença de sacarose, o que impede que as células rompam-se imediatamen-
foruülurrrnur, i&f

,ufu'nmam"dUr

uClLir:q,:tliiu uLlm

tuCiüuu
'üllhf
Cromossomo bacteriano EsÍeroplasto ;p'lirlt,tu1Nrmrirdurur

11|tiì(rrÌtìElI]jlflEl!1tlü,
if,

'Itrìrìilül,iitlr ìüutÌüt[
Lisozima
-llnnlllürr,lll4n|l,
+ EDTA
...........................".............'...* mtnrmmrudii td
Sacarose 25% rÜrt;|íltr 4l:

Plasmídeos

Membrana .'/
celular intacta

Parede celular
rompida
I

I rriton x-t oo
t
lmìtttittüuttllr, lnffi rrïfl ttilttumÌ"ìrìfiMiliüm'

ìo
I

Plasmídeos
o2 ab
\ ^,. llüllür riiilrÌrlllíffiirriiÌìllMll i$MnülilïlrM -
/-
Lisado
clariÍicado
+-
CentriÍugação
IV
.aa
.^ /' '
i ilÌllüiillilü

o-\
'ütflÌn1Imdirxtrudllui

Grandes uulÍÍÍtlü,fl 1 tttjümr uLl

fragmentos Extrato celular


de DNA Figura 3.9 nur| utl[, r||l{ulutü
Resíduos celulares
Preparação lütrr unmnr llirrltttluru

de um lisado
clarificado. Dlrl
{trr illlntnluttu,,idlffulìir

rrtttrrrrnt{ttttu * dim*rnn

\-_ :; r::-.1
o
z

IE
*s1 o


r'm; ::i
gr
:: ::.:.:::i-io:.rirrlop,{rr,,.,r.r"'"1r,,:'.'rìi:.jïj,::ï1ï:ìil::ïïlïrJïiffinï:'i.ï::ï;'j;'l#;:;:
rrpuêr'âlÍll ollluq un r $u'croJ eÌ opuq rrqir:q apod 1os o anb rrp ua1'Ãorrii1"*o.,
ÍE
L
oe5enunuo: e a a:olànb:o4 G
F-rç : fLì--a qT! uf .opunlu op lornu e,epn-Br ezetsrJt €un ?tlo^ g.zeSsap :s rapur anb o opnl anb "p
lw,;: :: I -EDuêsn? Ens e EloÌ]] op?q€s op orluaÌrs o ,êlâp âruou o zÌp €troj ?Ì
erp uâJ.of,ernq un ?nl e,rãap rt
Ìos o,ãlãqu?uv.of,st:ue:g,rrd nes o ors :nb srrp rraa,,

a
CLorunoev GÊNrcA E ANÁLrsE oe DNA 51

r quebrado e gera fragmentos li-


te. Em vez disso, são formados esferoplastos, células com paredes celulares parcialmente de-
: Lineares resultará, portanto, em gradadas, que retêm uma membrana citoplasmáticaintacta. A lise celular é, então, induzida
pela adição de um detergente não-iônico, como o Triton X-100 (detergentes iônicos, como o
SDS, causam quebras cromossômicas). Esse método provoca poucas quebras no DNA bacte-
riano, de modo que a centrifugação resulta em um lisado clariÍicado, consistindo quase que
;io de preparação do extrato ce- inteiramente em DNA plasmidial.
controladas, ocoÍïe apenas uma Contudo, um lisado clarificado ainda conterá, invariavelmente, algum DNA cromossômi-
lmentos de DNA resultantes são co. Ademais, se os próprios plasmídeos são moléculas grandes, eles também podem sedimen-
Ddem ser removidos, juntamen- tar juntamente com os resíduos celulares. Assim, o fracionamento por tamanho raramente é
n é também facilitado pelo fato suficiente por si só, devendo-se considerar modos alternativos para a remoção dos contami-
rur oÌtório celulaq de modo que nantes de DNA bacteriano.
clulares se essa interação não é
\22 Separação com base na conÍormação
b maneira bastante branda para Antes de se considerar como as diferenças conformacionais entre plasmídeos e DNA bacte-
fr e espécies aparentadas a ela, riano podem ser utilizadas para separar os dois tipos de DNA, deve ser analisada mais deta-
O tratamento com EDTA e li- thadamente a estrutura geral do DNA plasmidial. Não é estritamente correto dizer que plas-
- a-r rompam-se imediatamen-
mídeos têm conformação circular, pois círculos de DNA de fita dupla podem, na realidade,
adotar duas configurações alternativas bastante distintas. A maioria dos plasmídeos existe na
célula como moléculas superenroladas (Figura 3.10a). O superenrolamento ocoÍre porque a
hélice dupla do DNA plasmidial é parcialmente desenrolada durante o processo de replicação
plasmidial por enzimas chamadas de topoisomerases (p. 70). A conformação superenrolada
somente pode ser mantida se ambas as fitas polinucleotídicas estiverem intactas, daí o nome
mais técnico de DNA circular covalentemente fechado (ccc, do inglês covalently closed-
circular). Se uma das fitas polinucleotídicas é quebrada, a hélice dupla retorna ao seu estado
normal relaxado e o plasmídeo adota a sua conformação alternativa, denominada de circular
aberta (oc, do inglèsopen-circular) (Figura 3.10b).

- Corte

Figura 3.10
lMurms conformações de DNA de Íita dupla circular:
lmlt srnerenrolado - ambas as Íitas estão intactas;
'Ìh l roular aberto - uma ou ambas as fitas pos- (a) Superenrolado (b) Circular aberto
suem uma quebra.

O superenrolamento é importante na preparação de plasmídeos porque moléculas supe-


renroladas podem ser facilmente separadas de DNA não-superenrolado. Dois métodos dife-
rentes são comumente utilizados, os quais têm capacidade de purificar DNA plasmidial a par-
Figura 3.9 tir de extratos celulares brufos, embora, napráÍica, sejam obtidos resultados melhores quan-
Preparação do um lisado clarificado é primeiramente preparado.
de um lisado
clarificado. Desnaturação alcalina
A base dessa técnica é a existência de uma estreita faixa de pH na qual DNA não-superenro-
lado é desnaturado, enquanto plasmídeos superenrolados não o são. Se, com a adição de hi-

a
z

IE
#g: 9


:.---:lJrrl-r r.rril odu:.ìl:atrl ouu.ìlil rnb rrd o:.rr1os x.rrrsr orul g
or11r1 o urcì G
@ ì .- : r ::ì ::: :::.:ri; .ossrnoursuaauuanba:o^roc'oqÌg'rlporlnounarduasuslsBl/^{ oJorlf L
Xumr .rú cr: ür :tsrr rÍc- n: !ãu'Ëro_J pl opurl rsqlrrq apod 1os o anb erp uâI ?rrgtsrÌ{ essou ep oe5rnurluo: r a a:ol anbro4 IE
úrr$r; r im: l flr üJ-rc::---u Õp ronu e 'tpnËr ezâtsl:] Eun ello^ E ZBJsãp âs râpur ênb o opnr anb erp uâJ of,rrnq un ?rrl rr:8ap rt
lndil ;r : m-Es:x ms f, Ei.q-- otlEqe\ op oÍf,uâFs o'JIJp âuou o zrp rloJ gl Ios o 'atêqu€uy oJsrf,ur:g 'rcd nas o oçs anb stlp uaa,,
a
52 T.A.Bnowru

dróxido de sódio a um extrato celular ou a um lisado clarificado, o pH é ajustado para l2,O a cula form
12,5, aspontes de hidrogênio do DNA não-superenrolado são rompidas, o que causa o desen- de de flun
rolamento da hélice dupla e a separação das duas cadeias polinucleotídicas (Figura 3.1 1). Se, de a densr
depois disso, é adicionado ácido, essas fitas de DNA bacteriano desnaturado reagregam-se em de flutuaq
uma massa desorganizada. A rede insolúvel formada pode, então, ser sedimentada por centri- forma um
fugação, deixando o DNA plasmidial puro no sobrenadante. sidade po
ao tratâm
Adem
(EtBr) pc
O bromet
?

5V
DNA linear

4z-
-+-
centes. pr
mento res

/ :ffi\
*ïr" near. O D

/ PIasmídeos
suPerenrolados
-
pH 12,0
a 12,5

-t{3 DNA linear de


de desenr
da densid
apenas a
formam u
i

fita simples pondente


A cen
,,0 método u
io, cado é sul
separado
RNA pru
Centrifugação s9 o tubo
/a
i

plasmidia
ã do dotub

Plasmídeos q3 bq
\
Figura 3-í
PuriÍicação de
1
DNApla
- \ó gura 3.14
superenrolados Sedimento de
sde
de DNA linear r plasmídeos pelo
método de des- tá pronto
DNA linear
naturação alca-
lina.

Uma vantagem adicional desse procedimento é que, sob certas circunstâncias (especifica-
mente, lise celular por SDS e neutralização com acetato de sódio), a maioria das proteínas e
do RNA também se torna insolúvel e pode ser removida pela etapa de centrifugação. A extra-
ção com fenol e o tratamento com ribonuclease podem, portanto, não ser
necessários se o mé-
todo de desnaturação alcalina é utilizado.

CentriÍugação em gradiente de densidade de brometo de


etídeo-cloreto de césio
Essa é uma versão especializada da técnica mais geral de equilíbrio ou centrifugação em
gradiente de densidade. Um gradiente de densidade é produzido pela centrifugação de
uma solução de cloreto de césio (CsCl) a uma velÒcidade muito elevada (Figura 3.12a). O
gradiente é formado porque a força centrífuga elevada puxa os íons de césio e de cloreto em CentriÍugação em,
direção ao fundo do tubo. A migração dos íons no tubo é contrabalançada por difusão, de dade de cloreto ú
modo a levar ao estabelecimento de um gradiente, com as maiores densidades de CsCl em diente de densidac
direção ao fundo. do por centriÍuga@r
Macromoléculas presentes na solução de CsCl quando ela é centrifugada formam bandas (b) Separação d
em pontos distintos do gradiente (Figura 3.12b). O ponto exato onde uma determinada molé- RNA em um gradi

B "Tèmdiasquesãooseupai,Francisco.Âmanhece,osoliáforadizonomedele,osilênciodosábadochoraasuaausência.Ederepentetudooqueera
rt alegria viraìm buraco.Tem dia que tudo o que andei se desfaz.E volta umâ tristeza aguda, a maior do mundo.Em dias como esses,só você faz sentido,
Poique você é a continuação da nossa história.Tem dia que o sol pode brilhar Lindo lá fora,mas é um brilho triste.Tem dia que nem chove,mas é dia de
Ir
t  nrãc esi:reve para r: iìlho sobrc o pai qur' elr'não tele tentpo par;r corirecer'
!r
II
I
(
o
z
=çq
o para Francisco, I AII-X Ediro.a
I
Cloruneeu GÊr,rrca E ANÁLtsE oe DNA 53

lo. o pH é ajustado para 12,0 a cula forma uma banda depende da sua densidade de flutuação; o DNA possui uma densida-
ompidas, o que causa o desen- de de flutuação de aproximadamente r,7 glcm3 e, portanto, migra até o ponto do gradiente
on-
ucleotídicas (Figura 3.11). Se, de a densidade do cscl é de l,i g/cm3. As moléculas protéicãs, po, ,uu vez,
tê,mdensidades
,
desnaturado reagregam-se em de flutuação muito mais baixas e, por isso, flutuam no topo do gradiente, enquanto o RNA
io. ser sedimentada por centri- forma um sedimento no fundo do tubo (Figura 312b).4 centrifugação em gradientes de den-
sidade pode, pois, separar DNA, RNA e proteínas e é uma alternativa à extração com fenol
e
ao tratamento com ribonuclease para a purificação de DNA.
Ademais, a centrifugação em gradientes de densidade na presença de brometo de etídeo
(EtBr) pode ser utilizadapwa separar DNA superenrolado de moléculas não-superenroladas.
O brometo de etídeo liga-se a moléculas de DNA intercalando-se entre pares de bases adja-
centes, provocando um desenrolamento parcial da hélice dupla (Figura 3.13). Esse desenrola-
mento resulta em um decréscimo na densidade de flutuação de até0,125 glcm3 paraDNA li-
near. O DNA superenrolado, por sua vez, por não ter extremidades livres, tem uma liberdade
de desenrolamento muito restrita e liga-se a uma quantidade limitada de EtBr. O decréscimo
da densidade de flutuação de uma molécula superenrolada é, assim, muito menor, chegando
apenas a aproximadamente 0,085 g/cm3. Em conseqüência disso, moléculas superenroladas
formam uma banda em um gradiente de EtBr-CsCl em uma posição diferente daquela coÍïes-
pondente a DNA linear e circular aberto (Figura3.l4a).
A centrifugação em um gradiente de densidade de brometo de etídeo-cloreto de césio é um
método muito eficiente para a obtenção de DNA plasmidial puro.
Quando um lisado clarifi-
cado é submetido a esse procedimento, os plasmídeos formam bandas em um ponto distinto,
separado do DNA bacteriano linear, com as proteínas flutuando no topo do graãiente e com
o
RNA precipitado no fundo. A posição das bandas de DNA pode ser visualizada iluminando-
se o tubo com radiação ultravioleta, que faz com que o EtBr ligado ao DNA
fluoresça. o DNA
plasmidial puro é removido por aspiração, utilizando-se uma seringa cuja agulha perfura o la-
do do tubo na altura correspondente à amosúa a ser coletada (Figura :.i+U;. O EtBr ligado
Figura 3.11 ao
PuriÍicação de DNA plasmidial é extraído com n-butanol (Figura 3.14c) e o CsCl, removido por diálise (Fi-
plasmídeos pelo gura 3.14d). A preparação plasmidial resultante é praticamente IOOVo pura e o plasmídeo
es-
método de des- tá pronto para ser utilizado como um veículo de clonagem
naturação alca-
lina.

Proteína
rtas circunstâncias (especifi ca-
dio). a maioria das proteínas e
hpa de centrifugação. A extra- 1,60
o. não ser necessários se o mé-
6-
c
è 1,65

e brometo de Aumento da õ
concentração $o t,zo
de CsCI
o
o
uilíbrio ou centrifugação em
E
Ì, t.zs <_ DNA
duzido pela centrifugação de 'õ
c
úto elevada (Figura 3.I2a). O
s íons de césio e de cloreto em Figura 3.12 oo 1,80
Oenhifugação em gradiente de densi-
ntrabalançada por difusão, de
@de de cloreto de césio. (a) Um gra-
riores densidades de CsCl em ,diemte de densidade de CsCl produzi-
RNA
,üu por centrifugação a alta velocidade.
é centrifugada formam bandas (a) (b)
rib) Separação de proteínas, DNA e
r onde uma determinada molé- Hfi,lA em um gradiente de densidade.

B "Temdiasquesãooseupai,Francisco.Âmanhece,osolláforadizonomedele,osilênciodosábadochoraasuaausência.Ederepentetudooqueera
o
lr
alegria vira um buraco.Tem dia que tudo o que andei se desfaz. E voltâ umâ tristeza âguda, a maior do mundo.Em dias como esses, só você lz senrido.
Porque você é a continuação da nossa história.Tèm dia que o sol pode brilhar lindo 1á fora,mas é um brilho triste.Tèm dia que nem chove,mas é dia de
ll
o
tt
 :lic escri:r.c p:rn o úlho sohrc o 1::ì qur clr'nào teve lclrrpc p:rr i:r:lltlcrl.

I
(
q,
;t+
z
o
Francisr:o. AÌÌX Editur.,
54 T.A.Bnowru

Estrutura química do
brometo de etídeo

Molécula de
EtBr intercalada

)s,+ Â
Figura 3.13
EtBr Desenrolamento par-
+
cial da hélice dupla do
DNA por intercalação
3,4 A de EtBr entre pares
Arcabouço de bases adjacentes.
de açúcar-ÍosÍato >3,4 Â
Par de bases A molécula de DNA
normal, mostrada à
esquerda, é parcial-
mente desenrolada
ao incorporar quatro
ftgnl
Hélice dupla murnftrna@e0
de DNA normal moléculas de EtBr, re-
ffihrmriffilp,or
sultando na estrutura ilümMosnmngnd
"esticada", à direita. ü|uffiffi
ffir.@

3.2.3 Amplificação de plasmídeos


A preparação de DNA plasmidial pode ser dificultada pelo fato de que os plasmídeos repre-
sentam apenas uma pequena porção do DNA total de uma célula bacteriana. O rendimento de
tI Plqnr
uma preparação de DNA plasmidial a partir de uma cultura bacteriana pode, portanto, ser de- Aüfro
cepcionantemente baixo. A amplificação plasmidial é uma das maneiras de aumentar esse
rendimento.
Mu
ffir(@
A amplificação tem por objetivo aumentar o número de cópias de um plasmídeo. Alguns t'
plasmídeos multicópia (aqueles com um número de cópias de 20 ou mais) guardam a pro-
priedade útil de serem capíves de replicar na ausência de sínteseprotéica. Isso contrasta com
o cromossomo bacteriano principal, que é incapaz de replicar sob tais condições. Essa pro-
priedade pode ser utilizada durante a multiplicação das bactérias em cultura para purificação
de DNA plasmidial. Depois que uma densidade celular satisfatória foi atingida, um inibidor
de síntese protéica (por exemplo, cloranfenicol) é acücionado à cultura, que, por sua vez, é en-
tão incubada adicionalmente por mais 12 horas. Durante esse período, as moléculas do plas-
mídeo continuam a replicar, apesar da replicação cromossômica e da divisão celular terem si-
do bloqueadas (Figura 3.15). O resultado é que um número de cópias de plasmídeo de vários
milhares pode ser atingido. A amplificação é, pois, um meio muito eficiente de aumentar o ffiem
rendimento de preparações de plasmídeos multicópia.
ffi

B "Tèmdiasquesãooseupai,Francisco.Amanhece,osolláforadizonomedele,osilênciodosábadochoraasuaausência.Ederepentetudooqueera
tt
o
alegria vira um buraco.Tem dia que tudo o que andei se desfaz.E voltâ uma trìsteza âguda, a maior do mundo.Em dias como esses, só você faz sentido.
Porque você é a continuação da nossa história.Tèm dia que o sol pode brilhar lindo 1á fora,mas é um brilho triste.Tèm dia que nem chove,ms é dia de
rt choro. Mas tem sempre um outro dia, Íìlho. Foi você quem me ensinou isso." Quenclo tiìtr irrl dos pcrsonâgcnr lìriNril3ìs. cono c<>lrinua l hrrrórir:

o  rrãe escrer.c p:tra o fìlho sobrc o pai qrie cÌe nâo tcvc terrrpo prrr conhei:er.

(
-t
ô o
ê
Cr-ounceu GÊNrcA E AruÁuse oE DNA 55

Proteínas

DNA linear
eoc ---_*
---------------{>
DNA ._l Remoção do DNA
superenrolado superenrolado
com uma seringa

RNA

(a) Um gradiente de (b) Remoção da banda de DNA


Figura 3.13 densidade de EtBr-CsGl
Desenrolamento par- , Mistura com n-butanol e
cial da hélice dupla do I agitação, repouso para
DNA por intercalação V separação das Íases
de EtBr entre pares
de bases adjacentes. Tampão
Solução EtBr na Íase
A molécula de DNA
de DNA orgânica
normal, mostrada à
em tubo
+ -
esquerda, é parcial-
de diálise
mente desenrolada Figura 3.14 DNA na Íase
ao incorporar quatro Furificação de DNA Difusão do para o tampão aquosa
moléculas de EtBr, re- qmrncmidial por centri-
sultando na estrutura ffiuqação em gradien- (d) Remoção do CsCl (c) Extração do EtBr
por diálise com rFbutanol
"esticada", à direita. h de densidade de
EtBr-CsCl.

p de que os plasmídeos repre- til Preparação de DNA de bacterióÍagos


! bacteriana. O rendimento de
p;*u pode. portanto. ser de- A diferença fundamental entre a purificação de DNA de fagos e preparações de DNA celular
maneiras de aumentar esse total ou DNA plasmidial ó que, para fagos, o material de partida normalmente não é um ex-
las
Ì trato celular. Isso ocorre porque as partículas de bacteriófagos podem ser obtidas em grande
plasmídeo. Alguns número a partir do meio extracelular de uma cultura bacteriana infectada. Quando uma des-
fpias de um
20 ou mais) guardam a pro-
lb
p protéica. Isso contrasta com
rsob tais condições. Essa pro-
em cultura para purificação
íria foi atingida, um inibidor o (À o %3.3s-
fculrura, que, por sua vez, é en- o oílòì o o
---------------- ooXo-c
íodo, as moléculas do plas-
e da divisãocelular terem si-
?ítt)\t " o lncubação na
presença de
cloranÍenicol
ta!-JY /

cópias de plasmídeo de viírios


muito eficiente de aumentar o
Íï$Ía 3.15 Plasmídeos mulÌicópia DNA Plasmídeos presentes em um
,ffiffifha@o de (número de cópias de 20+) bacteriano número de cópias de 1.000++
Mbsmídeos.

B "Tem dias que são o seu pai, Francisco.Amanhece, o sol lá fora diz o nome dele, o silêncio do sábado chora a sua ausência.E de repente tudo o que era

It
g
alegria vira um buraco.Tèm dia que tudo o que andei se desfaz.E volta uma tristeza aguda, a maior do mundo. Em dias como esses, só você faz sentido.
Porque você é a continuâção dâ nossa história.Tèm dia que o sol pode brilharLindo lá fora,mas é um brilho triste.Tèm dia que nem chove,mas é dia de
rl choro.Mas tem sempre um outro dia,fi1ho.Foi você quem me ensinou isso." Quanilo là1ta urrr clos p.'rsonrgcnr príncipais,corro corrinrra: hirr<iri.r?
g  *ãe cscrcr.c prra o filho sobrc o p:ì qrie e1c não teve tcrrrpc p:rr conl:ci:cr.
II
(
I g
;r*
o

z
o
56 T. A. Bnowrrr

sas culturas é centrifugada, as bactérias são sedimentadas, deixando as partículas de fago em grad(
suspensão (Figura 3.16). As partículas de fago são então coletadas da suspensão e o seu DNA mudi
é extraído por uma simples etapa de desproteinização para remoção do capsídeo viral. N
Esse processo geral é bem mais direto que o procedimento utilizado para preparar DNA rer. P
celular total ou plasmidial. Apesar disso, uma purificação bem-sucedida de quantidades sig- de- er

nificativas de DNA de fago está sujeita a diversos percalços. A principal difìculdade, especial- a pro
mente com ì,, é a multiplicaçáo de células infectadas em cultura de uma maneira tal que o tí-
tulo de fagos extracelulares (o número de partículas de fago por ml de cultura) seja suficien-
temente alto. Em termos práticos, o título máximo que pode ser razoavelmente esperado para
l, é de 1010 por ml; ainda assim, 1010 partículas de ), renderão somente 500 ng de DNA. Gran-
des volumes de cultura, na faixa de 500 a 1.000 ml, são, portanto, necessários se quantidades
substanciais de DNA de l, devem ser obtidas.

3.3.1 Cultivos bacterianos visando à obtenção de altos títulos de l,


Não há problemas maiores em cultivar bactérias em grandes volumes (culturas bacterianas de
50 ú ou mais são comuns em biotecnologia), mas a obtenção de um título máximo de fagos re-
quer certas habilidades. O fago l" que ocorre naturalmente é lisogênico (p. 31) e uma cultura in-
fectada consiste principalmente em células portadoras do profago integrado no DNA bacteria-
no (Figura 2.7). O título de À exffacelular é extremamente baixo sob tais circunstâncias.
Para a obtenção de um alto rendimento de l, extracelular, a cultura deve ser induzida, a fim
de que todas as bactérias entrem na fase lítica do ciclo de infecção, o que resulta na moÍe celu-
lar e na liberação de partículas de 1, no meio. O controle da indução é, normalmente, muito difi-
cil, mas a maioria das linhagens de À de laboratório é portadora de uma mutação termossensí-
vel (ts) no gene cI, o qual é um dos responsáveis pela manutenção do fago no seu estado inte-

\-r. a\
^?? Cultura inÍectada
??O|ç(bactérias+
q,t a^'' fagos extracelulares)
it
-

? ç ç?.
?.trt,?i suspensão de Íagos I
,? ? ? lffir@,üu
Figura 3.16 rtffi,düb",Ntr'üt
- Preparação de uma suspensão ffiM
S S"Oir"r,to de bactérias de Íagos a partir de uma cultura
de bactérias infectadas.

E "Temdiasquesãooseupai,Francisco.Amanhece,osolláforadizonomedele,osilênciodosábadochoraasuaausência.Ederepentetudooqueera
o
o
alegria vira um buraco.Tèn dia que tudo o que andei se desfaz.E voltâ uma tristeza aguda, a maior do mundo.Em dias como esses,só você faz senrido.
Porque você é a continuação da nossa história.Tem dia que o sol pode brilhar lindo iá fora,mas é um brilho triste.Tem dia que nem chove,mas é dia de
rl choro.Mas tem sempre um outro dia,frlho. Foi você quemme ensinou isso." Quando iàlta urr r:los persona*ens principais, cor:ro continua; históna7
g A ntãc escrcve plrr o filho sobre o pri que eÌe não telc rcrrpo par:r conhecer.
I!
(
q.
o g
z
Cr-orunoeu GÊt'ttcn r ANÁLtsE oe DNA 57

rando as partículas de fago em grado. Se inativado por uma mutação, o gene cI não funciona mais corretamente, o que leva a
das da suspensão e o seu DNA mudança para a fase lítica do ciclo de infecção.
noção do capsídeo viral. Na mutação clls, o gene cI é funcional a 30oC, temperatura na qual a lisogenia pode ocor-
o utilizado para preparar DNA rer. Porém, a 42"C, o produto do gene clls não funciona adequadamente e a lisogenia não po-
n-sucedida de quantidades sig- de, então, ser mantida. Uma cultura de E. coli infectada com l, clls pode, assim, ser induzida
principal dificuldade, especial- a produzir fagos extracelulares pela transferência de 30"c para 42"c (Figura3.l1).
ra de uma maneira tal que o tí-
or ml de cultura) seja suficien-
r razoavelmente esperado para
Dmente 500 ng de DNA. Gran-
nto. necessários se quantidades
Profago ì.

altos títulos de ?r,

olumes (culturas bacterianas de 30.c


_---------------
e um ítulo máximo de fagos re- Sem indução
rgênico (p. 31) e uma cultura in-
rgo integrado no DNA bacteria-
o sob tais circunstâncias.
cultura deve ser induzida, a fim
po, o que resulta na morte celu-
ryão é, normalmente, muito difi-
rde uma mutação termossensí-
nção do fago no seu estado inte- 1",..
lndução

Genoma de À liberado

r-i."
I ""tut",

p
+

(
\.-a^,r
Figura 3.17 \
ffi4ao de um lisógeno Novas partículas de fago l,
3.16 ü tu düs por transÍerência
de 30'C Para42'C.
ção de uma suspensão
s a partir de uma cultura
érias inÍectadas.

B "Têmdiasquesãooseupai,Francìsco.Amanhece,osolláforadizonomedele,osilênciodosábadochoraasuaausência.Ederepentetudooqueera

It
g
alegria vira um buraco.Tèm dia que tudo o que andei se desfaz.E voltâ umâ tristezâ aguda, a maior do mundo.Em dias como esses, só você faz sentido
Porque você é a continuacão da nossa história.Tem dia que o sol pode brilhar lindo 1á fora, mas é um brilho triste.Tem dia que nem chove,mas é dra de

I
qt A nàe cscrevc pirra o filÌro sobrc O paì qLre e1e nãO levc lelnpo prrr i:onheclr.

Io
(
-t
qr
z
o
58 T. A. Bnowr.r

3.3.2 Preparação de fago ?r, não-lisogênico t,33 Coleta de


Embora a maioria das linhagens de À seja lisogênica, muitos vetores de clonagem derivados Os resnm&
desse fago são modificados, por deleções de cI e de outros genes, a fim de que a lisogeniaja- intactal por
mais ocorra. Tais fagos são incapazes de se integrarem no genoma bacteriano e podem infec- l,asòfagor
tar células apenas pelo ciclo lítico (p. 31). pra5 mlu
Com esses fagos, a chave para a obtenção de um alto título reside na maneira pela qual as Aspütí
células são cultivadas, sendo sobremaneira importante o estágio no qual as células são infec- wlaidadcs
tadas pela adição de partículas virais. Se os fagos são adicionados antes de as células estarem porunc
se dividindo na velocidade máxima, todas elas são lisadas rapidamente, resultando em um dE sal úiltr
baixo título (Figura 3.18a). Por outro lado, se os fagos são adicionados quando a densidade de fuup
celular é muito alta, então a cultura jamais será completamente lisada e, novamente, o título sotl"idoenr
de fago será baixo (Figura 3.18b). A situação ideal é quando o estágio da cultura e o tamanho
do inóculo do fago são equilibrados de modo que as células continuem a multiplicar-se, mas tg./l nrmcaçE
que todas elas acabem sendo infectadas e lisadas (Figura 3.18c). Como pode ser imaginado, Aespui
habilidade e experiência são necessárias paÍa ajustar o processo até a perfeição. DÈ'{Apd
rxrtliÍie,E
qlldia&r
studsp
(a) A densidade da cultura é muito baixa slheeq
z lnóculo de ì"
@el;ü
tJ 165r-nl
oo a
?i
Í
.a
t'
r,ri""
pfrrg
br[rd
)i
oo Adicão do Íaoo ? -
Todas as células
o
?
f puffi
Bactéria são rapidamente
lisadas = baixo título de fago
Amúrirrd
FoüÍt
(b) A densidade da cultura é muito alta ,eflim&g
rouü:d
aO &'irZ,?" |Nfi,fu
'?'
\ :,2+7ÍzZ"
"'#í 'oo oe?
o o o ??'
A cultura nunca é completamente
lisada = baixo título de Íago

(c) A densidade da cultura é correta

Oe ?l Figura 3.18
Situações que podem
ooo"i"
i!íí''-'dlï+,
ocorrer quando se
oo busca o equilíbrio
correto entre o está-
En,lt
gio da cultura e o ta-
A cultura continua a desenvolver-se, manho do inóculo pa-
mas as células acabam sendb
lisadas = alto título de fago
ra a preparação de Ífr"dmEn
uma amostra de um
Íago não-lisogênico.

B "Tem dias que são o seu pai, Francisco.Amanhece, o sol 1á fora diz o nome dele,o silêncio do sábado chora a sua ausência.E de repente tudo o que era

o
o
alegria vira um buraco.Tem dia que tudo o que andei se desfaz.E volta umâ tristeza âguda,a maior do mundo.Em dias como esses,só você fz sentido.
Porque você é a continuação da nossa história.Têm dia que o so1 pode brilharlindo lá fora,mas é um brilho triste.Tem dia que nem chove,mx é dia de
rl choro.Mas tem sempre um outro dia, âlho. Foi você quem me ensinou isso." Quendo felta unr dol persor:agens priucip:is, corrto continua a história?
o
I!
 rnãe escreve para o {ìlho sobre o pai que eÌe não tere ten:po parl cor:hecer.

