Sunteți pe pagina 1din 336

DESARROLLO DE LA CONDUCTA…………

CONDUCTA EMOSIONAL
-

“El desarrollo emocional o afectivo se refiere al proceso por el cual el niño


construye su identidad (su yo), su autoestima, su seguridad y la confianza en sí
mismo y en el mundo que lo rodea, a través de las interacciones que establece
con sus pares significativos, ubicándose a sí mismo como una persona única y
……………………………………..
CONDUCTA EMOCIONAL SU MOTIVACIÓN CONSCIENTE
E INCONSCIENTE SU APRENDIZAJE

1. AFECTIVIDAD FUNDAMENTAL

Se define la afectividad como:

- Capacidad para los afectos y sentimientos poco profundos.

- Disposición para recibir estimulos, experiericias y reacciones afectivas.

- Estados subjetivos que alteran las funciones psíquicas y pueden provocar


repercusiones orgánicas.

- Disposición innata, inconsciente, temperamental.

Según estas diversas definiciones podemos llegar a concluir que la afectividad es:

"La c~pacidad innata e inconsciente para experimentar sentimientos y


emociones al recibir los estímulos".
Esta capacidad es lo que suele llamarse "afectividad fundamental", que se
diferencia de las tres situaciones afectivas básicas:

a) Emoción:

Se la define como:

"Fenómeno afectivo que se caracteriza por aparecer en forma brusca, ser


intenso, depender de los centros diencefálicos e implicar manifestaciones de
índole vegetativa con repercusiones glandulares, musculares y viscerales".

b) Sentimiento:

Definido como:

"Estado afectivo duradero ~ de moderada itteusidad"

e) Pasión:

Definida así:

"Expresión emotiva intensa, incontrolada y 9ermanente, que monopoliza el


psiquismo del sujeto encauzándolo obsesivamente hacia una meta
determinada".

La afectividad se caracteriza por:

1. El predominio de la reacción afectiva sobre la percepción y el pensamiento.

2. La inhibición de las funciones conscientes.


3. Dirigir el pensamiento, las tendencias y el querer hacia objetivos
determinados.

4. Oscilar entre dos polos: lo agradable - lo desagradable.

La afectividad fundamental sufre variaciones dando lugar a emociones y pasiones

II. La Emoción

Señalamos anteriormente que la emoción es: "Un fenómeno afectivo que se


caracteriza por aparecer en forma brusca, ser intenso, depender de los centros
diencefálicos e implicar manifestaciones de índole vegetativa con repercusiones
glandulares, musculares y viscerales".

Este fenómeno afectivo se produce como una reacción de excitación frente a


estímulos. La excitación emotiva altera no sólo la afectividad, sino también la
conducta y el funcionamiento fisiológico del organismo.

Los cambios más importantes que se presentan durante la emoción son:

- Aceleración de los latidos del corazón y del pulso.


- Constricción de las arterias del abdomen.
- Elevación de la presión sanguínea.
- Enrojecimiento de la piel.
- Rápida conversión del azúcar en energía.
- Secreción de adrenalina por las glándulas suprarrenales que acelera el
ritmo cardíaco y predispone para la acción.
- Cambio en la velocidad y profundidad de la respiración de acuerdo a la
intensidad, duración y conducta corporal de la situación emocional. La respiración
podrá ser difícil: inhalación de aire brusca o un jadeo rápido, o se acelerará y será
más profunda.
- Interrupción de la función digestiva y de la secreción salival: se seca la
boca.
- Las funciones excretoras se alteran: en unos casos se interrumpen y en otros
se hacen más frecuentes.
- Aumenta la sudoración, como producto del esfuerzo muscular.
- Dilatación de la pupila.
- Pérdida más o menos profunda del control mental.
- Descontrol de la conducta.
- Alteraciones faciales: contracción descontrolada de músculos.

Teorías de la emoción:
La base fisiológica de la emoción no está aun clara, porque los investigadores no
han logrado determinar el funcionamiento exacto de la misma.

De acuerdo a la evolución científica se han elaborado diversas teorías de las que


señalaremos tres:

- Teoría de James-Lange.

- Teoría de Cannon y Bard.

- Teoría de Arnold y Lindsley.

De ellas se considera más aceptable la de Arnoid y Lindsley.

III. CONDUCTAS EMOCIONALES CONGÉNITAS


El niño no nace con emociones diferenciadas, sino con disposiciones genéticas
que a lo largo del proceso de maduración se van desarrollando en emociones
definidas y especializadas.

Se considera que las emociones son pautas de conducta


innatas relacionadas con los instintos. Pero son distintas de los instintos puesto
que no son tan rígidas como ellos, variando de individuo a individuo y con las
diversas culturas. Por lo tanto, la expresión facial de la emoción, el llanto, la risa y
ciertas actitudes corporales son innatas; mientras que las formas de manifestar las
emociones son aprendidas.

Según Bridges y Wallon se dan tres fases en el desarrollo emocional:

l~ Predominio del plano visceral de la sensibilidad: de 1 a 6 meses.

De 1 a 3 meses el niño experimenta emociones globales que siguen el esquema:

displacer-excitación-placer.
A los 6 meses aparecen las reacciones de miedo, cólera y amor.

20 Predominio del plano propioceptivo de la sensibilidad: 6 meses a 1 año

De 6 meses a 1 año de edad, el niño se va desligando de su madre y aumenta el


interés por el mundo. Entran en acción los músculos y reflejos posturales y de
equilibrio que dan origen a nuevas emociones.

3 a Predominio del plano exteroceptivo de la sensibilidad:

A partir del año de vida se inicia el proceso de socialización y vinculación al mun-


do. La imitación desempeña un papel importante. Aparecen las siguientes
emociones:
celos, envidia, alegría, simpatía, tristeza.
El aprendizaje de las emociones:

Conforme va creciendo el niño aprende a manifestar sus emociones. No aprende


emociones nuevas, sino a supeditar las emociones elementales de miedo, furor y
amQr, a estímulos nuevos y a~tiñ.ciales.

~1ediante este aprendizaje emocional, estímulos inicialmente indiferentes se


convierten en emociones. Se da el fenómeno llamado condicionamiento.

La educación afectiva que proporciona el hogar y cada uno de sus integrantes, es


muy importante en el desarrollo de una adecuada conducta emotiva en el niño.

Hay muchas conductas deseables e indeseables que dependen de la conducta de


105 padres. Como ejemplos podemos mencionar: el niño que consigue todo a
fuerza de lloros y pataleos, en su vida posterior se verá en dificultades para
superar la frustración; el niño que por excesiva insistencia en la hombría o en el
machismo no sabe ser respetuoso y comprensivo con los demás; el niño que se
asusta ante la vista de ciertos animales o ante la muerte porque lo ha visto en su
hogar.

Los principales factores de aprendizaje emotivo son:

a) La experiencia del dolor y del placer:

Estas experiencias crean en el hombre la memoria emocional. Por ejemplo: la per-


sona mordida por un perro, teme a los perros; un alumno con bajas calificaciones
en una materia, teme a la materia y al profesor.
Sin embargo, estas experiencias emocionales ayudan a una mejor adaptación y
protección del individuo cuando son superadas positivamente.

b) El factor colectivo:

Ayuda a internalizar ideas, situaciones, cosas y personas que emocionan a la


colectividad.

El niño imita las actuaciones de los grupos a que pertenece: familia, escuela, club,
amigos, y termina identificando su conducta con la de ellos. Por ejemplo: la
emoción de pánico ante un temblor se extiende rápidamente entre el alumnado de
un colegio y de acuerdo con la reacción de quienes lo sintieron será el
aprendizaje de todo el grupo.

c) La transferencia:

Lleva a reproducir las mismas emociones frente a situaciones y objetos


similares.

Ejemplo: el amor a la novia, poco a poco se hace extensivo a sus


familiares; el
Alumno que tiene un problema con un profesor y reacciona con antipatía hacia
todos los profesores diciendo que son iguales.

d) La proyección:

Desplaza los estados emotivos adquiridos, hacia objetos nuevos más distantes. El
niño pequeño, por ejemplo, sólo tiene miedo ante objetos físicos concretos; pos-
teriormente lo desplaza a la oscuridad.

e) El pensamiento:
Trae a la memoria recuerdos de hechos, situaciones y personas que han supuesto
emociones, y por transferencia, proyección o simple recuerdo es fuente de nuevas
emociones.

Por ejemplo, el recordar la muerte de un ser querido puede producir la emoción de


dolor con toda intensidad hasta llegar a derramar lágrimas.

Iv. CONFLICTOS Y FRUSTRACIONES

La conducta tiene su génesis en necesidades, deseos y decisiones. No surge de


la nada. Las motivaciones despiertan y orientan las conductas hacia metas
definidas que pueden ser intermedias y finales.

Cuando se alcanzan las metas se habla de éxito.

El éxito facilita los esfuerzos, eleva el nivel de aspiraciones, incrementa la


autoestimación y la iniciativa.

El fracaso se produce cuando una necesidad o el logro de una meta es


obstaculizado porfaclores de cualquier tipo. La vivencia del fracaso se llama
frustración.

Frustración:

Es:
"El estado de un organismo motivado cuando se Interrumpe su conducta
hacía una meta".

Para que se produzca la frustración es necesario:


1. Que exista una privación, es decir, que esté presente un impulso para lograr
algo que no se tiene.

2. Que exista un impedimento, algún tipo de interferencia que impida la


gratificación o la realización de la acción.

El impedimento puede ser producido por:

a) La introducción de barreras físicas entre el organismo y la meta.

b) La eliminación de las claves de dirección, es decir, retirando el estimulo que


sustenta la conducta hacia la meta.

c) La provocación de respuestas incompatibles, es decir, por conflicto entre


tendencias de acción, metas o motivos.

Principales fuentes de Frustración

1 Inadecuación Interior-exterior.'

Inadecuación que tiene su origen en excesiva exigencias del individuo al


ambiente, o por el contrario, una excesiva demanda ambiental que el individuo no
puede satisfacer.

2 Crisis del desarrollo:

A lo largo de la vida se producen situaciones de crisis que producen frustración.


Entre ellas se encuentran: la restricción de la actividad infantil; el destete; la
enseñanza de hábitos higiénicos; la pérdida del amor, de la seguridad o del apoyo;
dificultades económicas en la vida adulta; la muerte de seres queridos.
3 Situaciones que amenazan la autoestima o la integridad:

No todas las situaciones difíciles producen frustración, solamente las que


implican una amenaza para el yo o una defensa de la autoestima e integridad
como persona.

Conflicto:

El conflicto es:

"Un estado de tensión Incrementada que se caracteriza por vacilación y duda,


fatiga e incluso bloqueo, provocado por dos motivaciones o necesidades de
Igual intensidad, ante las cuales el sujeto debe elegir por seguir una y dejar
la otra

En el conflicto las dos tendencias de acción son incompatibles: el seguir una


impide la realización de la otra.

Los conflictos pueden ser de tres tipos:

A. Acercamiento - acercamiento: Dualidad en la que las dos situaciones


atraen.

B. Evitación - evitación: Dualidad en la que las dos situaciones son


igualmente indeseables y producen aversión.
c. Acercamiento - evitación: Dualidad producida por el deseo y la aversión de
una misma tendencia.

Consecuencias de los estados de conflicto y frustración:


Tanto la frustración como el conflicto provocan estados emocionales
caracterizados por:

- angustia y ansiedad
- inseguridad e indecisión
- excitación e irritabilidad
- resentimiento
- generalización de la angustia
- actitud de huida
- agresividad
- neurosis

No todos los estados producen estos síntomas con la misma intensidad. Esta
depende del grado de amenaza que suponen para el yo del individuo la frustración
y el conflicto.

Junto a estas consecuencias negativas, existen otras positivas: se aprende a


evitar ciertas situaciones y estimulan la productividad y el esfuerzo.

Frustración y agresividad:
Una reacción frecuente ante la imposibilidad de lograr una meta, es la conducta
agresiva caracterizada por el enojo y el ataque.

La intensidad de la agresividad depende:

a. de la fuerza de la instigación.

b. del grado de interferencia con la respuesta frustrada.


c. de la frecuencia con que se interrumpen las secuencias de respuesta.

La agresión puede dirigirse hacia el agente frustrante, o volverla contra objetos,


personas o contra sí mismo.

VI. STRESS Y STRESSORES

Se define el stress como:

"El estado del organismo en cualquier situación en que percibe que su


bienestar o equilibrio está en peligro y que debe dedicar todas sus energías a
su protección".

Es un estado de reacción del organismo que como consecuencia de la interacción


entre el individuo y el ambiente, percibe una amenaza y no encuentra una
respuesta normal de ajuste.

Las reacciones al stress son de dos tipos:

- Fisiológicas:

Se desarrollan en tres fases:


Primera Fase: descarga de adrenalina, aceleración del ritmo cardiaco, disminución
de la temperatura y del tono muscular, anemia, acidez, como reacción a la alarma.

Segunda fase: hiperactividad de las glándulas suprarrenales en su corteza que


producen un aumento de la virilidad y de la resistencia.

Tercera fase: agotamiento.


- Psicológicas:

- emoción con las consecuencias que ello supone.


- sentimiento de congoja, ansiedad y tensión. La tensión va acompañada de
deterioro en la ejecución, el juicio y las relaciones, rigidez de respuesta,
irritabilidad.
- conducta defensiva, que en la fase de agotamiento físico se caracteriza por el
retraimiento, la represión amnésica, respuestas disociativas, y psicosis cuando la
situación de stress es muy prolongada.

Las condiciones que provocan stress, o stressores, son todas aquellas que
perturban la homeóstasis fisiológica o amenazan la integridad del yo, tanto por
déficit como por exceso. Entre ellas se encuentran:

1. La ruptura del equilibrio fisiológico: temperaturas muy altas, sueño drogas...


2. Estímulos desagradables o dolorosos: choque eléctrico, sonidos fuertes.
3. Presiones: críticas, molestias
4. Fracasos: imposición de tareas imposibles de realizar.
5. Conflictos sociales.
6. Situaciones que amenazan la seguridad: incertidumbres, amenazas de muerte

El que un hecho o acontecimiento, sea o no factor de stress depende de la


interpretación y evaluación perceptual que de él haga el sujeto.

Entre los factores psicológicos más frecuentes, causantes de estas enfermedades,


se encuentran: angustia, dependencias, temor ante amenazas, agresividad,
hostilidad, stress emocional, preocupaciones, fracasos, disputas, sentimientos de
culpa, hipersensibilidad, perfeccionismo, falta de confianza.
………………………………………………
CONDUCTA EMOCIONAL SU MOTIVACIÓN CONSCIENTE EMOCIONAL, SU
MOTIVACIÓNCONSCIENTE E INCONCIENTE.Afectividad Fundamental

Se define afectividad como:Capacidad para los efectos y sentimientos poco profundo

Disposición para recibir estímulos, experiencias y reacciones afectivas.

Estados subjetivos que alteran las funciones psíquicas y pueden provocar repercusiones orgánicas.

Disposiciones innatas, inconciente, temperamental.

Según estas diversas definiciones podemos llegar a concluir que la afectividad:La capacidad innata
e inconsciente para experimentar sentimientos y emociones de recibir los estímulos.Esta
capacidad es la que suele llamarse afectividad fundamental que se diferencia de las tres
situacionesbásicas afectivas:

a) Emoción:

Se define como:Fenómeno afectivo que se caracteriza por aparecer en forma brusca, ser intenso,
depender de los centrosdiencenfalicos e implicar manifestaciones de índole vegetativa con
repercusiones glandulares, musculares yviscerales.

b) Sentimientos:

Definido como:Estado afectivo duradero y moderada intensidad.

c) Pasión:

Definida así:Expresión emotiva intensa, incontrolada y permanente, que monopoliza el psiquismo


del sujeto encauzándoloobsesivamente hacia una meta determinada.La afectividad se caracteriza
por:

1. El predominio de la reacción afectiva sobre la percepción y el pensamiento.2. La inhibición de


las funciones conscientes.3. Dirigir el pensamiento, las tendencias y el querer hacia objetivos
determinados.4. Oscilar entre dos polos: Lo agradable, lo desagradable.La afectividad fundamental
sufre variaciones dando lugar a emociones y pasiones. Estas variaciones puedendeberse a:

Causas somáticas :


a. Cinestesia: Alteraciones viscerales.b. Kinestesia: Alteraciones musculares de la posición y el
equilibrio.Percepción: interpretación y significado que se atribuye a los diversos estímulos que
recibimos de acuerdo alos engramas ya existentes.

Causas ambientales:

El trato con personas y animales nos hace percibir sensaciones que afectan el estado de ánimo, o
que provocanrecuerdos de situaciones emotivas vividas con anterioridad.

Estimulo verbo − pensante:

Son estímulos provocados por palabras que recuerdan pensamientos, imágenes, hechos
situacionesproblemáticos, que hacen revivir mentalmente emociones agradables o momentos de
angustia.

LA EMOCIÓN

Señalamos anteriormente que la emoción es: Fenómeno afectivo que se caracteriza por aparecer
en formabrusca, ser intenso, depender de los centros diencenfalicos e implicar manifestaciones de
índole vegetativacon repercusiones glandulares, musculares y viscerales.Este fenómeno afectivo
se produce como una reacción de excitación frente a estímulos. La excitación emotivaaltera no
solo la afectividad, sino la conducta y el funcionamiento fisiológico del organismo.Los cambios más
importantes que se presentan durante la emoción son:1. Aceleración de los latidos del corazón y
el pulso.2. Constricción de las arterias del abdomen.3. Elevación de la presión sanguínea4.
Enrojecimiento de la piel.

5. Rápida conversión del azúcar en energía.6. Secreción de adrenalina por las glándulas
suprarrenales que acelera el ritmo cardíaco y predispone para laacción.7. Cambio de la velocidad y
profundidad de la respiración de acuerdo a la intensidad, duración y conductacorporal de la
situación emocional. La respiración podrá ser difícil: inhalación de aire o un jadeo rápido, o
seacelera y será más profunda.8. Interrupción de la función digestiva y de la secreción salival: se
seca la boca.9. Las funciones excretoras se alteran: en unos casos se interrumpe y en otros se
hacen más frecuente.10. Aumenta la sudoración, como producto del esfuerzo muscular.11.
Dilatación de las pupilas.12. Pérdida más o menos profunda del control mental.13. Descontrol de
la conducta14. Alteraciones faciales: Contracción descontrolada de músculos.

Teorías de la Emoción:

La base filosófica de la emoción no esta aun clara, porque los investigadores no han logrado
determinar elfuncionamiento exacto de la misma.De acuerdo a la evolución científica se han
elaborado diversas teorías de la que señalaremos tres:Teorías de James−Lange.

Teoría de Cannon y Bard

Teoría de Arnold y Lindsley.

De ella se consideran mas aceptable la de Arnold y Lindsley.A:

Teoría de James − Lange (1884)

Según ellos la emoción se produce de la siguiente forma:El órgano receptor percibe la situación
que puede afectar como una situación de peligro y la transmitea la corteza cerebral.

Se produce una reacción desencadenándose una serie de manifestaciones orgánicas.

Se perciben estas modificaciones del organismo y entonces es cuando se siente la emoción, es


decir se

emociona.Las fallas que se presentan esta teoría son: no indican la participación de los centros
cerebrales; la emoción esindependiente de la recepciones y se ha comprobado que personas
paralíticas tienen capacidad emotiva.Gráficamente se la puede presentar
así:_________________________________________________________Corteza cerebralEstimulo

Receptor Motivaciones
Orgánicas_________________________________________________________Representación
grafica de la teoria de James − LangeB.

Teoría de Cannon (1927) y Bard ( 1934): Teoría talamica

Cannon y Bard descubrieron que el tálamo y el hipotálamo son los centros que regulan las
actividadesnerviosas de la emoción.Propone el siguiente esquema:El estimulo se trasmite de3sde
el órgano receptor hasta la corteza a través del hipotálamo y deltálamo.

Si es fuerte, supera la inhibición que ejerce la corteza sobre el tálamo y se activa los
mecanismostalamicos.

Los mecanismos talamicos a través del hipotálamo, desencadenan las manifestaciones orgánicas
de laemoción.

Una señal de este desencantamiento es trasmitida la corteza.

La corteza aprecia respuesta.

Las fallas que representan esta teoría son: el tálamo no es esencial a la emoción; el hipotálamo no
tieneproyecciones sensoriales especificas a la corteza; hay emociones que se producen sin la
desinhibición cortical;la corteza cerebral tiene no solo funciones inhibidoras si no también
excitadoras.En la forma básica de la teoría de Cannon y Bard será
así _________________________________________________________Corteza
cerebralPercepción de la respuestaTH desinhibicion

Estimulo

ReceptorManifestaciones
Orgánicas_________________________________________________________Representación
grafica de la teoria de Cannon − BardC.

Teoría de la activación o excitación de Arnold y Lendley (1951

)La emoción se produce de la siguiente forma:Los estímulos tantos viscerales como somáticos
llegan a la formación reticular; allí se integran y sedifunden por el hipotálamo y el tálamo y a
través de este activan la corteza.

Si la intensidad del estimulo es fuerte aumenta la actividad cerebral y la corteza da una señal de
alertaque desinhibe los centros di encefálicos: hipotálamo y tálamo.

El patrón de alerta hace que se produzcan la expresión orgánica de la emoción y se desencadene


unaserie de modificaciones del organismo.


LA corteza recibe información de las modificaciones orgánicas producidas y esta percepción
influyeen la toma de posición emocional.

La toma de posición emocional producida por el estimulo original y los estímulos de lo que
estaocurriendo en el organismo, refuerza el desarrollo de la emoción.

Las fallas de esta teoría son: alerta cortical no tiene las graduaciones tan finas como para
correlacionarse concada emoción; el alerta cortical es un requisito, pero no explica el
comportamiento emocionalSu representación
es._________________________________________________________Corteza cerebralPosición
emocionalTH desinhibiciónFrEstimulo

ReceptorManifestaciones
Orgánicas_________________________________________________________

Representación grafica de la teoría de activación o excitación.

SITUACIONES QUE DESENCADENAN LA EMOCIÓN.

La emoción puede ser desencadenada por situaciones, personas y objetos que se presentan
cómo agradables odesagradables, buenos o malos.Lo que consideramos bueno nos agrada y lo
deseamos. Y cuando lo tenemos lo disfrutamos. Por el contrario ,lo que consideramos malo nos
desagrada y tratamos de evitarlo; lo rechazamos y cuando se nos hace presentenos causa tristeza
y descontento.Estas emociones básicas nos impulsan a la acción: a buscar lo que nos agrada y a
evitar lo desagradable. Siencontramos dificultades para lograr este objetivo luchamos para lograr
este objetivo luchamos con másintensidad para lograrlo.Los objetivos que consideramos
superables a pesar de las dificultades, provocan esperanza, mientras que losinsuperables nos
producen desesperación. La esperanza nos llevará a reaccionar con esfuerzo y alegría.
Ladesesperación nos hará sentir miedo y terror.Las situaciones que pueden desencadenar
emociones son básicamente de dos tipos:a. Situaciones que existen la satisfacción de las
necesidades fundamentales: Comida, bebida, sueño, seguridad,amor, aprecio, libertad, etc...b.
Situaciones en las que se busca el crecimiento.

EL SHOCK EMOCIONAL

No todas las emociones presentan la misma intensidad ni alteran en igual grado el curso habitual
de laactuación del sujeto.Se habla de schokc emocional en:Las emociones en las que la
brusquedad e intensidad son tan fuertes que el sujeto se ve radicalmenteperturbado por la
emoción.Son características de un shock emocional:

6
1. Un estado emocional explosivo, rápido y de efectos inmediatos.2. La pérdida del control mental
racional y la adopción de conducta típicamente animales.3. Alteraciones fisiológicas bruscas.4.
Conducta cohibida o al contrarío gesticulante y agitada.

CONDUCTAS EMOCIONALES CONGÉNITAS

El niño no nace con emociones diferenciadas, si no con disposiciones genéticas que alo largo del
proceso demaduración se van desarrollando en emociones definidas y especializadas.Se
consideran las emociones son pautas de conductas innatas relacionadas con los instintos. Pero son
distintasde los instintos puesto que no son tan rigidas como ellos, variando de individuo a
individuo y con las diversasculturas. Por lo tanto le expresión facial de la emoción, el llanto, la risa
y ciertas actitudes corporales soninnatas; mientras que las formas de manifestar las emociones
son aprendidas.Según Bridges y Wallo se dan tres fases en el desarrallo emocional.Predominio del
plano visceral dela sensibilidad: de 1 a 6 nmeses.

De 1 a 3 meses el niño experimenta emociones globales que siguen el esquema:Displacer −


excitación − placer.A los 6 meses aparece la reacción del cólera, miedo y amor.b. predominio del
plano propioceptivo de la sensibilidad: 6 mese a 1 año.De 6 meses a 1 año de edad, el niño se va
desligando de su madre y aumenta el interés por el mundo. Entra enacción con los músculos y
reflejos posturales y de equilibrio que dan origen a nuevas emociones.predominio del plano
exterceptivo de la sensibilidad:

A partir del año la vida se inicia en el proceso de socialización y vinculación al mundo. La


limitacióndesempeña un papel importante. Aparecen las siguientes emociones: celos envidia,
alegría, simpatía, tristeza.

EL APRENDIZAJE DE LAS EMOCIONES

Conforme al crecimiento el niño aprende a manifestar sus emociones: no aprende emociones


nuevas; sino asupeditar las emociones elementales de miedo, furor y amor a estímulos nuevos y
artificiales.Mediante el aprendizaje emocional, estímulos inicialmente indiferentes se convierte en
emociones. Se da elfenómeno llamado condicionamiento.

La educación efectiva que proporciona el hogar y cada uno de sus integrantes, es muy importante
en eldesarrollo de una persona adecuada conducta emotiva en el niño ó joven.Hay muchas
conductas deseables e indeseables que dependen de la conducta de los padres.Como por ejemplo
podemos mencionar: El niño que consigue todo a la fuerza de lloros y pataleos, en su vidaposterior
se vera en dificultades para supera la frustración; el niño que por excesiva insistencia en la
hombríao en el machismo no sabe ser respetuoso y comprensivo con los demás; el niño que se
asusta ante la vista deciertos animales o ante la muerte porque lo ha visto en su hogar.

LOS PRINCIPALES FACTORES DE APRENDIZAJE EMOTIVO SON:−La experiencia del dolor y el


placer:
Estas experiencias crean en el hombre la memoria emocional. Porejemplo: la persona mordida por
un perro, teme a los perros; un alumno con bajas notas en una materia, temea la materia y al
profesor. Sin embargo, estas experiencias emocionales ayudan a una mejor adaptación
yprotección del individuo cuando son superadas positivamente.

−El factor colectivo:

ayuda a internalizar ideas, situaciones, cosas y personas que emocionan a lacolectividad. El niño
imita las actuaciones de los grupos a que pertenece: familia, escuela, club, amigos yterminada
identificado su conducta con la de ellos. Por ejemplo la emoción de pánico ante un temblor
seextiende rápidamente entre el alumnado de un colegio y de acuerdo con la reacción de quienes
lo sintieronserá aprendizaje de todo el grupo.

− La transferencia:

Lleva a reproducir las mismas emociones frente a situaciones y objetos similares.Ejemplo el amor
a la novia, poco a poco se hace extensivo a sus familiares, el alumno que tiene problemascon un
profesor reacciona con atipatia hacia todos los profesores diciendo que son iguales.

− La proyección:

desplaza los estados emotivos adquiridos, hacia objetos nuevos más distante. El niñopequeño por
ejemplo, sólo tiene miedo ante objetos físicos concretos, posteriormente lo desplaza a
laoscuridad.−

El pensamiento:

Trae a la memoria recuerdos de hechos, situaciones y personas que han supuestoemociones y por
transferencia, proyección o simplemente recuerdo es fuente de nuevas emociones. Porejemplo; el
recordar la muerte de un ser querido puede producir la emoción de dolor con toda intensidad
hastallegar a derramar lágrimas.

CONFLICTOS Y FRUSTRACIONES

La conducta tiene su génesis en necesidades, deseos y decisiones. No surge de la anda. Las


motivacionesdespiertan y orientan las conductas hacia metas definidas que pueden ser
intermedios y finales. El éxitofacilítalos esfuerzos, eleva el nivel de aspiraciones, incrementa la
autoestimación y la iniciativa.El fracaso se produce cuando una necesidad o el logro de una meta
es obstaculizado por factores de cualquier

tipo. LA vivencia del fracaso se llama frustración.

LA FRUSTRACIÓN:

El estado de organismo motivado cuando se interrumpe su conducta hacia una meta.Para que se
produzca la frustración es necesario:Que exista una privación, es decir, que esté presente un
impulso para lograr algo que no se tiene.


Que exista un impedimento, algún tipo de interferencia que impida la gratificación o la realización
dela acción.El impedimento puede ser producido por:

La introducción de barreras físicas entre el organismo y la meta.

La eliminación de las claves de dirección, es decir, retirando el estímulo que sustenta la conducta
hacia lameta.

La provocación de respuesta incompatible, es decir, por conflicto entre tendencias de acción,


metas omotivos.

Principales fuentes de frustración:1.

Inadecuación interior − exterior:

Que tiene su origen en excesivas exigencias del individuo al ambiente,o por el contrarío, una
excesiva demanda ambiental que el individuo no puede satisfacer.2.

Crisis del desarrollo:

A lo largo de la vida se producen frustraciones. Entre ellas se encuentran: larestricción de la


actividad infantil, la falta de hábitos, la pérdida del amor, de la seguridad o del apoyo,dificultades
económicas en la vida adulta, la muerte de seres queridos.3.

Situaciones que amenazan la autoestima o la integridad:

No todas las situaciones difíciles producenfrustración, solamente las que implican una amenaza
para el Yo o una defensa de la autoestima e integridadcomo persona...

CONFLICTO:

Estado de tensión incrementada que se caracteriza por la vacilación y duda, fatiga e incluso
bloqueo,provocado por dos motivaciones o necesidades de igual intensidad, ante las cuales el
sujeto debe elegir porseguir una y dejar la otra. En el conflicto las dos tendencias de acción son
incompatibles: el seguir una impidela realización de otra.En el conflicto las dos tendencias de
acción son incompatibles: el seguir una impide la realidad de la otra.Los conflictos pueden ser de
tres tipos:

1.

Acercamiento:

Dualidad en la que dos situaciones se atraen.2.


Evitación:

Dualidad en la que la que las dos situaciones son igualmente indeseables y producen aversión.3.

Acercamiento: − Evitación:

Dualidad producida por el deseo y la aversión de una misma tendencia.

CONSECUENCIAS DE LOS ESTADOS DE CONFLICTO Y FRUSTRACIÓN

− Angustia y ansiedad− Inseguridad e indecisión− Excitación e irritabilidad− Resentimiento−


Generalización de la angustia− Actitud de huida− Agresividad− NeurosisNo todos los estados
producen estos síntomas con la misma intensidad. Depende del grado de amenaza quesuponen
para el yo del individuo la frustración y el conflicto.Junto a estas consecuencias negativas, existen
otras positivas: se aprende a evitar ciertas situaciones yestimulan la productividad y el esfuerzo.

FRUSTRACCIÓN Y AGRESIVIDAD

Una reacción frecuente ante la imposibilidad de lograr una meta, es la conducta agresiva
caracterizada por elenojo y el ataque.La intensidad de la agresividad depende:− De la fuerza de la
instigación.− Del grado de interferencia con la respuesta frustrada.− De la frecuencia con que se
interrumpe las secuencias de respuesta

MECANISMO DE DEFENSA DEL YO

Tanto la frustración como el conflicto son vivenciados como peligros que amenazan la integridad
del yo porlo tanto producen angustia y ansiedad. Ante este estado emocional el individuo
reacciona agrediendo como seacaba de indicar o defendiéndose. Para defenderse de la angustia
todo individuo posee unos mecanismosllamado defensa.Los mecanismos de defensa son:

10

Formas inconscientes de adaptación y de reducción de la ansiedad y agresividad ante situaciones


defrustración y conflictoLos mas utilizados en los seres humanos son:

La Represión:

Eliminar de la conciencia ideas que producen situaciones desagradables o vergonzosas para


elindividuo.Este olvida los episodios que producen incomodidad.Es un olvido protector, que lleva a
cerrar los ojos ala realidad, a negar las obligaciones o circunstanciasgeneradoras de tensión.

La Fijación:

Retroceso o adhesión a uno de los componentes del instinto sexual a una etapa o fase primitivadel
desarrollo psicosexual, pregenital, en la que se siente sastifacciòn.Supone que el individuo no ha
logrado superar con toda normalidad, la etapa a la que recurre en su fijación.

La Regresión:

Retorno a sastifaciones y a modos de conducta infantiles en los que el individuo ha


quedadofijado.La regresión supone un apartarse de la dificultad son que se ha tropezado, un
renunciar a seguir luchando y unechar mano de hábitos anteriores, de soluciones ya establecidas a
las que ha quedado fijado. Este mecanismova unido con la de fijación.

La Proyección:

Atribución de los propios impulsos , faltas y debilidades reprimidos, a otras personas.La persona
no reconoce estos procesos como propios, sino que los experimenta como si fueran de otros,
lospercibe en otros individuos. Popularmente se indica la proyección con el refrán: cree el ladrón
que todos sonde su condición.

Racionalización:

Proceso mental mediante el cual se buscan razones aceptables y defendibles para justificaractos u
opiniones que causan ansiedad, fundamentado en otro motivo o causa.Se niegan los auténticos
motivos de una acción criticable, y se sustituyen por otras razones que puedan serjustificadas pero
en ese caso no son las ciertas.Un ejemplo de racionalizacion es el estudiante que ha sido aplazado
en un examen para el que no se habíapreparado en forma adecuada y en lugar de reconocerlo,
culpa al profesor de haber preguntado cosas noexplicadas o haber puesto una prueba para aplazar
a los alumnos.

Fantasía

. Es la forma como el ser humano enfrenta las situaciones en las cuales se ven interrumpidas
susmetas, refugiándose en aspectos que difieren de la realidad.La fantasía en estos aspectos es un
refugio, pues supone la huida de la realidad en lugar de buscar lasatisfacción en la solución del
conflicto qué se presentan en el camino que conduce a las metas.

Compensación:

Mediante la compensación el individuo que reconoce una deficiencia propia, busca otraforma de
enacara el problema utilizando sus recursos y destrezas mas desarrollados.Se pueden presentar
tres casos de compensación:

11

Esfuerzo equilibrante o restaurante del fallo o la insuficiencia

( sobre compensación): Un ejemplotípico es Demóstenes, que siendo tartamudo, sobre la base del
esfuerzo y practica se convirtió en elmejor de los oradores griegos.

desarrollo de otras capacidades:

Ejemplo: la persona con defecto físico busca ser admirada por susconocimientos y estudios o en
otro campo.

Compensación ficticia, equilibrar los defectos con características impropias o falsas:

Apareciendo lo que no es en realidad. Es el fenómeno conocido como pantallería.


Identificación:

Es la atribución a uno mismo de los rasgos y cualidades que se admiran en otras personas.Se
tiende a copiar las acciones y las actitudes dl otro, a convertirse en el otro pero en la fantasía.

LA MOTIVACIÓN INCONSCIENTE

Además de los motivos conscientes de la conducta, existen otros tipos de inconscientes que tienen
su origenen los instintos o en represiones de reacciones o de contenidos que nuestra conciencia
no acepta.La emoción genera un impulso a la acción, a la descarga; si se le reprime pasa al
inconsciente y puede serperniciosa para la personalidad y el organismo. Estos contenidos
inconscientes, producen angustia y ansiedad,que induce al sujeto a actuar de manera que esta
angustia sea superada.En aquellos casos en que la angustia domina al individuo, este puede llegar
a enfermarse, hablándose entoncesde neurosis.

CONCEPTO DE NEUROSIS

Es un trastorno funcional, reacción inadecuada a estímulos, a consecuencia de tensiones y


conflictos internos,en el que se altera la afirmación del yo y las relaciones afectivas, profesionales
y sociales del sujeto y puededar lugar a perturbaciones respiratorias, circulatorias y digestivas, por
alteraciones en el control de talesfunciones.La Neurosis se caracteriza por:− Egocentrismo,
agresividad reprimida, intolerancia a las pequeñas frustraciones, inmadurez sexual.− Vivir en
estado de insatisfacción y de angustia flotante y difusa.− Llamar la atención sobre la propia
persona con crisis como ataques o perdida temporal de algunas funciones

12

psíquicas.− Tener miedos infundados que dificultan la vida diaria.

TIPOS DE NEUROSIS

− La Histeria: Es la neurosis en la que el enfermo trasforma el conflicto emocional en síntomas


somáticos, conel fin de negar la existencia del impulso reprimido, de crear un impedimento físico
que impida la realizacióndel acto temido, de auto castigo por sentir deseos inaceptables.Síntomas
de la Histeria1. Alteraciones de la conciencia.2. Ataques acompañados de reacciones con gran
cantidad de movimientos y mucha teatralidad.3. Conversión del problema en parálisis de alguna
parte del cuerpo o pérdida de la sensibilidad.

− NEUROSIS FÓBICA

Es la neurosis caracterizada por un miedo irracional y desproporcionado que experimenta el


individuo anteestímulos. El miedo se produce siempre por los mismos estímulos y el sujeto no
logra vencerlos aunquecomprenda que es absurdo.El enfermo a través de la fobia, trata de
desplazarla angustia de un trauma afectivo insoportable hacia unobjeto banal, con lo que consigue
tener reprimido y olvidado el trauma original.Síntomas:1. La presencia de ansiedad, inquietud y
temor.2. La presencia de miedos irracionales: fobias.
− NEUROSIS OBSESIVA

Es la neurosis en la que se hacen presentes pensamientos insistentes que no se pueden desechar y


queatormentan al individuo, aunque se da cuenta que no tienen fundamentos.

13

Síntomas:1. Impulsos por repetir ciertos actos: compulsión.2. Repetición en la mete de ideas
absurdas sin poder desterrarlos: ideas obsesivas.3. Ideas de perfeccionismo y minuciosidad.

CONCEPTO PSICOANALITICO DE CONCIENTE, PRECONCIENTE E INCONSCIENTE

Freud señala que la vida se divide en tres extractos: conciente, preconciente e inconsciente. Estos
extractosestán diferenciados por la distinta disponibilidad de los materiales de la mente.

Consciente:

Es el estrato en que se encuentran todos los procesos mentales de los que nos damos cuenta.

Preconsciente:

Es el estrato de los procesos mentales que siendo inconscientes pueden hacerse conscientessin
dificultad, es decir, pueden ser recordados o reproducidos.

Inconsciente:

Es el estrato de los procesos mentales que no llegan a ser consciente a pesar de su intensidad
nipor el esfuerzo de la memoria. Sólo llegan a conocerse ó adivinarse a través de los sueños y los
síntomasneuróticos.Además de esta división de la vida psíquica, Freíd afirma que la psique
humana redivide en tres grupos deestructuras psicodinamicas. Son estructuras quedan dinamismo
al aparato psíquico: el ello, el ego o yo y elsuperego o superyo.El Ello: Se alimenta de todo
heredado, especialmente de las tendencias instintivas. Es la parte oscura,desorganizada e ilógica
de la personalidad. Actúa en el plano inconsciente y responde automáticamente alprincipio del
placer. No hace caso de la realidad sino que busca la satisfacción inmediata de los instintos.El Yo:
Es la parte consciente, que se encuentra en contacto directo con el mundo exterior, con la
realidad. Seha formado en la copa más superficial del ello a través de la influencia del mundo
exterior.El Yo tiene como funciones:− Comprobar la realidad examinándola y juzgándola

14

− Acepta o rechaza los deseos e impulsos que provienen del ello.− Ser mediador entre el ello y el
súper yo; entre el ello y la realidad; buscando la auto conservación y laseguridad.El súper yo: Es la
estructura que se forma por introducción de las normas éticas, de los valores, de los ideales,de las
costumbres y forma de conducta que el niño o el joven va aprendiendo y haciendo suyas a través
de laidentificación con sus padres del proceso educativo. El superyo lucha por la perfección en
oposición al yo quelucha por la realidad y el ello que busca el placer. Esto origina conflictos entre
los tres estructuras. El superyoes también la conciencia moral.
MANIFESTACIONES DEL INCONSCIENTE EN PERSONAS NORMALES

Los contenidos del inconsciente, como se indicó anteriormente son fuente de tensiones y
angustias que llevana ciertas personas a enfermarse psicológicamente y a veces fisiológicamente,
en forma de neurosis.En las personas normales los contenidos del inconsciente no tienen
consecuencias tan funestas, pero tambiénestán presentes.Podemos conocer el inconsciente a
través de las manifestaciones que tienen: los sueños, los lapsu o actosfallidos, los temores, manías
o fobias; los resentimientos y venganzas y en otras formas más positivas como elarte, las
costumbres y las concepciones morales.

EL STRESS Y STRESSORESEL STRESS:Estado del organismo en cualquier situación en que percibe


que su bienestar o equilibrio está en peligroy que debe dedicar toda su energía a su
protección.Las reacciones al Stress son de dos tipos:− Fisiológicas:1 era fase: descarga de
adrenalina, aceleración del ritmo cardíaco, disminución de la temperatura y deltono muscular,
anemia, acidez, como reacción a la alarma.2 da fase: Hiperactividad de las glándulas
suprarrenales en su corteza que produce un aumento de la

15

virilidad y de la resistencia.3 era fase: AgotamientoPsicológicas: emoción con las consecuencias


que ello supone.− Sentimientos de congoja, ansiedad y tensión. La tensión acompañada de
deterioro en la ejecución, eljuicio y las relaciones, rigidez de respuestas, irritabilidad.− Conducta
defensiva, que en la fase de agotamiento físico se caracteriza por el retroalimento, larepresión
amnésica, respuesta disoaciativas y psicosis cuando la situación de Stress es muy prolongada.Las
condiciones que provocan stress o strresores son todas aquellas que perturban la
homeostasisfisiológica o amenazan la integridad del yo, tanto por déficit como por exceso.Entre
ellas se encuentran:− La ruptura del equilibrio fisiológico, temperaturas muy altas, sueño,
drogas....− Estímulos desagradables o dolorosos, sonidos fuertes....− Presiones: Criticas,
molestias.− Fracasos: Imposición de tareas imposibles de realizar.− Conflictos sociales−
Situaciones que amenazan la seguridad, incertidumbre, amenazas de muerte...ENFERMEDADES
PSICOSOMATICAS:Como su nombre lo indica, son enfermedades de origen psiquico o
emociomnel que llegan a producirsede tipo somatico o fisiologico.El origen de estas
enfermedades pueden estar, tanto en factores del infancia como en factores actualesque
determinan reacciones anormales.Son reflejos orgánicos de la tensión psicológica.
Normalmente, la angustia, al igual que todas las demásmanifestaciones emotivas, se expresa a
través de las vísceras, pero cuando es muy intensa y de largaduración afecta filológicamente a
los órganos involucrados. En estos trastornos lo fisiológico y orgánicoso efectos, las causas
deben ser buscadas a nivel psíquicos.

16

Los pacientes que los sufren se quejan de trastornos como: vómitos, dolores lumbares,
cefaleas,palpitaciones., pero no hacen referencia a angustia, depresiones, resentimientos y
otros tipos detensiones.Dentro de estas enfermedades se agrupan tres tipos de enfermos:Los
que sufren síntomas físicos sin tener enfermedad corporal que los origine. Suelen
llamarseenfermedades funcionales.

Los que sufren enfermedad física originada por trastornos emocionales.

Los que sufren enfermedad física, pero algunos síntomas de la misma tiene origen psíquico.

Algunas de las enfermedades psicosomáticas son:Síndrome de esfuerzo:

caracterizado por fatiga, palpitaciones, cefaleas, miedo al esfuerzo.

A nivel de aparato digestivo

: úlcera péptica, colitis ulcerosa, gastritis, constipación, hemorroides yalteraciones a nivel de la


vesícula. La elección de este sistema se centra en la relación alimentaría entra lamadre y el hijo.

A nivel respiratorio

: asma bronquial, bronquitis, rinitis alérgica y sinusitis. Aquí la relación reside en elhecho de que la
depresión produce suspiros, la sorpresa corta la respiración, la angustia ahoga y la emociónsofoca.

A nivel cardiovascular

: hipertensión arterial, infarto de miocardio y hemorragias cerebrales. Estas personasson muy


trabajadoras, compulsivas, siempre faltos de tiempo.

Aparato genitourinario

: vaginismo, trastornos menstruales, enuresis, disfunciones sexuales, etc.

Sistema endocrino

: bocio, diabetes, hipertiroidismo y obesidad.

En la piel

: eccema, alopecia, picazón, urticaria, psoriasis, etc.

Aparato locomotor

: dolores lumbares, defectos en la postura, artritis reumatoidea. En éste último, se ha vistola


presencia de una madre restrictiva que limitaba los movimientos del hijo.Entre los factores
psicológicos mas frecuentes causante de estas enfermedades, se encuentran:
angustia,dependencia, temor ante amenaza, agresividad, hostilidad, streess emocional,
preocupaciones, fracasos,disputas, sentimientos de culpas, hipersensibilidad, perfeccionismo, falta
de confianza.

EMOTIVIDAD Y SALUD
La emotividad es un elemento integrante de la existencia humana tiene aspectos positivos cuando
esplacentera, que ayudan a la superación y esfuerzo y facilitan el funcionamiento orgánico y otros
negativos queperjudican tanto física como psíquicamente, como las mencionadas
anteriormente.El logro de un dominio adecuado de la afectividad es muy importante y como la
expresión de la emotividad seaprende, este aprendizaje debe buscar la reducción de la angustia,
es el foco infeccioso y el desarrollo de lasmanifestaciones emocionales gratificantes.Solo así se
llegara a obtener un equilibrio afectivo que predomine en la vida y que acepte tensiones
yconflictos sin perder el control emocional.

17

El aprendizaje emocional debe iniciarse en la infancia el ambiente familiar de cariño y afecto,


emotividadsana, de libertad y exigencia, de comprensión y responsabilidad es la mayor escuela de
aprendizaje emocional.No es buena la sobreprotección que busca librar al niño de todo conflicto y
frustración, como Tampico lo espermitir que se muestre sin respeto a los demás desconociendo
las normas sociales y morales.Objetivo del proceso educativo de la emotividad lograra la madurez
de la misma convirtiéndola en unelemento de salud y de estimulo en la vida. Este objetivo se
habrá logrado cuando la emotividad se caractericepor:El equilibrio entre las exigencias del
individuo y las externas del ambiente.

La ausencia de reacciones emocionales infantiles dominadas por el egoísmo y los instintos.

La tolerancia adecuada a frustraciones y conflictos.

La integración interior que se supone autocontrol, aceptaciones de si mismo y actitudes, valores


ymetas constructivas e integradoras.

La persona que posea estas características en su afectividad será una persona psíquicamente sana
queexperimenta un bienestar interno que vive buenas relaciones con los demás y sabe afrontar las
exigencias de lavida.

ANEXO

Muy frecuentemente al tratar este tema y oír hablar de neurosis y otros tipos de trastornos, existe
la preguntaque es la psicosis y la personalidad anti−social.Como en el ambiente ciertas general
existes ciertas confusiones sobre estas enfermedades, creemosconveniente poner este anexo
como información y elemento de esclarecimiento de este campo.

La psicosis:
Se puede definir:La enfermedad mental, por lo general grave, en la que aparecen síntomas
perturbaciones marcadas del juicio yde la percepción.Los principales síntomas de de a psicosis
son:Cambios bruscos y profundos de la conducta.

Replegarse sobre si mismo sin hablar con nadie.

Cree sin motivo que la gente lo observa, habla de el o trama algo contra el.

Hablar a solas, oir voces, tener visiones soin que existan estímulos.

Tener periodos de confusión mental o perdida de la memoria.

Tener ideas de grandeza.

Experimentar sentimientos de culpabilidad, fracaso, depresión.

Algunos tipos de psicosis son:La esquizofrenia: Que se caracteriza por una actitud de
distanciamiento del ambiente, suspicacia, periodos deimpulsividad destructiva, percepciones
distorsionadas por ideas delirantes y alucinaciones; aislamiento a unmundo de fantasía, ignorancia
de las costumbres sociales y descuido de la presentación personal.

18

La paranoia: caracterizadas por ideas delirantes, persistentes, razonadas lógicamente y


sistematizada. Elcomportamiento general, el habla y las reacciones emocionales no suelen sufrir
alteraciones.La psicosis afectiva: son trastornos de la conducta que se caracterizan,
principalmente, por aumento odisminución en la actividad o en el pensamiento, expresando el
estado de animo depresivo o de exaltación.La fase maniaca se caracteriza por seguridad
exagerada; autosuficiencia, desinhibición, alegría desbordante;socialmente agresivo, jactancioso,
extravagante en sus gustos; planes ambiciosos, inicia empresas quefracasan pronto o abandona en
poco tiempo; actividad excesiva; atención dispersa.La fase depresiva: se caracteriza por tristeza,
pesimismo, sentimientos de culpa, retardo del pensamiento y dela afectiviad, sufrimiento afectivo,
acompañado de tensiones musculares, cuerpo encorvado, mirada fija haciaabajo, cara con
expresión de pena.

LA PERSONALIDAD ANTI−SOCIAL:
Se llama personalidad anti−social a ciertas alteraciones en los rasgos de la personalidad, debido a
una falta deidentificación con los medios de adaptación socialmente aceptados, a la ausencia de
controles de lasreacciones de ira y hostilidad hacia las demás personas.El origen de este tipo de
trastornos es psicógeno:Ausencia de padres o de adultos que puedan sustituirlos, falta de
experiencia para identificar su yo,situaciones de rechazo.Las características más resaltantes, de la
personalidad anti−social son:Falta de lealtad hacia otras personas.

Insensibilidad a los problemas.

Entrega a los placeres inmediatos.

Ausencia del sentido de responsabilidad.

Carencia de juicio social.

Falta de conciencia moral.

Los anti−sociales son individuos falto de ética y moralidad, conducta destructiva del bienestar y
orden social,rudeza, sin sentido de responsabilidad; vida emocional fría pareciendo ser incapaces
de establecer relacionesemocionales maduras; carecen de ambición y de seriedad; son
brutalmente egoístas y no sientenremordimiento por sus acciones.REPUBLICA BOLIVARIANA DE
VENEZUELAMINISTERIO DE EDUCACION CULTURA Y DEPORTESUE ANIBAL PARADISI

CONDUCTA EMOCIONAL:SU MOTIVACIÓN CONSCIENTE E INCONSCIENTE

MARIARA, ENERO 2006.

INTRODUCCIÓN

19

Son, pues, estados anímicos que manifiestan una gran actividad orgánica, que se refleja a veces
como untorbellino de comportamientos externos e internos, y otras con estados anímicos
permanentes.Estas se conciben como un comportamiento que puede ser originado por causas
externas e internas; que puedepersistir, incluso, una vez que ha desaparecido el estímulo y que
acompaña necesariamente, en mayor o menorgrado, toda conducta motivada.Se puede decir, que
las emociones no son entidades psicológicas simples, sino una combinación compleja deaspectos
fisiológicos, sociales, y psicológicos dentro de una misma situación polifacética, como
respuestaorgánica a la consecución de un objetivo, de una necesidad o de una motivaciónLas
emociones como los motivos pueden generar una cadena compleja de conducta que va más allá
de lasimple aproximación o evitación.

CONCLUSION:

Hoy ya sabemos que las personas emocionalmente inteligentes son más eficaces en la vida. Sin
embargo, esono significa que quienes no lo sean no puedan alcanzar el éxito.Las emociones son
estados afectivos, de expresión súbita y de aparición breve, pueden según lo
estudiadoanteriormente, crear un impacto positivo o negativo sobre nuestra salud física, mental y
espiritual.Determinaremos cada uno de estos estrados como influyen en nosotros y cuales son sus
consecuencias:Emociones que afligen: Son aquellas que promueven o mantienen los procesos de
enfermedad a través de unaserie de conexiones psiconeuroinmunológicas, mencionaremos en
Primer Lugar. La Ira o Rabia, la cual abarcatres etapas.La Inicial: Desconfianza ante el medio que
rodea la persona.Luego: Sentimiento de molestia o rabia como tal.Finalmente: La conducta
expresiva como gritar, agredir, romper o tirar objetos. En Segundo Lugar LaDepresión, es decir, la
tristeza acompañada de una visión negativa de si mismo, el mundo que lo rodea y sufuturo, esta
afecta cualquier proceso de recuperación de cualquier otra enfermedad. En Tercer Lugar
LaAnsiedad que consiste en una preocupación constante y excesiva por los acontecimientos en
nuestra vidadiaria. En Cuarto Lugar Represión o Negación es donde la persona no expresa o no
toma conciencia de queexiste algo que le causa molestia o dolor emocional, siendo grave para
nuestra salud integral.Para controlar de mejor forma las emociones, tanto positivas como
negativas las cuales forman parte denuestra vida, y que es normal que las sintamos, ya que sin
ellas aquellos Grandes Cerebros no contarían en lahistoria, ni tampoco los Retención, Recepción,
Análisis, Emisión y controlen funciones de nuestro cuerpo enforma integra, de la misma forma La
Inteligencia Emocional en el Trabajo, Competencias, HabilidadesTécnicas y Cognoscitivas son
indispensables en nuestro crecimiento personal, familiar y empresarial, parallenarnos de
conocimientos y aprender a manejarnos en ciertas y determinadas circunstancias aplicando
yPracticando pensamientos y sentimientos saludables como estos:Sonríe: Este cambio en
los músculos faciales produce una serie de cambios bioquímicos que cambian nuestraemoción y
favorece la salud.Reenfoca el problema: Trata de encontrarle lo positivo a lo que sucede, recuerda
que las situaciones difícilesson una gran oportunidad para aprender y que has experimentado
situaciones conflictivas en el pasado y

20

pudiste seguir adelante.Expresa tus Sentimientos: Sean molestia o dolor conversando con la
persona involucrada (con personasamigas o de confianza) o escríbele una carta donde desahogues
tus emociones.BIBLIOGRAFÍARELLOSO GERADO, PSICOLOGIA, 4º AÑO. EDICIONES CO−BO

……………………………………………………..

1. El hombre como unidad bio-psicosocial

2. Las necesidades espaciales del hombre

3. Los factores psicológicos


4. Mecanismos del proceso

5. Desarrollo de la senso percepción

6. Las emociones

7. Bases fisiológicas

8. Características de las reacciones emocionales

9. Desarrollo de las emociones

10. Stress psicológico y relación con la salud

11. Los procesos cognoscitivos

12. Pensamiento y lenguaje

13. Procesos cognoscitivos y adquisición de pautas y control de la conducta

14. Necesidades humanas

15. Interacción social

16. Actitudes

17. Conclusiones

18. Bibliografía

INTRODUCCION

La psicología es la ciencia de los fenómenos psíquicos, o sea de las funciones cerebrales que
reflejan la realidad objetiva.

Los fenómenos psíquicos, sensaciones y percepciones y sentimientos, deseos, necesidades e


intereses y capacidades, cualidades volitivas y rasgos de carácter, son muy familiares pero la
concepción científica y verdadera de estos fenómenos constituye una gran importancia en los
seres humanos.

La información de este trabajo nos da la formación de lograr comprender la conducta humana, la


propia conducta es decir, los factores que intervienen en ella, como se interrelacionan para
producirla y conocer diversos aspectos corporales y psíquicas.

El proceso senso-perceptivo analiza los procesos psicológicos, y que toda conducta se origina en la
recepción de estímulos, el cual responde la percepción. La interpretación de los estímulos, nos
lleva ha lo emocional, hecho en el cual nos puede llevar a no apreciar con exactitud, e interpretar
en forma inadecuada lo que percibimos.

En la psicología las investigaciones sobre la conducta humana el psicólogo trata con respeto la
integridad del sujeto que investiga y presupone una asimilación de ética profesional, es obstante
que la psicología como profesión requiere ineludiblemente de los que estudien y ejerzan, un
profundísimo sentido de respeto al ser humano con quien han de entenderse, una caba y sincera
comprensión de la necesidad de cada persona.

EL HOMBRE COMO UNIDAD BIO-PSICOSOCIAL

En el espacio surgen diferentes conceptualizaciones de esta idea, Cassirer, por ejemplo, señala las
diferencias entre espacio orgánico, el que está determinado por las necesidades biológicas de todo
ser vivo, y el espacio abstracto, aquel que se desarrolla por la reflexión humana, la cual extrae del
mundo natural sus cualidades para formular ideas.

Dentro de este espacio se indica un nivel práctico, el de la identificación de los lugares inmediatos,
el de la vida diaria. También identifica el espacio perceptivo, como una característica de
los animales superiores y que surgen de la experiencia sensible, óptica, táctil, acústica y quinésica,
todas estos estímulos se conjugan para dar una imagen del espacio perceptivo.

Hay una categoría más planteada por Cassirer, el del espacio simbólico, fruto de la memoria y
desarrollado a través del lenguaje, condición que favorece la acepción del espacio y que se gesta a
partir de diferentes experiencias espaciales dentro de la sociedad.

Al plantearse estas reflexiones Cassirer apunta que el hombre requiere desarrollar el sentido del
espacio La existencia humana es lo que es sólo en relación con un espacio. La existencia es espacio
().

La espacialidad es una definición esencial de la existencia humana esta idea es ampliamente


explicada en el texto de Fiedrich Bollnow con título "Hombre y espacio"(). Aquí explica el autor
que es conveniente no confundir la vivencia del espacio como experiencia psíquica con lo
vivencial. La expresión de espacio vivido tiene la ventaja de indicar que no se trata de algo
psíquico, fruto de una experiencia momentánea, sino del espacio mismo, de la imagen que se
adquiere al vivir en él y con él, del espacio como medio de vida humana. La existencia humana es
lo que es sólo en relación con un espacio. La existencia es espacio, señala categórico Bollnow.

Al hacer estas reflexiones sobre el espacio apunta que la referencia a esta condición espacial no
significa que el hombre, así como todo su cuerpo, llene un ámbito determinado, que ocupe
un volumen (), expresa más, indica que el hombre está circunscrito en su vida siempre y
necesariamente por un espacio que le rodea.

El arquitecto construye edificios que habitará el ser humano y requiere, por lo mismo, conocer
todas las necesidades espaciales que los seres humanos tenemos para que estos espacios, estén
completos.

Al realizar esta acción más que construir muros, techos, puertas y ventanas el arquitecto construye
los lugares en los que vivirá un hombre, una familia, una sociedad. Los cuales no se constituyen
sólo por los ladrillos de las paredes sino también por los anhelos, experiencias, deseos y todas las
manifestaciones culturales del hombre y la sociedad.

La búsqueda del espacio para vivir es un hecho natural a todo ser vivo, sin embargo para el
hombre el espacio tiene una característica distinta, no sólo es lo que la naturaleza por si misma
ofrece, también es algo significativo. El espacio que se habita no sólo existe de forma natural,
existe también a partir de la mente del ser humano.
LAS NECESIDADES ESPACIALES DEL HOMBRE

LOS FACTORES PSICOLOGICOS


LA SENSO PERCEPCION

Es un mecanismo que permite dar una apertura a todos los sentidos del cuerpo, ya que
generalmente no lo hacemos por estar saturados de información visual emitida bajo el
descubrimiento de los sentidos: visual, auditivo, kinestesico, térmico y olfativo; para buscar
una actitud consciente y sensible hacia si mismo.

La senso percepción se inicia con la presencia de un estimulo y que tiene como objetivo la
extracción de una información que nos va a proporcionar la representación del mundo exterior.

MECANISMOS DEL PROCESO

a.- Se inicia con la presencia de un estimulo.

b.- Son las fases interpretativas de los estímulos recibidos. La percepción necesita de la sensación,
aunque es un fenómeno más complejo.

c.- La sensación es un concepto fisiológico y la percepción es un concepto psicológico.

d.- La sensación es un fenómeno innato y la percepción es adquirida a través del aprendizaje.

Todo individuo realiza la censo percepción teniendo su organismo unas determinadas condiciones
fisiológicas: descanso, dolor, sueño, cansancio, hambre, sed, enfermedad, malestar, etc., estando
psíquicamente influenciado por motivaciones, intereses, preocupaciones, estado de
animo, personalidad, etc. Además, se percibe en un ambiente determinado con sus propias
condiciones. Es decir, la percepción se efectúa dentro de un campo psicofísico.

Los objetivos que se plantea senso percepción son básicamente la movilización del cuerpo a través
de la sensibilización de músculos, articulaciones, piel, y la toma de conciencia de que si conocemos
nuestro cuerpo y estamos atentos, podemos prevenir tensiones musculares, desvíos de columna,
posturas incorrectas por muchos. Un cuerpo sano es aquel en el que los músculos están estirados
y a la vez tienen la fuerza suficiente para sostener el esqueleto y para esto necesitamos la
movilización periódica de todos nuestros tendones y músculos (incluso aquellos cuya existencia no
nos es evidente), por lo que es importante conocernos y vivir más sana y plenamente. Nuestro
cuerpo, huesos, tendones y músculos están colocados de forma armónica y equilibrada, mantener
este equilibrio no es difícil.

Una de las técnica hace hincapié en la piel, que es el órgano que envuelve todo nuestro cuerpo,
nos contiene, nos protege, por lo que su importancia va más allá de lo estético, además es una
fuente de placer que no aprovechamos en todas sus posibilidades, nos sorprendería la variedad de
sensaciones que obtendríamos a través de una exploración minuciosa por cada rincón de nuestra
piel que por lo general pasamos por alto. Como por ejemplo la que está entre los dedos de la
mano.

Nuestro cuerpo nos representa de muy diversas formas, si le prestamos atención es como un
mapa en sus formas y costumbres: si la columna se desvía de un modo específico, si hay tensión
en la cintura o en los hombros. Manejarnos con sensibilidad hacia uno mismo nos enseña a
percibir el mundo interno de los demás, nuestra comunicación es más profunda si sabemos
observar el lenguaje corporal, el estado en que se halla la otra persona.
En cuanto a la respiración, la utilizamos como vehículo para la relajación, oxigenación y como
regulador de nuestro ritmo.

DESARROLLO DE LA SENSO PERCEPCION

La mente humana es un doble flujo informativo, desde afuera hacia dentro y desde adentro hacia
fuera, lo que llevara a una intelectualizacion y posterior síntesis de todas las sensaciones
percibidas, externas o internas. De esta manera cada persona va construyendo su realidad. El
proceso de la realidad percibida es fundamental en el desarrollo de la vida individual, porque la
realidad sobre el cual se edificaron y se siguen edificando los dos polos psíquicos de la existencia
humana, la cordura y la locura.

La psiquiatría clásica de los años 30 adopto el concepto de realidad para dividir a


las enfermedades mentales en dos grandes grupos: las neurosis, caracterizadas por
un mantenimiento del contacto con la realidad, y la psicosis cuyo síntoma cardinal era la pérdida
del contacto vital con la realidad. Habiendo pasado desde entonces tres cuartos de siglo, se sigue
hablando y discutiendo acerca de la realidad.

Pero se han conducidos cambios importantes en el mundo, en la gente y en la percepción de la


realidad. Los conceptos básicos se mantienen pero en nuestros días ya es corriente, la realidad
virtual.

Que es una especie de realidad inducida es decir, algo que nos impone, o que viene programado
de antemano y es desencadenante o que actúa como un estimulo. La reacción de cada individuo
se deriva de la percepción privada o intima de esa realidad virtual. Cada persona elabora y genera
desde su propia visión de lo que es real y lo que no es. Lo real esta en el interior de cada uno y
como cada uno percibe, ya no solo de acuerdo con la información elaborada por sus órganos
sensoriales, sino también desde las asociaciones internas que se producen en cada ser, toda vez
que le llega una nueva información, o un nuevo estimulo y este se contacta con
su banco de datos inconsciente, que abarca desde sentimientos y emociones hasta las mas
primitivas reacciones instintivas.

Este proceso que tiene fases rápidas e instantáneas y que posee después también respuestas
retardadas, esas que surgen de la unión de los últimos restos libres del estimulo con los elementos
mas profundos de las capas aparentemente ocultas de la conciencia. Es una serie de reacciones
encadenadas que se desplazan y transcurren entre neurotransmisores, receptores, micro
partículas mas pequeñas y mas grandes, mas pesadas y mas livianas. En ese constante fluir y
refluir de macro y micro moléculas se va gestando la individualidad específica de cada ser humano.

Todos los sentidos intervienen en el desarrollo de la percepción, por ejemplo un niño agita una
sonaja (oído) , después de agarrarla (tacto) y luego la mordisquea (gusto) a través de
estas acciones el entra en la interacción con ese objeto para reconocerlo. Esos conocimientos se
afirman y las percepciones se vuelven mas significativas a lo largo de los años dos factores son
importantes en este desarrollo, la maduración del sistema nervioso y la experiencia en el mundo.

LAS EMOCIONES
Son estados anímicos que manifiestan una gran actividad orgánica, que se refleja a veces como un
torbellino de comportamientos externos e internos, y otras con estados anímicos permanentes.
Estas se conciben como un comportamiento que puede ser originado por causas externas e
internas; que puede persistir, incluso, una vez que ha desaparecido el estímulo y que acompaña
necesariamente, en mayor o menor grado, toda conducta motivada.

Se puede decir, que las emociones no son entidades psicológicas simples, sino una combinación
compleja de aspectos fisiológicos, sociales, y psicológicos dentro de una misma situación
polifacética, como respuesta orgánica a la consecución de un objetivo, de una necesidad o de
una motivación .Las emociones como los motivos pueden generar una cadena compleja de
conducta que va más allá de la simple aproximación o evitación.

BASES FISIOLOGICAS

Las emociones van siempre acompañadas de reacciones somáticas. Son muchas las reacciones
somáticas que presenta el organismo, pero las más importantes son:

-Las alteraciones en la circulación.

-Los cambios respiratorios.

-Las secreciones glandulares

El encargado de regular los aspectos fisiológicos de las emociones es el Sistema Nervioso. El


sistema nervioso autónomo acelera y desacelera los órganos a través del simpático y para-
simpático; la corteza cerebral puede ejercer una gran influencia inhibitoria de las reacciones
fisiológicas; de este modo algunas personas con entrenamiento logran dominar estas reacciones y
llegan a mostrar un auto control casi perfecto.

El detector de mentiras es una máquina de detectar si el sujeto falsea las respuestas. Este aparato
intenta medir las reacciones Fisiológicas en el ritmo cardíaco y respiratorio, así como la tensión
sanguínea.

El cambio mas notable es la elevación del azúcar sanguíneo. Además de estas alteraciones
fisiológicas, se secreta adrenalina a la sangre por la medula suprarrenal, que es la parte no
endocrina de las glándulas suprarrenales. La adrenalina eleva la azúcar en la sangre, la coagula
más rápidamente, y aumenta la presión arterial.

Además del control e integración de las reacciones emocionales, reside principalmente en el


hipotálamo y en otras estructuras conocidas como sistema limbito; este último mantiene una
estrecha relación con la corteza cerebral, donde se centrarían las emociones subjetivas de la
emoción, el sistema limbito esta formado por una serie de estructuras, que son las siguientes:

1.- "Tiene una estrecha relación entre si."

2.- "Se conectan íntimamente con el hipotálamo y el tálamo."

3.-Se enlazan de manera estrecha con muchas otras regiones de la corteza cerebral."

CARACTERISTICAS DE LAS REACCIONES EMOCIONALES


1.- Las emociones varían de intensidad desde los estados moderados, tales como variaciones
ligeras de carácter, hasta las más intensas que desintegran y desorganizan la conducta.

2.- Las emociones son selectivas, pues provoca concentración sobre ciertos estimulo, mientras
excluye otros que compiten; un ejemplo seria como el de un viejo refrán "El amor es ciego" que
hace referencia a que la persona enamorada no ve las fallas, sino de la positivo de la persona que
lo atrae.

3.- Las emociones fuertes dominas la conciencia y la razón, por eso una persona aterrorizada, no
puede pensar en otra cosa sino en su propio miedo, a veces no come, no puede dormir y hasta se
le dificultan las tareas normales diarias.

4.- Finalmente, las emociones como experiencia consciente, son de naturaleza subjetiva. Por esta
característica nunca podemos estar seguro de haber entendido con exactitud como otra persona
siente, incluso, aun así si escuchamos el propio relato de sus sentimientos.

DESARROLLO DE LAS EMOCIONES

Un adulto no manifiesta sus emociones complejas totalmente, sino que a lo largo de su proceso de
desarrollo se encuentra con diferentes tipos de emociones. En algunas investigaciones se ha
podido encontrar que cualquier forma de estimulación repentina produce en el niño recién nacido
una actividad incardinada de la mayor parte de la musculatura, y este estimulo debe ser muy
fuerte para provocar reacción. Esta actividad fue identificada como una excitación general, la cual
presentan los niños ante cualquier situación, como al ser tomados en brazos, o cuando tenían
algún dolor, o cuando le ofrecían un tetero. Hacia el final del primer mes, comienzan a observarse
una clase de emoción: la aflicción, la cual se manifiesta en una forma peculiar de llanto, en el
rubor del rostro, en la acción de apretar los puños, de patalear, etc.; esta es desencadenada por
estímulos desagradables tales como incomodidad, dolor, hambre. Hacia el segundo mes comienza
aparecer una emoción positiva que se manifiesta con sonrisas, susurros y movimientos tranquilos.
Para el tercer mes, se pueden apreciar más claramente la angustia y el deleite.

En los tres y seis meses hay una diferenciación, la angustia se convierte en cólera, disgustos y
miedos mientras que el deleite se convierte en júbilo y afecto hacia el final del año. Los celos y el
afecto hacia los niños aparece hacia el año y medio; y a los dos años aparece la alegría y el placer.
De estos elementos básicos se generan el resto de las emociones que van agregándose
paulatinamente.

En este desarrollo interviene la maduración, claro todos los niños no atraviesan por esta secuencia
a la misma velocidad pero la secuencia es la aparición de las mismas es muy semejante entre un
niño y otro, independientemente de que hallan tenido o no, la oportunidad de presenciar estas
emociones en otras personas.

A medida que el niño crece, aumentan las posibilidades para el aprendizaje, y se hace cada vez
más difícil averiguar, que proporción de la expresión emocional puede ser atribuida a la
maduración o al aprendizaje.

STRESS PSICOLOGICO Y RELACION CON LA SALUD


El stress es el estado del organismo en cualquier situación en que se percibe que su bienestar o
equilibrio esta en peligro y que debe dedicar todas las energías a su protección.

La tristeza, el desaliento y los auto reproches producían palidez prolongada de la mucosa e


hiposecreción. La angustia producía hipermotilidad. Los sentimientos agresivos, incluyendo el
resentimiento y la hostilidad, producían un gran aumento en la secreción y en la vascularidad y un
aumento discreto en la motilidad.

De acuerdo con lo que las observaciones clínicas y de laboratorio muestran en la actualidad, las
experiencias que despiertan una emoción de gran de gran intensidad, ya sea porque son súbitas o
inesperadas o porque ocurren de manera variable o prolongada, tienen el potencial de establecer
patrones que desorganizan el funcionamiento orgánico.

Las respuestas psicofisiológicas pueden interpretarse como la perpetuación inapropiada de las


reacciones orgánicas que han servido para adaptarse a, o protegerse de, algún stress en la
experiencia de la vida humana.

El síntoma psicosomático representa la concomitante fisiológica de un estado emocional. Los


psicoanalistas han postulado que los síntomas representan regresiones fisiológicas, en la misma
forma en que los síntomas psicológicos a menudo expresan la reaparición de formas infantiles de
conducta, como una tentativa para resolver un conflicto.

Algunos psiquiatras opinan que los factores psicológicos no son los que determinan cuál sistema
orgánico se afectará por las influencias que actúan emocionalmente, sino más bien existe una
tendencia hereditaria a responder somáticamente ante el stress y ante el conflicto, en una forma
característica para cada individuo.

Según la experiencia clínica muestra que a veces un individuo puede tener, en forma sucesiva o
simultánea, trastornos que afectan a varios sistemasorgánicos. Con el objeto de clasificar estas
fallas, se separarán según el sistema en el que aparecen.

Sistema cardiovascular:

Se ha demostrado que el stress que provoca angustia tiende a aumentan la frecuencia de los
latidos cardíacos, el gasto cardíaco, y la presión sanguínea, así como a provocar cambios en el
ritmo y en el electrocardiograma. Estos desarreglos funcionales pueden volverse el foco neurótico,
especialmente si el médico emite algún comentario imprudente con respeto a ellos.

Tratamiento:

Cuando la función cardiaca está notablemente alterada debido a una lesión somática grave, una
carga de angustia añadida por el lado psíquico puede ser suficiente para inclinar la balanza
en dirección de la insuficiencia.

Una relación médico-enfermo que sea fuerte, segura y constructiva, ayudará al paciente a manejar
las tensiones intrínsecas y extrínsecas, y las situaciones vitales emocionalmente angustiantes.

En la enfermedad cardiaca, especialmente en la trombosis coronaria, el médico debe tratar de


disipar el miedo que el paciente tiene ante su trastorno, ya que lo ve como una dolencia que le
producirá incapacidad o muerte.
Hipertensión:

La hipertensión vascular no es, desde luego una enfermedad específica, sino más bien una
reacción sistemática que puede ser inducida por muchas causas. Los casos en los que el psiquiatra
se interesa primariamente son aquellos en los que un factor principal es la tensión emocional, que
actúa a través del sistema nervioso vegetativo y provoca vasoconstricción.

La personalidad de un paciente hipertenso muestra serenidad y afabilidad aparente, pero


encubre actitudes conflictivas de predisposición a la hostilidad agresiva que debe reprimirse a fin
de mantener fuertes ligas de dependencia, especialmente hacia personas que ocupan puestos
de autoridad.

Migrañas:

Este síndrome consiste en un mal funcionamiento neurovascular con muchas facetas, con otros
síntomas somáticos que también se acompañan de alteraciones en el estado de ánimo, en
individuos con una personalidad perfeccionista y de gran empuje, del tipo ejecutivo cuyas metas
son siempre ambiciosas.

Síntomas:

Se presenta cambios en el estado de ánimo, asociados a un aumento en la variabilidad del estado


contráctil de los vasos sanguíneos, especialmente en la cabeza

También aparecen enrojecimientos o lagrimeo del ojo afectado, edema de la mucosa nasal, y
contracción dolorosa de la musculatura del cuello en algunos pacientes. En otros hay nauseas,
vómitos, retención de líquidos y diversos fenómenos de otros tipos, que se asocian a la migraña.

Aparato gastrointestinal:

Los síntomas de trastornos gastrointestinales son múltiples, ya que se extienden, desde los que se
localizan en la cavidad bucal y que el dentista observa con mayor frecuencia, hasta la gran
variedad de expresiones de mal funcionamiento en el estómago, el intestino delgado y intestino
grueso, y en los principales órganos secretores que se relacionan con la digestión.

Los síntomas más frecuentes son: anorexia, náusea, indigestión nerviosa, incomodidad por gases,
vómito, eructos, dolor epigástrico, diarrea y constipación.

La obesidad:

Se ha interpretado en gran parte como un aumento en el impulso coercitivo que lleva el individuo
a comer. Se ha tratado de elucidar el origen de tal impulso patológico, tanto por medio de impulso
fisiológico como por medio de estudios psicológicos.

El desarrollo de la obesidad suele ocurrir en un marco familiar en el que los padres compensan las
propias frustraciones y desengaños de su vida a través de su devoción hacia el niño.

Al pasar el tiempo, la imagen del cuerpo obeso llega a tener un gran significado emocional para el
paciente, ya que suele representar el deseo poderoso y en la vida real proporciona satisfacción

Artritis reumatoide:
La artritis reumatoide proviene de la frecuente observación de que la aparición o la exacerbación
de la enfermedad se han relacionado con períodos de stress emocional. Este paciente es un
individuo emocionalmente tranquilo, que rara vez expresa abiertamente sus sentimientos y que
parece tener satisfacciones sirviendo a los demás.

Sistema respiratorio:

La conducta emocional afecta a el sistema respiratorio tanto en su expresión como en su acción. El


llanto y la risa, los gritos o el habla, implican cambios en la acción respiratoria; la respiración
excesiva o lo opuesto son repuestas típicas durante períodos contrastantes de acción o descanso.
Dentro de estas están el síndrome de hiperventilación, el asma, etc.

Sistema endocrino:

Diabetes mellitus, hipertiroidismo, sistema genitourinario, impotencia y eyaculación prematura,


trastornos menstruales, reacciones ante el aborto, la esterilización y la contracepción.

Sistema nervioso: Alteraciones de la imagen del cuerpo, neurastenia.

SITUACIONES DE EMERGENCIA Y EL STRESS

El primer paso para combatir el stress es ser conciente de cuáles son los estresores específicos
para ese individuo y cuáles sus reacciones físicas y emocionales. Y para ello es necesario.

 Percibir el stress, no negarlo.

 Darse cuenta de qué cosas lo estresan.

 Determinar cómo reacciona su cuerpo al stress.

En segundo lugar, reconocer qué se puede cambiar.

 Pueden ser eliminados o evitados los estresores?

 Puede reducirse su intensidad?

 Puede reducirse la exposición a ellos?

En este punto es importante recordar que uno sólo puede pretender cambiarse a sí mismo, no a
los demás.

En tercer lugar, reducir la intensidad de las reacciones emocionales al stress. La reacción de stress
es disparada por la percepción de peligro (físico o emocional).

 Está la persona percibiendo sus estresores de manera exagerada?

 Está tratando de complacer a alguien?

 Está reaccionando exageradamente y viendo las cosas como absolutamente críticas y


urgentes?

 Trabajar para adoptar puntos de vista más moderados.

En cuarto lugar, aprender a moderar las reacciones físicas al stress.


 Las técnicas de relajación (como la Relajación Muscular Progresiva de Jacobson, el
Entrenamiento Autógeno de Schultz, Hipnosis o Autohipnosis, Yoga, Meditación
Trascendental, etc.) ayudan a reducir la tensión muscular

 Aprender a respirar lenta y profundamente para permitir volver a la normalidad el ritmo


cardíaco y respiratorio

 Hacer ejercicios aeróbicos no competitivos para reducir la tensión en el momento agudo


del stress

En quinto lugar, construir reservas físicas.

 Nadar, caminar, andar en bicicleta, etc. regularmente

 Comer balanceadamente, evitando estimulantes (nicotina, alcohol, cafeína, etc.)

 Alternar el trabajo con el placer

 Dormir el tiempo suficiente

En sexto lugar, mantener las reservas emocionales.

 Desarrollar relaciones personales mutuamente gratificantes

 Buscar apoyo emocional

 Plantearse metas realistas

 Estar preparado para algunas frustraciones, penas y fallas, y permitirse no ser perfecto.

 Por último, aunque parezca obvio, la consulta con un profesional médico o psicólogo,
especializado en el tema del Stress ayudará a recuperarse más rápida y eficazmente de
esta enfermedad endémica de nuestra época.

LOS PROCESOS COGNOSCITIVOS

Jean Piaget (1896-1980), psicólogo y pedagogo suizo, conocido por sus trabajos pioneros sobre el
desarrollo de la inteligencia en los niños. Sus estudios tuvieron un gran impacto en el campo de la
psicología infantil y la psicología de la educación.

Nacido en Neuchâtel (Suiza), Piaget escribió y publicó su primer trabajo científico cuando tenía
sólo diez años. Estudió ciencias naturales en la Universidad de Neuchâtel y, después de doctorarse
a los 22 años, comenzó a interesarse por la psicología, disciplina que estudió e investigó, primero
en la Universidad de Zurich (Suiza) y después en la Sorbona, París, donde inició sus estudios sobre
el desarrollo de las capacidades cognitivas. En 1955 fue nombrado director del Centro
Internacional de Epistemología Genética de la Universidad de Ginebra, y después codirector de
la Oficina Internacional de Educación.

En sus trabajos, Piaget distinguió cuatro estadios del desarrollo cognitivo del niño, que están
relacionados con actividades del conocimiento como pensar, reconocer, percibir, recordar y otras.
En el estadio sensoriomotor, desde el nacimiento hasta los 2 años, en el niño se produce la
adquisición del control motor y el conocimiento de los objetos físicos que le rodean. En el periodo
preoperacional, de los 2 a los 7 años, adquiere habilidades verbales y empieza a
elaborar símbolos de los objetos que ya puede nombrar, pero en sus razonamientos ignora el rigor
de las operaciones lógicas. Será después, en el estadio operacional concreto, de los 7 a los 12
años, cuando sea capaz de manejar conceptos abstractos como los números y de establecer
relaciones, estadio que se caracteriza por un pensamiento lógico; el niño trabajará
con eficacia siguiendo las operaciones lógicas, siempre utilizando símbolos referidos a objetos
concretos y no abstractos, con los que aún tendrá dificultades. Por último, de los 12 a los 15 años
(edades que se pueden adelantar por la influencia de la escolarización), se desarrolla el periodo
operacional formal, en el que se opera lógica y sistemáticamente con símbolos abstractos, sin una
correlación directa con los objetos del mundo físico.

Entre su vasta obra, destacan: El pensamiento y lenguaje del niño (1926), Juicio y razonamiento en
el niño (1928), El nacimiento de la inteligencia en el niño (1954), Seis estudios de psicología
(1964), Biología y conocimiento (1967) y Psicología y pedagogía (1970).

PENSAMIENTO Y LENGUAJE

El pensamiento y el lenguaje son los procesos cognoscitivos, el lenguaje es el matrimonio mas


importante de la humanidad, para la persona media el lenguaje es fundamental, como medio de
comunicación, pero realmente su valor, va mucho mas allá, porque así como se dice que no hay
sociedad humana sin cultura, tampoco hay cultura sin lenguaje, esta es una de las características
que hace claramente humana la conducta del hombre.

Hay por lo menos tres formas en que la comunicación humana difiere de la de los otros primates:
Primero, la comunicación humana es de naturaleza simboliza, un gesto, una expresión facial o
un sonido, tienen su significado. Segundo, estos símbolos son aprendidos y tercero, esos símbolos
además de expresar emociones describen o designan objetos, hechos o acciones.

DESARROLLO DEL PROCESO DEL PENSAMIENTO Y EL LENGUAJE

El idioma es una especie de computadora que funciona de manera automática, como los procesos
de asociación antes de pensar, entonces habría que suponer que el lenguaje está primero. La
"teoría reguladora" explica que la acción y el pensamiento dependen de la capacidad lingüística de
la persona, en tanto el psicólogo suizo Jean Piaget, cuya teorías cognitivas son ampliamente
conocidas, sostiene que el lenguaje es, en gran medida, el producto del desarrollo de la acción y el
pensamiento, ya que tanto la palabra como la idea son imágenes observadas y no a la inversa.
Empero, no faltan quienes aseveran que durante el desarrollo intelectual del individuo hay una
interrelación dialéctica entre el lenguaje y el pensamiento. De modo que responder a la pregunta
si primero está el lenguaje o el pensamiento, es lo mismo que responder a la pregunta si primero
está el huevo o la gallina.

De cualquier modo, las tres teorías fundamentales que responden a la pregunta de si primero está
el lenguaje o el pensamiento se pueden sintetizar así:

"el lenguaje está antes que el pensamiento" plantea que el idioma influye o determina la
capacidad mental (pensamiento). En esta corriente lingüística incide la "gramática generativa" de
Noam Chomsky, para quien existe un mecanismo idiomático innato, que hace suponer que el
pensamiento se desarrolla como consecuencia del desarrollo idiomático. Por lo tanto, si se
considera que el lenguaje es un estado interior del cerebro del hablante, independiente de otros
elementos adquiridos del entorno social, entonces es fácil suponer que primero está el lenguaje y
después el pensamiento; más todavía, si se parte del criterio de que el lenguaje acelera nuestra
actividad teórica, intelectual y nuestras funciones psíquicas superiores (percepción, memoria,
pensamiento, etc.)

"El pensamiento está antes que el lenguaje" sostiene que la capacidad de pensar influye en el
idioma. No en vano René Descartes acuñó la frase: "primero pienso, luego existo". Asimismo,
muchas actitudes cotidianas se expresan con la frase: "tengo dificultad de decir lo que pienso".
Algunos psicolingüistas sostienen que el lenguaje se desarrolla a partir del pensamiento, por
cuanto no es casual que se diga: "Una psiquis debidamente desarrollada da un idioma efectivo".
En esta corriente lingüística esta la llamada "The cognition hypothesis" (La hipótesis cognitiva),
cuya teoría se resume en el concepto de que el "pensamiento está antes que el lenguaje". Pero
quizás uno de sus mayores representantes sea Jean Piaget, para quien el pensamiento se produce
de la acción, y que el lenguaje es una más de las formas de liberar el pensamiento de la acción.
"Piaget indica que el grado de asimilación del lenguaje por parte del niño, y también el grado de
significación y utilidad que reporte el lenguaje a su actividad mental depende hasta cierto punto
de las acciones mentales que desempeñe; es decir, que depende de que el niño piense con
preconceptos, operaciones concretas u operaciones formales.

La "teoría simultánea" define que tanto el lenguaje como el pensamiento están ligados entre sí.
Esta teoría fue dada a conocer ampliamente por el psicólogo ruso L.S. Vigotsky, quien explicaba
que el pensamiento y el lenguaje se desarrollaban en una interrelación dialéctica, aunque
considera que las estructuras del habla se convierten en estructuras básicas del pensamiento, así
como la conciencia del individuo es primordialmente lingüística, debido al significado que tiene el
lenguaje o la actividad lingüística en la realización de las funciones psíquicas superiores del
hombre. Asimismo, "El lenguaje está particularmente ligado al pensamiento. Sin embargo, entre
ellos no hay una relación de paralelismo, como frecuentemente consideran los lógicos y lingüistas
tratando de encontrar en el pensamiento equivalentes exactos a las unidades lingüísticas y
viceversa; al contrario, el pensamiento es lingüístico por su naturaleza, el lenguaje es el
instrumento del pensamiento. Lazos no menos fuertes ligan al lenguaje con la memoria. La
verdadera memoria humana (intermediadora) más frecuentemente se apoya en el lenguaje que
en otras formas de intermediación. En igual medida se realiza la percepción con la ayuda de la
actividad lingüística".

Así pues, las diversas teorías que pretenden explicar el origen del lenguaje, las funciones del
pensamiento y sus operaciones concretas, son motivos de controversias entre los estudiosos de
estas ramas del conocimiento humano. Empero, cualquier esfuerzo por echar nuevas luces sobre
este tema, tan fascinante como explicarse los misterios del universo, es siempre un buen pretexto
para volver a estudiar las ciencias que conciernen al lenguaje y el pensamiento de todo ser dotado
de capacidad racional y sentido lógico.

PROCESOS COGNOSCITIVOS Y ADQUISICION DE PAUTAS Y CONTROL DE LA CONDUCTA

Los pensamientos que tenemos ante una situación, las predicciones sobre lo que va a ocurrir y
cuál es la respuesta más adecuada. Se puede hablar, en general, de dos tipos de expectativas:
Las vinculadas a los resultados previsibles de la conducta. Los individuos, por nuestra
propia historia de aprendizajes, tenemos una idea sobre qué resultados se suelen obtener tras
nuestras conductas. Esta experiencia nos ayuda a la hora de evaluar una situación nueva, a
anticipar o predecir cuáles pueden ser las consecuencias de nuestras conductas.

Las consecuencias asociadas a determinados estímulos presentes en las situaciones. No todos los
estímulos de las situaciones aportan la misma información. Su influencia sobre las expectativas es
clara en dos sentidos:

En primer lugar, porque el conjunto estimular configura una situación particular y, en segundo,
porque aprendemos a diferenciar que ciertos estímulos predicen con más frecuencia unos
acontecimientos que otros. Por ejemplo, el aula en un día de clase es un contexto bien conocido
por los alumnos; pero no todos los estímulos del contexto tienen el mismo significado:
la iluminación, la temperatura o el color de las paredes, en general, suelen ser menos informativos
como estímulos que la cara del profesor, el lugar en el que se coloca o un jersey nuevo de un
compañero. Por ello, cuando uno de estos estímulos presenta variaciones (un día que el profesor
llega sonriente frente a otro en el que llega muy serio) da más información que cualquier otro.

El tema de las atribuciones ha estado habitualmente relacionado con las explicaciones que los
sujetos damos a los resultados de nuestras conductas. Por ejemplo, frecuentemente imaginamos
cuáles han sido las causas que han hecho que, a pesar de nuestra voluntad de ayudar a un ciego a
pasar la calle, alguien nos haya reprochado que los hicimos para impresionar a los que nos veían.
Las atribuciones que realizamos para evaluar cada conducta y su resultado, a la postre, se han de
convertir en nuevo conocimiento, nueva información con la que modificar las expectativas para
adaptarnos mejor a las futuras situaciones.

MOTIVACION Y NECESIDADES

La conducta humana va invariablemente dirigida hacia ciertos fines u objetivos, los cuales
frecuentemente están relacionados con la satisfacción de ciertas necesidades. Cuando nos
preguntamos que es lo que nos mueve a nosotros y a otros organismos vivientes, estamos
planteando un problema acerca de la motivación. El termino motivación proviene del verbo latino
moveré, que significa mover-hacia.

CARACTERISTICAS DE LA CONDUCTA

Tiene las siguientes características:

1.- Energía: La cual va a depender de cada situación y de la fuerza de la necesidad que se pretenda
satisfacer. Si una persona a sido privada por muchas horas de alimento, actuara mas
rigurosamente para obtenerlo, que una que no ha sido privada. Por eso se dice que, si alguien
trabaja más energéticamente que otro es porque su motivación es más poderosa.

2.- Persistencia: Un individuo motivado no abandona fácilmente su tarea. Si a un niño se le


esconde un dulce, no descansara hasta encontrarlo. Si abandona rápidamente la tarea es porque
la motivación no era muy fuerte.

3.- Variabilidad: La persona motivada busca diferentes alternativas en su esfuerzo por obtener una
satisfacción, generalmente no realiza los mismos actos para lograrlo.
4.- Cíclica: Las motivaciones cumplen cierto ciclo, primero se presenta una necesidad (carencia de
algo bien fisiológico o psicológico), que al convertirse en estimulo hace surgir un motivo; luego se
moviliza la conducta para buscar como satisfacer esa necesidad, y finalmente se llega a un objetivo
que hace reducir el motivo.

NECESIDADES HUMANAS

Varios autores han clasificado las necesidades o motivos según diferentes sistemas. La presente
discusión se organizará alrededor de la distinción relativamente fundamental entre necesidades
fisiológicas y psicológicas.

a.- Necesidades fisiológicas: Algunas necesidades básicas de la conducta humana son inducidas
orgánicamente. Estas necesidades son consideradas a veces primarias en el sentido de que no sólo
son básicas para el mantenimiento de la vida, sino que, en casos de grave frustración, tienden
también a tomar precedencia sobre necesidades no orgánicas como estimación y afecto.

En realidad, puesto que las necesidades fisiológicas tienden a ser satisfechas en un mayor grado
que las necesidades psicológicas, por lo menos en nuestra cultura, a menudo ejercen menos
influencia en la determinación de la conducta que estas últimas que son, teóricamente menos
básicas. La siguiente es una lista parcial de las muchas necesidades fisiológicas que podrían
mencionarse:

La necesidad del alimento, el hambre es una necesidad cuya importancia como causa de conducta,
está reducida al mínimo actualmente por la fácil disponibilidad del mismo. Es probable que cierto
grado de agitación en la escuela y aun malo conducta se relacionen con la tensión resultante de
cólicos por hambre.

La necesidad de agua, esta puede ser satisfecha fácilmente.

b.- Necesidades psicológicas. Estos son importantes determinantes de la conducta, principalmente


porque son incapaces de completa satisfacción. Una persona puede comer hasta el punto en que
ya no de otro bocado, pero nunca puede tener todo el amor, la seguridad o el reconocimiento
social que desearía.

Nuevamente, el desglose de estas necesidades es esencialmente una cuestión de


preferencia personal.

Necesidad de afecto, todos deseamos vivir en una relación de efecto recíproco con una o más
personas, trata de ampliar su dominio para abarcar algunos amigos íntimos, luego un novio o
novia y finalmente un cónyuge y familia propia.

La necesidad de pertenencia, se agrupan a menudo bajo el encabezado de seguridad emocional,


cuya importancia, particularmente en la lactancia es universalmente reconocida.

La necesidad de superación, está necesidad esta relacionada con el reconocimiento social y


estimación propia. Se le conoce como motivo para la superación.

La necesidad de independencia. Es una necesidad básica. Las personas desean regir sus vidas, fijar
sus objetivos sin interferencia ni compulsión.
La necesidad de reconocimiento social, llamada también de posición social o aprobación. Es el
deseo evidentemente universal de sentir de lo que somos y lo que hacemos es visto favorable por
otros. Este resulta probablemente en gran medida del condicionamiento a través del elogio que
sus padres confieren al niño.

La necesidad de estimación propia, lo que pensamos de nosotros mismos gira alrededor de


nuestras normas de lo que es bueno y de lo que es malo. Esta necesidad gira principalmente
alrededor de los valores adquiridos durante el proceso de socialización por medio del cual la
sociedad perpetúa su forma de vida.

CLASIFICACION DE LA NECESIDADES

a.- Teoría Hedónica: Esta se basa en el concepto obtenida desde hace mucho tiempo, sobre la
tendencia del organismo a buscar el placer y evitar el dolor, términos que constituyen estados
efectivos o emocionales. Se considera la emoción, como un determinante de la conducta motivada
o al menos como un importante acompañamiento de ella.

No existe una clara distinción entre emoción y motivación, son considerados elementos de un
mismo continuo, muchas motivaciones son de naturaleza emocional ejemplo: situaciones de
miedo o de cólera intenso, surgen conductas orientadas hacia metas.

Esta teoría suele ser empleada en nutrición y en los campos de la salud para incentivar a los
pacientes a través de los gustos.

Mc Clelland, como defensor de este enfoque define el motivo, como asociación afectiva que se
caracteriza por una reacción de mente anticipatoria y basada en asociaciones pasadas de ciertas
clases, con en placer y el dolor.

b.- Teoría de la homeostasis: Según las pulsaciones biológicas constituyen mecanismos


regulatorios que ayudan a mantener el equilibrio biológico del individuo; así el organismo hará lo
imposible por mantener la constancia de su ambiente interno, proceso este llamado homeostasis.

Las pulsaciones biológicas se originan en condiciones fisiológicas que han perturbado el equilibrio
del organismo, lo cual hace aparecer condiciones que motivan a este a buscar una actividad que
desempeñar, tal actividad cesa, únicamente, cuando se logra el objetivo y se restablece el
equilibrio biológico. Aquí también interviene el aprendizaje, el ambiente, muchos psicólogos han
tratado de aplicar el concepto de homeostasis al aspecto social de la motivación, y aunque no
existe un acuerdo total, hay gran cantidad de pruebas que sugieren la existencia de proceso de
equilibracion de la conducta, por tanto de las motivaciones psicosociales.

INTERACCION SOCIAL

Cultura y socialización

En virtud de que la noción de formación, en el ámbito educativo, está cargada de múltiples


equívocos, me gustaría compartir con ustedes algunas reflexiones pedagógicas sobre este
concepto:

Para muchos la formación consiste en adquirir o perfeccionar un saber, una técnica, que se ejerce
en beneficio del sistema socioeconómico.
Otra acepción dice que la formación puede verse también como una institución, como un
dispositivo organizacional compuesto de planes de estudio,programas, certificaciones, etc.

Para Gilles Ferry, autor francés que ha escrito sobre la formación, ésta se define como: "...un
proceso de desarrollo personal tendiente a adquirir o perfeccionar capacidades. Capacidades de
sentir, de actuar de imaginar, de comprender, de aprender, de utilizar el cuerpo". Si tomamos
como válida esta afirmación, debemos renunciar a ciertas maneras de hablar que son frecuentes:
una formación no se recibe ni se da; nadie puede formar a otro, no se puede hablar de la acción de
un formador sobre un "formado".

Dice Ferry, que cada individuo se forma a sí mismo, reflexionando sobre situaciones, sucesos,
ideas, no solamente en el aspecto profesional, sino en todas las facetas del ser humano: uno se
forma en múltiples actividades: como padre, como ciudadano, como consumidor, como inquilino,
etc., y se forma de manera permanente, desde la infancia hasta la vejez.

Sin embarhgo, ninguna persona se forma a través de sus propios sino que requiere de la ayuda de
mediaciones, siendo la educación la más adecuada y necesaria de ellas. De acuerdo con este
enforque, se puede contribuir en gran medida a la formación de los individuos, aunque no puede
garantizarla.

CARACTERÍSTICAS DE LAS ACTITUDES

Podemos destacar una serie de características de las actitudes:

1.- Objeto: las actitudes deben tener un punto focal. Este puede ser abstracto o tangible.

2.- Dirección: favorable, desfavorable.

3.- Grado: cuánto gusta o disgusta el objeto.

4.- Intensidad: nivel de seguridad o confianza de la expresión relativa al objeto o bien la fuerza
que atribuye a su convicción.

5.- Estructura: organización en las actitudes, es decir, tienen consistencia interna y una
centralidad interactitudinal.

6.- Aprendizaje: las actitudes se aprenden.

Tomemos como ejemplo la miel. Si te gusta, la actitud tiene una dirección favorable, el grado
sería si te gusta poco, mucho, muchísimo..., la intensidad sería el nivel de convicción del individuo
sobre su decisión de que la miel le gusta mucho.

En la vida cotidiana, el término "personalidad", es comúnmente utilizado. Sin embargo, en la


psicología se le otorga un sentido técnico especial.

A la personalidad se la define como todos los rasgos emocionales y conductuales relativamente


estables y predecibles, que caracterizan a una persona. Estos rasgos y conductas determinan la
manera, que cada uno posee, de relacionarse con los otros y de enfrentarse con el mundo.

De la historia del desarrollo individual de cada sujeto, emerge un sentido de funcionamiento


psicológico habitualmente fijo. Es a través de la interacción de la disposición constitucional de
cada individuo y de las respuestas de su medio ambiente, que las personas van adquiriendo un
repertorio de rasgos y conductas, profundamente grabados y difíciles de modificar. Es decir, que
en la infancia el ser humano se comporta espontáneamente, según su carácter y su
temperamento, mientras que va aprendiendo que conductas son recompensadas por su familia o
personas significativas y cuales no son permitidas, hasta llegar a cristalizar un repertorio de las
mismas, predominantemente en un sentido.

Según Dr. Theodore Millon (reconocido especialista de los trastornos de la personalidad), la


personalidad es vista hoy como un modelo complejo, de características psicológicas profundas,
que son generalmente inconscientes, que no pueden ser erradicadas, y se expresan
automáticamente en cada faceta del funcionamiento individual. Sus rasgos, intrínsecos y
persistentes, emergen de una complicada matriz de disposiciones biológicas, del aprendizaje, de
percibir, razonar y enfrentar las situaciones y a los otros.

La normalidad de la personalidad se refleja en la flexibilidad y adaptabilidad con que un sujeto se


enfrenta al medio y en que la percepción y conductas típicas se traduzcan en un incremento de la
satisfacción personal.

De acuerdo con la Asociación Psiquiátrica Norteamericana, los rasgos de personalidad son


patrones persistentes de formas de percibir, relacionarse y pensar sobre uno mismo y el entorno,
que se ponen de manifiesto en una amplia gama de contextos sociales y personales. Sólo al ser
inflexibles y desadaptativos, y producir una significativa incapacidad social, ocupacional o bien,
malestar subjetivo, es que constituyen un trastorno de personalidad.

ACTITUDES

Una actitud se define como: un sistema relativamente estable de creencias relativas a cierto
objeto y que resultan en una valoración de dicho objeto. El concepto de actitud se usa extensa y
técnicamente en psicología, pero de manera más laxa en sociología. Las encuestas sobre actitudes
son criticadas, a veces con el argumento de que los cuestionarios no revelan las verdaderas
actitudes de las personas.

Actitud, forma de motivación social que predispone la acción de un individuo hacia determinados
objetivos o metas. La actitud designa la orientación de las disposiciones más profundas del ser
humano ante un objeto determinado. Existen actitudes personales relacionadas únicamente con
el individuo y actitudes sociales que inciden sobre un grupo de personas.

A lo largo de la vida, las personas adquieren experiencia y forman una red u organización de
creencias características, entendiendo por creencia la predisposición a la acción. La actitud
engloba un conjunto de creencias, todas ellas relacionadas entre sí y organizadas en torno a un
objeto o situación. Las formas que cada persona tiene de reaccionar ante cualquier situación son
muy numerosas, pero son las formas comunes y uniformes las que revelan una actitud
determinada.

El concepto de actitud es básico en dos campos: en psicología social y en la teoría de la


personalidad. A finales de la década de 1920, el psicólogo estadounidense Gordón W. Allport se
interesó por la investigación de las actitudes sociales, pero no fue hasta la década de 1940, con la
publicación de El miedo a la libertad (1941) de Erich Fromm, cuando este concepto empezó a
cobrar importancia en la teoría de la personalidad. La actitud social es compartida y favorece los
intereses sociales por encima de los individuales.

En virtud de que la noción de formación, en el ámbito educativo, está cargada de múltiples


equívocos, me gustaría compartir con ustedes algunas reflexiones pedagógicas sobre este
concepto:

Para muchos la formación consiste en adquirir o perfeccionar un saber, una técnica, que se ejerce
en beneficio del sistema socioeconómico.

Otra acepción dice que la formación puede verse también como una institución, como un
dispositivo organizacional compuesto de planes de estudio, programas, certificaciones, etc.

Para Gilles Ferry, autor francés que ha escrito sobre la formación, ésta se define como: "...un
proceso de desarrollo personal tendiente a adquirir o perfeccionar capacidades. Capacidades de
sentir, de actuar de imaginar, de comprender, de aprender, de utilizar el cuerpo". Si tomamos
como válida esta afirmación, debemos renunciar a ciertas maneras de hablar que son frecuentes:
una formación no se recibe ni se da; nadie puede formar a otro, no se puede hablar de la acción de
un formador sobre un "formado".Dice Ferry, que cada individuo se forma a sí mismo,
reflexionando sobre situaciones, sucesos, ideas, no solamente en el aspecto profesional, sino en
todas las facetas del ser humano: uno se forma en múltiples actividades: como padre, como
ciudadano, como consumidor, como inquilino, etc., y se forma de manera permanente, desde la
infancia hasta la vejez.

Sin embargo, ninguna persona se forma a través de sus propios sino que requiere de la ayuda de
mediaciones, siendo la educación la más adecuada y necesaria de ellas. De acuerdo con este
enfoque, se puede contribuir en gran medida a la formación de los individuos, aunque no puede
garantizarla.

Formación de las actitudes.

Las actitudes se forman a través de lo siguiente:

1.- Por la acumulación y la integración de numerosas experiencias relacionadas entre si.

2.- Por traumas o experiencias dramáticas.

3.- Por la adopción de actitudes convencionales.

4.-El pertenecer a un grupo se van aprendiendo sus patrones de conducta, y con ellos también las
actitudes. Muchos de los perjuicios que las personas poseen lo han copiado de los demás.

CONCLUSIONES

Durante el tiempo y a través de los siglos, los hombres de ciencias y los estudiosos de la conducta
y las reacciones humanas, han hecho y siguen haciendo tantos esfuerzos, en sistematizar por
grupos fenómenos altamente individuales. Han ido conformando una variedad de datos y
reacciones específicamente personales, agrupamientos sintomáticos que luego se vuelcan
en manuales diagnósticos y estadísticas, han permitido calificar con criterio de unanimidad, la
salud y la enfermedad mental de cada uno.
Las actitudes emocionales tienden a percibir gran influencia sobre la selectividad de la percepción.
Cuando existe una actitud de indiferencia, no se percibe el objeto o supersección es muy
superficial; por el contrario, cuando hay interés o actitud emocional hacia el objetó, este se
convierte fácilmente en el objeto de la supersección

. Las necesidades de los hombres están determinadas con las condiciones sociales de vida, el
hombre se manifiesta con deseos y tendencias

. Muchas cualidades de los actos dependen de los motivos morales de la conducta que son de una
gran importancia como actividad humana y dependiendo de cómo se manifiesten

. La identidad personal depende de la interacción social y la socialización, que es la adquisición de


las pautas sociales y culturas necesarias para convertir a un individuo en un ser social. Los
individuos constituyen su propia realidad en el mundo social, interactuando en el.

La socialización es un proceso que necesita tanto de la existencia de acciones


y modelos personales en el entorno social, como de la identificación, imitación e interiorización de
los mismos por parte de ciertas personas.

La cultura es un sello indeleble en la existencias de los individuos ella dota de sentidos la


existencias de las personas desde sus nacimientos, aportando elementos necesarios que aportan
identidad de los individuos. Crecemos en unas culturas que nos proporcionan el aliento y el
alimento espiritual y material como personas. Todo esto constituye un contexto vital de cada
individuo.

…………………………………………………………………………………………..

Emociones

Las emociones son procesos psicológicos que nos preparan para adaptarnos al entorno, cuya
función principal consiste en ser la guía para poder elaborar las acciones adecuadas en cada
momento. Creemos en nosotros mismos cuando somos capaces de diferenciar claramente aquello
que sentimos por encima de lo que pensamos, lo que nos cuentan, o lo que dicta la norma cultural
del momento.

Los diferentes tipos de emociones que vamos experimentando en la vida van construyendo
nuestro sentido de la realidad e identidad. El primer paso para saber quiénes somos es saber qué
sentimos. Existen emociones más difíciles de reconocer debido a las condiciones de aprendizaje (si
fueron negadas, prohibidas..) o por las consecuencias que su representación en la consciencia
puede tener para la auto-imagen y la auto-estima.

EMOCIÓN Y COMUNICACIÓN

En realidad toda emoción, aunque no sea expresada abiertamente, es una comunicación. En este
sentido, para entender la función de las emociones y los sentimientos hay que observar el cuadro
completo de los mensajes enviados, es decir, el patrón de secuencias que producen. Pongamos un
ejemplo; A se enfada, entonces B se asusta y pone cara de miedo, entonces A se indigna y aprieta
los puños, entonces B se asusta más y se aleja un paso…En este caso observamos que la
emoción es la respuesta del organismo ante una situación y, al mismo tiempo, el estímulo que
genera una reacción en el otro. Al igual que sucede en todacomunicación humana, la emoción es
una respuesta y un estímulo, al mismo tiempo, en el sentido de que es determinada y determina el
comportamiento del otro. El miedo, por ejemplo, puede producir ira, la ira alejamiento, el
alejamiento soledad…de manera que cada patrón complejo de intercambio hará emerger una
realidad concreta.

EMOCIÓN, PERSONALIDAD y APRENDIZAJE

No todas las personas se relacionan con su universo emocional de la misma manera. Algunas
encuentran sencillo sentir y expresar con precisión los sentimientos, mientras otras tardan más
tiempo en comprender los cambios que sufre su espíritu, y precisan interrumpir, incluso negar, su
emotividad. ¿A qué se debe esta diferencia?. ¿Cuándo aprendimos a separarnos de lo que
sentimos?

La infancia es un periodo complejo en lo referente a toda la ambivalencia emocional que el niño


puede experimentar con respecto a sus mayores. Pero la facilidad o dificultad que tenemos para
gestionar emociones y sentimientos no sólo depende de los traumas psicológicos sufridos. Una
parte se debe a la trasmisión. Algunas familias trasmiten la capacidad de celebración y la alegría,
mientras que otras se vinculan desde la culpa, o la ira. Sentirorgullo o vergüenza, tener alta o baja
autoestima, y ser capaz de gestionar los propios sentimientos, depende de las experiencias y de
los aprendizajes tempranos.