(
o
p:ira Fr:rncisr:o. I ARX Pditor.
Cloruneev GÊNrcA E Ar.rÁlrsr oe DNA 59

tjtir Coleta de fagos a partir de uma cultura infectada


de clonagem derivados Os restos das células bacterianas lisadas, juntamente com quaisquer células que perrnaneceriìm
.a fim de que a lisogenia ja- intactas, podem ser removidos de uma cultura infectada por centrifugação, deixando as partícu-
bacteriano e podem infec- las do fago em suspensão (Figura 3.16). O problema agorué a redução do volume da suspensão
para 5 ml ou menos, um volume manipulável para a extração de DNA.
reside na maneira pela qual as As partículas do fago são tão pequenas que só podem ser sedimentadas por centrifugação a
no qual as células são infec- velocidades muito elevadas. Por isso, a coleta dos fagos é geralmente feita por precipitação com
antes de as células estarem polietileno-glicol (PEG). O PEG é um composto polimérico de cadeia longa que, na presença
. resultando em um de sal, absorve água e, por isso, faz com que estruturas macromoleculares, como as partículas
ionados quando a densidade de fago, precipitem. O material precipitado pode, então, ser coletado por centrifugação e redis-
lisada e, novamente, o título solvido em um volume adequadamente pequeno (Figura 3.19).
estágio da cultura e o tamanho
tiluem a multiplicar-se, mas ür"4 Purificação de DNA a partir de partículas de fago lv
r. Como pode ser imaginado, A desproteinizaçáo do precipitado de PEG redissolvido é, às vezes, suficiente para a extração de
até a perfeição. são submetidos a uma etapa de purificação inter-
DNA puro do fago, mas, em geral, os fagos l"
mediária. Essa etapa é necessária porque o precipitado de PEG pode conter também uma certa
quantidade de resíduos bacterianos, possivelmente incluindo o indesejável DNA celular. É pos-
sível separar esses contaminantes das partículas de À, por centrifugação em um gradiente de den-
sidade de CsCl. A banda das partículas de l, em um gradiente de CsCl forma-se em uma densi-
dade de 1,45-1,50 g/cm3 6igura 3.20) e pode ser coletada do gradiente como descrito anterior-
mente para bandas de DNA (p. 54 e Figura 3. 14). A remoção do CsCl por dirílise resulta em uma
preparação pura de fagos, a partir da qual o DNA pode ser extraído com fenol ou por tratamen-
to com protease, para a digestão do envoltório protéico do fago.

üLs A purificação do DNA de Ml3 causa alguns problemas


A maioria das diferenças entre os ciclos de infecção de Ml3 e l" representa uma vantagem
para o biólogo molecular que deseja preparar DNA de Ml3. Primeiramente, a forma repli-
cativa de fita dupla de M13 (p. 34 e 36), que se comporta como um plasmídeo de alto nú-
mero de cópias, é facilmente purificada por procedimentos-padrão para a preparação de
DNA plasmidial. Um extrato celular é preparado a partir de células infectadas com Ml3,

r?r8U
q&
Adição tr
I
?.
Figura 3.18 de PEG +({
Situações que podem w"È
a
lta ocorrer quando se
+ NaCl
:s)
Do busca o equilíbrio Figura 3.19
ata Suspensão Partículas de Sedimento de
Ç
correto entre o está- Coleta de partículas
t' de Íagos fago precipitadas partículas de Íago
gio da cultura e o ta- de fago por precipita- + resíduos celulares
manho do inóculo pa- çao com polietileno-
ra a preparação de glicol(PEG).
uma amostra de um
fago não-lisogênico.

B "Temdiasquesãooseupai,Francisco.Amanhece,osolláforadizonomedele,osì1ênciodosábadochoraasuaausência.Ederepenterudooqueera

It
qt
alegria vira um buraco.Tem dia que tudo o que andei se desfaz.E voltâ uma tristezâ eguda, a maior do mundo. Em dias como esses,só você faz sentido.
Porque você é a concinuação da nossa hìstória.Tèm dia que o sol pode brilhar hndo lá fora,mas é um brilho triste.Tèm dia que nem chove,mas é dia de
rl choro.Mas tem sempre um outro dia,filho. Foi você quem me ensinou isso." Quar,lo ialta rur dos personrecnr priur:íp:ìs.colro cortìnua;r histórie?
!,
II
 rràe cscrevc pau o iìlho sobrc o pai q*r'c1c nic lcve tdnrpo prrr r:onlte:cr.

(
!,
;r+
õ

z
o r:rrr lirrncisro Alì X F,ììtorr
60 T. A. Bnowr.r

1,35

1,40

1,45
Partículas
de fago l.
1,50

1,55

1,60

Densidade Figura 3.20


de CsCl Purificação de partículas de Íago l,
(g/cms) por centriÍugação em gradiente de
densidade de CsCl.

sendo a forma replicativa separada do DNA bacteriano, por exemplo, por centrifugação em
gradiente de densidade de EtBr-CsCl.
Entretanto, a forma de fita simples do genoma de M13, contida nas partículas extrace-
lulares do fago, é freqüentemente necessária. Nesse aspecto, a grande vantagem em relação
a l, vem do fato de que altos títulos de M13 são mais facilmente obtidos. Como as células
infectadas secretam continuamente partículas de Ml3 para o meio (Figura 2.8), sem a ocor-
rência de lise, um alto título de M13 é obtido simplesmente pela manutenção da cultura in-
fectada até que seja alcançada uma.alta densidade celular. De fato, títulos de 1012 por ml ou
maiores são obtidos com facilidade, sem o emprego de qualquer truque especial. Títulos al- Figun
tos como esses implicam que quantidades significativas de DNA de M13 de fita simples po- Prepa
dem ser preparadas a partir de volumes pequenos de cultura - 5 ml ou menos. Além disso,
como as células infectadas não são lisadas, não há problemas de contaminação da suspen-
são de fagos com resíduos celulares. Conseqüentemente, a etapa de centrifugação em gra-
Leit
diente de densidade de CsCl, necessária para a preparação de fago 1,, é raramente utilizada
Birnboi
com Ml3.
iVlrl
Em resumo, a preparação de DNA de M13 de fita simples envolve o cultivo em peque- Boom-
no volume das bactérias infectadas, centrifugação para sedimentação das células bacteria- (19
nas, precipitação das partículas de fago com PEG, extração com fenol para remoção do en- 494

voltório protéico do fago e precipitação com etanol para concentração do DNA resultante Clewell
(Figura 3.21). fol
Marnu
cul
Radloff
s€d
cr{
Rogers.
mií
Yamam
. tati
7y
Zì,fu-
tÈú
Ct-onneeu GÊNrcA E ANÁLrsE oe DNA 61

(a) Cultura (b) CentriÍugação (c) Adição de PEG


de células para remoção à suspensão de
inÍectadas das células Íagos, centriÍugação

ü
Lz,l +w.."u *Ë

w I de Íagos M13 Fag


Células
sedimentadas

ffi
I I I 3DNA
M13D

por centrifugação em

nas partículas extrace-


grande vantagem em relação
obtidos. Como as células
W
(g) Ressuspensão
do DNA de M13 em
(Í)
da Íase
tr
Remoção
aquosa,
M1 3DNA
N-._
[ïï-
Wr.not
(e) Adição
Íenol
de
para
p'o
Protêína

W
(d) Ressuspensão
do Íago em tampão
um pequeno volume etanol,
adição de remoção do
(Figura 2.8), sem a ocor- centriÍugação capsídeo protéico
manutenção da cultura in-
fato, títulos de 1012 por ml ou
truque especial. Títulos al- Figura 3.21
de Ml3 de fita simples po- Preparação de DNA de M13 a partir de uma cultura bacteriana inÍectada.
5 ml ou menos. Além disso,
de contaminação da suspen-
de centrifugação em gra-
Leituras adicionais
fago 1", é raramente utilizada
i Birnboim, H.C. & Doly, J. (1979) A rapid alkaliae extraction procedure for screening recombinant plasmid DNA.
Nucleic Acids Research, 7 ,1513-23. [Um método para a preparação de DNA plasmidial.]
b envolve o cultivo em peque- Boom, R., Sol, C.J.A., Salimans, M.M.M., Jansen, C.L., Wertheim van Dillen, P. M. E. & van der Noordaa, J.
inentação das células bacteria- (1990) Rapid and simple method for purification of nucleic acids. Journal of Clinical Microbiotogy, 28,
bm fenol para remoção do en- 495-503. [O método de tiocianato de guanidina e sílica para a purificação de DNA.]
hcentração do DNA resultante Clewell, D.B. (1972) Nature of ColEl plasmid replicationin Escherichia coli inthe presence of chloramphenicol.
Journal of Bacteriology, ll0, 66'1-76. [A base biológica da amplificação de plasmídeos.]
Marmur,J.(1961)Aprocedurefortheisolationofdeoxyribonucleicacidfrommicroorganisms. Journalof MoIe-
cular Biology, 3, 208- 1 8. [Preparação de DNÁ celular total.]
Radloff, R., Bauer, W. & Vinograd, J. (1967) A dye-buoyant-density method for the detection and isolation of clo-
I
sed-circular duplex DNA. Proceedings of the National Academy of Sciences of the USA, 57,1514-21. [A des-
crição original da centrifugação em gradiente de densidade contendo brometo de etídio.l
: Rogers, S.O. & Bendich, A.J. (1985) Extraction of DNA from milligram amounts of fresh, herbarium and mum-
I mified plant tissues. Plant Molecular Biology, 5,69-76. [O método de CTAB.]
Yamamoto, K.R., Alberts, B.M., Benzinger, R., Lawhome, L. & Trieber, G. (1970) Rapid bacteriophage sedimen-
.
tation in the presence of polyethylene glycol and its application to large scale virus preparation. l4rology, 40,
: 734-44.lPrcpração de,pNA de À.1
Zinder, N.D. & Boeke, J.D. (1982) The filamentous phage (Ff) as vectors for recombinant DNA. Gene, 19, l-10.
[Métodos para a multiplicação e a preparação de DNA de fagos.]
CnpÍru to 4
Manipulação de DNA Purificado

A gama de enzimas para a manipulação de DNA, 64 Ligação: unindo moléculas de DNA, 86


Enzimas para a clivagem de DNA: endonucleases de
restrição, 7 I

Depois de amostras de DNA puras terem sido preparadas, a etapa seguinte em um experimen-
to de clonagem gênica é a construção da molécula de DNA recombinante (Figura 1.1). para
produzir essa molécula recombinante, tanto o vetor como o DNA a ser clonado devem ser cli-
vados em pontos específicos e unidos de uma maneira controlada. A clivagem e a união são
dois exemplos de técnicas de manipulação do DNA, uma grande variedade das quais vem sen-
do desenvolvida nos últimos anos. Além de serem clivadas e reunidas, as moléculas de DNA
podem ser encurtadas, estendidas, copiadas em RNA e em novas moléculas de DNA e modi-
ficadas pela adição ou remoção de grupos químicos específicos. Essas manipulações, que po-
dem, sem exceção, ser realizadas em tubos de ensaio, constituem a fundação não apenas para
a clonagem gênica, mas também para estudos básicos sobre a bioquímica do DNA, a estrutu-
ra dos genes e o controle da expressão gênica.
Quase todas as técnicas de manipulação do DNA utilizam enzimas purificadas. No inte-
rior da célula, tais enzimas paÍicipam de processos essenciais, como a replicação e a transcri-
ção do DNA, a destruição de DNA estranho ou indesejável (por exemplo, o DNA de um vírus
invasor), a reparação de DNA mutado e a recombinação entre diferentes moléculas de DNA.
Depois da purificação a partir de extratos celulares, muitas dessas enzimas podem ser persua-
didas a executar suas reações naturais, ou algo relacionado a elas, sob condições artificiais.
Embora essas reações enzimáticas sejam freqüentemente diretas, a maioria dàlas é impossí-
vel de executar por métodos químicos tradicionais. As enzimas purificadas são, portanto, cru-
ciais para a engenharia genética, fato que levou ao surgimento de um ramo industrial impor-
tante, a partir da preparação, dacaracÍenzação e da comercialização das mesmas. Fornecedo-
res comerciais de enzimas altamente purificadas prestam um serviço essencial ao
biólogo mo-
lecular.
64 T. A. Bnowru

As manipulações de clivagem e de união que constituem a base da clonagem gênica são


executadas por enzimas chamadas endonucleases de restrição (para clivagem) e ligases (pa-
ra a união). A maior parte deste capítulo tratará dos diferentes modos de utilização desses dois
tipos de enzima. Primeiramente, porém, deve ser considerada toda a gama de enzimas para a
manipulação do DNA, para ver exatamente quais os tipos de reações que podem ser executa-
das. Muitas dessas enzimas serão mencionadas em capítulos posteriores, quando da descrição
de procedimentos que fazem uso delas.

4.1 A gama de enzimas para a manipulação de DNA


As enzimas para a manipulação do DNA podem ser agrupadas em cinco grandes classes, de-
pendendo do tipo de reação que catalisam:

(1) Nucleases são enzimas que clivam, encurtam e degradam moléculas de ácidos nucléi-
cos.
(2) Ligases unem moléculas de ácidos nucléicos.
(3) Polimerases fazem cópias de moléculas.
(4) Enzimas modiÍicadoras removem ou adicionam grupos químicos.
(5) Topoisomerases introduzem ou removem superenrolamentos de DNA circular covalen-
temente fechado.

Antes de ver detalhadamente cada uma dessas classes de enzima, dois aspectos devem ser
salientados. O primeiro é que, embora a maioria das enzimas possa ser designada para uma
classe específica, algumas apresentam atividades múltiplas, abrangendo duas ou mais classes.
Mais importante ainda é que muitas polimerases combinam suas capacidades de produzir no-
vas moléculas de DNA com uma atividade degradativa (isto é, de nuclease) de DNA associa-
da. fre nugesr
Em segundo lugar, deve ser observado que, assim como existem as enzimas para a mani- ruüúBfrG
pulação de DNA, há muitas enzimas similares conhecidas que são capazes de agir sobre o ünr,k
RNA. A ribonuclease utilizada paÍa remover RNA contaminante de preparações de DNA (p. mÍilrdh4ç,q
45) é um exemplo desse tipo de enzima. Embora algumas enzimas de manipulação de RNA mrffic
tenham aplicações na clonagem gênica e sejam mencionadas em capítulos posteriores, o en- üumdÍffid
foque, em geral, estará restrito àquelas enzimas com atuação sobre DNA.
lh&Íblil
ü|ffinfuÉ
4.1.1 Nucleases üm[offesr
Nucleases degradam moléculas de DNA quebrando as ligações fosfodiéster que unem nucleo-
tídeos adjacentes em uma fita de DNA. Existem dois tipos diferentes de nuclease (Figura 4.1):

(1) Exonucleases removem um nucleotídeo de cada vez, a pafiir da extremidade de uma üdt
molécula de DNA. m
(2) Endonucleases são capazes de quebrar ligações fosfodiéster no interior da molécula de mfu
DNA. grú
puú
A principal distinção entre as diferentes endonucleases reside no número de htas que são
degradadas quando uma molécula de fita dupla é atacada. A enzima chamada 8a131 (purifi- ]om'crrÉi
cada a partir da bactéria Alteromonas espejiana) é um exemplo de exonuclease que remove

L
Clotlneev GÊNtcA E ANÁLtsE oe DNA 65

I a base da clonagem gênrca são


b (para clivagem) e ligases (pa- (a) Uma exonuclease
tmodos de utilização desses dois
I toda a gama de enzimas para a Clivagem
rreações que podem ser executa-
I +
posteriores, quando da descrição
+ Ponte de hidrogênio

Nucleotídeo
Ligação fosfodiéster
Clivagem
D de DNA D'
-o-
hs em cinco grandes classes, de-

hur moléculas de ácidos nucléi- qog?99999ç9gg99po-o


:q-O-@3-O

m químicos.
rrcntos de DNA circular covalen- (b) Uma endonuclease

enzima, dois aspectos devem ser


as possa ser designada para uma
Srangendo duas ou mais classes.
has capacidades de produzir no-
€, de nuclease) de DNA associa- Figura 4.1
ls reações catalisadas
bxistem as enzimas para a mani- dois tipos diferentes
de nuclease. (a) Uma
fuue são capazes de agir sobre o
wrte de preparações de DNA (p. mruclease, que remove
mdeotídeos a partir da
nzimas de manipulação de RNA
ü€Ínidade de uma mo- +
h em capítulos posteriores, o en- Fctila de DNA. (b) Uma
b sobre DNA. .@ ..@
iaÉonuclease, que que-
tha fgações ÍosÍodiéster
..É -@-
:
internas.
kx fosfodiéster que unem nucleo-
ftrentes de nuclease {Figura 4. I ):
r

nucleotídeos a partir de ambas as fitas de uma molécula de fita dupla (Figura 4.2a). euanto
ia partir da extremidade de uma maior for o tempo de ação da Bal31 sobre um grupo de moléculas de DNA, mais curtos serão
péster no interior da molécula de os fragmentos de DNA resultantes. Já outras enzimas, como a exonuclease III de E coli, de-
gradam apenas uma das fitas da molécula de fita dupla, deixando DNA de fita simples como
: produto (Figura 4.2b).
bside no número de fitas que são
Lenzima chamada Bal3l (purifi- critério pode ser utilizado para classihcar endonucleases. A endonuclease S I (do fwgo Asper-
s oryzae) cliva apenas fitas simples (Figura 4.3a), enquanto a desoxirribonuclease I (DNase I), a
rylo de exonuclease que remove
é preparada a partir de pâncrEas bovino, cliva tanto moléculas de fita simples como de fita dupla (Fi-
66 T. A. Bnowr.r

(a) Bal3l

Ud+o.+O..rcr1c
opo4àóó+q P

(b) Exonuclease lll Fi$


âsrca@sca
das por dibre
5' 3', pcdeendonu
rttttt
pl ì*dease S
ftapenas D
3', 5', tasimples, in
çebras defit
Ces em mol
FrdoÍÍúnaÍile
üfadr.pla-(b,
Figura4.2 s I, que divr
As reações catalisadas pelos diferentes tipos de exonuclea- Íl{A de fita s
se. (a) Bal31 , que remove nucleotídeos a partir de ambas as çEbdefita
-@
+ó Íitas de uma molécula de Íita dupla. (b) Exonuclease lll, que iffiffmendornr
rrlrrl
.Cr. ìC. +-O-GO+O€+ remove nucleotídeos somente a partir da extremidade 3'(ver cËlesüiçãq qu
p. 91 para a descrição das diÍerenças entre as extremidades IIiIA de fita
3'e 5'de um polinucleotídeo). ÌnEapenas(
fiitneíoffirb
gura 4.3b). A DNase I é considerada inespecífica porque ataca o DNA em qualquer ligação fosfodiéster
interna; o resultado final da ação prolongada da DNase I é, portanto, uma mistura de mononucleotídeos
dnris
e oligonucleotídeos muito curtos. Por outro lado, o grupo especial de enzimas chamadas de endonuclea-
deDI\
ses de restrição cliva DNA de fita dupla somente em um número limitado de sítios de reconhecimento
específicos (Figura 4.3c). Tais enzimas, extremamente importantes, são descritas em detalhe na página tffl.l| Èlim
71.
DNA.
4.1.2 Ligases molde
nâÍ s{]
Na célula, a função das ligases é reparafquebras ("descontinuidades") em fitas individuais,
gresp
que surgem em moléculas de DNA de fita dupla durante a replicação do DNA, por exemplo.
As DNA-ligases da maioria dos organismos podem igualmente unir dois fragmentos indivi- a
pÍine

r--- : - :*+::!:- .'+-:-i--!!:==.::


= -,-:
-+1

F
v

í
Ë
I
í.

h
F : i=%___-
F
Cr-orunceu GÊNrcA E ANÁLrsE DE DNA 67

(a) Nuclease 31

Uma quebra

(D (ii)
-@ €...* ..@
I
I
óóó<+ó+o-e
V I
I

.@-@ Y
..@ .@
I
I

V
óó+ +J{+
=*4.@..F àQ

(b) DNase I

(D (ii)
."@
9annffi
-@
I

Figura 4.3 t I
I

Y
fficações catalisa- ..@..@
bpordiÍerentes ti- €4rrtrrrll
o+€..É
I
I ..@€...@
endonuclease. V
S1, que .*-G-.@..É
apenas DNA de
inclusive -FG-.É..@ rrt
çÉÍas de Íita sim- ..F+..F..@
psem moléculas
mÉrninantemente
illadupla. (b) DNa- (c) Uma endonuclease de restrição
c l" que cliva tanto
tipos de exonuclea- mAde Íita simples
ídeos a partir de ambas as
(b) Exonuclease lll, que
mrnb de Íita dupla.
endonuclease
a partir da extremidade 3'(ver que cliva
entre as extremidades llÌ{A de Íita dupla, I
msapenas em um
limitado de sÊ
tios.
qualquer ligação fosfodiéster
mistura de mononucleotídeos
duais de DNA de fita dupla (Figura 4.4). O papel dessas enzimas na construção de moléculas
chamadas de endonuclea-
de DNA recombinantes é descrito na página 84.
de sítios de reconhecimento
itas em detalhe na página
Polimerases
DNA-polimerases são enzimas que sintetizam uma nova fita de DNA, complementaÍ a um
molde de DNA ou RNA preexistente (Figura 4.5a). A maioria das polimerases pode funcio-
") em fitas individuais, nÍÌr somente se o molde possui uma região de fita dupla, que atua com um iniciador (do in-
glês primer) para reação de polimerização.
do DNA, por exemplo.
unir dois fragmentos indivi- Quaffo tipos de DNA-polimerase são utilizados rotineiramente na engenharia genética. O
primeiro é a DNA-polimerase I, geralmente obtida de E. coli. Essa enzima liga-se a uma re-

F
68 T. A. Bnowr'r

(a) Reparo de descontinuidade

Uma descontinuidade

I oNn-tig"r"
i

(b) União de duas moléculas

Figura 4.4
As duas reações catalisadas pela DNA-ligase. (a)
o*o-"n"."
J Reparo de uma descontinuidade - uma ligação
..@.@ ÍosÍodiéster Íaltante em uma das Íitas de uma
rlrrlrrrl
-@O..@ molécula de Íita dupla. (b) União de duas molé-
culas.

gião curta de fita simples (ou quebra) em uma molécula de DNA de fita dupla e, então, sin-
tetizauma fìta completamente nova, degradando a fita preexistente à medida que prossegue
na sua atividade (Figura 4.5b). A DNA-polimerase I é, portanto, um exemplo de enzima com
atividade dupla - polimerização e degradação de DNA.
De fato, as atividades de polimerase e de nuclease da DNA-polimerase I são controladas
por diferentes partes da molécula da enzima. A atividade de nuclease está contida nos primei-
ros 323 aminoácidos do polipeptídeo, de modo que a remoção desse segmento dá origem a
uma enzima modificada, a qual retém a função de polimerase, mas é incapaz de degradar
DNA. Essa enzima modificada, chamada de fragmento de Klenow, pode ainda sintetizar
uma fita de DNA complementar a um molde de fita simples, mas, como não possui atividade
de nuc!959, é incapaz de continuar a síntese depois de a quebra ter sido preenchida (Figura
4.5c). Vrárias outras enzimas - polimerases naturais e versões modificadas possuem proprie- Figura
-
dades similares às do fragmento de Klenow. A principal aplicação do fragmento de Klenow e As rea
dessas polimerases relacionadas a ele é no seqüenciamento de DNA (p.2I2). sintetü
A DNA-polimerase de Taq,utllizada na reação em cadeia da polimerase (PCR) (Figura bras, n
1.2), é' a enzima DNA-polimerase I da bactéria Thermus aquaticus. Esse organismo vive em dftJa qr

fontes termais e muitas de suas enzimas, inclusive a DNA-polirnerase de Taq, são termoestá-
quebr
veis, o que significa que são resistentes à desnaturação por tratamento térmico. É essa a carac-
teística especial da DNA-polimerase de Taq que a torna adequada para a pCR, pois, se não
fosse termoestável, ela seria inativada quando a temperatura da reação é elevada a 94"C para
desnaturar o DNA.
tl.tl Enzim
O tipo final de DNA-polimerase importante para a engenharia genética é a transcriptase Exister
reversa, uma enzima envolvida na replicação de viírios tipos de vírus. A transcriptase reversa de gn4
é única por utilizar RNA como molde, emqez de DNA (Figura 4.5d). A capacidade que essa
enzima tem de sintetizar uma fita de DNA complementar a um molde de RNA ó fundamental (1) r
para a técnica denominada clonagem de DNA complementar (cDNA) (p.112-fi9. n
7, 4

F
F
;
:
:

t
F
E
Crorueeeu GÊNrcA E ANÁLrsE oe DNA 69

(a) A reação básica

s', 3', 5_
A_T_G_C-A-A_T-G-C_A_T_
3',
-A-T-G-C-A-A-T-G-C-A-T- ----ì>
,/ _- à-ì-^- - t - a - c - g - t - t - a - c-c-T-A-
Molde lniciador 3' 5' 3', 5',

Nova Íita sintetizada

(b) DNA-polimerase I

- A-T-G-C-A-A-T-G-C-A-T- -----> -A-T-G-C-A-A-T-G-C-A-T-


-T_A_C-G G-T_A_ - t - a - c - g - t -t - a- c -G-T-A-
Uma quebra N ucleotídeos preexistentes

-_ -/-
são substituídos

catalisadas pela DNA-ligase. (c) O fragmento de Klenow


de - uma ligação
em uma das fitas de uma
. (b) União de duas molá
-f-T-9-9-A-A-r-G-9-l-T- _____> -A-T-G-C-A-A-T-G-C-A-T-
-T-A-C-G G_T-A- -T-A-C-G- t - Ì - a - C-G-T-A-
,
Os nucleotídeos / \\
preexistentes
não são substituídos
- Somente a quebra
DNA de fita dupla e, então, é preenchida
istente à medida que
um exemplo de enzima (d) Transcriptase Íeversa

-polimerase I são controlartes -A-u-c-c-A-A-u-c-g-l-y- -/-l-y-g-g-l-l-y-g-g-f-y-


t v6-T-A-
l'/-t-a-c-g-t-t-a-c-c-T-A-
está contida nos primei-
desse segmento dá origem a /
/**o\ \
. mas é incapaz de degrada
Klenow, pode ainda sintetiza
Molde de RNA Nova Íita
de DNA
aüÌs. como não possui atividade
ter sido preenchida (FiguÍa
Figura 4.5
do fragmento de Klenow e As reações catalisadas por DNA-polimerases. (a) A reação básica: uma nova Íita de DNA é
DNA (p.212). sintetizada na direção de 5'para 3'. (b) DNA-polimerase l, que inicialmente preenche que-
da polimerase (PCR) (Figura bras, mas, depois, continua a sintetizar uma nova Íita, degradando a fita preexistente à me-
. Esse organismo vive em dida que prossegue na sua atividade. (c) O fragmento de Klenow, que somente preenche
quebras. (d) Transcriptase reversa, que utiliza um molde de RNA.
de Taq, são termoestá-
térmico.Éessaacarac-
para a PCR, pois, se não
reação é elevada a 94.C para Enzimas modificadoras de DNA
genética é a transcriptase Existem inúmeras enzimas que modificam moléculas de DNA pela adição ou pela remoção
vírus. A transcriptase reversa de grupos químicos específicos. As mais importantes são as seguintes:
-1.5d). A capacidade que essa
molde de RNA é fundamental (1) Fosfatase alcalina (de E. coli, de tecido intestinal de vitelo ou de camarão iártico), que
remove o grupo fosfato presente na extremidade 5' de uma molécula de DNA (Figura
) @. 172-174t.
o 4.6a).

Ë
70 T. A. Bnowrl

(2) Polinucleotídeo-quinase (de E. coli infectada com fago T4), que tem o efeito inverso
da fosfatase alcalina, adicionando grupos fosfato às extremidades 5'livres (Figura 4.6b).
4.2 Enz
(3) Desoxinucleotidil-transferase terminal (de tecido tímico de vitelo), que adiciona um den
ou mais desoxirribonucleotídeos às extremidades 3'de uma molécula de DNA (Figura
4.6c). Ar
pft
4.1.5 Topoisomerases tru
s€I
A classe final de enzimas para a manipulação de DNA é a das topoisomerases, as quais são
seÍ
capazes de modificar a conformação de DNA circular fechado covalentemente (por exemplo,
moléculas de DNA plasmidial) pela introdução ou remoção de superenrolamentos (p. 50-51). rar
Embora as topoisomerases sejam importantes para o estudo da replicação do DNA, ainda não .cli
ten
foi encontrada uma utilidade efetiva para elas na engenharia genética.
es[

4.7
qu(
des
(a) FosÍatase alcalina

'-ottì"-o,o,o-o--d OH HO
rrlr \#
ry{@q
OH

Poï HO. OH

(b) Polinucleotídeo-quinase
Figura 4.6
As reações catalisa-
HO
W "w
'-o"P
rtttt
oH das por enzimas mo-
diÍicadoras de DNA.
HO
P+oo-.q. OH
P..+o-o44q
HO' 'POï (a) FosÍatase alcali-
na, que remove gru-
pos S'-Íosfato. (b) Po-
(c) Desoxinucleotidil-transÍerase terminal
linucleotídeo-quina-
se, que acrescenta
grupos S'-ÍosÍaÌo. (c)
(i)
s',
..@\
3'J s',
-€...@{4O-F
s',
Desoxinucleotidil-
transÍerase terminal,
que acrescenta deso-
xirribonucleotídeos
(ii)
s', 3',JJ 5' às extremidades 3'
,.- ?fl999ng-
iarrrtll! 1+ afaAfa9Êo+ de polinucleotídeos
J3' 3@tt,*
ç{F.F{F.F.F{>{){F_ @
em moléculas (i) de
Íita simples ou (ii) de Frgrr
Íita dupla. fi,nessilar
ofiiqens pre
mnnnanirulaçÍ
IilD{A ern um r
;ümnbdec
seÍn s€

F
:

;:

F
CLoruecev GÊNtcA E Ar.rÁlrse oe DNA 11

go T4), que tem o efeito inverso


remidades 5'livres (Figura 4.6b).
Enimas para a clivagem de DNA: endonucleases
nico de vitelo), que adiciona um de restrição
; uma molécula de DNA (Figura
A clonagem gênica exige que as moléculas de DNA sejam clivadas de uma maneira
muito
prwisa e reproduível. Isso é ilustrado pela maneira pela qual o vetor é clivado
durante a cons-
rução de uma molécula de DNA recombinante (Figura 4.7a). Cadamolécula
do vetor deve
hs topoisomerases, ser clivada em uma única posição, para abrir o círculo de modo que
as quais são novo DNA possa ser in-
b covalentemente (por exemplo, serido: uma molécula clivada mais de uma vez será quebrada em àois ou mais
fragmentos se-
le superenrolamentos (p. 50-51). 1mn'ados e não será útil como vetor de clonagem. Ademais, cada molécula.de vetor deve ser
la replicação do DNA, ainda não ulivada exatamente na mesma posição do círculo como ficará claro a partir
- de capítulos pos-
genética. uÊÍiores. a clivagem aleatória não é adequada. Deve ficar bem-explicitado que
um tipo muito
cspecial de nuclease é necessário para executar essa manipulação.
Freqüentemente, também é necessário clivar o DNA que está para ser clonado (Figura
4-Tb). Para tanto, há duas razões. Primeira, se o objetivo for a clonàgem
de um único gãne,
que pode consistir em apenas 2 ou 3 kb de DNA, ele deve ser separado por
clivagem das gran-
des (muitas vezes maiores que 80 kb) moléculas de DNA proãuzidas pelo
uso das técnicas I

I
I

I
I
(a) Moléculas de vetor
I
I

I
I

aì-ï\cvasem
\-/Cs c\J
I
I
I
I risura +.e
As reações catalisa-
oas por enzimas mo-
OificaOoras de DNA.
^ \, + ,,--_,\. u
i I (a) FosÍatase atcati-
/-ì (
I n", que remove gru- () \-/
po" S'{osfato. (b) Po-
I linucleotídeo-quina-
Cada molécula de vetor deve ser clivada uma
I :::??"ïï'"ï::as
as cr ivasens devem
I se, que acrescenta
I Otunos s'{osÍato. (c)
(b) A molécula de DNA que contém o gêne a ser clonado
s, I Desoxinucleotidil-
r I transÍerase terminal,
Gene
I que acrescenta deso-
I às extremidades
* || de
xirribonucleotídeos
3'
r\_--{ ,%
polinucleotídeos \
| Íita
"r
motécutas (i)de , .....................*
<.--\
\
| fita dupla. ou (ii) de
simptes Figura 4.7 5- )
,lffi,rmressidade de A,/
Sítios de clivagem
idlluryens precisas - \<
rnmmranipulação de
[MilAem um expe- Fragmentos pequenos
Grande molécula de DNA o suficiente para serem
nmimpntode clona- clonados
gem gênica.
72 T. A. Bnowr.r

preparativas descritas no Capítulo 3. Segunda, grandes moléculas de DNA podem ter de ser
quebradas simplesmente visando à produção de fragmentos suficientemente pequenos para
serem cilïegados pelo vetor. A maioria dos vetores de clonagem exibe uma preferência por
fragmentos de DNA dentro de uma determinada faixa de tamanho; vetores baseados em M13,
por exemplo, são muito ineficientes para a clonagem de moléculas de DNA com uma exten-
são maior que 3 kb.
Endonucleases de restrição purificadas permitem que o biólogo molecular clive molécu-
las de DNA da maneira precisa e reprodutível, necessária para a clonagem gênica. A desco-
berta dessas enzimas, que deu o Prêmio Nobel para W. Arber, H. Smith e D. Nathans, em
1978, foi um dos marcos fundamentais no desenvolvimento da engenharia genética.