Los diferentes acontecimientos por los que atraviesa cualquier grupo humano
de pertenencia construye una historia concreta, una narrativa donde se instalan distintas
emociones y mecanismos de defensa para abordar la realidad. De la misma manera, cada país
genera una cultura que determina la manera en que sus miembros pueden representarse los
sentimientos. Cada momento histórico genera un ideario social, y las emociones no se salvan de
esta influencia, y son connotadas en positivo o condenadas al ostracismo. Expresar rabia, por
ejemplo, puede ser una mala idea cuando se vive en contextos que prohíben la autonomía, donde
pensar diferente tiene un precio tan alto, que la gente aprende pronto a no enfadarse. Sentir
debilidad y tristeza, por ejemplo, puede suponer un desacato a la ideología social del momento,
cuando la prescripción generalizada es “los hombres no lloran” La neurosis, como ya dijo Freud, es
el precio que las personas pagamos por pertenecer a una sociedad. El problema es que los
sentimientos y las emociones no se eligen, surgen sin más. Podemos elegir lo que hacemos,
podemos admitir que estamos equivocados en la forma de pensar las cosas, incluso reconocer que
nuestra reacción ha sido desproporcionada, pero es difícil aceptar que lo que estamos sintiendo es
incorrecto, inadecuado o falso.

conducta humana psicología


La conducta es un conjunto de actos de un hombre o un animal, exteriores y visibles para
su observador. La conducta de un hombre revela, más que sus palabras, sus verdaderos
pensamientos, sus propósitos y sus ideales.
En la siguiente investigación desarrollaremos varios puntos importantes sobre la conducta
humana y los factores que la determinan.
Con este trabajo buscamos conocer más sobre uno de los temas más importantes de la
psicología, como lo es la conducta o comportamiento de todo ser humano.
Esperamos que nuestro trabajo sea del agrado y provecho de todo lector del mismo, así
como lo fue para nosotras.
LA CONDUCTA HUMANA
La mayoría de los psicólogos de hoy convienen en que el objeto propio de las ciencias
psicológicas es la conducta humana.
Pero, por “Conducta humana” se entienden muchas cosas, además de poder ser enfocada
desde muy diversos puntos de vista.
Conducta humana es la lucha por la vida del recién nacido prematuro.
Artistas, científicos, profesores, políticos, ejercitan la conducta humana cuando aplican sus
conocimientos y destrezas a sus tareas correspondientes.
Conducta humana son las fantasías de un niño, los sueños del adolescente, las
alucinaciones del alcohólico.
La conducta humana se conoce bien, pero se comprende poco.
Cuando hablamos de conducta, aludimos primeramente, a las actividades claras y
evidentes observables por los demás: su caminar, hablar, testicular, su actividad
cotidiana… a esta conducta se le denomina conducta evidente por ser externamente
observable.
Interpretación científica de la conducta
Para hacernos cargo de cualquier problema humano debemos intentar comprender
primero la conducta humana de un modo científico.
¿Que quiere decir esto?
Entender a “nivel científico” la conducta quiere decir que nos es preciso conocer los
principios que la rigen.
Estos principios son tres:
Casualidad, motivación y finalidad.
Casualidad: para este principio, toda conducta es causada, obedece a una causa. Ante una
situación dada nos comportamos de una manera y no de otra: según este principio
debemos buscar la razón de esta unicidad del comportamiento en hechos precedentes y
no en el resultado o realización del mismo.
Motivación: toda conducta esta motivada por algo.
Perseguimos siempre una finalidad en el comportamiento, y por ella cobra sentido la
conducta del hombre y puede ser interpretada.
Proceso de la conducta humana
Las conductas difieren entre si porque los sujetos:
Se encuentran en situaciones distintas.
Tienen diferencias individuales,
Persiguen fines diferentes.
Es decir, que todo proceso conductual seguirá este derrotero:
 un estimulo actuaría sobre el individuo
 dando lugar a una conducta
 que lleva una realización
¿Qué es la conducta?
Entendemos por conducta el acto realizado como reacción ante el estimulo. Este acto
incluye el pensamiento, movimientos físicos, expresión oral y facial, respuestas
emocionales.
Realización es el resultado de la conducta, e incluye el cambio en la estimulación, la
supervivencia, la evasión…
El producto de la interacción estimulo-persona es la Percepción.
La influencia de las condiciones individuales.
De cada uno sobre el estimulo hace que lo percibamos de manera distinta.
Los fines pueden ser infinitos.
A los modos constantes y generales de interpretar una situación y reaccionar ante ella se
denomina actitud.
El estudio de la conducta humana se caracteriza porque sostiene que la conducta:
Esta causada y, por lo tanto, para conocerla hay que analizar los hechos que la
preceden.
Varía con la naturaleza del estímulo y debe hacerse cargo con él y de la situación en que
se da;
Varía también con la naturaleza de la persona, debe ser analizada para ser comprendida
y se debe tratar de saber de sus aptitudes, temperamento, carácter, experiencias
anteriores.
Situaciones, diferencias individuales, hábitos, actitudes y fines son los datos
fundamentales que se debe analizar científicamente, rigurosamente, para entender la
conducta humana.
La psicología tiene por objeto conocer científicamente a los seres humanos, para ello,
observa su conducta o comportamiento.
Describe las diferentes formas de la conducta, identifica cada una de estas formas y las
distingue de las demás, las explica e interpreta y también aplica todo este saber
organizado a los asuntos de la vida práctica.
El hombre se expresa a sí mismo mediante actos de conducta. Si pudiéramos saber qué es
lo que hace una persona y cómo lo hace, la conoceríamos bastante bien.
Las formas de la conducta son cuatro: las actitudes corporales, los gestos, la acción y el
lenguaje.
La conducta de los seres humanos es una reacción frente a las circunstancias de la vida.
Decimos que estas circunstancias constituyen estímulos para nuestras reacciones.
La vida psíquica es activa, porque el hombre reacciona frente a las circunstancias con
actitudes corporales, gestos, acciones y lenguaje. En todas estas reacciones hay diversos
factores.
 El pensar: cuando enunciamos con palabras la solución de un problema.
 El imaginar: cuando el sujeto crea con su acción una obra de arte.
 El percibir: cuando excita al sujeto a coger el objeto percibido.
 El recuerdo
 La voluntad
 Las afecciones: cuando el sujeto es preso de una emoción violenta, actúa
exaltadamente.
La personalidad, animada por el carácter y el temperamento, es el factor global de la
conducta.
Al lado de estos factores, hay otros que son o tienden a ser de naturaleza puramente
mecánica. Son los reflejos, los instintos y los hábitos.
Los reflejos
Los reflejos constituyen reacciones mecánicas y constantes de músculos y glándulas,
frente a estímulos físicos (luz, golpe, contacto,…) químicos (el olor de los alimentos…) y
aun psíquicos (una emoción violenta desencadena reacciones instantáneas de las
glándulas suprarrenales).
En los reflejos, los estímulos se convierten inmediatamente en reacciones orgánicas. Son
ejemplos de reflejos: la reacción de la rótula cuando responde al estimulo físico de un
ligero golpe, la reacción de los dedos del pie cuando se estiran al estímulo de un roce en la
planta de nuestra extremidad inferior, la reacción de la pupila que se agranda o
empequeñece según la cantidad de luz que penetra en ella; la reacción de las glándulas
salivares, que segregan automáticamente mayor cantidad de saliva frente al estímulo
representado por el olor de viandas sabrosas; la reacción instantánea de las glándulas
sudoríparas al estimulo de una emoción de temor o de ira.
Todas estas son reacciones mecánicas: se producen sin la intervención del yo.
La función de los reflejos es la de contribuir a adaptar mecánicamente el organismo a su
ambiente.
Los instintos
Los animales son muy ricos en conducta instintiva. Los seres humanos en cambio,
ostentan instintos muy pobres. La conducta llamada instintiva se ha debilitado
considerablemente en el hombre. Lo que el hombre tiene de común con los animales son
las necesidades instintivas, es decir, impulsos a cumplir ciertos actos con los cuales está
ligada la conservación de la vida.
Podemos definir los instintos como las reacciones impulsivas destinadas a satisfacer
necesidades biológicas fundamentales.
Los instintos fundamentales del hombre son los siguientes:
- Los instintos de conservación: impulsan al hombre a satisfacer su necesidad de
alimentarse, de protegerse contra el frió y el calor excesivos, etc.…, lo impulsan a huir
automáticamente, ciegamente ante los peligros, a la lucha cuando ella es inevitable para
conservar la vida, etc.
- Los instintos de reproducción: impulsan al hombre a perpetuar la especie humana.
- Los instintos gregarios: impulsan al hombre a buscar la sociedad con otros seres
humanos.
El impulso instintivo es innato en el hombre, pero la ejecución de la conducta instintiva,
destinada a satisfacer necesidades biológicas elementales, depende del ambiente social y
de la personalidad del sujeto.
Los hábitos
Una vez que el organismo ha adquirido una habilidad motor (como caminar), ocurre que
esa habilidad repte innumerables veces en actos de conducta.
El habito es una reacción adquirida (no innata) y relativamente invariable.
La función del habito es la de disminuir el esfuerzo de la voluntad (al caminar, no nos
proponemos deliberadamente adelantar un pie luego el otro), el esfuerzo de la atención
(no necesitamos poner atención ni ser conocientes de los movimientos que efectuamos al
caminar) y del pensar (tampoco pensamos en lo que vamos haciendo al caminar).
El hábito tiene de común con los reflejos y los instintos que él también tiende a mecanizar
la conducta.
Apuntes sobre la conducta
Las bases de la conducta humana son fisiológicas y psicológicas: porque el hombre es un
compuesto de cuerpo y alma. El cuerpo constituye el soma y el alma el psique. Por eso
decimos que el hombre es una realidad someto-síquica. Las funciones propias del cuerpo
las estudia la fisiología y las funciones propias del alma las estudia la psicología. Seria un
burdo error materialista el pretender, que la, conducta humana solo depende de los
fenómenos fisiológicos. Pues siendo el hombre una realidad someto-síquica la conducta
del mismo depende de factores psicológicos y de factores fisiológicos.
La realización misma de la vida de cada sujeto, no la vida biológica simple, sino la vida que
realiza como miembro de un grupo social, constituye la expresión de su personalidad,
hecho que se conoce con el nombre de conducta.
La conducta es, entonces, la expresión de todas las características personales, es la
manera como cada uno realiza su propia cualidad, como se manifiesta lo que es. Todo lo
que la personalidad tiene de íntimo, la conducta lo tiene de externo: es la misma
personalidad, pero manifiesta; es la manera de ser, mostrada al exterior.
Consecuentemente, al considerar la personalidad y la conducta como hechos correlativos
(pues cada manera de ser corresponde una manera de manifestarse, o mas claramente,
todo ser se manifiesta), la cuestión de cómo investigar la personalidad, como peculiaridad
de cada uno de los sujetos, se resuelve al considerar que, siendo la conducta la proyección
de la personalidad, el estudio de aquella es el camino para el conocimiento de esta. Así,
por ejemplo, el estudio de las manifestaciones de la inteligencia nos permite apreciarla en
su cantidad; el conocimiento de las actitudes de los sujetos nos lleva a descubrir sus
intereses, etc. El estudio de la personalidad se hace a través del estudio de la conducta.
Claro está que, al hablar de un estudio de la personalidad a través de la conducta, nos
referimos al aspecto psicológico de la personalidad, pues aunque ésta está constituida no
tan solo por elementos psíquicos, sino también somáticos y funcionales, estos últimos
constituyen una realidad concreta que se puede apreciar directamente, como el peso, la
estatura, el rigor, las agudezas sensoriales, etc. El estudio de la conducta nos proporciona
pues, el conocimiento de algunos rasgos psicológicos de la personalidad.
La motivación de la conducta
En términos generales, tanto los animales como los seres humanos entran en actividades
movidas por algún resorte. La vida es un proceso de interacción constante entre el ser y el
medio en que vive. Toda conducta está, pues, determinada por dos clases de factores:
externos unos, como los estímulos o situaciones externas, e internos otros, como la
condición en que se encuentran los órganos y tejidos del ser vivo en un momento dado.
Otros resortes de la conducta humana
Estudiar los resortes de la conducta animal es bastante fácil, y se ha hecho en los
laboratorios de psicología con notables resultados. Pero la conducta humana es
enormemente mas complicada que la conducta animal. Además de los imperativos
fisiológicos, y por sobre ellos, el hombre es también movido por incentivos morales y
sociales. Así, por ejemplo, el deseo de obtener la admiración y el respeto de sus
conciudadanos, la ambición de conquistar fama y gloria, los sentimientos de honor, de
justicia, etc., actúan a menudo como potentes resortes de la acción humana.
Los seres humanos se ven colocados frecuentemente en situaciones muy complejas, en
que intervienen muchos de esos resortes de la acción, a veces incompatibles entre si, son
situaciones de conflicto.
Factores que intervienen en la conducta humana
Entre los factores que intervienen en la conducta humana, aparecen dos básicos, que son:
Los Factores biológicos
Los factores ambientales y de socialización
Factores Biológicos:
Entre todas las posibilidades genéticas de dos, cada ser humano que nace hace su propia
combinación de genes los cuales influyen en el desarrollo biológico y determina en parte
la conducta. A ese elemento lo llamamos genotipo.
Sobre esta estructura genética actúan otros factores como son los externos (alimentación,
medicinas ingeridas durante el embarazo, estados emocionales durante este periodo,
cómo aconteció el parto, etc.). A la unión de estos factores se les denomina fenotipo.
Factores Ambientales y de Socialización:
El medio ambiente es todo lo que nos rodea y todos los elementos ambientales son
necesarios para el desarrollo físico e intelectual normal. La socialización se refiere a los
modelos de conducta que adoptamos en los grupos, como son: la familia, la escuela, los
amigos, etc.
Conclusión
La conducta humana viene dada por reacciones adaptativas a los estímulos ambientales.
La psicología estudia la conducta del hombre a partir de la observación de su
comportamiento y de sus condiciones.
En la conducta humana existen factores influyentes, como son los factores biológicos y los
factores ambientales o de socialización, estos últimos refiriéndose a la influencia de la
familia, los amigos y la sociedad en el comportamiento de todo individuo.
Esperamos que nuestro trabajo haya sido del agrado de ustedes.
Bibliografía
……………………………………………………………..
Comportamiento humano
Ir a la navegaciónIr a la búsqueda

Existen dudas o desacuerdos sobre la exactitud de la información


en este artículo o sección.
En la página de discusión puedes consultar el debate al respecto.
Este aviso fue puesto el 6 de diciembre de 2017.

El comportamiento humano es el conjunto de actos exhibidos por el ser humano y está


determinado por absolutamente todo el entorno en que se vive; tiene influencias más
sociales.
El comportamiento humano desde los inicios de su historia se ha tratado de estudiar y
comprender, esto para tratar de aprovechar sus características en el desarrollo de
actividades o mejorarlo para permitirle al mismo vivir de una mejor manera, ya sea
observando sus fortalezas, mejorando esos aspectos y tratar de disminuir las debilidades
aumentando la atención en los puntos en los que generalmente el ser humano suele
fallar.
Muchos consideran el comportamiento humano algo muy complicado, sin embargo no lo
es, puesto que desde sus inicios el ser humano ha demostrado su interés de aprender
sobre lo que lo rodea y aprovecharlo para su beneficio y comodidad, si bien el ser humano
es curioso, también es creativo, al inventar toda una serie de formas para comunicarse,
desde el [lenguaje] por señas, el escrito, incluso el oral, entre otras muchas más cosas que
ayudaron a facilitar la vida del ser humano, así como su supervivencia. Otro aspecto
importante sobre la forma de ser de las personas es el hecho de la manera en la que éstas
aprenden; siendo esto la imitación, este recurso es muy utilizado por el ser humano desde
la antigüedad, evidentes ejemplos de esto es el hecho de que mediante la copia o
imitación se aprende a hablar o caminar. Algunos de los inventos se basan en la imitación
de la naturaleza como lo es el caso de los aviones, imitando la anatomía de las aves o el
del helicóptero, siendo muy parecido a las libélulas. El aspecto del comportamiento, en el
cual las personas deben poner atención, es el hecho que la imitación esta presente y
posee mucha relevancia ya que desde la infancia se fomenta el imitar como una manera
de aprender, así se aprende a hablar, caminar entre otras cosas; de esta manera muchos
prácticamente adoptan la personalidad de otra persona, por lo cual las personas deben
tener cuidado en su forma de actuar, ya que aquellos quienes tienden a copiar lo que ven
son los infantes que siempre tienen en mente ser como su “héroe” es decir a quien
admiran.
En primera instancia, se tiene a los padres o tutores encargados de los infantes como
figura, de los cuales, en sus primeros pasos tendrán como ejemplo durante esta etapa. El
comportamiento humano de los infantes, es en su mayoría, el reflejo de lo que observa y
oye en su entorno, como su hogar, la escuela o los lugares a los que normalmente
concurre, así como de las personas de las que se rodea, padres, hermanos, familia en
general, maestros, compañeros, etc.
Cuando el infante empieza a dejar la infancia para convertirse en preadolescente,
empezaran cambios físicos y psicológicos, que drásticamente irán en torno a su
comportamiento humano, ya que la etapa de cambio, genera la entrada a un nuevo modo
de pensar, se viven situaciones muy diferentes que en los primeros años de vida.
El comportamiento de la persona (así como de otros organismos e incluso mecanismos),
cae dentro del rango de lo que es visto como lo común, lo inusual, lo aceptable y por fuera
de los límites aceptables. En sociología el comportamiento es considerado como vacío de
significado, no dirigido a otro sujeto y por lo tanto una acción esencialmente humana. El
comportamiento humano no puede confundirse con el comportamiento social que es una
acción más desarrollada y que está dirigido a otro sujeto. La aceptación del
comportamiento es relativamente evaluada por la norma social y regulada por diferentes
medios de control social.
El comportamiento de la gente es estudiado por las disciplinas académicas de
la psicología, la sociología, la economía, la antropología, la criminología y sus diferentes
ramas.
Relación con su entorno: el hábitat del hombre no adaptación sino transformación.
El animal está vinculado a su entorno. Entorno en el que encuentra satisfacción a sus
estímulos y eso le basta. Es verdad que el hombre también busca la satisfacción de sus
instintos pero, al mismo tiempo, se hace cargo de mucho más, conoce otras muchas
realidades y se interesa por ellas aunque no le sean útiles ni le proporcionen una
satisfacción.
Para la ardilla no existe la hormiga que sube por el mismo árbol. Para el hombre no solo
existen ambas sino también las lejanas montañas y las estrellas, cosa que desde el punto
de vista biológico es totalmente superfluo.
El animal capta y conoce una parte del mundo, lo que necesita del mundo, y eso es para él
"Todo el mundo". El hombre está abierto a todo el mundo, o mejor, a todo el ser.
Por ejemplo. si una persona le habla a otra, la manera en que reacciona dicha persona es
la conducta

Índice
 1Desarrollo del ser humano
 2Conciencia
 3Factor importante en el comportamiento humano
 4Comportamiento (social)
 5Factores que afectan el comportamiento humano
 6Véase también
 7Notas y referencias
 8Bibliografía
 9Enlaces externos
Desarrollo del ser humano[editar]
 La finalidad de todo organismo y con él de su especie es conseguir la supervivencia
para llevar a cabo el trasvase generacional del genotipo mediante el acto
reproductor. Para sobrevivir el organismo adopta una conducta dirigida a la
obtención de alimento y elabora una estrategia efectiva para vivir de sus enemigos
tróficos. Todo ser humano crece con un instinto o manera de supervivencia.
 Los genes juegan gran parte en esta conducta o instinto. Estos comportamientos
son determinados tanto por herencia como por el ambiente, cada uno
contribuyendo diferentes grados de reacciones particulares. Las reacciones son
limitadas por la habilidad del individuo de detectar y responder al estímulo
presentado. El comportamiento tiene algunas conductas que son innatas, estas
ocurren cuando la acción debe ser realizada correctamente desde la primera vez.
Estos tipos de conducta rara a la vez son genéticamente modificadas y están
hechas a nivel de población. Además de las conductas innatas tenemos un
comportamiento que se puede desarrollar en un ambiente flexible o estricto. En
un ambiente flexible es fácil poder modificar el comportamiento por las diferentes
experiencias e instituciones. Esto hace que la conducta sea adaptativa, en cambio
un ambiente estricto deja poco lugar para influencias externas haciendo difícil la
modificación del comportamiento que ya posee.12
Todos las conductas son determinados por herencia como por el medio ambiente cada
uno contribuyendo a diferentes grados para respuestas particulares. (Lewis, 1991).2
Conciencia[editar]
Artículo principal: Conciencia
Conocimiento que el espíritu humano tiene de su propia existencia, estados y actos. En el
comportamiento humano un factor importante lo es la conciencia ya que nos
encontramos literalmente en una carrera con nosotros mismos. Por otra parte para que
haya una evolución biológica debe de haber una evolución de conciencia y para que esto
suceda tenemos que comprender lo que es nuestra conciencia. Solo los sucesos más
importantes que necesitan nuestra atención entran en la conciencia.
Factor importante en el comportamiento humano[editar]
Artículo principal: Psicología
 Un factor de mucha importancia en el comportamiento humano, es el social e
incluso en la vida diaria es la psicología, que es la ciencia de la vida mental, tanto
de sus fenómenos como de sus condiciones. Fenómenos son lo que llamamos
sentimientos, deseos, cogniciones, razonamientos, decisiones y cosas similares;
consideradas superficialmente es tal su variedad y complejidad que deja una
impresión caótica al observador. Sin una mente saludable y estable no puede
haber un comportamiento sano y estable, por tal razón la salud mental influye
mucho en el comportamiento humano.
Comportamiento (social)[editar]
Artículo principal: Sociología
 El comportamiento, es un aspecto social de la conducta humana, de tal modo que,
el comportamiento social puede ser definido como el conjunto de pautas de
conducta que organizan la relación entre los individuos que conforman un grupo,
el modo de actuación de éste, en su globalidad, con respecto al medio en el que
habita, existiendo una finalidad de carácter adaptativo que le convierte en una de
las claves esenciales del proceso evolutivo, al estar constantemente sometido a la
variación de los criterios selectivos y, por tanto, a los selectores directos del
cambio.
 Las prácticas culturales usualmente tienen una gran influencia en diferentes tipos
de comportamientos sociales. Este fenómeno de prácticas culturales se origina
cuando el repertorio de dos o más individuos crean una unidad duradera que
posee la posibilidad de durar más allá del tiempo de esos individuos. Las prácticas
que se pasan de generación en generación por décadas, pasando por un proceso
evolutivo a nivel cultural, son los que más influencia tienen en nuestra realidad.
Esto hace que en estas prácticas culturales el comportamiento de una persona
influya el comportamiento de otra persona que influye a la otra persona como una
concatenación de acontecimientos. Esto crea la misma estructura cultural que se
construye por los diferentes comportamientos de la sociedad. A su vez la cultura
influye el proceso de socialización de los jóvenes por las diferentes instituciones. 34
Prácticas culturales usualmente involucran entrelazar contingencia conductual, donde la
conducta de una persona puede proveer consecuencias positivas para la conducta de una
segunda persona. (Todorov, 2009).3
 Existen sociedades simples y sociedades complejas, sistemas de interacción social
igualitarios y sistemas jerarquizantes, sociedades subsistenciales y sociedades de
consumo, etc. Sin embargo la configuración social de nuestra especie ha
experimentado una evolución de una complejidad tal que se ha traducido en la
aparición de una variedad de formas adaptadas de acuerdo con un criterio
histórico y económico, intrínseco al proceso evolutivo del género humano. El ser
humano contra de tener una economía productora comienza a hacerse sedentario
y a ejercer una presión mayor, lo que ha causado que en unos pocos milenios
aumente la producción, el incremento demográfico y la aparición de sistemas
sociales distintos en los que se establecen jerarquías funcionalmente diferentes
que marcan el comienzo de las desigualdades.
 Por otra parte tenemos una sociedad cooperativa y solidaria. En la cooperativa
aparecen determinados rasgos de colaboración a altruísmo estas manifestaciones
son elementos minoritarios del global de la conducta. La conducta humana es
solidaria, es decir, orientada no solo a la cooperación en la obtención de un
objetivo tras lo cual finaliza el acto de colaboración en la mayor parte de las
sociedades semicooperativas aludidas sino a la distribución energética obtenida a
través del mismo.
 En definitiva, la transformación en una sociedad cooperativa y solidaria con
independencia de los miembros que la forman, el establecimiento de estrategias
sexuales entre ambos sexos de carácter extensivo y vitalicio, el cambio de las
relaciones endógenas de las unidades reproductoras, que además de
reproductivas se hacen subsistenciales y el empleo de una división social del
trabajo son los rasgos distintivos que identifican el comportamiento humano.
Factores que afectan el comportamiento humano[editar]
 La actitud: en este grado la persona hace una evaluación favorable o desfavorable
del comportamiento. Ver leyes de la negatividad.
 La norma social: esta es la influencia de la presión social que es percibida por el
individuo (creencia normativa) para realizar o no ciertos comportamientos.
 Control del comportamiento percibido: cómo las creencias del individuo hacen
fácil o difícil la realización del comportamiento.
 La cultura: influencia entrelazada con la contingencia de diferentes conductas.4
 La genética - (ver también Psicología evolucionista).
………………………………………………………………………….

AMBIENTE, HERENCIA Y CONDUCTA

Mariano Yela

En Psicología y Medio Ambiente. Monografías del Centro de Estudios de Ordenación


del Territorio y Medio Ambiente. Ministerio de Obras Públicas y Urbanismo.
Madrid, 1981, pp. 69-104.

La conducta es la interacción de un organismo vivo, genéticamente dotado, y su


ambiente. La psicología se ocupa de la conducta. No es extraño que el influjo del
ambiente y la herencia en la conducta sea un tema capital y constante en la
ciencia psicológica. Ha resultado ser, además, un tema intrincado y polémico.
Trataré de resumirlo, con la máxima concisión y claridad, al hilo de su abundante
bibliografía, de la que presento al final una amplia selección.

En Psicología y Medio Ambiente. Monografías del Centro de


Imprimir
Estudios de Ordenación del Territorio y Medio Ambiente.
Ministerio de Obras Públicas y Urbanismo. Madrid, 1981, pp.
Ver PDF
69-104.
1. El problema
La conducta es la interacción de un organismo vivo, genéticamente dotado, y su
ambiente. La psicología se ocupa de la conducta. No es extraño que el influjo del
ambiente y la herencia en la conducta sea un tema capital y constante en la ciencia
psicológica. Ha resultado ser, además, un tema intrincado y polémico. Trataré de
resumirlo, con la máxima concisión y claridad, al hilo de su abundante bibliografía, de
la que presento al final una amplia selección.
Hay dos grandes perspectivas en la investigación psicológica: la general y la
diferencial. Debieran ser complementarias, pero suelen ser meramente distintas y,
con frecuencia, antagónicas. La general estudia los fenómenos y leyes de la
conciencia, el inconsciente y el comportamiento,prescindiendo de las diferencias
individuales. Representantes: WUNDT, FREUD, WATSON. Tiende a considerar al
individuo como una tabula rasa en la que la experiencia y el aprendizaje escriben el
curso del desarrollo. Propende, con salvedades, matices y excepciones, a ser
ambientalista. Ejemplo, el conocido texto de WATSON (1930, p. 104): «Dadme una
docena de niños... y os garantizo que puedo tomar cualquier al azar y formarlo para
que sea el tipo de especialista que yo escoja -doctor, abogado, artista, comerciante y,
sí, incluso pordiosero o ladrón- al margen de sus talentos, inclinaciones, tendencias,
aptitudes, vocaciones y raza de sus antecesores.» La herencia da, por lo visto, lo
mismo; sólo importa el ambiente.
La otra perspectiva es la diferencial. Su origen más eminente es la obra de DARWIN.
Se ocupa de los fenómenos psicológicos en tanto vienen afectados por las diferencias
individuales. Tiende a considerar al individuo en un proceso filo y ontogenético.
Propende a subrayar el influjo de la herencia. Ejemplo, GALTON (1822-1911), primo
de DARWIN y uno de los fundadores de la psicología diferencial y de las
investigaciones psicogenéticas. Ya en 1883 (p. 241) afirmaba: «La natura predomina
enormemente sobre la cultura.» Conviene, pues, estudiar, controlar y mejorar esa
«naturaleza», fundamentalmente genética. El ambiente es lo de menos; lo decisivo es
la herencia: seleccionar a los mejores, dificultar o impedir la propagación de los
peores.
Desde entonces, los psicólogos no han abandonado el tema. Recordemos como hitos
sobresalientes los estudios de BURT y de TOLMAN; aquél, desarrollando la
metodología de la genética de la inteligencia a la que más adelante nos referimos;
éste, iniciando la diferenciación experimental de cepas intraespecíficas en el estudio
del aprendizaje animal (1924, 1929: vid. McCLEARN y DeFRIES, 1973, pp.211-217).
En los últimos decenios ha nacido una nueva disciplina psicobiológica, la genética del
comportamiento. En 1960 se publica el primer texto general, de FULLER y
THOMPSON. Siguen numerosos trabajos y obras de síntesis, como la dirigida por
CANCRO (1971). Los libros de McCLEARN y DeFRIES (1973) y de EHRMAN y PARSONS
(1976) exponen, puesto al día, el estado de las investigaciones. En español pueden
consultarse LACADENA (1975-1976), PINILLOS (1975, capítulo 9) y YELA (1976, 1978,
1980).
Por otra parte, el estudio del ambiente y su control e influjo en la conducta ha
originado en los últimos decenios nuevos enfoques de la psicología general,
diferencial, evolutiva y aplicada, como las llamadas psicologías ecológicas y
ambientales, las terapias de conducta y las psicologías de la intervención 1.
El tema es algo más que académico. De vez en cuando los trabajos de laboratorio,
supuestamente ecuánimes, se ven alterados por violentas polémicas, casi siempre
atizadas por dogmatismos ideológicos, generalizaciones apresuradas e intereses
políticos. Los excesos de los genetistas han terminado, en ocasiones, en el mito de la
raza superior y en los hornos crematorios. Los excesos de los ambientalistas han
llevado a modificar el ambiente por decreto, trasladando, para cumplir cualquier plan
quinquenal, a grandes masas de población, aunque hayan perecido en el experimento
millones de hombres. Hace algún tiempo «estalló» el affaire Lisenko. Al final de los
sesenta hizo erupción, como un volcán, la disputa entre el nuevo nativismo de
JENSEN (1972, 1973; EYSENCK, 1971, 1973) y el nuevo ambientalismo de sus
contrincantes, como HUNT (1961, 1969, 1973; vid. los números monográficos de
la Harvard Educat. Rev., 39, 1969, y del American Psychologist,mayo, 1976). La lucha
continúa.
¿En qué consiste realmente el problema y qué se puede decir con algún rigor de él?
1.1. El verdadero problema
La mayor parte de las polémicas han sido estériles. Están desenfocadas. Pretenden
averiguar qué es más importante, si la herencia o el ambiente. Es un falso problema.
Los dos son igualmenteimportantes, porque los dos son imprescindibles.
¿Cuál es, entonces, el verdadero problema? Los especialistas en genética, como
DOBZHANSKY (1964, p. 55), y los psicólogos, como ANASTASI (1966), lo formulan así:
Los seres vivos son diferentes; ¿en qué cuantía se debe ese hecho a sus diferencias
genéticas y en cuál a sus diferencias ambientales? Por ejemplo, los hombres difieren
en estatura. La estatura de cada cual depende, en cada uno de sus milímetros, de la
herencia que ha recibido y del ambiente en que se ha desarrollado. Pero ¿a qué se
debe que unos hombres sean más altos que otros? Tal vez, en parte, a que tienen
distinta herencia. Tal vez, en parte, a que han sido distintos sus ambientes. ¿En qué
partes? Ese es el problema.
Creo, sin embargo, que hay que precisar más. El verdadero problema consiste en
averiguar cómointerviene cada factor en su interacción con el otro; cuál es el
mecanismo genético y cómo actúa el influjo ambiental. Y, sobre todo, en la medida en
que vayamos conociendo estos procesos, la cuestión estriba en qué hacer, en favor
del hombre, con ese conocimiento.
2. La herencia
2.1. El hecho genético
Frente a todos los argumentos ambientales subsiste un hecho genético irrebatible. De
la garza nacen garzas, y del hombre, hombres. Y no por casualidad. Lo que se sabe de
la cuestión puede resumirse como sigue.
El material hereditario está contenido en las bandas de ácido
desoxirribonucleico (ADN) que forman los cromosomas. Cada especie tiene un
número de cromosomas, los llamados autosómicos y el par gonosómico o sexual. A lo
largo de cada molécula de ADN hay una sucesión de nucleótidos, cada uno de los
cuales contiene una de cuatro bases nitrogenadas. Cada tres nucleótidos sucesivos
forman un «codón», que parece ser la unidad de código genético y está programado
para sintetizar un determinado aminoácido. Los elementos transmisores de la
herencia son los genes. Un gen es un trozo de ADN con información para la síntesis de
un polipéptido o cadena de aminoácidos, que forman las proteínas. Las enzimas son
proteínas catalizadoras de procesos que sólo así son posibles en las condiciones del
organismo, o sólo así son acelerados y regulados. La hipótesis actual es, simplificando,
que a cada gen corresponde una proteína y que el mecanismo básico por el cual un
gen actúa es a través de la producción de enzimas y del control de esa producción.
Parece probable que cada individuo tenga una peculiar organización proteínico-
enzimática y que esa peculiaridad sea la base de su individualidad y de la constitución
y desarrollo de sustancias celulares, células, tejidos y órganos y, a su través, del
comportamiento (HARRIS, 1967).
La dotación genética de un individuo constituye su genotipo. En cada par de
cromosomas, uno del padre y otro de la madre, los genes que ocupan el mismo lugar
-locus- se llaman homólogos. Si son iguales, el genotipo es homocigótico respecto a
ese gen; si son distintos, hay dos alelos homólogos en el mismo locus y el genotipo
es heterocigótico respecto a ese gen.
La acción genética de los alelos puede combinarse linealmente en forma de
herencia aditiva, o uno de los alelos puede ser determinante y el otro recesivo, en
varios grados. Los genes de diferentes loci pueden influirse entre sí, produciendo un
efecto genético por epitasia. Nuevos alelos pueden surgir por mutación y los
cromosomas pueden, finalmente, sufrir diversas alteraciones que modifican la
información genética.
La separación aleatoria de los pares de cromosomas de cada progenitor en dos series,
cada una con un cromosoma de cada par, para formar los gametos -óvulos y
espermatozoides-, la unión de unas u otras series en la célula hija -cigote o huevo- y
las diversas posibilidades de cambios e interacciónes que acabamos de mencionar,
producen diferentes dotaciones genéticas y genotipos. Las propiedades observables
del individuo constituyen su fenotipo.
Pues bien, las variedades posibles de genotipos son, en principio, suficientes para
diferenciar fenotípicamente a los organismos. Por ejemplo, en el caso del hombre -y
según el más sencillo de los mecanismos mendelianos, que no es el único-, si hay dos
alelos en un locus, A1 y A2, pueden resultar tres genotipos: A1A1, A1A2 y A2A2. Si
hay n alelos referidos a un locus, los diferentes genotipos posibles serán las
combinaciones con repetición de orden dos que se pueden formar con n elementos, a
saber: n(n+1)/2. Lo mismo ocurre con otros alelos en otros loci. En general, si
hay nalelos en N loci, los diferentes genotipos posibles serán:

Así, si hubiera 4 alelos en cada uno de 10 loci, el número de genotipos diferentes


podría ser 1010, es decir, diez mil millones, más que habitantes en el planeta. Hoy se
conocen loci de hasta 200 alelos. No se sabe el número exacto de genes. Las
estimaciones más tímidas varían entre 10.000 y 100.000 (STERN, 1973). Con que sólo
hubiera cuatro alelos en 100 loci, tendríamos 10100 genotipos diferentes. Cierto que
todos estos genotipos no son igualmente posibles, pues las frecuencias alélicas no son
iguales en la población, ni los genes son independientes, sino que se agrupan en
cromosomas; pero los diversos procesos de segmentación y cruce de cromosomas,
las mutaciones y otros cambios, mantienen inimaginablemente elevado el número de
combinaciones, tantas como para poblar el universo de hombres genotípicamente
distintos.
¿No basta esto para explicar las diferencias entre los hombres? En principio, como
dije, parece que sí. Advirtamos, sin embargo, que cada genotipo se ha formado y
desarrollado en un cierto ambiente. ¿Cuál es, entonces, el peso relativo que en las
diferencias fenotípicas tienen esas diferencias genéticas, tan sumamente variadas?
Veámoslo en lo que concierne al comportamiento, que es lo que directamente
importa a la psicología.
2.2. El peso de la herencia
Cabe distinguir dos tipos de caracteres: discretos y continuos. Los discretos, como ver
o no ver un color, o tener o no un determinado síndrome, suelen estar ligados a un
gen, que por eso se llama mayor (herencia monogénica). Los continuos o casi
continuos, como la emotividad o la inteligencia, suelen estar en conexión con varios o
numerosos genes (herencia poligénica).
2.3. La herencia animal
Desde el paramecio al chimpancé se han comprobado muchos casos en que un solo
gen afecta al comportamiento, ya sea en un carácter o en varios (pleiotropismo).
Incluso en las bacterias se han localizado genes mutantes que eliminan la atracción
normal hacia determinadas sustancias (MESIBOV y ADLER, 1972). En los Paramecia se
han producido varias mutaciones similares; la más espectacular consiste en la
reacción violenta al ión sódico de los llamados, por eso, paramecios paranoicos por
SATOW y KUNG (1974). Numerosos estudios indican la relación de un gen con fases y
aspectos del comportamiento sexual en diferentes especies de insectos, peces y
roedores (EHRMAN y PARSONS, 1976, pp. 219-232). Un experimento especialmente
claro es el de ROTHENBUHLER (1964), en el que se muestra que cierta conducta
higiénica de las abejas se debe a dos genes recesivos, cada uno de los cuales controla
una fase del aseo de la colmena cuando las larvas se mueren: abrir la celdilla y
limpiarla. Algunos aspectos del canto del grillo están ligados a genes en el cromosoma
sexual (EHRMAN y PARSONS, 1976, pp. 232-238); la curiosa reacción «contemplativa»
de ciertas codornices, que vuelven la cabeza hacia atrás y hacia arriba, se debe
también a un gen recesivo, esta vez autosómico (SAVAGE y COLLINS, 1972). Pero son
los ratones los que, con la Drosophila, han sufrido más estudios experimentales. A
genes recesivos se deben modos y fases del apareamiento, la pérdida del equilibrio
por lesión de los otolitos, la susceptibilidad a las convulsiones otógenas o el tipo de
chillido cuando se les suspende por el rabo. También a genes autosómicos recesivos
se deben muchas de las peculiares conductas de los «ratones danzarines», aunque
algunas variedades convulsivas están ligadas a un gen dominante y ciertas
incoordinaciones motoras a la acción de varios genes. Un gen autosómico produce el
albinismo en los ratones y explica, en buena parte, por efectos pleitrópicos, otros
varios caracteres continuos, como el bajo nivel de actividad en campo libre (open
field), la mayor reactividad emotiva, la mayor dificultad en establecer el reflejo
condicionado de evitación y la más rápida extinción del mismo, la menor preferencia
por el alcohol, etc. Digamos, finalmente, que hace poco se ha encontrado un
chimpancé con la misma alteración cromosómica que en el hombre produce el
«mongolismo»: la chimpancé manifestaba el típico retraso mental, motor y sexual
(McCURE, BELDEN y PIEPER, 1969).
Muchos otros rasgos de carácter continuo se interpretan poligénicamente, como la
actividad locomotora, diversas quimiotaxias, la geotaxia y la fototaxia, la rapidez de
apareamiento, la duración de la cópula, etc., en la Drosophila; o la rapidez de carrera,
el nivel de actividad, el impulso sexual, el apareamiento temprano o tardío, la
emotividad, la lucha, la preferencia alcohólica y ciertos tipos de aprendizaje en el
laberinto, en diversas especies de roedores. Algunos de estos rasgos, a pesar de su
origen poligénico, deben la mayor parte de sus diferencias, como dije, a uno o pocos
genes mayores (EHRMAN y PARSONS, 1976).
2.4. La herencia humana. Rasgos discretos
Se conocen muchos rasgos del comportamiento ligados a un solo gen. Entre los 1.545
síndromes descritos por McKUSICK (1971), 135 incluyen síntomas de insuficiencia
mental, de los cuales 112 se deben a genes autosómicos recesivos, siete a
dominantes autosómicos y 16 a genes ligados al sexo. El peso de la herencia, sobre
todo en las anomalías, es, como se ve, muy considerable. Mencionaré, brevemente,
los casos mejor conocidos.
A genes autosómicos recesivos se debe la docena de aminoacidurias estudiadas. Son
dismetabolias de aminoácidos. Entre ellas,
la fenilcetonuria o imbecillitas fenilpirúvica, un trastorno del metabolismo de la
fenilalanina que deteriora el tejido nervioso y suele rebajar dramáticamente el nivel
mental. La misma causa tienen las dismetabolias de los hidratos de carbono, como
la galactosemia, que impide la conversión de galatosa en glucosa y provoca grave
defecto mental, y las de los lípidos, como las idiocias amauróticas, así como ciertos
tipos de epilepsia, como la mioclónica progresiva de Lafora. Otros trastornos ligados a
genes autosómicos dominantes, como las porfirias, con parálisis, desarreglos
neuróticos y demencia progresiva, o la corea de HUNTINGTON, una perturbación
motórica que lleva a la demencia y la muerte. Otros rasgos menos graves, como las
varias cegueras cromáticas, están ligados a un gen recesivo en el cromosoma sexual.
Varios otros caracteres provienen de irregularidades cromosómicas. Unas acontecen
en los cromosomas sexuales, que normalmente son un par, XX, en la mujer, y XY, en
el varón. La fórmula cromosómica se denomina cariotipo. El cariotipo normal de la
mujer es 46, XX -46 cromosomas y sexo femenino-, y el normal del varón es 46, XY.
Pues bien, los cariotipos masculinos con más de un cromosoma X, provocan
el síndrome del Klinefelter, con varios trastornos de la personalidad y,
frecuentemente, debilidad mental. El cariotipo con XYY es actualmente muy
estudiado y discutido; aunque las pruebas son insuficientes, parece abundar más en
varones delincuentes agresivos. Más claro es el síndrome de Turner, con cariotipo 45,
X0, es decir, mujeres a las que les falta un cromosoma X: tienen un desarrollo sexual
imperfecto y son deficientes en inteligencia perceptiva y espacial, pero no en nivel
mental general. VANDENBERG (1971) ha revisado la bibliografía sobre cariotipos con
más de una X o más de una Y. Parece que, cuantos más cromosomas X, tanto en
varones como en mujeres, más desciende la inteligencia media; lo mismo sucede,
aunque en grado menor, cuantos más cromosomas Y, en los varones. Otras anomalías
proceden de cromosomas autosómicos. Así, el conocido retraso sexual, motor y
mental que lleva el nombre de mongolismo o síndrome de Down. Parecía, y así sigue
diciéndose en muchos textos, que era producido por un cromosoma extra en el par
21 y se suele denominar, por eso, trisomía 21. Estudios recientes indican que el
cromosoma adicional se sitúa en el par 22, como se comprobó también en la
chimpancé citada (HUNGER-ORD y col., 1970, 1971). Otros casos conocidos son
la trisomía 18, con defectos musculares y mentales profundos; la trisomía 13, con
paladar y labio hendidos, deformidad de manos y profunda insuficiencia mental, y el
síndrome del «maullido» o «cri du chat», de llanto débil, microcefalia y grave
deterioro mental, ligado a irregularidades en el cromosoma 5.
2.5. Rasgos continuos
La herencia monogénica o cromosómica, teóricamente clara y prácticamente
decisiva, afecta relativamente a pocos sujetos. Los grandes rasgos de la personalidad,
en un amplio margen que incluye a la mayor parte de los hombres, son de carácter
continuo. Son más difíciles de estudiar. Plantean intrincados problemas de medida,
muestreo y control, algunos no resueltos. Uno de los más estudiados y mejor
conocidos es la inteligencia. Voy a examinarlo con cierto pormenor. Las
consideraciones que siguen valen, mutatis mutandis, para otros rasgos continuos que
no podemos estudiar con tanto detalle.
2.6. La inteligencia y el modelo poligénico
La inteligencia puede considerarse como una variable cuantitativa y continua, como la
estatura. Se es más o menos inteligente, como se es más o menos alto. La estatura se
mide con el metro; la inteligencia, con los tests. Las medidas de inteligencia, como el
conciente intelectual (CI), han llevado a la formulación de la hipótesis poligénica2.
Según ella, la inteligencia se transmite por medio de un elevado número de genes,
cada uno de los cuales pueden estar presente o no en el genotipo y, cuando lo está,
ejerce un efecto similar a los otros, pequeño y aditivo. La combinación aleatoria de
los genes de la población debe determinar en la descendencia una distribución
binomial, que, cuando el número de genes sea elevado, se aproxime a la distribución
gaussiana o normal. No se conoce el número de genes ligados a la inteligencia.
Bastaría una o dos docenas para producir, en los supuestos anteriores, una
distribución bastante aproximada a la normal. De hecho hay indicios de que
intervienen muchos más, tal vez unos 1003. La distribución debe ser, entonces,
normal. Y así sucede. Más aún, si recordamos las anomalías producidas por la acción
de genes mayores, la distribución normal debe tener un aumento de frecuencia en el
extremo inferior. Esto es lo que, en efecto, ocurre. El modelo se ajusta, pues a los
datos4.
2.7. La cuantía del efecto hereditario en la inteligencia
Suele expresarse mediante la heredabilidad, h2, que indica la proporción de la
variabilidad de la inteligencia que se debe a las diferencias genéticas. Los valores de la
heredabilidad estimados por los psicólogos suelen ser altos y varían entre 0,40 y 0,90,
con cifras medias de 0,70 a 0,805. Creo, por razones que luego diré, que estos valores
son exagerados. Los biopsicólogos especializados en genética dan estimaciones en
torno a 0,50 o menores6. En resumen, los datos empíricos llevan a la conclusión,
incierta pero plausible, de que la heredabilidad de la inteligencia está entre 0,40 y
0,70. Es decir, las diferencias en herencia explican la mitad -tal vez más, quizá las dos
terceras partes- de las diferencias individuales en inteligencia7.
El notable influjo de la herencia se ve confirmado por otros muchos resultados.
Además de los ya expuestos, citaré sumariamente los más importantes (vid. YELA,
1976, para más pormenores).
La correlación entre la inteligencia de los sujetos crece con el parentesco. Las
correlaciones medias de decenas de miles de casos son: cero, entre personas sin
parentesco; 0,20 entre primos hermanos; 0,50 entre padres e hijos y entre hermanos;
0,65 entre gemelos dicigóticos, y 0,90 entre gemelos monocigóticos. La concordancia
entre las correlaciones obtenidas y las pronosticadas por el modelo poligénico es, en
el promedio, casi perfecta8.
La correlación entre padres e hijos se mantiene, incluso si se separan desde el
nacimiento. En cambio, se acerca a cero, y en el mejor de los casos llega a 0,15 o 0,20,
entre padres e hijos adoptivos, incluso cuando conviven desde muy pronto 9.
Los CI, en circunstancias normales, son estables, sobre todo desde los cuatro o cinco
años, y, más aún, a partir de los siete10.
Las fases en el desarrollo de la inteligencia, según, por ejemplo, la teoría de PIAGET,
siguen el mismo orden en todos los ambientes, sociedades y culturas estudiadas11.
Cuando los padres son parientes cercanos, aumenta la probabilidad de que alelos
recesivos, generalmente perjudiciales, ocupen el mismo locus y nazcan más hijos
homocigóticos y deficientes. Así se ha comprobado12.
Los innumerables programas de «enseñanza compensatoria», aplicados para
recuperar intelectualmente a niños de baja inteligencia procedentes de grupos
socialmente desfavorecidos, han dado, en general, resultados desalentadores13.
Todo ello, unido a las diferencias sistemáticas encontradas entre las clases
socioeconómicas (20 puntos del Cl entre las altas y las bajas)14, a la correlación de
aproximadamente 0,50 entre el nivel profesional de los padres y el Cl medio de los
hijos, a la superioridad de unos 15 puntos del CI, como media, de los blancos sobre
los negros en los Estados Unidos15, y al hecho comprobado de que, en general,
aunque con muchas excepciones, los hijos con CI mayor de 100 tienden a ascender en
su nivel cultural, profesional y socioeconómico y los de CI menor tienden a bajar 16, ha
llevado a algunos autores, como JENSEN, a suponer que las diferencias en inteligencia
entre los individuos, los grupos y las etnias son, en su mayor parte, determinadas por
la herencia.
2.8. Otras variables
Por investigaciones y datos similares, puede concluirse que ciertas variables
relacionadas con la percepción sensorial, como la magnitud de las ilusiones
perceptivas, el punto crítico de fusión, las propiedades de las imágenes eidéticas, el
tamaño de las imágenes consecutivas, etc., parecen tener una dependencia
poligénica, con una heredabilidad en torno a 0,50.
La inteligencia suele interpretarse como una estructura de covariación de múltiples
aptitudes. Entre éstas figuran las llamadas por THURSTONE aptitudes mentales
primarias. Han sido objeto de algunos estudios genéticos. Su heredabilidad es
parecida, o algo menor, que la de la inteligencia general; más alta en las verbales,
espaciales y numéricas, más baja en las lógicas y en la memoria (VANDENBERG,
1967). Ciertos datos, como el síndrome de TURNER, antes mencionado, concuerdan
con la hipótesis de que puede haber una herencia diferente para las distintas
aptitudes cognoscitivas.
Los grandes rasgos del temperamento, como la emotividad y la extraversión, arrojan
datos parecidos, que apoyan la hipótesis poligénica y una alta heredabilidad, mayor
en el control emotivo y menor en la extraversión17.
El complejo grupo patológico de las esquizofrenias, incluyendo las anomalías
esquizoides, se explica por dos teorías distintas. Una defiende la acción de un gen
autosómico dominante. Otra, cada vez más extendida, defiende el carácter
poligénico, con varios umbrales de predisposición, cuya actualización depende, en
parte, de condiciones ambientales18.
Menos claros son los datos acerca de las psicosis maníaco-depresivas. La explicación
predominante las asocia a un gen dominante en el cromosoma sexual. Otros
resultados se explican mejor admitiendo una heterogeneidad genética, con varios
genes en cada caso19.
En resumen, muchos caracteres discretos del comportamiento humano dependen
claramente de un gen o peculiaridad cromosómica. Los principales rasgos de la
personalidad, como la inteligencia, las aptitudes, el control emotivo, la extraversión y,
tal vez, las grandes psicosis están ligados a una combinación de genes.
3. El ambiente
3.1. El hecho ambiental
Los datos que acabamos de resumir muestran la importancia del factor genético. Su
interpretación no es fácil. Prueban el peso notable de la herencia. No anulan ni
aminoran el del ambiente. Cuando parecen hacerlo son engañosos.
Porque frente a todos los argumentos nativistas subsiste un hecho ambiental
innegable. Los animales modifican su conducta por experiencia y aprendizaje. Tanto
más cuanto más se asciende en el phylum evolutivo, desde las taxias y tropismos al
condicionamiento, la solución inteligente de problemas y la aparición y uso del
lenguaje articulado, el trabajo, la técnica, la educación y la cultura. Es claro que, en el
caso del hombre, incluso si la herencia determinara por entero -que no lo hace- las
diferencias en inteligencia, aptitudes y temperamento, el papel del ambiente sería
todavía capital. Cada uno tendría sus dotes y peculiaridades emotivas heredadas.
Pero su personalidad y su vida no estriban principalmente en ellas, sino en lo que con
ellas se hace. Y esto depende de la interacción del hombre con su ambiente. Las ideas
y creencias, los conocimientos, los prejuicios y los mitos, la lengua, el arte y el trabajo,
las costumbres, los hábitos, las actitudes, el sistema de valores, el contenido de las
aspiraciones y proyectos, de los afectos y los odios, las posibilidades y dificultades
que la sociedad y la cultura ofrecen, todo eso depende del ambiente en que se nace y
vive. Probablemente el hombre de Cro-Magnon tenía las mismas aptitudes que
nosotros. Podía, en principio, hacer lo mismo. No lo hacía. No podía realmente
hacerlo. No podía, por ejemplo, ser cristiano o budista, hegeliano de la derecha o de
la izquierda, futbolista, bioquímico o aviador. El ambiente, sin duda, tiene su peso.
¿Cuál?
3.2. El peso del ambiente
Repasamos los argumentos anteriores en favor de la herencia. Veamos qué papel
dejan al ambiente. Lo haremos sólo respecto de la inteligencia, porque no hay espacio
para más. Lo que diga puede aplicarse, mutatis mutandis -como dije-, a los otros
rasgos. Veremos que el modelo poligénico no es incuestionable; que la alta
heredabilidad es discutible; que la heredabilidad es una propiedad, no de la
inteligencia, sino de la población en que se mide y de las circunstancias en que se
hace; que un rasgo puede tener alta heredabilidad en una cierta población y ser al
tiempo modificable por el ambiente; en el rigor, todo depende de la interacción entre
ambiente y herencia, y que, en fin, el hombre, como queda dicho, puede intervenir en
el proceso, alterando los factores.
3.3. Los modelos genéticos
El modelo monogénico, relativo a los rasgos discretos, está abrumadoramente
confirmado. El modelo poligénico, relativo a los rasgos continuos, es más discutible.
Su prueba básica es la siguiente: Si es correcto el modelo, la distribución de la
inteligencia debe ser normal. Así sucede. Luego, el modelo queda confirmado.
El razonamiento no es concluyente. Lo sería si los tests midieran la inteligencia como
el metro la estatura. No lo hacen. Que los tests miden la inteligencia no está tan claro
como que el metro mide la estatura. Cada test de inteligencia la mide a su manera y
los resultados que ofrece están, desde luego, influidos por muchas variables, sobre
todo por la experiencia previa de los sujetos. Los tests no dan medidas en escalas de
intervalo, con unidad constante, lo que hace que sea un tanto impropio realizar
operaciones artiméticas con ellas. Los tests se contruyen procurando que sus medidas
se distribuyan normalmente; el que luego lo hagan, prueba que hemos logrado lo que
pretendíamos, no que la distribución sea «objetivamente» normal. Hay corrientes
importantes en la psicología actual (BRUNER, LURIA, PIAGET) que interpretan la
inteligencia no como una variable cuantitativa y continua, sino como el desarrollo
progresivo de una serie de estructuras cualitativamente distintas a través de estadios
que difieren cualitativamente entre sí. Todo ello hace algo dudoso que la distribución
normal de la inteligencia sirva como prueba estricta de ningún argumento.
Es verdad, sin embargo, que hay datos bioquímicos innegables sobre la transmisión
de la herencia y sobre su influjo en la estructura y funcionamiento del organismo; que
hay anomalías claramente atribuibles a genes y cromosomas; que la inteligencia
medida por los tests, en lo que tiene de cuantificable, muestra algo común y cuasi
continuo, y que sus medidas, empíricamente ordinales, se prestan a ser interpretadas
mediante un modelo matemático de unidad constante, suficientemente aproximado
para permitir diagnósticos y pronósticos verificables y, en buena parte, verificados. Es
verdad, finalmente, que el carácter normal de la distribución de esas medidas,
aunque sea considerablemente artificioso, es fácil de obtener y se reitera
empíricamente en muestras y poblaciones muy diversas, como si, en efecto,
responderá a algo «objetivo».
En conclusión, el modelo monogénico está en muchos casos demostrado. El modelo
poligénico no está estrictamente demostrado, pero es el más plausible y coherente
con los datos.
3.4. La heredabilidad
Su estimación se apoya en lo siguiente. Se supone que la medida de la inteligencia
fenotípica, F, puede expresarse en función lineal de la inteligencia debida a factores
genéticos, G, la debida al ambiente, E, y la debida a la interacción, G x E; a saber: F = G
+ E + (G x E). Supuesta nula la interacción: F = G + E. En este caso, la variabilidad de las
medidas de inteligencia, es decir, la varianza fenotípica, VF, sería igual a la varianza
genotípica, VG, más la varianza ambiental, VE, más el duplo de la covarianza entre
genotipo y ambiente: VF = VG + VE + 2 Cov (GE). Supuesta nula la covarianza, y,
consiguientemente, la correlación rGE, resulta: VF = VG + VE. Donde VG = VA + VAI + VD +
VI; es decir, la varianza genotípica total será igual a la varianza aditiva, VA, debida a los
genes estrictamente heredados de cada progenitor, que puede estar incrementada
por la varianza aditiva por isofenogamia, VAI, debida a que los cruces de los padres no
son aleatorios, sino que los consortes se eligen de modo que son parecidos en
inteligencia; más la varianza debida a la dominancia, VD, o interacción entre genes de
un mismo locus; más la varianza por epistasia, VI, o interacción entre genes de
distintos loci.
Pues bien, la heredabilidad, h2, fue definida por LUSH (1940) como la fracción de la
varianza fenotípica debida a diferencias hereditarias. Conviene distinguir entre
heredabilidad en sentido restringido, VA / VF que expresa la proporción de la varianza
estrictamente heredada de los genes de los padres, y la heredabilidad en sentido
lato, VG / VF, proporción debida a todos los factores genotípicos.
Se han propuesto muchas fórmulas para estimar la heredabilidad. Dan resultados
distintos, a veces muy distintos e incluso no monotónicos, de modo que cuando unos
suben otros bajan. No podemos entrar aquí en el problema20. Examinaré, como
muestra, una de las estimaciones más claras. Me refiero a la correlación intraclase
entre la inteligencia de gemelos monocigóticos, rMZ, criados y educados aparte.
Si suponemos que cada par de gemelos tiene el mismo genotipo y que el influjo
ambiental en cada par es puramente azaroso, sin que haya covarianza ni interacción
entre genotipo y ambiente, podemos interpretar el efecto ambiental como error
aleatorio de la medida de la inteligencia genotípica. Entonces rMZ puede considerarse
como la correlación de la inteligencia fenotípica consigo mismo y equivale al
coeficiente de fiabilidad de la inteligencia fenotípica, al cuadrado de la correlación
entre genotipo y fenotipo y a la razón entre la varianza genotípica y la fenotípica, es
decir, a la heredabilidad:

En efecto, en los supuestos antes mencionados, y empleando valores diferenciales,


cuya esperanza o valor esperado vale cero - E(F) = E(G) = E(E) = 0 - tendremos:

pues los términos E(GE2), E(GE1) y E(E1E2), expresan las covarianzas entre genotipos y
ambientes, supuestamente nulas. Como la esperanza del cuadrado de la medida
genotípica es su varianza, resulta:
como quería demostrarse. Asimismo:

En efecto:

Estos coeficientes rMZ , aunque muy diversos en distintos estudios, arrojan un valor en
torno a 0,7521. Esa sería la heredabilidad de la inteligencia humana. ¿Qué significa?
En primer lugar, esa sería la h2 en sentido lato. Indicaría la fracción de la varianza
fenotípica debida a todos los factores genotípicos. No sólo la parte directamente
heredada, VA, sino la producida por dominancia y epistasia, VD y VI que en los
monocigóticos es considerable. Sobre todo, parte de la varianza genética se debe al
cruce electivo o isofenogamia, VAI lo que quiere decir que la varianza aditiva no es la
que se obtendría en una población en la que los individuos se cruzasen
aleatoriamente, sino la que se obtiene en nuestra población donde los cónyuges se
eligen por ciertos parecidos. En nuestra sociedad este parecido es pequeño en los
rasgos físicos, excepto en la edad; es también pequeño en muchos rasgos de
personalidad (correlaciones entre esposos de 0,10 a 0,20), pero es considerable,
precisamente, en inteligencia (la correlación mediana está en torno a 0,50)22. Esto
hace que la varianza aditiva se eleve aproximadamente, según distintas estimaciones,
en 0,2023. Por supuesto, este aumento es genético, pero controlado por factores
ambientales: los usos y costumbres matrimoniales de una sociedad. Debido a estos
influjos mixtos de herencia y ambiente, habría que descontar de la h2 = 0,75 una
cierta cantidad, no sabemos exactamente cuál, pero, probablemente, en torno a 0,20.
Pero es que, además, los supuestos de correlación e interacción nulas entre el
genotipo y el ambiente son discutibles. La correlación positiva entre ambos
significaría que, en general, a mejor genotipo, mejor ambiente. ¿No habrá algo de
eso? ¿No serán los más dotados más capaces de buscar o formar un ambiente mejor?
Cuesta creer que no. De hecho, cuando se ha estudiado empíricamente la cuestión,
esta correlación se aproxima a 0,25 (p.e. CATELL, 1965). De nuevo, esto haría bajar
la h2 estimada. Por su parte, la interacción significaría que la diferencia fenotípica en
inteligencia entre distintos genotipos sería distinta en distintos ambientes, o, lo que
es lo mismo, que los distintos genotipos se aprovecharían de manera distinta de los
diferentes ambientes. ¿No parece también razonable? Es verdad que las estimaciones
de esta interacción, en los casos humanos estudiados, dan valores muy pequeños.
Pero es que, en las muestras humanas, no se ha controlado estrictamente el
ambiente. Es posible hacerlo con animales. Se encuentran, entonces, interacciones
elevadas. Por ejemplo, cepas de ratas «listas» y «torpes» en el laberinto, se
diferencian ampliamente en un ambiente «normal»24; en ambientes «ricos» (con
mayor variedad estimulante), las «listas» apenas mejoran, pero las «torpes» mejoran
mucho y se acercan a las «listas»; en ambientes «pobres» (con extrema penuria
estimulante), las «torpes» apenas empeoran, pero las «listas» empeoran mucho y se
acercan a las «torpes»25. Varios tipos de interacción intensa se han comprobado entre
razas de perros y cepas de ratones. En este último caso, cuando las madres
embarazadas se sometieron a «estrés», la descendencia de una de las cepas
aumentaba su actividad en «campo libre», mientras que la descendencia de la otra
disminuía (DeFRIES, 1964, 1967). En conclusión, cuando pueden controlarse con rigor
la herencia y el ambiente, se encuentra interacción. Parece razonable suponer que la
haya también en el caso del hombre. Si la hay, otra porción, no sabemos cuál, que
habría que descontar de la heredabilidad estimada.
Finalmente, se supone que los ambientes de cada para de monocigóticos no tienen
nada de común. Es posible. Pero ¿y la comunidad intrauterina?, ¿y la que
probablemente suscita la misma edad, la igualdad de aspecto, etc.? La cosa no está
clara. Si hay, como es verosímil, cierta comunidad de ambiente, habría que descontar
otra porción, reduciendo más la heredabilidad.
No es extraño que, cuando se considera lo anterior y se tienen en cuenta las
estimaciones hechas por otros procedimientos, se llegue, como dije, a la conclusión,
insegura pero plausible, de que la heredabilidad de la inteligencia es probablemente
menor de 0,5026. Supongamos, para favorecer la tesis hereditaria, que sea
aproximadamente de 0,64 (VERNON, 1972). De nuevo ¿qué significa este valor? ¿Que
la herencia es sumamente importante?: sin duda. ¿Que el ambiente lo es menos?: de
ninguna manera. Veamos por qué.
3.5. Heredabilidad y ambiente
Incluso si h2 es igual a 0,64, como la desviación típica de los CI es, aproximadamente,
15, el error típico de estimación del fenotipo sería . Lo que indica que,
en general, de cada 100 sujetos genotípicamente medios, 95 tendrán CI entre 82 y
118 (100 ± 2 x 9). Todo dependerá del ambiente que les haya caído en suerte. Vemos
que al mismo genotipo corresponderán fenotipos de hasta 36 puntos de diferencia en
el CI; diferencia, recuérdese, mayor que la existente entre clases sociales y etnias. Y
ello sin contar el 5 por 100 de casos extremos, que se diferenciarían aún más.
Claro que no hay por qué conformarse con el reparto aleatorio del ambiente. Se
puede intervenir, sin modificar el ambienté actual, simplemente cambiando a los
sujetos de un ambiente perjudicial a otro mejor. Entonces, podemos pronosticar que
los hijos de un grupo numeroso de padre con CI medio igual a 70 (lindero con la
debilidad mental) tendrán, por simple regresión estadística hacia la media, un CI
medio de 8527. Si, además, como suponemos, no dejamos que el influjo ambiental sea
aleatorio, sino que proporcionamos a estos niños un ambiente muy favorable, por
ejemplo, a un nivel sólo superado por el 1 por 100 de los ambientes, entonces el CI
medio de estos niños, según el modelo de TENSEN, será de 10628. Es decir, serán
superiores a sus padres en 36 puntos de CI, como media, y pasarán, de ser más bien
retrasados mentales, a ser un grupo normal y corriente e incluso un tanto aventajado.
Esto lo admite explícitamente JENSEN (1972, pp. 16 y 17). Lo que no subraya
explícitamente es que éste no es un mero ejemplo teórico, sino que ha ocurrido en la
realidad en varios casos, especialmente en el que describe SKEELS (1966), en el cual,
mediante mejoras del ambiente, se han obtenido aumentos de CI de 30 y 40 puntos
de forma persistente durante más de veinte años.
Incluso, pues, con una heredabilidad de 0,64, la modificabilidad del Cl es
considerable. Pero hay más. En rigor, la heredabilidad es una cosa y la posibilidad de
modificar la inteligencia por factores ambientales es otra distinta. La h2 es el cuadrado
de la correlación entre el genotipo y el fenotipo, y una correlación entre el genotipo y
el fenotipo, y una correlación no se altera ni se aumenta aditivamente cualquiera de
las variables. Puede perfectamente crecer el nivel mental de una población, sin que
cambie la heredabilidad. De hecho es lo que está sucediendo, contra lo que varios
investigadores temían29. Se basaban en que las familias de menor inteligencia tenían
más hijos, con lo que los mecanismos hereditarios forzarían un descenso en el Cl
medio de la población, calculado en 1 punto de CI por cada década. Sucede al revés:
el nivel medio asciende. Es cierto que el pronóstico no estaba bien fundado, porque
los sujetos de menor inteligencia tienen, en efecto, más hijos, si se casan, pero es que
se casan menos o son, en mayor proporción, estériles. Con lo que todo se compensa y
hace prever la estabilidad de la inteligencia media en la población occidental30. Ahora
bien, lo que pasa no es que la media se mantenga, es que crece. Por ejemplo, la
mediana de los reclutas norteamericanos en la Segunda Guerra Mundial equivale al
centil 84 de la distribución del mismo test de inteligencia en la Primera Guerra. En un
cuarto de siglo, la mitad de esa población supera el 84 por 100 de lo anterior
(TUDDENHAM, 1948). Parece claro que es la mejora progresiva del ambiente -la
alimentación, la higiene, la terapia, la extensión de la enseñanza, etc.- lo que hace
que se incremente el nivel de la inteligencia psicométrica y el de otras muchas
variables, como la estatura, la salud, etc.31.
En realidad, todos los argumentos antes aducidos en favor de la herencia, ponen
asimismo de manifiesto el peso del ambiente. Los Cl son estables, pero en el
promedio y en circunstancias normales: cuando el ambiente sufre grandes cambios,
el Cl puede variar fuertemente, y la estabilidad del promedio oculta notables
oscilaciones individuales32. La relación entre inteligencia y parentesco es grande, pero
a mayor parentesco no sólo corresponde una mayor herencia común, sino también
una mayor semejanza ambiental; de hecho, la correlación entre gemelos dicigóticos
es sistemáticamente mayor que la existente entre hermanos corrientes a pesar de
que la comunidad genética es la misma en los dos casos, lo único que es más
semejante en los dicigóticos es el ambiente. Incluso los gemelos monocigóticos, con
igual herencia, pueden diferir en muchos puntos de CI, si se educan en ambientes
muy dispares33. Es verdad que la correlación entre padres e hijos adoptivos es muy
pequeña, pero también que el nivel mental de los hijos adoptados crece con el
tiempo, cuando el hogar adoptante es culturalmente favorable34. Los primogénitos y
los hijos únicos tienen, en el promedio, CI más altos, y entre la descendencia de
hombres ilustres se cuentan más individuos que han dejado fama que entre sus
antecesores. Parece que, sin ninguna razón genética clara, el ambiente de mayor
relación con los adultos o el disfrute de una familia culturalmente estimulante,
mejora el nivel mental35. Existen, desde luego, diferencias de inteligencia entre las
clases sociales; en parte, tal vez debidas a la herencia, pero en parte, sin duda,
debidas al ambiente. Porque hay notables diferencias ambientales entre ellas. Unas
de carácter físico y fisiológico, durante la gestación, el parto y la crianza: en las clases
desfavorecidas, más embarazos y más seguidos en edades precoces y tardías, peor
nutrición, menos peso al nacer, más nacimientos prematuros, mayor morbilidad y
mortalidad, más partos laboriosos, toxemias, anemias, malformaciones, etc. otras, de
carácter psicosocial, afectivo, motivacional, cognoscitivo y lingüístico: diferentes
estímulos culturales, diferente trato, distinto tipo de lenguaje, distintos medios y
objetivos, distintas pautas de conducta. Cuando estas diferencias se aminoran o
invierten, tienden a reducirse o invertirse las diferencias en nivel mental36. Lo mismo
acontece entre poblaciones urbanas y rurales. Aquéllas suelen superar a éstas en 10
puntos de CI; pero a medida que las condiciones económicas, profesionales y
educativas se asemejan, la diferencia se atenúa y desaparece 37.
Los múltiples estudios longitudinales sobre el desarrollo mental en relación con las
clases sociales, de los que luego hablaremos, muestran, como concluye KAGAN (1969)
que el nivel de los niños varía sistemáticamente con el tipo de relación madre-hijo en
diversos aspectos físicos, personales y sociales. Parece, asimismo, agrega KAGAN, que
el influjo genético es más determinante en los extremos, entre los muy dotados y los
débiles mentales profundos. Todo indica que, para llegar a ser un Einstein hace falta,
por lo pronto, una excepcional dotación genética. Pero, para asimilar la enseñanza
escolar corriente, parece que lo decisivo, salvo casos patológicos, es el ambiente
familiar y la metodología de la enseñanza38.
Es cierto que el desarrollo ontogenético de la inteligencia parece ser el mismo en
distintas culturas, pero el ritmo del desarrollo y el nivel que se alcanza son distintos y
parecen ligados a las circunstancias ambientales39.
Las diferencias entre grupos étnicos, muy estudiadas en los Estados Unidos, son
extremadamente complejas. En algunos estudios se mantienen, a pesar de controlar
las diferencias ambientales. En otros cambian y se invierten cuando cambian o se
invierten éstas40. Desde luego, una alta heredabilidad intra-etnia y una diferencia
entre las etnias, no implica, necesariamente, que tal diferencia se deba
predominantemente a la herencia41. La diversidad ambiental ha sido tan grande y
prolongada que puede explicar en parte, tal vez en la mayor parte, la diversidad de
nivel mental. Es asunto sin resolver. Ni siquiera se sabe la heredabilidad de la
inteligencia en las subpoblaciones diversas dentro de la raza blanca de cultura
occidental, mucho menos, la heredabilidad de otras razas y culturas42. Hay, sin
embargo, algunos datos salientes. La importancia del ambiente en el nivel y estilo
mental se manifiesta en estudios comparativos entre culturas distintas. DENNIS
(1966), por ejemplo, aplicó el test de inteligencia de GOODENOUGH, que, como es
sabido, puntúa ciertas características del dibujo de un hombre hecho por el sujeto, a
muestras amplias de niños típicos de seis a nueve años de edad en unas 50 culturas
distribuidas por toda la Tierra. Los Cl medios obtenidos varían de 52 a 124; es decir,
en 72 puntos de CI, tantos como los que separan al débil mental del superdotado en
nuestra cultura. Los Cl medios más altos de obtuvieron en los niños de la clase media-
alta de Inglaterra y Estados Unidos, en un pueblo pescador de Japón y en los indios
Hopi. Los más bajos, en una tribu beduina del desierto de Siria y en un grupo nómada
del Sudán. El test de GOODENOUGH guarda una considerable correlación, en nuestra
cultura, con las escalas de inteligencia general. En la muestra estudiada, niños
corrientes y normales de numerosas culturas variaron en CI medio casi tanto como
varían los individuos de una sola cultura, y desde luego mucho más que varían entre
sí las clases sociales o los grupos raciales dentro de la cultura occidental. La única
variable relacionada con estas diferencias no era el desarrollo cultura de los pueblos,
ni ninguna diferencia genética conocida, sino el grado de contacto con la expresión
gráfica y pictórica y el hábito o prohibición de cultivarla. Otro estudio importante es el
de GOTTESMAN (1968). Mostró que incluso cuando se utilizan «conjuntos genéticos
iguales» (matched gene pools), se obtienen diferencias medias de Cl muy notables,
cuando los ambientes son muy distintos. Por ejemplo, 14 puntos de diferencia media
de Cl en 38 pares de gemelos monocigóticos: aproximadamente, la misma diferencia
que existe entre los Cl medios de los blancos y los negros americanos.
Asimismo, MERCER (1971) y MAYESKE (1971) han hallado que la varianza del Cl y del
rendimiento escolar asociada a la pertenencia a grupos raciales o sociales se reduce a
1 o 2 por 100 cuando se controla estadísticamente el influjo del nivel económico, la
presencia o carencia de padres, las aspiraciones y motivaciones de los padres y los
hijos respecto al progreso escolar, etc.
En cuanto al fracaso de la enseñanza compensatoria hay que decir que, aunque
comprobado, sólo demuestra que aplicar los métodos de la escuela actual a niños de
cuatro o cinco años durante unas semanas o, a lo más, un curso, es demasiado poco y
demasiado tarde: too little and too late, como han manifestado muchos psicólogos y
educadores, alguno nada desfavorable a la tesis genética (CROW, 1969). Así y todo,
cuanto más largo e intensivo el programa, mejores los resultados. Las evaluaciones
antes citadas de COLEMAN, MOYNIHAM, etcétera (Vid. nota 13 y CICARELLI, 1969),
así lo indican. Los efectos son más positivos y substanciales, con ganancias medias de
10 puntos de CI y algunas de 20 puntos, cuando se aplican programas específicos e
intensivos a grupos más pequeños y en condiciones similares a las que ofrece el
núcleo familiar43.
El propio JENSEN indica que la heredabilidad en el rendimiento escolar es
aproximadamente 0,40. La varianza ambiental es, pues, el 60 por 100 de la fenotípica.
Pues bien, según JENSEN (1972, p. 134) esta varianza se debe principalmente a las
diferencias entre familias (54 por 100), y muy poco a las diferencias dentro de las
familias (6 por 100).
Parece, pues, que una de las fuentes ambientales más influyentes es la familia
(CLAUSEN, 1966). Y, de hecho, los programas de mejora del nivel mental y educativo
que han logrado un mayor éxito han sido los que se han realizado a partir de edades
muy tempranas y a través de la familia o de situaciones parecidas a las familiares. Por
ejemplo, el caso descrito por SKEELS (1966). Huérfanos, retrasados profundos, son
trasladados a una institución para subnormales y cada uno asignado a una chica
mayor, ligeramente retrasada, que hace con él el oficio de madre; luego se le atiende
en un jardín de infancia preparado especialmente para proporcionarle cuidado
personal y un ambiente estimulante y acogedor. Otros huérfanos continuaron en las
condiciones primeras de ambientes precario. A los cuatro años, el grupo experimental
había logrado una mejora media de 32 puntos de CI, el grupo de control había sufrido
un deterioro medio de 21 puntos. La diferencia entre los grupos resultó, pues, de 53
puntos. Veinte años después se mantiene la diferencia: los primeros han hecho
estudios primarios normales, bastantes llegaron a los secundarios y un tercio,
al College. La vida de los segundos se desarrolla a un nivel rudimentario de intenso
retraso mental, social y profesional.
En otro caso se eligió un grupo de 40 niños recién nacidos cuyas madres tenían CI
inferiores a 75. La mitad de ellos, escogidos al azar, fueron asignados al grupo
experimental. Hasta los seis meses, un experto visita diariamente el hogar, juega con
el niño y le atiende, asesora a la madre sobre la educación del niño y la
administración del hogar; luego, cada niño va cinco días a la semana a un centro
especial donde le cuida, atiende y educa una mujer especialmente preparada. La otra
mitad forma el grupo de control, en el que sólo se realiza el asesoramiento a la madre
acerca de la marcha del hogar. A los cuarenta y cinco meses, el grupo de control tiene
un Cl medio de 90 y el experimental de 12844.
HUNT y sus colaboradores han desarrollado escalas ordinales de inteligencia, al estilo
de PIAGET, para apreciar, por ejemplo, la «permanencia del objeto» o el nivel de
«imitación vocal» en el comportamiento del niño. En un caso aplicaron estas pruebas
a tres grupos de niños atenienses, en un orfanato en que cada 10 niños estaban
cuidados por una persona, en otro en que la proporción era de 3 a 1 y en hogares de
la clase más baja. Comprobaron grandes diferencias en el desarrollo mental; los
mejores eran los niños criados en su hogar, los peores los del orfanato con menos
relaciones personales. En otro estudio, realizado en los Estados Unidos, se aplicaron
pruebas similares, desde el nacimiento a los cuatro años, a niños de clase media y a
niños de familias en extrema pobreza. Las madres de estos últimos siguieron, sin
embargo, un programa destinado a mejorar su modo de atender al niño,
proporcionándole afecto, cuidado y estímulos educativos. Los resultados indican una
notable superioridad en el desarrollo mental de los niños de la clase inferior,
alterando el hecho habitual de que los niños de la clase media son netamente
superiores. Las diferencias encontradas en estos trabajos, traducidas a la escala de CI,
suponen unos 70 puntos y están relacionadas, no con el nivel sociométrico, sino con
el grado y tipo de contactos madre-hijo45.
La conclusión parece clara. Es muy difícil mejorar el nivel mental por los medios
escolares habituales. El peso de la herencia es considerable. Pero hay indicios de que
se pueden conseguir mejoras amplias y persistentes cuando se cumplen ciertos
requisitos. No se sabe bien cuáles son esos requisitos (ZIGLER, 1967). No sabemos si
los resultados que acabamos de citar serán sistemáticamente confirmados. Los datos
sugieren, sin embargo, que las mejoras son tanto más grandes y permanentes cuanto
los grupos de niños son más pequeños, las edades más tempranas, los planes más
específicamente dirigidos a estimular ciertas funciones cognoscitivas y el influjo más
estrictamente ejercido a través del perfeccionamiento de las relaciones familiares y
otras equivalentes.
4. Los datos de la psicología general y evolutiva
4.1. Ambiente y conducta
Numerosas investigaciones experimentales han versado recientemente sobre el tema
que nos ocupa. Han sido impulsadas, sobre todo, por el psicoanálisis, la etiología, la
psicología humana y comparada del condicionamiento, el aprendizaje y la
modificación de la conducta, ciertas teorías psiconeurológicas y bioquímicas, como las
de HEBB y HYDÉN, y el estudio ontogenético del comportamiento46.
Estos trabajos muestran el influjo que la riqueza estimulante y el contacto
interindividual, en los primeros días y meses de la vida, ejercen, de una parte, en
el nivel de desarrollo del comportamiento adulto -percepción, adaptación
sensomotora, solución de problemas- y, de otra, en la abundancia y complejidad de
las estructuras neuroanatómicas y en su actividad bioquímica: número de neuronas
periféricas y centrales, ramificaciones nerviosas, espesor cortical, configuraciones
neuronales, tasas de acetilcolinesterasa, de RNA, etc.
Los resultados son superabundantes en animales47. Prueban que las estructuras
nerviosas, las funciones fisiológicas y el nivel adaptativo de la conducta van creciendo
en complejidad y eficacia en función del ambiente y de la actividad del organismo
desde el nacimiento. Otros muchos estudios señalan el influjo decisivo del contacto
con la madre en los primeros períodos de la vida sobre el tipo y nivel de
comportamiento inteligente y social48.
En el mismo sentido apuntan las observaciones y experimentos realizados con
hombres. El condicionamiento clásico puede establecerse contra lo que se creía,
desde el tercero o cuarto día (LIPSITT, 1963, 1964). Se han señalado posibles períodos
de «acuñamiento» (imprinting) incluso intrauterino (SALK, 1962), y, con más certeza,
en los primeros meses (SLUCKIN, 1970, pp. 54 y ss.), así como períodos críticos de
«socialización» -de «dependencia» durante el primer año, de «autonomía» durante el
segundo- en los que el contacto con el adulto parece imprescindible para el desarrollo
normal49. Por otra parte, la pobreza o carencia afectiva y el ambiente desprovisto de
variedad estimulante al principio de la vida, puede producir el deterioro profundo del
desarrollo en numerosos aspectos fisiológicos, afectivos e intelectuales, comprobado,
en algunos casos, hasta la adolescencia50.
La mayor parte de las teorías y modelos actuales de la psicología experimental de la
inteligencia la conciben como constituida por un sistema de estrategias y principios
activos de «procesamiento» de datos ordenados jerárquicamente y en el que cada
nivel se basa y origina en el anterior, cuya complejidad y desarrollo, hasta
reorganizarse en forma superior, dependen de la experiencia previa del sujeto. Así,
los modelos relacionados con la inteligencia artificial y la simulación de conductas
intelectuales mediante ordenadores electrónicos51; los últimos modelos
estrictamente conductistas, como el de BERLYNE (1965); los que proceden de la
teoría general de sistemas (YELA, 1974); la teoría jerárquica de GAGNÉ (1961); los
modelos cibeméticos, como el de MILLER, GALANTER y PRIBRAM (1960), y los
neurosociales, como el de LURIA (1974); las teorías de modificación de conducta
mediante diversas clases de condicionamiento clásico y operante, la imitación activa,
el condicionamiento vicario y la terapia cognitiva del comportamiento52, y en fin, las
múltiples corrientes de la psicología cognoscitiva del desarrollo mental53.
Ninguna de estas teorías niega la importancia de la herencia, que impone ciertos
límites potenciales, pero todas reconocen que es el ambiente el que especifica, en
interacción con ella, el nivel funcional de la inteligencia. Las que ofrecen alguna
precisión acerca de cuáles son los factores ambientales más influyentes en el
desarrollo mental y los refieren más específicamente a la experiencia activa del ser
vivo en el contexto próximo de su medio familiar son, tal vez, las de HEBB y PIAGET.
HEBB (1947, 1949, 1955, 1959) insiste sobre todo en el desarrollo de las estructuras
neurológicas básicas. El nivel mental depende de la complejidad y riqueza de las
«asambleas o conjuntos neuronales» del cortex (cell assemblies), las cuales son, a su
vez, función, por una parte, de ciertos factores constitucionales y genéticos, como la
razón A/S en el cortex «asociativo» y el «sensomotor», que fijan el «potencial innato»
y, por otra, de la actividad del sujeto en relación con la riqueza estimulante del
ambiente, que determina «el nivel funcional» efectivo. Hay, pues, que distinguir,
según HEBB, una inteligencia, A, genéticamente potencial, y una inteligencia B, la
efectivamente lograda en interacción con el ambiente. Incluso cabe añadir, como
hace VERNON (1969), una inteligencia C, la empíricamente apreciada por los tests,
que no es sino una parte de la B y que permite y obliga a distinguir entre lo que
algunos autores como HALSTEAD (1947) han llamado inteligencia psicométrica y la
inteligencia clínica; aquélla, medida por los tests, ésta manifestada en la manera de
enfrentarse el sujeto con los problemas de su vida cotidiana.
Según HEBB, el nivel funcional conseguido -las inteligencias B y C - dependen
fundamentalmente de la riqueza estimulante. Más concretamente, de la variedad de
estimulación, que ha de ser alta, pero no excesiva, para favorecer la constitución y
crecimiento de conjuntos celulares y evitar su conflicto; de la organización estimular,
frente a una variación aleatoria de los estímulos, que consolide y no perturbe los
conjuntos; de la novedad adecuada, que provoque un grado de vigilancia óptima,
para suscitar el interés y la motivación, y evite la monotonía o el exceso de activación
que produce trastornos emocionales y desorganiza las configuraciones neurales, y,
finalmente, de un cierto grado de repetición de estructuras estimulantes, entre la
pura identidad y la imprevisibilidad total, que refuercen la organización neural sin
anquilosarla ni hacerla caótica.
Riqueza, variación, organización, novedad y repetición estimulante, son más bien
características algo vagas y generales del ambiente que, sin embargo, han permitido
realizar un gran número de estudios experimentales confirmatorios54, y que,
claramente, son más abundantes en los ambientes típicos -y sobre todo en el medio
familiar-, de las clases más favorecidas.
Una precisión mayor acerca de los factores ambientales que influyen más
decisivamente en el desarrollo mental comienza a lograrse mediante el estudio de
ciertos aspectos físicos del medio intrauterino, perinatal y posnatal, y en las
investigaciones de PIAGET y su escuela acerca de la ontongénesis de la inteligencia.
4.2. El ambiente físico
Los factores ambientales comienzas a actuar en el medio intrauterino. Los gemelos
monocigóticos no suelen nacer con el mismo peso y el que lo tiene menor resulta en
el promedio menos dotado55. Los monocigóticos tienen más mortalidad y menos peso
al nacer que los dicigóticos y desarrollan, ulteriormente, un Cl medio inferior a los
dicigóticos (STOTT, 1960), comprobándose en todos ellos una pequeña pero
significativa correlación entre el peso natal -en igual edad de gestación- y el CI, con
independencia del nivel socioeconómico de la familia 56. Las peores condiciones
prenatales de los gemelos se confirman, asimismo, por el hecho varias veces
comprobado de que su CI medio es de 4 a 7 puntos menor que el de los nacidos en
parto simple 57. Del mismo modo, los prematuros tienen un gran déficit de Cl (Stott,
1966), aunque no siempre58 sino más bien cuando su peso al nacer es muy bajo
(menor de 1,5 kg) y con respecto sobre todo a los Cl extremos (por debajo de 50)59.
Un factor importante es la nutrición. El cerebro alcanza aproximadamente el 70 por
100 de su peso adulto en el primer año de la vida extrauterina60. Es, pues,
comprensible que la calidad y cantidad de la nutrición en las primeras fases de la vida
pie y posnatal tengan considerable relación con el desarrollo mental ulterior.
Especialmente la falta de proteínas y de las vitaminas y sales minerales esenciales
para su anabolismo puede reducir hasta 20 puntos de Cl el nivel mental de los niños.
Estas diferencias se han comprobado hasta los ocho años, pero siempre que la
malnutrición acontezca desde los primeros años. Apenas tiene efectos negativos
cuando ocurre temporalmente y después de los cinco o seis años de edad61. Cuando
un grupo de madres gestantes se divide aleatoriamente en dos subgrupos, a uno de
los cuales se le suministra una dieta adicional adecuada durante el embarazo,
mientras al otro se le da un «placebo», los hijos del primer grupo tienen a los cuatro
años un Cl medio superior en 8 puntos a los hijos del segundo62. Es asimismo claro
que, cuando los factores pre y perinatales hacen sospechar malnutrición o lesión
cerebral, los niños tienen cocientes de desarrollo inferiores63.
Ahora bien, en las clases más bajas se comprueba, como dije, la existencia de muchos
factores ambientales de este tipo: embarazos seguidos y numerosos en edades
tempranas y tardías, mayor tensión emocional y malnutrición, bajo peso al nacer,
nacimientos prematuros, mayor morbilidad, parto laborioso, toxemias, anemias,
malformaciones, etc., que deben influir, en cuantía no conocida con precisión, en el
desarrollo mental64.
Hay indicios de influjo de otros muchos factores mal conocidos. Por ejemplo, la
incompatibilidad de «Rh» en la madre y el feto, cuyo efecto aumenta en partos
ulteriores, puede tener algún influjo dañino en el cerebro y explicar, en parte, el
hecho de que los primogénitos tengan un CI medio superior a los otros hermanos.
Otro factor pudiera ser la comprensión abdominal y uterina, ligada tal vez a
situaciones de «estrés» persistente. En un estudio se comprobó en 400 gestantes
sometidas en los tres o cuatro meses últimos de embarazo a un procedimiento de
decomprensión abdominal durante una hora diaria, que los niños eran superiores en
desarrollo general durante los dos primeros años (unos 30 puntos de cociente de
desarrollo) a los niños de otro grupo de madres, equiparadas en lo demás, pero no
sometidas a ese tratamiento (HEYNS, 1963). Los resultados no han podido, sin
embargo, verificarse en un estudio ulterior65.
En resumen, está claro que existen factores ambientales negativos de carácter físico,
más abundantes en familias de las clases desfavorecidas, que pueden deteriorar
considerablemente el desarrollo mental de los niños durante las primeras fases de su
vida pre y postnatal. La cuantía exacta de este influjo no se conoce ni, sea, la que
fuera, elimina, claro está, el condicionamiento genético.
4.3. Factores ambientales en el desarrollo cognoscitivo
Los trabajos y resultados que acabamos de resumir se refieren más directamente al
desarrollo de estructuras y funciones somáticas y al nivel adaptativo de
comportamientos sensomotores, factores básicos, sin duda, para el ulterior
desarrollo cognoscitivo, pero no idénticos a él. La teoría y las investigaciones de
PIAGET y su escuela ofrecen mayores precisiones a este respecto. Considerémoslas
sucintamente66.
El desarrollo típico de la inteligencia humana sigue un cierto orden de equilibración
progresiva, común a la especie y genéticamente posibilitado. El ritmo y la rapidez del
proceso, así como el estado máximo al que se llega, dependen, sin embargo, de las
circunstancias ambientales de los individuos, las clases y las culturas. El niño no es
pasivo. Sus estructuras nerviosas no sólo son afectadas por los estímulos ambientales,
los asimilan a sus esquemas previos, que, por eso mismo, se van complicando y
modificando, acomodándose a las demandas del medio. El ambiente no es tampoco
amorfo ni está simplemente constituido por estímulos más o menos abundantes;
posee cierta estructura y responde a las acciones del niño con un valor heurístico
mayor o menor. Es preciso en cada momento un ambiente suficientemente rico,
aunque no demasiado, para que sea asimilado y para que la actividad que sobre él se
ejerza reciba una sanción clara de éxito o fracaso. Esto supone una organización
ambiental que pueda experimentarse como obediente a ciertas reglas, para poder
descubrirlas, adaptarse a ellas y generalizarlas progresivamente, hasta alcanzar un
nuevo equilibrio entre la asimilación del ambiente a la actividad del sujeto y la
acomodación de su actividad al ambiente.
Los aspectos del medio que, según la teoría de PIAGET, favorecen o dificultan el
desarrollo, han sido considerados por HUNT, ELKIND y REUCHLIN en relación con el
ambiente socioeconómico, profesional y cultural de las familia67. En general, el mejor
nivel social y cultural suele ofrecer ambientes más interesantes, que facilitan la
participación activa del niño para adaptarse a los problemas que le plantean;
más estructurados, coherentes, estables y diferenciados, que favorecen la
coordinación de las acciones, al suscitar éstas, exigir múltiples ensayos y sancionar
claramente los éxitos y fracasos, reforzando aquéllos; más variados en objetos y
situaciones, más jerarquizadosen objetivos, más ricos en medios distintos o
equivalentes para alcanzarlos, más abundantes en metas remotas, en normas que
facilitan la previsión a largo plazo y el sacrificio del éxito inmediato al más lejano, así
como más propicios para oír y utilizar un lenguaje más preciso, matizado y formal.
Características todas que favorecen el paso de la inmediato a lo mediato, de lo
concreto a lo abstracto, de lo simple a lo complejo, de lo real a lo virtual, de lo
perceptivo a lo pensado, de lo presente a lo hipotético, y, con ello, el desarrollo de
procesos intelectuales de abstracción y generalización y la aparición y consolidación
de estructuras operativas abstractas y reversibles.
Uno de los aspectos más claramente distintos entre las clases y culturas es el
lenguaje. Cada grupo tiene su lenguaje peculiar. El de las clases más bajas es distinto,
aunque no forzosamente menos rico, que el de las más acomodadas. De ahí, según
algún lingüista, el fracaso de los programas de enseñanza compensatoria: se pretende
recuperar intelectual y escolarmente a niños de clase baja utilizando para ello un
lenguaje -el típico de la clase media- que no es el suyo; se incrementan así las
dificultades, no ya para resolver los problemas, sino previamente para entenderlos;
aparecen constantes correcciones y castigos que hacen ingrata la escuela; se perturba
el aprendizaje, etc68. Sin embargo, el hecho -si lo es- de que cada lenguaje permita el
desarrollo de conductas sancionadas por el grupo que lo habla y sea gramaticalmente
tan complejo como cualquier otro, no implica, ni mucho menos, que todos sean
igualmente favorables para promover el desarrollo cognoscitivo69. Incluso antes de
hablar, el niño escucha comprensivamente70. Y el tipo de lenguaje que aprende a
comprender y ejecutar, en continuidad con sus esquemas sensomotores previos y su
comunicación gestual, es más o menos propicio para el desarrollo de dichas fases
anteriores, para la interiorización de las acciones, la generalización de los esquemas,
la clasificación de los objetos, el establecimiento de invariantes y permanencias a
través del cambio, etc.
Ya en 1935 SMITH71 comprobó que el lenguaje espontáneo de niños de dieciocho a
setenta y dos meses era muy distinto en tres clases sociales; en la más alta, las frases
son más largas, más complejas, más lógicas, más correctas y contienen más
preguntas.
Recientemente, BERSTEIN y sus colaboradores han distinguido el «lenguaje público» o
«código restringido» de la clase baja, del «lenguaje formal» o «código elaborado» de
la clase media. El análisis de muestras del lenguaje con el que las madres de la clase
baja se comunican con sus hijos indica que el primero está constituido sobre todo por
denotaciones concretas, frases descriptivas y contenidos tangibles y visuales;
predominan en él las órdenes, las afirmaciones y las preguntas sencillas; subraya las
implicaciones emotivas y de obediencia, más que las lógicas. El código elaborado del
lenguaje formal, comprobado entre las madres de la clase media, se caracteriza por
sus denotaciones y símbolos más abstractos, es más rico en clasificaciones y
preguntas complicadas, insiste más en las implicaciones lógicas y en la explicación y
comprensión de los mensajes. Es, en suma, más apto para el desarollo de las
aptitudes intelectuales72.
Del mismo modo, SIGEL (1970) halló que los niños de ocho a nueve años de la clase
media clasifican con la misma facilidad los objetos reales que los dibujados o las
tarjetas con sus nombres. Los de la clase baja, sólo clasifican con soltura los objetos
concretos, pero muy deficientemente los nombres.
De hecho, este tipo de deficiencias, debidas en parte a las inferiores condiciones
lingüísticas y cognoscitivas de su ambiente previo, se apreció en los niños de uno de
los más ambiciosos programas de enseñanza compensatoria -el Head Start-. El 90 por
100 de los niños de los jardines de infancia, en torno a los cuatro años de edad, son
capaces de coger las piezas de color apropiadas cuando se van diciendo los nombres
de los colores; sólo el 20 por 100 de los niños que iniciaron el plan Head Start, de esas
mismas edades, pudieron hacerlo (HUNT, 1973).
En los grandes estudios longitudinales del desarrollo73 prolongados a veces durante
veinte o treinta años, se confirma, de una parte, la importancia capital del ambiente,
sobre todo el familiar, en las primeras fases de la vida, y, de otro lado, el influjo
acumulativo que tienen en el desarrollo ciertos aspectos de las relaciones entre los
padres -la madre, en especial, dentro de nuestra cultura- y los hijos. En resumen, y
prescindiendo de matices secundarios y ocasionales discordancias, estos aspectos son
los siguientes, al menos en el ambiente sociocultural de los Estados Unidos. La
dimensión personal de amor-hostilidad, en la que la clase media suele ofrecer más
aceptación, comprensión y armonía frente al mayor calor y afectividad de la clase
baja, y, cuando aparecen matices de dureza y frialdad, suelen estar motivados en
aquélla, por la ambición y el empeño de promover al hijo, y, en ésta, por el fastidio, el
cansancio y el deseo de eludir una carga enojosa. Las prácticas educativas en el
hogar, más tolerantes en la clase media; más autoritarias, en la baja. El contacto y la
abundancia de comunicaciones: en familias de la clase media se comprueba más
tiempo de dedicación, más frecuencia de contactos, relaciones más variadas,
ponderadas y respetuosas; en los hogares de la clase baja, menos tiempo, contactos
más escasos, relaciones más aleatorias y rígidas y asimismo más intensas y
desbordantes. El aprendizaje de normas y reglas: en la clase cultural y socialmente
superior, normas más claras y variadas, más acento en la comprensión de las mismas,
mayor flexibilidad y fomento coherente de la responsabilidad progresiva del niño,
refuerzos diferidos, conductas a largo plazo, abundancia de proyectos, interés por el
éxito escolar y cultural; en las clases bajas, normas más escasas, inflexibles y menos
matizadas, más acento en la obediencia o en el «laissez faire» que en la comprensión,
refuerzos inmediatos, conductas a corto plazo, menos interés en el éxito escolar y
cultural. Todo ello resulta en una correlación sistemática y creciente, a partir del
segundo año de vida, entre varios índices de nivel social de la familia, sobre todo del
nivel educativo y cultural, con el CI de los hijos, y confirma, en general, las previsiones
de la teoría de PIAGET, dentro, por supuesto, de grandes variaciones individuales y en
función de las normas, creencias y papeles del ámbito cultural en que la familia se
integra74.
Una copiosa bibliografía de psicología antropológica y evolutiva, clínica y
experimental, confirma que la familia y sus relaciones interindividuales son el agente
más universal y decisivo en la conformación de la personalidad del hombre y en su
inicial socialización75. Fundamentalmente muestran el influjo directo del ambiente
físico y humano en el desarrollo sensomotor y cognoscitivo, según las formas
generales que acabamos de exponer, y, en una dimensión más básica, el influjo
indirecto del contexto familiar en ese desarrollo, a través de la formación de
sentimientos y hábitos motivacionales que van constituyendo lo que he
llamado actitudes básicas (YELA, 1967, 1977).
Estas actitudes básicas de apertura o clausura condicionan el enfrentamiento del
sujeto con la realidad y su predisposición a encararse con las situaciones o a rehuirlas.
En actitud de apertura, el individuo tiende a percibir las dificultades como problemas,
intenta resolver los problemas que percibe, y, en ese esfuerzo adaptativo, libera sus
funciones, aumenta las posibilidades de autognosis e intercomunicación y desarrolla
procesos de aprendizaje y modos de conducta integrados y racionales. En actitud de
clausura, el individuo tiende a percibir las dificultades como amenazas,
intenta defenderse de las amenazas que recibe, y en ese esfuerzo
defensivo, bloquea emotiva y conflictivamente sus funciones, disminuye las
posibilidades de autognosis y comunicación y desarrolla mecanismos de defensa y
modos de conducta objetiva y personalmente desajustados.
Estas actitudes se forman a través de la experiencia y desde los primeros contactos
con los mayores. Los resultados de la investigación sugieren que la actitud de
apertura se funda en sentimientos básicos, de seguridad, simpatía, autonomía y
logro; por el contrario, los sentimientos de inseguridad, dispatía, dependencia e
incompetencia originan actitudes de clausura. La seguridad es el primer ingrediente
básico y parece exigir una protección efectiva y afectiva desde el nacimiento y en los
primeros meses y años, sobre todo a través del contacto con la madre76. En esa
«urdimbre» de relaciones protectoras y seguras, se acrecen las posibilidades de
aprendizaje por condicionamiento, imitación e identificación analítica, que
enriquecen la conducta del niño y promueven los sentimientos de simpatía y
concordancia afectiva con el ambiente y, sobre todo, con los modelos humanos 77.
Sobre este fondo de incipientes relaciones personales, básicamente seguras y
concordantes, pueden iniciarse después los procesos de emancipación y autonomía y
desarrollarse modos de conducta responsable. Los efectos y carencias estimulares y
afectivos, desde el principio, y, ulteriormente, la ausencia, incoherencia, hostilidad o
sobreprotección de los modelos, originan sentimientos negativos de inseguridad,
dispatía y dependencia, provocan actitudes cerradas y pueden retardar, detener o
perturbar el desarrollo general y cognoscitivo de los sujetos78.
5. La interacción entre herencia y ambiente
Hay datos que muestran el peso de la herencia. Los hay que muestran el peso del
ambiente. Pero lo decisivo no es eso. Lo decisivo es su interacción y el conocimiento y
control de los mecanismos por los que actúan. El desarrollo, desde la concepción, no
es el despliegue automático de estructuras genéticamente dadas, ni la modelación
que el ambiente hace de un organismo indeferenciado y pasivo, sino la utilización
activa de las condiciones ambientales por un ser vivo genéticamente dotado. Incluso
entre los genes los hay estructurales, programados para la síntesis de ciertas
sustancias, y los hay reguladores, programados para, de acuerdo con los influjos
ambientales, activar, inhibir y modificar los procesos79. El mecanismo general de la
interacción es poco conocido y ha sido interpretado de diversas maneras. Una de las
más sugerentes es el modelo del «paisaje epigenético» de WADDINGTON (1962). El
desarrollo puede considerarse como la trayectoria de un punto en un espacio
enedimensional. El genotipo podría pensarse como un paisaje, con llanuras, valles,
colinas, etc. El fenotipo, como el punto desplazándose. El mensaje genético señalaría
vías o «creodos». El influjo del ambiente podría desplazar la trayectoria del punto,
que seguiría otro creodo o volvería al anterior, según la fuerza de la desviación y la
configuración del paisaje. En todo caso, el resultado dependerá de la interacción. Si
cambia la dotación genética, no de cualquier manera, sino de una determinada, se
produce, en igualdad de condiciones ambientales, una determinada variación en el
comportamiento. Por ejemplo, la presencia de un alelo recesivo determinado
produce en los ratones la pérdida del equilibrio, por lesión de los otolitos del oído
interno. Si cambia el ambiente, no de cualquier manera, sino de una determinada, se
produce, en igualdad de condiciones genéticas, una determinada variación del
comportamiento, tal vez la misma. Por ejemplo, el mismo desequilibrio se produce
dando a los ratones normales una dieta desprovista de manganeso. El fenotipo puede
deberse a una variación genética específica, en ambiente «normal», o a una variación
ambiental específica, con genes «normales» (fenocopia). La relación genotipo-
comportamiento no es fatal. Si se conoce, puede tal vez controlarse, mediante
modificaciones determinadas del genotipo (consejo genético, ingeniería genética) o,
más fácilmente, por el momento, mediante modificaciones específicas del ambiente.
Si los ratones gestantes portadores del gen dañino son alimentados con dietas
abundantes en manganeso, la descendencia mutante no padece la anomalía.
Lo mismo acontece en el hombre. La oligofrenia fenilpirúvica está producida por un
gen recesivo que perturba el metabolismo de la fenilalanina. Si el recién nacido recibe
una dieta con la dosis adecuada de fenilalanina, su inteligencia tiende a desarrollarse
con normalidad. La galactosemia es, también, un defecto heredado que lleva a la
debilidad mental: basta dar al niño una dieta sin galactosa, para evitar el defecto.
Asimismo, la heredabilidad de los rasgos continuos, independientemente de su
cuantía, no es una propiedad intrínseca del rasgo; refleja las condiciones de una
determinada población. Si esas condiciones se alteran, la distribución del rasgo se
modifica. La cuestión es saber qué hay que modificar y cómo, cuáles son los mutantes
genéticos y los mutantes ambientales apropiados y cuáles son sus mecanismos de
acción. La relación entre la herencia y el medio no es tanto un hecho como un reto al
trabajo, al ingenio y a la decisión del hombre.
En realidad es lo que, si bien se mira, decían GALTON y WATSON, cuando sus frases se
interpretan como debe, pero no suele hacerse, en su contexto. GALTON afirmaba que
la herencia es mucho más importante que el ambiente «cuando las diferencias del
ambiente no exceden de las que comúnmente acontecen entre personas de la misma
condición social y la misma región». Ahí está el quid: que las condiciones ambientales
sean parecidas. Porque pueden ser muy variadas o, más simplemente, pueden variar
en el factor oportuno, como consumir o no galactosa; entonces, el ambiente es lo
decisivo. WATSON se comprometía a lograr cualquier cosa de cualquier niño, pero
agregaba que, para eso, los niños tenían que ser «sanos y bien formados» y que él
habría de disponer «del tipo de ambiente específico que deseara para criarlos». De
nuevo, ahí está el quid. ¿Y si los niños no son hereditariamente «sanos»? ¿Y si están,
para empezar, muy diversamente «formados»? Y, sobre todo, ¿en qué consiste, en
cada caso, el ambiente que justamente se necesita? Añadía WATSON que su
afirmación iba «más allá de los hechos», pero alegaba que «también sus
contrincantes lo hacían». Tenía razón. Todos vamos más allá de los hechos. No hay
más remedio. Los hechos no vienen por sí mismos claros, ordenados y suficientes.
Hay que buscarlos y comprobarlos. Para eso, es preciso elegirlos, observarlos e
interpretarlos: ir siempre más allá de ellos.
Los hechos de nuestro tema son, en resumen, los siguientes: Muchos rasgos discretos
del comportamiento dependen de un gen o un cromosoma; la mayor parte de los
rasgos continuos dependen de muchos genes y deben la mitad o más de su varianza
fenotípica a diferencias hereditarias. Estas dependencias ocurren en determinadas
circunstancias: si éstas se modifican, aquéllas varían. El hecho decisivo es la
interacción entre herencia y ambiente. El problema decisivo es descubrir el
mecanismo de esta interacción. El hecho capital consiste en que el ambiente no es,
sobre todo en el caso del hombre, un mero conjunto de estímulos que objetivamente
interactúa con un mero conjunto de estructuras orgánicas. El hombre es un ser vivo,
activo, consciente y personal, que asimila el ambiente a su propio funcionamiento y lo
incorpora interpretativamente a sus proyectos. El ambiente es una realidad -incluida
la del propio organismo y su dotación y mecanismos genéticos- con la que el hombre
se encuentra, de la que se hace problema y que, según sus proyectos, conocimientos
y técnicas, pueden modificar.
La cuestión última va más allá de todos estos hechos. Consiste en decidir qué hacer
con ellos.
……………………………………………………………….
Factores sociales y culturales de la conducta
Las normas sociales son abstracción como la percepción y la motivación
27/09/2010 - Autor: UNAM - Fuente: Webislam
 conducta
 cultura
 sociedad

 2


La conducta social
Individuo, Grupo y Sociedad
El individuo vive en un contexto social que lo pone en contacto desde su nacimiento con
otros seres humanos de los cuales depende para conservar su vida, formar su carácter y
aprender el modo de ganarse el sustento. La psicología individual explica cómo el
individuo se apropia las pautas de conducta de sus compañeros y se conforma
eventualmente con las preferencias de aquéllos; pero el psicólogo social prefiere un
enfoque más general acerca de los fenómenos del influjo social.
Vimos cómo el grupo afecta la conducta del individuo. Luego consideramos algunas
funciones de la sociedad que representan áreas por cuyo medio aquéllas influyen en el
individuo, porque la sociedad funciona como entidad organizada, y se acerca al hombre en
formas distintas. Le enseña normas. Define los límites a los cuales debe apegarse su
conducta. Realiza todo esto mediante mecanismos de acuerdo con los principios de la
motivación, la percepción y el aprendizaje. En nivel más general (el nivel social) influye en
la conducta de los miembros, definiendo y reforzando las normas y los papeles (roles)
sociales.
Las normas sociales son abstracción como la percepción y la motivación. El científico
observa la conducta de la sociedad y de los grupos aún pequeños y formula el principio de
que la conducta social puede entenderse mejor si pensamos en términos de normas
sociales o reglas que las situaciones del grupo definen y refuerzan. El influjo de las normas
acomoda la conducta individual a las necesidades del grupo de suerte que éste pueda
funcionar y sobrevivir. Toda sociedad o grupo social posee reglas explícitas o implícitas de
lo correcto e incorrecto las cuales sirven para restringir o facilitar la conducta del individuo
a fin de que fomente el bienestar general. Algunas normas se originan de cada una de las
funciones generales de la sociedad. Por ejemplo, la norma prevaleciente respecto de la
actividad sexual, es que no debe haber reproducción fuera de los límites del matrimonio.
Respecto del gobierno el individuo no debe traicionar el orden establecido, vendiendo
secretos militares. La sociedad aprueba la conducta correcta, y castiga la incorrecta. El
grupo que administra los premios y castigos controla la conducta del individuo, si éste lo
necesita. Sanciona la conducta de los niños por medio de los padres y los maestros, y
apresura así la sociabilización de nuevos miembros de la sociedad. Definiendo, reforzando
y enseñando las normas, el grupo influye en la conducta del individuo.
Si una persona interactúa con uno o más individuos, está ya en un grupo. Esto implica que
los miembros de un grupo son conscientes uno del otro, que se toman en cuenta
mutuamente, que su relación tiene cierta continuidad y que tienen un pasado común y un
futuro predecible. Si por ejemplo, una persona viera de repente a un individuo a punto de
saltar al vacío desde lo alto de una torre y junto a algún otro caminante se detuviera a
observar la escena y determinaran tratar de impedir el salto del suicida, desde ese
momento formarían parte de un grupo. Pertenecemos a muchos grupos diferentes, la
familia, las agrupaciones infantiles, las clases de la preparatoria y unas cuantas
asociaciones basadas en intereses comunes de los miembros.
El grupo, en su afán de sobrevivir, define y da a conocer las normas de conducta: las
normas sociales. Señalamos ya como influyen en la conducta del individuo y cómo éste las
internaliza de suerte que lleguen a formar parte de su conciencia social, haciéndolo más
sociabilizado como miembro del grupo.
La norma también sirve para que el psicólogo social describa y de cuenta de la influencia
social sobre el individuo. En realidad, la norma es abstracción del psicólogo social para
tratar la conducta social y para entender las relaciones entre el individuo y la sociedad. Se
necesita otra abstracción, el papel social, o sea, la pauta organizada de conducta que se
espera del individuo, cuando ocupa cierta posición en el grupo social.
Definición y fin de los papeles sociales. Todas las sociedades grandes y pequeñas, simples
o complejas definen ciertas pautas de conducta necesarias para el funcionamiento de la
sociedad, y las prescriben a los individuos. Las pautas prescritas de conducta son los
papeles sociales. Toda sociedad desarrolla su propio conjunto de papeles para lograr sus
fines y mantener la propia forma adecuada de organización y orden. A cada individuo se le
asigna, a veces por sus propios esfuerzos, un papel o una pauta de papeles con los cuales
contribuye al grupo y se granjea la recompensa de la sociedad Por ejemplo, existe un
conjunto de normas que definen el papel del gerente de una gran empresa. Se espera de
él que las cumpla exactamente y que por su propia iniciativa e ingeniosidad la empresa
progrese. Aunque el gerente de la empresa sea esposo, padre de familia, miembro de un
club, etc., estos atributos desaparecen dentro de la empresa. Su papel lo monopoliza. En
todos los subordinados existe una serie de expectaciones respecto del gerente. Esto
mismo sucede respeto de la jerarquía de la empresa. Cada uno de sus miembros posee un
papel asignado; ejecutivo, agente de ventas, informador, etc., y todos se engranan en una
pauta funcional sumamente compleja. Cada uno tiene sus responsabilidades, habilidades
y privilegios claramente definidos, y, cuando un individuo se sale de su papel, se le sujeta
a presión social. El agente de ventas que autoriza un pedido sin el visto bueno del jefe del
departamento, recibirá una sanción.
El individuo que pertenece a una estructura social debe saber lo que se espera de ésta y,
también, lo que se espera de él mismo, como otros saben lo que se espera de él. Un papel
social está engranado en una pauta de expectaciones sociales negativas y positivas. La
vida social de cada uno de nosotros exige que desempeñemos diversos papeles. Cada ser
humano desde su niñez debe empezar a aprender su papel social, es decir, cómo actuar,
en cuanto niño o niña, luego en cuanto adolescente y finalmente, aunque a menudo sin
ninguna oportunidad para practicarlo, en cuanto adulto. El muchacho aprende el papel de
hermano mayor o menor; de jefe del grupo, de encargado de deportes en la escuela.
Aprende también el papel de hijo, de abogado, o de médico, etc., y continúa explorando
las expectaciones del mundo social, encontrando que algunas veces se acomodan a sus
gustos y, otras los contrarían. Aprende el papel de esposo, de padre, de proveedor, de
ingeniero, etc. Aprende a actuar y a vivir y a vestirse de acuerdo con las características de
los papeles que ha asumido. La mujer desempeña asimismo una serie de papeles. Las
observaciones realizadas en grupos pequeños demuestran claramente que aun cuando
éstos se componen de personas extrañas entre sí, pronto se desarrolla una variedad de
papeles especializados. Una persona, por ejemplo, se convierte en la animadora del
grupo, y dirige sus esfuerzos a conservar alta la moral. Sus compañeros la buscan en las
dificultades, o las expectaciones de aquellos la obligan a acomodarse a su papel. El
aprendizaje de los papeles comienza pronto en la vida. Lo realizan la instrucción
intencional y también el aprendizaje incidental.
Junto con el aprendizaje de pautas de conducta, el individuo aprende asimismo pautas de
expectación. En efecto, el niño pequeño no sólo aprende los patrones de conducta
propios del muchacho de su cultura, sino también espera de sus compañeros la misma
pauta. Cuando otros individuos se apartan de esta paute, se les reduce al orden mediante
alguna forma de refuerzo social. Si el muchacho es soplón, el grupo se encarga de eliminar
esa conducta que considera impropia de uno de sus miembros. Indica que los juegos de la
niñez son proceso importante para el aprendizaje de papeles sociales. Los niños obtienen
en sus juegos la experiencia para desempeñar sus papeles en el ejercicio de las
expectaciones sociales, y también aprenden a cambiar papeles lo mismo que a
modificarlos. Tal cambio de papeles es aspecto significativo del proceso sociabilización.
Tradición
Podemos definir a la tradición como la comunicación o transmisión de noticias,
composiciones literarias, doctrinas, ritos, costumbres, hecha de padres a hijos al correr los
tiempos y sucederse las generaciones. Para otros la tradición constituye doctrina,
costumbre conservada en un pueblo por transmisión de padres a hijos.
En especial tradición, es la costumbre de una antigua práctica que impone respeto en
virtud de su largo pasado. Una práctica iniciada por imposición autoritaria puede en
determinadas circunstancias, llegar a hacerse tradicional, pero, en sentido estricto, la
tradición no puede ser decretada, ya que su aceptación se basa en la convicción tácita de
que su perduración a través de los tiempos acredite su valía y justifica su mantenimiento.
Las instituciones permanentes, tribales, nacionales, religiosas, judiciales, matrimoniales,
profesionales, así como las de parentesco ó casta tiende al desarrollo de hábitos que
resisten el cambio, la revisión crítica.
A veces su origen se remonta a la mitología. Revelaciones, o hechos sobrehumanos de
significado ejemplar. El derecho de cada país a conservar su territorio descansa en gran
parte a la tradición. Esta desempeña un papel importante en las maneras de interpretar o
modificar los estatutos tribales y las leyes básicas de las naciones.
En las sociedades estacionarias, la aceptación indiscutida de prácticas tradicionales tiende
a suplir la fuerza física que las sociedades inestables utilizan para reformar la ley y el
orden. De todos modos, aún en nuestro mundo contemporáneo, ciertas observaciones y
costumbres tradicionales se resisten al cambio. Es en gran parte, la tradición la que define
la corrección del lenguaje, la ortografía, las relaciones sociales, los ritos religiosos y el
protocolo del Estado.
Mientras la técnica, el arte militar y hasta las artes en general van evolucionando en
nuestra sociedad contemporánea, los ritos litúrgicos el himno nacional, gran parte de los
procedimientos parlamentarios y judiciales, la esencia del código moral aceptado, siguen
basados en la tradición tanto en su forma como en su significado.
Tradición es un modo colectivo de comportamiento ya establecido, que está allí, como
una pauta o ruta que invita a ser seguida, y que ya ejerce la característica presión de los
hechos sociales.
En nuestros medios urbanos fumar en pipa es un hábito de unos pocos individuos. Fumar
cigarrillos es un hábito social y muy extendido. Pero ese hábito de fumar cigarrillo no llega
a constituir verdaderamente una tradición, porque en realidad no constituye un modo
colectivo de conducta característica de ningún grupo social.
Las tradiciones, son modos colectivos de conducta, pero no son considerados como
obligatorias. Pasear los jóvenes de ambos sexos por la plaza principal de una ciudad
provinciana a determinada hora y a determinados días de la semana, comer pavo y el día
de Navidad, son modos colectivos de comportamiento (tradiciones) los cuales ejercen una
cierta presión, pero no contienen ninguna dimensión de obligatoriedad. Es decir, los
miembros del grupo social donde tales tradiciones rigen no consideran que aquellas
personas que no los cumplen han infringido ninguna norma obligatoria. Sencillamente se
apartaron de un camino, el cual es seguido por mucha gente, incluso tal vez de la mayoría,
pero que no es considerado como obligatorio. La tradición consiste, pues, en una
regularidad de hecho en la conducta, sin que esa regularidad entrañe ningún sentido
normativo. En ese respecto, puede decirse que la tradición no está dotada de "validez",
puesto que nadie exige su cumplimiento.
En la tradición falta la distinción entre el presente y el pasado, entre sí y los demás, lo que
hace de ella una forma primitiva e impropia. A la actitud tradicionalista se opone desde
este punto de vista, la actitud crítica que da al individuo una determinada libertad de
juicio.
Costumbres
Las costumbres primeramente son hábitos cuando son individuales, es decir, ejecutados
por individuos aislados, pero al convertirse en dominio público o realizados por la masa
son "Costumbres", las cuales son o pueden ser arraigadas en la sociedad donde persisten
de generación en generación.
Las costumbres individuales o hábitos son realizados mecánicamente sin reflexión; el
realizar lo mismo todos lo días o constantemente se convierte en costumbre.
Las costumbres sociales son las que van a determinar en cierto grado el comportamiento
del o los individuos pertenecientes a ese grupo o sociedad.
Las costumbres pueden resumir como definiciones tradicionales de las estructuras
sociales fundamentales y de relaciones que la propia sociedad o grupo determinado
considera esencialmente para su estabilidad en un lugar y período determinado.
Las costumbres y los usos sociales que la acompañan son de contenido tan amplio que
permite a los individuos adultos encontrarse pertrechados para enfrentarse a la mayoría
de los problemas que entrañan las relaciones sociales sin necesidad de recurrir a otros
procedimientos más racionales u objetivos.
Las costumbres también pueden considerarse como conductas predominantes en un
grupo social debido a la educación recibida en las primeras etapas de la vida del individuo
(niño), a la formación de hábitos de éstos, pertenecientes a un grupo determinado.
La costumbre es también clasificada como una expresión ordenada de la voluntad social
que surge de forma natural y espontáneamente del hábito y del uso activo en cuanto
manifestaciones del consentimiento común, por esto su valor como fuente creadora del
derecho.
Las costumbres fundan sus bases en la cultura, por esta razón en cada grupo social se
cuentan con variadas costumbres, que en algunos casos van muy ligados los prejuicios y
superchería.
Para darle mayor entendimiento a nuestro comentario sobre este tema vemos que la
costumbre es un uso del que se predica validez, normatividad y por consiguiente
obligatoriedad. Las costumbres relativas al trato social, a la etiqueta, al modo de vestir, a
las formas de salud etc. Son consideradas como normas válidas como pautas obligatorias
de comportamiento dentro del grupo social. Claro es que las fronteras entre la tradición y
la costumbre no suelen ser tajantes, sino que por el contrario, en ocasiones aparecen
difuminadas o borrosas.
A través de las costumbres pueden manifestarse y de hecho se manifiestan muy diversos
tipos de normas: morales, del trato social (esto es, del decoro, de la decencia, de la
cortesía, de la etiquete, etc.), higiénicas, técnicas y jurídicas.
Mientras que las tradiciones, puesto que no son obligatorias, no llevan aparejadas unas
sanciones para su incumplimiento, en cambio, las costumbres si están provistas de
sanciones de diversos tipos, por ejemplo: risa o burla, crítica, censure apartamiento del
grupo, o expulsión del grupo, etc.
Las costumbres de perpetuación, son las que fomentan, o eso es lo que se cree, la
supervivencia social más ella de las generaciones actuales.
Algunas formas institucionales son: el matrimonio y la familia que supone una adaptación
al medio aceptado, la condición peculiar de la bisexualidad.
Estrato Social y Prejuicio
Las llamadas clases o estratos sociales constituyen uno de los círculos colectivos de mayor
volumen y relieve.
Algunos grandes grupos totales o suprafuncionales, como la comunidad social, la nación, e
incluso sectores más extensos, se hallan estratificados en varios niveles o capas, cada uno
de ellos diferenciado de los otros por características específicas -situación, posición,
modos de vida y posibilidades de sus miembros.
Cuando la estratificación social es muy rígida, y la pertenencia a cada capa está
determinada de una vez para siempre por el nacimiento, recibe el nombre de castas.
Los estamentos pueden definirse como estratos sociales relativamente rígidos, cuyas
respectivas posiciones están determinadas por el Derecho o por una costumbre muy
vigorosa. Con esta palabra se designa la estratificación medieval en tres estamentos, la
nobleza, el clero y el estado llano, estratificación que se prolongó durante algún tiempo.
Cuando la estratificación no es rígida, cuando las divisiones aunque importantes no
afectan esencialmente a los derechos individuales básicos del hombre, y sobre todo
cuando hay movilidad vertical, es decir, cuando hay posibilidad de pasar de una capa a
otra, entonces la estratificación se llama división en clases sociales.
La clase social implica unas formas comunes de vida, una coincidencia de intereses, una
conciencia de esas concordancias y de la diferencia colectiva frente a las otras clases, pero
no constituye un hecho de comunidad propiamente una comunidad, porque dentro de la
clase social no se cumple un conjunto de funciones o de fines humanos comunes, porque
la clase social no constituye la condición para el desarrollo de fines tales, ni tampoco
ofrece medios para su cumplimiento.
La posición o rango social depende de múltiples factores en las varias sociedades, e
incluso dentro de una determinada sociedad; frecuentemente depende de más de un
factor.
La posición o rango social se puede basar en diferencias de linaje de riqueza, de profesión
u oficio, de poder político, de pertenencia étnica, o de mérito personal. Ahora bien, lo más
frecuente es que el rango o posición esté determinado por la concurrencia o combinación
de más de uno de esos factores.
Nótese además que la significación y el matiz de cada uno de los factores enumerados es
vario en las diversas sociedades, y es cambiante a través de la historia.
También ha variado la forma principal de la riqueza como base de estratificación social.
También es diversa y cambiante en las varias situaciones y épocas la jerarquía del mérito
personal.
Las clases sociales son grandes conjuntos de personas, conjuntos que se distinguen por los
rasgos específicos de su cultura y su situación económica. Aun cuando el factor económico
tiene una gran importancia para la determinación de la clase social, en realidad el factor
decisivo es el de la cultura, puesto que sólo es posible el paso de los individuos de uno a
otro círculo mediante la adaptación cultural.
Las tres clases principales no están tajantemente delimitadas una frente a la otra, sino
que, por el contrario, en sus zonas marginales están interpenetradas la una con la otra,
dando eso lugar a la existencia de clases mixtas.
"En consecuencia, hay en las clases sociales muchos estados intermedios fundamentados
en situación económica y en transiciones de cultura".
La clase social constituye, como ya se ha dicho, un círculo colectivo, definido por unos
modos de vida característicos, por la coincidencia de unos intereses, y por el sentimiento
de constituir un grupo diferente de las otras clases sociales. Los miembros de una clase
social tienen una conciencia de pertenencia a ella. Este conciencia comprende dos
aspectos: comprende un darse cuenta de tener con los demás miembros de su clase unas
características comunes; y comprendo al mismo tiempo un darse cuente de que hay otras
clases diferentes situadas a distintos niveles, es decir, un darse cuenta de que
objetivamente hay una jerarquía entre las clases. Así pues, el darse cuenta de que hay
diferencias entre las clases y una jerarquía objetiva entre ellas no implica necesariamente
una plena aceptación individual de esa jerarquía, ni una sumisión voluntaria a dicha
jerarquía.
Las actitudes de unas clases respecto de las otras varían según las situaciones históricas,
en los diversos países y en las diferentes épocas. En situaciones estables, y en donde la
estratificación social concreta no contiene grandes injusticias muy irritantes, la actitud de
las clases inferiores respecto de las superiores suele ser de aceptación de estado de cosas,
de respeto y de subordinación; y la actitud de las clases altas con relación a las bajas suele
ser de condescendencia y de protección. La clase media situada entre las otras presenta,
precisamente por esto, peculiares actitudes, en relación con la superior y en relación con
la inferior. Por una parte, las gentes de la clase media como tienden a imitar los modos de
vida de la clase alta y de aproximarse a éstos todo lo que puedan, se sienten próximas a
ésta, incluso cuando sus intereses sean contrarios a los de ésta en muchos aspectos; y, de
otra parte, como su cultura es del mismo tipo que la de la clase alta, o incluso
generalmente superior a la de ésta, se sienten muy dispares frente a la clase baja.
En cambio, en las situaciones sociales de tensión entre los estratos bajos y los elevados,
por causa de que los segundos han cometido muchos y grandes abusos, y los primeros
sufren tremendas injusticias, o por causa de que una nueva ideología que propugna un
cambio radical en la estructuración social va ganando más y más adeptos, y empieza a
producir ya resultados prácticos, entonces se desarrolla una corriente de hostilidad en
ambos sentidos, de abajo hacia arriba y de arriba hacia a bajo.
El sentimiento y la conciencia de clase son fenómenos casi universales en la sociedad
humana, como lo es el hecho de la estructuración en clases.
El caso extremo de imposibilidad de circulación entre los varios estratos sociales es el
régimen de castas: quien nació en una casta nada puede hacer para dejar de pertenecer a
ella y para ingresar en otra.
Ha habido en el pretérito -y por desgracia suele haber en el presente- sociedades en las
que los prejuicios de clase han determinado que se estableciese discriminación
desfavorable contra los miembros de las clases inferiores, mediante normas jurídicas.
Tales normas son un obstáculo tremendo para la movilidad vertical.
El reconocimiento, el respeto y la fiel observancia de los derechos fundamentales del
hombre, de sus derechos individuales de libertad, de sus derechos democráticos y de sus
derechos sociales, de educación y económicos, constituye un factor de enorme alcance
para favorecer la circulación entre las clases y el ascenso en situación social.
Todos los hechos sociales que tienden a conmover, minar, dislocar, y transformar las
estructuras establecidas alteran la estratificación social, y ofrecen ocasiones de gran
circulación entre las clases.
Prejuicios
La conciencia de clase origina con frecuencia el nacimiento y el desarrollo de prejuicios y
de conductas discriminatorias -grave mal social- que consisten en juzgar a las personas no
en tanto que individuos, según sus méritos y sus deméritos individuales, sino tan sólo en
cuanto miembros de determinado grupo al que se tiene en una valoración despreciativa.
Desde el punto de vista psicológico, se concibe la palabra prejuicio como "la actitud en pro
o en contra de cierta hipótesis sin probar, que impide que se valoren como es debido las
nuevas pruebas. Se consideran sinónimos preconcepto y predisposición".
El prejuicio puede ser desarrollado por aquellas personas que sufren gran inseguridad
acerca de su propio valor personal. Otro factor de suma importancia que da lugar al
prejuicio son las actitudes familiares, si el individuo se desarrolla en un ambiente
autoritario, se tiene una tendencia a ser prejuicioso.
En principio, se examinó al prejuicio en función de la conciencia de clase y el rechazo de lo
distinto; en el contexto de lo interindividual se considera que la expresión el prejuicio es
parte de la personalidad.
"Las teorías sobre el prejuicio han ido variando por el estrés existente en las
consideraciones interindividuales o intergrupo".
James Whittaker en su obra La psicología social en el mundo de hoy, refiriéndose al
prejuicio, afirmo:
Se trata de un fenómeno de intergrupo, "Aunque los prejuiciados son los individuos, su
blanco es un grupo por lo que los orígenes del prejuicio están determinados por un
grupo".
Persuasión y Propaganda
La persuasión
Por persuasión entendemos la acción y efecto de persuadir o persuadirse, esto es, inducir
al individuo con razones a creer o hacer una cosa, este objetivo se logra a través de la
propaganda, que son actividades desarrolladas para fomentar ventas de productos o
servicios.
Se puede lograr control social "por procedimientos de propaganda y métodos de
persuasión no fraudulentos, los cuales, sin intención de engaño, se limiten a llamar la
atención sobre las bondades de determinadas mercancías, o sobre las virtudes de ciertos
hombres públicos o sobre la verdad de ciertas ideas".
Este tipo de propaganda y publicidad puede emplearse en cualquier campo social, que se
encamine a que otros reconozcan determinadas verdades, valores e ideas.
"Es frecuente que las personas se percaten de que esa influencia social puede conducirla a
actuar de un modo que no les conviene y en consecuencia, crean defensas para no ser
persuadidas contra su voluntad".
La técnica del "pié en la puerta" es empleada con bastante éxito por los vendedores de
puerta en puerta, a los que debe su nombre; la utilizan también los individuos que tienen
que persuadir a otros de hacer cosas sobre las que podrían poner reparos. La idea básica
de esta técnica consiste en pedir al individuo en quien se pone la mira que concede un
favor de escasa importancia. Es evidente que el hecho de concederlo menoscabe las
defensas del individuo en cuestión, quien se siente entonces menos capaz de rehusarse a
conceder un favor mayor de lo que hubiera sido si se lo hubiesen pedido al principio".
"Según Hovland, Janis y Kelley para que una persona cambie de actitudes, es importante
que la misma reciba incentivos; es por ello que la comunicación persuasiva deberá
revestirse de incentivos capaces de recompensar al receptor de la comunicación con el
objeto de facilitar la adopción de dicha información.
"Es por ello que cuando existen problemas para cambiar las actitudes en el individuo o en
un grupo, se acude a la comunicación persuasiva, para aplicarla deben de tomarse en
cuenta varios factores como son:
Quién debe dirigir la comunicación.
Cuándo debe hacerse.
A través de qué medio de difusión.
Cómo presentar los argumentos.
En qué forma, estilo y en qué orden.
Si se buscan cambiar las actitudes de una manera rigurosa, a través de la utilización de la
fuerza, los cambios que produzca pueden ser solo aparentes, pero puede darse el caso de
que sea un cambio real, o que se produzca éste con el paso del tiempo.
Por tanto se puede decir que cada vez que una persona recibe nueva información, hay
cierta probabilidad de que una o más de sus creencias puedan alterarse, y como resultado
la actitud se puede modificar.
Hay mucha gente que puede alterar esa información u olvidarla y por ende no modificar
sus actitud, es por ello que aunque se sepa qué va a cambiar en la conducta con el tipo de
información sepa qué va a cambiar en la conducta con el tipo de información que se le
está trasmitiendo, se debe de tomar en cuenta cuál es la información que
verdaderamente se absorberá.
Para que las actitudes del individuo cambien, se deben tomar en cuenta: el prestigio que
tenga la fuente de comunicación, entre más honesta parezca, es más probable que tenga
éxito el cambio de actitud. Cuando un discurso se emite sin ningún tipo de desacuerdo del
auditorio, funciona mejor, porque da la impresión de que el hablante es honesto y sabe lo
que dice, además ayuda más si el auditorio desconoce el tema del que se habla y está de
antemano de acuerdo con el hablante; si llegara a haber puntos de vista distintos,
entonces se dudaría sobre el problema y el expositor.
Para estudiar la persuación que se realiza en la sociedad es necesario analizar las variables
dependientes e independientes de tal proceso.
Dentro de la independiente encontramos: "quién dice qué a quién, por qué vías, con qué
resultados; a través de los siguientes elementos: la fuente, el mensaje, el canal, el
receptor, el destino, elementos indispensables en el proceso de la comunicación.
Dentro de la variable dependiente existen 6 pasos que el individuo debe recorrer cuando
se le persuade de que adopte una nueva actitud" persuación de la comunicación
persuasiva. Una vez presentado, el sujeto debe atenderlo. Si lo atiende también debe
entenderlo, por lo menos la conclusión que se le ofrece. A parte de entender la
información, debe ceder a ella. Es indispensable que esa información se mantenga hasta
algún momento posterior, para medir el efecto. El último paso es el que se espera, que el
sujeto actúe como se pretendía.
Para que el sujeto sea persuadido con mayor facilidad, es necesario considerar la atención
y comprensión que de a la información persuasiva; algunos autores mencionan que la
inteligencia es importante para no ser persuadido, pero en experimentos realizados, se
llegó a la conclusión de que las personas inteligentes son las más persuadidas,
posiblemente porque está más elevado su nivel de atención y comprensión antes referido.
Dentro de la comunicación de persuasión (propaganda) se pueden despertar distintos
estados anímicos en el sujeto, por ejemplo:
Temor (de no hacer lo que se dice).
Acrecentar su motivación (de actuar en forma preventiva).
Dentro del temor se puede presentar "la huida y lucha en contra del mensaje, provocando
en ocasiones la reducción de la atención y de la comprensión o retención del mensaje.
El estudio de la comunicación, como proceso es muy complejo, y lo es aun más si nos
referimos a los elementos de control social dentro de la comunicación, y es precisamente
este enfoque de la comunicación, el que concibe al hombre como una máquina
conceptualizadora, ocupada en infundir significaciones a los estímulos que llegan hasta él.
La propaganda
La propaganda es el empleo deliberado de símbolos con el propósito de cambiar las
creencias e ideas de la gente y en último término sus actos. Como forma de poder y
control social, pues, difiere de la violencia organizada.
La manipulación deliberada de las palabras y otros símbolos con el fin de conseguir un
cambio de las opiniones y actitudes y en definitiva de las acciones, es sin embargo algo tan
viejo como la historia escrita. Desde el punto de vista psicológica, la actual fabricación
consciente de estereotipos, leyendas y de mitos sólo difiere de la producción inconsciente
de dichos materiales verbales por la intención expresa de modificar las creencias,
convicciones, actitudes y comportamientos.
La propaganda puede ser empleada por un grupo de interés especial en oposición a otro
grupo, o bien con relación a un público o consumidor más amplio los organismos
gubernamentales la emplean para promover planes locales de carácter político-
económico. Puede ser usada también como un aspecto de la guerra psicológica entre
naciones, tanto en la paz como en la guerra.
En estrecha relación con la propaganda se hallan prácticas no deliberadas para inducir
actitudes y valores, por ejemplo la enseñanza de valores nacionalistas básicos a través de
la historia, la geografía y la literatura. En términos estrictos, no puede hablarse de
propaganda cuando el proceso no forma parte de un esquema deliberado de
adoctrinamiento.
Debemos decir algo acerca del lugar que ocupan en la propaganda los anuncios y la
publicidad. También los medios de comunicación tienen una influencia poderosa en la
inducción indirecta a la delincuencia, el cine, los cómicos y, fundamentalmente, la
televisión, productos eminentes de la cultura actual que inundan los mercados mundiales
ofrecen pautas de conducta, modelos, actitudes y actividades que forman parte de las
claves que presiden posibles conductas delictivas. La violencia de las relaciones de poder y
dominación, con sus secuelas de abuso de la fuerza, son ambiguamente presentados, en
no pocas ocasiones, como los caminos que pueden conducir al éxito a través de esta
propaganda, se postule un individualismo egoísta y se promueve la constante utilización
de las personas y los objetos en beneficio propio. La ideología filtrada por este alud
publicitario estimule el cambio ininterrumpido de bienes materiales y de valores morales,
y ensalza un mundo en que la transgresión de normas constituye el estilo de vida habitual
de los personajes.
Es así como la propaganda provoca en los seres humanos conductas que son nocivas para
la sociedad.
El propagandista provoca la asimilación mediante la técnica de sugestión; añade nuevos
relatos, explicaciones y descripciones de acontecimientos, todo ello calculado con el fin de
despertar nuestro miedo de ciertas cosas o nuestra cólera contra otras, y de hacernos
aceptar y hallar placer en nuevas leyendas y, por proyección, participar en ella. Al igual
que gran parte de nuestra conducta, nuestro miedo, cóleras, irritaciones, rechazos,
aceptaciones amores y simpatías reflejadas nuestros vínculos con un grupo particular y
nuestras actitudes negativas hacia otros grupos.
Como hemos visto, las leyendas y mitos en los que todos hemos sido educados son
principalmente relatos sobre una historia nacional, nuestra religión e iglesia, nuestro
partido político y sobre los hombres de nuestros grupos históricos que se han destacado.
La propaganda no es más que la creación consciente de esta clase de materiales, en
beneficio de la supervivencia del grupo y del control social.
La sugestión es el elemento psicológico esencial de la propaganda. Más específicamente,
los propagandistas emplean una variedad de técnicas especiales de argumentación. Los
factores básicos en cualquier análisis de la propaganda son:
El propósito, relacionado siempre con el auditorio al que va dirigida la propaganda.
El material o contenido simbólico.
El método especial de sugestión y demás técnicas psicológicas empleadas.
La recepción de la propaganda y sus efectos en la modificación de las ideas, actitudes,
valores y especialmente acciones.

La intención de la propaganda velada rara vez es conocida por el investigador, y las


campañas más exitosas de esta clase son conocidas sólo más tarde, retrospectivamente,
por los historiadores. La finalidad de la propaganda abierta se manifiesta por adelantado.
Al investigador que estudie este tipo de propaganda le resulta por lo general mucho más
fácil descubrir y medir los símbolos empleados.
Desarrollo y planificación
ntroducción a la planificación
Una vez fijados nuestros objetivos hemos de preparar un plan de acción para
conseguirlos e ir controlando el desarrollo del plan para asegurarnos que vamos bien
hacia el objetivo. En esta página se describe qué es un objetivo y sus características, qué
es un plan como se hace y como se controla.
Introducción a la planificación
Dr. José Antonio García Higuera
Miembro del equipo de Psicoterapeutas.com
Consúltale en el
Centro de Psicología Clínica y Psicoterapia García Higuera
C/ Hermosilla, 114. 1ºC Madrid 28009
Teléfono: 914119140
Contacta con él
Definición de objetivo
El primer punto de la planificación es la definición de un objetivo. Un objetivo es un
resultado que esperamos obtener del plan que vamos a construir.
Es conveniente distinguir entre objetivos y valores. Valores son consecuencias globales
deseadas a muy largo plazo, mientras que los objetivos son consecuencias que se esperan
obtener en un relativamente corto plazo de tiempo.
“Con los valores definimos cómo queremos el mundo futuro y la forma ideal de cómo nos
gustaría vernos en él. Los valores tienen características especiales: no pueden ser
alcanzados, no pueden ser poseídos como objetos, ni pueden conseguirse
permanentemente. Son direcciones en la vida, y como tales nos indican un camino, no una
meta a alcanzar. Cuando caminamos hacia nuestros valores podemos encontrar señales
que sobrepasamos, objetivos que alcanzamos, que son pequeños pasos que vamos dando
y nos señalan nuestros avances; pero lo importante no es alcanzar esas señales, sino
seguir el rumbo fijado”. ("Curso Terapéutico de Aceptación I y II" página 71). En
contraposición, los objetivos han de ser alcanzables, pueden ser poseídos como objetos y
se pueden tener permanentemente.
Fijar los resultados que son compatibles con nuestros valores y que son alcanzables en un
relativamente corto espacio de tiempo es una forma de avanzar por la vida en la dirección
que deseamos y que nos marcan nuestros valores.
El valor define un objetivo cuando prevemos algo tangible en la dirección que nos marca.
Para ello, concretamos un resultado tangible, le asignamos una fecha, elaboramos unos
planes para alcanzarlo y ponemos los medios necesarios para conseguirlo.
En este sentido un objetivo es un sueño con una fecha, un plan y unos medios para
conseguirlo.
Los objetivos se refieren a “QUÉ” es lo que queremos los planes se refieren a cómo
conseguirlo.
Los componentes de un objetivo
Los objetivos tienen como componentes principales: el resultado que se espera, la fecha
de su consecución,
1. El resultado que se pretende que ha de ser:
 Específico. Los objetivos han de ser específicos, es decir, se han de concretar en un
resultado concreto y sin posibles ambigüedades.
 Medible. Dentro de la concreción se ha de tender a que sean medibles, de forma
que cualquiera pueda determinar si se ha conseguido o no.
 Aceptable por aquellos que van a participar en su consecución.
 Reforzante o reforzado. Conseguir el resultado que supone un objetivo ha de ser
reforzante para aquel que lo consigue y, si no coincidiera con los valores de quien
ha colaborado para conseguirlo, este ha de ser reforzado.
1. La fecha de consecución o tiempo para obtener el resultado. En este aspecto los
objetivos propuestos han de ser:
o Realista. Se han de poder conseguir en el tiempo fijado, con los medios de
los que se dispone y con el plan trazado.
o Adecuada para que sea reforzante. Hay que considerar que muchos
objetivos lo son en tanto en cuanto se consiguen en una fecha
determinada, puede que si se consiguen después, ya no son reforzantes.
2. Un objetivo, para dejar de ser un sueño deseable, ha de tener una fecha y también
un plan y unos recursos humanos y materiales para conseguirlo.
Planes
Los planes son la secuencia de acciones necesarias para conseguir el resultado, es decir, el
objetivo. Cada acción del plan conlleva:
1. Una serie de precondiciones para poder hacerla. Las precondiciones son los
elementos necesarios para poder iniciarlas
2. Un resultado. Toda acción tiene un resultado que se convierte en sí mismo en un
objetivo intermedio y como tal tiene que tener las mismas características que
cualquier objetivo.
3. Los medios necesarios para llevarla a cabo. La disponibilidad de los recursos en el
momento preciso es también una precondición necesaria para poder llevar a cabo
la acción.
4. Un tiempo de finalización que ha de estar coordinado con el resto de las acciones
precisas para conseguir el objetivo global.
5. Un responsable de la acción. En la planificación se asigna una persona que
adquiera la responsabilidad de que la acción se realice y produzca el resultado
esperado. Responsable significa “capaz de dar respuesta”, es decir, la persona
elegida ha de tener la capacidad de llevar a cabo la acción y de planificarla. Es
importante que esa persona tenga el objetivo que conlleva la acción como suyo y
está motivada para llevarla a cabo.
La tarea de planificar
La planificación implica la secuenciación de las distintas acciones teniendo en cuenta las
dependencias causales que existen entre ellas y que han sido puestas de manifiesto por
las precondiciones de cada una de ellas.
La planificación establece las relaciones temporales entre las acciones necesarias para
obtener el objetivo propuesto.
Las acciones se pueden realizar de forma paralela, cuando no se interfieren entre ellas. De
forma secuencial, cuando el resultado de una de ellas es una precondición de otra. De
forma confluyente, cuando son necesarias las dos para obtener un único resultado. La
asignación de recursos ha de hacerse de teniendo en cuenta estas características.
El responsable de la planificación ha de ser capaz de simular en su cabeza las acciones, sus
precondiciones, sus resultados y su secuencia para poder realizar el plan de forma
adecuada.
La capacidad de planificar implica capacidades cognoscitivas que nos permiten imaginar
las acciones intermedias, adelantar sus resultados y realizar la coordinación precisa para
armonizarlas en el tiempo y en las precondiciones para lograr la consecución del objetivo.
El control del plan
El "Curso Terapéutico de Aceptación I y II" plantea claramente qué es el control y su
importancia a la hora de planificar.
“Los seres humanos tenemos un modo muy potente de funcionar que nos ha permitido
conquistar la tierra. Aprendemos las leyes que gobiernan los distintos sistemas, nos
proponemos objetivos concretos e influimos en el comportamiento del sistema para
conseguirlo. Nos convertimos así en un sistema de control que tiene como meta controlar
el comportamiento de otro sistema controlado y para ello necesitamos:
Un objetivo, meta o estándar que alcanzar. El ser humano se puede plantear objetivos
propios, nuevos y originales creando una representación mental, más o menos clara, de lo
que quiere alcanzar a través del manejo del comportamiento del sistema controlado.
Un método para observar el avance hacia el objetivo. El sistema de control necesita un
seguimiento continuado del resultado que se está obteniendo en cada momento.
Un método de comparación para cotejar la situación actual con el objetivo que se
persigue.
Capacidad de modificar el comportamiento del sistema controlado. Cuando la diferencia
entre lo esperado y lo que se va obteniendo es significativa, el sistema de control actúa
sobre el sistema controlado, para modificar su comportamiento y conseguir que vaya
hacia el objetivo.
Un ejemplo sencillo de sistema de control son los termostatos de los calefactores:
 El objetivo es mantener en un recinto un intervalo de temperatura determinado.
 El termostato mide de forma continua la temperatura de la habitación y la
compara con el objetivo a conseguir.
 Cuando se sobrepasa una determinada temperatura (objetivo), el termostato
interrumpe el funcionamiento del sistema que calienta el recinto. Para ello ha de
tener acceso a un interruptor que pare el sistema de calefacción.
 Cuando la temperatura baja al límite inferior predeterminado el sistema de control
pone de nuevo en funcionamiento el sistema de calefacción.
El sistema de control posee un modelo del comportamiento de aquello que quiere
controlar, de forma que sabe lo que va a ocurrir cuando realiza cualquier acción
correctora sobre él. En efecto, el termostato se construye de acuerdo con un modelo
simple del funcionamiento de la calefacción: si el interruptor está apagado, la calefacción
deja de dar calor y si está encendido, lo proporciona. Si el tiempo es frío y el sistema deja
de funcionar, la temperatura bajará. Cuando llegue al mínimo que marca el termostato, lo
encenderá accionando el interruptor. Por eso es necesario medir constantemente la
temperatura, para saber si hay que dejar de generar calor o no.
Las personas también pueden funcionar como un sistema de control. Muchas actuaciones
aparentemente sencillas, como mantener el equilibrio al andar o sujetar una copa, son
ejemplos de acciones que siguen este modelo de funcionamiento. Cuando lo empleamos,
nos comportamos de forma automática y efectiva. Seguramente la evolución de la especie
humana ha ido configurando un cerebro con esa capacidad muy desarrollada, por la
eficacia que tiene para resolver nuestros problemas de supervivencia. También es una
forma muy extendida para manejarnos en la producción de bienes y servicios, en la que
nuestra civilización ha sido tan exitosa. Virtualmente todas las relaciones sociales pueden
verse bajo el paradigma de la persecución de objetivos (Bargoon, 2000), en la que el
control juega un papel fundamental. Una de las funciones más importantes de esa manera
de operar es prepararnos para afrontar riesgos. Cuando prevemos un peligro, nuestra
mente se dispara de inmediato para intentar controlarlo” ("Curso Terapéutico de
Aceptación I y II", páginas 23 y siguientes).
Grupos de trabajo
El responsable del grupo de trabajo es el encargado de concretar los objetivos de grupo.
Ha de hacerlo en función de los valores de cada miembro que son compartidos por todo el
grupo. Es también el encargado de fijar las fechas, realizar el plan y de conseguir los
medios precisos.
Resumiendo el control supone
1. Comparar los resultados obtenidos con los esperados. Chequeando en el tiempo
las tareas realizadas y las esperadas.
2. Corregir problemas:
o Generando las acciones alternativas que pueden corregir las desviaciones
detectadas.
o Cambiado la asignación de recursos para lograr el resultado.
3. Cambiar los objetivos cuando se comprueba que no es posible alcanzarlo,
adecuando el objetivo al tiempo y al recurso disponible en cada momento.
Los planes están para ser modificados. Un plan rígido se puede convertir en un corsé que
impida alcanzar el objetivo. el control del avance del plan permite su modificación y su
adaptación a las circunstancia concretas. La tarea de planificación es constante a lo largo
del desarrollo del plan.
………………………………………….
1.
Aspectos generales e importancia de la planificación
2. Planificación. Definición
3. Clases de planificación y Características
4. Planificación y niveles gerenciales
5. Relación entre la Planificación y el Control
6. Conclusión
Introducción
La planificación cumple dos propósitos principales en las organizaciones: el protector y el
afirmativo. El propósito protector consiste en minimizar el riesgo reduciendo la
incertidumbre que rodea al mundo de los negocios y definiendo las consecuencias de
una acción administrativa determinada. El propósito afirmativo de la planificación consiste
en elevar el nivel de éxito organizacional.
Un propósito adicional de la planificación consiste en coordinar los esfuerzos y
los recursos dentro de las organizaciones. Se ha dicho que la planificación es como una
locomotora que arrastra el tren de las actividades de la organización, la dirección y
el control.
Por otro lado, se puede considerar a la planificación como el tronco fundamental de un
arbol imponente, del que crecen las ramas de la organización, la dirección y el control. Sin
embargo, el propósito fundamental es facilitar el logro de los objetivos de la empresa.
Implica tomar en cuenta la naturalezadel ámbito futuro en el cual deberán ejecutarse
las acciones planificadas.
La planificación es un proceso continuo que refleja los cambios del ambiente en torno a
cada organización y busca adaptarse a ellos.
Uno de los resultados más significativos del proceso de planificación es
una estrategia para la organización.
Aspectos generales e importancia de la planificación
Planificar significa que los ejecutivos estudian anticipadamente sus objetivos y acciones, y
sustentan sus actos no en corazonadas sino con algún método, plan o lógica. Los planes
establecen los objetivos de la organización y definen los procedimientos adecuados para
alcanzarlos.
Además los planes son la guía para que (1) la organización obtenga y aplique los recursos
para lograr los objetivos; (2) los miembros de la organización desempeñen actividades y
tomen decisiones congruentes con los objetivos y procedimientos escogidos, ya que
enfoca la atención de los empleados sobre los objetivos que generan resultados (3) pueda
controlarse el logro de los objetivos organizacionales. Asimismo, ayuda a fijar prioridades,
permite concentrarse en las fortalezas de la organización, ayuda a tratar los problemas de
cambios en el entorno externo, entre otros aspectos.
Por otro lado, existen varias fuerzas que pueden afectar a la planificación:
los eventos inesperados, la resistencia psicológica al cambio ya que ésta acelera el cambio
y la inquietud, la existencia de insuficiente información, la falta de habilidad en la
utilización de los métodos de planificación, los elevados gastos que implica, entre otros.
Planificación. Definición.
Entre conceptos de varios autores pudimos enfocar las siguientes definiciones:
"Es el proceso de establecer metas y elegir medios para alcanzar dichas metas" (Stoner,
1996).
"Es el proceso que se sigue para determinar en forma exacta lo que la organización hará
para alcanzar sus objetivos" (Ortiz, s/f).
"Es el proceso de evaluar toda la información relevante y los desarrollos futuros
probables, da como resultado un curso de acción recomendado: un plan", (Sisk, s/f).
"Es el proceso de establecer objetivos y escoger el medio más apropiado para el logro de
los mismos antes de emprender la acción", (Goodstein, 1998).
"La planificación... se anticipa a la toma de decisiones . Es un proceso de decidir... antes de
que se requiera la acción" (Ackoff,1981).
"Consiste en decidir con anticipación lo que hay que hacer, quién tiene que hacerlo, y
cómo deberá hacerse" (Murdick, 1994). Se erige como puente entre el punto en que nos
encontramos y aquel donde queremos ir.
"Es el proceso de definir el curso de acción y los procedimientos requeridos para alcanzar
los objetivos y metas. El plan establece lo que hay que hacer para llegar al estado final
deseado" (Cortés, 1998).
"Es el proceso consciente de selección y desarrollo del mejor curso de acción para lograr
el objetivo." (Jiménez, 1982). Implica conocer el objetivo, evaluar la situación considerar
diferentes acciones que puedan realizarse y escoger la mejor.
"La planificación es un proceso de toma de decisiones para alcanzar un futuro deseado,
teniendo en cuenta la situación actual y los factores internos y externos que pueden influir
en el logro de los objetivos" (Jiménez, 1982).
"Es el proceso de seleccionar información y hacer suposiciones respecto al futuro para
formular las actividades necesarias para realizar los objetivos organizacionales"
(Terry,1987).
En prácticamente todas las anteriores definiciones es posible hallar algunos elementos
comunes importantes: el establecimiento de objetivos o metas, y la elección de los medios
más convenientes para alcanzarlos (planes y programas).
Implica además un proceso de toma de decisiones, un proceso de previsión
(anticipación), visualización (representación del futuro deseado) y de predeterminación
(tomar acciones para lograr el concepto de adivinar el futuro). Todo plan tiene tres
características: primero, debe referirse al futuro, segundo, debe indicar acciones, tercero,
existe un elemento de causalidad personal u organizacional: futurismo, acción y
causalidad personal u organizacional son elementos necesarios de todo plan. Se trata de
construir un futuro deseado, no de adivinarlo.
Clases de planificación y Características.
Existen diversas clasificaciones acerca de la planificación. Según Stoner, los gerentes usan
dos tipos básicos de planificación. La planificación estratégica y la planificación operativa.
La planificación estratégica está diseñada para satisfacer las metas generales de la
organización, mientras la planificación operativa muestra cómo se pueden aplicar los
planes estratégicos en el quehacer diario. Los planes estratégicos y los planes operativos
están vinculados a la definición de la misión de una organización, la meta general que
justifica la existencia de una organización. Los planes estratégicos difieren de los planes
operativos en cuanto a su horizonte de tiempo, alcance y grado de detalle.
La planificación estratégica es planificación a largo plazo que enfoca a la organización
como un todo. Muy vinculados al concepto de planificación estratégica se encuentran los
siguientes conceptos: a) estrategia, b) administración estratégica, c) cómo formular una
estrategia.
 Estrategia: es un plan amplio, unificado e integrado que relaciona las ventajas
estratégicas de una firma con los desafíos del ambiente y se le diseña para alcanzar
los objetivos de la organización a largo plazo; es la respuesta de la organización a
su entorno en el transcurso del tiempo, además es el resultado final de la
planificación estratégica. Asimismo, para que una estrategia sea útil debe ser
consistente con los objetivos organizacionales.
 Administración estratégica: es el proceso que se sigue para que una organización
realice la planificación estratégica y después actúe de acuerdo con dichos planes.
En forma general se piensa que el proceso de administración estratégica consiste
en cuatro pasos secuenciales continuos: a) formulación de la estrategia; b)
implantación de la estrategia; c) medición de los resultados de la estrategia y
d) evaluación de la estrategia.
 Cómo formular una estrategia: es un proceso que consiste en responder cuatro
preguntas básicas. Estas preguntas son las siguientes: ¿Cuáles son el propósito y
los objetivos de la organización?, ¿A dónde se dirige actualmente la organización?,
¿En que tipo de ambiente está la organización?, ¿Qué puede hacerse para alcanzar
en una forma mejor los objetivos organizacionales en el futuro?
La planificación operativa consiste en formular planes a corto plazo que pongan
de relieve las diversas partes de la organización. Se utiliza para describir lo que las diversas
partes de la organización deben hacer para que la empresa tenga éxito a corto plazo.
Según Wilburg Jiménez Castro la planificación puede clasificarse, según sus propósitos en
tres tipos fundamentales no excluyentes, que son: a) Planificación Operativa, b)
Planificación Económica y Social, c) Planificación Física o Territorial. Según el período que
abarque puede ser: a) de corto plazo, b) de Mediano plazo, c) de largo plazo.
Planificación Operativa o Administrativa: se ha definido como el diseño de un estado
futuro deseado para una entidad y de las maneras eficaces de alcanzarlo (R. Ackoff, 1970).
"Planificación Económica y Social: puede definirse como el inventario de recursos y
necesidades y la determinación de metas y de programas que han de ordenar esos
recursos para atender dichas necesidades, atinentes al desarrollo económico y al
mejoramiento social del país.
Planificación Física o Territorial: podría ser definida como la adopción de programas
y normas adecuadas, para el desarrollo de los recursos naturales, dentro de los cuales se
incluyen los agropecuarios, minerales y la energía eléctrica, etc., y además para el
crecimiento de ciudades y colonizaciones o desarrollo regional rural.
Planificación de corto plazo: el período que cubre es de un año.
Planificación de mediano plazo: el período que cubre es más de un año y menos de cinco.
Planificación de largo plazo: el período que cubre es de más de cinco años" (W. Jiménez C.,
1982).
Según Cortés, los planes se pueden clasificar también de acuerdo al área funcional
responsable de su cumplimiento: Plan de Producción, Plan de Mantenimiento, Plan
de mercadeo, Plan de Finanzas, Plan de Negocios.
Según el alcance, los planes se pueden clasificar como:
1.
2. Intradepartamentales, si se aplican a un departamento. Ejemplo: plan de
mantenimiento mecánico.
3. Interdepartamentales, si afectan a más de un departamento, ejemplos: plan
de seguridad industrial.
4. Para toda la organización. Ejemplo: Presupuesto.
5. Tambien pueden ser considerados como planes las políticas, los procedimientos,
las normas y los métodos de trabajo. Las políticas son líneas generales o directivas
amplias que establecen orientación para la toma de decisiones.
Ejemplo: promoción interna del personal.
Los procedimientos son reglas que establecen la forma convencional de organizar
actividades para cumplir una meta. Ejemplo: cierre de un ejercicio comercial.
Los métodos son formas sistemáticas y estructuradas para realizar actividades en forma
eficiente.
Las normas son regulaciones estrechas que definen con detalle los pasos y acciones para
realizar actividades repetitivas.
Pasos del proceso de planificación.
El proceso de planeación incluye cinco pasos principales (Cortés, 1998): 1) definición
de los objetivos organizacionales; 2) determinar donde se está en relación a los objetivos;
3) desarrollar premisas considerando situaciones futuras; 4) identificar y escoger entre
cursos alternativos de acción; 5) puesta en marcha de los planes y evaluar los resultados.
Planificación y niveles gerenciales.
Los administradores de nivel superior generalmente invierten más tiempo en la
planificación que los administradores de nivel bajo. Los administradores de nivel inferior
se encuentran altamente implicados en las operaciones diarias de la organización y, por lo
tanto, tienen menos tiempo para contribuir a la planificación que la alta dirección. Los
administradores de nivel medio usualmente invierten más tiempo en la planeación que los
administradores de nivel inferior, pero menos que los administradores de nivel superior.
El tipo de planificación realizada por los administradores también cambia a medida
que éstos ascienden en la organización. Típicamente, los administradores de nivel inferior
planean a corto plazo; los administradores de nivel medio planean a un plazo un tanto
más prolongado; y los administradores de nivel superior planean a un plazo más
prolongado.
La experiencia de los administradores de nivel inferior con las operaciones cotidianas los
convierte en los mejores para planear en cuanto a lo que debe hacerse en el corto plazo
para alcanzar los objetivos organizacionales. Los administradores de nivel superior
usualmente tienen una mejor visión de la situación organizacional como un todo y por lo
tanto se encuentran mejor dotados para planificar a largo plazo.

Relación entre la Planificación y el Control.


La planificación proporciona estándares (indicadores) de control contra los cuales puede
medirse el desempeño. Si existe una desviación significativa entre el desempeño real y el
planeado, puede tomarse una acción correctiva. Un ejemplo claro de los planes
empleados como estándares de control se pueden encontrar en los presupuestos.
Estos presupuestos proporcionan la base para estándares continuos de control durante
todo el año de operaciones. Si el desempeño real no corresponde estrictamente al
desempeño planeado y presupuestado, hace que se aplique una acción correctiva.
Desde un punto de vista muy general puede considerarse que todo proyecto tiene tres
grandes etapas:
 Fase de planificación. Se trata de establecer cómo el equipo de trabajo deberá
satisfacer las restricciones de prestaciones, planificación temporal y coste. Una
planificación detallada da consistencia al proyecto y evita sorpresas que nunca son
bien recibidas.
 Fase de ejecución. Representa el conjunto de tareas y actividades que suponen la
realización propiamente dicha del proyecto, la ejecución de la obra de que se
trate. Responde, ante todo, a las características técnicas específicas de cada tipo
de proyecto y supone poner en juego y gestionar los recursos en la forma
adecuada para desarrollar la obra en cuestión. Cada tipo de proyecto responde en
este punto a su tecnología propia, que es generalmente bien conocida por los
técnicos en la materia.
 Fase de entrega o puesta en marcha. Como ya se ha dicho, todo proyecto está
destinado a finalizarse en un plazo predeterminado, culminando en la entrega de
la obra al cliente o la puesta en marcha del sistema desarrollado, comprobando
que funciona adecuadamente y responde a las especificaciones en su momento
aprobadas. Esta fase es también muy importante no sólo por representar la
culminación de la operación sino por las dificultades que suele presentar en la
práctica, alargándose excesivamente y provocando retrasos y costes imprevistos.
A estas tres grandes etapas es conveniente añadir otras dos que, si bien pueden incluirse
en las ya mencionadas, es preferible nombrarlas de forma independiente ya que definen
un conjunto de actividades que resultan básicas para el desarrollo del proyecto:
 Fase de iniciación. Definición de los objetivos del proyecto y de los recursos
necesarios para su ejecución. Las características del proyecto implican la necesidad
de una fase o etapa previa destinada a la preparación del mismo, fase que tienen
una gran trascendencia para la buena marcha del proyecto y que deberá ser
especialmente cuidada. Una gran parte del éxito o el fracaso del mismo se fragua
principalmente en estas fases preparatorias que, junto con una buena etapa de
planificación, algunas personas tienden a menospreciar, deseosas por querer ver
resultados excesivamente pronto.
 Fase de control. Monitorización del trabajo realizado analizando cómo el progreso
difiere de lo planificado e iniciando las acciones correctivas que sean necesarias.
Incluye también el liderazgo, proporcionando directrices a los recursos humanos,
subordinados (incluso subcontratados) para que hagan su trabajo de forma
efectiva y a tiempo.
Los periodos generales de duración los podemos ver a continuación:
Estas etapas citadas presentan, sin embargo, características bastante diferentes según se
trate de proyectos internos o de proyectos externos. Las principales diferencias aparecen
en la etapa de planificación. En el proyecto externo existen un conjunto de acciones que se
relacionan con la necesidad de presentar una oferta al cliente y lograr la adjudicación
del contrato en competencia con otras empresas o personas.
Si, por la razón que fuere, el contrato no se consigue el proyecto queda abortado antes de
haberse comenzado y carece de sentido preocuparse de cómo debe ser gestionado. La
exigencia comercial tiene, pues, un carácter prioritario para las empresas, siendo la
consecución del contrato paso imprescindible para poder acometer un
proyecto concreto y, con una perspectiva más amplia, condición esencial para la
supervivencia de la empresa.
Haciendo referencia a las tres grandes etapas nombradas al principio, podemos ver la
diferencia entre ambos tipos de proyectos:
Cuando se abordan proyectos grandes y complejos, la consecución del resultado final
depende de la realización armónica del conjunto de las etapas pertinentes con ayuda de
los medios materiales y humanos requeridos en cada momento. La concepción de las
fases que han de ejecutarse, el orden de encadenamiento lógico de las mismas y la
estimación de la naturaleza y cantidad de recursos a emplear en cada momento, precisan
de un conocimientoprofundo de las tecnologías que concurren en el proyecto y de una
experiencia que permita prever y superar las dificultades que en la práctica suelen
aparecer.
A continuación se presentan las distintas etapas en el desarrollo de una Planificación:
ETAPA 1 El "promotor" expone sus necesidades y el deseo de resolver el problema por
medios informáticos. Se crea un primer documento breve que recoge el anteproyecto y es
aprobado por la dirección o el comité correspondiente.
ETAPA 2 El estudio de oportunidad concreta los objetivos y resultado a aportar por el
proyecto, los plazos y costes previstos y los medios a emplear.
ETAPA 3 El jefe de proyecto define, ya en detalle, con el apoyo de los técnicos de su
equipo, el contenido del proyecto, su análisis funcional, las cargas de trabajo previstas y
la metodología a desarrollar.
ETAPA 4 A partir del análisis funcional se determinan en forma definitiva los volúmenes,
cargas de trabajo, calendario y medios a utilizar, dando lugar al contrato formal entre
cliente, usuarios e informáticos, frecuentemente conocido con el nombre de cuaderno de
cargas o, más concretamente, "pliego de especificaciones".
ETAPA 5 Los técnicos realizan el análisis orgánico y las especificaciones
para programación.
ETAPA 6 Se realiza la programación de la aplicación y las pruebas para programación.
ETAPA 7 Al resultar satisfactorias las pruebas se realiza la recepción provisional, dando
lugar a los manuales de usuario y de explotación.
ETAPA 8 La puesta en marcha de la aplicación es una fase delicada que requiere una
estricta vigilancia hasta comprobar su correcto funcionamiento. A continuación se realiza
un balance de los resultados del proyecto.
ETAPA 9 Después de varios meses de funcionamiento de la aplicación se debe realizar un
balance que permita apreciar los beneficios que realmente ha producido a la empresa.
ETAPA 10 Transcurridos uno o dos años, debe efectuarse una auditoria de la aplicación
que permita comprobar si sigue siendo adecuada o si es necesario introducir
modificaciones.
Desde el punto de vista de la metodología de gestión de proyectos, también pueden
identificarse varias fases que generalmente deberán darse en todo tipo de proyectos:
1.
2. Decisión de acometer el proyecto.
3. Nombramiento del jefe de proyecto.
4. Negociación de objetivos.
5. Preparación.
6. Ejecución.
7. Información.
8. Control.
Por qué es importante.
Hoy día las posibilidades de realizar un buen planeamiento se han visto favorecidas por el
desarrollo de la informática (software y hard), que ha optimizado la capacidad para
generar, almacenar, procesar y transportar información. Sin embargo la tecnología por sí
sola no es suficiente: quienes integran el Ceo de las organizaciones y principalmente los
Directores de Comunicación, deben saber utilizarla y la cultura empresaria debe estimular
las innovaciones y los cambios armoniosos que producen la integración de la tecnología y
el torrente de información.
En la Venezuela de hoy parece más que necesario instrumentar este tipo de metodologías.
Cierto es que no son muchas las empresas o consultoras que se dedican a estos temas o
que cuentan con los profesionales preparados para tales fines. Pero como dice el dicho
"una imagen vale más que mil disculpas" por lo tanto cuidarla se torna imprescindible,
claro que no solo para la imagen sino también para los negocios.
Por otra parte, es una herramienta de posicionamiento anticipado que permite a la
organización saber las amenazas y oportunidades para ganar clientes, posicionar, lanzar
y/o retirar productos, en síntesis anticiparse y adecuarse a los cambios del mercado y de
la sociedad.
Para terminar no hay que olvidar que la calidad de un trabajo de planificación no se mide
por la capacidad de hacer predicciones correctas, sino por el cuestionamiento de
los modelos mentales y la transformación de las personas implicadas, el desarrollo de sus
habilidades para la coordinación y la concertación de estrategias, y el estímulo a la
instrucción y los procesos cognitivos que coadyuven a comprender y conducir una acción
eficaz, en beneficio de los hombres del mañana.
Conclusión
Si una organización aspira a permanecer sana debe plantearse objetivos realistas. La
planificación está comprometida en la fijación de los objetivos de la organización y en las
formas generales para alcanzarlos. La opción frente a la planificación es la actividad
aleatoria, no coordinada e inútil. Los planes efectivos son flexibles y se adaptan
condiciones cambiantes.
Debe hacerse notar que ni la planificación estratégica ni la operativa es un esfuerzo
ocasional si se quiere que sea efectiva y logre los resultados deseados. Más bien es un
círculo continuo que nunca debe terminar en una organización; debe ser vigilada
periódicamente, revisada y modificada de acuerdo con los resultados internos, y externos
y los eventos.