4-2.1 A descoberta e a função das endonucleases de restrição


A observação inicial que levou à descoberta das endonucleases de restrição ocorreu no início da
década de 1950, quando foi demonstrado que algumas linhagens bacterianas eram imunes à in-
fecção por bacteriófagos, um fenômeno chamado de restrição controlada pelo hospedeiro.
O mecanismo de restrição não é muito complicado, embora tenham sido necessiírios 20
anos para que ele fosse completamente compreendido. A restrição ocorre porque abactéria
produz uma enzima que degrada o DNA do fago antes que ele tenha tempo de replicar-se e de
dirigir a síntese de novas partículas virais (Figura 4.8a). O DNA da própria bactéria, cuja des-
truição seria obviamente letal, fica protegido do ataque por ser portador de grupos metila adi-
cionais, os quais bloqueiam a ação degradativa da enzima (Figura 4.gb).
Essas enzimas degradativas são denominadas endonucleases de restrição e são sintetiza-
das por muitas, ou talvez por todas, espécies de bactéria; mais de 1.200 enzimas de restrição
diferentes já foram caracterizadas alé agora. São reconhecidas três classes diferentes de endo-
nucleases de restrição, cada uma delas distinguida por um modo um pouco diferente de ação.
As enzimas dos tipos I e III são bastante complexas e têm aplicação limitada na engenharia
genética. As endonucleases de restrição do tipo II, por outro lado, são as enzimas de clivagem
Figur
Afurção de umi
de grande importância para a clonagem gênica.
ünudease de rr
çao em uma c
4-2-2 Endonucleases de restrição do tipo ll clivam o DNA em ffiüeriana: (a) o
seqüências n ucleotíd icas especíÍicas do Íago é clir
mas (b) o DNA
A caracteística principal
das endonucleases de restrição dô tipo II (que, de agora em di4nte,
teriano nãc
serão chamadas apenas de endonucleases de restrição) é que cada uma delas reconhece e cli-
va uma seqüência específica em uma molécula de DNA. Uma determinada enzima cliva o
DNA apenas na seqüência de reconhecimento, deixando qualquer outra seqüência intocada.
Por exemplo, a endonuclease de restrição chamada PvaI (isolada de Proteis vulgaris) cliva 42.3 Extrer
DNA apenas no hexanucleotídeo CGATCG. Já uma segunda ettzimada mesma ba ciéna, cha-
A natu
mada de PvuII, cliva em um hexanucleotídeo diferente, neste caso CAGCTG.
import
Muitas endonucleases de restrição reconhecem sítios-alvo hexanucleotídicos, mas outras
clivam
clivam seqüências de quatro, cinco ou até oito nucleotídeos. Sau3A (de Staphytococcus au-
sultant
reus linhagem 3A) reconhece GATC e AluI (de Arthrobacter luteus) cliva em AGCT. Exisrem
exemp
também exemplos de endonucleases de restrição com seqüências de reconhecimento degene-
Enr
radas, o que significa que elas clivam o DNA em qualquer membro de uma família de sítios
relacionados - Hinfl (de Haemophilus influenzae linhagem R), por exemplo, reconhece
rauml
GANTC, de modo que cliva em GAATC, GATTC, GAGTC e GACTC.
tenar
fÍìs, est
As seqüências de restrição para alguràas das endonucleases de restrição mais freqüente-
determ
mente utilizadas estão listadas na Tabela 4.1.
em cad
pois o I

t
E

rË :<
Ct-oruncev GÊuca e ANÁLtsE oe DNA 73

de DNA podem ter de ser


nte pequenos para
(a) Restrição do DNA do Íago
uma preferência por
rrtores baseados em M13,
de DNA com uma exten-

molecular clive molécu-


gênica. A desco-
Smith e D. Nathans, em

restrição
Endonucleases de restrição
ocoÍïeu no início da ligam-se ao DNA do fago
eram rmunes a ln-
pelo hospedeiro. (b) O DNA bacteriano não é clivado
tenharn sido necessários 20
ocorre porque a bactéria
tempo de replicar-se e de
da própria bactéria, cuja des-
de grupos metila adi-
4.8b).
de restrição e são sintetiza-
1.200 enzimas de restrição
classes diferentes de endo-
um pouco diferente de ação.
limitada na engenharia Figura 4.8
são as enzimas de clivagem frnção de uma en-
de restri-
1ão em uma célula
DNA em briana: (a) o DNA
tb Íago é clivado,
ms (b) o DNA bac-
tr (que, de agora em diante, teriano não o é.
uma delas reconhece e cli-
determinada enzima cliva o
ouffa seqüência intocada
de Proteus vulgaris) cliva- Extremidades cegas e coesivas
ima da mesma bactéria, cha- A natureza exata da clivagem produzida por uma endonuclegse de restrição é de considerável
CAGCTG. importância no projeto de um experimento de clonagem. Müitas endonucleases de restrição
mas outras clivam simplesmente as duas fitas no meig da seqüência de reconhecimento (Figura 4.9a), re-
A, (de Staphylococcus au- sultando em uma extremidade cega (do inglê,s blunt end ou flush end). PvuII e AluI são
) clivaemAGCT. Existem exemplos de enzimas que geram extremidades cegas.
de reconhecimento degene- Entretanto, um grande número de endonucleases de restrição cliva o DNA de uma manei-
de uma família de sítios ra um pouco diferente. Com essas enzimas, as duas Íitas de DNA não são clivadas exatamen-
&), po. exemplo, reconhee te na mesma posição. Em vez disso, a clivagem ocoÍïe de maneira desencontrada nas duas fi-
GACTC. tas, estando os sítios de clivagem geralmente separados por dois a quatro nucleotídeos, o que
de restrição mais freqüente- determina que os fragmentos de DNA resultantes possuam pequenas projeções de fita simples
em cada extremidade (Figura 4.9b). Tais extremidades são chamadas de adesivas ou coesivas,
pois o pareamento de bases entre elas pode reunir os fragmentos da molécula de DNA (lem-

F
t

b
I
74 T.A.Bnowr

Tabela 4.1 As seqüências de reconhecimento para algumas das endonucleases de restrição


mais freqüentemente utilizadas

Seqüência de Extremidade
Enzima Organismo reconhecimentou cega ou coesiva

EcoR.I Escherichia coli GAATTC Coesiva


BamHI B ac illus amy lo liquefac i en s GGATCC Coesiva
BgIII Bacillus globigii AGATCT Coesiva
PvuI Proteus vulgaris CGATCG Coesiva
PvUII Proteus vulgaris CAGCTG Cega
HindIII H ae mo p hi lus influe nzae Ro AAGCTT Coesiva
HinfT H ae mo p hi lu s influe nzae R, GANTC Coesiva
Sau3A Staphylococcus aureus GATC Coesiva
AluI Arthrobacter luteus AGCT Cega
TaqI Thermus aquaticus TCGA Coesiva
HaeIII Haemophìlus aegyptius GGCC Cega
NotI N o cardia otitidis - c aviarum GCGGCCGC Coesiva
sfr S t re ptomy c e s fimb riatus GGCCNNNNNGGCC Coesiva

"A seqüência mostrada corresponde à de uma das fitas, representada na direção de 5' para 3'. Note que
quase todas as seqüências de reconhecimento são palíndromos: quando as duas fitas são consideradas,
elas são lidas da mesma maneira em ambas as direções. Por exemplo:
Er
5'_GAATTC_3'
EcoRl ||lt
3'-CTTAAG-5'

bre que extremidades coesivas foram vistas napâgina 33, durante a descrição da replicação
do fago l,). Uma característica importante dessas endonucleases de restrição é que enzimas
com diferentes seqüências de reconhecimento podem produzir as mesmas extremidades coe-
sivas. BamHI (com a seqüência de reconhecimento GGATCC) e BgIII (AGATCT) são exem-
plos disso - ambas produzem extremidades coesivas GATC (Figura 4.9c). Amesma extremi-
dade coesiva é também produzida por Sau3A, que reconhece somente o tetranucleotídeo
Ê
iQfiloa
GATC. Fragmentos de DNA produzidos por clivagem com qualquer uma dessas enzimas po-
dein ser ligados uns aos outros, pois cada um deles é portador de uma extremidade coesiva
complementar.
rffi
4.2.4 A freqüência de seqüências de reconhecimento em uma tffimcl
molécula de DNA &,q:r
üm
O número de seqüências de reconhecimento para uma determinada endonuclease de restrição dËrn
em uma molécula de DNA de tamanho conhecido pode ser calculado matematicamente. Urm tud
seqüência tetranucleotídica (por exemplo, GATC) deve ocorrer uma vez a cada 4a = 256 nw müü(
cleotídeos, e uma seqüência hexanucleotídica (por exemplo, GGATCC) uma vez a cada 46
= drul
4.096 nucleotídeos. Esses cálculos assumem que os nucleotídeos estão ordenados de manei- frthdl
ra aleatória e que os quatro nucleotídeos diferentes estão presentes nas mesmas proporçõee ü,u
(isto é, um conteúdo de GC = 507o). Na prâtica, nenhuma dessas suposições é completamer rp
te válida. Por exemplo, a molécula de DNA de ),, com 49 kb, deveria conter
te 12 sítios prÌra uma endonuclease de restrição com uma seqüência de reconhecimento mru

F
Crorunoev GÊntcn e ANÁLlsE oe DNA 75

(a) Produção de extremidades cegas

-N-N-A-G-C-T-N-N- AIr^t
_N-N-A_G C_T-N_N-
-N-N_ T-C_G_A-N-N- -N-r$-ï-b c-À-ú-ú-
'N'= A, G, C ou T Extremidades cegas

(b) Produção de extremidades coesivas

-N-NG-A-A-T-T-C-tÈt$-+ ecoRl -N-N-G A-A-T-T-C-N-N-


-N-N-C-T-T-A-A-G-Ì{--N- -N-N-C-T-T-A-A\ G-N-N-
\\
Extremidades coesivas

de 5'para 3'. Note que (c) As mesmas extÍemidades coesivas produzidas


fitas são consideradas, por diÍerentes endonucleases de Íestrição'
Figura 4.9
_N_N_G G_A_T_C-C_N_N-
filclüernidades Pro-
Bam*l
rünftlas por clivagem -*-ru-c- c-T-A-c G-N_N-
übDilA com diÍeren-
(a) Uma ex-
-N_N_A G_A_T-C-T_N-N-
cega produ- Bgttt
a descrição da rePlicação
pÍÁ/ri.(b) Uma -ú-ú-i- c-r-A-c À-ú-ú-
rünmilade coesiva
restrição é que enzimas por EcoRl.
Mmrnas extremidades coe- npsmas extre- IN_N_N G_A-T_C_N-N-N_
ffiSm (AGATCT) são exem- coesivas pro- SauSA
{.9c). A mesma extremi- ürudas por Bam{l, -N-ü-N- c-r-A-c ú-ú-ú-
$iffnente o tetranucleotídeo ftillle SauBA.
uma dessas enzimas Po'
uma extremidade coesiva
nucleotídica. Na realidade, tais sítios de reconhecimento ocorrem com uma freqüência menor
(por exemplo, seis para BglII, cinco pata BamHI e apenas dois para SalI), um reflexo do fato
em uma de que o conteúdo de GC de À é bem merìor do que 50Vo (Figura4.10a).
Além disso, os sítios de restrição em geral não estão distribuídos uniformemente ao longo
de uma molécula de DNA. Se eles estivessem, uma digestão com uma determinada endonu-
endonuclease de restrição
clease de restrição geraria fragmentos com tamanhos aproximadamente iguais. A Figura 4.10b
matematicamente. Uma
nostra os fragmentos produzidos pela clivagem do DNA de l, com BgtII, BamHI e SalI' Em
uma vez a cada 4a = 256 nu-
sada caso, existe uma considerável variação nos tamanhos dos fragmentos, indicando que os
uma vez a cada 46 =
nucleotídeos não estão ordenados aleatoriamente no DNA de À.
s estão ordenados de maneÈ
A lição a ser tilada da Figura 4.10 é que, embora a matemática possa dar uma idéia de
nas mesmas proporçoes
quantos sítios de róstriçao são esperados para uma molécula de DNA, somente uma análise
suposições é comPletamen-
'eria conter aProximadamen- experimental é capazde mostrar o quadro real. Deve-se, portanto, ir adiante para considerar-
sa como as endonucleases de restrição são utilizadas em laboratório'
cia de reconhecimento hexa-

t
76 T.A.Bnowru

caso deven
(a) Sítios de clivagem no DNA de À 4.1 la). São
Obvian
tida de um
antes de se
da para pm
das endoru
podem vari
dio [NaCl],
po [I exiger
te redutor, r

damental q
I egnt- 6 sítios tas de NaC
I eamHl -5sítios bém poden
ocorTa em r

À srn-2sÍtios A coml
estáemum
ção à miso
(b) Tamanhos dos Íragmentos da reação s
já presente
A endo
Bgill
enzima é d
22010
13286 modo que r

qüentemen
r------- 2392
para a cÏl'z
-651
n 415
r60
Bgü+ tS
Oúltin
Bamt'l.l ses de resü
16841 exigências
----.---...-..--7233
r--------------- 677O como aDìti
t-----"---'---- 6527 de resriçã
|_-.....--ì5626 da enzima-
|------------ì5505 Depois
DNA prod
Sa/l
32745 destmída d
1 5258 DNA que'
n 499 "matar" es
outrÍìs é ul
(EDTA) (q
Figura 4.10 4.1le).
Restrição da molécula de DNA de ì,. (a) As posições das seqüências de reconhecimento pa-
ra Bgtll, Bamïl e Sa/ì. (b) Os Íragmentos produzidos por clivagem com cada uma dessas |t!È6 Analisam
endonucleases de restrição; os números correspondem aos tamanhos dos Íragmentos, em
pares de bases. Uma diges
das posiçú
gnal (Figu
4.2.5 Executando uma digestão de restrição no laboratório gem gênic:
Por exemplo, será considerado como digerir uma amostra de DNA de l" (em uma concentra- nho dos fra
ção de 125 pg/ml) com BglII. @e serer
Primeiramente, toda a quantidade de DNA necessiíria deve ser pipetada em um tubo de en- léculas de I
saio. A quantidade de DNA que será restringida depende da natureza do experimento; neste nores, de n

ft
n
F
t,'
I
-L
i.
Clouncev GÊNrcA E ANÁLrsE oe DNA 77

caso devem ser ingeridos 2 trtg de DNA de 1,, que estão contidos em 16 pl da amostra (Figura
4.lla). São, portanto, necessárias micropipetas bastante precisas.
Obviamente, o outro componente principal da reação será a endonuclease de restrição, ob-
tida de um fornecedor comercial como uma solução pura e de concentração conhecida. Mas,
antes de se adicionar a endonuclease de restrição, a solução contendo o DNA deve ser ajusta-
da para prover as condições corretas pÍÌra assegurar a atividade máxima da enzima. A maioria
das endonucleases de restrição funciona adequadamente em pH 7 ,4, mas diferentes enzimas
podem variar nas suas exigências quanto à força iônica (geralmente suprida por cloreto de só-
dio [NaCl]) e à concentração de magnésio (Mg*2) (todas as endonucleases de restrição de ti-
po II exigem Mg*z para o seu funcionamento). É também recomendável a adição de um agen-
te redutor, como o ditiotreitol (DTT), que estabiliza a enz;rmae evita a sua inativação. É fun-
damental que as condições corretas sejam proporcionadas à enzima - concentrações incorre-
tas de NaCl ou Mg*'não somente reduzem a atividade da endonuclease de restrição, mas tam-
bém podem causar alterações na sua especificidade, fazendo com que a clivagem do DNA
ocoÍra em outras seqüências de reconhecimento, não-usuais.
A composição de um tampão adequado para BgIII é mostrada na Tabela 4.2. Esse tampão
está em uma concentração 10 vezes maior do que a de trabalho e é diluído quando da sua adi-
ção à mistura da reação. No exemplo apresentado, um volume final adequado para a mistura
da reação seria de 20 pl, se forem adicionados 2 pl de tampão de Bgill l0 x aos 16 pl de DNA
já presentes (Figura 4.1 lb).
A endonuclease de restrição pode agora ser adicionada. Por convenção, uma unidade de
enzima é definida como a quantidade necessária para clivar 1 pg de DNA em uma hora, de
modo que serão necessárias 2 unidades de BglII para clivar 21tg de DNA de ìu. BgIII é fre-
qüentemente obtida em uma concentração de 4 unidades/pl, de modo que 0,5 pl é suficiente
para a clivagem do DNA. Os ingredientes finais na mistura da reação são, portanto, 0,5 pl de
BgIII + 1,5 pl de água, determinando um volume final de 20 p.l (Figura 4.11c).
O último fator a ser considerado é a temperatura de incubação. A maioria das endonuclea-
ses de restrição, inclusive Bg1II, funciona melhor a3'7"C, mas algumas poucas enzimas têm
exigências diferentes. TaqI, por exemplo, é uma enzima de restrição de Thermus aquaticus e,
como a DNA-polimerase de Tgq, possui uma temperatura de trabalho mais elevada. Digestões
de restrição comTaql devem ser incubadas a 65'C para que seja obtida a atividade máxima
da enzima.
Depois de uma hora, a restrição deve ser completa (Figura 4.1 1d). Se os fragmentos de
DNA produzidos pela restrição destinam-se a experimentos de clonagem, a enzima deve ser
destruída de alguma maneira, para que não possa digerir acidentalmente outras moléculas de
DNA que venham a ser adicionadas em um estágio posterior. Existem várias maneiras de
"matar" essa enzima. Para muitas, uma breve incubação a 70'c é suficiente, enquanto para
outras é utilizada uma extração com fenol ou a adição de ácido etilenodiaminotetracético
(EDTA) (que se liga a íons Mg*2, impedindo a ação da endonuclease de restrição) (Figura
4.1 1e).
de reconhecimento pa-
com cada uma dessas Analisando o resultado de uma clivagem de restrição
dos Íragmentos, em
Uma digestão de restrição resulta em vários fragmentos de DNA, cujos tamanhos dependem
das posições exatas das seqüôncias de reconhecimento para a endonuclease na molécula ori-
ginal (Figura 4.10). Para que as endonucleases de restrição possam ser utilizadas em clona-
gem gênica, é obviamente necessário um método para a determinação do número e do tama-
iA de l, (em uma concentra- nho dos fragmentos de DNA gerados por elas. A ocorrência ou não da clivagem da molécula
pode ser evidenciada com facilidade a partir do teste de viscosidade da solução. Grandes mo-
pipetada em um tubo de en- léculas de DNA resultam em uma solução mais viscosa do que uma contendo moléculas me-
do experimento; neste nores, de modo que a clivagem está associada a um decréscimo na viscosidade. A resolução
78 T. A. Bnowr.r

mâea
(a) Adição de 2 pl (b) Adição de 0,5 pl (c) meflIìa
de tampão de de Bglll + 1 ,5 trrl de dife
deH2O ffi
\ ll
Bglll Ent
forese
\_ ..-.......> de rtm:
I

tr L_l
---------->

u
las de ì

VI
DNA
léculas
Nal
r

2 pg de DNA
de À (16 rrl) I
/lncubação a
sar scp

37'c pot th
(d)
f
/

(e) tr
V----.-
W ,/ DNA de À ctivado

I I -/ídiçàode renot ou EDTA Figura 4.11


I I ou áquecimento a70 C por 15 min
Execução de uma diges-

V tão de restrição em labo-


ratório (ver texto para de-
talhes).

Tabela 4.2 Um tampão lOx adequado para a restrição de DNA com BglII

Componente Concentração (mM)


Tris-HCl, pH7,4 500
MgCl, 100
NaCl 500
Ditiotreitol 10

do número e do tamanho dos produtos de clivagem é, contudo, mais difícil. De fato, por mui-
tos anos esse foi um dos aspectos mais tediosos dos experimentos envolvendo DNA. Tais pru
blemas acabaram sendo resolvidos no início da década de 1970, quando foi desenvolvidaa
técnica da eletroforese em gel.

Separação de moléculas por eletroforese em gel


Moléculas de DNA, assim como proteínas e muitos outros compostos biológicos, são
doras de uma carga elétrica, negativa no caso do DNA. Conseqüentemente, quando
las de DNA são colocadas em um crìmpo elétrico, elas migram em direção ao pólo posi
(Figura4.l2a). A velocidade de migração de uma molécula depende de dois fatores: a sua
Croruneeu GÊNrcn e ANÁLrsE oe DNA 79

ma e a sua razão entre carga e massa. Infelizmente, a maioria das moléculas de DNA possui a
mesma forma e todas têm razões bastante similares entre carga e massa. Portanto, fragmentos
de diferentes tamanhos não podem ser separados por procedimentos-padrão de eletroforese.
Entretanto, o tamanho da molécula de DNA passa a ser um fator considerável se a eletro-
forese for executada em um gel. Um gel, que é via de regra feito de agarose, de acrilamida ou
de uma mistura de ambas, constitui uma rede complexa de poros, através da qual as molécu-
las de DNA devem passar para atingir o eletrodo positivo. Quanto menor for a molécula de
DNA, mais rapidamente ela pode migrar pelo gel. Portanto, a eletroforese em gel separa mo-
léculas de DNA de acordo com seus tamanhos (Figura 4.12b).
Na prática, a composição do gel determina os tamanhos das moléculas de DNA que podem
ser separadas. Um gel de agarose O,SVo com 0,5 cm de espessura, que possui poros relativa-

(a) EletroÍorese-padrão

DNA Tampão

Figura 4.11 r,"uo,o,"."


Execução de uma diges- f
tão de restrição em labo-
ratório (ver texto para de-
talhes).

com BglII O DNA migra em direção


ao ânodo, mas a separação
por classes de tamanho é
incipiente

(b) EletroÍorese em gel

Tampão

A amostra de DNA é aplicada


mais difíciÌ. De fato, por mur- em uma çanaleta formada no próprio gel
envolvendo DNA. Tais pro'
quando foi desenvolvida a

Figura 4.12
postos biológicos, são porta O DNA separa-se em bandas correspondentes
eleúoÍorese-pad rão não se-
a fragmentos de diferentes tamanhos
nte, quando molécu- de DNA de tama-
em direção ao pólo positivo nilirediÍerentes, enquanto (b) a MenoÍ
de dois fatores: a sua for- eletroÍorese em gel o faz.
-
80 T.A.Bnowru

mente grandes, pode ser usado para moléculas na faixa de tamanho qntre 1 e 30 kb, permitin- Auto-ra
do, por exemplo, a clara distinção entre moléculas de 10 e l2kb. No outro extremo da escala, Uma da
um gel de poliacrilamida 4OVo muito delgado (0,3 mm), com poros extremamente pequenos, DNA, A
pode ser utilizado paÍa separÍÌr moléculas de DNA muito menores, na faixa de 1 a 300 pb, per- lizadas i
mitindo a distinção de moléculas cujas extensões diferem em apenas um único nucleotídeo. tecção r

Visualizando moléculas de DNA em um gel Aar


trofores
Coloração de ser vi
A maneira mais fácil de visualizar os resultados de um experimento de eletroforese em gel é O DNA
a sua coloração com um composto que torne o DNA visível. O brometo de etídeo (EtBr),
já Umi
descrito na página 53 como um meio para a visualização de DNA em gradientes de cloreto de dores dt
césio (CsCl), é também rotineiramente utilizado na coloração de DNA em géis de agarose e essa ma

poliacrilamida (Figura 4.13). Bandas mostrando as posições das diferentes classes de tama- lation) <

nho de fragmentos de DNA são claramente visíveis sob irradiação ultravioleta após coloração AT:
com EtBr, desde que esteja presente DNA suficiente. Infelizmente, esse procedimento é bas- A maior
tante perigoso, pois o brometo de etídeo é um agente mutagênico potente e a radiação ultra- quando
violeta utilizada para visualizar o DNA pode causar queimaduras severas. Por essa razão, co- limerase
rantes não-mutagênicos, que coram o DNA de verde ou azul e não requerem irradiação ultra-
violeta para visualização dos resultados, são agora utilizados em muitos laboratórios.

Canaletas para as amostras

Gel de agarose
Suporte plástico
transparente para UV

lncubação em solução de
EtBr 0,5 pg/ml por 15 min

Bandas de DNA
fluorescentes,

Figura 4.13
Visualização de
bandas de DNA em Figura
um gel de agarose da autr
por coloração com dfrlgtda para vis
brometo de etídeo e
irradiação ultraviole-
tro Õ DÌ,lA rne
UV
ta (UV). umlgd de agar
Cr-oruecrv GÊNrcA E ANÁLrsE oe DNA 81

eltre 1 e 30 kb, permitin- Auto-radiografïa de DNA marcado radioativamente


No outro extremo da escala, Uma das desvantagens da coloração é o limite da sua sensibilidade. Se menos de l0 ng de
extremamente pequenos, DNA, aproximadamente, estão presentes em cada banda, é improvável que elas sejam visua-
na faixa de 1 a 300 pb, per- lizadas após a coloração. Para pequenas quantidades de DNA, é necessário um método de de-
um único nucleotídeo. tecção mais sensível.
A auto-radiografia é a resposta paÍa essa demanda. Se o DNA for marcado antes da ele-
troforese, pela incorporação de um marcador radioativo nas moléculas individuais, ele po-
de ser visualizado a partir da colocação de um filme fotográfico sensível a raios X sobre o gel.
de eletroforese em gel é O DNA radioativo expõe o filme, revelando o padrão de bandas (Figura 4.14).
O brometo de etídeo (EtBr), já Uma molécula de DNA é via de regra marcada pela incorporação de nucleotídeos porta-
A em gradientes de cloreto de dores de um isótopo radioativo do fósforo, o "P lFigura 4.15a). Existem vários métodos para
de DNA em géis de agarose e essa marcação, sendo os dois mais populares a translação de quebras (do inglês nicktrans-
diferentes classes de tama- lation) e o preenchimento de extremidades.
ultravioleta após coloração A translação de quebras (nick translation) refere-se à atividade da DNA-polimerase I (p. 68).
te, esse procedimento é bas- A maioria das amostras de DNA purificado contém algumas moléculas quebradas, mesmo
lco potente e a radiação ultra- quando apreparação foi feita da maneira mais cuidadosa possível. Isso significa que a DNA-po-
severas. Por essa razáo, co- limerase I pode ligar-se ao DNA e catalisar a reação de substituição de fita (Figura 4.5b). Tal rea-
não requerem irradiação ultra-
em muitos laboratórios.

Placa de vidro

Gel de agarose secado


em forno

ru Colocação de um filme
sensível a raios X
sobre o gel

Exposição por 12 a 1 00 horas,


revelação do Íilme

Figura 4.13
Visualização de
bandas de DNA em Figura 4.14
um gel de agarose da auto-ra-
por coloração com rügnfia para visuali-
brometo de etídeo e Auto-radiograÍia
de DNA marca-
irradiação ultraviole- em
ta (UV). un gel de agarose.