División celular
División celular
Ir a la navegaciónIr a la búsqueda

Esquemas de la división celular.


La división celular es una parte muy importante del ciclo celular en la que
una célula inicial se divide para formar células hijas.1 Debido a la división celular se
produce el crecimiento de los seres vivos. En los organismos pluricelulares este
crecimiento se produce gracias al desarrollo de los tejidos y en los seres unicelulares
mediante la reproducción asexual.
Los seres pluricelulares reemplazan su dotación celular gracias a la división celular y suele
estar asociada con la diferenciación celular. En algunos animales la división celular se
detiene en algún momento y las células acaban envejeciendo. Las células senescentes se
deterioran y mueren debido al envejecimiento del cuerpo. Las células dejan de dividirse
porque los telómeros se vuelven cada vez más cortos en cada división y no pueden
proteger a los cromosomas como tal.
Las células hijas de las divisiones celulares, en el desarrollo temprano embrionario,
contribuyen de forma desigual a la generación de los tejidos adultos.

Índice
 1Tipos de reproducción asociados a la división celular
 2Procesos de división celular
 3Factores que explican la división celular
 4Divisiones silenciosas
 5Véase también
 6Referencias
Tipos de reproducción asociados a la división celular[editar]
Bipartición: es la división de la célula madre en dos células hijas, cada nueva célula es un
nuevo individuo con estructuras y funciones idénticas a la célula madre. Este tipo de
reproducción la presentan organismos como bacterias, amebas y algas.
Gemación: se presenta cuando unos nuevos individuos se producen a partir de yemas. El
proceso de gemación es frecuente en esponjas, celentereos, . En una zona o varias del
organismo progenitor se produce una envaginación o yema que se va desarrollando y en
un momento dado sufre una constricción en la base y se separa del progenitor
comenzando su vida como nuevo ser. Las yemas hijas pueden presentar otras yemas a las
que se les denomina yemas secundarias.
En algunos organismos se pueden formar colonias cuando las yemas no se separan del
organismo progenitor. En las formas más evolucionadas de briozoos se observa en el
proceso de gemación que se realiza de forma más complicada. La gemación es el proceso
evolutivo del ser vivo por meiosis. El número de individuos de una colonia, la manera en
que están agrupados y su grado de diferenciación varía y a menudo es característica de
una especie determinada. Los briozoos pueden originar nuevos individuos sobre unas
prolongaciones llamados estolones y al proceso se le denomina estolonización.
Ciertas especies de animales pueden tener gemación interna, yemas que sobreviven en
condiciones desfavorables, gracias a una envoltura protectora. En el caso de
las esponjas de agua dulce, las yemas tienen una cápsula protectora y en el interior hay
sustancia de reserva. Al llegar la primavera se pierde la cápsula protectora y a partir de la
yema surge la nueva esponja. En los briozoos de agua dulce se produce una capa
de quitina y de calcio y no necesitan sustancia de reserva pues se encuentra en estado
de hibernación.
Esporulación: esputación o esporogénesis consiste en un proceso de diferenciación
celular para llegar a la producción de células reproductivas dispersivas de resistencia
llamadas esporas. Este proceso ocurre en hongos, amebas, líquenes, algunos tipos
de bacterias, protozoos, esporozoos (como el Plasmodium causante de malaria), y es
frecuente en vegetales (especialmente algas, musgos y helechos), grupos de muy
diferentes orígenes evolutivos, pero con estrategias reproductivas semejantes, todos ellos
pueden recurrir a la formación de células de resistencia para favorecer la dispersión.
Durante la esporulación se lleva a cabo la división del núcleo en varios fragmentos, y por
una división celular asimétrica una parte del citoplasma rodea cada nuevo núcleo dando
lugar a las esporas. Dependiendo de cada especie se puede producir un número
apreciable de esporas y a partir de cada una de ellas se desarrollará un individuo
independiente.
La división celular es el proceso por el cual el material celular se divide entre dos nuevas
células hijas. En los organismos unicelulares esto aumenta el número de individuos de la
población. En las plantas y organismos multicelulares es el procedimiento en virtud del
cual crece el organismo, partiendo de una sola célula, y también son reemplazados y
reparados los tejidos estropeados.
Procesos de división celular[editar]
 Interfase es la preparación de las células para la división.
 Mitosis es la forma más común de la división celular en las células eucariotas. Una
célula que ha adquirido determinados parámetros o condiciones de tamaño,
volumen, almacenamiento de energía, factores medioambientales, puede replicar
totalmente su dotación de ADN y dividirse en dos células hijas, normalmente
iguales. Ambas células serán diploides o haploides, dependiendo de la célula
madre.
 Meiosis es la división de una célula diploide en cuatro células haploides. Esta
división celular se produce en organismos multicelulares para
producir gametoshaploides, que pueden fusionarse después para formar una
célula diploide llamada cigoto en la fecundación.
Los seres pluricelulares reemplazan su dotación celular gracias a la división celular y suele
estar asociada a la diferenciación celular. En algunos animales, la división celular se
detiene en algún momento y las células acaban envejeciendo. Las células senescentes se
deterioran y mueren, debido al envejecimiento del cuerpo. Las células dejan de dividirse
porque los telómeros se vuelven cada vez más cortos en cada división y no pueden
proteger a los cromosomas. Las células cancerosas son inmortales.
Una enzima llamada telomerasa permite a estas células dividirse indefinidamente.
La característica principal de la división celular en organismos eucariotas es
la conservación de los mecanismos genéticos del control del ciclo celular y de la división
celular, puesto que se ha mantenido prácticamente inalterable desde organismos tan
simples como las levaduras a criaturas tan complejas como el ser humano, a lo largo de la
evolución biológica.
Factores que explican la división celular[editar]
Una teoría afirma que existe un momento en el que la célula comienza a crecer mucho, lo
que hace que disminuya la proporción área/volumen. Cuando el área de la membrana
plasmática de la célula es mucho más pequeña en relación con el volumen total de ésta,
se presentan dificultades en la reabsorción y en el transporte de nutrientes, siendo así
necesario que se produzca la división celular.
Hay tres tipos de reproducción celular: la fisión binaria, relativamente simple y dos tipos
más complicados que implican tanto la mitosis o la meiosis.
 La fisión binaria
Los organismos como las bacterias típicamente tienen un solo cromosoma. Al inicio del
proceso de fisión binaria, la molécula de ADN del cromosoma de la célula se replica,
produciendo dos copias del cromosoma. Un aspecto clave de la reproducción celular de la
bacteria es asegurarse de que cada célula hija recibe una copia del
cromosoma. Citocinesis es la separación física de las dos células hijas nuevas.
 Reproducción celular que involucra la mitosis.
La mayoría de los organismos eucariotas como los humanos tienen más de un
cromosoma. Con el fin de asegurarse de que una copia de cada cromosoma sea segregado
en cada célula hija se utiliza el huso mitótico. Los cromosomas se mueven a lo largo de
los microtúbulos largos y delgados como los trenes en movimiento a lo largo de las vías
del tren. Los seres humanos son diploides, tenemos dos copias de cada tipo de
cromosoma, uno del padre y uno de la madre .
 Reproducción celular que involucra la meiosis.
Las células sexuales, denominadas también «gametos», son producidas por meiosis. Para
la producción de esperma hay dos pasos (citocinesis) que producen un total de cuatro
células N, cada una con la mitad del número normal de cromosomas. La situación es
diferente: en los ovarios la producción de huevos en uno de los cuatro conjuntos de
cromosomas que se segrega se coloca en una célula huevo grande, listo para ser
combinado con el ADN de una célula de esperma (véase la meiosis para más detalles).
Divisiones silenciosas[editar]

Divisiones silentes.
Las divisiones silenciosas son divisiones sin mutaciones. A veces se confunden con
mutaciones que no son detectables. Pero se puede comprobar si las divisiones son
silenciosas por comparación de las frecuencias de los alelos de la línea celular con la suma
de las frecuencias de los alelos de las dos células derivadas, lo cual tiene que ser similar.
No se puede detectar una división que origina una célula sin mutaciones (silenciosa) y otra
muerta (no contribuye al adulto).
…………………………………………….
En la división celular se encuentran dos tipos que son, división celular directa o amitosis y
la indirecta cariocinesis. ... Mitosis Es mediante el cual la célula se divide en dos células
hijas mediante un conjunto de fases que conforman el proceso miótico como tal que son:
profase, metafase, anafase, telofase.
……………………………………………………
División Celular
División Celular.
Concepto.
Es el proceso por medio del cual las células se multiplican.
La división celular comprende:
- La división del núcleo (Cariodiéresis).
- La división del citoplasma (Plasmodiéresis o citocinesis) La división celular es la parte
del ciclo celular en la que una célula inicial llamada madre se divide en dos para formar
dos células hijas.
Tipos de división celular:
• Directa o Amitosis.
• Indirecta o Cariosinesis
• Mitosis.
• Meiosis.
Ciclo celular:
Es la secuencia de crecimiento y división celular.
Se divide en dos etapas:
• Mitosis propiamente dicha.
• Interfase.
• Fase G1: Síntesis de ARN, Proteínas. Volumen
• Fase S: Síntesis y duplicación del ADN.
• Fase G2: Duplicación de Centriolos, se Produce y almacena energía.
Síntesis de macromoléculas.
Cromosomas:
• Estructuras nucleares formados por ácidos nucleicos y proteínas presentes en todas las
células animales y vegetales.
• Contiene el ADN, que se divide en pequeñas unidades llamadas genes.
• Son bien notables en la mitosis.
• En el hombre existen 46 cromosomas, 23 pares semejantes entre si.
• Entre estos pares existe uno que reúne los cromosomas sexuales. XX en la mujer y XY
en el hombre.
Clasificación según su función:
A) Cromosomas autosomas: Son los no portadores de caracteres sexuales y se encargan
de inducir el desarrollo de las características morfológicas de un ser vivo, son iguales en
ambos sexos.
B) Cromosomas sexuales: Son los determinantes del sexo del individuo. Se encuentran
constituidos por un par de cromosomas distintos. La combinación XX es propia del sexo
femenino y la XY del masculino.
Estructura del cromosoma:
A) Telómeros: Es el nombre que se utiliza para identificar las dos extremidades o brazos
del cromosoma, los cuales presentan la propiedad de polaridad.
B) Centromeros o constricción primaria: Es el estrangulamiento donde se une dos
telómeros. Este constituye el centro de orientación de los cromosomas durante la
mitosis para emigra a los polos de la célula, siguiendo la dirección de las fibras del huso
acromático.
C) Constricciones secundarias: Son estrechamientos dispuestos a lo largo del
cromosoma.Están relacionadas con la reorganización de los nucléolos.
D) Satélite: Es una formación esférica que se encuentra en uno de los extremos del
cromosoma.
E) Centromero: Une los dos telómeros o brazos del cromosoma.
F) Cromonema: filamento doble, arrollado en forma de espiral, localizado en el interior
del cromosoma.

Según la forma del cromosoma y posición del centrómero pueden ser:


 ACROCENTRICOS. Tienen el centrómero muy cerca de un extremo, con un brazo
corto muy pequeño.
 METACENTRICOS. Tienen los brazos corto y largo de aproximadamente la misma
longitud, con el centrómero en el punto medio.
 SUBMETACENTRICOS. Tienen los brazos corto y largo de longitudes desiguales,
con el centrómero más próximo a uno de los extremos.
División directa o amitosis:
 Simple estrangulación de la célula y separación posterior de los fragmentos sin
que se observen modificaciones importantes en el núcleo o citoplasma.
 En ocasiones esta división es solamente nuclear. C. hepáticas, nerviosas,
fibrobroblastos.
 En ocasiones es total dando origen a dos células completas.Leucocitos, c.
óseas, cartilaginosas.

MITOSIS:
• Forma más común de la división celular.
• Las células hijas poseen igual número de cromosomas de la célula madre y por lo tanto
igual contenido genético.
• Todo el proceso de división de la célula ocurre tras la duplicación del
material genético.
• Fases: 4 períodos:
• Profase.
• Metafase.
• Anafase.
• Telofase.
Profase:
• Comienza luego del Período intermitótico o sea el lapso de tiempo entre una mitosis y
la siguiente.
• Primeras modificaciones del citoplasma y núcleo.
• La célula adopta forma esférica.
• Se comienza a condensar la cromatina haciéndose visibles los cromosomas.
• Se duplican los centríolos al final de esta fase ocupan los polos de la célula formando
el huso mitótico.

• Metafase
Los cromosomas se disponen en un plano equidistante de las dos esferas atractivas.
• Formando la llamada placa ecuatorial.
• La membrana nuclear y los nucleolos desaparecen.
• Se individualizan completamente las dos cromátides.
• Los cromosomas se unen a las fibras del huso por los centromeros, los cuales al final
de esta fase se dividen.
Anafase:
• Continua la separación de las cromatides y se hace completa llegando a ambos polos.
• Ausencia de membrana nuclear.
 El cuerpo celular se alarga y adquiere forma ovoide.

Telofase:
• Los cromosomas han llegado a los polos.
• Se reconstituye la cromatina.
• Aparecen los nucleolos y se reconstituye la membrana nuclear.
• Desaparece el huso acromático, persistiendo los centríolos.
• Se completa la división del citoplasma.
MEIOSIS:
• Es el proceso de división celular mediante el cual cada célula hija contiene la mitad de
los cromosomas que contenía el núcleo de la célula madre. (Haploide).
• Cada célula hija contiene caracteres genéticos de origen paterno y materno a la vez.
• Constituye la forma en que se dividen las células sexuales.
• Consta de una primera división reduccional MEIOSIS I.
• Seguida de una segunda división ecuatorial MEIOSIS II.

Primera división meiótica o reduccional:


• Profase I:
Es la etapa más compleja del proceso. En esta fase:
• La membrana nuclear y nucleolos desaparecen.
• Los cromosomas se ven; se acortan y aumentan su grosor.
• Los centriolos emigran a los extremos de la célula y quedan unidos por fibras.
Se divide en 5 subetapas:
1.- Leptoteno: Los cromosomas aparecen en forma de filamentos.
2.-Zigoteno: Los cromosomas homólogos se alinean y se aparean, proceso que a
menudo, es denominado sinapsis.

3.- Paquiteno: Se completa el apareamiento de los cromosomas homólogos, se acortan y


aumentan de grosor. Recombinación o crossing-over. En este último proceso los
cromosomas intercambian segmentos o recombinan sus genes.

4.-Diploteno: Los cromosomas apareados se separan, aunque ellos todavía permanecen


unidos en los puntos de intercambio o quiasmas.

5.- Diacinesis: Los cromosomas están bien diferenciados y están separados, cada uno
para su lado, al final de la profase, desaparece el nucléolo y la membrana nuclear.

• Metafase I:
• Los cromosomas se alinean en el centro para luego irse al plano ecuatorial.
• El huso acromático ya se ha formado y sus fibras se unen a cada cromosoma homólogo
por el centrómero.
• Los cromosomas emigran hacia los polos de la célula.

• Anafase I:
• Comienza la fase reduccional.
• Los cromátides se separan constituyendo los cromosomas hijos. Comienza la migración
a los polos acercándose a los centríolos.
• El centrómero no se divide.

• Telofase I:
• Los cromosomas se desarrollan y alargan.
• Se inicia la reaparición de la membrana nuclear.
• Se originan dos células hijas con la mitad de la carga cromosómica que tenía la célula
madre, debido a que cada una de ella se queda con un juego de cromosomas
homólogos.

Segunda división meiótica: Similar a la mitosis.


• Profase II:
•Comienza a condensarse la cromatina en forma de cromosomas.
•Desaparece la membrana nuclear.
 Los centriolos se dirigen a los polos Celulares y forman el huso.

• Metafase II:
• Los cromosomas forman la placa ecuatorial.
• Se distinguen nítidamente las cromátides.
• Los centrómeros se orientan siguiendo las Fibras del huso-.

• Anafase II:
• División de los centrómeros.
• Los cromosomas “hijos” se separan y se dirigen a los polos.

• Telofase II:
• Los cromosomas llegan a los polos de la célula.
• Se forma la membrana nuclear
• Se divide el citoplasma.

Al final se obtienen 4 células hijas con la mitad del número de cromosomas que la célula
madre.
Diferencias entre mitosis y meiosis:

La mitosis da origen a dos células hijas; en cuento la meiosis da origen a cuatro células
hijas.
La mitosis posee exactamente el mismo numero de material genético (igual número de
cromosomas que la célula madre) ; la meiosis posee la mitad del numero del material
genético (la mitad del número de cromosomas que la célula madre) .
Por ultimo, en la mitosis los cromosomas son simples: en la meiosis los cromosomas son
mixtos ya que existe un proceso de recombinación del material genético.
La mitosis es la forma de división celular de las células somáticas y las células sexuales
(óvulo y espermatozoide se dividen por meiosis.

…………………………………………

División celular
La división celular es una parte muy importante del ciclo celular, donde da vida a
doscélulas hijas. En la división celular se observa la cariodiéresis (la división del núcleo) y
la plasmodiéresis o citocinesis (división del citoplasma). En la división celular
se encuentrandos tipos que son, división celular directa o amitosis y la indirecta
cariocinesis.
División celular directa o amitosis:
Es cuando el núcleo se separa en dos fragmentos sin necesidad de que el citoplasma
sedivida, tan bien se caracteriza porque es de manera rápida y no como la mitosis
quetienden ha interactuar los cromosomas.
La división celular directa:
En este grupo de división se encuentran la mitosis y la meiosis.
Ciclo celular
El ciclo celular se componente como la fase durante la cual ocurre la duplicación delADN
que sabemos que es el componente fundamental de los cromosomas. El ciclo vitalde la
célula esta dividido en dos fases que son la interfase y la mitosis, que a su vez lainterfase
esta subdividida en tres fases que son G1, S, G2 en la cual la función masimportante tiene
lugar en la síntesis (fase S), donde se recopila el ADN, mientras que lafases G1 y G2 que en
ingles es Gap que significa intervalo, lapso o espacio, dondetambién se cumplen funciones
esenciales para el nuevo proceso miótico.
Mitosis
Es mediante el cual la célula se divide en dos células hijas mediante un conjunto de fases

que conforman el proceso miótico como tal que son: profase, metafase, anafase, telofase.
Profase:
en esta fase se observa como la cromatina aparece, y en el núcleo se vancondensando los
cromosomas que parecen dos filamentos paralelos unidos por uncentrómero, la
membrana nuclear desaparecer y la centríolos comienzan a aparecer alfinal de la profase.
Metafase:
en esta fase se observa que la membrana nuclear desaparece los cromosomasaparecen,
aparece el huso acromático, los centríolos se hacen visible y se ubican a ladoscontrarios
de la célula y los cromosomas se ubican en el plano ecuatorial.
Anafase:
los cromosomas se dividen por la mitad en su lado ecuatorial dando origen a
loscromosomas hermanos generalmente tienen forma de V y luego se ubican a los polos
dela célula, cuando los cromosomas hermanos o cromátidas son llevados a lados opuesto
dela célula se les denomina de nuevo cromosomas.
Telofase:
después de posicionarse los cromosomas en los centríolos empiezan a

desarrollarse, procese después a formarse los núcleos en las dos células nuevas
y posteriormente aparecen los nucleolos en las dos células hijas, después la
membrananuclear se renueva y los husos desaparecen.
Está leyendo una previsualización gratis. Desbloquee el acceso completo con una prueba
gratis.
Pages 2 to 3 are not shown in this preview.

Descargar con una prueba gratis

Meiosis
Es uno de los tipos de división celular,

que solo ocurre con células sexuales, experimentados divisiones sucesivas, con la
capacidad de generar cuatro células con la mitad delnúmero de cromosomas, esta tipo de
división celular esta compuesto por una divisiónreduccional y otra división ecuatorial, en
estos dos tipos de divisiones se observa la profase, metafase, anafase y telofase, con la
única diferencia de que en la divisiónreduccional, la profase se subdivide en leptoteno,
zigoteno, paquiteno, diploteno,diacinesis.
División reduccional:Profase:
durante la primera fase la membrana nuclear desaparece al igual que losnucléolos, los
cromosomas aparecen y los centríolos emigran a los polos de la célula yquedan unidos por
fibras.
a.
Leptoteno:
los cromosomas aparecen
b.
Zigoteno:
los cromosomas homólogos aparecen y interactúan entre si
c.

Paquiteno:
realizan una recombinación genética o crossing-over en la quecambian pequeños
segmentos de ADN.
d.
Diploteno:
se separan los cromosomas homólogos, pero permanecen en unainteracción de cambios
de quiasmas
e.
Diacinesis:
los cromosomas están separados y diferenciados, cada uno por sulado, al final de la
profase desaparece el nucléolo y la membrana nuclear.
Metafase:
los cromosomas se van alineando en el plano ecuatorial, aparece el husoacromático y los
une con sus fibras a cada cromosoma homologo por su centrómero, a suves lo
cromosomas emigran a los polo de la célula.
Anafase:
la cromatina se separa constituyendo a dos cromosomas hijos, acercándose a
loscentríolos que se ubican en los polos opuestos de la célula, pero el centríolo no se
divide.
Telofase:
los cromosomas se desarrollan y alargan, se forma la membrana nuclear y seoriginan dos
células hijas con la mitad de la carga cromosomatica que tenia la originaldebido a que
cada una de las células se queda con una carga cromosomatica de loshomólogos.
División ecuatorial:
Esta segunda división es muy parecida a la de la mitosis la única diferencia es que lacarga
cromosomatica es del 46 cromosomas (2x23), al igual que la primera parte estadividida en
cuatro fases.
Profase II:
de nuevo empieza un proceso miótico en el cual la membrana nuclear sedesintegra, los
centríolos emigran a polos opuestos donde se encuentran los husos de encada una de las
células hijas de la primera división celular.
Metafase II:
en esta parte se observa mayormente el movimiento de los cromosomas
al plano ecuatorial, donde la cromatina y centrómeros se orientan según el huso
acromático.
Está leyendo una previsualización
Desbloquear el acceso completo con una prueba gratis.
Descargar Con Una Prueba Gratis

Anafase II:
los cromosomas se dividen y los huso comienzan a reducir de tamaño estocomo
consecuencia hace que los cromosomas hijos emigren a los polos de la célula (estoocurre
en las dos células hijas simultáneamente).
Telofase II:
los cromosomas hijos hacen una migración final a los polos de las células,donde se
vuelven menos densos y comienza a reaparecer la membrana nuclear y se divideel
citoplasma de cada célula.
Cariotipo
Es la ciencias que dependiendo de la especie se puede estudiar las alteraciones de
lacantidad de números de cromosomas que posee así también como tamaño forma y
otrascaracterísticas propias. En las alteraciones del cariotipo humano se encuentra
numéricas yestructurales.
Numéricas:
en las alteraciones cariotiecas humanas encontramos el síndrome de Downesta alteración
se diferencia por el mismo cromosoma que se repite en un individuo en

este caso es el cromosoma 21 que se repite 3 veces, también el síndrome de Turner que
seobserva cuando la mujer le falta un cromosoma sexual X así teniendo un total de
45cromosomas (solo pasa en las mujeres), y el síndrome de klinefelter que
generalmentesucede cuando hay una disyunción en el cromosoma sexual X y hace que sus
cromosomassean XXY cuando lo normal es XY (solo en hombres)
Estructural:
aquí se observa el síndrome de Cri-Dun-Chat
Está leyendo una previsualización
Desbloquear el acceso completo con una prueba gratis.
Descargar Con Una Prueba Gratis
Recompense su curiosidad
Todo lo que desea leer.
En cualquier momento. En cualquier lugar. Cualquier dispositivo.
Lea Gratis Por 30 Días
Sin compromisos. Cancele cuando quiera.
Compartir este documento
Compartir o incrustar documentos
Opciones para compartir
 Compartir En Facebook, Abre Una Nueva Ventana
 Compartir En Twitter, Abre Una Nueva Ventana
 Compartir En Linkedin, Abre Una Nueva Ventana
 Compartir Por Correo Electrónico, Abre Un Cliente De Correo Electrónico
 Copy Text
Intereses relacionados
 Meiosis
 Mitosis
 Chromosome
 Ciencias de la vida y de la tierra
 Life Sciences
Documentos similares a Division Celular
………………………………………………………………….
Cromosoma
Ir a la navegaciónIr a la búsqueda

Vista general de los cromosomas y su aspecto cambiante dentro de las células: (a) células
sin dividirse (obsérvese la red de cromatina y el nucléolo intensamente teñido); (b)
núcleos preparados para la división celular (puede observarse que la cromatina se ha
condensado); (c) células en distintos estadios de división mitótica (se puede observar que
la cromatina se ha terminado de condensar y se han formado los cromosomas); (e) par de
células hijas poco después de la división. En un ápice de raíz de cebolla, observado con
800 aumentos.
En biología y citogenética, se denomina cromosoma (del griego χρώμα, -τος chroma, color
y σώμα, -τος soma, cuerpo o elemento) a cada una de las estructuras altamente
organizadas, formadas por ADN y proteínas, que contiene la mayor parte de
la información genética de un ser vivo.
En las divisiones celulares (mitosis y meiosis) el cromosoma presenta su forma más
conocida, cuerpos bien delineados en forma de X, debido al alto grado de compactación y
duplicación.
En la interfase no pueden ser visualizados mediante el microscopio óptico de manera
nítida ya que ocupan territorios cromosómicos discretos. En las células eucariotas y en
las arqueas (a diferencia que en las bacterias), el ADN siempre se encontrará en forma
de cromatina, es decir asociado fuertemente a unas proteínas denominadas histonas y no-
histonas. La cromatina, organizada en cromosomas, se encuentra en el núcleo de las
células eucariotas y se visualiza como una maraña de hebras delgadas. Cuando comienza
el proceso de duplicación y división del material genético llamado (cariocinesis), esa
maraña de hebras inicia un fenómeno de condensación progresivo que permite visualizar
cada uno de los cromosomas.

Diagrama esquemático de un cromosoma eucariótico ya duplicado y condensado


(en metafase mitótica). (1) Cromátida, cada una de las partes idénticas de un cromosoma
luego de la duplicación del ADN. (2) Centrómero, el lugar del cromosoma en el cual ambas
cromátidas se tocan. (3) Brazo corto. (4) Brazo largo.
Cuando se examinan con detalle durante la mitosis, se observa que cada uno de los
cromosomas presenta una forma y un tamaño característicos.
Cada cromosoma tiene una región condensada, o constreñida, llamada centrómero, que
confiere la apariencia particular a cada cromosoma y que permite clasificarlos según la
posición del centrómero a lo largo del cromosoma.
Otra observación que se puede realizar es que el número de cromosomas de los
individuos de la misma especie es constante. Esta cantidad de cromosomas se denomina
número o Ploidía y se simboliza como 2n o 4n o 1n dependiendo del tipo de célula.
Cuando se examina la longitud de tales cromosomas y la situación del centrómero surge el
segundo rasgo general: para cada cromosoma con una longitud y una posición del
centrómero determinada existe en el núcleo otro cromosoma con características
idénticas, o sea, en las células diploides 2n los cromosomas se encuentran formando
pares. Los miembros de cada par se denominan cromosomas homólogos.
Mapa citogenético o cariograma de una niña antes de nacer, resultado de
una amniocentesis.
En la figura de la derecha se presentan todos los cromosomas de interfase de una niña
(obsérvese los dos cromosomas X abajo derecha), ordenados por parejas de homólogos y
por su longitud, lo que se denomina cariotipo. Puede observarse que en este cariotipo hay
46 cromosomas (o sea, 2n=46) que es el número cromosómico de la especie humana. Se
puede advertir, también, que cada cromosoma tiene una estructura doble, con dos
cromátidas hermanas que yacen paralelas entre sí y unidas por un único centrómero.
Durante la mitosis las cromátidas hermanas, que son idénticas, se separan una de otra
hacia dos nuevas células.
Las parejas de cromosomas homólogos que se observan en la imagen tienen, además, una
semejanza genética fundamental: presentan los mismos genes situados en los mismos
lugares a lo largo del cromosoma (tales lugares se denominan locus o loci en plural). Esto
indica que cada miembro del par de homólogos lleva información genética para las
mismas características del organismo. En organismos con reproducción sexual, uno de los
miembros del par de cromosomas homólogos proviene de la madre (a través del óvulo) y
el otro del padre (a través del espermatozoide). Por ello, y como consecuencia de la
herencia biparental, cada organismo diploide tiene dos copias de cada uno de los genes,
cada una ubicada en uno de los cromosomas homólogos.
Una excepción importante al concepto de parejas de cromosomas homólogos es que en
muchas especies los miembros de la pareja de los cromosomas sexuales, no tienen el
mismo tamaño, ni igual situación del centrómero, ni la misma proporción entre los brazos
o, incluso, no tienen los mismos loci. Por ejemplo, el cromosoma Y(que determina el sexo
masculino en humanos) es de menor tamaño y carece de la mayoría de los loci que se
encuentran en el cromosoma X.1

Índice
 1Historia y definiciones
o 1.1Cronología de descubrimientos
 2Estructura y composición química de la cromatina
o 2.1Las histonas
o 2.2El nucleosoma
o 2.3Proteínas cromosómicas no histónicas: el armazón proteico
 2.3.1Las proteínas HMG
 2.3.2El armazón proteico de los cromosomas
o 2.4Modelos alternativos de la estructura cromosómica
 2.4.1La aproximación biofísica
 2.4.2Los componentes bioquímicos de los cromosomas
o 2.5El ARN
 3Tipos de cromatina
o 3.1Diferencias entre eucromatina y heterocromatina
o 3.2Tipos de heterocromatina
 4Elementos diferenciados en la estructura cromosómica
o 4.1Centrómeros
o 4.2Telómeros
o 4.3Regiones organizadoras del nucléolo
o 4.4Cromómeros
 5Estructura externa de los cromosomas: número, forma y tamaño
o 5.1Constancia del número de cromosomas
o 5.2Cromosomas sexuales
o 5.3Forma de los cromosomas
o 5.4Tamaño cromosómico
o 5.5Bandeo cromosómico
 6Los cromosomas humanos
o 6.1Técnica de estudio
 7Tipos especiales de cromosomas
o 7.1Cromosomas politénicos
o 7.2Cromosomas en escobilla
o 7.3Cromosomas B
o 7.4Isocromosomas
 8El cromosoma en organismos procariotas
 9Cromosomas artificiales
 10Véase también
 11Notas
 12Referencias
 13Bibliografía
 14Enlaces externos
Historia y definiciones
Desde el punto de vista etimológico, la palabra «cromosoma» procede del griego y
significa «cuerpo que se tiñe»; mientras que la palabra «cromatina» significa «sustancia
que se tiñe».
Los cromosomas fueron observados en células de plantas por el botánico suizo Karl
Wilhelm von Nägeli en 1842 e, independientemente, por el científico belga Edouard Van
Beneden en lombrices del género Ascaris.23 El uso de drogas basofílicas (p. ej. las anilinas)
como técnica citológica para observar el material nuclear fue fundamental para los
descubrimientos posteriores. Así, el citólogo alemán Walther Flemming en 1882 definió
inicialmente la cromatina como «la sustancia que constituye los núcleos interfásicos y que
muestra determinadas propiedades de tinción».4
Por lo tanto, las definiciones iniciales de cromosoma y cromatina son puramente
citológicas. La definición biológica solo se alcanzó a principios del siglo XX, con el
redescubrimiento de las leyes de Mendel: tanto la cromatina como el cromosoma
constituyen el material genético organizado. Para ello, fueron fundamentales los trabajos
del holandés Hugo de Vries (1848-1935), del alemán Carl Correns (1864-1933) y del
austríaco Erich von Tschermak-Seysenegg (1871-1962), cuyos grupos de investigación
redescubrieron independientemente las leyes de Mendel y asociaron los factores
genéticos o genes a los cromosomas. Un breve resumen de los acontecimientos asociados
a la historia del concepto de cromosoma se provee a continuación.5
El primer investigador que aisló ADN fue el suizo Friedrich Miescher, entre 1868 y 1869,
cuando realizaba sus estudios postdoctorales en el laboratorio de Felix Hoppe-Seyler (uno
de los fundadores de la bioquímica, la fisiología y la biología molecular) en Tübingen.
Miescher estaba analizando la composición química del pusde los vendajes usados del
hospital, para lo cual aisló núcleos y comprobó que estaban formados por una única
sustancia química muy homogénea, no proteica, a la que denominó nucleína. Sin
embargo, fue Richard Altmann en 1889 quien acuñó el término ácido nucleico, cuando se
demostró que la nucleína tenía propiedades ácidas. En 1881, E. Zacharias demostró que
los cromosomas estaban químicamente formados por nucleína, estableciendo la primera
asociación entre los datos citológicos y bioquímicos.
Las primeras observaciones de la división celular (la mitosis, durante la cual la célula
madre reparte sus cromosomas entre las dos células hijas), se realizaron
entre 1879 y 1882 por Walther Flemming y Robert Feulgen, de forma independiente,
gracias al desarrollo de nuevas técnicas de tinción. La asociación entre herencia y los
cromosomas se realiza poco después (1889) por August Weismann, de manera teórica,
casi intuitiva. Pero los primeros datos experimentales que permitieron a Walter Sutton6
y Theodor Boveri7 proponer que los «factores» de Mendel eran unidades físicas que se
localizan en los cromosomas (lo que se denomina a menudo la teoría cromosómica de
Sutton y Boveri) datan de 1902. Estas ideas permanecieron controvertidas hasta
que Thomas Hunt Morgan realizó los experimentos que hoy se consideran clásicos sobre
los rasgos genéticos ligados al sexo, publicados en 1910, lo que le valió el Premio
Nobel en 1933.8
La demostración de que los genes están en los cromosomas se realizó por Calvin
Bridges y Nettie Stevens en 1912 y fue Alfred Henry Sturtevant quien probó que los genes
se hallan dispuestos linealmente a lo largo del cromosoma, elaborando el primer mapa
genético de un organismo, Drosophila melanogaster. Las bases fundamentales de la
herencia quedaron definitivamente establecidas en 1915, cuando apareció el libro El
mecanismo de la herencia mendeliana escrito por Morgan, Strurtevant, Müller y Bridges.9
En 1919 Phoebus Levene identificó que un nucleótido está formado por una base,
un azúcar y un fosfato,10 iniciando así el análisis molecular del ADN, que llevaría a la
comprensión de los mecanismos moleculares de la herencia (véase también Historia del
ADN).
Cronología de descubrimientos
Karl Wilhelm von Nägeli, botánico suizo descubridor de los cromosomas
 1842, los cromosomas fueron descubiertos por Karl Wilhelm von Nägeli.
 1869, Friedrich Miescher descubre el ADN.
 1882, Walther Flemming identifica la cromatina, como sustancia que se tiñe en
núcleos interfásicos.
 1889, Wilhelm von Waldeyer les dio el nombre de cromosoma que significa cuerpo
coloreado en idioma griego.
 1910, Thomas Hunt Morgan describió que son los portadores de los genes.
 1921, Theophilus Painter estableció erróneamente el número de cromosomas
humanos en cuarenta y ocho, conclusión que se mantuvo vigente hasta 1956.
 1944, Oswald Avery, C. McLeod y M. McCarty descubren que el ADN es el material
hereditario.
 1953, James Dewey Watson y Francis Harry Compton Crick descubren la estructura
del ADN.
 1956, Joe Hin Tjio estableció el número correcto de cromosomas humanos en
cuarenta y seis.
 1966, Severo Ochoa completa el código genético.
 1972, D. Jackson, R. Symons, P. Berg: molécula artificial.
 1973, J. Boyer, S. Cohen: clonación de bacterias.
 1977, Frederick Sanger: secuenciación del ADN.
 1978, producción de proteína humana en bacterias.
 1981, se hace el primer diagnóstico prenatal.
 1982, se crean los primeros organismos transgénicos.
 1983, secuenciación de los primeros genomas enteros.
 2001, secuenciación del genoma humano.
Estructura y composición química de la cromatina
Artículo principal: Cromatina
Los cromosomas eucarióticos son moléculas muy largas de ADN de doble hélice que están
estrechamente relacionadas con proteínas llamadas histonas y proteínas llamadas no
histonas. Los cromosomas se pueden hallar desde estados laxos o poco compactados,
como en los núcleos de las células en interfase, hasta en estados altamente compactados,
como sucede en la metafase mitótica.
Los principales componentes que se obtienen cuando se aísla la cromatina de los núcleos
interfásicos son el ADN, las proteínas histónicas, las proteínas no histónicas y el ARN.

Cromatina
Las histonas
Artículo principal: Histona
Las histonas son proteínas básicas, ricas en residuos de lisina y arginina, que muestran una
elevada conservación evolutiva y que interaccionan con el ADN formando una subunidad
que se repite a lo largo de la cromatina denominada nucleosoma. Los principales tipos de
histonas que se han aislado en los núcleos interfásicos en diferentes especies eucariontes
son: H1, H2A, H2B, H3 y H4. Además de estas histonas, también existen otras que son
específicas de tejido como la histona H5 muy rica en lisina (25 moles%) específica de
eritrocitos nucleados de vertebrados no mamíferos, y las histonas del endosperma.11
Asimismo, la cromatina centromérica se caracteriza por la presencia de una isoforma
específica de la histona H3, denominada CENP-A en vertebrados.
Una de las características más destacables es su elevado conservadurismo evolutivo,
sobre todo de las histonas H3 y H4. La histona H4 de guisante y de timo de ternera se
diferencian solamente en dos aminoácidos. Este dato indica que las interacciones entre el
ADN y las histonas para formar la cromatina deben ser muy semejantes en todos los
organismos eucariontes.
Los genes que codifican las histonas se encuentran agrupados en nichos (o clusters) que se
repiten decenas o centenas de veces. Cada clúster o grupo contiene el siguiente orden de
genes que codifican histonas: H1-H2A-H3-H2B-H4. Estos genes son ricos en pares G-C, ya
que codifican proteínas con un elevado contenido en lisina y arginina, pero están
separados por secuencias espaciadoras ricas en pares A-T.1213111415
El nucleosoma
Artículo principal: Nucleosoma

Estructura del nucleosoma


La cromatina de núcleos en interfase, cuando se observa mediante técnicas de
microscopia electrónica, se puede describir como un collar de cuentas o un rosario, en el
que cada cuenta es una subunidad esférica o globular que se denomina nucleosoma; los
nucleosomas se hallan unidos entre sí mediante fibras de ADN. Se sigue, entonces, que la
unidad básica de la estructura de la cromatina es el nucleosoma. Un nucleosoma típico
está asociado a 200 pares de bases (pb) de ADN y está formado por una médula (coreen
inglés) y un ligador (o linker). La médula está formada por un octámero constituido por
dos subunidades de las histonas H2A, H2B, H3 y H4. En otras palabras, se trata de un
dímero: 2×(H2A, H2B, H3, H4). Los trabajos de Aaron Klug y colaboradores1617 sobre la
disposición de las histonas en la médula del nucleosoma le valieron el Premio Nobel de
Química en 1982.
Alrededor de la médula se enrolla el ADN (140 pb) dando casi dos vueltas (una vuelta y
tres cuartos). El resto del ADN (60 pb) forma parte del ligador (linker), que interacciona
con la histona H1. La cantidad de ADN asociado con un nucleosoma varía de una especie a
otra, de 154 pb a 241 pb; esta variación se debe fundamentalmente a la cantidad de ADN
asociada al ligador (linker).12
Las fibras de ADN dúplex desnudo tienen un grosor de 20 Å. La asociación del ADN con las
histonas genera los nucleosomas, que muestran unos 100 Å de diámetro. A su vez, los
nucleosomas se pueden enrollar helicoidalmente para formar un solenoide (una especie
de muelle) que constituye las fibras de cromatina de los núcleos intefásicos con un
diámetro aproximado de 300 Å. Los solenoides pueden volverse a enrollar para dar lugar a
supersolenoides con un diámetro de 4000 Å a 6000 Å que constituirían las fibras de los
cromosomas metafásicos.1618
Proteínas cromosómicas no histónicas: el armazón proteico
Las proteínas cromosómicas no histónicas son proteínas diferentes de las histonas que se
extraen de la cromatina de los núcleos con cloruro sódico (NaCl) 0.35 mol/L (disolución
salina), tienen un alto contenido en aminoácidos básicos (25 % o más), alto contenido en
aminoácidos ácidos (20-30 %), una elevada proporción de prolina (7 %), bajo contenido en
aminoácidos hidrofóbicos y una alta movilidad electroforética. Las proteínas
cromosómicas no histónicas que se extraen de la cromatina de los núcleos varían mucho
dependiendo de la técnica de aislamiento empleada. Un grupo de estas proteínas
cromosómicas no histónicas presentan alta movilidad electrofóretica y se denominan
abreviadamente HMG (grupo de alta movilidad). La cantidad de proteínas no histónicas
puede variar de unos tejidos a otros en el mismo individuo y dentro del mismo tejido a lo
largo del desarrollo.
Las proteínas HMG
Estas proteínas se agrupan en una superfamilia por sus similitudes físicas y químicas, y
porque todas ellas actúan como elementos arquitectónicos que afectan múltiples
procesos dependientes de ADN en el contexto de la cromatina. Todas las HMG tienen un
terminal carboxilo rico en aminoácidos de tipo ácido, y se clasifican en tres familias
(HMGA, HMGB y HMGN), cada una con un motivo funcional único, que induce cambios
específicos en sus sitios de unión y participa en funciones celulares diferentes.19
La familia HMGA consta de cuatro miembros, y todos ellos contienen un motivo funcional
característico, denominado «gancho AT» (AT hook). A través de estas secuencias, las
HMGA se unen preferencialmente a secuencias ricas en AT de ADN en forma-B e inducen
cambios de conformación que inducen la unión de componentes adicionales. Las
proteínas HMGA tienen una cola C-terminal ácida, que podría ser importante para la
interacción con otras proteínas. Tradicionalmente, este grupo se denominaba HMG-I/Y.20
La familia HMGB consta de tres variantes, cada una de las cuales contiene dos motivos
funcionales (las cajas HMG) y un extremo C-terminal muy ácido. Las cajas HMG están
formadas por tres α-hélices plegadas conjuntamente para formar una estructura en forma
de L, que en parte se introduce en la hendidura menor del ADN, plegándolo intensamente.
Existen ligeras diferencias entre las cajas HMG de las diferentes HMGB, lo que confiere
especificidad a cada una de ellas. Las colas acídicas modulan la afinidad por una variedad
de estructuras de ADN distorsionado.19 Tradicionalmente estas proteínas se denominaban
proteínas HMG-1/-2.20
La familia de proteínas HMGN se caracteriza por un dominio cargado positivamente, el
dominio de unión a nucleosomas, y por una cola C-terminal ácida, el dominio de
desplegado de la cromatina. Las proteínas HMGN se unen específicamente a los
nucleosomas y alteran tanto la estructura local como la estructura de nivel superior de la
cromatina.19 Estas proteínas se conocen tradicionalmente como la subfamilia HMG-14/-
17.20
Se han detectado más de 20 proteínas HMG; las proteínas HMG-1/-2 (HMGB) y HMG-14/-
17 (HMGA) se han identificado en todas las especies de mamíferos, aves y peces
estudiadas hasta el momento. Las proteínas HMG-1/-2 se encuentran solo en el núcleo,
están implicadas en la replicación, se unen preferentemente a ADN de hélice sencilla,
desenrollan el ADN dúplex y se estima que existe una molécula de HMG-1 o HMG-2 por
cada 15 nucleosomas. Las proteínas HMG-14/-17 se encuentran en el núcleo y en el
citoplasma, están relacionadas con la regulación de la transcripción y se estima que existe
una molécula de HMG14 o HMG-17 por cada 10 nucleosomas.
El armazón proteico de los cromosomas
Nucleosoma. Primer nivel de compactación de la cromatina. La doble hélice del ADN se ve
violeta. Las Histonas se ven coloreadas en el centro: H2A amarillo, H2B rojo, H3 Azul y H4
verde. La definición de esta estructura se realizó con técnicas de cristalografía con una
resolución de 2,5 ángstroms
Muchos estudios citogenéticos muestran que el ADN está intensamente enrollado, en los
cromosomas, cuando se observa al microscopio. El primer nivel de compactación lineal del
ADN es el obtenido por el plegamiento de la fibra del ADN alrededor de
los nucleosomas,21 responsable del primer nivel de plegamiento lineal (de 6 a 7 veces). El
siguiente nivel de plegamiento corresponde a la denominada «fibra de 30 nm», que es lo
que se observa en núcleos en interfase. Aunque ha habido mucha controversia para
describir esta estructura,22 la fibra de 30 nm se considera normalmente como el
enrollamiento helicoidal de las fibras de nucleosomas, que genera la compactación de
otras 6-7 veces. En mitosis, la fibra de 30 nm debe compactarse otras 200-500 veces hasta
alcanzar el diámetro observado al microscopio para las fibras cromosómicas durante la
división celular (–700 nm).23 Por tanto, se han tenido que producir nuevos
superenrollamientos. Sin embargo, la explicación de estos plegamientos de orden superior
ha generado gran controversia.22
Laemmli y colaboradores en 1977 consiguieron aislar cromosomas metafásicos
desprovistos de histonas mediante un tratamiento con sulfato de dextrano y heparina. 24
Estos cromosomas metafásicos desprovistos de histonas presentan una médula central
densamente teñida que ha sido denominada scaffold (armazón). Este armazón proteico
(scaffold) es resistente a la acción de la ADNasa, ARNasa y también a soluciones de ClNa
2M. Sin embargo, desaparece por tratamientos con urea 4M y dodecil sulfato sódico o por
tratamiento con enzimas proteolíticas. Por tanto, se trata de un armazón proteico.
La observación a microscopía electrónica pone de manifiesto que de este armazón
proteico (scaffold) salen y llegan lazos o fibras que pueden hacerse desaparecer mediante
tratamiento con ADNasa. Por tanto, estos lazos o dominios que arrancan del armazón
proteico son lazos de ADN. Uno de los principales componentes del armazón proteico es la
enzima topoisomerasa II α (topoIIα),2526 una enzima que produce cortes en el ADN dúplex
a nivel de ambas hélices. La topoisomerasa II (girasa) interviene durante la replicación del
ADN creando o relajando los superenrollamientos. En mamíferos se encuentran
dos isoformas de esta enzima (α y ß), con propiedades similares in vitro. Sin embargo,
aunque topoIIα y β se comportan in vivo de forma similar en interfase, en mitosis tienen
un comportamiento diferente: solo topoIIα está asociado mayoritariamente a los
cromosomas.27 La aparición de la topoisomerasa II α solo en el armazón proteico sugiere
que se encuentra en la base de los lazos o dominios de ADN, indicando que esta
organización en dominios podría estar relacionada con la replicación y transcripción. Otras
enzimas, como la topoisomerasa I que produce cortes en el ADN dúplex a nivel de una
sola hélice y la HMG-17, se encuentran solo en los lazos o dominios y no en el armazón
proteico. La evidencia existente hasta el momento sugiere que las fibras de solenoides
(30 nm) formarían los lazos o dominios que emanan del armazón proteico y que este
armazón estaría a su vez enrollado formando una espiral.24
Además de la enzima topoisomerasa II α, el otro componente fundamental propuesto del
armazón proteico es la condensina 13S.28 La tinción doble con anticuerposcontra topoIIα y
condensina genera un armazón con aspecto de un «polo de barbero» (un cilindro con
bandas espirales rojas y blancas que simboliza la antigua doble profesión de los barberos
como cirujanos), en la cual alternan «cuentas» enriquecidas en topoIIα y en condensina.
Esta estructura parece estar generada por dos cadenas yuxtapuestas. Parece ser que el
ensamblaje de este armazón proteico tiene lugar en dos fases, ya que la condensina solo
se asocia en la transición de profase a metafase durante la mitosis. Sin embargo, el papel
estructural de la topoIIα en la organización de los cromosomas aún se discute, ya que
otros grupos argumentan que esta enzima se intercambia rápidamente tanto en los
brazos cromosómicos como en los cinetocoros durante la mitosis.2927
Los dominios de ADN parecen estar unidos al armazón proteico por unas regiones
específicas denominadas abreviadamente SAR (scaffold associated regions, también
denominadas MAR, matrix attachment regions) que se detectan cuando los cromosomas
metafásicos desprovistos de histonas se tratan con endonucleasas de restricción. 30
Después de este tratamiento quedan regiones de ADN unidas al armazón que a su vez
resisten la digestión con exonucleasas gracias a que están protegidas por una proteína.
Cuando se digiere esta proteína, las regiones de ADN protegidas contienen secuencias de
varios cientos de pares de bases que son muy ricas en AT y que presentan sitios de unión
para topoisomerasa II e histona H1. Estas regiones de unión específicas de los dominios al
armazón proteico son las regiones SAR. Se ha sugerido que estas regiones juegan un papel
global durante la condensación de los cromosomas mitóticos y son necesarias para el
mantenimiento de la estructura de los cromosomas.31 Las regiones SAR también podrían
estar implicadas en la expresión génica, al facilitar tanto la transición como la expansión
de una estructura abierta de la cromatina.
Modelos alternativos de la estructura cromosómica
Es cada vez más evidente que incluso con los métodos de fijación más utilizados27 se
pueden producir cambios significativos en la localización de las proteínas cromosómicas, y
estas dificultades técnicas han estado presentes en la mayor parte de las preparaciones
cromosómicas utilizadas para realizar los estudios estructurales. Por ello, parece necesario
utilizar muestras vivas siempre que sea posible, así como aproximaciones alternativas que
permitan un análisis complementario.32
La aproximación biofísica
Un modo alternativo para el análisis estructural de los cromosomas es el biofísico. Las
medidas precisas de la rigidez y la elasticidad de los cromosomas pueden guiar la
construcción de los modelos estructurales. Estudios realizados en diferentes laboratorios
indican que los cromosomas presentan una elasticidad remarcable: tanto dentro de las
células como en tampones fisiológicos, los cromosomas pueden estirarse hasta varias
veces su longitud normal y volver de nuevo a su longitud original.33 Sin embargo, los datos
obtenidos por diferentes laboratorios son muy variables, probablemente debido a la
variedad de tampones utilizado por los distintos grupos. Un estudio de Poirier y Marko en
2002 mostró que la elasticidad de los cromosomas es muy sensible a nucleasa.34 Estos
datos sugieren que la integridad mecánica de los cromosomas mitóticos se mantiene por
enlaces entre las fibras cromosómicas, no por la existencia de un armazón proteico. La
naturaleza de estos enlaces no está clara, pero este estudio estima su frecuencia en 10-
20 kb como mínimo.
Los componentes bioquímicos de los cromosomas
Un método convencional y muy potente para entender una estructura biológica consiste
en establecer una lista que incluya todos sus componentes. Los estudios iniciales de la
estructura cromosómica se enfrentaron a muchos problemas técnicos para conseguir
aislar bioquímicamente los cromosomas mitóticos de las células, aunque métodos
sofisticados permitieron el aislamiento de los cromosomas completos y la identificación
del armazón proteico.35
Un método alternativo consiste en la utilización de extractos libres de células procedentes
de huevos de anfibios. Este sistema permite la reconstitución in vitro de cromosomas
mitóticos a partir de sustratos simples (por ejemplo, cromatina de esperma) en
condiciones fisiológicas, de manera que los componentes proteicos de las estructuras que
se ensamblan pueden aislarse por centrifugación en un solo paso y caracterizarse de
forma sistemática.36 Además de las histonas centrales y una histona de ligamiento, la
fracción así aislada contiene topoIIα (CAP-B en ese estudio), un complejo de cinco
subunidades denominado condensina (CAP-C, -E, -D2, -G y -H),3637 cromokinesina (CAP-
D/Klp138) y la ATPasa remodeladora de cromatina ISWI38 (CAP-F). Una de las conclusiones
más importantes de estos estudios es que las ATPasas son componentes importantes de
los cromosomas. La energía de hidrólisis del ATP es utilizada en muchos casos para inducir
cambios locales o globales en los cromosomas, mientras que en otros casos sirve para
soportar el movimiento de los cromosomas anclados a los microtúbulos.
Una observación sorprendente fue la identificación de la proteína titina como uno de los
componentes de los cromosomas en embriones de Drosophila.39 La titina es una proteína
filamentosa gigante (–3 MDa) que funciona como un componente integral del filamento
grueso en el sarcómero de las células musculares. Se ha propuesto que, en analogía con su
función muscular, la isoforma de la titina que se encuentra en los cromosomas puede
funcionar por un lado como una «regla molecular» que determina la longitud
cromosómica, y por otro como un «muelle molecular» que proporciona elasticidad a los
cromosomas.40
El ARN
El ARN parece jugar algún papel en el plegamiento del cromosoma eucariótico. Al menos
en humanos y en Drosophila se han encontrado evidencias de este papel estructural del
ARN.41 Sin embargo, hay que tener en cuenta que el armazón proteico descrito por
Laemmli y colaboradores (1978) no se ve afectado por el tratamiento con ARNasa. Podría
ser que las propias proteínas del armazón protegieran al ARN de la acción del ARNasa. En
cualquier caso, es conveniente recordar que el ADN del cromosoma bacteriano también
está organizado en dominios y que el ARN podría jugar algún papel en el mantenimiento
de dicha estructura. En organismos con características intermedias entre las de
procariontes y eucariontes como los dinoflagelados, también existen datos que apoyan el
papel estructural del ARN en la organización cromosómica.
Tipos de cromatina
La cromatina (la sustancia que compone los núcleos de las células y que resulta de la
interacción del ADN con las proteínas histónicas, no histónicas y ARN) puede presentar
distintos grados de empaquetamiento o contracción. Cuando los cromosomas se tiñen con
sustancias químicas que se unen al ADN aparecen regiones densamente teñidas y regiones
menos densamente teñidas. La cromatina mayoritaria, la que constituye la mayor parte
del núcleo recibe el nombre de eucromatina y la minoritaria el de heterocromatina.
Mientras que la eucromatina representa la fracción que contiene la mayor parte de los
genes activos, la heterocromatina interviene en varios procesos nucleares, como la
función centromérica, el silenciamiento de genes y la organización nuclear.
La heterocromatina puede aparecer más densamente teñida que la eucromatina
(heteropicnosis positiva) o menos densamente teñida que la eucromatina (heteropicnosis
negativa). La aplicación de determinados tratamientos experimentales en combinación
con diferentes tipos de tinción de los cromosomas, puede producir la aparición de zonas
heterocromáticas en los cromosomas de muchas especies. Estas zonas heterocromáticas
presentan una distribución característica o patrón de bandas típico de cada cromosoma,
que permite identificar cromosomas distintos. Estas técnicas reciben el nombre
de "técnicas de bandeo cromosómico" y son enormemente útiles en la identificación
individual de los cromosomas y en la construcción de cariotipos.
Diferencias entre eucromatina y heterocromatina
 Diferencias genéticas: los experimentos de construcción de mapas demuestran
que la mayor parte de los genes activos se localizan en la eucromatina. En los
núcleos interfásicos, la eucromatina se tiñe menos densamente debido al menor
grado de empaquetamiento, y en general se acepta que este es el estado más
compatible con la actividad génica y la transcripción. La heterocromatina se
encuentra en muchos organismos flanqueando las regiones centroméricas, algunas
veces también se encuentra en regiones teloméricas, y en algunos casos se ha
observado la existencia de cromosomas completos heterocromáticos (por ejemplo,
el cromosoma Y de Drosophila melanogaster). Se han detectado muy pocos genes
activos en la heterocromatina.42 Por ejemplo, en Drosophila existen mutaciones
letales en genes que se localizan en regiones heterocromáticas; por tanto estos
genes deben poseer alguna actividad. En cualquier caso, el porcentaje de genes
activos localizados en regiones heterocromáticas es muy bajo, comparado con el
de genes activos situados en la eucromatina. La principal diferencia entre la
eucromatina y la heterocromatina radica por tanto en la actividad de estos dos
tipos de cromatina. Estudios tempranos de la heterocromatina condujeron al
descubrimiento del fenómeno conocido como «variegación por efecto de la
posición» (PEV, por sus siglas en inglés),43 en el cual si un gen eucromático se
coloca cerca o dentro de una región heterocromática, deviene silenciado de
forma epigenética. Este proceso tiene importantes implicaciones en la regulación
génica, el envejecimiento y la progresión tumoral.
 Diferencias citológicas: a nivel estructural, en los núcleos interfásicos, existe un
mayor grado de enrollamiento o empaquetamiento en la heterocromatina que en
la eucromatina.44 Esto se demuestra porque la heterocromatina presenta una
sensibilidad reducida al tratamiento con nucleasas, lo cual refleja un
posicionamiento de los nucleosomas a intervalos cortos y regulares.
 Diferencias bioquímicas: la heterocromatina presenta modificaciones
características en las histonas, como un alto grado de metilación en la lisina 9 de la
histona H3 (H3K9) y en la lisina 27 (H3K27), combinado con una carencia
de acetilación. La heterocromatina también se caracteriza por la presencia de la
proteína HP1(heterochromatin protein 1). Además, la heterocromatina de
vertebrados y plantas presenta un elevado grado de metilación en las islas CpG
(regiones genómicas ricas en dinucleótidos C+G).45 La metilación de H3K9 conlleva
el reclutamiento de más enzimas que transfieren grupos metilo a las histonas
(HMTs, histone methyltransferases), mediado por HP1. Se han descrito dos rutas
diferentes para llevar a cabo este proceso. Una de estas rutas utiliza ARN
interferente,46 mientras que la segunda utiliza proteínas de unión a ADN que
reconocen secuencias específicas para dirigir las HMTs.46
 Alociclia: la heterocromatina sigue un ciclo de condensación y descondensación
distinto a la eucromatina. La heterocromatina puede aparecer más intensamente
teñida que la eucromatina o menos intensamente teñida dependiendo del estado
celular (alociclia). La alociclia a su vez está relacionada con la replicación del ADN.
La heterocromatina se replica más tarde que la eucromatina.
Tipos de heterocromatina
Se pueden distinguir dos clases de heterocromatina:
 Heterocromatina constitutiva: cromatina que aparece siempre más intensamente
teñida que la eucromatina (heteropicnosis positiva), o menos intensamente teñida
que la eucromatina (heteropicnosis negativa), independientemente del estado de
desarrollo o fisiológico. HP1 es esencial para la formación de la heterocromatina
constitutiva, que se caracteriza por la presencia de H3K9-trimetilada, mediada por
las HMT denominadas Suv39h1 y Suv39h2.47 En este grupo se incluyen el ADN
satélite de las regiones centroméricas y la cromatina de los telómeros.
 Heterocromatina facultativa: cromatina que aparece más intensamente teñida
que la eucromatina, o menos intensamente teñida que la eucromatina
dependiendo del estado fisiológico o del momento de desarrollo. El cromosoma X,
en algunas especies animales, como el saltamontes Schistocerca gregaria, aparece
más intensamente teñido que el resto de los cromosomas durante la diplotena de
la profase I de meiosis. La heterocromatina facultativa se genera de manera
diferente a la constitutiva, posiblemente mediada por HMTs diferentes (como G9a,
ESET/SETDB1 y/o ErHMTasa1), y parece ser que presenta sobre todo H3K9-mono y
dimetilada.45
En la especie humana, todos los cromosomas X que están en exceso de uno aparecen más
intensamente teñido que el resto de los cromosomas (heteropicnosis positiva) en los
núcleos de células en interfase. Por tanto, las mujeres normales que tienen dos
cromosomas X, tienen un cromosoma X que aparece más intensamente teñido y que está
inactivado. Sin embargo, durante las primeras etapas del desarrollo embrionario (durante
los 16 primeros días de gestación en la especie humana) ambos cromosomas X son
activos.
En algunas especies eucariontes, el ADN satélite o ADN minoritario que presenta un
contenido en G+C distinto al ADN principal o mayoritario, está constituido por unas
secuencias cortas de ADN que están repetidas millones de veces. En concreto en ratón se
ha demostrado que el ADN satélite está localizado en la zona centrómerica. Este ADN
satélite constituye un ejemplo de heterocromatina constitutiva cuya presencia y acción es
constante en el cromosoma.4849
Elementos diferenciados en la estructura cromosómica
La organización de la cromatina no es uniforme a lo largo de la estructura del cromosoma.
De hecho, se pueden distinguir una serie de elementos diferenciados: los centrómeros (o
constricciones primarias), los telómeros (o extremos cromosómicos), las regiones
organizadoras del nucléolo (NORs según la abreviatura en inglés) y los cromómeros, todos
ellos caracterizados por contener secuencias específicas de ADN.
Centrómeros
Artículo principal: Centrómero
El centrómero es la constricción primaria que utilizando tinciones tradicionales aparece
menos teñida que el resto del cromosoma. Es la zona por la que el cromosoma
interacciona con las fibras del huso acromático desde profase hasta anafase, tanto
en mitosis como en meiosis, y es responsable de realizar y regular los movimientos
cromosómicos que tienen lugar durante estas fases. Las estructuras centroméricas que
interaccionan con las fibras del huso se denominan cinetocoros. Además, el centrómero
contribuye a la nucleación de la cohesión de las cromátidas hermanas. En la estructura del
centrómero intervienen tanto el ADN centromérico, que consta fundamentalmente de
heterocromatina constitutiva, como proteínas centroméricas.
En la levadura de gemación (Saccharomyces cerevisiae) el ADN centromérico consta
únicamente de 125 pb y está conservado entre los diferentes cromosomas.50 Sin embargo,
el ADN centromérico en metazoos puede constar de megabases, y no contiene secuencias
consenso fácilmente identificables (ver la revisión de Choo en 199751). A pesar de las
diferencias entre el ADN centromérico de levaduras y metazoos, el cinetocoro se
ensambla en ambos casos sobre nucleosomas centroméricos que contienen una forma
especializada de histona H3 (Cse4p en levaduras52 o su homólogo CENP-A en metazoos).
Telómeros
Artículo principal: Telómero

Cromosomas humanos (en gris) y sus telómeros(en blanco)


La palabra telómero procede del griego telos, «final» y meros, «parte». Los telómeros son
los extremos de los cromosomas. Son regiones de ADN no codificante, altamente
repetitivas, cuya función principal es la estabilidad estructural de los cromosomas en
las células eucariotas, la división celular y el tiempo de vida de las estirpes celulares.
Además están involucradas en enfermedades tan importantes como el cáncer. En los
organismos procariotas, los cromosomas son circulares y no poseen telómeros.53
Los telómeros fueron descubiertos por Hermann Joseph Muller durante la década de
1930. Desde entonces, se ha avanzado mucho en el conocimiento de los telómeros,
gracias a las técnicas de la genética molecular.

Algunas secuencias conocidas de telómeros

Secuencia del telómero


Grupo Organismo
(Dirección 5'a 3' hasta el fin)

Humanos, ratón, Xenopus, D


Vertebrados TTAGGG
anio rerio

Hongos filamentosos Neurospora crassa TTAGGG

Physarum, Didymium TTAGGG


Mohos del fango
Dictyostelium AG(1-8)

Protozooscinetoplásti
Trypanosoma, Crithidia TTAGGG
dos

Tetrahymena, Glaucoma
TTGGGG
Paramecium
Protozoos ciliados TTGGG(T/G)
Oxytricha, Stylonychia, Euplot
TTTTGGGG
es

Protozoos
Plasmodium TTAGGG(T/C)
apicomplexa

Plantas superiores Arabidopsis thaliana TTTAGGG

Algas verdes Chlamydomonas TTTTAGGG

Insectos Bombyx mori TTAGG

Ascáridos Ascaris lumbricoides TTAGGC

Levaduras aisladas Schizosaccharomyces pombe TTAC (A)(C) G(1-8)

Saccharomyces cerevisiae TGTGGGTGTGGTG (de copias


Levaduras agregadas de ARN)
Candida glabrata o G(2-3)(TG)(1-6)T (consenso)
Candida albicans GGGGTCTGGGTGCTG
Candida tropicalis GGTGTACGGATGTCTAACTTCTT
Candida maltosa GGTGTA[C/A]GGATGTCACGATC
Candida guillermondii ATT
Candida pseudotropicalis GGTGTACGGATGCAGACTCGCTT
Kluyveromyces lactis GGTGTAC
GGTGTACGGATTTGATTAGTTAT
GT
GGTGTACGGATTTGATTAGGTAT
GT

Regiones organizadoras del nucléolo


Artículo principal: Región organizadora nucleolar
Además de las constricciones primarias, en algunos cromosomas se puede distinguir otro
tipo de «adelgazamiento» denominada constricción secundaria, las que se hallan
relacionadas normalmente con la presencia de las secuencias de ADN ribosómico. Tales
regiones se denominan regiones organizadoras del nucléolo (o, sencillamente, NOR por el
acrónimo en inglés para nucleolus organizer regions). Las secuencias de ADN ribosómico
quedan englobadas dentro del nucléolo, que permanece adosado a las NOR durante
buena parte del ciclo celular. Los cromosomas portadores de NOR en muchos casos
presentan un segmento que une a esta región con el telómero, el cual se
denomina satélite o trabante.54
Cromómeros
Artículo principal: Cromómero
Los cromómeros son «engrosamientos» o regiones más compactadas de la eucromatina,
que se distribuyen de manera más o menos uniforme a lo largo de los cromosomas y se
pueden visualizar durante las fases de la mitosis o de la meiosis de menor condensación
de la cromatina (profase). Su naturaleza molecular sigue siendo controvertida, pero
podrían ser consecuencia de un cierto grado de compartimentalización en la distribución
de las secuencias de ADN y en la organización de los cromosomas. Desde hace varios años,
el grupo de Giorgio Bernardi en Italia, sostiene que hay una distribución
compartimentalizada de secuencias relativamente grandes de ADN (llamadas «isócoras»)
en el genoma de los vertebrados de sangre caliente, de modo tal que cada isócora tiene
un contenido en bases (porcentaje de C+G) relativamente homogéneo pero diferente al
de las demás.55565758 Después de publicado el primer borrador del Proyecto Genoma
Humano, parece confirmarse la existencia de cinco isócoras en el genoma de los humanos,
dos de ellas ricas en A y T, y tres ricas en G y C. La distribución alternante de ambos tipos
de isócoras podría ser la explicación molecular de la existencia de cromómeros.5960
Estructura externa de los cromosomas: número, forma y tamaño
El estudio de la estructura externa de los cromosomas de cualquier especie eucariótica
consiste en analizar la forma, tamaño y número de los cromosomas que posee. El mejor
momento para llevar a cabo dicho estudio suele ser aquel en el que los cromosomas han
alcanzado su máximo grado de contracción y tienen sus bordes perfectamente definidos.
Dicho momento suele ser la metafase mitótica. El estudio de la estructura externa de los
cromosomas culmina con la obtención del cariotipo.1
Los cromosomas se pueden estudiar en distintos momentos según la especie y
dependiendo de los objetivos planteados. Algunas especies tienen cromosomas que se
pueden observar con gran detalle en interfase, tal es el caso de Drosophila melanogaster,
que posee cromosomas politénicos gigantes que se observan en las glándulas salivales de
dicho insecto, y el de Chironomus tentans, otro díptero. El cariotipo se confecciona
usualmente después de un apropiado pre-tratamiento y tinción de las células, para hacer
más visibles los cromosomas individuales. Al diagrama simplificado de los cromosomas
metafásicos del cariotipo se lo denomina idiograma, que se construye con el número
genómico.
Para realizar el ordenamiento de los cromosomas tanto en cariotipos como idiogramas se
debe tener en cuenta el tamaño cromosómico (ubicados de mayor a menor, con el brazo
corto «bc» o «p» hacia arriba y el brazo largo «bl» o «q» hacia abajo); posición del
centrómero (generalmente alineados) y presencia de constricciones secundarias y
satélites.1
Constancia del número de cromosomas

Números de cromosomas en
diferentes especies

Número de
Especie
cromosomas

Hormiga Myrmecia pilosula, macho 1

Hormiga Myrmecia pilosula, hembra 2

Mosca de la fruta (Drosophila melanogaster) 8

Centeno (Secale cereale) 14


Caracol (Helix) 24

Gato (Felis silvestris catus) 38

Cerdo (Sus scrofa) 38

Ratón (Mus musculus) 40

Trigo (Triticum aestivum) 42

Rata (Rattus rattus) 42

Conejo (Oryctolagus cuniculus) 44

Liebre (Lepus europaeus) 46

Humano (Homo sapiens sapiens) 46

Chimpancé (Pan troglodytes) 48

Patata, Papa (Solanum tuberosum) 48

Oveja (Ovis aries) 54

Vaca (Bos taurus) 60

Asno (Equus asinus) 62

Mula (Equus mulus) 63 (estéril)

Caballo (Equus caballus) 64

Camello ( Camelus bactrianus) 74

Llama (Lama glama) 74

Perro (Canis lupus familiaris) 78

Gallina (Gallus gallus) 78

Paloma Columbia livia 80


Diamante mandarín (Taeniopygia guttata) 7261

Pez Carassius auratus 94

Equisetum arvense Equisetum arvense 216

Mariposa 380

Helecho Ophioglussum reticulatum 1260

Protozoario Aulacantha scolymantha 1600

Usualmente las especies animales y vegetales tienen un número de cromosomas


constante y determinado que constituyen su cariotipo (ley de la constancia numérica de
los cromosomas), aunque existen especies con una alta variabilidad cariotípica, no solo en
número sino en forma y tamaño de los cromosomas.

El protozoario Aulacantha, con 1600 cromosomas en sus células, es la especie con el


mayor número de cromosomas.62
El número de cromosomas de una especie (o fase vital) diploide se identifica
como 2n mientras que ese número en una especie (o fase vital) haploide se identifica con
la letra n. En aquellas especies que presentan un número repetido de cromosomas
superior a dos complementos se habla de poliploidía, representándose el múltiplo por
delante de la letra n. Así: 3n indicaría un complemento cromosómico triploide, 4n un
tetraploide, etc. Todas estas son situaciones de euploidía. Con la indicación x se quiere
expresar el número básico de cromosomas de una especie que presenta individuos con
diversos grados de ploidía o el de una línea filogenética a partir de la cual diversos taxones
han alcanzado situaciones aneuploides variadas, siendo en este caso el número
cromosómico una variación del número original con aumento o disminución del número
básico, por pérdida, fusión o división de cromosomas (p. ej., n+1 o n-1). Un ejemplo de
esta situación anormal la tenemos en los individuos de la especie humana que presentan
el llamado síndrome de Down, situación de aneuploidía (2n=47) por la presencia de un
ejemplar más de lo habitual del cromosoma 21 (trisomía).
El número de cromosomas 2n varía mucho de unas especies a otras y no existe relación
entre el número de cromosomas y la complejidad de los mismos: existen especies
vegetales con pocos cromosomas como Haplopappus gracilis (2n=4), Crepis
capillaris (2n=6) y Secale cereale (2n=14), especies vegetales con bastantes cromosomas
como Triticum aestivum (2n=42) y especies vegetales con muchos cromosomas
como Ophioglossum petiolatum (n >500). En animales sucede algo semejante, hay
especies con pocos cromosomas como la hormiga australiana Myrmecia pilosula cuyos
machos tienen un cromosoma (2n=1) y las hembras dos cromosomas (2n=2), especies con
bastantes cromosomas como la humana Homo sapiens (2n=46) y especies con muchos
cromosomas como el lepidóptero Lysandra atlantica (2n=434-466). No existe ninguna
relación entre el número de cromosomas 2n y la complejidad evolutiva, ni entre el
número de cromosomas y la cantidad de ADN. Un ejemplo claro de esta situación es el de
los ciervos del género Muntiacus en el que hay especies muy similares
(denominadas especies gemelas) una con 2n=6 (M. muntjak) y otra con 2n=46 (M.
reevesi).6364
Cromosomas sexuales
En muchos organismos, uno de los pares de los cromosomas homólogos es distinto al
resto, realizando la determinación del sexo del individuo. A estos cromosomas se les llama
cromosomas sexuales o heterocromosomas e incluso gonosomas, porque determinan
el sexo.
 Sistema de determinación XY: es propio del ser humano y muchos otros animales.
Las hembras, siendo XX, darán gametos iguales con cromosoma X, sexo
homogamético y los machos, siendo XY, darán dos tipos de gametos, uno con el
cromosoma X y otro con el cromosoma Y. La probabilidad de que en
la fecundación, al unirse los gametos, resulte una combinación XX (hembra) o XY
(macho) es aproximadamente del 50 %.
 Sistema de determinación ZW: en otras especies (p. ej. mariposas y aves) ocurre lo
contrario, el sexo masculino es homogamético (ZZ) y el femenino heterogamético
(ZW).
 Sistema de determinación XO: En otras especies (peces, insectos, anfibios, etc)
que no tienen el cromosoma Y, determinándose el sexo por el número de
cromosomas X, macho XO y hembra XX.
Forma de los cromosomas
El cromosoma humano 19 es metacéntrico

El cromosoma humano 14 es acrocéntrico


Cariotipo espectral, el cariograma se obtiene luego de la identificación y clasifciación de
los cromosomas. El cariotipo que se muestra corresponde a un individuo de sexo
femenino ya que se observan dos cromosomas X.
La forma de los cromosomas es para todas las células somáticas constante y característica
de cada especie. La forma depende fundamentalmente de las constricciones que presente
el cromosoma y de su localización en la cromátida.
El cromosoma se encuentra constituido básicamente por el centrómero que divide el
cromosoma en un brazo corto o brazo p y un brazo largo o brazo q. Algunos cromosomas
presentan satélites en el brazo corto.
Según la posición del centrómero, los cromosomas se clasifican en:
Metacéntricos
El centrómero se localiza a mitad del cromosoma y los dos brazos presentan igual
longitud.
Submetacéntricos
La longitud de un brazo del cromosoma es algo mayor que la del otro.
Acrocéntricos
Un brazo es muy corto (p) y el otro largo (q).
Telocéntricos
Solo se aprecia un brazo del cromosoma al estar el centrómero en el extremo.
El par de gonosomas o sexocromosomas se constituyen por un cromosoma X
(submetacéntrico mediano) y un cromosoama Y considerado acrocéntrico sin satélites,
aunque en algunas revisiones de la literatura se le refiere como submetacéntrico.
Tamaño cromosómico
Los cromosomas sufren grandes variaciones en su tamaño a lo largo del ciclo celular,
pasando de estar muy poco compactados (interfase) a estar muy compactados (metafase),
por tal motivo, los estudios sobre el tamaño suelen realizarse en metafase mitótica.
Además, es necesario tener en cuenta que los tratamientos para teñir los cromosomas y
para obtener las metafases mitóticas influyen de manera muy importante en el tamaño de
los cromosomas. En cualquier caso, en general es posible decir que hay especies
eucarióticas con cromosomas grandes y especies con cromosomas pequeños.
Las monocotiledóneas (vegetales) y los anfibios y ortópteros (animales) poseen
cromosomas muy largos (de 10 a 20 micras). Las dicotiledóneas, las algas, los hongos y la
mayoría de las especies animales poseen cromosomas pequeños (longitud inferior a 5
micras). Naturalmente, existen algunas excepciones en los ejemplos citados. El
cromosoma 1 humano tiene 0,235 pg de ADN, que equivalen a una longitud total de ADN
doble hélice de 7,3 cm y en metafase mitótica presenta una longitud aproximada de
0,001 cm.
Bandeo cromosómico
En algunas especies los pares cromosómicos no pueden diferenciarse claramente
considerando solo sus componentes distintivos en sentido longitudinal; en estos casos se
debe recurrir a técnicas citológicas especiales para la tinción de los cromosomas, que
evidencian «bandas» transversales (oscuras y claras) a lo largo de los mismos, y que
corresponden a los distintos tipos de cromatina. En una especie dada, estas variantes de la
cromatina presentan un tamaño y disposición constante. Las técnicas de bandeo
cromosómico más usadas son:
 Bandeo C : es relativamente sencilla, y se basa en el uso del colorante Giemsa que
tiñe regiones con heterocromatina constitutiva, que en vegetales se halla
localizada principalmente en regiones teloméricas, mientras que en animales, se
encuentra en regiones centroméricas.
 Bandeos G, R, Q : son técnicas basadas en tratamientos enzimáticos que ponen de
manifiesto distintos patrones de bandas de la eucromatina a lo largo del
cromosoma. El material se tiñe con colorante Giemsa (G, R) o colorantes
fluorescentes, como la quinacrina (Q). Son las bandas más estudiadas en animales
y en el hombre. En los vegetales son muy difíciles de obtener por el alto grado de
empaquetamiento de los cromosomas metafásicos.
 Bandeo NOR : permite identificar cromatina con secuencias medianamente
repetidas de ADNr, asociada a las regiones NOR del cromosoma. El número total y
localización de las regiones NOR es variable, por lo cual, como ya se expresó,
además de su importancia funcional tiene valor cariotípico.1
Los cromosomas humanos
Artículo principal: Genoma humano
El ser humano presenta 23 pares de cromosomas en sus células somáticas:
22 autosomas y un par de cromosomas sexuales (dos X en el caso de las mujeres y un
cromosoma X y un Y en el caso de los varones). El tamaño total aproximado del genoma
humano es de 3 200 millones de pares de bases de ADN (3 200 Mb) que contienen unos
20 000-25 000 genes.65 De las 3 200 Mb unas 2 950 Mb corresponden a eucromatina y
unas 250 Mb a heterocromatina. El Proyecto Genoma Humano produjo una secuencia de
referencia del genoma humano eucromático, usado en todo el mundo en las ciencias
biomédicas.
La secuencia de ADN que conforma el genoma humano contiene codificada la información
necesaria para la expresión, altamente coordinada y adaptable al ambiente,
del proteoma humano, es decir, del conjunto de proteínas del ser humano. El genoma
humano presenta una densidad de genes muy inferior a la que inicialmente se había
predicho, con solo en torno al 1,5 %66 de su longitud compuesta por exones codificantes
de proteínas. Un 70 % está compuesto por ADN extragénico y un 30 % por secuencias
relacionadas con genes. Del total de ADN extragénico, aproximadamente un 70 %
corresponde a repeticiones dispersas, de manera que, más o menos, la mitad del genoma
humano corresponde a secuencias repetitivas de ADN. Por su parte, del total de ADN
relacionado con genes se estima que el 95 % corresponde a ADN no
codificante: pseudogenes, fragmentos de genes, intrones, secuencias UTR, entre otras.
Aunque tradicionalmente esas secuencias de ADN han sido consideradas regiones del
cromosoma sin función, hay datos que demuestran que esas regiones desarrollan
funciones relacionadas con la regulación de la expresión génica.
En la siguiente tabla se listan los cromosomas humanos, el número de genes que presenta
cada uno, su tamaño en pares de bases y su morfología.

Cromosoma Genes Bases Formato

1 4.222 247.199.71967 metacéntrico, grande.

2 2.613 242.751.14968 submetacéntrico, grande.

3 1.859 199.446.82769 metacéntrico, grande.

4 451 191.263.06370 submetacéntrico, grande.

5 617 180.837.86671 submetacéntrico, grande.

6 2.280 170.896.99372 submetacéntrico, mediano.

7 2.758 158.821.42473 submetacéntrico, mediano.

8 1.288 146.274.82674 submetacéntrico, mediano.

9 1.924 140.442.29875 submetacéntrico, mediano.

10 1.793 131.624.73776 submetacéntrico, mediano.

11 449 131.130.85377 submetacéntrico, mediano.


12 1562 132.289.53478 submetacéntrico, mediano.

acrocéntrico, mediano, con


13 924 114.127.98079
satélite en su brazo corto.

acrocéntrico, mediano, con


14 1.803 106.360.58580
satélite en su brazo corto.

acrocéntrico, mediano, con


15 1122 100.114.05581
satélite en su brazo corto.

16 1098 88.822.25482 submetacéntrico, pequeño.

17 1576 78.654.74283 submetacéntrico, pequeño.

18 766 76.117.15384 submetacéntrico, pequeño.

19 1859 63.806.65185 metacéntrico, pequeño.

20 1012 62.436.22486 metacéntrico, pequeño.

21 582 46.944.32387 acrocéntrico, pequeño.

22 1816 49.528.95388 acrocéntrico, pequeño.

Cromosoma
1850 154.913.75489 submetacéntrico, mediano.
X

Cromosoma
454 57.741.65290 acrocéntrico, pequeño.
Y

Técnica de estudio
Es posible visualizar los cromosomas por medio de la microscopía de luz y de tinciones
especiales. El proceso para obtener el material cromosómico se realiza en diversos pasos,
que incluyen la obtención de una muestra viva, la siembra e incubación de la misma y la
posterior tinción y lectura.N 1
Tipos especiales de cromosomas
Existen algunos tipos de cromosomas presentes solo en algunos tipos celulares o en
poblaciones concretas de una especie. Entre ellos, destacan los cromosomas politénicos,
en escobilla, cromosomas B e isocromosomas.
Cromosomas politénicos
Artículo principal: Cromosoma politénico

Cromosoma politénico de una glándula salival

Cromosoma politénicos de Drosophila melanogaster. La imagen fue obtenida mediante


contraste de fase. El cromocentro se halla en el ángulo superior derecho. La flecha señala
el extremo del cromosoma X. La imagen ampliada (B) muestra las bandas y las interbandas
con mayor detalle.
Las células de las glándulas salivares de los insectos del orden de
los Dípterospresentan núcleos que se hallan en una interfase permanente. Durante el
crecimiento y desarrollo de las larvas de estos insectos, la división celular se detiene en
algunos tejidos pero las células continúan su crecimiento por incremento de volumen.
Este proceso ocurre, por ejemplo, en los tubos de Malpighi, en las células nutricias de
los ovarios, en el epitelio intestinal y en las células de las glándulas salivares. En las células
de tejidos mencionados, los cromosomas sufren rondas repetidas de duplicaciones pero
sin separarse, proceso conocido como endomitosis. Esto lleva a la producción de
cromosomas constituidos por varios cientos o aun miles de hebras. Durante este proceso
de politenización o politenia, los cromosomas incrementan tanto su longitud como su
diámetro. De hecho, la longitud de los cromosomas de Drosophilaen una metafase es del
orden de 7,5 μm mientras que el largo total de los cromosomas en un núcleo de las
glándulas salivares es de alrededor de 2000 μm.5492
Además del cambio en el tamaño, los cromosomas politénicos presentan otras dos
características. En primer lugar, los cromosomas homólogos están asociados entre sí en
toda su extensión. Esta condición, denominada apareamiento somáticoes propia de la
mitosis de la mayoría de los Dípteros.93 La otra característica peculiar es que los
cromosomas muestran un patrón particular de bandeo transversal que consiste en zonas
más oscuras, llamadas bandas, que alternan con zonas claras, llamadas interbandas.
Cuando se observan al microscopio óptico se identifican como bandas oscuras y claras
transversales alternantes.94 Aunque la mayoría de las bandas son continuas a través del
cromosoma, otras aparecen como una serie de puntos. Este bandeo es reproducible de
núcleo a núcleo, formando un patrón constante de tal manera que los cromosomas
pueden ser identificados y mapeados en toda su longitud. Hay aproximadamente 5000
bandas y 5000 interbandas en total en el genoma de Drosophila melanogaster. Debido a
que el patrón de bandeo que presentan los cromosomas politénicos es un reflejo
constante de las secuencias de ADN, las bandas sirven como marcadores para localizar
varias características genéticas (lugar de los genes, o cambios en el genoma debido a
reordenamientos cromosómicos, por ejemplo deleciones, duplicaciones de bandas y
translocaciones)9596 y se han utilizado en diversos estudios genéticos y evolutivos.979899100
101

En D. melanogaster el patrón de bandeo no se distingue en aquellas regiones


heterocromáticas presentes en región centromérica de todos sus cromosomas (n=4). Las
regiones heterocromáticas están asociadas formando un cromocentro. Ya que dos
miembros del complemento haploide de esta especie son metacéntricos (los cromosomas
II y III) y dos son acrocéntricos (cromosoma sexual X o Y y el cromosoma IV), los
cromosomas politénicos en esta especie aparecen como cinco brazos desiguales que
irradian del cromocentro: un brazo correspondiente al cromosoma X, los dos brazos del
cromosoma II y los dos brazos del cromosoma III (3L y 3R). En algunos casos se puede
visualizar un sexto brazo muy pequeño que representa el cromosoma IV.54
Cromosomas en escobilla
Artículo principal: Cromosomas en escobilla
Cromosoma en escobilla de un ovocito de tritón.102
Los cromosomas en escobilla (también llamados cromosomas plumosos), observados por
primera vez por Walther Flemmingen 1882 en oocitos de salamandra (Ambystoma
mexicanum),103 son uno de los tipos de cromosomas más grandes y se hallan en
los oocitos de la mayoría de los animales, exceptuando a los mamíferos. Se hallan durante
el estadio de la meiosis I denominado diploteno. Luego de este relativamente largo
período de la meiosis I, los cromosomas en escobilla vuelven a compactarse durante el
período de metafase I. Son estructuras transitorias, específicamente bivalentes (es decir,
dos cromosomas apareados cada uno de los cuales está formado por dos cromátidas
hermanas). Cada uno de los dos cromosomas está constituido por dos largas hebras que
forman muchos «rulos» o «bucles», a la manera de un cepillo o escobilla, a lo largo del eje
mayor del cromosoma. Esos «rulos» permiten que el ADN se halle disponible para el
proceso de transcripción durante la maduración del ovocito.104105 De hecho, la presencia
de cromosomas en escobilla en una célula es indicador de que está ocurriendo la
transcripción del ARN mensajero.106107108 El término «cromosomas en escobilla»
(lampbrush chromosome) fue acuñado por J. Rückert en 1892,109 quien asimiló la forma de
estos cromosomas a un cepillo del siglo XIX, bastante equivalente a lo que actualmente se
denomina «limpiatubos».106
Cromosomas B
Artículo principal: Cromosomas B
La mayoría de los organismos son habitualmente muy poco tolerantes a la adición o
pérdida de material cromosómico, incluso en cantidades ínfimas. Así, alteraciones
cromosómicas como las deleciones, duplicaciones y aneuploidías (el exceso o defecto
respecto al número cromosómico normal en una especie dada) provocan en el individuo
afectado desde malformaciones hasta inviabilidad en diferentes niveles del desarrollo. Sin
embargo, una excepción a este hecho en muchas especies animales y vegetales consiste
en la existencia de cromosomas supernumerarios o cromosomas B. La distinción entre
cromosomas B y los del complemento normal (cromosomas A) fue realizada por primera
vez por Randolph en 1928.110 En general, los cromosomas accesorios presentan las
siguientes características:111
 no son indispensables para la vida normal de sus portadores;
 no son homólogos de ninguno de los cromosomas A, de los que probablemente
proceden;
 por lo general tienen sistemas de herencia irregulares y no mendelianos;
 morfológicamente, suelen ser más pequeños que los cromosomas del
complemento normal, heterocromáticos y alocíclicos;
 en cuanto a su distribución, los cromosomas B varían en frecuencia
 dentro de poblaciones de la misma especie (por ejemplo, en el
saltamontes Myrmeleotettix maculatus solo se han encontrado
cromosomas B en la parte sur de Gran Bretaña, no apareciendo ni en otras
poblaciones del país ni en las poblaciones de países continentales
adyacentes como Francia o Bélgica112);
 dentro de individuos de la misma población;
 dentro de células del mismo organismo (por ejemplo, en Aegilops
mutica y Aegilops speltoides los B solo están presentes en varias partes
aéreas de las plantas, como hipocótilos y ápices, y no en las raíces;113
 en general carecen de genes mayores,114 no tienen efectos cualitativos sobre
el fenotipo112 y son dañinos para los individuos que los portan en número
elevado.111
Sin embargo, el término «cromosoma B» integra un conjunto heterogéneo de
cromosomas, que varían tanto en su comportamiento como en su forma y tamaño, por lo
que las generalizaciones deben realizarse con precaución.
Isocromosomas
Artículo principal: Isocromosoma
Un isocromosoma es un cromosoma metacéntrico anormal originado durante la meiosis o
mitosis cuando la división del centrómero se produce según el plano horizontal en vez de
vertical. Como consecuencia, uno de los brazos del cromosoma original se pierde y los
brazos del isocromosoma resultante son genéticamente idénticos entre sí pero en sentido
inverso.1
En los humanos, los isocromosomas se hallan asociados a ciertas enfermedades. Así, por
ejemplo, se hallan en algunas niñas que presentan el síndrome de Turner, en los pacientes
con el síndrome de Pallister-Killian y en algunos tumores. El isocromosoma «17q» (o sea,
el isocromosoma formado por dos brazos largos del cromosoma 17 y que ha perdido el
brazo corto) y el isocromosoma «14q» están asociados a ciertos tipos de leucemia.115116
Además, los individuos portadores de isocromosomas pueden tener descendientes con
mayor número de cromosomas que el normal.117
El cromosoma en organismos procariotas
Los procariotas, bacteria y archaea, presentan típicamente un solo cromosoma circular, si
bien existen algunas variantes a esta regla.118 El cromosoma bacteriano puede tener un
tamaño desde 160 000 pares de bases (como en el endosimbionte Carsonella ruddii,119 a
12 200 000 pares de bases en la bacteria del suelo Sorangium cellulosum.120
Las bacterias usualmente tienen un solo punto en su cromosoma desde el cual se inicia la
duplicación, mientras que algunas archeas presentan múltiples sitios de inicio de la
duplicación.121 Por otro lado, los genes de los procariotas están organizados en operones y
no contienen intrones.
Los procariotas no poseen un núcleo verdadero, en cambio su ADN está organizado en
una estructura denominada nucleoide.122 El nucleoide es una estructura distintiva y ocupa
una región definida en la célula bacteriana. Esta estructura es muy dinámica y se halla
mantenida y remodelada a través de la acción de proteínas similares a histonas, las cuales
se asocian al cromosoma bacteriano.123 En archaea, el ADN en el cromosoma se halla
todavía más organizado, con el ADN empacado dentro de estructuras similares a los
nucleosomas eucarióticos.124125
Cromosomas artificiales
Artículos principales: Cromosoma artificial de levadura, Cromosoma artificial
bacteriano, Cromosoma artificial humano y Cromosoma artificial de mamífero.
Los cromosomas artificiales son cromosomas que han sido manipulados a través de
herramientas de ingeniería genética para que presenten estructuras precisas que
permiten su integración, permanencia y duplicación en determinados organismos.126
El cromosoma artificial de levadura o YAC (acrónimo inglés por yeast artificial
chromosome) es un tipo de vector de clonación de alta capacidad siendo, de hecho, el de
mayor capacidad (200 kb a 3000 kb). Fueron descritos por primera vez en 1983.127 Es un
vector que imita las características de un cromosoma normal de una levadura, ya que
porta un centrómero y los telómeros terminales. Esto permite clonar (es decir, multiplicar)
en levaduras secuencias de ADN de hasta un millón de pares de bases o más, al
comportarse como un cromosoma propio de la levadura. Son utilizados en construcción
de genotecas genómicas, siendo muy extendido su uso en los primeros años del Proyecto
Genoma Humano.128 Sin embargo, son más inestables que otros vectores, tales como BAC
(acrónimo inglés de bacterial artificial chromosome o cromosoma artificial bacteriano),
que han acabado imponiéndose.129 Estos últimos son también vectores de clonación
usados para clonar fragmentos de ADN de 100 a 300 kb de tamaño en
la bacteria Escherichia coli. Su estructura es análoga a la del plásmido factor-F encontrado
de modo natural en esa especie bacteriana.
Véase también
 Anexo:Conteo cromosómico por organismo
 Estructura supracromosómica
 Genoma
 Genoma humano
 Citogenética
 Cariotipo
 Aberración cromosómica
Notas
1. ↑ Los pasos para realizar el estudio de los cromosomas humanos mediante
técnicas convencionales son los siguientes:91
1. Obtención de la muestra: se realiza exclusivamente de tejidos vivos
que contengan células con núcleo. Principalmente se emplean los
glóbulos blancos que se hallan en la sangre por su fácil accesibilidad.
2. Siembra: la cual se realiza agregando aproximadamente 1 mililitro
de sangre entera heparinizada a un medio de cultivo enriquecido
con suero fetal bovino, antibióticos y mitógenos, lo cual estimulará
el crecimiento y división de las células.
3. Incubación: se mantiene a 38 °C con una atmósfera de CO2 al 5 % y
humedad por 72 horas.
4. Cosecha: Se agrega colchicina a la muestra para detener
la mitosis en metafase, posteriormente se cenfrifuga la mezcla para
retirar el sobrenadante (suero sanguíneo y medio de cultivo). Se
agrega solución hipotónica de cloruro de potasio para romper las
membranas celulares y para finalizar el paso de la cosecha se
realizan 3 lavados con una solución de metanol y ácido acético.
5. Goteo: con posterioridad a los lavados, por medio de
centrifugación, se obtiene un botón celular blanco, el cual se
suspende en la misma solución fijadora de metanol y ácido acético y
se procede a gotear en un portaobjetos a unos cuantos centímetros,
esto es con el objetivo de «reventar» las células y obtener los
cromosomas.
6. Envejecimiento: en este paso se espera a que la muestra pierda
humedad. Se puede aplicar calor al portaobjetos para deshidratar la
muestra.
7. Tinción: existen muchos tipos de tinciones para observar los
cromosomas. La más utilizada es la tinción con colorante Giemsa, se
conoce como técnica de bandas GTG. En este caso se expone la
muestra del portaobjetos a tripsina, con el objetivo de
desnaturalizar algunas de las proteínas constitutivas de los
cromosomas. Posteriormente se tiñen con dos colorantes, Giemsa y
Wright, en algunos laboratorios puede emplearse un solo colorante,
pero el empleo de los dos mejora la calidad del resultado, puesto
que facilita el análisis al microscopio para el citogenetista creando
un contraste de color en las bandas que se formaron al emplear la
tripsina. Por medio de estas bandas podemos distinguir las
características de un cromosoma y determinar si es normal o
presenta alguna anomalía estructural. Existen otras técnicas de
tinción, como bandas NOR, ICH, bandas Q, bandas R, técnicas para
teñir centrómero y heterocromatina. Con este tipo de técnicas se
puede llegar a realizar un diagnóstico citogenético acerca de una
enfermedad cromosómica.
8. Lectura: el último paso consiste en observar por lo menos 20 placas
metafásicas y formar un cariotipo o cariograma, donde se
acomodan los cromosomas por grupos según el tamaño y la
localización del centrómero.
Referencias
1. ↑ Saltar a:a b c d e Facultad de Ciencias Agropecuarias. Universidad Nacional
de Córdoba (Argentina). Genética. Capítulo 2. Forma y tamaño
cromosómico. Cariotipo. [1]
2. ↑ Nägeli, C. «Memoir on the nuclei, formation, and growth of vegetable
cells» (A. Henfrey, trans.). En: C. y J. Adlard, eds., Reports and Papers on
Botany. London: The Ray Society, 1846.
3. ↑ Daintith, John, et al., (eds), Biographical Encyclopedia of Scientists,
second edition. Bristol, UK: Institute of Physics Publishing, 1994.
4. ↑ Flemming, W. 1882. Zell-substanz, Kern und Zelltheilung (Citoplasma,
núcelo y división celular).
5. ↑ Olins, D. E.; Olins, A. L. (2003), «Chromatin history: our view from the
bridge», Nature Reviews Molecular Cell Biology 4 (10): 809-13 (enlace
roto disponible en Internet Archive; véase el historial y la última versión).
6. ↑ Crow, E. W.; Crow, J. F. (2002), «100 Years Ago: Walter Sutton and the
Chromosome Theory of Heredity», Genetics 160 (1): 1-4
7. ↑ Satzinger, Helga (2008), «Theodor and Marcella Boveri: chromosomes
and cytoplasm in heredity and development», Nature Reviews
Genetics 9 (3): 231, doi:10.1038/nrg2311
8. ↑ Morgan, Thomas Hunt, «Chromosomes and Heredity.» The American
Naturalist, 44(524):449-496, 1910.
9. ↑ Gonzalo Claros, M. Historia de la Biologìa (V): La naturaleza química del
DNA (hasta el primer tercio del siglo XX). Edición para Internet de la
revista Encuentros en la Biología, editada en la Facultad de Ciencias de la
Universidad de Málaga. ISSN 1134-8496
10. ↑ Levene, P. (1919). «The structure of yeast nucleic acid». J Biol
Chem 40 (2): 415-24.
11. ↑ Saltar a:a b Kornberg, R. D.; Lorch, Y. (1999), «Twenty-Five Years of the
Nucleosome, Fundamental Particle of the Eukaryote
Chromosome», Cell 98: 285-294, doi:10.1016/S0092-8674(00)81958-3,
archivado desde el original el 22 de junio de 2010, consultado el 6 de
diciembre de 2008
12. ↑ Saltar a:a b Facultad de Ciencias Veterinarias. Universidad Nacional de la
Plata. MORFOLOGÍA CROMOSÓMICA - CARIOTIPO.
13. ↑ Isenberg, I. (1979), «Histones», Annual Reviews in Biochemistry 48 (1):
159-191, doi:10.1146/annurev.bi.48.070179.001111
14. ↑ Grunstein, M. (1990), «Histone Function in Transcription», Annual
Reviews in Cell Biology 6 (1): 643-
676, doi:10.1146/annurev.cb.06.110190.003235
15. ↑ Kedes, L. H. (1979), «Histone Genes and Histone Messengers», Annual
Reviews in Biochemistry 48 (1): 837-
870, doi:10.1146/annurev.bi.48.070179.004201
16. ↑ Saltar a:a b Klug, A., Rhodes, D., Smith, J., Finch, J. T., Thomas, J. O. «A
low resolution structure for the histone core of the nucleosome.» Nature.
1980 Oct 9;287(5782):509-516.
17. ↑ Klug, A. & L. C. Lutter. 1981. «The helical periodicity of DNA on the
nucleosome». Nucleic Acids Res. September 11; 9(17): 4267-4283.
18. ↑ Klug, A. & L C Lutter. 1981. «The helical periodicity of DNA on the
nucleosome.»Nucleic Acids Res. September 11; 9(17): 4267-4283.
19. ↑ Saltar a:a b c Hock, R.; Furusawa, T.; Ueda, T.; Bustin, M. (2007), «HMG
chromosomal proteins in development and disease», Trends in Cell
Biology 17 (2): 72-79, doi:10.1016/j.tcb.2006.12.001
20. ↑ Saltar a:a b c Bustin, M. (1999), «Regulation of DNA-Dependent Activities
by the Functional Motifs of the High-Mobility-Group Chromosomal
Proteins», Molecular and Cellular Biology 19 (8): 5237-5246
21. ↑ Kornberg, Roger D. (1974), «Chromatin Structure: A Repeating Unit of
Histones and DNA», Science 184 (4139): 868-
871, PMID 4825889, doi:10.1126/science.184.4139.868
22. ↑ Saltar a:a b Woodcock, C. L.; Dimitrov, S. (2001), «Higher-order structure
of chromatin and chromosomes», Current Opinion in Genetics &
Development 11 (2): 130-135
23. ↑ Li, Gang; Sudlow, Gail; Belmont, Andrew S. (1998), «Interphase Cell Cycle
Dynamics of a Late-Replicating, Heterochromatic Homogeneously Staining
Region: Precise Choreography of Condensation/Decondensation and
Nuclear Positioning», The Journal of Cell Biology 140 (5): 975-
989, PMID 9490713, doi:10.1083/jcb.140.5.975
24. ↑ Saltar a:a b Paulson, J. R.; Laemmli, U. K. (1977), «The structure of
histone-depleted metaphase chromosomes», Cell 12 (3): 817-
28, doi:10.1016/0092-8674(77)90280-X(enlace roto disponible en Internet
Archive; véase el historial y la última versión).
25. ↑ Earnshaw, W. C.; Halligan, B.; Cooke, C. A.; Heck, M. M.; Liu, L. F.
(1985), «Topoisomerase II is a structural component of mitotic
chromosome scaffolds», The Journal of Cell Biology 100 (5): 1706-
1715, PMID 2985625, doi:10.1083/jcb.100.5.1706
26. ↑ Gasser, S. M.; Laroche, T.; Falquet, J.; Tour, E.; Laemmli, U. K. (1986),
«Metaphase chromosome structureInvolvement of topoisomerase II», J.
Mol. Biol188: 613-629, doi:10.1016/S0022-2836(86)80010-9
27. ↑ Saltar a:a b c Christensen, Morten O.; Larsen, Morten K.; Barthelmes,
Hans Ullrich; Hock, Robert; Andersen, Claus L.; Kjeldsen, Eigil; Knudsen,
Birgitta R.; Westergaard, Ole; Boege, Fritz; Mielke, Christian
(2002), «Dynamics of human DNA topoisomerases II{alpha} and II{beta} in
living cells», The Journal of Cell Biology 157 (1): 31-
44, PMID 11927602, doi:10.1083/jcb.200112023
28. ↑ Maeshima, K.; Laemmli, U. K. (2003), «A Two-Step Scaffolding Model for
Mitotic Chromosome Assembly», Developmental Cell 4 (4): 467-
480, doi:10.1016/S1534-5807(03)00092-3
29. ↑ Tavormina, Penny A.; Come, Marie-George; Hudson, Joanna R.; Mo, Yin-
Yuan; Beck, William T.; Gorbsky, Gary J. (2002), «Rapid exchange of
mammalian topoisomerase II{alpha} at kinetochores and chromosome
arms in mitosis», The Journal of Cell Biology 158 (1): 23-
29, PMID 12105179, doi:10.1083/jcb.200202053
30. ↑ Mirkovitch, J.; Mirault, M. E.; Laemmli, U. K. (1984), «Organization of the
higher-order chromatin loop: specific DNA attachment sites on nuclear
scaffold», Cell 39(1): 223-32, doi:10.1016/0092-8674(84)90208-3
31. ↑ Hart, C. M.; Laemmli, U. K. (1998), «Facilitation of chromatin dynamics
by SARs», Current Opinion in Genetics & Development 8 (5): 519-
525, doi:10.1016/S0959-437X(98)80005-1, archivado desde el original el 24
de abril de 2009, consultado el 10 de diciembre de 2008
32. ↑ Swedlow, J. R.; Hirano, T. (2003), «The Making of the Mitotic
Chromosome: Modern Insights into Classical Questions», Molecular
Cell 11 (3): 557-569, doi:10.1016/S1097-2765(03)00103-5 (enlace
roto disponible en Internet Archive; véase elhistorial y la última versión).
33. ↑ Poirier, M. G.; Eroglu, S.; Marko, J. F. (2002), «The Bending Rigidity of
Mitotic Chromosomes», Molecular Biology of the Cell: 10804011
34. ↑ Poirier, M. G.; Marko, J. F. (2002), «Mitotic chromosomes are chromatin
networks without a mechanically contiguous protein scaffold», Proc. Natl.
Acad. Sci. USA99: 15393-15397
35. ↑ Lewis, C. D.; Laemmli, U. K. (1982), «Higher order metaphase
chromosome structure: evidence for metalloprotein
interactions», Cell 29 (1): 171-81, doi:10.1016/0092-8674(82)90101-5
36. ↑ Saltar a:a b Hirano, T.; Mitchison, T. J. (1994), «A heterodimeric coiled-
coil protein required for mitotic chromosome condensation in
vitro», Cell 79 (3): 449-58, doi:10.1016/0092-8674(94)90254-2
37. ↑ Hirano, M.; Kobayashi, R. (1997), «Condensins, Chromosome
Condensation Protein Complexes Containing Xcap-c, Xcap-e and a
Xenopus…», Cell 89 (4): 511-521
38. ↑ Saltar a:a b Vernos, I.; Raats, J.; Hirano, T.; Heasman, J.; Karsenti, E.;
Wylie, C. (1995), «Xklp 1, A Chromosomal Xenopus Kinesin-like Protein
Essential for Spindle Organization and Chromosome…», Cell 81 (1): 117-127
39. ↑ MacHado, C.; Sunkel, C. E.; Andrew, D. J. (1998), «Human Autoantibodies
Reveal Titin as a Chromosomal Protein», The Journal of Cell Biology 141 (2):
321-333
40. ↑ MacHado, C.; Andrew, D. J. (2000), «D-Titin a Giant Protein with Dual
Roles in Chromosomes and Muscles», The Journal of Cell Biology 151 (3):
639-652
41. ↑ Clemson, C. M. (1996), «X chromosome at interphase: evidence for a
novel RNA involved in nuclear/chromosome structure», The Journal of Cell
Biology 132 (3): 259-275
42. ↑ Elgin, S. C. R. (1996), «Heterochromatin and gene regulation in
Drosophila», Current Opinion in Genetics & Development 6 (2): 193-202
43. ↑ Lewis, E. B. (1950), «The phenomenon of position effect», Adv Genet 3:
73-115, doi:10.1016/S0065-2660(08)60083-8
44. ↑ Heitz, E. (1928), «Das heterochromatin der moose», Jahrb. Wiss.
Botanik 69: 762-818
45. ↑ Saltar a:a b Grewal, S. I. S.; Rice, J. C. (2004), «Regulation of
heterochromatin by histone methylation and small RNAs», Current Opinion
in Cell Biology 16 (3): 230-238, doi:10.1016/j.ceb.2004.04.002, archivado
desde el original el 29 de junio de 2010
46. ↑ Saltar a:a b Volpe, Thomas A.; Kidner, Catherine; Hall, Ira M.; Teng, Grace;
Grewal, Shiv I. S.; Martienssen, Robert A. (2002), «Regulation of
Heterochromatic Silencing and Histone H3 Lysine-9 Methylation by
RNAi», Science 297 (5588): 1833-
1837, PMID 12193640, doi:10.1126/science.1074973 (enlace
roto disponible en Internet Archive; véase el historial y la última versión).
47. ↑ Lachner, M.; O'Sullivan, R. J.; Jenuwein, T. (2003), «An epigenetic road
map for histone lysine methilation», Journal of Cell Science 116: 2117-
2124, doi:10.1242/10.1242/jcs.00493
48. ↑ Hennig, W. (1999), «Heterochromatin», Chromosoma 108 (1): 1-
9, doi:10.1007/s004120050346
49. ↑ Craig, J. M. (2005), «Heterochromatin-many flavours, common
themes», BioEssays 27 (1): 17-28, doi:10.1002/bies.20145, archivado
desde el original el 16 de agosto de 2011, consultado el 6 de diciembre de
2008
50. ↑ Fitzgerald-hayes, M.; Clarke, L.; Carbon, J. (1982), «Nucleotide sequence
comparisons and functional analysis of yeast centromere
DNAs», Cell 29 (1): 235-44, doi:10.1016/0092-8674(82)90108-8
51. ↑ Choo, K. H. A. (1997), The centromere
52. ↑ Meluh, P. B.; Yang, P.; Glowczewski, L.; Koshland, D.; Smith, M. M.
(1998), «Cse 4 P is a Component of the Core Centromere of Saccharomyces
Cerevisiae», Cell94 (5): 607-613
53. ↑ Kurenova, E. V.; Mason, J. M. (1997), «Telomere functions. A
review», Biochemistry (Mosc) 62 (11): 1242-53
54. ↑ Saltar a:a b c Panzera, F., Ruben Pérez y Yanina Panzera. Identificación
cromosómica, cariotipo. Facultad de Ciencias Veterinarias, Universidad
Nacional de La Plata.
55. ↑ Saccone, S.; Federico, C.; Andreozzi, L.; D'antoni, S.; Bernardi, G.;
Molecolare, E.; Zoologica, S.; Slota, E. et al. (2002), «Chromosome
structure», Chromosome Research 10 (1): 1-50, archivado desde el
original el 22 de julio de 2011
56. ↑ Bernardi, G. (1989), «The Isochore Organization of the Human
Genome», Annual Reviews in Genetics 23 (1): 637-
659, doi:10.1146/annurev.ge.23.120189.003225
57. ↑ Saccone, S.; Bernardi, G. (2001), «Human chromosomal banding by in
situ hybridization of isochores», Methods in Cell Science 23 (1): 7-
15, doi:10.1023/A:1013173011458
58. ↑ Bernardi, G. (1995), «The Human Genome: Organization and
Evolutionary History», Annual Reviews in Genetics 29 (1): 445-
476, doi:10.1146/annurev.ge.29.120195.002305
59. ↑ Costantini, M.; Clay, O.; Auletta, F.; Bernardi, G. (2006), «An isochore
map of human chromosomes», Genome Research 16 (4): 536-
541, doi:10.1101/gr.4910606
60. ↑ Bernardi, G. (2000), «Isochores and the evolutionary genomics of
vertebrates», Gene 241 (1): 3-17, doi:10.1016/S0378-1119(99)00485-0,
archivado desde el originalel 13 de octubre de 2008, consultado el 13 de
diciembre de 2008
61. ↑ Ensembl
62. ↑ Bendich, Arnold J., Karl Drlica. 2000. «Prokaryotic and eukaryotic
chromosomes: what's the difference?» BioEssays 22: 481-486.
63. ↑ Wurster, Doris H. y Kurt Benirschke. 1970. «Indian Momtjac, Muntiacus
muntiak: A Deer with a Low Diploid Chromosome Number.» Science 12 de
junio de 1970: Vol. 168. no. 3937, pp. 1364-1366.
64. ↑ McClintock, B. (1984). «The significance of responses of the genome to
challenge.» Science 226, 792-801.
65. ↑ International Human Genome Sequencing Consortium (2004). «Finishing
the euchromatic sequence of the human genome». Nature 431 (7011): 931-
45. PMID 15496913. [2]
66. ↑ International Human Genome Sequencing Consortium (2001). «Initial
sequencing and analysis of the human genome». Nature 409 (6822): 860-
921. PMID 11237011.[3]
67. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 1. Accedido 12 de diciembre de 2008. [4]
68. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 2. Accedido 12 de diciembre de 2008. [5]
69. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 3. Accedido 12 de diciembre de 2008. [6]
70. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 4. Accedido 12 de diciembre de 2008. [7]
71. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 5. Accedido 12 de diciembre de 2008. [8]
72. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 6. Accedido 12 de diciembre de 2008. [9]
73. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 7. Accedido 12 de diciembre de 2008. [10]
74. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 8. Accedido 12 de diciembre de 2008. [11]
75. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 9. Accedido 12 de diciembre de 2008. [12]
76. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 10. Accedido 12 de diciembre de
2008. [13]
77. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 11. Accedido 12 de diciembre de
2008. [14]
78. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 12. Accedido 12 de diciembre de
2008. [15]
79. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 13. Accedido 12 de diciembre de
2008. [16]
80. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 14. Accedido 12 de diciembre de
2008. [17]
81. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 15. Accedido 12 de diciembre de
2008. [18]
82. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 16. Accedido 11 de enero de 2009. [19]
83. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 17. Accedido 11 de enero de 2009. [20]
84. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 18. Accedido 11 de enero de 2009. [21]
85. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 19. Accedido 11 de enero de 2009. [22]
86. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 20. Accedido 11 de enero de 2009. [23]
87. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 21. Accedido 11 de enero de 2009. [24]
88. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome 22. Accedido 11 de enero de 2009. [25]
89. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome X. Accedido 11 de enero de 2009. [26]
90. ↑ Sanger Institute. Vertebrate Genome Annotation (VEGA) database.
Human Map View. Chromosome Y. Accedido 11 de enero de 2009. [27]
91. ↑ Paz y Miño, César. 1999. Citogenética humana: manual de
prácticas. Práctica 5: Cultivo y preparación de linfocitos para análisis
cromosómico. Laboratorio de Genética Molecular y Citogenética Humana,
Departamento de Ciencias Biológicas, Facultad de Ciencias Exactas y
Naturales y Facultad de Medicina. Pontificia Universidad Católica del
Ecuador.
92. ↑ Ashburner, M. (1970), «Function and structure of polytene
chromosomes during insect development», Adv Insect Physiol 7 (1): 3S4
93. ↑ Rudkin, G. T. (1972), «Replication in polytene chromosomes», Results
Probl Cell Differ 4: 59-85
94. ↑ G. (1974), «The Relationship Between Genes and Polytene Chromosome
Bands», Annual Reviews in Genetics 8 (1): 51-
62, doi:10.1146/annurev.ge.08.120174.000411
95. ↑ Lewis, E. B. (1954), «The Theory and Application of a New Method of
Detecting Chromosomal Rearrangements in Drosophila», The American
Naturalist 88 (841): 225, doi:10.1086/281833
96. ↑ C. A. (1971), «The Genetic Organization of Chromosomes», Annual
Reviews in Genetics 5 (1): 237-
256, doi:10.1146/annurev.ge.05.120171.001321
97. ↑ Gunderina, L. I.; Kiknadze, I. I.; Istomina, A. G.; Gusev, V. D.;
Miroshnichenko, L. A. (2005), «Divergence of the polytene chromosome
banding sequences as a reflection of evolutionary», Russian Journal of
Genetics 41 (2): 130-137, doi:10.1007/s11177-005-0036-6
98. ↑ Gunderina, L. I. (2005) «Divergence patterns of banding sequences in
different polytene chromosome arms reflect relatively independent
evolution of different genome components.» Russian Journal of
Genetics 41(4).
99. ↑ Coluzzi, Mario; Sabatini, Adriana; Della Torre, Alessandra; Di Deco, Maria
Angela; Petrarca, Vincenzo (2002), «A Polytene Chromosome Analysis of
the Anopheles gambiae Species Complex», Science 298 (5597): 1415-
1418, PMID 12364623, doi:10.1126/science.1077769
100. ↑ Moltó, M. D.; Frutos, R.; Martinez-Sebastián, M. J. (1987), «The
banding pattern of polytene chromosomes of Drosophila guanche
compared with that of D», Genetica 75 (1): 55-70, doi:10.1007/BF00056033
101. ↑ Zhao, J. T.; Frommer, M.; Sved, J. A.; Zacharopoulou, A.
(1998), «Mitotic and polytene chromosome analyses in the Queensland
fruit fly, Bactrocera tryoni(Diptera: Tephritidae)», Genome 41: 510-
526, doi:10.1139/gen-41-4-510 (enlace rotodisponible en Internet Archive;
véase el historial y la última versión).
102. ↑ Oscar Hertwig, 1906: Lehrbuch der Entwicklungsgeschichte des
Menschen und der Wirbeltiere. Achte Auflage.
103. ↑ Flemming, W. 1882. Zellsubstanz, Kern- und Zelltheilung. Vogel,
Leipzig.
104. ↑ Izawa, M.; Allfrey, V. G.; Mirsky, A. E. (1963), «The Relationship
between RNA Synthesis and Loop Structure in Lampbrush
Chromosomes», Proceedings of the National Academy of Sciences 49 (4):
544-551
105. ↑ Callan, H. G. (1963), «The Nature of Lampbrush
Chromosomes», Int Rev Cytol15: 1-34, doi:10.1016/S0074-7696(08)61114-6
106. ↑ Saltar a:a b Macgregor, H. Lampbrush chromosomes . School of
Biosciences, University of Exeter.
107. ↑ Callan, H. G. (1986), «Lampbrush chromosomes», Mol Biol
Biochem Biophys36: 1-252
108. ↑ Gall, J. G.; Murphy, C.; Callan, H. G.; Wu, Z. A. (1991), «Lampbrush
chromosomes», Methods Cell Biol 36: 149-66, doi:10.1016/S0091-
679X(08)60276-9
109. ↑ Rückert, J. 1892. «Zur Entwicklungsgeschichte des Ovarialeies bei
Selachiern.» Anat Anz 7: 107-158.
110. ↑ Randolph, L. F. (1928). «Chromosome numbers in Zea Mays». L.
Cornel1 Agric. Exp. Sta. Memoir 117. 44.
111. ↑ Saltar a:a b Jones, R. N.; Rees, H. (1982), B chromosomes (enlace
roto disponible en Internet Archive; véase el historial y la última versión).
112. ↑ Saltar a:a b Hewitt, G. M.; East, T. M. (1978), «Effects of B
chromosomes on development in grasshopper embryos», Heredity 41: 347-
356, doi:10.1038/hdy.1978.105
113. ↑ Cebriá, A., Navarro, M. L., Puertas, M. J. (1994). «Genetic control
of B-chromosome transmission in Aegilops speltoides (Poaceae)». Am J of
Botany 81(11). 1502-1511.
114. ↑ Fox, D. P.; Hewitt, G. M.; Hall, D. J. (1974), «DNA replication and
RNA transcription of euchromatic and heterochromatic chromosome
regions during …», Chromosoma 45 (1): 43-62, doi:10.1007/BF00283829
115. ↑ Hernandez-Boluda, J. C.; Cervantes, F.; Costa, D.; Carrio, A.;
Montserrat, E. (2000), «Chronic myeloid leukemia with isochromosome
17q: report of 12 cases and review of the literature», Leuk
Lymphoma 38 (1-2): 83-90
116. ↑ Liu, H. W.; Lie, K. W.; Chan, L. C. (1992), «Isochromosome 14 q
and leukemia with dysplastic features», Cancer genetics and
cytogenetics 64 (1): 97-98, doi:10.1016/0165-4608(92)90333-4
117. ↑ Kleczkowska, A.; Fryns, J. P.; Buttiens, M.; Bisschop, F.; Emmery,
L.; Berghe, H. V. (1986), «Trisomy (18q) and tetrasomy (18p) resulting from
isochromosome formation», Clinical Genetics 30 (6): 503-
508, doi:10.1111/j.1399-0004.1986.tb01918.x
118. ↑ Thanbichler, M., Shapiro, L. (2006). «Chromosome organization
and segregation in bacteria». J. Struct. Biol. 156 (2): 292-
303. PMID 16860572. doi:10.1016/j.jsb.2006.05.007.
119. ↑ Nakabachi, A., Yamashita, A., Toh, H., Ishikawa, H., Dunbar, H.,
Moran, N., Hattori, M. (2006). «The 160-kilobase genome of the bacterial
endosymbiont Carsonella». Science 314 (5797):
267. PMID 17038615. doi:10.1126/science.1134196.
120. ↑ Pradella, S., Hans, A., Spröer, C., Reichenbach, H., Gerth, K.,
Beyer, S. (2002). «Characterisation, genome size and genetic manipulation
of the myxobacterium Sorangium cellulosum So ce56». Arch
Microbiol 178 (6): 484-92. PMID 12420170. doi:10.1007/s00203-002-0479-
2.
121. ↑ Kelman, L. M., Kelman, Z. (2004). «Multiple origins of replication
in archaea». Trends Microbiol. 12 (9): 399-
401. PMID 15337158. doi:10.1016/j.tim.2004.07.001.
122. ↑ Thanbichler, M., Wang, S. C., Shapiro, L. (2005). «The bacterial
nucleoid: a highly organized and dynamic structure». J. Cell.
Biochem. 96 (3): 506-21. PMID 15988757. doi:10.1002/jcb.20519.
123. ↑ Sandman, K., Pereira, S. L., Reeve, J. N. (1998). «Diversity of
prokaryotic chromosomal proteins and the origin of the nucleosome». Cell.
Mol. Life Sci. 54 (12): 1350-
64. PMID 9893710. doi:10.1007/s000180050259.
124. ↑ Sandman, K., Reeve, J. N. (2000). «Structure and functional
relationships of archaeal and eukaryal histones and nucleosomes». Arch.
Microbiol. 173 (3): 165-9. PMID 10763747. doi:10.1007/s002039900122.
125. ↑ Pereira, S. L., Grayling, R. A., Lurz, R., Reeve, J. N.
(1997). «Archaeal nucleosomes». Proc. Natl. Acad. Sci. U.S.A. 94 (23):
12633-7. PMID 9356501. doi:10.1073/pnas.94.23.12633.
126. ↑ Basu, J. y Huntington F. Willard. «Artificial and engineered
chromosomes: non-integrating vectors for gene therapy.» Trends in
Molecular Medicine, Volume 11, Issue 5, May 2005, 251-258.
127. ↑ Murray, A. W., Szostak, J. W. (1983): «Construction of artificial
chromosomes in yeast.» Nature 305, 2049-2054.
128. ↑ Larin, Z., Monaco, A. P., Lehrach, H. (1991): «Yeast artificial
chromosome libraries containing large inserts from mouse and human
DNA.» Proceedings of the National Academy of Sciences (USA) 88, 4123-
4127.
129. ↑ Bellanné-Chantelot, C. et al. (1992): «Mapping the whole human
genome by fingerprinting yeast artificial chromosomes», Cell 70, 1059-
1068.
Bibliografía
 Adolph, K. (ed.) (1988) Chromosomes and chromatin 1-3 Boca Raton FL: CRC
………………………………………………………………………………………………………..
Significado de Cromosomas
Qué es Cromosomas:
Los cromosomas son filamentos o anillos condensados de ADN y son solo visibles durante
la división celular (mitosis y meiosis).
En las células eucariotas (con núcleo definido), los cromosomas son alargados y se
encuentran en el núcleo, mientras que en las células procariotas como, por ejemplo, las
bacterias, estas se presentan como anillos circulares cerrados en el nucleoide.
¿Qué función cumplen los cromosomas?
La función principal del cromosoma es la compactación de la información genética del
ADN duplicado, que en primera instancia, mantendrá las 2 copias juntas a través de un
centrómetro. Las 2 copias de 1 cromosoma que se encuentran unidas se conoce como
cromátidas hermanas.
Cuando las cromátidas hermanas son separadas en la anafase de la mitosis (división
celular), aparecen los 2 cromosomas (cada una con información idéntica a la otra) que
constituirán el elemento fundamental de conservación del ADN original en cada célula
hija.
En este sentido, el cromosoma permite que la información del ADN sea conservada y
repartida equitativamente entre las células hijas producto de la división celular.
¿Cuántos cromosomas tienen los seres humanos?
Cada especie tiene una cantidad definida de cromosomas. Los seres humanos, por
ejemplo, tenemos 46 cromosomas o 23 pares homólogos o pares iguales. Los cromosomas
humanos además se dividen en:
 cromosomas sexuales: denominados X e Y que determinan el sexo biológico, y
 cromosomas no sexuales: los 44 cromosomas restantes denominados también
como autosomas.
La etimología de la palabra cromosoma proviene de cromo que significa “color, tinta”
y soma que expresa “cuerpo”.
Estructura de los cromosomas