*
:
t
82 T.A.Bnowru

ção requer um suprimento de nucleoídeos: se um deles estiver marcado radioativamente, a mo-


lécula de DNA também se tornará marcada (Figura 4.15b).
12.7 Estimath
A translação de quebras pode ser utilizadapara marcaÍ qualquer molécula de DNA, mas, A eletrofo
sob certas circunstâncias, ela também pode causar a clivagem do DNA. O preenchimento de grando mi
extremidades é um método mais brando, que raramente provoca a quebra do DNA, mas que, de tamanh
infelizmente, só pode ser utilizado para marcar molóculas que possuem extremidades coesi- trição, pol
vas. A enzimautilizada é o fragmento de Klenow (p. 68), que "preenche" uma extremidade nados os ü
coesiva sintetizando a fita complementar (Figura 4.15c). Assim como na translação de que- O métr
bras, se a reação de preenchimento de extremidades for executada na presença de nucleotí- gração col
deos marcados, o próprio DNA ficará marcado.
Tanto a translação de quebras quanto o preenchimento de extremidades viabili zam a mar- D=a_H.
cação do DNA em um grau tal que mesmo quantidades mínimas podem ser detectadas em gel
na qual D r
por auto-radiografia. Até 2 ng de DNA por banda podem ser visualizadas sob condições
das condiç
ideais.
Em gel
timativa dr
fragmento
(a) [0-3'zP]dATP é executad
NH, cadores de
t- nhos varia

o- o- o- )-c-c\*
Hi/ ll
dos fragmr

.-f--f-o"ì-o-?r, -o tÌ-c--nl"t I
gestão exp
[il1dns nas

o o/o t.," \l - serexecuta


/ c'H H-C

,,p,^aio(o lt8;i'
,112."8 Mapeame
uma mol(
Até agora-

K
mentos de
(b) Marcação portranslação de quebras (nicktranstationl na anáIiee
sições rela
quando rrm
colTetÍunetr
^é'* DNA Pot I ra .t.l 7).
*-Pt - Umasé
4 1 / +"p-dArp
meiramentr
Quebras
(nicks) trição der"er
marcadas 195, jg tame
de dig€rúõr
(c) Marcação por preenchimento de extremidades
motempo-.
Figura 4.15 [65 x5 gnzir
Marcação radioativa: (a) tirlansnte- i
estrutu ra do cr-32P-triÍos- de rcação q

Ã--**jrK,r' f
Íato de desoxiadenosina guneetrzir
11a-3'ze1oRre;, (b) mar- A cory
cação do DNA por
restrição. sc
\"{\4 translação de quebras
(nick translation), e (c) te resoll"ida
Extremidade coesiva \ Extremidade de um nrirrr
marcação do DNA por
de EcoRl marcada qinis são- ri
preenchimento de ex-
tremidades. zima não te
Cr-oruaoEu GÊucn E ANÁLtsE oe DNA 83

radioativamente, a mo-
4.2.7 Estimativa do tamanho de moléculas de DNA
r molécula de DNA, mas, A eletroforese em gel separa moléculas de DNA de diferentes tamanhos, com as menores mi-
DNA. O preenchimento de grando maiores distâncias em direção ao eletrodo positivo. Se diversos fragmentos
de DNA
a quebra do DNA, mas que, de tamanhos variados estiverem presentes (o resultado bem-sucedido de umã digestão
de res-
m extremidades coesi- trição, por exemplo), então uma série de bandas apareceráno gel. Como podem ser determi-
uma extremidade nados os tamanhos desses fragmentos?
como na translação de que- O método mais preciso ltlliza arelação matemática que correlaciona a velocidade de mi-
na presença de nucleotí- gração com o peso molecular. A fórmula relevante é:

viabilizam mar-
a
D=a-b(logL/t),
podem ser detectadas em gel
naqualDéadistânciapercorrida,Méopesomolecular eaebsãoconstantesquedependem
visualizadas sob condições
das condições de eletroforese.
Em geral, é utilizada uma maneira muito mais simples, embora menos precisa, para a es-
timativa dos tamanhos de fragmentos de DNA. Uma digestão de restrição-padrão,
[ue inclui
fragmentos de tamanhos conhecidos, é usualmente incluída em cada eletroforese em gel que
é executada. Produtos de restrição de DNA de l, são muitas vezes assim utilizados, como
mar-
cadores de tamanho. Por exemplo, HindIII cliva o DNA de À em oito fragmentos, com tama-
nhos variando entre 125 pb, para o menor, e mais de 23 kb, parco maior. Como os tamanhos
dos fragmentos nessa reação de digestão são conhecidos, os tamanhos dos fragmentos na di-
gestão experimental podem ser estimados a partir da comparação das posições relativas
das
bandas nas duas trilhas do gel (Figura 4.16). Embora de precisão limitada, ósse método pode
' ser executado com apenas 57o de eno, o que é satisfatório na maioria dos casos.

tuLg Mapeamento das posições de diÍerentes sítios de restrição em


uma molécula de DNA
Até agora, consideramos como podem ser determinados o número e os tamanhos dos frag-
mentos de DNA produzidos por clivagem com endonucleases de restrição. A próxima etafa
na análise de restrição é a construção de um mapa mostrando, na molécula oe oNR,
as po-
sições relativas das seqüências de reconhecimento de diversas enzimas diferentes.
Somente
quando um mapa de restrição está disponível é que as endonucleases de restrição podem
ser
corretamente selecionadas para uma determinada manipulação de clivagem a executar (Figu-
ra 4.17).
Uma série de digestões de restrição deve ser executada para a construção de um mapa. pri-
meiramente, o número e o tamanho dos fragmentos produzidos por uma endonuclease
de res-
trição devem ser determinados por eletroforese em gel seguida de comparação com marcado-
res de tamanho (Figura 4.18). Essa informação deve, então, ser suplementada
por uma série
de digestões duplas, nas quais o DNA é clivado por duas endonucÈases de restrição
ao mes-
mo tempo. A execução de uma clivagem dupla pode ser possível em uma única etapa,
se am-
Figura 4.15 bas as enzimas tiverem exigências similares quanto a pH, concentração de Mg*2,
eti.Alterna-
Marcação radioativa: (a) tivamente, as duas digestões podem ser executadas uma após a outra, ajustando-se
a mistura
estrutu ra do cr-32P-trifos- de reação após a primeira digestão para suprir um conjunto diferente de
fato de desoxiadenosina condições para a se-
gunda enzima.
([s-3'zP]dATP), (b) mar-
A comparação de resultados de digestões simples e duplas permite que muitos sítios de
cação do DNA por
restrição, se não todos, sejam mapeados (Figura 4. l g). As ambigüidades pàdem
translação de quebras ser geralmen_
(nick translation), e (c) te resolvidas por digestão parcial, executada sob condições que resultam apenas
na clivagem
marcação do DNA por de um número limitado de sítios de restrição em qualquer mãlécula de DNA.
Digestões lar-
preenchimento de ex- ciais são, via de regra, conseguidas pela redução do período de incubação, de moão qu" u
tremidades. zima não tenha tempo suficiente para clivar todos os sítios de restriçat, ou pela incubação"n-
a
84 T. A. Bnowr.r

(a) Estimativa grosseiÍa por visualização direta (b) Estimativa gráÍica precisa

Hiúlll Amostra
1" desconhecida 10
-o
!

23130ob---- ã
z
7,5

941 6 ô
6557
_cerca de 5.000 pb õoc
4361 1r-- P z.s
c
2--- _cerca de 3.200 pb (ú

2322
2027 _cerca de 2.000 pb
F
Fo 012345
3---
Distância migrada (cm)
564

Figura 4.16
Estimativa dos tamanhos de fragmentos de DNA em um gel de agarose. (a) Uma estimativa grosseira
do tamanho dos fragmentos pode ser obtida a partir da vÈualização direta. (b) Uma mediçãJmais pre-
cisa do tamanho dos fragmentos é conseguida utilizando-se as mobilidades de Íragmentol
de À-Hr'ndlll
para a construção de uma curva de calibragem; os tamanhos de Íragmentos
desconhecidos podem,
então, ser determinados a partir das distâncias que migraram.

geneB geneC .geneD


Mapa {enético

Mapa de restrição

legnr I san
ò laamHr À

Para obtenção do gene B, digerir com Bgíl

o
P''- írN;
\
g--_e_
_í-
Figura 4.17
Para obtenção do gene D, digerir com BamHl + Sa/l Utilização de um ma-
pa de restrição para
deÍinir as endonu-
---*,
AAB
ffi ,-il. cleases de restrição
que devem ser utili-
n.---42.,c, ^ ,s*Z)
t*--'À
zadas para a obten-
ção de Íragmentos
Figura 4.1
Uapearne
contendo genes indi- e l(prttta
viduais.

ì
:
F
I
Cronnceu GÊNtcA E ANÁLtsE oe DNA 85

Digestões simples e duplas

Enzima Número de fragmentos Tamanhos (kb)

Xbal 2 24,O;24,5
xhd 2 15,0; 33,5
Kpnl 3 1 ,5; 17,0; 30,0

Xbal + Xhd 3 9,0; 15,0; 24,5


Xbal + Kpnl 4 1,5; 6,0; '17,O;24,0

Gonclusóes:

(1) Como o DNA de ì, é linear, o número de sítios de restrição para cada


012345 enzima é Xbal 1, Xhol 1 e KPnl 2.
Distância migrada (cm)
(2) Os sítios de Xbal e Xhol podem ser mapeados:

Íragmentos de Xbal
Íragmentos de Xhd ,9,0, , 15,0 , , 24,5 ,
Xbal
fragmentos de Xhd , 15,0 , , 33,5 ,

Xhol Xbal
Uma estimativa grosseira A única possibilidade é:
15,0 9,0 24,5
(b) Uma medição mais pre-
de fragmentos de l,-Hr'ndlll
(3) Todos os sítios de Kpnl estão no Íragmento de 24,5 kb de Xbal, pois
desconhecidos podem,
o fragmento de 24,0 kb fica intacto após a digestão dupla com
XbalKpnl.A ordem dos fragmentos de Kpnl somente pode ser
determinada por digestão parcial.

Digestão paÌcial

Enzima Tamanhos dos Íragmentos (kb)

Kpnl - condições limitantes 1 ,5; 17,O; 18,5; 30,0; 31 ,5; 48,5

Conclusões:

(1) Fragmento de 48,5 kb = l, não-clivado.


(2) Os fragrnentos de 1 ,5; 17,0 e 30,0 kb são produtos de digestão completa'
(3) Os fragmentos de 18,5 e 31 ,5 kb são produtos de digestão parcial'

Kpnls
O mapa de Kpnl deve ser:
30,0 1,5 17,O

Figura 4.17 Xhol Xbal Kpnls


Utilização de um ma- Portanto, o mapa completo é:
pa de restrição para 15,0 9,0 6,0 1,5 17,0

deÍinir as endonu-
cleases de restrição
que devem ser utili-
Figura 4.18
zadas para a obten-
Mapeamento de restrição. Este exemplo mostra como as posições dos sítios de Xbal, Xhol
ção de Íragmentos e Kpnl na molécula de DNA de À podem ser determinadas.
contendo genes indi-
viduais.
86 T.A. BRowN

uma temperatura baixa (por exemplo , a 4" C em vez de a 37 " C) , o que limita a atividade da en-
zima.
O resultado de uma digestão parcial é um padrão complexo de bandas em um gel de ele-
troforese. Fragmentos adicionais, com diferentes tamanhos, são visualizados juntamente com
os fragmentos-padrão, produzidos por digestão total. Os fragmentos adicionais correspondem
a moléculas que incluem dois fragmentos de restrição adjacentes, separados por um sítio que
não foi clivado. Os seus tamanhos indicam quais fragmentos de restrição da digestão comple-
ta estão próximos um ao outro na molécula não-clivada (Figura 4.18).

4.3 Ligação: unindo moléculas de DNA


A etapa final na construção de uma molécula de DNA recombinante é a união da molécula do
vetor com o DNA a ser clonado (Figura 4.19). Esse processo é chamado de ligação e a enzi-
ma que catalisa a reação é denominada de DNAJigase. t[ação: a etapa 1

moler
4.3.1 O modo de ação da DNA-ligase
Todas as células vivas produzem DNA-ligases, mas aenzimautilizada em engenharia genéti-
ca é geralmente a purificada de bactérias E. coli que foram infectadas com fago T4. Na célu-
la, essa enzima executa uma função muito importante, reparando quaisquer descontinuidades
que venham a surgir em uma das fitas de uma molécula de fita dupla (Figura 4.4a). Uma des-
continuidade é simplesmente uma posição na qual uma ligação fosfodiéster entre nucleotí-
deos adjacentes está faltando (note a diferença em relação a uma quebra fnick],naqual um ou
mais nucleotídeos estão ausentes). Embora as descontinuidades possam surgir em decorrên-
cia de quebras aleatórias de moléculas de DNA celular, elas também surgem como um resul-
tado natural de processos como a replicação e a recombinação do DNA. Portanto, as ligases
desempenham funções vitais na célula.
Em tubo de ensaio, DNAìigases purificadas, além de repararem descontinuidades de fi-
tas simples, também podem unir moléculas de DNA individuais ou as duas extremidades de
uma mesma molécula. A reação química envolvida na ligação de duas moléculas é exatamen-
te a mesma que ocorre na reparação de descontinuidades, exceto pelo fato de que duas liga-
ções fosfodiéster devem ser estabelecidas, uma para cada fita (Figura 4.20a).

4.3.2 Extremidades coesivas aumentam a eficiência da ligação


A reação de ligação da Figura 4.20a mostra a união de dois fragmentos com extremidades ce-
gas. Embora essa reação possa ser executada em tubo de ensaio, ela não é muito eficiente. Is-
so ocoffe porque a ligase é incapaz de "segurar" a molécula a ser ligada e, por isso, tem que
esperar que as extremidades sejam posicionadas lado a lado por associação casual. Se possí-
vel, ligações de extremidades cegas devem ser executadas cory altas concentrações de DNA,
a fim de aumentar as chances de encontro correto entre as extremidades das moléculas.
Figur
Por outro lado, a ligação de extremidades coesivas complementares é muito mais eficien- ffifrrentes reag
te. Isso ocolre porque extremidades coesivas compatíveis podem parear suas bases entre si por ffigação catalisadr
pontes de hidrogênio (Figura 4.20b), formando uma estrutura relativamente estável, sobre a ffilA-ligase: (a) |
qual a enzima pode atuar. Se as ligações fosfodiéster não forem sintetizadas rapidamente, as ümrÍárrlasdee
extremidades coesivas separam-se de novo. Tais estruturas com bases pareadas, embora tran- ffiescegase (l
sitórias, realmente aumentam a eficiência de ligação, pois estendem o tempo durante o qual qpode ÍÍìoléGllas
as extremidades estão em contato uma com a outra. teínitades cor
Cronncev GÊrurcn e ANÁLtsE oe DNA 87

o que limita a atividade da en-

cene
\
de bandas em um gel de ele-
visualizados juntamente com +B L DNA a ser
adicionais correspondem
clonado
separados por um sítio que
I
restrição da digestão comple- Vetor DNA-lisase
4.18). I

é a união da molécula do
chamado de ligação e aenzi- Figura 4.19
O--""""
Molécula de DNA
lLil#o: a etapa final na construção de uma recombinante
molécula de DNA recombinante.

em engenharia genéti-
com fago T4. Na célu-
quaisquer descontinuidades (a) Ligação de extremidades cegas
(Figura 4.4a). Uma des-
-.oF{rcrcl-o
tr I
re
llr +
fosfodiéster entre nucleotí- -ffi }-+€--a-
quebra fnickl,naqual um ou
possÍÌm surgir em decorrên-
surgem como um resul-
do DNA. Portanto, as ligases

descontinuidades de fi- (b) Ligação de extremidades coesivas


ou as duas extremidades de -o-o-o
lllirtt
#
duas moléculas é exatamen- -.@(H .+
pelo fato de que duas liga-
4.20a).
Descontinuidades
da ligação
\
com extremidades ce-
eta não é rnuito ef,ciente. Is-
ìigada e, por isso, tem que Estrutura transitória mantida
associação casual. Se possí- por pareamênto de bapes
altas concentrações de DNA"
das moléculas.
\
Figura 4.20
é muito mais eficien- reações de
parear suas bases entre si por catalisadas pela
nte estável, sobre a : (a) ligação
sintetizadas rapidamente, as de extremi-
bases pareadas, embora tran- ffis cegas e (b) liga- A DNA-ligase sela as
o tempo durante o qual üfDde moléculas de ex- descontinuidades
üemidades coesivas.
88 T. A. Bnowlr

4.3.3 colocando extremidades coesivas em uma molécula de


extremidades cegas
Pelas razões detalhadas na seção anterior, extremidades coesivas compatíveis são desejáveis
em moléculas de DNA a serem ligadas em um experimento de clonagem gênica. Muitàs ve-
zes, tais extremidades coesivas podem ser obtidas a partir da digestão tanto do vetor quanto
do DNA a ser clonado com a mesma endonuclease de restrição, ou com diferentes enzimas
que produzem a mesma extremidade coesiva, embora isso nem sempre seja possível. É co-
mum ocoffer, por exemplo, que a molécula do vetor tenha extremidades coesivas, mas que os
fragmentos de DNA a serem clonados tenham extremidades cegas. Nessas circunstânciai, três
métodos alternativos podem ser utilizados para colocar as extremidades coesivas corretas nos
fragmentos de DNA.

Oligonucleotídeos de ligação
O primeiro desses métodos envolve o uso de oligonucleotídeos de ligação (/izfters). Esses
oligonucleotídeos são pequenos pedaços de DNA de fita dupla, de seqüência nucleotídica co-
nhecida, que são sintetizados em tubo de ensaio. Um oligonucleotídeo de ligação típico é
mostrado na Figura 4.2la.Ele possui extremidades cegas, mas contém um sítio de restrição, Figura 4
para BamHl no exemplo mostrado. A DNA-ligas e é capaz de ligar tais oligonucleotídeos às Cligonucleotídeos
extremidades de moléculas de DNA maiores, também cegas. Apesar de ser uma ligação de ex- fuação (linkers) e t
tremidades cegas, é possível executaÍ essa reação em particular de maneira bastante eficiente, rrrilÊ:açãs; (a) a eStn
pois oligonucleotídeos sintéticos, como os de ligação, são passíveis de produção em grandes mfípie de um oligo
quantidades e adicionados à mistura de ligação em uma concentração elevada. deotídeo de ligaçã
Mais de um oligonucleotídeo irá ligar-se a cada extremidade da molécula de DNA, produ- {b) a ligação de oli
nucleotídeos a u
zindo a estrutura em cadeia mostrada na Figura4.2lb.Mas a digestão com BamHI cliva as ca-
nnnnlécula de extremi
deias nas seqüências de reconhecimento, produzindo um grande número de oligonucleotídeos
des ceg
clivados e o fragmento de DNA original, agora portador de extremidades coesivas de BamHI.
Esse fragmento modifìcado está pronto para ligação em um vetor de clonagem clivado com
BamHL

Adaptadores
Há um problema em potencial na utilização de oligonucleotídeos adaptadores. Considere o
que iria acontecer se a molécula de extremidades cegas mostrada na Figura 4.21b contivesse
uma ou mais seqüências de reconhecimento de BamHI. Se esse fosse o caso, a etapa de restri-
ção necessiíriapara a clivagem dos oligonucleotídeos de ligação e produção das extremidades
coesivas também clivaria a molécula de extremidades cegas (Figura 4.22). Osfragmentos re-
sultantes teriam as extremidades coesivas coffetas, mas isso não compensaria o pioblema ge-
rado pela quebra em dois pedaços do gene contido no fragmento de extremidadãs cegas.
O segundo método para ligar extremidades coesivas a uma molécula de extremidades ce-
gas foi idealizado para evitar esse problema. Os adaptadores também são oligonucleotídeos
sintéticos curtos. Mas, ao contriírio dos oligonucleotídeos de ligaição, eles são sintetizados
de
maneira a já possuírem uma extremidade coesiva (Figura 4.23a). Obviamente, a idéia é ligar
a
extremidade cega do adaptador às extremidades cegas do fragmento para aprodução de
, uma
nova molécula com extremidades coesivas. O método pode parecer simples, mas, na prâtica,
ele leva ao surgimento de novos problemas. As exÍemidades coesivas de moléculas individuais lllm possível probl
do adaptador podem parear suas bases entre si, formando dímeros (Figura 4.23b), o que faz uuüIzação de oligont
com que a nova molécula de DNA continue tendo extremidades cegas (Figura 4.23c).As @- Compare esüa
ex-
tremidades coesivas poderiam ser recriadas pela digestão com uma endonuclease de restrição, suÌtado desejad
mas isso iria eliminar a vantagem primríria da utilização de adaptadores.
Ba'rrïl, como r
Cr-oruneeu GÊNrcA E ANÁusE oe DNA 89

(a) Um oligonucleotídeo de ligação típico

c-G -A- T-G-G-A-T- C- C-A-T- C-G


compatíveis são desej áveis tlttrlllllttlr
de clonagem gênica. Muitas ve- G-C-r- A€--c {; A-G -G {-A-G-c
digestão tanto do vetor quanto Sítio de BamHl
ou com diferentes enzimas
(b) A utilização de oligonucleotídeos de ligação
nem sempre seja possível. É co'
coeslvas, mas que os Molécula de Oligonucleotídeos
n/
Nessas circunstâncias, três extremidades cegas êê de ligação
êê
coesivas corretas nos ê
a9" DNA-ligase

de Iigação (finfters). Esses


de seqüência nucleotídica co-
de ligação típico é
mas contém um sítio de restrição, Figura 4.21
de ligar tais oligonucleotídeos às
de / "'^r,
BamHl
(Ínkers) e sua
Apesar de ser uma ligação de ex- t*t. ia^de coesivade BamHl
(a) a estrutu-
de maneira bastante eficiente, /
- ì-ï'ú-
de um oligonu-
passíveis de produção em grandes de ligação e
fgação de oligo- 1\
damolécula de DNA, produ- OligonucleotÍdeos
adigestão comBamHI cliva as ca- de extremida- de ligação clivados
número de oligonucleoÍdeos des cegas.
extremidades coesivas de BamHL
vetor de clonagem clivado com

adaptadores. Considere o
na Figura 4.21b contivesse
esse fosse o caso, a etapa de resri-
e produção das extremidades
(Figwa4.22). Os fragmentos re-
BamHl
não compensaria o problema ge-
de extremidades cegas.
uma molécula de extremidades ce-
também são oligonucleotídeos
de ligação, eles são sintetizados de
4-23a). Obviamente, aidéia é ligara
--ttt-- -E-
fragmento, para a produção de uma
Figura4.22
parecer simples, mas, na práticq
possível problema decorrente da
-Éat-- -í- --E-
coesivas de moléculas individuais
de oligonucleotídeos de liga- -í- -í-
dímeros (Figura 4.23b), o que faz
Gompare esta situação com o re- -Ê-
idades cegas (Figura 4.23c). As ex- güado desejado da restrição com Clivagens devidas a
com uma endonuclease de restrição, Berrifll, como mostrado na Figura sítios de EamHl internos
4.21b.
90 T. A. Bnowlr

(a) Um adaptador típico

G_A-T-C_C-C_G-G
ttlt
c-c_c_c
Extremidade coesiva de Bam9l

(b) Adaptadores podem ligar-se uns aos outros


-
-A-T-C-C-C-c-G
lttt Figura 4.23
G-G-C-C-C-T-A- G-G-C-C Os adaptadores e o
problema potencial
decorrente de seu
uso. (a) Adaptador tí-
(c) A nova molécula de DNA ainda possui extremidades cegas pico. (b) Dois adapta-
dores podem ligar-se
um ao outro para pro-
duzir uma molécula
E_ \_ similar a um oligonu-
Adaptadores cleotídeo de ligação,
6_-í
de modo que (c) após
oj a ligação de adapta-
\ DNA-risase
dores a moléculas de
extremidades cegas,
elas ainda apresen-
tam esse tipo de ex-
tremidade, necessi-
Os adaptadores ligam-se tando, portanto, de
uns aos outros uma etapa de restri-
ção.

A resposta para esse problema está na estrutura química precisa das extremidades da mo-
lécula adaptadora. Normalmente, as duas extremidades de uma fita polinucleotídica são qui-
micamente distintas, um fato que se torna claro a partir do exame da estrutura po-
limérica do DNA (Figura 4.24a). Uma das extremidades, chamada"uidudoro
de 5'-terminal, é portaão-
ra de um grupo fosfato (5'-P); a outra, a 3'-terminal, possui um grupo hidroxila (:'-ou).
Na
hélice dupla, as duas fitas são antiparalelas (Figura4.24b), de modo que cada extremidade
de Ftgura
uma molécula de fita dupla consiste em um terminal 5'-P e um terminal 3'-OH. A ligação
nor- mücürçao enfe c
malmente acontece entre as extremidades 5'-p e 3'-OH (Figura 4.24c).
5e 3'de um
As moléculas adaptadoras são sintetizadas de modo que a extremidade cega é a mesma nudeoti
de
um DNA "natural", mas a extremidade coesiva é diferente. O terminal 3'-OH da
extremidade
coesiva é o usual, mas o terminal 5'-P é modificado; ele não possui o grupo fosfato,
sendo, na
verdade, um terminal 5'-oH (Figura 4.25a).4 DNA-ligase é incapaid" fo.-u.
uma ligação
fosfodiéster entre extremidades 5'-oH e 3'-oH. o resultado disso é que, embora Produçã
,errp..
ocoffa o pareamento de bases entre as extremidades coesivas de moléculas adaptadoras, cauda h(
eisa
associação nunca é estabilizada por ligação (Figura 4.25b).
os adaptadores podem, portanto, ser ligados a uma molécula de DNA, mas não uns aos Atécnicad
outros. Depois da ligação dos adaptadores, os terminais 5'-OH anormais são convertidos dagem radi
à DÌrIA de er
forma 5'-P natural por tratamento com a enzimapolinucleotídeo-quinase (p. 70), originando
as subunid:
um fragmento de extremidade coesiva que pode ser inserido em um vetor adequado.
Daé 'rn ex

Í
i
Cloruncev GÊrurcn e AruÁuse oe DNA 91

?, (a) A estrutura de uma


o- Íita polinucleotídica
O-P:O mostrando a distinção
química entre os
o
Um \ terminais 5'-P e 3'-OH
nucleotídeo

Figura 4.23
Os adaptadores e o
problema potencial
-O-P:O
o
decorrente de seu
uso. (a) Adaptador tÊ
\ cF.o__._ïa."

V
pico. (b) Dois adapta-
dores podem ligar-se
um ao outro para pro-
duzir uma molécula o
similar a um oligonu- -o-eço
cleotídeo de ligação, o
de modo que (c) após t"". Base
a ligação de adapta- ",
dores a moléculas de
extremidades cegas,
elas ainda apresen- (b) Na hélice dupla, as Íitas polinucleotídicas çì
OH
tam esse tipo de ex- são antiparalelas
tremidade, necessi- s', 3'
3',

tando, portanto, de "D K


uma etapa de restri-
ção.
3', s',

(c) A ligação acontece entre teÌminais


5'-P e 3'-OH
precisa das extremidades da mo-
E.
r....@e D'
"'ma fita polinucleotídica são qui-
€trame cuidadoso da estrutura po-
de S'-terminal, é portado-
3'-ôôôo-o-o-o-o- 5'
I

um grupo hidroxila (3'-OH). Na


I
modo que cada extremidade de Figura4.24 5' 3'
terminal 3'-OH. A ligação nor- -@o-r@
tttttr
entre os ter- o.-tH_ -,
4.24c). 5'e 3'de um poli- ^,{rcrCrGr:n}r}:f,-
iJC
a ertremidade cega é a mesma de nucleotídeo.
terminal 3'-OH da extremidade
possui o grupo fosfato, sendo, na
é incapaz de formar uma ligação
disso é que, embora semprc Produção de extremidades coesivas por síntese de
de moléculas adaptadoras, essa cauda homopolimérica
A técnica de síntese de cauda homopolimérica (homopolymer tailing) representa uma abor-
de DNA, mas não uns aos
dagem radicalmente diferente para a produção de extremidades coesivas em uma molécula de
{H anormais são convertidos à DNA de extremidades cegas. Um homopolímero é simplesmente um polímero no qual todas
inase (p. 70), originando
as subunidades são iguais. Uma fita de DNA feita inteiramente de, digamos, desoxiguanosi-
em um vetor adequado.
na é um exemplo de homopolímero, que é chamado de polidesoxiguanosina ou poli(dG).
vel o sut
(a) A estÍutura precisa de um adaptadoÌ rimento r
combina
to-o-o-r-c-c-c-c que com
-oto'
,/ -é-ò-ò-ò-Poá
terminá Ho-
-OH modificado

Figura 4.25
O uso de adaptado-
res: (a) A estrutura
real de um adapta-
dor, mostrando o
terminal 5'-OH mo-
diÍicado. (b) Conver-
são das extremida-
des cegas em coesi-
vas pela ligação de
adaptadores.

A síntese de uma cauda envolve a enzima desoxinucleotidil-transferase terminal (p. 70),


que adiciona uma série de nucleotídeos às extremidades 3'-OH de uma molécula de DNA de
fita dupla. Se essa reação é executada na presença de apenas um desoxirribonucleotídeo, é Figura,
produzida uma cauda homopolimérica (Figura 4.26a). gi[nlese de caude
É óbvio que, para ser possível a ligação de duas moléculas adicionadas de cauda, os ho- mmpolimérica (âc
mopolímeros devem ser complementares. Freqüentemente, caudas de polidesoxicitosina (po- wmertailind,
litdcl) são ligadas ao vetor e de poli(dG) são ligadas ao DNA a ser clonado. Quando as mo- úÈse de uma cz
léculas de DNA são misturadas, ocoÍïe o pareamento de bases entre as duas caudas (Figura llrunopolimérica
4.26b). onsfução de
Na prática, as caudas de poli(dG) e poli(dC) em geral não são exatamente do mesmo ta-
mdéorla de DNI
manho, além de as moléculas recombinantes com bases pareadas resultantes apresentarem
mmtÉnnte a part
um wtor e de ul
quebras e descontinuidades (Figura 4.26c). A reparação dessas moléculas é, portanto, um pro-
Gbde DNA, an
cesso de duas etapas, que utiliza a polimerase de Klenow para preenchimento das quebras, se-
dhirnados de ca
guida da ação da DNAJigase, para a síntese das ligações fosfodiéster faltantes. Nem sempre e {c) reparaçã
é necessário que a reação de reparação seja executada em tubo de ensaio. Se as caudas homo- mrmmlárlade DN
poliméricas complementares forem mais longas do que 20 nucleotídeos, são formadas asso- ourtÍnante. dC
ciações por pareamento de bases bastante estáveis. Uma molécula de DNA recombinante 5'-lribsfato de 2
mantida unida por pareamento de base, mas não completamente ligada, é muitas vezes está- soxicitÍ
Cr-ounoeu GÊNrcA E ANÁLrsE oe DNA 93

vel o suficientepara ser introduzida em uma célula hospedeira, no estágio seguinte do expe-
rimento de clonagem (Figura 1.1). Uma vez no interior da hospedeira, a molécula de DNA re-
combinante poderá ser reparada pela DNA-polimerase e pela DNA-ligase da própria çélula,
que completarão a construção iniciada em tubo de ensaio.

(b) Ligação de caudas homopoliméricas

Figura 4.25
O uso de adaptado- G
G
res: (a) A estrutura G
G
real de um adapta-
dor, mostrando o
terminal 5'-OH mo-
diÍicado. (b) Conver- -c^
-c:c^
são das extremida-
des cegas em coesF Vetor - caudas de poli(dC)
ï\----.
vas pela ligação de
adaptadores. G
lnserto dê DNA -
caudas de poli(dG) )
-C6
clc
terminal (p.70),
uma molécula de DNA de Molécula de DNA recombinante
desoxirribonucleotídeo, é Figura 4.26 (c) As etapas de reparação
de cauda ho- 0uebra
ionadas de cauda, os ho- ilmpdimérica (homa --'---r----r-----T--f-G-G-G-G / r---r l-rT-----
II
de polidesoxicitosina (po- pfuner tailing): (a) Ë;-ë-ë-c-c-c
"
ser clonado. Quando as mo- de uma cauda ./"
Descontinuidade
as duas caudas (Figura lliunopolimérica, (b)
ustrução de uma
exatamente do mesmo ta-
rrËqrla de DNA re-
a partir de A polimerase de Klenow
resultantes apresentarem
umìretor e de um in- repara a quebra
las é, portanto, um pre
de DNA, ambos
das quebras, se- r-r--r-r--rG-G
de cauda, -G-G -G -G-G
rrrrrf_c_c_c_c_c_c
faltantes. Nem sempru e (c) reparação da
ensaio. Se as caudas homo- tmÉrlade DNA re- \"""""
Ídeos, são formadas unrnôinante. dCTP = Aìgase repaÍa as
de DNA üi.üilosfato de 2'-de- descontinuidades
ligada, é muitas vezes está soxicitidina.
94 T. A. Bnowr.r

Leituras adicionais
Brown, T.A. (1998) Molecular Biology Labfar. Volume I: Recombinant DNA, 2nd edn. Academic press,
London.
[Contém detalhes a respeito de todos os tipos de enzimas utilizadas na manipulação de DNA e RNA.]
Jacobsen, H., Klenow, H. & Overgaard-Hansen, K. (1974) The N-terminal amino acid sequences
of DNA polymera-
selfromEscherichiacoliandofthelargeandsmallfragmentsobtainedbyalimitedproteolysis. EuropeanJour-
nal of Biochemistry, 45, 623-7 . [Produção do fragmento de Klenow da DNA-polimerase I.]
Lobban, P. & Kaiser, A.D . (1973) Enzymatic end-to-end joining of DNA molecules. Joumal of Molecular Biology.,
79, 453-71. [Ligação.]
McDonell, M.W., Simon, M.N. & Studier, F.W. (1977) Analysis of restriction fragments of T7 DNA and determina-
tion of molecular weights by electrophoresis in neutral and alkaline gels. Journal of Molecular Biotogy, Il0,
1 19-46. [Um exemplo inicial do uso da eletroforese em gel de agarose na análise dos tamanhos de fragmentos
de restrição.l
REBASE: wwwneb.com/rebase/rebase.html [Uma listagem abrangente de todas as endonucleases de restrição co-
nhecidas e dos respectivos sítios de reconhecimento.]
Roústeìn, R.J., Lau, L.F., Bahl, C.P., Narang, N.A. & Wu, R. (1979) Synthetic adaptors for cloning DNA. Methods
in Enzymology, 68, 98-109.
Smith' H.O. & Wilcox, K.W. (1970) A restriction enzyme from Haemophilus influenTae. Journal of Molecular Bioptg;.
51, 379-91. [uma das primeiras descrições completas de uma endonuclease de restrição.]

t\s
cu}
tro(
pan
nÍì5
con

der
mitt
rre{
süEl
c,op
pôÍr
zes
DN.
mili
€tap
bink
i
nig,
$ar c
hém
DTLJ
CnpÍrulo 5
;2nd edn. Academic press, London.
ipulação de DNA
n
e RNA.I
acid sequences of DNA polymera-
lntrodução de DNA em Células Vivas
r limited proteolysis. European Jour-
[-polimerase I.]
ales. Journal of Molecular Biotogy,

iagments olTT DNA and determina-


Iournal of Molecular Biology, ll0,
do, tamanhos de fragmentos
Talir"
hs as endonucleases de restrição co-

{upto., for clo.ning DNA. Methods

v4te Joumal of Molecular Biology,


;de restrição.]

Transformação: a incorporação de DNA por células Introdução de DNA de fagos em células bacterianas,
bacterianas, 98 105
Identificação de recombinantes, l0l Identificação de fagos recombinantes, I 09
Transformação de células não-bacterianas, I l0

As manipulações descritas no Capítulo 4 permitem que o biólogo molecular crie novas molé-
culas de DNA recombinante. A etapa seguinte em um experimento de clonagem gênica é a in-
trodução dessas moléculas em células vivas, geralmente bactérias, que então multiplicam-se
para produzir clones (Figura 1.1). Estritamente falando, a palavra "clonagem" refere-se ape-
nas aos estágios finais do processo e não propriamente à construção da molécula de DNA re-
combinante.
A clonagem serve a dois propósitos principais. Primeiramente, ela permite que um gran-
de número de moléculas de DNA recombinante seja produzido a partir de uma quantidade li-
mitada de material de partida. No início, podem estar disponíveis apenas uns poucos nanogra-
mas de DNA recombinante, mas cada bactéria que incorpora um plasmídeo divide-se subse-
qüentemente várias vezes para produzir uma colônia, na qual cada célula contém múltiplas
cópias da molécula. Viírios microgramas de DNA recombinante podem, via de regra, ser pre-
parados a paÍir de uma única colônia bacteriana, o que representa um aumento de 1.000 ve-
zes sobre a quantidade inicial (Figura 5.1). Se a colônia é uirllizada não como uma fonte de
DNA, mas como um inóculo para uma cultura líquida, as células resultantes podem fornecer
miligramas de DNA, um aumento de um milhão de vezes no rendimento. Dessa maneira, a
etapa de clonagem é capaz de suprir as grandes quantidades de DNA necessárias para estudos
biológico-moleculares da estrutura e da expressão gênicas (Capítulos 10 e 11).
A segunda função importante da clonagem pode ser descrita como de purificação. As ma-
nipulações que resultam em uma molécula de DNA recombinante apenas raramente podem
ser controladas ao ponto de não permitirem que qualquer outra molécula de DNA esteja tam-
bém presente no final do processo. A mistura de ligação pode conter, além da molécula de
DNA recombinante, uma quantidade variável dos seguintes componentes (Figura 5.2a):
96 T.A.Bnown

oo
oOO
Uma única célula contendo
múltiplas ópias de uma
o-ôo_o
ooE molécula de DNA recombinante

Permite a obtenção
de várias pg de DNA
recombinante

lnoculação em 500 ml de
meio líquido, incubação
por 1 I horas

Permite a obtenção de
várias mg de DNA Figura 5.1
._.2
recombinante A clonagem é capazde
gerar grandes quantida-
des de DNA recombi-
nante.

(1) Moléculas de vetor que não foram ligadas.


(2) Fragmentos de DNA que não foram ligados.
(3) Moléculas do vetor que foram recircularizadas sem a inserção de qualquer DNA (vetor
"autoligado").
(4) Moléculas de DNA recombinante portadoras de fragmentos de DNA inseridos incor-
retamente.

Moléculas não-ligadas raramente causam algum problema, pois, mesmo que sejam incor-
poradas por células bacterianas, somente sob circunstâncias excepcionais serão replicadas. É
muito mais provável que esses pedaços de DNA sejam degradados por enzimas da bactéria
hospedeira. Por outro lado, moléculas de vetor autoligadas e Blasmídeos recombinantes incor-
retos são replicados de maneira tão eficiente quanto a molécula desejada (Figura 5.2b). Mes-
mo assim, a purificação da molécula desejada ainda pode ser conseguida por meio da clona-
gem, pois é extremamente incomum que qualquer célula incorpore mais de uma molécula de
DNA. Cada célula dá origem a uma única colônia, de modo que cada um dos clones resultan-
tes consiste em células que contêm a mesma molécula. É claro que colônias diferentes con- Figura 5
têm moléculas diferentes: algumas guardam a molécula de DNA recombinante desejada, ou- A clonaç
tras possuem diferentes moléculas recombinantes e outras, ainda, contêm o vetor autoligado. diÍerents
O problema passa a ser, portanto, a identificação das colônias com plasmídeos recombinantes
corretos.
Cr-orunceu GÊNrcA E ANÁLrsE DE DNA 97

(a) Os produtos da ligação


, Fragmentos de
Moléculas de vetor
não-lisados
\ T*o autoligadas
u

í- L Vo"""
\_-/
ti /--\ ,--Gene
\_-_. \_-,
Moléculas de vetor A molécula de DNA
recombinante

i,r-.-rhÀ^
li::ïï',ï'"Í'"""-^
aìo
\í-ì
desejada

"incorretas"
\----i
(b) Todas as moléculas circulares serão clonadas

Figura 5.1
A clonagem é capaz de
gerar grandes quantida- Célula contendo Célula contendo uma
des de DNA recombi- o vetor autoligado molécula de DNA
nante. recombinante "inconeta"

de qualquer DNA (vetor Célula contendo a


molécula desejada

de DNA I

I
pois, mesmo que sejam incor-
ionais serão replicadas. É
por enzimas da bactéria
recombinantes incor-
/ \
desejada (Figura 5.2b). Mes-
Clone do vetor autoligado \ Clone de uma
conseguida por meio da clona- O clone desejado molécula "incorreta"
mais de uma molécula de
cada um dos clones resultan-
que colônias diferentes con- Figura 5.2
recombinante desejada, ou- A clonagem é análoga a um processo de purificação. A partir de uma mistura de moléculas
, contêm o vetor autoligado. diferentes, podem ser obtidos clones contendo cópias de apenas uma molécula.
plasmídeos recombinantes
98 T.A. Bnowru

Este capítulo trata da maneira pela qual vetores plasmidiais e virais e moléculas recombi-
nantes deles derivadas são introduzidos em células bacterianas. Ao longo do capítulo, ficaní
Itl2 Prepara
evidente que a seleção de colônias contendo moléculas recombinantes em meio a colônias Assim co
com o vetor autoligado é relativamente simples. O mais difícil é a distinção entre clones com fuadamen
a molécula de DNA recombinante correta e todos os demais clones recombinantes, que será do foi obs
tratada no Capítulo 8. lada capu
mM de clr
cloreto de
5.1 TrasÍormação: a incorporação de DNA por Ainda
células bacterianas deterrnina
responsáv
ja qual for
A maioria das espécies de bactéria é capaz de incorporar moléculas de DNA a partir do meio
corporaçã
no qual elas se multiplicam. Muitas vezes, uma molécula de DNA incorporada dessa manei-
exterior ú
ra é degradada, mas, ocasionalmenÍe, ela é capaz de sobreviver e replicar-se na célula hospe-
efetiva mc
deira. Isso acontece sobretudo se a molécula de DNA for um plasmídeo com uma origem de
breve elev
replicação reconhecida pelo hospedeiro.
que térmi(
A incorporação e a manutenção estável de um plasmídeo é em geral detectada a partir da
análise da expressão de genes nele contidos (p. 25).Por exemplo, células de E. coti'são nor-
Seleção r
malmente sensíveis aos efeitos inibitórios da multiplicação proporcionados pelos antibióticos
ampicilina e tetraciclina. Entretanto, células que contêm o plasmídeo pBR322 (p. 116-l l7)" A transfor
um dos primeiros vetores de clonagem a serem desenvolvidos, ainda na década de 1970, são cuidadosar
resistentes a tais antibióticos. Isso ocorrb porque pBR322 é portador de alguns genes especí Possa gera
ficos: um gene que codifica uma p-lactamase, enzima que modifica a ampicilina para de todas as
forma não-tóxica para abacténa, e um conjunto de genes que codificam enzimas que pe+rcnatr
xificam a tetraciclina. A entrada de pBR322 nas células de E. coli pode ser detectada te. Esse últ
as bactérias são transformadas de sensíveis à ampicilina e à tetraciclina(amp'tet') em resi
tes a esses antibióticos (ampotet*).
Em anos mais recentes, o termo transformação foi estendido e passou a incluir a incr-
poração de qualquer molécula de DNA por qualquer tipo de célula, independentemente de eri
sa incorporação resultar ou não em uma alteração detectável na célula e não importando se t
célula envolvida é de uma bactéria, de um fungo, de um animal ou de um vegetal.

5.1.1 Nem todas as espécies de bactéria incorporam DNA


com a mesma eficiência
Na natureza, a transformação provavelmente não é um processo importante para a
de material genético por paÍte das bactérias. Um reflexo disso é que, em laboratório, somerF.
te algumas poucas espécies (especialmente membros dos gêneros Bacillus e
podem ser transformadas com facilidade. Um estudo cuidadoso desses organismos
que eles possuem mecanismos sofisticados para ligação do DNA às células e para a ì
ração do mesmo.
A maioria das espécies de bactéria, inclusive E. coli, incorpora apenas quantidades li
tadas de DNA sob circunstâncias normais. Para transformar tais espécies eficientemente,
bactérias devem passar por alguma forma de tratamento fisico e/ou químico que aumente
suas capacidades de captação de DNA. Células submetidas a esse tratamento são ditas
petentes.
Figura 5Í
aoDNAei
pot
bacterian€
competente
Croruncev GÊNrcA E ANÁLtsE oe DNA 99

e virais e moléculas recombi-


Ao longo do capítulo, ficará
sl.2 Preparação de células de E. colicompetentes
em meio a colônias Assim como muitos dos avanços na tecnologia de DNA recombinante, o desenvolvimento
o distinção entre clones com fundamental em relação à transformação também ocorreu no início da década de 1970, quan-
recombinantes, que será do foi observado que células de E. coli que haviam sido incubadas em uma solução de sal ge-
lada captavam DNA de forma mais eficiente do que células não-tratadas. Uma solução de 50
mM de cloreto de cálcio (CaClr) é usada tradicionalmente, embora outros sais, em especial o
cloreto de rubídio, também sejam eficientes.
Ainda não se sabe exatamente por que esse tratamento funciona. Possivelmente, o CaCl,
determina a precipitação do DNA sobre a superfície externa das células ou, talvez, o sal seja
responsável por algum tipo de alteração na parede celular que favoreça a ligação ao DNA. Se-
ja qual for o caso, a incubação em CaCl, afeta apenas a ligação ao DNA e não a sua efetiva in-
de DNA a partir do meio
corporação pela célula. Quando DNA é adicionado a células tratadas, perÍnanece ligado ao
incorporada dessa manei-
exterior das mesmas, não sendo transportado para o citoplasma nesse estágio (Figura 5.3). A
replicar-se na célula hospe-
efetiva movimentação do DNA para o interior das células competentes é estimulada por uma
com uma origem de
breve elevação da temperatura para 42'C. Mais uma vez, o porquê da efetividade desse cho-
que térmico perïnanece desconhecido
leral detectada a partir da
cÉlulas de E. coli são nor- 6.1.3 Seleção de células transÍormadas
ionados pelos antibióticos
ídeo pBR322 (p. 116-117), A transformação de células competentes é um processo ineficiente, mesmo quando elas são
mla na década de 1970, são cuidadosamente preparadas. Embora 1 ng do vetor plasmidial chamado puC8 (p. I I 8- I 19)
de alguns genes especí- possa gerar de I .000 a I 0.000 transformantes, isso representa a incorporação de apenas 0,0 I 7o
a ampicilina para uma de todas as moléculas disponíveis. Ademais, 10.000 transformantes representam apenas uma
ificam enzimas que desto- pequena proporção do número total de células que estão presentes em uma cultura competen-
te. Esse último fato implica a necessidade de encontrar alguma maneira para distinguir-se en-
@e ser detectada porque
(amp' tet') em resisten-

e passou a incluir a incor-


independentemente de es-
e não importando se a

Plasmídeo ligado
DNA ao exterior da célula
Bactéria normal

mportante para a obtenção


. em laboratório, somen-
Bacillus e Streptococcus)
,lesses organismos revelou
ìrs células e para a incorpo-

apenas quantidades limi- Célula competente Plasm ídeo transportado


es@ies eficientemente, as para o interior da célula
químico que aumente as
tratamento são ditas com-

Figura 5.3
Aligação ao DNA e a
ua incorporação por
uuna célula bacteriana Célula transÍormada
competente.
100 T. A. Bnowlr

tre uma célula que incorporou um plasmídeo dos muitos milhares de células que não foram as cólula
transformadas. resistênc
A resposta para o problema é aúilização de um marcador de seleção presente no plasmí-
deo. Um marcador de seleção é simplesmente um gene que confere uma nova característica à
célula transformada, que não ocorre em uma bactéria não-transformada. Um bom exemplo de W ldentifir
marcador de seleção é o gene de resistência à ampicilina de pBR322. Após um experimento
de transformação com pBR322, somente aquelas células que incorporaÍam o plasmídeo são O plaqut
o*p*t"f e capazes de formar colônias em um meio de ágar que contém ampicilina ou tetraci- formant(
clina (Figura 5.4); não-transformantes, que ainda sáo ampstets, não produzem colônias no tas por cr
meio seletivo. Células transformantes e não-transformantes são, portanto, facilmente distin- tor autol
guidas umas das outras. to de DÌr
A maioria dos vetores de clonagem carrega pelo menos um gene que confere resistência a combin:
antibiótico às células hospedeiras, com a seleção de transformantes sendo feita por plaquea- inativadr
mento em meio de ágar que contém o antibiótico relevante. Tenha em mente, contudo, que a da inatir
resistência ao antibiótico não é devida meramente à presença do plasmídeo nas células trans- pBR322
formadas. O gene de resistência no plasmídeo também deve ser expressado para sintetização
da enzima que destoxifica o antibiótico. A expressão do gene de resistência começa imedia- t21 Seleção
tamente após a transformação, mas leva alguns minutos até que a célula contenha uma quan- deumg
tidade de enzima suficiente para ser capaz de suportar os efeitos tóxicos do antibiótico. Por
O pBR3l
essa razão, as bactérias transformadas não devem ser plaqueadas em meio seletivo imediata-
mente após o tratamento por choque térmico. Em primeiro lugar, elas devem ser colocadas em
tura do r
exemplo
um pequeno volume de meio líquido, na ausência de antibiótico, e incubadas por um cuÍo pe-
sistência
íodo. A replicação plasmidial e a expressão podem então ser iniciadas, de modo que, quando
adiciona
tetracicl
DNA ins
ampicilir

Célula de
Célula de E. coli normal E. coli
(sem plasmídeos)
contendo
plasmídeos
pBR322

Não
sobrevive Sobrevive e produz
uma colônia Fi,
Epessao Íenotípi
Figura 5.4 ihrmuôaçao a 37"C 1

Seleção de célu- mnailes do plaqu


las que contêm ieürÌmrrta a taxa de
plasmídeos uÉÍrcia das transfu
pBR322 por pla- ümntndoseletirrc, p
queamento em MÉrias tiveram te
AgaÍ contendo 40 pg/ml de ampicilina, meio de ágar con- nnffiara síntese c
15 pg/ml de tetraciclina ou uma combinação de ambas tendo ampicilina mms de resistêrrci
e/ou tetraciclina.
Clorurceu GÊrurcn e AruÁlrse oe DNA 101

de células que não foram as células forem plaqueadas e encontrarem o antibiótico, elas já terão sintetizado enzimas de
resistência suficientes para poder sobreviver (Figura 5.5).
seleção presente no plasmí-
uma nova característica à
Um bom exemplo de ü.2 Identificação de recombinantes
22. Após um experimento
orporaram o plasmídeo são O plaqueamento em um meio seletivo permite a distinção entre transformantes e não-trans-
contém ampicilina ou tetraci- formantes. O problema seguinte é determinar quais das colônias transformantes são compos-
. não produzem colônias no tas por células que contêm moléculas de DNA recombinante e quais contêm moléculas de ve-
portanto, facilmente distin- tor autoligadas (Figura 5.2). Na maioria dos vetores de clonagem, a inserção de um fragmen-
to de DNA no plasmídeo destrói a integridade de um dos genes presentes na molécula. Os re-
Eene que confere resistência a combinantes podem, portanto, ser identificados porque a caracteística codificada pelo gene
tes sendo feita por plaquea- inativado não é mais apresentada pelas células hospedeiras (Figura 5.6). Os princípios gerais
em mente, contudo, que a da inativação por inserção são ilustrados por um experimento de clonagem típico usando
plasmídeo nas células trans- pBR322 como vetor.
erpressado para sintetização
resistência começa imedia- 1 Seleção de recombinantes com pBR322: inativação por inserção
a célula contenha uma quan- de um gene de resistência a antibiótico
tóxicos do antibiótico. Por
em meio seletivo imediata- O pBR322 possui vários sítios de restrição únicos, os quais podem ser utilizados para a aber-
elas devem ser colocadas em tura do vetor antes da inserção de um novo fragmento de DNA (Figura 5.7a). BamHI, por
e incubadas por um curto pe- exemplo, cliva pBR322 em apenas uma posição, no agrupamento de genes que codifica a re-
iadas, de modo que, quando sistência à tetraciclina. Uma molécula de pBR322 recombinante, que carÍega um segmento
adicional de DNA no sítio de BamHI (Figura 5.7b), não é mais capaz de conferir resistência à
tetraciclina para a célula hospedeira, pois um dos genes necessários foi interrompido pelo
DNA inserido. Células com essa molécula de pBR322 recombinante ainda são resistentes à
ampicilina, mas são sensíveis à tetraciclina çampRtef).

Proteína de resistência
a antibiótico
Plasmídeo

lmediatamente após
a transÍormação

Figura 5.S
Eryressão Íenotípica. U ma
Figura 5.4 hnòação a37'C por t ho-
Seleção de célu- m antes do plaqueamento
las que contêm rflrrÌenta a taxa de sobrevi-
plasmídeos r€ncia das transformantes
pBR322 por pla- um rneio seletivo, porque as Após incubação a
queamento em lMérias tiveram tempo pa- 37"C por t hora
meio de ágar con- mhiciar a sÍntese das enzi-
tendo ampicilina mas de resistência a anti-
e/ou tetraciclina. biótico.
1O2 T.A.Bnowru

(a) Molécula de vetoÌ normal

--_____-------à Produto do gene

Gene-alvo para
inativação por inserção

(b) Molécula de vetor recombinante

Figura 5.6
lnativação por inserção. (a)
A molécula de vetor não-re-
combinante normal é porta-
dora de um gene cujo pro-
______________-, Sem o produto
duto conÍere uma caracte-
do gene
rística selecionável ou iden-
Oretor de clonagem
tificável à célula hospedei-
llhÍa normal do vetor
lh recombinante cont€
ra. (b) Esse gene é inativa-
adicional de DNA i
do quando novo DNA é in-
serido no vetor; em conse-
fufiI\. Para um rna
qüência disso, o hospedei- de pBR3
Gene-alvo interrompido
ro recombinante não apre-
senta a característica rele-
vante.
tÍ;,n 2 A inativaçi
resistêncii
A seleção de recombinantes de pBR322 é executada da seguinte maneira. Após a transfor- A inativação
mação; as células são plaqueadas em meio com ampicilina e incubadas até que apareçam âs veniente par
colônias (Figura 5.8a). Todas essas colônias são transformantes (lembre-se de que células plasmidiais u
não-transformadas são a^pt e não produzem colônia no meio seletivo), mas somente umas tador do gen
poucas contêm moléculas de pBR322 recombinantes: a maioria tem o plasmídeo normal, au-
enzima p-gal
toligado. Para identificação dos recombinantes, as colônias são plaqueadas em réplica em
lacZ, coma
meio de ágar que contém tetraciclina (Figura 5.8b). Após a incubação, algumas das colônias
dase (Figura
originais desenvolvem-se novamente, enquanto outras, não (Figgra 5.8c). Aquelas que se de-
A p-galar
senvolvem consistem em células portadoras do pBR322 normal, sem inserção de DNA, e,
mais galactor
portanto, de um agrupamento funcional de genes de resistência à tetraciclina (amp*tet*;. As
mo de E. coli
colônias que não se desenvolvem em ágar com tetraciclina são recombinante s (amp*tets); co-
um segmento
mo a posição delas nas placas é conhecida, é possível a recuperação de amostras para estudos
sidase (Figur
adicionais a partir da placa original de ágar com ampicilina.
abrigam um I
Um exper
com ampicilir
lactosidase. C
Croruncev GÊNtcA E ANÁLtsE oe DNA lGl

(a) A molécula normal do vetor

Gene de
resistência
à ampicilina
Agrupamento
de genes de
resistência à
tetraciclina

ampRte4

(b) Uma molécula de pBR322 recombinante

Novo DNA inserido


, Figura 5.6 no sítio de BarnHl
lnativação por inserção. (a)
A molécula de vetor não-re-
combinante normal é porta-
dora de um gene cujo pro-
Figura 5.7
duto conÍere uma caracte-
O vetor de clonagem pBR322: (a) a mo-
rística selecionável ou iden-
Scr.rla normal do vetor e (b) uma molécu-
tificável à célula hospedei-
ür recombinante contêndo um segmento
ra. (b) Esse gene é inativa-
adicional de DNA inserido no sítio de
do quando novo DNA é in-
BarrlÍ{l. Para um mapa mais detalhado ampqteF
serido no vetor; em conse-
de pBR322, ver Figura 6.1.
qüência disso, o hospedei-
ro recombinante não apre-
senta a característica rele-
vante.
W22 A inativação por inserção nem sempre envolve
resistência a antibiótico
inte maneira. Após a transfor- A inativação por inserção de uma resistência a antibiótico constitui-se em uma maneira con-
incubadas até que apareçam as veniente para a identificação de recombinantes. Apesar disso, vários vetores de clonagem
(lembre-se de que células plasmidiais utilizam um sistema diferente. Um dos exemplos é pUCS (Figura 5.9a), que é por-
io seletivo.y. mas somente umas tador do gene de resistência à ampicilina e de um gene chamado lacZ' , que codihca parte da
ia tem o plasmídeo normal, au- enzima B-galactosidase. A clonagem com pUC8 envolve a inativação por inserção do gene
sao plaqueadas em réplica em lacZ' , com os recombinantes sendo identificados pela incapacidade de sintetizar
B-galactosi-
bação, algumas das colônias dase (Figura 5.9b).
5.8c). Aquelas que se de- A B-galactosidase é uma das váriap enzimas envolvidas na quebra de lactose em glicose
sem inserção de DNA, e, mais galactose. Ela é normalmente codificada pelo gene lacZ, que está situado no cromosso-
a à tetraciclina (amp*tef;. As mo de E coli. Algtmas linhagens de E. coli possuem um gene lacZmodifiçado, que não tem
recombinante s Tamp* t ett 7 ; co- um segmento denominado lacZ' , que codifica a porção chamada de peptídeo u da
B-galacto-
de amostras para estudos sidase (Figura 5.10a). Esses mutantes são capazes de sintetizar a enzima somente quando
abrigam um plasmídeo, como pUC8, que é portador do segmento lacZ'faltante do gene.
Um experimento de clonagem com pUCl8 envolve a seleção de transformantes em ágar
com ampicilina, seguida pela identificação de recombinantes com base na atividade de p-ga-
lactosidase. Células portadoras de um plasmídeo pUCS normal são ampR e cap.ves de sinte-
104 T.A. Bnowr

(a) Colônias em meio com ampicilina

(b) Plaqueamento em réplica

I Blocode I I I

I madeira I .l I Cétutasaderidas
I 1..r.,r.'...1 ,/ 1r...r..r......1 ao bloco
Superfície
de toque
' / ï-f-\---
I / de toque I
WM
rncunaçao

meio
Colônias em Meio com
\ /
com ampicilina tetraciclina ColôÀias tetB
@ ueúor de clonagem
(c) Colônias amfteF desenvolvem-se em meio com tetraciclina lnrmltÉcrrla de vetor non
Ímrécula recombiÍìar
I]llll]rÍ| segmento adiciona
Posição de recombinante ampqteÊ
serido no sítio de,

|l]lÍÈepas mais detalhad


ver Figur
Não-recombina nles am pR tef

tem uma cq
Figura 5.8 sídeo,IPTG
Seleção de recombinantes de pBR322 por inativação por inserção do gene de resistência à tes, formadr
tetraciclina. {a) As células são plaqueadas em ágar com ampicilina: todas as transÍormantes binantes, cot
produzem colônias. (b) As colônias são plaqueadas em réplica em meio com tetraciclina. (c) cas. Esse sis
As colônias que se desenvolvem em meio com tetraciclina são amp'tef e, portanto, não-re-
combinantes. Recombinantes (ampBtef) não se desenvolvem, mas suas posições na placa
de ampicilina são conhecidas.
E3 lntroduçã
Existem doi:
tizar B-galactosidase (Figura 5.9a); recombinantes também são ampR, mas são incapazes de
da com um r
produzir B-galactosidase (Figura 5.9b).
A identificação da presença ou da ausência da p-galactosidase é de fato bastante fácil. Em ção e empr
vez de realizat um ensaio para a detecção da quebra de lactose em glicose e galactose, é exe-
cutado um teste para a detecção de uma reação um pouco diferente, também catalisada pela
["3.1 TransÍecçi
enzima. Essa reação envolve um análogo da lactose, chamado X-gal (5-bromo-4-cloro-3-in- Esse process
dolil-B-D-galactopiranosídeo), o qual é degradado pela p-galactosidase em um produto que um fago em

F
Cr-ounoev GÊNtcA E ANÁLrsE oe DNA 105

(a) pUCB

Gene de
resistência
à ampicilina

amf ftgat'
(b) Uma molécula de pUCB recombinante

Figura 5.9
O vetor de clonagem pUCS: (a) a
nrm*écula de vetor normal, (b) uma
nnolécula recombinante contendo
Íun segmento adicional de DNA in-
serido no sítio de BamHl.Para
ampR pgaf
mapas mais detalhados de pUC8,
ver Figuras 6.3 e 6.4.

tem uma cor azul-escuro. Se X-gal (mais um indutor da enzima, como o isopropiltiogalacto-
sídeo, IPTG) for adicionado ao ágar juntamente com ampicilina, as colônias não-recombina-
do gene de resistência à tes, formadas por células que sintetizam B-galactosidase, terão cor.azlul, enquanto as recom-
todas as transÍormantes binantes, com o gene lacZ' intenompido e incapazes de produzir B-galactosidase, serão bran-
rneio com tetraciclina. (c) cas. Esse sistema, chamado de seleção Lac, está resumido na Figura 5.10b.
t=tef e, portanto, não-re-
suas posições na placa
5.3 lntrodução de DNA de fagos em células bacterianas
Existem dois métodos diferentes pelos quais uma molécula de DNA recombinante construí-
, mas são incapazes de
da com um vetor derivado de fago pode ser introduzida em uma célula bacteriana: transfec-
ção e empacotamento in vitro.
é de fato bastante fácil. Em
gÌicose e galactose, é exe-
5.3.1 TransÍecção
. também catalisada pela
(5-bromo-4-cloro-3-in- Esse processo é equivalente à transformação, com a diferença de que o DNA envolvido é o de
em um produto que um fago em vez do de um plasmídeo. Assim como com um plasmídeo, o DNA de fago puri-

:
106 T. A. Bnowrl

No segundo sil
(a) A Íunção do gene tacz' mutação em um 91
E. coli lacZ'- +pUC8 uma das linhagens
linhagens é capaz
to do gene mutado
tos de todas as ou
Molêculas
oQo mistura de empacc
incompletas
) I
culturas celulares-
./9oQ Moléculas
de B-galac-
tosidase
pUCS completas
- Fragmento da p-galactosidase codiÍicado pelo gene bacteriano
e Fragmenlo da B-galactosidase codificado pelo gene plasmidial
Figura 5.10
c Molécula de P-galactosidase completa
A base teórica da ina-
(b) Seleção de recombinantes de pUCB tivação por inserção
do gene lacZ'presen-
'+ X-gal + IPTG te em pUC8. (a) Os
genes bacteriano e
Colônia azul = não-recombinante
plasmidial comple-
mentam-se um ao ou-
Colônia branca = recombinante
tro para produzirem
uma molécula de p-
galactosidase Íuncio-
colônias azuis = p-galactosidase sintetizada nal. (b)Os recombi-
X-gal-+ produto azul nantes são seleciona-
Colônias brancas = p-galactosidase não-sintetizada dos a partir do pla-
X-gal-+ sem produto azul queamento em ágar
contendo X-gal e
IPTG.

ficado ou uma molécula de fago recombinante é misturado com células de E. coli competen-
tes, com a incorporação do DNA induzida por choque térmico. Figura 5.11
Empacotamento in vi-
5.3.2 Empacotamento in vitro Íro. (a) Síntese das
proteínas do capsídeo
A transfecção com moléculas de DNA de l, não é um processo muito eficiente quando com-
de i, pela linhagem de
parada com a infecção de uma cultura de células com partículas de fago l, maduras. Seria,
E coli SMR10, que é
portanto, útil se moléculas de l" recombinantes pudessem ser empacotadas na estrutura de ca- portadora de um Íago
beça e cauda de l, em um tubo de ensaio. que possui sítios cos
Isso pode parecer difícil, mas, na realidade. é um processo de execução relativamente ffictivos. (b) Síntese
simples. O empacotamento exige diversas proteínas codificadas pelo genoma de 1,, mas elas üconjuntos incomple-
podem ser preparadas em uma alta concentração a partir de células infectadas com linhagens tos de proteínas de
defectivas de fago 1,, com a possibilidade de utilizarem-se dois sistemas diferentes. Com o capsídeo de l. pelas li-
sistema de linhagem única, o fago l, defectivo é portador de uma mutação nos sítios cos, de nhagens de E. coli
modo que eles não são reconhecidos pela nuclease que normalmente çliva os catenanos de À EflB2688 e 8H82690.
(c) Uma mistura de li-
durante a replicação do fago (p. 33-3a). Portanto, o fago defectivo é incapaz de replicar-se,
sados celulares provê
embora ele dirija a síntese de todas as proteínas neçessárias ao empacotamento. As proteínas
ioonjunto completo de
acumulam-se na bactéria e são purificadas a partir de culturas de E. coli infectadas com o l, poteínas de capsídeo
mutado, podendo ser utilizadas para o empacotamento in vitro de moléculas de l, recombi- @pode empacotar mo-
nantes (Figura 5. I 1a). léculas de DNA de l"
em tubo de ensaio.

l
Crorunceu GÊwtcn e AruÁlrse oe DNA 107

No segundo sistema, duas linhagens defectivas de l, são necessiírias,


ambas portando uma
mutação em um gene que codifica um dos componentes
do envoltório protéico do fago: em
uma das linhagens, a mutação é no gene D e, na ãut,a,
é no gene E (Figura 2.9). Nenhuma das
linhagens é capaz de completar um ciclo de infecção
em E. cori,pois, na ausência do produ_
to do gene mutado, a estrutura completa do capsídeo
não pode ser montada. Assim, os produ_
tos de todas as outras proteínas do envoltórió acumuram-se
na célula (Figura 5.1rb). uma
mistura de empacotamento pode, portanto, ser preparada pela
combinação de lisados de duas
culturas celulares, uma infectada com a linhagem ãe o
À e a outra infeàtaoa com a linhagem

Figura 5.10
(a) Um sistema de êmpacotamento de linhagem
A base teórica da ina- única
tivação por inserção
dogene lacZ'presen- Proteínas de
DNA de l.
te em pUC8. (a) Os À acumulam-se
genes bacteriano e na célula
plasmidial comple-
mentam-se um ao ou-
tro para produzirem E coli SMR10 _ o DNA
de À possui sítios cos deÍectivos
uma molécula de B-
galactosidase Íuncio-
(b) Um sistema de empacotamento de duas linhagens
nal. (b) Os recombi-
nantes são seleciona-
dos a partir do pla-
queamento em ágar
contendo X-gal e
IPTG.

E. coliBHB26SA E. coliBHB2690
Figura 5.11 À deÍectivo para a Àdefectivo para a
síntese da proteína E (a) síntese da proteína D @
Empacotamenlo in vi-
Íro. (a) Síntese das
Futeínas do capsídeo (c) Empacotamento in vitro
eficiente quando com-
ü I pela linhagem de
fago À maduras. Seria, E ooli SMR10, que é cos
I cos
I cos
na estrutura de ca- poÍtadora de um Íago I cos
r Catenanos de DNA de À
gue possui sítios cos
Oo
relativamente Èrbctivos. (b) Síntese
üconjuntos incomple-
o-_t +o Proteínas de À de SMRIO
genoma de 1,, mas elas
+ +C ou de uma mistura de
com linhagens tos de proteínas de
\+ + c BHB2688 + BHB2690
s diferentes. Com o oapsídeo de À pelas li-
nhagens de E. coli o.-. j *
nos sítios cos, de
cliva os catenanos de À
incapaz de replicar-se,
E-182688 e 8H82690.
{c) Uma mistura de li-
"o
. As proteínas
coli infectadas com o À
sados celulares provê
omnjunto completo de
Foteínas de capsídeo

H H
'
Partícutas de fago À
las de l, recombi- contendo moléculas
epode empacotar mo-
léculas de DNA de ì. ç de DNA empacotadas
r
em tubo de ensaio.
108 T.A. BRowN

-.
E A mistura contém, então, todos os componentes necessários para o empacotamento de clareamento rel
moléculas de l" recombinantes em partículas de fago maduras (Figura 5.11c). zonas mais clan
Com qualquer um dos dois sistemas, as moléculas empacotadas são introduzidas em célu- O resultado
las de E coll simplesmente pela adição dos fagos montados à cultura bacteriana. A partir daí l, ou de M13 é.
ocorre o processo infectivo normal de 1". é derivada de ru
las virais idêntir
5.3.3 A inÍecção por fago é visualizada como placas em combinantes.
um meio de ágar
O estágio final do ciclo infectivo do fago é a lise celular (p. 3l). Se as células infectadas são
espalhadas em um meio de ágar sólido imediatamente após a adição do fago, ou imediatamen-
5.4 IdentiÍicaçã
te após a transfecção com DNA viral, a lise celular pode ser visualizada na forma de placas
Há diversas ma
sobre um tapete de bactérias (Figura 5.12a). Cada placa étmazona de clareamento, produzi-
guintes.
da à medida que os fagos lisam as células, infectam bactérias vizinhas que acabam sendo li-
sadas e assim por diante (Figura5.l2b).
5.4.1 Inativação p
Tanto l, como M13 formam placas. Com À, tais placas são verdadeiras, eis que produzidas
por lise celular. Com M13, por outro lado, elas se apresentam um pouco diferentes, pois esse
utilizado col
fago não lisa as células hospedeiras (p.32). Em vez disso, Ml3 causa um decréscimo na ve- Todos os vetorc
locidade de multiplicação das células infectadas, que é suficiente para produzir uma zona de dos de ì,, são p
inativa a síntesr
recombinantes
contendo fagos
5.13a).
(a) Placas em um tapete de bactérias
5.4,2 lnativação p
Vários tipos de
Tapete formado pela
ne cI (posição !
multiplicação conÍluenté de bactérias alteração na mc
tes com o gene
aparente para u
Uma placa - uma zona de
clareamento
5.4.3 Seleção utili
(b) Placas líticas O fago l, nornu
grada de um fq
Tapete de bactérias
// com o profago
.,,',jilt í. t'&-
i-'.r..; i,ï.:1. +. que a inserção <

.Í;on'ij': ,,u"" - todas as bactérias Íoram combinantes ir


''iÈiilir,",iìii'.{kl.i;
"ÌÏ- hospedeiras em
:"*:',ïï,:ï:ïXï,ïiï"n"" Figura 5.12
formam placas,
Placas de bacterióÍago.
(a) A aparência das placas em
um tapete de bactérias. (b) Pla-
r[4.4 Seleção con
(c) Placas de M13 cas produzidas por um Íago que O sistema de er
lisa a célula hospedeira (por de inserir na esl
exemplo, l. no ciclo de infecção la menor que 3,
As placas contêm bactérias lítico); as placas contêm células deleção de gral
de multiplicação lenta lisadas e muitas partículas de
+ partículas do fago M13 de modo que tê
Íago. (c) Placas produzidas por
partículas virais
M13; essas placas contêm bac-
térias de multiplicação lenta e o tamanho total
muitas partículas de Íago M13. tores, somente I
Crorunoeu GÊrurcn e ANÁLrsE DE DNA 109

paÍa o empacotamento de clareamento relativo em um tapete bacteriano. Embora não sejam placas verdadeiras, essas
5.1 1c). zonas mais claras são visualmente idênticas a placas de fago normais (Figura 5.12c).
são introduzidas em célu- O resultado final de um experimento de clonagem gênica utilizando um vetor derivado de
bacteriana. A partir daí À ou de Ml3 é, portanto, uma placa de âgar coberta com placas de fagos. Cada placa de fago
é derivada de uma célula individual transfectada ou infectada, que contém, portanto, partícu-
las virais idênticas. Tais partículas podem ou conter moléculas de vetor autoligadas ou ser re-
combinantes.

Se as células infectadas são


do fago. ou imediatamen-
5.4 Identificação de Íagos recombinantes
'uadana
forma de placas
Há diversas maneiras para distinguir placas recombinantes. As mais importantes são as se-
de clareamento. produzi-
guintes.
que acabam sendo li-
rn4.1 lnativação por inserção de um gene lacZ'presente no fago
iras, eis que produzidas
pouco diferentes, pois esse
utilizado como vetor
€ausa um decréscimo na ve- Todos os vetores de clonagem derivados de Ml3 (p. l2l-122), além de vários vetores deriva-
para produzir uma zona de dos de i,, são portadores de uma cópia do gene lacZ'. A inserção de novo DNA nesse gene
inatiya a síntese de B-galactosidase, exatamente como acontece com o plasmídeo pUCS. Os
recombinantes são identificados por plaqueamento das células em ágar com X-gal: placas
contendo fagos normais são azuis, enquanto placas recombinantes são incolores (Figura
5. I 3a).

t 4.2 lnativação por inserção do gene c{ de l,


Viírios tipos de vetores de clonagem derivados de l, possuem sítios de restrição únicos no ge-
ne cI (posição 38 no mapa da Figura 2.9). A inativação por inserção desse gene provoca uma
alteração na morfologia das placas. As placas normais são "turvas", enquanto as recombinan-
tes com o gene cI interrompido são "claras" (Figura 5.13b). A diferença entre elas é bastante
aparente para um olho treinado.

n4.3 Seleção utilizando o fenótipo Spi


O fago l" normalmente não pode infectar células de E. coli que já possuem uma forma inte-
grada de um fago aparentado chamado P2.Diz-se, por isso, que l, é Spi- (sensível à inibição
, com o profago P2). Alguns vetores de clonagem derivados de l, foram projetados de modo
que a inserção de um novo DNA cause uma mudança de Spi* para Spi-, permitindo que os re-
combinantes infectem células portadoras de profagos P2. Tais células são utilizadas como
hospedeiras em experimentos de clonagem com esses vetores; assim, somente recombinantes
5.12
formam placas, pois só eles são Spi (Figura 5.13c).
de bacterióÍago.
aparência das placas em
tâpete de bactérias. (b) pla- f.4.4 Seleção com base no tamanho'do genoma de l,
produzidas por um Íago que O sistema de empacotamento de À, que monta as partículas virais maduras, somente é capaz
a célula hospedeira (por de inserir na estrutura da cabeça moléculas com tamanho entre 37 e 52kb. Qualquer molécu-
l, no ciclo de inÍecção la menor que 37 kb não é empacotada. Muitos vetores derivados de À foram construídos pela
as placas contêm células
deleção de grandes segmentos da molécula de DNA que compõe o genoma do fago (p. 130),
e muitas partículas de
de modo que têm um tamanho inferior a 37 kb. Esses vetores só podem ser empacotados em
(c) Placas produzidas por
partículas virais maduras depois de o DNA adicional ter sido inserido neles, fazendo com que
; essas placas contêm bac-
de multiplicação lenta e o tamanho total do genoma seja maior do que 37 kb (Figura 5.13d). Portanto, com esses ve-
partículas de Íago M13. tores, somente os fagos recombinantes podem ser replicados.
espécies bi
(a) lnativação por inserção do gene tacZ, poração de
Saccharon,
mais sohst
Ágar+X-gal +IPTG
Placa clara = recombinante 5.5.1 Transforn
Placa azul = não- Para a mai,
recombinante celular. Cél
te transforn
cio (Figura
(b) lnativação por inserção do gene l,cl de celular.
fungos e ve
Placa clara = recombinante
gura 5.14b
ainda pode
Placa turva = não- células são
recombinante ria de poror
na célula. A
gradativas r
Em conr
cos para a ir
(c) Seleção utilizando o Íenótipo Spi
pipeta muitr
Profago P2 transformac
seqüenteme
Somente um fago À volve o bon
recombinante é capaz culas de our
de inÍectar a célula rados sobre
chamada de
l, não-recombinante
5.5.2 Transform
a célula
Para animai
(d) Seleção com base no tamanho do genoma de l. sim, um org
Sítios cos partir de cél

|#--r-r--rr-t /t\
tì t
mento de pr
gramíneas.
' Catenanodel, ì
transformad
ïamanho correto Muito pequeno Figura 5.13 esse DNA cl
-
para empacotamento para ser empacotado Estratégias para a 7.13b). Anin
seleção de Íagos re-
que a obtenç
combinantes.
lizada com r
do oviduto, r

(p. l6l_162)
5.5 TransÍormação de células não-bacterianas
Métodos para a introdução de DNA em leveduras, fungos, animais e vegetais também são ne-
cessários, se tais organismos devem ser utilizados como hospedeiros para a clonagem gênica.
Em termos gerais, a incubação das células em solução de sal só é eficiente para umas poucas
Croruncev GÊrurcn e AruÁuse oe DNA 111

espécies bacterianas, embora um tratamento com cloreto ou acetato de lítio aumente a incor-
poração de DNA por células de levedura e seja freqüentemente utilizado na transformação de
Saccharomyces cerevisiae.Para a maioria dos organismos superiores, entretanto, métodos
mais sofìsticados são necessários.

55.1 Transformação de células individuais


Para a maioria dos organismos, a principal barreira para a incorporação de DNA é a parede
celular. Células animais em cultura, que em geral não possuem parede celular, são facilmen-
te transformadas, sobretudo se o DNA for precipitado na superficie celular com fosfato de cál-
cio (Figura 5.14a). Para outros tipos de cólulas, a resposta é muitas vezes a remoção da pare-
de celular. Há enzimas disponíveis que degradam paredes celulares de células de leveduras,
fungos e vegetais e, sob condições adequadas, podem ser obtidos protoplastos intactos (Fi-
gura 5.14b), os quais, via de regra, incorporam DNA com facilidade, mas a transformação
ainda pode ser estimulada por técnicas especiais, como a eletroporação. Na eletroporação, as
células são submetidas a um pulso elétrico curto, que, acredita-se, induz a formação transitó-
ria de poros na membrana celular, pelos quais as moléculas de DNA são capazes de penetrar
na célula. Após a transformação, os protoplastos são lavados para a remoção das enzimas de-
gradativas e a parede celular é espontaneamente reconstituída.
Em contraste com os sistemas de transformação descritos até agora, há dois métodos físi-
cos irara a introdução de DNA em células. O primeiro deles é a microinjeção, que utiliza uma
pipeta muito fina para injetar moléculas de DNA diretamente nos núcleos das células a serem
transformadas (Figura 5.15a). A técnica foi inicialmente aplicada a células animais, mas sub-
seqüentemente aplicada também, com sucesso, em células vegetais. Um segundo método en-
volve o bombardeamento das células com microprojéteis de alta velocidade, em geral paÍí-
culas de ouro ou tungstênio, que foram recobertas com DNA. Esses microprojéteis são dispa-
rados sobre as células por uma pistola de partículas (Figura 5.15b). A técnica incomum é
- -
chamada de biobalística e já foi utilizada com diversos tipos diferentes de célula.

t5.2 TransÍormação de organismos inteiros


Para animais e plantas, o produto final desejado pode não ser uma célula transformada, mas,
sim, um organismo transformado. Plantas podem ser regeneradas com relativa facilidade a
partir de células em cultura, embora tenham sido encontrados problemas paÍa o desenvolvi-
mento de procedimentos de regeneração para espécies de monocotiledôneas, como cereais e
gramíneas. Uma única célula vegetal transformada pode, portanto, dar origem a uma planta
transformada, que será portadora do DNA clonado em cada uma de suas células e transmitirá
Figura 5.13 esse DNA clonado a sua progênie, depois da floração e da produção de sementes (ver Figura
Estratégias para a 7.13b). Animais, é claro, não podem ser regenerados a partir de células em cultura, de modo
seleção de Íagos re-
que a obtenção de animais transformados exige uma abordagem mais sutil. Uma técnica uti-
combinantes.
lizada com mamíferos, como os camundongos, é baseada na remoção de óvulos fecundados
do oviduto, que são microinjetados com DNA e reimplantados no trato reprodutivo da mãe
(p.161-162).

e vegetais também são ne-


iros para a clonagem gênica.
é efiçiente para umas poucas
T. A. BRowN

a) Precipitação de DNA sobÍe células animais Leituras adici


Calvin, N.M. ó

_ _-__- Solução de fosfato de cálcio of Bacteir


Capecchi, M.R
cells. Cell,
gq.- DNA precipitado sobre a
Cohen, S.N., C
superfície das células
formation
Monocamada de células animais 69,2tt0-1
Hammer, R.E.,
(b) TransÍormação de protoplastos vêgetais jection. Na

#
Hohn, B. & Mr
dings of th
Hegeneraçao Klein, T.M., W

-*y_
I
da planta I
into living
Mandel, M. & l
154-62. tT
* da parede celular Figura 5.14
Estratégias para a
Célula vegetal Protoplasto Célula vegetal Planta introdução de novo
transÍormada transformada DNA em células ani-
mais e vegetais.

(a) Microinjeção

(b) TransÍormação com microprojéteis

Microprojéteis
Pino de disparo

-n Células-alvo
^a
Carga

. N células-alvo
n ::Sl bomoarceaoas Figura 5.15

a
:i[$ "ot microprojéteis Dois métodos Íísicos
para a introdução de
DNA em células.

-----=:-
Ct-oruacer,a GÊrurcn e ANÁLtsE oe DNA 1 l3

ras adicionais
calvin, N.M. & Hanawalt, PC. (1988) High effrciency transformation of bacterial cells by
electrop oration. Journal
of B ac t e rio lo gy, 17 0, 27 96-g0l.
Capecchi, M.R. (1980) High efficiency transformation by direct microinjection
of DNA into cultured mammalian
cells. C e I l, 22,47 9 -88.
Cohen, S'N., Chang, A.VY', Hsu,L. et al. (1972) Nonchromosomal antibiotic resistance
in bacteria: genetic trans-
formation of Escherichia cali by R-factor DNA. Proceedings of the National Academy of
Sciences of the IJSA,
69,2ll0-14. [Transformação de uma bactéria com um plasmídeo.]
Hammer,R.E.,Pursel,V.G.,Rexroad,C.E. etal.(L981)Productionoftransgenicrabbits,sheepandpigsbymicroin-
jection. N ature, 315, 680-83.
Hohn,B'&Murray,K.(Lg77)PackagingrecombinantDNAmoleculesintobacteriophageparticles
invitro.procee-
dingsoftheNationalAcademyof SciencesoftheUSA,T4,3259-63.[Empacotamento invitro.]
Klein' T'M', Wolf, E.D., Wu, R. & Sanford, J.C. (1987) High velocity microprojectiles for delivering
nucleic acids
into living cells. Nature, 327,70-73. [Biobalística.]
Mandel, M. & Higa' A. (1970) Calcium-dependent bacteriophage DNA infecÍion. Journal
of Molecular Biotogy, 53,
I 54-62. [Transfecção.]
Figura 5.14
Estratégias para a
introdução de novo
DNA em células ani-
mais e vegetais.

Figura 5.15
Dois métodos físicos
para a introdução de
DNA em células.
Cnpírulo 6
Vetores de Clonagem para E. coli

Vetores de clonagem baseados em plasmídeos de E. l, e outros vetores de alta capacidade permitem que
coli. 1 l5 bibliotecas genômicas sejam construídas, 136
Vetores de clonagem baseados no bacteriófago M I 3, Vetores para outras bactérias, I 37
122
Vetorés de clonagem baseados no bacteriófago À,
t29

As técnicas experimentais básicas envolvidas na clonagem gênica já foram descritas. Os Ca-


pítulos 3,4 e 5 mostraram como o DNA pode ser purificado de extratos celulares, como mo-
léculas de DNA recombinantes podem ser construídas em um tubo de ensaio, como molécu-
las de DNA podem ser reintroduzidas em células vivas e como clones recombinantes podem
ser distinguidos. Agora deve-se olhar mais atentamente paÍa o vetor de clonagem propriamen-
te dito, a fïm de analisar a variedade de vetores disponíveis para o biologista molecular e pa-
ra entender as propriedades e utilizações de cada tipo individual.
A maior variedade de vetores de clonagem que existe é para a utilização de E. coli como
organismo hospedeiro. Isso não é surpreendente, tendo em vista o papel central que essa bac-
téria tem exercido na pesquisa básica nos últimos 50 anos. A imensa riqueza de informações
existente a respeito da microbiologia, bioquímica e genética de E. coli signihca que, virtual-
mente, todos os estudos fundamentais de estrutura e função gênica foram realizados tendo es-
sa bactéria como organismo experimental. Recentemente, a clonagem gênica e a pesquisa bio-
lógica molecular têm se tornado mutualmente sinergísticas - avanços na clonagem gênica têm
atuado como estímulo para a pesquisa, enquanto as necessidades da pesquisa têm acelerado o
desenvolvimento de novos e mais sofisticados vetores de clonagem.
Neste capítulo, serão descritos os tipõs mais importantes de vetores de clonagem para E.
coli e desÍacadas as utilizações específicas das moléculas representativas. No Capítulo 7, os
vetores de clonagem para leveduras, fungos, plantas e animais serão considerados.

t 1 vetores de clonagem baseados em plasmídeos de E. coti


Os vetores de clonagem mais simples e os mais amplamente utilizados na clonagem gênica
são aqueles baseados em plasmídeos bacterianos pequenos. Um grande número de vetores
plasmidiais diferentes está disponível para auÍilização em E. coli,muitos obtidos de fornece-
dores comerciais. Eles combinam a facilidade de purificação com propriedades desejáveis,
116 T. A. Bnown

tais como alta eficiência de tfansformação, marcadores convenientes para a seleção de trans-
formantes e recombinantes e a capacidade para clonagem de pedaços de DNA razoavelmen-
te grandes (até cerca de 8 kb). A maioria dos experimentos de clonagem gênica de "rotina" faz
uso de um ou outro desses vetores plasmidiais.
Um dos primeiros vetores a ser desenvolvido - e ainda um dos mais populares hoje em
dia - é o pBR322, o qual foi introduzido no Capítulo 5 para ilustrar os princípios gerais da se-
leção na transformação e a identificação dos recombinantes (p. 98). Este estudo de vetores
plasmidiais de E. coli será iniciado a partir de uma visão mais aproximada do pBR322.

6.1.1 A nomenclatura dos vetores de clonagem plasmidiais Um mapa de pB


O nome "pBR322" obedece às regras gerais para a nomenclatura de vetores: nes de resistên
(er1, a origem
. "p" indica que ele é realmente um plasmídeo.
. "BR" identifica o laboratório no qual o vetor foi originalmente construído (BR cones-
ponde a Bolívar e Rodrigues, pesquisadores que desenvolveram o pBR322).
c "322" distingue esse plasmídeo de outros desenvolvidos no mesmo laboratório (existem
tambéni plasmídeos chamados pBR325, pBR327, pBR328, etc.).

6.1.2 As propriedades úteis do pBR322


O mapa genético e físico do pBR322 (Figura 6.1) fornece uma indicação darazão pela qual
esse plasmídeo tem se tornado um vetor de clonagem tão popular.
A primeira característica útil do pBR322 é o seu tamanho. No Capítulo 2 foi determinado
que um vetor de clonagem deve ter um tamanho menor do que 10 kb para evitar problemas,
tais como a quebra do DNA durante a purificação. O pBR322 possui 4.363 pb, o que signifi-
ca que não somente o próprio vetor pode ser purificado com facilidade, mas também o podem
as moléculas de DNA recombinantes construídas apartir dele. Mesmo com 6 kb de DNA adi-
cionais, uma molécula de pBR322 recombinante ainda apresenta um tamanho manipulável.
A segunda característica do pBR322 é que, conforme descrito no Capítulo 5, ele contém
dois grupos de genes para resistência a antibióticos. Tanto resistência à ampicilina quanto à
tetraciclina podem ser utilizadas como marcas de seleção para células contendo o plasmídeo,
e cada gene marcador contém sítios de restrição únicos, que podem ser utilizados em experi-
mentos de clonagem. A inserção de um DNA novo em um pBR322 que tenha sido clivado
com Psfl, PvuIou ScaI inativa o gene que confere resistência à ampicilina (o*po),e inserções
utilizando qualquer uma das oito endonucleases (principalmente BamHI e HindIII) inativam
a resistência à tetraciclina. Essa grande variedade de sítios de restrição, que pode ser utiliza-
da para a inativação por inserção, confirma que o pBR322 pode ser utilizado para clonar frag-
mentos de DNA com qualquer um dos viírios tipos de extremidades coesivas.
Uma terceira vantagem do pBR322 é que ele apresenta um número de cópias relativamen-
te alto. Geralmente existem cerca de 15 moléculas presentes em uma célula de E. coli Írans-
formada, mas esse número pode ser aumentado, para até 1 .Õ00 a 3.000, pela amplificação do
plasmídeo na presença de um inibidor da síntese protéica, tal como cloranfenicol (p. 54). Uma
cultura de E. coli, portanto, fornece um bom rendimento de moléculas de pBR322 recombi-
nantes. Flgu
o oeag
6.1.3 O pedigreedo pBR322 @:(a)as
q,ações envo
A extraordinária conveniência do pBR322 como um vetor de clonagem não apareceu ao aca- na construç
so' O plasmídeo foi, na verdade, planejado de modo que se possibilita à construção final ter ffie(b)t
essas propriedades desejáveis.As linhas gerais do esquema utilizado para construir o pBR322 orrn das orbe
são mostradas na Figura 6.2a. Conforme pode ser observado, sua construção foi um trabalho p8l
CLoruncrv GÊNrcA E ANÁLtsE DE DNA 117

para a seleção de trans-


de DNA razoavelmen- EcoRl Hird,lll
gênica de "rotina" faz

dos mais populares hoje em


os princípios gerais da se-
98). Este estudo de vetores
proximada do pBR322.
Figura 6.1
Lfm mapa de pBR322 mostrando as posições dos ge-
ms de resistência à ampicilina (amp\ e à tetraciclina
(eÔ, a origem de replicação (ori) e alguns dos sítios
de restrição mais imPortantes.
construído (BR corres-
'eram o pBR322).
mesmo laboratório (existem

(a) Construção de pBR322


*7--\_
z\
[ï/v
indicação darazão pela qual Fragmento Í
recrrcuranzaoo \ R6_5 ì/
(
No Capítulo 2 foi determinado
e l0 kb para evitar problemas,
possú 4.363 pb, o que signifi-
rnÀ /
l/
*'l-< Ecolt* \.--/

drdade, mas também o podem /=.-< EcoRt. {PSC101)


Áttr,rÀ EcoRl.
Fragmento de EcoRl .\--/
u1,\
trlíesmo com 6 kb de DNA adi-
EcoRl
um tamanho manipulável. ampR
dentro do éítio de
// ./

w
no Capítulo 5, ele contém
istência à ampicilina quanto à Tn33\
/-\ ;.- EcoRl\9{
ó'à
t
ulas contendo o plasmídeo,
ser utilizados em experi- ,'r"/--\'".
@
22 que tenha sido clivado
*mpicilina (o*p*), e inserções
BamHI e HindIII) inativam
restrição, que pode ser utiliza-
\--l-{*t""À
tef
ser utilizado para clonar frag-

de cópias relativamen-
uma célula de E. coli ïrans-
@ uors ÌragmenÌos
ligados

ee,
tef

a 3.000, pela amplificação do ori


cloranfenicol (p. 54). Uma (b) As origens de pBR322
las de pBR322 recombi-
Figura 6.2
O pedigree de
pBR322: (a) as mani-
pulações envolvidas
não apareceu ao aca- na construção de
ibilitaà construção final ter pBR322 e (b) um re-
para construir o pBR322 sumo das origens de
construção foi um trabalho pBR322.

-
a

-::

a
1 í I T. A. Bnowr'r

iírduo que exigiu a utilização hábil e muito bem feita das técnicas de manipulação do DNA des- (2) A dele
critas no Capítulo 4. Um resumo dos resultados de tais manipulações é fomecido na Figura 6.2b, pBR32
a partir da qual pode ser observado que o pBR322, de fato, compreende DNA derivado de três transfe
plasmídeos naturalmente existentes. O gene ampR estáoriginalmente presente no plasmídeo ca, evit
Rl, um plasmídeo típico de resistência a antibióticos, que é encontrado em populações natu- nante t
rais de E. coli (p.29). O gene tetR é derryado de R6-5, um segundo plasmídeo de resistência a molecr
antibióticos. A origem de replicação de pBR322, a qual comanda a multiplicação do vetor nas popula
células hospedeiras, é original de pMB l, que é bastante relacionado ao plasmídeo produtor de sua m€
colicilina ColEl (p. 29). so acor
te peril
6.1.4 Outros vetores plasmidiais típicos para E. coli pUCS: um
O pBR322.foi desenvolvido no final da década de l9lo, e o primeiro trabalho científico des-
Esse vetor fc
crevendo sua utilização foi publicado em 19'.''...Desde então, muitos outros vetores de clona-
da inativaçã<
gem plasmidiais foram construídos, a maioria derivada de pBR322, por meio de manipula-
6.3b) é deriv
ções semelhantes àquelas resumidas na Figura 6.2a. Não haveria sentido em tentar descrever neçam. A se
todos esses vetores, principalmente porque muitos são variações de um mesmo tema. Três
contém mais
exemplos adicionais serão suficientes para ilustrar as características mais importantes apre-
pados em un
sentadas pela ampla variedade de vetores de clonagem plasmidiais disponível atualmente pa-
O pUCS
ra os engenheiros genéticos.
lares vetores
pBR327: um plasmídeo com alto número de cópias na construçã
de replicaçã
O pBR327 (Figura 6.3a) foi construído pela remoção de um segmento de 1.089 pb de
mesmo anter
pni:ZZ. Essa deleção manteve os genes o*p* e tef intactos, mas alterou as capacidades re-
nado, obtido
plicativas e conjugativas do plasmídeo resultante. Como resultado, pBR327 difere de pBR322
tes.
de duas maneiras importantes:
A segund
um processo
(1) O pBR327 apresenta um número de cópias superior ao pBR322, estando presente com
lina e X-gal
cerca de 30 a 40 moléculas por célula de E. coli. Isso não é de grande relevância quan-
cedimento el
do a preocupaçáo é o rendimento do plasmí-
para o outro
deo, uma vez que ambos os plasmídeos podem
(a) pBR327 na metade ú
ser amplificados para um número de cópias su-
perior a 1.000. No entanto, o número de cópias A terceiri
EcoRl Hr'ndlll
Scal o qual permi
superior de pBR327 em células normais torna
mos, EcoRl
Pvul esse vetor mais adequado. caso o objetivo do
pulações adi,
experimento seja o estudo das função do gene
ra 6.4a). Out
clonado. Nesses casos, a dosagem gênica tor-
cem uma fle
na-se importante, pois, com a existência de
nados (Figru
mais cópias de um gene clonado, maior a pro-
mo que os a!
babilidade de que o efeito do gene clonado nas
células hospedeiras seja detectado. O pBR327,
um membro
corresponder
com seu alto número de cópias, é, portanto, a
de DNA ou i
melhor opção para esse tipo de trabalho do que
procediment
(b) pUCB pBR322.
pGEM3Z:

/"*A
t
2.t5'r pD
, ))
O pGEM3Z
lacZ',
mente do me
este íi
ori /acz7ÁAgrupamento de sítios
\ \€7- Figura 6.3
(ver Figura 6.4a)
Dois vetores de clonagem plasmidiais de E
coli.
CroNeoeM GÊr.rrcr e AnÁuse or DNA 1 19

manipulação do DNA des- (2) A deleção também eliminou a capacidade conjugativa de pBR322, transformando
é fomecido na Figura 6.2b, pBR327 em um plasmídeo não-conjugativo, que náo é capaz de comandar a sua própria
DNA derivado de três transferência para outras células de E. coli. Isso é importante para a contenção biotógi-
presente no plasmídeo ca, evitando a possibilidade de que uma molécula de um plasmídeo pBR327 recombi-
em populações nafu- nante escape de um tubo de ensaio e colonize bactérias do intestino de um biologista
plasmídeo de resistência a molecular descuidado. Em contraste, pBR322 poderia, teoricamente, ser passado para
a multiplicação do vetor nas populações naturais de E. coli por conjugação, embora, de fato, pBR322 também pos-
ao plasmídeo produtor de sua meios de proteção (apesar de menos sofisticados) para minimizar as chances de is-
so acontecer. O pBR327 é, portanto, preferível, caso o gene clonado seja potencialmen-
te perigoso na ocorrência de um acidente.

pUGS: um plasmídeo de seleção Lac


trabalho científico des-
Esse vetor foi mencionado no Capítulo 5, quando a identificação de recombinantes por meio
[os outros vetores de clona-
da inativação por inserção do gene da B-galactosidase foi descrira (p. 10a). O pUCS (Figura
312. por meio de manipula-
rentido em tentar descrever 6.3b) é derivado de pBR322, embora somente a origem de replicação e o gene amp* perma-
neçÍìm. A seqüência de nucleotídeos do gene amp* foimodificada, de tal forma que ela não
de um mesmo tema. Três
cas mals rmportantes apre-
contém mais os sítios de restrição únicos; todos aqueles sítios de clonagem estão agora agru-
pados em um segmento curto do gene lacZ'presente no pUC8.
disponível atualmente pa-
O pUC8 possui três vantagens importantes, que o levaram a se tornaÍ um dos mais popu-
lares vetores de clonagem para E. coli. A primeira delas é casual: as manipulações envolvidas
na construção do pUCS foram acompanhadas por uma mutação inesperada, dentro da origem
segmento de 1.089 pb de de replicação, que resultou no plasmídeo apresentando um número de cópias de 500 a 700,
alterou as capacidades re- mesmo antes da amplificação, o que tem um efeito significativo no rendimento do DNA clo-
pBR327 difere de pBR322 nado, obtido a partir de células de E. coli transformadas com plasmídeos pUC8 recombinan-
tes.
A segunda vantagem é que a identificação de células recombinantes pode ser realizada em
estando presente com um processo de uma única etapa, por meio do plaqueamento em meio ágar contendo ampici-
é de grande relevância quan- lina e X-gal (p. 105). Com ambos. pBR322 e pBR327, a seleção de recombinantes é um pro-
é o rendimento do plasmí- cedimento em duas etapas, necessitando de placas-réplicas, de um meio com um antibiótico
ambos os plasmídeos podem para o outro (p. 103). Um experimento de clonagem com pUC8 pode, portanto, ser realizado
pam um número de cópias su- na metade do tempo necessário para com pBR322 ou pBR327.
entanto, o número de cópias A terceira vantagem de pUC8 está relacionada com o agrupamento dos sítios de restrição,
l7 em células normais torna o qual permite que um fragrnento de DNA com duas extremidades.coesivas diferentes (diga-
dequado, caso o objetivo do mos, -EcoRI em uma extremidade e BamHI na outra) seja clonado sem a utilização de mani-
o estudo das função do gene pulações adicionais, tais como a ligação de uma molécula de ligação (do inglês linker) (Figu-
cuÌsos, a dosagem gênica tor- ra 6.4a). Outros vetores pUC carregam combinações diferentes de sítios de restrição e forne-
pois, com a existência de cem uma flexibilidade ainda maior para os tipos de fragmentos de DNA que podem ser clo-
gene clonado, maior a pro- nados (Figura 6.4b). Ademais, o agrupamento de sítios de restrição em tais vetores é o mes-
o efeito do gene clonado nas mo que os agrupÍÌmentos nas séries de vetores M I 3 equivalentes (p. I25). O DNA clonado em
seja detecrado. o pBR327, um membro de uma série pUC pode, portanto, ser transferido diretamente para o seu M13mp
ro de cópias, é, portanto, a correspondente, de tal forma que este pode ser analisado por intermédio de seqüenciamento
essetipo de trabalho do que de DNA ou mutagênese in vitro (Figura 6.4c; ver páginas 2ll e 244 para a descrição desses
procedimentos).

pGEM3Z: transcrição in vitro do DNA clonado


I o pGEM3Z (Figura 6.5a) é muito semelhante a um vetor puc: ele contém os genes amp* e
J
i lacZ', último contendo um agmpamento de sítios de restrição, além de ser quase exata-
esÍe
l mente do mesmo tamanho. A diferença é que o pGBM3Zpossui dois pedaços de DNA extras,
I

b clonagem plasmidiais de E
12O T. A. Bnowr,r

(a) Sítios de restrição em pUCB


RNA-pol
fragment
zado con
que objet
síntese dr
Hitúlll Os pr
Psll cias-paú
Sali, Accl, Hirrcll
BamHl é específ
Smal, Xmal limerase
EcoRl li com ur
para utili
(lembre-
do que or
(b) Sítios de restrição em pUCIB I a21tgr
padrão dr

Hindlll
Sphl
puc18 Psfl
SaÃ, Accl, Hincll
Xbal
BamHl
Smal, Xmal
Kpnl

EcoRl

(c)TransÍerência de um Íragmento de DNA de pUCS para Mt3mp8

pUCS recombinante

BamHl

(:_1ï'
DNA novo
Sítios de restrição
Figura 6.4
com BamHl e EcoRl Os plasmídeos pUC. (a)
Clivagem EcoRl \ O agrupamento de sÊ
com EanrHl \ \ tios de restrição no int+
e EcoRl
rior do gene lacZ'de
pUC8. (b) O agrupa-
mento de sítios de res-
trição em pUC18. (c)
TransÍerência de um
fragmento de DNA de Figul
pUCS para M13mp8. pGEM3z. (a) Ma
Ëí. (b) Síntese de
itmÌuf,fo. R = agrupaÍ
cada um atuando como sítio de reconhecimento para a ligação de uma
üsÍtios de restriçã
enzima RNA-polime- ra EcoRl, Sac{,
rase. Essas duas seqüências promotoras situam-se em cada um dos lados
do ug*pì-"nto
dos sítios de restrição utilizados para a introdução de um DNA novo em uma
M, Smal, BanrHl,
molécula de Sat, Acd, Hircll,
pGElú3Z.Isso significa que, se uma molécul a de pGBM3Zrecombinante for misturada Sphl e H
com

--=.-
Ct-oruncev GÊrurcn e ANÁLrsE oe DNA 121

RNA-polimerase purificada em um tubo de ensaio, a transcrição ocorrerá e cópias de RNA do


fragmento clonado serão sintetizadas (Figura 6.5b). O RNA que é produzido poderá ser utili-
zado como uma sonda de hibridizaçáo (p. 174), ou poderá ser necessário para experimentos
que objetivam o estudo do processamento de RNA (por exemplo, a remoção de íntrons) ou
síntese de proteínas.
Os promotores presentes no pGEM3Z e nos demais vetores desse tipo não são seqüên-
cias-padrão reconhecidas pela RNA-polimerase de E. coli.Ao contriírio, um dos promotores
é específico para a RNA-polimerase codificada pelo bacteriófago T7 e o outro pela RNA-po-
limerase do fago SP6. Essas RNA-polimerases são sintetizadas durante a infecção de E. co-
/i com um ou outro fago e são responsáveis pela transcrição dos genes do fago. Sua escolha
para utilização na transcrição in vitro deve-se ao fato de essas enzimas serem muito ativas
(lembre-se de que um ciclo lítico de infecção inteiro leva somente 20 minutos [30], de mo-
do que os genes do fago devem ser transcritos muito rapidamente) e capazes de sintetizar de
I a21tg de RNA por minuto, substancialmente mais do que pode ser produzido pela enzima-
padrão de E. coli.

(a) pGEM3Z

Promotor de T7

Promotor de SP6

(b) Síntese de RNA rn viÍro

Promotor de T7
Figura 6.4
Os plasmídeos pUC. (a)
O agrupamento de sí-
tios de restrição no int+
rior do gene lacZ'de
pUC8. (b) O agrupa-
mento de sítios de res-
trição em pUC18. (c)
TransÍerência de um
Íragmento de DNA de Figura 6.5
pUCS para M13mp8. pGEM3Z. (a) Mapa do
ffiÍ. (b) Síntese de RNA
rflmuúfo. R = agrupamento
iüsítios de restrição pa-
de uma enzima RNA-polime- Transcritos de RNA
ra EcoRl, Sacl, Kpnl,
dos lados do agrupamento *d" Smal, BamHl, Xbal,
novo em uma molécula de &t, Accl, Hirrcll, Psl|,
inante for misturada com Sphl e Hidlll.

-- l
çt.z vel(.,rËì' qg ur(rrrageilr uaìteau(,st rr(J uaulerr(,rag(, tut tr,
A exigência mais importante para qualquer vetor de clonagem é que ele possua uma manelra
de se replicar em uma célula hospedeira. Para vetores plasmidiais, essa necessidade é fácil de
satisfazer, uma vez que seqüências de DNA relativamente curtas são capazes de atuar como
origens de replicação plasmidial, e a maioria das enzimas necessárias para a replicação, se não
todas, é fornecida pela célula hospedeira. Manipulações elaboradas, tais como aquelas que re-
sultaram no pBR322 (Figura 6.2a), sáo, portanto, possíveis, contanto que a construção final
tenha uma origem de replicação intacta e funcional.
Com bacteriófagos, tais como Ml3, a situação em relação à replicação é mais complexa.
Moléculas de fago, em geral, contêm vários genes essenciais à replicação, incluindo aqueles
que codificam componentes do capsídeo protéico do fago e enzimas replicativas específicas
para o DNA do fago. Alteração ou deleção de qualquer um desses genes irá impedir ou des-
truir a capacidade replicativa da molécula resultante. Existe, pois, uma liberdade muito me-
nor paÍa se modificar moléculas de DNA de fago, e, via de regra, os vetores de clonagem de
fago são apenas levemente diferentes das moléculas parentais.
Os p'roblemas na construção de um vetor de clonagem de fago são ilustrados consideran-
do M13. O genoma normal de M13 possui 6,4 kb de comprimento, a maioria ocupada por l0
genes extremamente compactados (Figura 6.6), cada um essencial para a replicação do fago.
Há somente uma única seqüência intergênica, de 507 nucleotídeos, dentro da qual novas mo-
léculas de DNA podem ser inseridas, sem causar a intemrpção de um desses genes, e, na ver-
dade, essa região inclui a origem de replicação, que ela própria deve permanecer intacta. Cla-
ramente, há apenas um limitado espaço para modificação no genoma de Ml3. Figura 6.7
@wstrução de (a)
No entanto, será relembrado que a maior atração de M13 é a oportunidade que ele ofere-
M13mp1, e (b)
ce de obtenção de versões de fita simples do DNA clonado (p. 36).Tal característica tem afua-
a partir dc
do como estímulo para o desenvolvimento de vetores de clonagem M13. ggímÍna de M13 dc
li:o selvagem,
6.2.1 Desenvolvimento do vetor de clonagem M13mp2
O primeiro passo na construção de um vetor de clonagem M13 foi a introdução do gene lacT
dentro da seqüência intergênica. Isso originou Ml3mpl, o qual forma placas azuis em meio deo o tral
ágar com X-gal (Figura 6.7a). utilizandc
M13mpl não tem qualquer sítio único de restrição no gene lacZ'.Ele contém, no entanto, possui un
o hexanucleotídeo GGATTC próximo ao início do gene. Uma única substituição de nucleoú- de ácido i
M13mp2
Ml3n
des coesil
tinguidos

Hl3mp7
O próxim,
adicionais
údeo curt<
tios de res
clonagem
6.8b). um
lI e PsrI). I

te o gene I
Figura 6.6 de uma en
O genoma de M13, mostrando as posições dos genes I ao X
Cr-oruneev GÊrurcn e AruÁusr oe DNA 123

(a) Construção de M13mp1

ele possua uma maneira


Clivagem, lacZ'
essa necessidade é fácil de ligação
são capazes de atuar como
para a replicação, se não
tais como aquelas que re-
,uz*-\, M13 M13mp1
que a construção final

replicação é mais complexa- (b) Construção de M13mp2


incluindo aqueles
imas replicativas específi cas Mutagênese EcoRl
senes irá impedir ou des- in vitro
i:s.- uma liberdade muito me-
............................*
on lacz
os vetores de clonagem de
M13mp1 M'l3mp2
úo ilustrados consideran-
.a maioria ocupada por 10
met - thr-met - ile - thr - asp - ser - ;n1ç;edogenelacZ,
iaÌ para a replicação do fago.
dentro da qual novas mo-
-AïG ACC ATG ATT ACG GAT TCA- emM13mp1
*
um desses genes, e, na ver-
'e perÍnanecer intacta. Cla-
Figura 6.7
- thr -met - ile - thr - asn - ser -
met lpiçi6 dogenelacZ'
-ATG ACC ATG AT-r ACG AAT TCA- emM13mp2
Gonstrução de (a) *
crportunidade que ele ofere-
M13mp1, e (b)
r. Tal caracteística tem atua-
fil&np2, a partir do
gEnoma de M13 do EcoRl
tipo selvagem.

foi a introduçáo do gene lacT


tbrma placas azuis em meio deo o transformará em GAATTC, o qual é um sítio para EcoRI. Essa alteração foi realizada
utilizando-se mutagênese in vitro (p.2aD, resultando no Ml3mp2 (Figura 6.7b). M13mp2
Z'. Ele contém, no entanto, possui um gene lacZ'levemente alterado (o sexto códon agora especifica asparagina, emvez
substituição de nucleoú- de ácido aspártico), mas a enzima B-galactosidase produzida pelas células infectadas com
M13mp2 ainda é perfeitamente funcional.
Ml3mp2 é o vetor de clonagem M13 mais simples. Fragmentos de DNA com extremida-
des coesivas de EcoRI podem ser inseridos no sítio de clonagem, sendo os recombinantes dis-
tinguidos como placas claras em meio ágar com X-gal.

M13mp7: sítios de clonagem simétricos


O próximo passo no desenvolvimento de vetores M13 foi a introdução de sítios de restrição
adicionais dentro do gene lacZ', obtido pela síntese em um tubo de ensaio de um oligonucleo-
tídeo curto, chamado de sítio de policlonagem (polylinker), qle consiste em uma série de sí-
tios de restrição que possui extremidades coesivas de EcoRI (Figura 6.8a). Esse sítio de poli-
clonagem foi inserido dentro daquele de EcoRI de Ml3mp2, originando M13mp7 (Figura
6.8b), um vetor mais complexo, com quatro sítios de clonagem possíveis (EcoRI, BamH\ Sa-
il e PstI). O sítio de policlonagem foi projetado de tal forma que ele não interrompe totalmen-
te o gene lacZ'; urna fase de leitura é mantida por intermédio do sítio de policlonagem, além
de uma enzima B-galactosidase funcional, a qual, ainda que alterada, é produzida.
as posições dos genes I ao X.
124 T. A. Bnowlr

(a) O sítio de policlonagem

AATTC CCCGG ATC C GTC G AC CTG C AG GTC G AC G G ATC C G G G G

+EcoRl
GGGGC CTAG G C AG CT G G AC

Sall
G TC C AG CTG

Sall
C
+
CTAG G C C C CTTAA

EcoRl
Accl Accl
Hincll Hincll Figura 6.8
(b) Construção de Ml3mp7 Sítios de Construção de
restricão M13mp7: (a) o sítio
de policlonagem e
EcoRl, (b) sua inserção no
ligação
sítio de EcoRl de
M13mp2. Note que
rL/rv os sítios de restrição
M13mp2 M13mp7 para Sa/l são tam-
Sítio de
policlonagem bém reconhecidos
por Acd e Hircll.

Figura 6.9
Clonagem com
ffil3Ínp7 (ver o texto
para detalhes).

Quando o M13mp7 é digerido taÍlto com EcoRI, BamHI ou SaII, uma parte ou todo o sí-
tio de policlonagem é excisado (Figura 6.9a). Na ligação, na presença de um DNA novo, um
de três eventos pode ocorrer (Figura 6.9b). mídeo pUC8 (t
sua capacida&
(1) DNA novo é inserido. Uma segun
(2) O sítio de policlonagem é reinserido. possui o mestr
(3) O vetor se religa, sem inserção. clonado em M
M13mp9, estar
A inserção de um DNA novo quase que invariavelmente impede a produção de B-galacto- ciamento de D
sidase, de forma que as placas recombinantes são claras em meio ágar com X-gal (Figuá extremidade ú
6.9c). Alternativamente, se o sítio de policlonagem é reinserido, e o M13mp7 original é nova- 6.11d). Somen
mente formado, então ocorrerá a formação de placas azuis. Porém, o que acontecerá se o ve- ciamento; se o
tor se religar, nem com um DNA novo e nem com o sítio de policlonagem inserido? Mais urna será seqüencia
vez, o projeto do sítio de policlonagem entra em ação. Não importa qual o sítio de restrição ção no vetor gi
utilizado, a auto-ligação resulta em um gene lacZ'funcional (Figura 6.9c), originando placas mitirá que a se
azuis. A seleção é, portanto, inequívoca: somente fagos Ml3mpT recombinantes darão origem Outros pan
aplacas claras. semelhantes ac
Uma grande vantagem de M13mp7, com seus sítios de clonagem simétricos, é que o DNA de restrição dil
inserido tanto no sítio de BamHI, SalI ou PsrI pode ser excisado da molécula recombinante
utilizando-se EcoRI (Figura 6.10). Pouquíssimos vetores permitem que um DNA clonado se- Vetores híbl
ja tão facilmente recuperado. Embora os vetr
nes clonados, r
6.2.3 Vetores Ml3 mais complexos to de DNA qur
Os vetores Ml3 mais sofisticados possuem sítios de policlonagem mais complexos inseridos mo o tamanho
no gene lacZ'.lJmexemplo é o Ml3mp8 (Figura 6.11a), o qual é o correspondente do plas- dos. Para soluc

---------15
CLoruncev GÊNrcA E AnÁuse oe DNA 125

(a) Clivagem de Ml3mpz


Ïodo ou parte do sítio de policlonagem
Sítio de policlonagem
EcoRl,
ou Sa/l

/\/ã..
(b) Religação com novos
produtos de DNA passíveis (c) Coloração das placas em meio
Figura 6.8
Construção de 1 Novos insertos de DNA: /'l ágar com X-gal

M13mp7: (a) o sítio \


de policlonagem e tabZ'lnterrompido *Sem p-gal *Placa clara
(b) sua inserção no
sítio de EcoRl de
M13mp2. Note que 2 Sítio de policlonagem reinserido:
os sítios de restrição
para SaÍ são tam- lacz. rcslaurade * B_gal -*Placa azul
bém reconhecidos
por Accl e Hirrcll.

3 Sítio de policlonagem reinserido:


Figura 6.9 *p-gal *placa
lacZ'reslaurado azul
Clonagem com
1[ltl3rnp7 (ver o texto
para detalhes).
SalI, uma parte ou todo o sí-
de um DNA novo, um
mídeo pUCS (p. 119). Assim como no vetor plasmidial, uma vantagem do M13mp8 está na
sua capacidade. de receber fragmentos de DNA com duas extremidades coesivas diferentes.
Uma segunda característica é fornecida pelo vetor gêmeo M13mp9 (Figura 6.1 1b), o qual
possui o mesmo sítio de policlonagem, mas na orientação inversa. Um fragmento de DNA
clonado em M13mp8, se excisado por meio de uma restrição dupla, e, então, inserido em
Ml3mp9, estará, agora, na sua orientação inversa (Figura 6.11c). Isso é importante no seqüen-
a produção de p-galacto- ciamento de DNA (p. 211), durante o qual a seqüência de nucleotídeos é lida a partir de uma
meio ágar com X-gal (Figura extremidade do sítio de policlonagem para o interior do fragmento de DNA inserido (Figura
e o M13mp7 original é nova- 6.11d). Somente cerca de 600 nucleotídeos podem ser lidos em um experimento de seqüen-
ím, o que acontecerá se o ve- ciamento; se o DNA inserido é mais longo que isso, uma das extremidades do fragmento não
iclonasem inserido? Mais uma será seqüenciada. Uma alternativa é virar o fragmento ao contriírio, por sua excisão e reinser-
qual o sítio de restrição ção no vetor gêmeo. Um experimento de seqüenciamento de DNA com esse novo clone per-
6.9c), originando placas mitirá que a seqüência de nucleotídeos da outra extremidade do fragmento seja determinada.
'7
recombinantes darão origem Outros pares de vetores M13 também estão disponíveis. Ml3mp10/l 1 e M13mp18/19 são
semelhantes ao M13mp8/9, mas possuem sítios de policlonagem diferentes e, portanto, sítios
simétricos,équeoDNA de restrição diferentes.
da molécula recombinante
que um DNA clonado se- Vetores híbridos plasmídeo-M1 3
Embora os vetores M13 sejam muito úteis para a produção de versões de fita simples dos ge-
nes clonados, eles têm uma desvantagem. Existe uma limitação prÌra o tamanho do fragmen-
to de DNA que pode ser clonado em um vetor M13, com 1.500 pb, em geral, sendo tido co-
mais complexos inseridos mo o tamanho máximo, embora fragmentos de até 3 kb tenham sido ocasionalmente clona-
é o correspondente do plas- dos. Para solucionar esse problema, inúmeros vetores novos (fagomídeos, do inglês phage-
126 T.A.Bnowru

,^"-ü^
Extremidades de
Sau3A (GATC)
Clivagem com BamHl
(extremidades GATC)

Ligação, 1 Sítios de BamHl não


clonagem são restaurados

t/,,4t\, \
2 M13 possui muitos
\ sítios oara SauSA
/ Fragmento de \
i Satt3A \

/ \ a,,u"n"m com EcoRt

I \<*í
3 Portanto, recuperação
do fragmento por clivagem /\
com EcoRl
Figura 6.10
Recuperação de um DNA
Extremidades clonado a partir de uma

9\ clivagem oo u",o.
coesivas
de EcoRl
molécula de M13mp7 re-
combinante por meio da
,/ \ clivagem dos sítios mais
externos do sítio de poli-
clonagem.

mids) forandesenvolvidos pela combinação de uma paÍe do genoma de M13 com o DNA do
plasmídeo.
Um exemplo é fornecido pelo pEMBL8 (Figura 6.12a), construído pela transferência pa-
ra pUCS de um fragmento de 1.300 pb do genoma de Ml3. Esse pedaço de DNA de Ml3 con-
tém a seqüência-sinal reconhecida pelas enzimas que convertem a molécula de Ml3 de fita
dupla normal em DNA de fita simples, antes da secreção de novas partículas de fago. Essa se-
qüência-sinal ainda é funcional, mesmo que separada do restante do genoma de Ml3, de for-
ma que moléculas de pEMBLS são também convertidas em DNA de fita simples e secretadas
como partículas de fago defectivas (Figura 6.12b). É necessário qïe as células de E coli lti- Figura 6.11
lizadas como hospedeiras em um experimento de clonagem co{rì pEMBL8 sejam subseqüen- ll13mp8 e M13mpg.
temente infectadas com um M13 normal para atuar como um fago auxiliar (do inglês helper
phage), fornecendo as enzimas replicativas necessárias e as proteínas do capsídeo do fago. O
pEMBL8, sendo derivado de pUC8, possui os sítios de policlonagem no interior do gene
lacZ' , de forma que placas recombinantes podem ser identificadas da maneira padrão em meio
ágar contendo X-gal. Com pEMBLS, versões de fita simples dos fragmentos de DNA clona-
dos de até 10 kb de tamanho podem ser obtidas, aumentando significativamente a amplitude
do sistema de clonagem de M13.

ì-

Li

L.
Crorueeera GÊrurcr e ANÁLtsE oe DNA 127

(a) O sítio de policlonagem de M13mp8/9

AAT TCCCGGGGATCCGTCGACCTGCAGCC A
cGGòôóò in òccÀôc ieoÀcôióèe i rcon
I

EcoRl Smal Sa/l Hindlll


Xmal Accl
Hincll
(b) A orientação do sítio de policlonagem

aHindlll Hindl
,_ff<.''"t
EcoRl . EcoRl
-

-y_,rÈ
(c)TransÍerência de DNA de M13mp8 para M13mpg

EcoRl Hind|,t Hindtlt


Hindlll
I

d
n
N
R
h1
Figura 6.10 Clivagem t{ Ligação
n
Recuperação de um DNA P
I

clonado a partir de uma EcoRl


molécula de M13mp7 re-
combinante por meio da
(d) Seqüenciamento de DNA utilizando M13mp8 e Ml3mp9
clivagem dos sítios mais
eÍernos do sítio de poli-
clonagem.

de Ml3 com o DNA do


,/
Fsl
M13mpB \
*-.-/,r'

recombinante
Sequência de DNA

,R recombinante

ído pela transferência pa-


de DNA de Ml3 con-
a molécula de M13 de fita
partículas de fago. Essa se-
do genoma de M13, de for-
de fita simples e secretadas
que as células de E coliuti-
pEMBLS sejam subseqüen-
auxiliar (do inglês helper
do capsídeo do fago. O
m no interior do gene
da maneira padrão em meio
fragmentos de DNA clona-
ificativamente a amplitude
128 T. A. Bnowlr

6.3 Vetores d
Dois proble
(a) pEMBLS
pudessem s

Fragmento de DNA
de M13
(1) Amol
preseÍ
maior
3.997 pb partícr
ampR um fn
Agrupamento de sítios gura 6
(ver Figura 6.4a)
(2) O gen
mento
lizada
de um
(b) Conversão de pEMBLB em DNA de Íita simples
muito
Região de Ml3 zz>, Proheína de rePlicação
6.13U
@ aeïtns
A proteína de M13
replica pEMBLS em
DNA de fita simples

pEMBLS de fita dupla

Figura 6.11
,Í!s dois problemas qu
/\
tt llreram que ser resoM
\./ üs antes que os veto
\__./ rcs de clonagem de,

/ ^ \/ \
Fdessem ser desen
rolvidos. (a) A limita
\. / \_/ ção do tamanho esta
Moléculas de pEMBLS bebdda pelo genom
de fita simples ,üL, devido à necessi
dade de empacotá-l
Figura 6.12 m interior da cabeç
pEMBLS: um vetor hí- üÍago. (b) O DNAd
brido plasmídeo-M13 L possui múltiplos si
Partículas de "fago"
de pEMBLB
que pode ser convertF de reconhecimentt
do em DNA de Íita paÍa quase todas a
simples. de res
trição

F
ì
CrorunGeu GÊrurcn e ANÁLtsE oe DNA 129

Vetores de clonagem baseados no bacterióÍago À

Dois problemas tiveram de ser solucionados antes que os vetores de clonagem baseados em l,
pudessem se desenvolver:

(1) A molócula de DNA de l, pode ser aumentada em tamanho em somente cerca de 5vo,rc-
presentando a adição de apenas 3 kb de DNA novo. Se o tamanho total da molécula for
maior que 52 kb, ela não poderá ser empacotada dentro da estrutura da cabeça de l, e
partículas de fago infectivas não serão formadas. Isso limita severamente o tamanho de
um fragmento de DNA que pode ser inserido em um vetor l, que não foi modificado (Fi-
gura 6.13a).
(2) o genoma de l, é tão grande que ele possui mais do que uma seqüência de reconheci-
mento para virtualmente cada endonuclease de restrição. A restrição não poderia ser uti-
lizadapara clivar a molécula de l" normal em uma forma que ela iria permitir a inserção
de um DNA novo, pois a molécula seria clivada em vários pedaços pequenos, os quais,
muito improvavelmente, iriam restaurar um genoma de l, viável após religação (Figura
6.1 3b).

(a) A limitação de tamanho

Genoma normal de l" Possível recombinante


49 kb >52kb
\
t\
I Novo DNA > 3 kb
I +

X
Figura 6.13 Muito grande para
ser empacotado
dois problemas que
que ser resolvi- ?
Empacotamento
antes que os veto-
ms de clonagem de l,
pdessem ser desen-
(b) Múltiplos sítios de restrição
rolvidos. (a) A limita-
@ do tamanho esta-
Hecida pelo genoma , 1 ,2,3,4,5,6, EcoRl
1" devido à necessi-
dade de empacotá-lo
Figura 6.12
pEMBLS: um vetor hÊ
brido plasmídeo-M13
nn interior da cabeça
bfago. (b) O DNA de
fl, possui múltiplos sÊ
k*,
que pode ser converti-
de reconhecimento ' PU g Retisação Mistura complexa
do em DNA de Íita para quase todas as
simples. Cl É! de moléculas
de res- tgt
trição.

F
uul(-lalttçs, rur )urPtççlluçlltç quç ur[41 allllPla valt h,m
clonagem de l, se desenvolvesse, com sua utilização principal sendo a clonagem de grandes suíam <

pedaços de DNA, desde 5 a25kb, muito extensos pÍÌra manipulação em vetores plasmidiais
ção de
ou Ml3. DNA d
poucas
6.3.1 Segmentos do genoma de )', podem ser deletados sem preiuízos a tios par
sua viabilidade eventua
ra EcoI
A maneira que impulsionou o desenvolvimento dos vetores de clonagem de l, foi fornecida
pela descoberta de que um grande segmento na região central da molécula de DNA de l, po-
de ser removido sem prejudicar a capacidade do fago de infectar células de E. coli. A remo-
ô3.3 Vetorer
ção de toda ou de parte dessa região não-essencial, entre as posições 20 e35 do mapa mostra- Uma ve
do na Figura 2.9, diminui o tamanho da molécula de l, resultante para até cerca de 15 kb. Is- plos síti
so significa que até 18 kb de um DNA novo podem agora ser adicionados, antes que o ponto diferent
de clivagem para o empacotamento seja alcançado (Figura 6.14). a serem
A região "não-essencial" de fato contém a maioria dos genes envolvidos na integração e
excisão do profago de l, do cromossomo de E. coli. Um genoma de l, deletado é, portanto"
não-lisogênico e pode seguir somente o ciclo lítico de infecção. Isso é, por si só, desejável pa.
ra um vetor de clonagem, uma vez que a indução não é necessária antes que as placas sejern
formadas (p. 58).

E.
o.EO.Eó
:O2EE
oooc$ ì(ú
H,B g
O r(ú È
fi g€
rrú
Figura 6.14
Componentes
docapsídeo b2
gE
E6i E .E Et @ Í.
E
O mapa genético de 1", mostrando a po-
sição da região não-essencial que pode
= ser deletada sem prejuízos à capacida&
do Íago de seguir o ciclo lítico de infec-
ção.

6.3.2 A seleção natural pode ser utilizada para o isolamento de l,


modiÍicados que não possuem determinados sítios de restrição
Mesmo um genoma de À deletado, com a sua região não-essencial removida, possui múlt
sítios de reconhecimento para a maioria das endonucleases de restrição. Trata-se de um
blema freqüentemente encontrado quando um vetor novo está sendo desenvolvido. Se
te um ou dois sítios necessitam ser removidos, então atécniea de mutagênese in vitro (p.
pode ser utilizada. Por exemplo, um sítio para EcoRI, GAATTC, poderia ser modificado Figura 6.15
ra GGAITC, que não é reconhecido pela enzima. No entanto, a mutagênese invitro estaya iülzando-se a se-
sua infância quando os primeiros vetores de l, se desenvolveram, e, mesmo nos dias de llftão natural para
ela não seria uma maneira eficiente para a modificação de mais que uns poucos sítios em to de fa-
única molécula. l" que não pos-
sítios de res-
ütiiPo Para EcoRl.
Cloruncev GÊrurcn e AnÁuse oe DNA 131

variedade de vetores dc Em vez disso, a seleção natural foi utilizada paÍa fornecer linhagens de l" que não pos-
sendo a clonagem de grandes suíam os sítios indesejados. A seleção natural pode ser posta em funcionamento pela unliza-
em vetores plasmidiais
ção de uma linhagem hospedeira de E. coli que produz EcoRI. A maioria das moléculas de
DNA de À que invadem a célula é destruída por essa endonuclease de restrição, mas umas
poucas irão resistir e produzirão placas. Esses serão fagos mutantes, nos quais um ou mais sí-
sem preiuízos a tiospara EcoRI foram espontaneamente perdidos (Figura 6.15). Viírios ciclos de infecção irão,
eventualmente, resultar em moléculas de À que não possuem todos ou a maioria dos sítios pa-
clonagem de À foi fornecida ra EcoRI.

molécula de DNA de À po-


células de E. coli. A remo-
83,3 Vetores de inserção e substituição
20 e35 do mapa mostra- Uma vez que os problemas apresentados pela dificuldade de empacotamento e pelos múlti-
paraaté cerca de 15 kb. Is- plos sítios de restrição foram resolvidos, o caminho estava aberto para o desenvolvimento de
antes que o ponto diferentes tipos de vetores de clonagem baseados em 1,. As primeiras duas classes de vetores
a serem produzidas foram os vetores de l, de inserção e de substituição (ou troca).
envolvidos na integração e
de À deletado é, poÍanto,
lsso é, por si só, desejável pa-
ia antes que as placas sejam
5 sítios para EcoRl

,..-t '4ll\DNA de l, normat


I ttlll

Ç
r
\
\
de 1,, mostrando a po- infecção de células de E.coli
produtoras de EcoRl
ião não-essencial que pode
sem prejuízos à capacidade Placa formada
seguir o ciclo lítico de inÍec- Por fago mutante Somente 3 sítios

"..-JÏ:T'
de ?u Muito poucas placas

sítios de restrição
removida, possui múltiplos Repetição da inÍecção
com o fago mutante
e restrição. Trata-se de um pro-
sendo desenvolvido. Se somen-
de mutagênese invitro (p.244)
Sem sítios
, poderia ser modificado pa- Figura 6.15 oara Eco9l
a mutagênese invitro estava na llliNizando-se a se-
rt' t

, e, mesmo nos dias de hoje, leção natural para Segupda linhagem


Mais algumas
que uns poucos sítios em uma oisolamento de fa- de fago mutante
placas
gm l, que não pos-
sram sítios de res-

t--
üião para EcoRl.

I
132 ï A. Bnowlr

Vetores de inserção dess:


Em um vetor de inserção (Figura 6.16a), um fragmento grande da região não-essencial foi re- fer, d
movido e os dois braços ligados um ao outro. Um vetor de inserção possui ao menos um úni- dem
co sítio de restrição, dentro do qual um DNA novo pode ser inserido. O tamanho do fragmen- nho.
to de DNA que um vetor individualmente pode carrear dependerá, é claro, da extensão da de- . l,GE
leção de sua região não-essencial. Dois vetores de inserção populares são: kb (p
liclor
l,gt10 (Figura 6.16b), que pode caffear até cerca de 8 kb de um DNA novo, inserido em most
um único sítio de EcoRI, localizado no interior do gene cI. A inativação por inserção mais
desse gene resulta em recombinantes que são distinguidos como placas claras, emvez NNh
de placas turvas (p. 109). menl
LZ^PI (Figura 6.16c), com o qual inserções de até 10 kb de DNA no interior de qual- tanto
quer um dos seis sítios de restrição dentro do sítio de policlonagem irão inativar o gene que (
lacZ'presente no vetor. Os recombinantes originam placas claras, em vez de placas po st
azuis, em meio ágar com X-gal.
6.3.4 Experime
Vetores de substituição ou substi
Um vetor de ì, de substituição possui dois sítios de reconhecimento para a endonuclease de
Um experi
restrição utilizada para a clonagem. Tais sítios flanqueiam um segmento de DNA que é subs-
um vetor F
tituído pelo DNA a ser clonado (Figura 6.I7a). Freqüentemente, o fragmento substituível (ou
ligada e as
fragmento stuffer, no jargão de clonagem) carrega sítios de restrição adicionais que podem
ser utilizados para clivá-lo em pedaços pequenos, de forma que a sua própria reinserção du-
rante um experimento de clonagem é bastante improvável. Os vetores de substituição são, em
geral, projetados para carïear pedaços de DNA maiores do que os que os vetores de inserção
podem suportar. A seleção dos recombinantes é, freqüentemente, com base no tamanho, uma
vez que os vetores não-recombinantes são muito pequenos pÍÌra serem empacotados nas cabe-
ças do fago (p. 109).
Dois velores de substituição populares são:

ÀEMBL4 (Figura 6.17b), que pode carrear até20kb de DNA inserido pela substituição
de um segmento flanqueado por pÍÌres dos sítios de EcoRI, BamHIe SalI (qualquer uma

(a) Construção de um vetor de l, de inserção

clivagem'
DNA de À normat (49 kb) rigação yï1,.',::rà"
Figura 6.17
- |* (35-40kb) tlfrfiores de À de
Região nôstituição. (a)
não-essencial
lDbnagem com
um vetor de l,
ü zubstituição.
Figura 6.16 {b) Clonagem
(b) l.sr10 (c) rzAPil Vetores de l, de inser- oom i.EMBL4.
ção. P = sítio de poli- (c) A estrutura
clonagem no gene de },GEM11,

LTrj-+oxo ' 7à '-\ '41 kb


lacZ'de l.ZAPll, con-
tendo sítios de restri-
mmnslrando a or-
ffirn dos sítios
Deleção lacZ' ção únicos para Sad, ürestrição nos
Deleção dcÍs sítios de
Notl, Xbal, Spel, Eco
Rle Xhol. policlonagem.

b
b
t
i
===: È-r
Cr-oueerv GÊNtcA E ANÁLlsE oe DNA 133

dessas três endonucleases de restrição pode ser utilizadapararemover o fragmento stuf-


po-
não-essencial foi re-
fer, deforma que fragmentos de DNA com uma vaÍiedade de extremidades coesivas
dem ser clonados). A seleção dos recombinantes de ì"EMBL4 pode basear-se no tama-
possui ao menos um úni-
nho, ou pode utilizar o genótipo Spi (p. 109).
O tamanho do fragmen-
2,,GEM11 e ?r,GEM12 (Figura 6.1'7c), cada um dos quais possui uma capacidade de 23
É claro, da extensão da de-
kb (próxima ao máximo teórico), com o fragmento stuffer flanqueado por sítios de po-
sao:
liclonagem que contêm sete sítios de restrição diferentes. Os sítios de policlonagem
mostram-Se levemente diferenteS nesses dois vetores, mas' em ambos os casos, os sítios
DNA novo, inserido em
mais externos são para a enzima de restrição S7ïI, a qual reconhece a seqüência GGCC-
{ inativação Por inserção
NNNNNGGCC. Essa seqüência é muito rara e improvável de estar presente no frag-
placas claras, em vez
mento de DNA que foi clonado. A restrição do vetor recombinante com SfI pode, por-
rcLìüno

tanto, ser utilizada para excisar o fragmento clonado, com uma grande probabilidade de
DNA no interior de qual- que o fragmento seja recuperado intacto. Como com }"EMBL4, o tamanho ou o fenóti-
irão inativar o gene
po Spi podem ser utilizados para a seleção dos recombìnantes'
claras, emYez de Placas
n3.4 Experimentos de clonagem com vetores de ?r, de inserção
ou substituição
para a endonuclease de Um experimento de clonagem com um vetor de l" pode seguir as mesmas etapas como com
de DNA que é subs- um vetãr plasrnidial - as moléculas de ì" são clivadas, o DNA novo é adicionado, a mistura é
o fngmento substituível (ou ligada e as moléculas resultantes utilizadas para transfectar uma linhagem de E. coli hospe-
!ão adicionais que Podem
a sua própria reinserção du-
de substituição são, em
os que os vetores de inserção
com base no tamanho. uma
(a) Clonagem com um vetor de I de substituição

empacotados nas cabe- Clivagem,


ligação
t------T-------rJ I v77V77' I

inserido pela substituição


BamHIe SalI (qualquer uma
(b) ).EMBL4
L--Y,J

Fragmento
stuffer z \
DNA novo

EcoRl, BamHl,
Sa/l ou uma
r ffi___)
combinação \\
RBS SBR DNA novo,
Figura 6.17
R = EcoRl de até 23 kb
ffiores de ), de
urbstituição. (a) B= BamHl
0onagem com S = Sail
un vetor de l. (c) }"GEMI1
üsubstituição.
Figura 6.16 {b) Clonagem
Vetores de l, de inser- oom ÀEMBL4.
Ção. P = sítio de Poli-
[p) A estrutura
clonagem no gene de ÀGEM11,
Í
IacZ'de l,ZAPll, con- nmtrando a or- SfiI - Sacl - Xhol - Bam\l - Avrll- EcoRl
lb tendo sítios de restri- ffin dos sítios "rr\
restrição nos - - Avrl Bamïl - Xhol Sacl- Sfll
ção únicos Para Sac{, Xbal Eco?l
bçao Notl, Xbal, Spel, Eco dois sítios de
policlonagem.
Rle Xhol.

b
I %:
.:
134 T. A. Bnowr.r

deira competente (Figura 6.18a). Esse tipo de experimento necessita que o vetor esteja na sua 6.3.5 Fragmentc
forma circular, com os sítios cos ligados entre si por meio de pontes de hidrogênio. utilizande
Embora bastante satisfatório para muitos propósitos, um procedimento baseado em trans-
O último e o
fecção não é particularmente eficiente. Um número mais elevado de recombinantes será obti-
entre uma Ín
do se um ou dois refinamentos forem introduzidos. O primeiro é auttlização da forma linear
trada no fato
do vetor. Quando a forma linear do vetor é digerida com a endonuclease de restrição apropria-
da, os braços direito e esquerdo são liberados como fragmentos separados. Uma molécula re-
protéico do f
ootamento ra
combinante pode ser construída misturando-se o DNA a ser clonado com os braços do vetor
(Figura 6. 1 Sb). A ligação resulta em vários rearranjos moleculares, incluindo catenanos cons- lécula que cr
Um cosu
tituídos de braço esquerdo-DNA-braço direito, repetidos muitas vezes (Figura 6.18b). Se o
também nect
DNA inserido possui o tamanho correto, então os sítios cos, que separam essas estruturas, es-
tarão a uma distância correta um do outro para o empacotamenÍo in vitro (p. 101). Os fagos
recombinantes são, portanto, produzidos em um tubo de ensaio e podem ser utilizados para
infectar uma cultura de E. coli. Essa estratégia, em especial a utilização do empacotamento ln
vitro, restlta em um grande número de placas recombinantes.

(a) Clonagem com um DNA de I circular

( );* (
./---\
/\
\cos'
\__-/
/
."o*, U

\cos
À_-_-
'Fr*"
,.---.---',:!coat

/
DNA

Vetor de l. de inserção - / Molécula recombinante


forma circular Transfecção de E. coti

(b) Clonagem com um DNA de l" linear


Ligação cos Figura 6.18
e*t^tÊ"*" '..--%_q DiÍerentes estraté-
,orflEcoeì gias de clonagem

i^\
d" N
com um vetor de 1".
Braços
ô^ \, (a) Utilizando-se a
@.."nF{\
Íorma circular de l.
,ra'%," como um plasmÊ
DNA
novo deo. (b) Utilizando-
a se os braços es-

? ? ?-------
recombinantes ll=
J querdo e direito do
genoma de 1,, além Figura 6.19
,/ //L I do empacotamento ülm cosmídeo típico
./ Mistura do empacotamenlo in vitro in vitro, para a ob-
tenção de um nú-
ea maneira como
lnfecção de E. coli dts é utilizado para
mero maior de pla- ndonagem de Írag-
cas recombinantes. rmttos de DNA lon-
gos.

t
Ï
Ct-ouoeu GÊrurcn e ANÁLtsE oe DNA 135

que o vetor esteja na sua 53.5 Fragmentos muito grandes de DNA podem ser clonados
de hidrogênio. utilizando-se um cosmídeo
imento baseado em trans-
recombinantes será obti- O último e o mais sofisticado tipo de vetor baseado em l" é o cosmídeo, o qual é um híbrido
a utilizaçfie da forma linear entre uma molécula de DNA de fago e uma de plasmídeo bacteriano, com sua estratégia cen-
de restrição apropria- trada no fato de que enzimas que empacotam a molécula de DNA de l, dentro do capsídeo
Uma molécula re- protéico do fago necessitam somente dos sítios cos parafuncionar (p. 3a).4 reação de empa-
com os braços do vetor Gotamento in vitro funciona não somente com genomas de 1,, mas também com qualquer mo-
incluindo catenanos cons- lécula que cilïegue sítios cos separados por um DNA de 37 a 52kb.
vezes (Figura 6.18b). Se o Um cosmídeo é basicamente um plasmídeo que caÍrega um sítio cos (Figura 6.19a). Ele
essas estruturas, es- também necessita de uma marca de seleção, tal como o gene que confere resistência à ampi-
in vitro (p. 101). Os fagos
e podem ser utilizados para
do empacotamento in
(a) Um cosmídeo típico
BamHl

(b) Clonagem com pJBB


BamHl

Clivagem BamHl BamHl


I a
com BamHl
cos ampH
-=l
lo-t

la-l
pJBB linear
pJBB circular -
/ Bam*r BamHr

Figura 6.18
DiÍerentes estraté-
u:rn, /--=-
gias de clonagem DNA novo
com um vetor de 1". (r^"
(a) Utilizando-se a "r,
Íorma circular de l"
como um plasmÊ Empacotamento / "*-
deo. (b) Utilizando-
se os braços es-
querdo e direito do
genoma de À, além
invitro
3:l#:.ï15 ç??
,2" 'h-%
do empacotamento
Figura 6.19
lllin cosmídeo típico
Partícuraso"'\
in vitro, para a ob- e a maneira como ::J:i::;$:ïJs3[:lïil;:.,",
tenção de um nú- de é utilizado para
lnfecção de E. coli -t--__
/ I
mero maior de pla- sdonagem de Írag- U ,

cas recombinantes. fiEíìtos de DNA lon- Meio com ampicilina


gos.

:==1.*iryrr
136 T. A. Bnowrrr

cilina, além de uma origem de replicação plasmidial, rmayezque os cosmídeos não &zironrÍn
todos os genes de À e, portanto, não produzem placas. Ao contriírio, colônias são &procuraú
meio seletivo, exatamente como com um vetor plasmidial. [ma soh
um experimento de clonagem com um cosmídeo é realizado como segue (Figura 6.1 insertos de I
O cosmídeo ó aberto em seu único sítio de restrição e novos fragmentos de DNA são in dos nos cror
dos. Tais fragmentos são normalmente produzidos pela digestão parcìa7 com uma endonucl* somes), os q
se de restrição, uma vez que a digestão total quase que invariavelmente resulta em fragmen- lativamente
tos que são muito pequenos para serem clonados em um cosmídeo. A ligação érealizadade plasmidiais
forma que os catenanos são formados. Com a condição de que o inserto de DNA possua o ta- reduzindo o
manho correto, o empacotamenÍo in vitro cliva os sítios cos e coloca os cosmídeos recombi- tros vetores
nantes dentro das partículas de fago maduras. Esses fagos À são, então, utilizados para infec- vantagem. e
tar uma cultura de E. coli, apesar, é claro, de que placas não serão formadas. Em vez disso, as de capsídeo
células infectadas são plaqueadas em um meio seletivo e colônias resistentes ao antibiótico clonar fragr
irão aparecer. Todas as colônias serão recombinantes, já que cosmídeos lineares não-recom- nam as cara
binantes são muito pequenos para serem empacotados dentro das cabeças de À. dos de Pl (
dade de até

6.4 Àe outros vetores de alta capacidade permitem que


bibliotecas genômicas sejam construídas 6.5 Vetores p

O principal uso de todos os vetores baseados em À é a clonagem de fragmentos de DNA mui- Vetores de r

to grandes piìra serem suportados por vetores plasmidiais ou M13. Um vetor de substituição, incluindo S
tal como ÀEMBL4, pode carrear até20kb de DNA novo, enquanto alguns cosmídeos podem plasmídeos
sustentar fragmentos de até 40 kb. Isso confronta com o tamanho máximo do inserto de cerca pla faixa dr
de 8 kb para a maioria dos plasmídeos e menor do que 3 kb para os vetores Ml3. Uns poucos
A capacidade para clonar fragmentos de DNA tão extensos significa que bibliotecas ge- ses vetores r

nômicas podem ser produzidas. Uma biblioteca genômica é um conjunto de clones recombi- lizações.
nantes que contém todo o DNA presente em um organismo individual. Uma biblioteca genô-
mica de E. coli, por exemplo, contém todos os genes de E. coli, de forma que qualquer gene
desejado pode ser retirado da biblioteca e estudado. Bibliotecas genômicas podem ser manti-
das por muitos anos, além de multiplicadas, de maneira que cópias podem ser enviadas de um Tabela 6.1
grupo de pesquisa para outro. organismos
A grande questão é quantos clones são necessários para uma biblioteca genômica? A res-
posta pode ser calculada com a fórmula:

ln(l- p)
r"ír-9ì Espécies
\ b)
E. coli
na qual Né
o número de clones que são necessários, P é a probabilidade de um gene qualquer
Saccharom,
estarpresente, a é o tamanho médio dos fragmentos deDNA inseridos no vetor, ebéotama-
nho total do genoma. A Tabela 6.1 mostra o número de clones necessário para bibliotecas ge- Drosophila
nômicas em uma variedade de organismos, construídas utilizandtr um vetor de substituição de Anoz
l" ou um cosmídeo. Homem
Não é, de forma alguma, impossível obterem-se várias centenas de milhares de clones, e
Sapo
os métodos utilizados para identificar um clone carregando um gene desejado (Capítulo 8) po-
dem ser adaptados para lidar com números tão grandes, de maneira que bibliotecas genômi- " Calculado p
cas çom esses tamanhos não são, em absoluto, impraticáveis. No entanto, maneiras para se re- 'Fragmenros
'Fragmentos

t
l
CLoruneev GÊucn e ANÁLrsE oe DNA 137

os cosmídeos não possuem duzir o número de clones necessário para uma biblioteca genômica estão continuamente sen-
colônias são formadas em do procuradas.
Uma solução está no desenvolvimento de novos vetores de clonagem, capazes de suportar
como segue (Figura 6.19b). insertos de DNA longos. Durante os últimos anos, os progressos nessa área foram centraliza-
de DNA são inseri- dos nos cromossomos artificiais bacterianos (BACs, do inglês bacterial artificial chromo-
ial com uma endonuclea- somes), os quais são vetores modernos baseados no plasmídeo F (p. 29). O plasmídeo F é re-
resulta em fragmen- lativamente grande e os vetores dele derivados têm uma capacidade maior do que os vetores
. A ligação é realizada de plasmidiais normais. Os BACs podem sustentar insertos de DNA de até 300 kb de tamanho,
inserto de DNA possua o ta- reduzindo o tamanho de uma biblioteca genômica humana para somente 30.000 clones. Ou-
os cosmídeos recombi- tros vetores de alta capacidade foram construídos a partir do bacteriófago Pl, o qual possui a
então, utilizados para infec- vantagem, em relação a À, de ser capaz de comprimir 110 kb de DNA dentro da sua estrutura
formadas. Em vez disso, as de capsídeo. Vetores do tipo cosmídeos, baseados em P1, foram projetados e utilizados para
ias resistentes ao antibiótico clonar fragmentos de DNA variando em tamanho desde 15 até I00 kb. Os vetores que combi-
ídeos lineares não-recom- nam as características de vetores de Pl e BACs, chamados cromossomos artificiais deriva-
cabeças de 1". dos de Pl (PACs, do inglês PI-derived artificial chromosomes), também possuem a capaci-
dade de até 300 kb.

6.5 Vetores para outras bactérias


Vetores de clonagem também foram desenvolvidos para várias outras espécies de bactérias,
fragmentos de DNA mui-
. {Jm vetor de substituição, incluindo Streptomyces, Bacillus e Pseudomonas. Alguns desses vetore\ são baseados em
alguns cosmídeos podem plasmídeos específicos para o organismo hospedeiro, enquanto outros são iriasmídeos de am-
máximo do inserto de cerca pla faixa de hospedeiro, capazes de replicar em uma variedade de hospedeiros bacterianos.
os vetores Ml3. Uns poucos são derivados de bacteriófagos específicos para esses organismos. A maioria des-
ignifica que bibliotecas ge. ses vetores é muito semelhante aos vetores de E. coli em termos de objetivos gerais e de uti-

conjunto de clones recombi- lizações.


idual. Uma biblioteca genG
d,e forma que qualquer gene
genômicas podem ser manti-
podem ser enviadas de um Tabela 6.L Número de clones necessário para bibliotecas genômicas em uma variedade de
organismos
biblioteca genômica? A res-
Número de clones'

Tamanho do Fragmentos Fragmentos


Espécies genoma (pb) de 17 kbà de 3-5 kb'

E. coli 4,6 x IO6 820 4to


idade de um gene qualquer
S accharomy c e s ce rev isiae 1,8 x 107 3.225 1.500
idos no vetor, e b é o Íama-
ssário para bibliotecas ge- Dros ophila me lanogaster 1,2x 108 21.500 10.000
um vetor de substituição de Arroz 5,7x 108 100.000 49.000
Homem 3,2x l}e 564.000 274.000
de milhares de clones, e x
Sapo 2,3 l01o 4.053.000 1.969.000
desejado (Capítulo 8 I po-
a que bibliotecas genômi- " Calculado para uma probabilidade (P) de 957o de que um gene qualquer estará presente na biblioteca.
entanto, maneiras paÍa se re- 'Fragmentos adequados paÍa um vetor de substituição, tal como }"EMBL4.
'Fragmentos adequados para um cosmídeo.

t
CLoruneev GÊucn e ANÁLrsE oe DNA 137

os cosmídeos não possuem duzir o número de clones necessário para uma biblioteca genômica estão continuamente sen-
colônias são formadas em do procuradas.
Uma solução está no desenvolvimento de novos vetores de clonagem, capazes de suportar
como segue (Figura 6.19b). insertos de DNA longos. Durante os últimos anos, os progressos nessa área foram centraliza-
de DNA são inseri- dos nos cromossomos artificiais bacterianos (BACs, do inglês bacterial artificial chromo-
ial com uma endonuclea- somes), os quais são vetores modernos baseados no plasmídeo F (p. 29). O plasmídeo F é re-
resulta em fragmen- lativamente grande e os vetores dele derivados têm uma capacidade maior do que os vetores
. A ligação é realizada de plasmidiais normais. Os BACs podem sustentar insertos de DNA de até 300 kb de tamanho,
inserto de DNA possua o ta- reduzindo o tamanho de uma biblioteca genômica humana para somente 30.000 clones. Ou-
os cosmídeos recombi- tros vetores de alta capacidade foram construídos a partir do bacteriófago Pl, o qual possui a
então, utilizados para infec- vantagem, em relação a À, de ser capaz de comprimir 110 kb de DNA dentro da sua estrutura
formadas. Em vez disso, as de capsídeo. Vetores do tipo cosmídeos, baseados em P1, foram projetados e utilizados para
ias resistentes ao antibiótico clonar fragmentos de DNA variando em tamanho desde 15 até I00 kb. Os vetores que combi-
ídeos lineares não-recom- nam as características de vetores de Pl e BACs, chamados cromossomos artificiais deriva-
cabeças de 1". dos de Pl (PACs, do inglês PI-derived artificial chromosomes), também possuem a capaci-
dade de até 300 kb.

6.5 Vetores para outras bactérias


Vetores de clonagem também foram desenvolvidos para várias outras espécies de bactérias,
fragmentos de DNA mui-
. {Jm vetor de substituição, incluindo Streptomyces, Bacillus e Pseudomonas. Alguns desses vetore\ são baseados em
alguns cosmídeos podem plasmídeos específicos para o organismo hospedeiro, enquanto outros são iriasmídeos de am-
máximo do inserto de cerca pla faixa de hospedeiro, capazes de replicar em uma variedade de hospedeiros bacterianos.
os vetores Ml3. Uns poucos são derivados de bacteriófagos específicos para esses organismos. A maioria des-
ignifica que bibliotecas ge. ses vetores é muito semelhante aos vetores de E. coli em termos de objetivos gerais e de uti-

conjunto de clones recombi- lizações.


idual. Uma biblioteca genG
d,e forma que qualquer gene
genômicas podem ser manti-
podem ser enviadas de um Tabela 6.L Número de clones necessário para bibliotecas genômicas em uma variedade de
organismos
biblioteca genômica? A res-
Número de clones'

Tamanho do Fragmentos Fragmentos


Espécies genoma (pb) de 17 kbà de 3-5 kb'

E. coli 4,6 x IO6 820 4to


idade de um gene qualquer
S accharomy c e s ce rev isiae 1,8 x 107 3.225 1.500
idos no vetor, e b é o Íama-
ssário para bibliotecas ge- Dros ophila me lanogaster 1,2x 108 21.500 10.000
um vetor de substituição de Arroz 5,7x 108 100.000 49.000
Homem 3,2x l}e 564.000 274.000
de milhares de clones, e x
Sapo 2,3 l01o 4.053.000 1.969.000
desejado (Capítulo 8 I po-
a que bibliotecas genômi- " Calculado para uma probabilidade (P) de 957o de que um gene qualquer estará presente na biblioteca.
entanto, maneiras paÍa se re- 'Fragmentos adequados paÍa um vetor de substituição, tal como }"EMBL4.
'Fragmentos adequados para um cosmídeo.

t
a Cnpíruto 7
ion of new cloning vectors. IL

is packageable in vitro in
Vetores de Clonagem para Eucariotos
75.4242-6.
plasmids. Nucleic Acids

vectors carrying polylinker

propagation of large human

t 1984) Efïtctent in vitro


ning a bacteriophage SP6
clonado em um plasmídeo do

in single-stranded
-78. [Vetores Ml3.]
300 kilobase-pair fragments of
the National Academy of Sc

and recoveru of DNA


Sciences of the USA, 87,103-7-
Yectors and host strains: Vetores para leveduras e outros Íìngos, I 39 Vetores defuríagem para animais, 157
Vetores de clonagem para pìantas superiores, 148

A maioria dos experimentos de clonagem é realizada tendo como organismo hospedeiro E


coli, e a maior variedade dos vetores de clonagem que está disponível é para esse organismo.
A E. coli é particularmente popular quando o objetivo do experimento de clonagem é estudar
as caracteísticas básicas da biologia molecular, tais como a estrutura e a função do gene. No
entanto, sob certas circunstâncias, pode se tornar desejável autilização de um hospedeiro di-
ferente para um experimento de clonagem. Isso é especialmente verdadeiro em biotecnologia
(Capítulo 13), na qual o objetivo pode não ser o estudo de um gene, mas a utilização da clo-
nagem para controlar ou melhorar a síntese de um produto metabólico importante (por exem-
plo, um hormônio, tal como a insulina) ou para modificar as propriedades de um organismo
(por exemplo, introduzir a resistência a herbicida em uma planta cultivável). Devemos, por-
tanto, considerar os vetores de clonagem para organismos diferentes de E. coli.

Vetores para leveduras e outros fungos


A levedura Saccharomyces cerevisiaeé um dos organismos mais importantes na biotecnologia.
Assim como seu papel na fabricação de cerveja e na produção de pão, a levedura tem sido utili-
zada como hospedeiro para a produção de importantes compostos farmacêuticos, a partir de ge-
nes clonados (p.29I). O desenvolvimento de vetores de clonagem para levedura foi grandemen-
te estimulado pela descoberta de um plasmídeo presente na maioria das linhagens de S. cerevi-
siae (Figrxa 7.1). O plasmídeo de 2 ytn, como ele é chamado, constitui-se em um dentre uma
quantidade bastante limitada de plasmídeos encontrados em células eucarióticas.
14O T.A. Bnown

FLP

Figura 7.1
O plasmídeo de 2 pm de levedura. REP| e REP2 esttu
envolvidos na replicação do plasmídeo, e FLPcodifica
uma proteína que pode converter a Íorma A do plasmÊ
deo (mostrada aqui) para a Íorma B, na qual a ordem
dos genes Íoi reorganizada pela recombinação intrarno-
lecular. A Íunção de D não é exatamente conhecida.

7.1.1 Marcas de seleção para o plasmídeo de 2 Frm


72
O plasmídeo de 2 pm é, de fato, uma excelente base para um vetor de clonagem. Ele o
kb de tamanho, o que é ideal para um vetor, e existe na céluÌa de levedura em número de [.8.t2
pias entre 70 e 200. A replicação utriliza a origem de replicação do plasmíÇéó, ìárias enzir l[Iìa
fornecidas pela célula hospedeira, além das proteínas codificadas pelos g6nes REPl e Rl @se
presentes no plasmídeo ü!m
No entanto, tudo não é perfeitamente direto na utilização do plasmídeo de 2 pm como
vetor de clonagem. Primeiro, existe a questão da marca de seleção. Alguns vetores de
gem para levedura contêm genes que conferem resistência a inibidores, tais como me
to e cobre, mas a maioria dos vetores populares faz uso de um tipo radicalmente diferente
sistema de seleção. Na prática, um gene de levedura normal é utilizado, geralmente um
que codifica uma enzima envolvida na biossíntese de aminoácidos. um exemplo é o
LEU2, que codifica B-isopropil-malato-desidrogenase, uma das enzimas envolvidas na
versão de ácido piúvico a leucina.
A fim de úllizar LEU2 como marca de seleção, um tipo especial de organismo
ro é necessário. o hospedeiro deve ser um mutante auxotrófico, que possui um gene
não-funcional. Tal levedura leu2- é incapaz de sintetizar leucina e pode sobreviver some
esse aminoácido for fornecido como um nutriente no meio de crescimento (Figura 7.2a). A
leção é possível porque os transformantes contêm um plasmídeo que carrega uma c
gene LEU2, e, assim, são capazes de crescimento na ausência do aminoácido. Em um
mento de clonagem, as células são espalhadas em meio mínimo (ao qual não foi adici
qualquer aminoácido). Somente células transformadas são capazes de sobreviver e formar
lônias (Figura7.2bt. epissômico

7.'|..2 Vetores baseados no plasmídeo de 2 pm: plasmídeos


epissôm icos para levedura
os vetores derivados do plasmídeo de 2 pm são chamados de plasmídeos epissômicos OYEpl3 apr
levedura (YEps, do inglês yeast episomal plasmids).Alguns yEps contêm o plasmídeo Prim€irc. ele é u
pm inteiro, outros incluem somente a sua origem de replicação. um exemplo desse últi tde replicação de
po é YEpl3 tFigura 7.3;. ra de pBR322. e I
Crorunçev GÊNrcA E ANÁLrsE oE DNA 141

(a) Levedura leu2-

+
REP| e REP2 estão
e.FLP codiÍica
atorm{A do plasmÊ
B, na Qgal a ordem O meio deve conter
Cromossomos - ausência leucina
recombina]ão intrame
do gene LEU2
(b) Utilizando LEU2 como uma marca de seleção

TransÍormar levedura
Frgiura7.2
de clonagem. Ele possú o ^\ -\
lel'edura em número de gle LEU2 Somente células transformadas
podem sobreviver
plasmídeo, viírias enzi r@mo Uma
pelosgenes REP| e de se- Vetor - carrega
em um o gene LEU2 correlo
de 2 pm como
Meio mínimo - sem leucina
. Alguns vetores de

radicalmente diferente
izado, geralmente um
. Um exemplo é o
imas envolvidas na

que possul um gene


I DNAdepBR322
@e sobreviver somente 10,7 kb ori DNA de 2 pLm
imento (Figura 7 .2a). A
que cilïega uma cópia
- t/'
zz DNA do cromossomo
ninoácido. Em um exor de levedura
(ao qual não foi adic
de sobreviver e formar