Los cromosomas son una de las formas que adopta el ADN (ácido desoxirribonucleico),
ácido nucleico que contiene la información genética de cada célula. Algunas de las otras
formas que adopta el ADN son, por ejemplo, como cromatina y cromátida, entre otros.
En este sentido, el cromosoma es la forma que el ADN se compacta, empaqueta y prepara
para entrar en la fase M (mitosis o meiosis). Este proceso es denominado condensación
cromsómica y sucede después de que el ADN haya sido replicado.
En las células eucariotas, el ADN se encuentra la mayor parte del ciclo celular
descondensado en forma de cromatina.
La cromatina está compuesta del complejo de ADN, de histonas y otras proteínas
estructurales. Las histonas son un grupo de proteínas básicas con carga positiva que
forman bobinas para que el ADN con carga negativa pueda enrollarse en forma de
cromosoma.
La replicación del ADN sucede como preparación para la mitosis y cuando está completa, 2
copias de 1 cromosoma se unen a través de un centrómetro. Cuando se encuentran
unidas se le conoce como cromátidas hermanas y se considera 1 cromosoma.
Posteriormente, cuando las cromátidas hermanas se separan, se considera cada parte
como un cromosoma diferente, o sea, 2 cromosomas que contienen una copia exacta
del ADN original.
Clasificación de los cromosomas
El centrómero fracciona a las cromátidas en dos partes que se designan brazos. Los
cromosomas se clasifican según la longitud de sus brazos, dicho de otra manera, se
diferencia por la posición del centrómero:
 metacéntricos: cuando los brazos son aproximadamente iguales y el centrómero
está en el centro;
 submetacéntricos: el centrómero está levemente apartado hacia un lado, dando 2
brazos algo desiguales;
 telocéntricos: el centrómero está próximo de un extremo, dando 2 brazos muy
desiguales y,
 acrocéntricos: el centrómero está en un extremo, por lo que existe un brazo.
Tipos de cromosomas
Cromosomas homólogos
Los cromosomas homólogos son aquellos que juntos forman un par diploide completo.
Los cromosomas no sexuales, conocidos como autosomas o cromosomas somáticos, son
diploides (2n), o sea, vienen en pares homólogos y su división celular se conoce
como mitosis.
En el ser humano, los cromosomas del par 1 al 22 son autosomas y, el par 23 pertenece a
los cromosomas sexuales X e Y.
Cromosomas sexuales
Los cromosomas sexuales, denominados X e Y, determinan el sexo biológico. Estos
cromosomas tienen un solo cromosoma homólogo por ser células haploides (1n).
Esto quiere decir, que es necesario combinar un gameto masculino (espermatozoide, por
ejemplo) con un gameto femenino (como, por ejemplo, óvulo) para formar el conjunto
diploide completo de cromosomas. Este proceso se conoce como meiosis.
En el ser humano, el sexo biológico femenino surge de la combinación de 2 cromosomas X
(XX) y el sexo biológico masculino de la combinación de 1 cromosoma X y 1 cromosoma Y
(XY).
Vea también Reproducción sexual.
Fecha de actualización: 30/01/2019. Cómo citar: "Cromosomas". En: Significados.com.
Disponible en: https://www.significados.com/cromosoma/ Consultado: 27 de marzo de
2019, 12:08 pm.
………………………………………………………………….
Cromosoma
Un cromosoma es un paquete ordenado de ADN que se encuentra en el núcleo de la
célula. Los diferentes organismos tienen diferentes números de cromosomas. Los
humanos tenemos 23 pares de cromosomas - 22 pares autosómicos, y un par de
cromosomas sexuales, X e Y. Cada progenitor contribuye con un cromosoma de su par de
autosomas y uno del par sexual, de manera que la descendencia obtenga la mitad de sus
cromosomas de su madre y la mitad de su padre.
………………………………………………………………………
Anatomía humana
Ir a la navegaciónIr a la búsqueda
Una de las grandes ilustraciones detalladas en De humani corporis fabrica de Andreas
Vesalius(Siglo XVI), que marca el renacimiento de la anatomía humana
La anatomía humana es la ciencia de carácter práctico y morfológico principalmente
dedicada al estudio de las estructuras macroscópicas del cuerpo humano; dejando así el
estudio de los tejidos a la histología y de las célulasa la citología y biología celular. La
anatomía humana es un campo especial dentro de la anatomía general (animal).
Bajo una visión sistemática, el cuerpo humano —así como los cuerpos de los animales—,
está organizado en diferentes niveles de jerarquización. Así, está compuesto de aparatos,
a estos los integran los sistemas, que a su vez están compuestos por órganos, que están
compuestos por tejidos, que están formados por células, que están formados
por moléculas, etc. Otras visiones (funcional, morfogenética, clínica, etc.), bajo otros
criterios, entienden el cuerpo humano de forma un poco diferente.
Índice
 1Ramas y divisiones
 2Sistemas y aparatos del cuerpo humano
 3Anatomía topográfica
 4Anatomía artística. Historia
 5Véase también
 6Referencias
 7Bibliografía
 8Enlaces externos
Ramas y divisiones[editar]
Algunas ramas o disciplinas como la osteología, la miología, la artrología, la angiología o
la neuroanatomía cercan los límites de estudio del cuerpo humano de una manera más
particular. Así, la miología realiza el estudio específico de los músculos, sus características:
 Anatomía sistemática o descriptiva: esquematiza el estudio del cuerpo humano
fraccionándolo en las mínimas partes constituyentes, y organizándolas por
sistemas y aparatos.
 Anatomía topográfica, regional o quirúrgica: organiza el estudio del cuerpo por
regiones siguiendo diversos criterios. La Anatomía regional estudia cada región por
separado y todos los aspectos de esa región se estudian al mismo tiempo. Si se
estudia el tórax, se estudian todas sus estructuras: vascularización, músculos,
huesos, nervios...1
 Anatomía de superficie :es un área esencial en el estudio, pues los recuadros de
anatomía de superficie ofrecen una información visible y táctil sobre las
estructuras que se sitúan debajo de la piel.
 Anatomía artística: trata de las cuestiones anatómicas que afectan directamente a
la representación artística de la figura humana. Por ejemplo, los músculos que
aparecen superficialmente y sus tensiones según las diferentes posturas o
esfuerzos; las transformaciones anatómicas que se producen en función de la
edad, de la "raza" (o mejor dicho clina o fisiotipo), de las enfermedades; las
transformaciones anatómicas debidas al gesto o las emociones se estudian en una
subdivisión de la anatomía humana artística denominada fisiognomía o bien
fisiognómica.
 Neuroanatomía realiza el estudio del sistema nervioso en forma extensiva.
 Anatomía clínica : pone énfasis sobre el estudio de la estructura y la función en
correlación a situaciones de índole médico-clínica (y otras ciencias de la salud).
Aquí importan diferentes áreas como: la anatomía quirúrgica; la anatomía
radiológica en relación al diagnóstico por imágenes; la anatomía morfo genética
que se relaciona con las enfermedades congénitas del desarrollo (embriología);
la anatomopatología, entre otras.
Hay otras modalidades anatómicas que son aplicadas al estudio del cuerpo humano
como : Anatomía comparada, anatomía funcional, etc.
Sistemas y aparatos del cuerpo humano[editar]

Ejemplo: Sistemas cuerpo humano


Sistema
Un sistema es un grupo de órganos asociados que concurren en una función general y
están formados predominantemente por los mismos tipos de tejidos. Por ejemplo:
el sistema esquelético, el sistema cardiovascular, el sistema nervioso, etc.
 Sistema inmunitario: defensa contra agentes causantes de enfermedades.
 Sistema tegumentario: piel, pelo y uñas.
 Sistema nervioso: recogida, transferencia y procesado de información. Formado
por el sistema nervioso central (encéfalo y médula espinal) y el sistema nervioso
periférico (nervios de todo el cuerpo).
 Sistema cardiovascular: formado por el corazón, arterias, venas y capilares.
 Sistema linfático: formado por los capilares, vasos y ganglios
linfáticos, bazo, Timo y Médula Ósea.
 Sistema endocrino: comunicación dentro del cuerpo mediante hormonas. Está
formado por las glándulas endocrinas que sintetizan hormonas y las vuelcan al
medio interno (sangre, linfa, líquido intersticial) como son hipófisis, tiroides, timo,
suprarrenales, páncreas y gónadas y por células secretoras que se encuentran en
órganos que no son propiamente glándulas pero segregan hormonas como ocurre
con el riñón y el corazón.
 Sistema muscular: movimiento del cuerpo.
 Sistema óseo: apoyo estructural y protección mediante huesos.
 Sistema articular: formado por las articulaciones y ligamentos asociados que unen
el sistema esquelético y permite los movimientos corporales.
Aparato
Un aparato es un grupo de órganos que desempeñan una función común y sus órganos no
tienen predominio de ningún tejido, por ejemplo el aparato digestivo, o incluyen a varios
sistemas, como el aparato locomotor, integrado por los sistemas muscular, óseo, articular.
 Aparato digestivo: procesador de la comida, boca, faringe, esófago, estómago,
intestinos y glándulas anexas. Permite la conversión de los alimentos en moléculas
asimilables mediante las enzimas.
 Aparato excretor o urinario: eliminación de sustancias tóxicas y desechos del
cuerpo mediante la orina. Órganos: riñones (que contienen las unidades anatomo-
funcionales llamadas nefronas), uréteres, vejiga, uretra.
 Aparato reproductor: los órganos sexuales (masculinos y femeninos)
 Aparato respiratorio: son los órganos y cavidades empleados para el intercambio
de gases respiratorios: fosas nasales, faringe, laringe, tráquea, bronquios,
bronquiolos y pulmones. Dentro de los pulmones encontramos los alvéolos que
son la unidad anatomo-funcional del sistema.
 Aparato locomotor: conjunto de los sistemas esquelético, articular y muscular.
Estos sistemas coordinados por el sistema nervioso permiten la locomoción.
 Aparato circulatorio: conjunto de vasos sanguíneos (venas, arterias y capilares)
y linfáticos
……………………………………………………………………………………..
Anatomía
Ir a la navegaciónIr a la búsqueda

El Hombre de Vitruvio, reinterpretación de las proporciones ideales de los textos clásicos


elaborada por Leonardo da Vinci.
La anatomía es una ciencia que estudia la estructura de los seres vivos,1 es decir, la forma,
topografía, la ubicación, la disposición y la relación entre sí de los órganos que las
componen.
Si bien la anatomía se basa ante todo en el examen descriptivo de los organismos vivos, la
comprensión de esta arquitectura implica en la actualidad un maridaje con la función, por
lo que se confunde en ocasiones con la fisiología (en lo que se denomina anatomía
funcional) y forma parte de un grupo de ciencias básicas llamadas "ciencias morfológicas"
(biología del desarrollo, histología y antropología), que completan su área de
conocimiento con una visión dinámica y pragmática.
Al científico que cultiva esta ciencia se le denomina anatomista (aunque el Diccionario de
la lengua española de la Real Academia Española también acepta el término anatómico).

Índice
 1Etimología
 2Subdivisiones
 3Ciencias auxiliares
 4Historia de la anatomía
 5Asociaciones anatómicas
 6Notas
 7Referencias
 8Véase también
 9Enlaces externos
Etimología[editar]
Deriva del latín. anatomĭa, y del griego. ἀνατομία [anatomía];2 derivado del verbo
ἀνατέμνειν [anatémnein], ‘cortar’ o ‘separar’a compuesto de ἀνά [aná], ‘hacia arriba’b y
τέμνειν [témnein], ‘cortar’)c
El término designa tanto la estructura de los organismos vivientes como la rama de
la biología que estudia dichas estructuras, que en el caso de la anatomía humana se
convierte en una de las llamadas ciencias básicas o "preclínicas" de la medicina.3
Subdivisiones[editar]

Anatomía externa de los seres humanos. Aunque es similar a otros mamíferos, con la piel
recubierta por vello y el sistema sensorial desarrollados, son los únicos mamíferos con la
postura bípeda y tienen, con mucho, el cerebro más desarrollado del reino animal.
 Anatomía descriptiva: Separa el cuerpo en sistemas. También denominada
sistemática.4
 Anatomía topográfica: Se estudia por divisiones especiales. También llamada
regional.
 Anatomía quirúrgica: Consiste en el estudio de la estructura y morfología de los
tejidos y órganos del cuerpo aplicados a la cirugía.
 Anatomía clínica: Mencionada también como aplicada, relaciona diagnóstico con
tratamiento.
 Anatomía comparada: Compara la anatomía del cuerpo humano con los animales
 Anatomía microscópica: Predominio de la utilización de microscopio, llamada
también histología.
 Anatomía macroscópica: Estudia la forma de las estructuras, no se utiliza
microscopio.
 Anatomía del desarrollo: Relacionada desde la fertilización hasta el postnatal
llamada también Embriología.
 Anatomía funcional: Denominada también fisiológica, la cual estudia las funciones
de los órganos.
 Anatomía de superficie: Utilizada en rehabilitación (kinesiología).
 Anatomía de las mediciones: Usada en el reconocimiento del cuerpo por sus
características y medidas.
 Anatomía radiológica: Estudio mediante imágenes.
 Anatomía patológica: Estudia el deterioro de los órganos y sistemas.
 Anatomía artística: Estudia el arte anatómico.
 Anatomía vegetal: o fitotomía es el campo de la Botánica que estudia la estructura
interna de las plantas.
 Anatomía animal: Utilizada por los veterinarios. También llamada anatomía
veterinaria.
 Anatomía Humana: Describe el cuerpo humano.
Ciencias auxiliares[editar]
Son ciencias que complementan el estudio anatómico especializado y esta presentes en
cada una de sus ramas de la anatomía en general:
 Osteología: Ciencia que estudia los huesos.
 Artrología: Ciencia que estudia las articulaciones.
 Miología: Estudia los músculos.
 Angiología: Estudia los vasos sanguíneos.
 Cardiología: Estudia al corazón.
 Esplacnología: Se encarga del estudio de las vísceras.
 Neurología: Estudia la vía nerviosas y Sistema nervioso central.
 Neumología: Estudia las vías respiratorias.
 Gastroenterología: Estudia todo lo que abarca el sistema digestivo.
 Endocrinología: Estudia las glándulas.
Historia de la anatomía[editar]
Prehistoria
La Anatomía occidental tal y como la conocemos actualmente tuvo su origen en el imperio
helénico, existen muchas pinturas rupestres en diversas cavernas que narran cardiotomías
(incisión quirúrgica del corazón) de mammuts, traqueotomías aplicadas a equinos, y
diversas miotomías sobre todo explayadas gráficamente a los animales anteriores
(paquidermos y equinos), en donde se empleaba instrumentaría elaborada finamente con
piedra trabajada y puntas de madera.
Edad de Bronce
Diagrama anatómico en De humani corporis fabrica de Vesalius, 1543
En la Edad de Bronce, la anatomía tomó un fuerte impacto centralizado en Asia, sobre
todo en el subcontinente indio. La Indiafue la principal fuente de conocimientos
anatómicos para todas las escuelas de enseñanza de la antigua ciencia médica,
empezando a repartir sus enseñanzas con el pasar del tiempo hacia China, el Medio
Oriente y África. En la India Charaka Samhita, el registro de escritura más antiguo
de medicina interna, creado por Charaka, conocido como el padre de
la Medicinaen India o Ayurveda y de la cirugía reconstructiva, (antecesor y maestro del
legendario Shusruta); realizó las exploraciones anatómicas topográficas en cadáveres
humanos sobre todas las estructuras. Fue el primero en descubrir el Aparato circulatorio,
alrededor del siglo 3 a. C., nominado en ese entonces Mahatma Amar. Charaka estableció
un método sobre prevención de la salud, funcional hasta la actualidad, por lo que es
también considerado a nivel mundial como el padre de la medicina preventiva, la cirugía
plástica y la medicina interna. A su vez Charaka fue el primer regente en su era de
manufacturar más de 113 instrumentos quirúrgicos, que hasta la actualidad ciertos de sus
diseños siguen siendo empleados en la práctica quirúrgica.
Edad antigua
Las disecciones de la Escuela de Alejandría, donde destacó Erasístrato basan el
conocimiento anatómico aceptado por Galeno en la Roma clásica, quien, aportó algunos
datos a raíz de unas pocas disecciones en humanos y, sobre todo, en cerdos y monos.
Edad Media

Mondino dei Liuzzi, Anathomia, 1541


El conocimiento anatómico de la Edad Media se basa en la aceptación de la anatomía
galénica. Las clases impartidas por el profesor se hacían con la lectio del texto de Galeno, y
las escasas disecciones en cadáveres eran realizadas por un practicante y un mostrador
mientras se leía al clásico, sin crítica.
Edad Moderna

Ilustración de anatomía desde Acta Eruditorum, 1691


La Medicina galénica comienza a ser cuestionada desde la Anatomía. Tras una serie de
descubrimientos por parte de los llamados anatomistas prevesalianos, Andrea Vesalio,
considerado como el padre de la Anatomía moderna, dedicándose a la disección de
cadáveres para la obtención de conocimiento anatómico. Plasmó sus observaciones en
su De humani corporis fabrica, que marcará la Anatomía hasta nuestros días.
Edad Contemporánea
Ha tenido que vivir la aparición del microscopio, que abrió un nuevo mundo descriptivo
microscópico, la Anatomía microscópica o Histología, y la paulatina conversión de la
Anatomía en dinámica a partir de la estática fábrica de Vesalio, incorporando función y
relación dentro de sus observaciones.
……………………………………………………………………
La anatomía es una ciencia que estudia la estructura de los seres vivos, o sea la
disposición de sus huesos y órganos y la relación que existe entre ellos. También se
llama anatomía a la propia estructura de los seres vivos. Este término es muy utilizado en
ciencias como la medicina y la biología.
………………………………………………………………..
La ecología es la rama de la biología que estudia las relaciones de los diferentes seres
vivos entre si y con su entorno: «la biología de los ecosistemas» (Margalef, 1998, p. 2).
Estudia cómo estas interacciones entre los organismos y su ambienteafectan a
propiedades como la distribución o la abundancia. En el ambiente se incluyen las
propiedades físicas y químicas que pueden ser descritas como la suma de factores
abióticos locales, como el clima y la geología, y los demás organismos que comparten ese
hábitat (factores bióticos). Los ecosistemas están compuestos de partes que interactúan
dinámicamente entre ellas junto con los organismos, las comunidades que integran, y
también los componentes no vivos de su entorno. Los procesos del ecosistema, como la
producción primaria, la pedogénesis, el ciclo de nutrientes, y las diversas actividades de
construcción del hábitat, regulan el flujo de energía y materia a través de un entorno.
Estos procesos se sustentan en los organismos con rasgos específicos históricos de la vida,
y la variedad de organismos que se denominan biodiversidad. La visión integradora de la
ecología plantea el estudio científico de los procesos que influyen en la distribución y
abundancia de los organismos, así como las interacciones entre los organismos y la
transformación de los flujos de energía. La ecología es un campo interdisciplinario que
incluye a la biología y las ciencias de la Tierra.
Los antiguos filósofos griegos, como Hipócrates y Aristóteles, sentaron las bases de la
ecología en sus estudios sobre la historia natural. Los conceptos evolutivos sobre la
adaptación y la selección natural se convirtieron en piedras angulares de la teoría
ecológica moderna transformándola en una ciencia más rigurosa en el siglo XIX. Está
estrechamente relacionada con la biología evolutiva, la genética y la etología. La
comprensión de cómo la biodiversidad afecta a la función ecológica es un área importante
enfocada en los estudios ecológicos. Los ecólogos tratan de explicar:
 Los procesos de la vida, interacciones y adaptaciones
 El movimiento de materiales y energía a través de las comunidades vivas
 El desarrollo sucesional de los ecosistemas
 La abundancia y la distribución de los organismos y de la biodiversidad en el
contexto del medio ambiente.
Hay muchas aplicaciones prácticas de la ecología en biología de la conservación, manejo
de los humedales, manejo de recursos naturales (la agroecología, la agricultura,
la silvicultura, la agroforestería, la pesca), la planificación de la ciudad (ecología urbana), la
salud comunitaria, la economía, la ciencia básica aplicada, y la interacción social humana
(ecología humana). Los organismos (incluidos los seres humanos) y los recursos componen
los ecosistemas que, a su vez, mantienen los mecanismos de retroalimentación biofísicos
son componentes del planeta que moderan los procesos que actúan sobre la vida
(bióticos) y no vivos (abióticos). Los ecosistemas sostienen funciones que sustentan la vida
y producen el capital natural como la producción de biomasa (alimentos, combustibles,
fibras y medicamentos), los ciclos biogeoquímicos globales, filtración de agua, la
formación del suelo, control de la erosión, la protección contra inundaciones y muchos
otros elementos naturales de interés científico, histórico o económico.

Índice
 1Historia
 2Los precursores de la ecología
 3Objeto de estudio
 4Principios y conceptos de la ecología
o 4.1Teoría de sistemas
o 4.2Principios de ecología
o 4.3Flujos de materia y energía
 4.3.1Flujo de energía
o 4.4Niveles de organización
o 4.5Cadena Trófica
o 4.6Producción y productividad
o 4.7Tasa de renovación
o 4.8Riqueza, diversidad y biodiversidad
o 4.9Biosfera
o 4.10Ecosistema
o 4.11Relaciones espaciales y subdivisiones de la Tierra
 5Disciplinas de la ecología
o 5.1Otras disciplinas
 6Ecólogos célebres
 7Véase también
 8Referencias
 9Bibliografía
 10Enlaces externos
Historia[editar]
El término ökologie fue acuñado en 18691 por el naturalista y
filósofo alemán prusiano Ernst Haeckel a partir de las palabras griegas oikos (casa,
vivienda, hogar) y logos (estudio o tratado); por ello ecología significa «el estudio del
hogar».2
En un principio, Haeckel entendía por ecología la ciencia que estudia las relaciones de los
seres vivos con su ambiente, pero más tarde amplió esta definición al estudio de las
características del medio, que también incluye el transporte de materia y energía, y su
transformación por las comunidades biológicas.
Los precursores de la ecología[editar]
Hay que reconocer a los biólogos y geógrafos el papel fundamental en los inicios de la
ecología. Es justo recordar el aporte considerable de los griegos clásicos. Por
ejemplo, Aristóteles, además de filósofo, fue un biólogo y naturalista de gran talla. Baste
citar sus libros sobre la vida y costumbres de los peces, fruto de sus diálogos con
pescadores, y sus largas horas de observación personal.
Si nos trasladamos al siglo XVIII, cuando la biología y la geografía se estaban
transformando en las ciencias modernas que hoy conocemos, es imprescindible reconocer
el carácter absolutamente ecológico del trabajo de los fisiologistas en su progresivo
descubrimiento de las relaciones entre la vida vegetal y animal con los factores abióticos
tales como la luz, el agua o el carbono. Entre los muchos ejemplos posibles, es suficiente
recordar las investigaciones de René Antoine Ferchault de Réaumur en el campo de la
temperatura, así como las de Anton van Leeuwenhoek acerca de la formación del almidón
en las plantas verdes. Destacan también en esta época, los trabajos de Louis Receveur,
botánico , geólogo , químico , meteorólogo, astrónomo y sacerdote francés.
También se realizaron durante el siglo algunos de los grandes viajes científicos que
permitieron un conocimiento más metodológico de los paisajes geográficos de los
diversos continentes, ejemplo entre otros de Georges Louis Leclerc, Conde de Buffon,
autor de los primeros tratados de biología y geología no basados en la Biblia; o Alexander
von Humboldt, que exploró y estudió durante cinco años las tierras de América Latina.
El papel de los precursores del evolucionismo es asimismo fundamental, porque intuían
que no había ningún tipo de predeterminismo en la gran variedad de especies vivientes
existentes, sino progresivas adaptaciones ambientales.
Erasmus Darwin, abuelo del universalmente famoso Charles Darwin, predijo algunas de las
grandes tesis evolucionistas que desarrolló años más tarde su nieto y que influyeron de
modo decisivo en las corrientes de pensamiento del siglo XIX.
Sin duda alguna, la polémica entre deterministas y evolucionistas fue uno de los
principales debates científicos del siglo XIX, enfrentando a hombres de la categoría de
Cuvier, Owen, Agassiz y Kölliker, contra los nuevos "transformistas" Lamarck, Darwin,
Herbert Spencer, Muller, Haeckel, etc.
El calor de la polémica fue muy fecundo, porque exigió de los transformistas que
multiplicaran sus observaciones para justificar las nuevas teorías del evolucionismo.
En alguno de ellos se manifestó una conversión forzada por las evidencias; por ejemplo en
el científico galés Richard Owen, que aún siendo vivamente adversario de la nueva teoría
evolucionista, realizó descubrimientos que él mismo no podía justificar si no era
recurriendo a la teoría de Darwin.
Objeto de estudio[editar]

La ecología es la rama de la Biología que estudia las interacciones de los seres vivos con
su hábitat. Esto incluye factores abióticos, esto es, condiciones ambientales tales
como: climatológicas, edáficas, etc.; pero también incluye factores bióticos, esto es,
condiciones derivadas de las relaciones que se establecen con otros seres vivos. Mientras
que otras ramas se ocupan de niveles de organización inferiores (desde la bioquímica y la
biología molecular pasando por la biología celular, la histologíay la fisiología hasta
la sistemática), la ecología se ocupa del nivel superior a estas, ocupándose de las
poblaciones, las comunidades, los ecosistemas y la biosfera. Por esta razón, y por
ocuparse de las interacciones entre los individuos y su ambiente, la ecología es una ciencia
multidisciplinaria que utiliza herramientas de otras ramas de la ciencia,
especialmente geología, meteorología, geografía, sociología, física, química y matemáticas
.
Los trabajos de investigación en esta disciplina se diferencian con respecto de la mayoría
de los trabajos en las demás ramas de la Biología por su mayor uso de herramientas
matemáticas, como la estadística y los modelos matemáticos. Además, la comprensión de
los procesos ecológicos se basa fuertemente en los postulados evolutivos (Dobzhansky,
1973).
Principios y conceptos de la ecología[editar]
Teoría de sistemas[editar]
Artículo principal: Teoría de sistemas
Principios de ecología[editar]
Plantas y animales florecen solo cuando ciertas condiciones físicas están presentes. En la
ausencia de tales condiciones, las plantas y animales no pueden sobrevivir sin ayuda de
estos, son comensalismos.
Flujos de materia y energía[editar]
Artículo principal: Ciclo biogeoquímico
Flujo de energía[editar]
En esta sucesión de etapas en las que un organismo se alimenta y es devorado la energía
fluye desde un nivel trófico a otro. Las plantas verdes u otros organismos que realizan la
fotosíntesis utilizan la energía solar para elaborar hidratos de carbono para sus propias
necesidades. La mayor parte de esta energía química se procesa en el metabolismo y se
pierde en forma de calor en la respiración. Las plantas convierten la energía restante en
biomasa sobre el suelo como tejido leñoso y herbáceo y, bajo este, como raíces. Por
último, este material, que es energía almacenada, se transfiere al segundo nivel trófico
que comprende los herbívoros que pastan, los descomponedores y los que se alimentan
de detritos. Si bien, la mayor parte de la energía asimilada en el segundo nivel trófico se
pierde de nuevo en forma de calor en la respiración, una porción se convierte en biomasa.
En cada nivel trófico los organismos convierten en biomasa menos energía de la que
reciben. Por lo tanto, cuantos más pasos se produzcan entre el productor y el consumidor
final queda menos energía disponible. Rara vez existen más de cuatro o cinco niveles en
una cadena trófica. Con el tiempo, toda la energía que fluye a través de los niveles tróficos
se pierde en forma de calor. El proceso por medio del cual la energía pierde su capacidad
de generar trabajo útil se denomina entropía.
Niveles de organización[editar]
Para los ecólogos modernos (Begon, Harper y Townsend, 1999)(Molles, 2006), la ecología
puede ser estudiada a varios niveles o escalas:
 Organismo (las interacciones de un ser vivo dado con las condiciones abióticas
directas que lo rodean)
 Población (las interacciones de un ser vivo dado con los seres de su misma especie)
 Comunidad (las interacciones de una población dada con las poblaciones de
especies que la rodean),
 Ecosistema (las interacciones propias de la biocenosis sumadas a todos los flujos
de materia y energía que tienen lugar en ella)
 Biosfera (el conjunto de todos los seres vivos conocidos).
Cadena Trófica[editar]
La cadena alimenticia o cadena trófica señala las relaciones alimenticias entre
productores,consumidores y descomponedores. En otras palabras, la cadena refleja quién
se come a quién.
Las cadenas tróficas, son una serie de cadenas alimentarias íntimamente relacionadas por
las que circulan energía y materiales en un ecosistema. Se entiende por cadena
alimentaria cada una de las relaciones alimenticias que se establecen de forma lineal
entre organismos que pertenecen a distintos niveles tróficos. La cadena trófica está
dividida en dos grandes categorías: la cadena o red de pastoreo, que se inicia con las
plantas verdes, algas o plancton que realiza la fotosíntesis, y la cadena o red de detritos
que comienza con los detritos orgánicos. Estas redes están formadas por cadenas
alimentarias independientes. En la red de pastoreo, los materiales pasan desde las plantas
a los consumidores de plantas (herbívoros) y de estos a los consumidores de carne
(carnívoros). En la red de detritos, los materiales pasan desde las plantas y sustancias
animales a las bacterias y a los hongos (descomponedores), y de estos a los que se
alimentan de detritos (detritívoros) y de ellos a sus depredadores (carnívoros).
Por lo general, entre las cadenas tróficas existen muchas interconexiones; por ejemplo, los
hongos que descomponen la materia en una red de detritos pueden dar origen a setas
que son consumidas por ardillas, ratones y ciervos en una red de pastoreo. Los petirrojos
son omnívoros, es decir, consumen plantas y animales, y por esta razón están presentes
en las redes de pastoreo y de detritos. Los petirrojos se suelen alimentar de lombrices de
tierra que son detritívoras y se alimentan de hojas en estado de putrefacción.
Producción y productividad[editar]
En un ecosistema, las conexiones entre las especies se relacionan generalmente con su
papel en la cadena alimentaria. Hay tres categorías de organismos:
 Productores o autótrofos —Generalmente las plantas o las cianobacterias que son
capaces de fotosintetizar pero podrían ser otros organismos tales como las
bacterias cerca de los respiraderos del océano que son capaces
de quimiosintetizar.
 Consumidores o heterótrofos —Animales, que pueden ser consumidores primarios
(herbívoros), o consumidores secundarios o terciarios (carnívoros y omnívoros).
 Descomponedores o detritívoros —Bacterias, hongos, e insectos que degradan la
materia orgánica de todos los tipos y restauran los alimentos al ambiente.
Entonces los productores consumirán los alimentos, terminando el ciclo.
Estas relaciones forman las secuencias, en las cuales cada individuo consume al
precedente y es consumido por el siguiente, lo que se llama cadenas alimentarias o las
redes del alimento. En una red de alimento habrá pocos organismos en cada nivel como
uno sigue los acoplamientos de la red encima de la cadena, formando una pirámide.
Estos conceptos llevan a la idea de biomasa (la materia viva total en un ecosistema), de la
productividad primaria (el aumento en compuestos orgánicos), y de la productividad
secundaria (la materia viva producida por los consumidores y los descomponedores en un
rato dado). Estas dos ideas pasadas son dominantes, puesto que permiten evaluar la
capacidad de carga —el número de organismos que se pueden apoyar por un ecosistema
dado. En ninguna red del alimento se transfiere totalmente la energía contenida en el
nivel de los productores a los consumidores. Se pierden ascendentes cuanto más alta es la
cadena, mayor la energía y los recursos. Así, puramente de una energía y desde el punto
de vista del alimento es más eficiente para que los seres humanos sean consumidores
primarios (subsistir de vehículos, de granos, de las legumbres, de la fruta, etc.) que
consumidores secundarios (herbívoros consumidores, omnívoros, o sus productos), y aún
más que sean consumidores terciarios (carnívoros consumidores, omnívoros, o sus
productos). Un ecosistema es inestable cuando sobra la capacidad de carga. La
productividad total de los ecosistemas es estimada a veces comparando tres tipos de
ecosistemas con base en tierra y el total de ecosistemas acuáticos; se estima que la mitad
de la producción primaria puede ocurrir en tierra, y el resto en el océano.
 Los bosques (1/3 de la superficie terrestre de la Tierra) contienen biomasas densas
y muy productivas.
 Sabanas, praderas, y pantanos (1/3 de la superficie terrestre de la Tierra)
contienen biomasas menos densas, pero es productiva. Estos ecosistemas
representan a las mayores partes de las que dependen el alimento humano.
 Ecosistemas extremos en las áreas con climas más extremos —desiertos y semi-
desiertos, tundra, prados alpestres, y estepas -- (1/3 de la superficie terrestre de la
Tierra). Tienen biomasas muy escasas y baja productividad.
 Finalmente, los ecosistemas del agua marina y dulce (3/4 de la superficie terrestre
de la Tierra) contiene biomasas muy escasas (aparte de las zonas costeras).
Los ecosistemas difieren en su biomasa (carbón de los gramos por metro cuadrado) y la
productividad (carbón de los gramos por metro cuadrado por día), y las comparaciones
directas de la biomasa y la productividad puede no ser válida. Un ecosistema como este
en la taiga puede ser alto en biomasa, pero de crecimiento lento y así bajo en
productividad. Los ecosistemas se comparan a menudo en base de su volumen de ventas
(cociente de la producción) o del tiempo del volumen de ventas que sean los recíprocos
del volumen de ventas. Las acciones humanas durante los últimos siglos han reducido
seriamente la cantidad de la tierra cubierta por los bosques (tala de árboles), y han
aumentado agroecosistemas. En últimas décadas ha ocurrido un aumento en las áreas
ocupadas por ecosistemas extremos, como en el caso de la desertificación.
Tasa de renovación[editar]
Es la relación que existe entre la producción y la biomasa. Sirve para indicar la riqueza de
un ecosistema o nivel trófico, ya que representa la velocidad con que se renueva la
biomasa, por lo que también recibe el nombre de tasa de renovación. Su valor es el
cociente Pn/B. (producción neta entre biomasa)
Riqueza, diversidad y biodiversidad[editar]
Artículo principal: Biodiversidad
Algunas de las tasas de diversidad biológica más altas se observan en los arrecifes de
coral.
Biosfera[editar]
Artículo principal: Biosfera
La capa exterior del planeta Tierra puede ser dividida en varios compartimentos:
la hidrosfera (o esfera de agua), la litosfera (o ámbito de los suelos y rocas), y la atmósfera
(o la esfera de aire). La biosfera (o la esfera de la vida), a veces descrita como "el cuarto
sobre" es la materia viva del planeta, o la parte del planeta ocupada por la vida. Alcanza
así en los otros tres ámbitos, aunque no hay habitantes permanentes de la atmósfera. En
relación con el volumen de la Tierra, la biosfera es solo la capa superficial muy delgada
que se extiende 11.000 metros bajo el nivel del mar a 15.000 metros por encima.
Se piensa que la vida por primera vez se desarrolló en la hidrosfera, a profundidades
someras, en la zona fótica. (Sin embargo, recientemente, una teoría de la competencia se
ha convertido, de que la vida se originó alrededor de fuentes hidrotermales en la
profundidad de océano. Véase el origen de la vida.) Luego aparecieron los organismos
multicelulares y colonizaron las zonas bentónicas. Organismos fotosintéticos
gradualmente emitieron, mediante reacciones químicas, los gases hasta llegar a las
actuales concentraciones, especialmente la abundancia de oxígeno, que caracterizan a
nuestro planeta. La vida terrestre se desarrolló más tarde, protegida de los rayos UV por
la capa de ozono. La diversificación de las especies terrestres se piensa que fue
incrementada por la deriva de los continentes por aparte, o, alternativamente, chocar. La
biodiversidad se expresa en el nivel ecológico (ecosistema), nivel de población (diversidad
intraespecífica), especies (diversidad específica), y nivel genético.
La biosfera contiene grandes cantidades de elementos tales como carbono, nitrógeno,
hidrógeno y oxígeno. Otros elementos, tales como el fósforo, calcio y potasio, también
son esenciales a la vida, aún están presentes en cantidades más pequeñas. En el
ecosistema y los niveles de la biosfera, es un continuo reciclaje de todos estos elementos,
que se alternan entre los estados minerales y orgánicos.
Aunque hay una ligera entrada de la energía geotérmica, la mayor parte del
funcionamiento de los ecosistemas se basa en la aporte de la energía solar. Las plantas y
los microorganismos fotosintéticos convierten la luz en energía química mediante el
proceso de fotosíntesis, lo que crea la glucosa (un azúcar simple) y libera oxígeno libre. La
glucosa se convierte así en la segunda fuente de energía que impulsa el ecosistema. Parte
de esta glucosa se utiliza directamente por otros organismos para la energía. Otras
moléculas de azúcar pueden ser convertidas en otras moléculas como los aminoácidos.
Las plantas usan alguna de estos azúcares, concentrado en el néctar, para atraer a los
polinizadores para la ayuda en la reproducción.
La respiración celular es el proceso mediante el cual los organismos (como los mamíferos)
rompen de glucosa hacia abajo en sus mandantes, el agua y el dióxido de carbono, por lo
tanto, recuperar la energía almacenada originalmente dio el sol a las plantas. La
proporción de la actividad fotosintética de las plantas y otros fotosintetizadores a la
respiración de otros organismos determina la composición de la atmósfera de la Tierra, en
particular su nivel de oxígeno. Las corrientes de aire globales unen la atmósfera
mantieniendo casi el mismo equilibrio de los elementos en áreas de intensa actividad
biológica y las áreas de la actividad biológica ligera.
El agua es también intercambiada entre la hidrosfera, la litosfera, la atmósfera, la biosfera
y en ciclos regulares. Los océanos son grandes depósitos que almacenan el agua, aseguran
la estabilidad térmica y climática, y facilitan el transporte de elementos químicos gracias a
las grandes corrientes oceánicas.
Para una mejor comprensión de cómo funciona la biosfera, y las diversas disfunciones
relacionadas con la actividad humana, científicos Americanos trataron de simular la
biosfera en un modelo en pequeña escala, llamado Biosfera 2.
Ecosistema[editar]
Artículo principal: Ecosistema
El Daintree Rainforest de Queensland, Australia es un ejemplo de un ecosistema forestal
tropical.
Un principio central de la ecología es que cada organismo vivo tiene una relación
permanente y continua con todos los demás elementos que componen su entorno. La
suma total de la interacción de los organismos vivos (la biocenosis) y su medio no viviente
(biotopo) en una zona que se denomina un ecosistema. Los estudios de los ecosistemas
por lo general se centran en la circulación de la energía y la materia a través del sistema.
Casi todos los ecosistemas funcionan con energía del sol capturada por los productores
primarios a través de la fotosíntesis. Esta energía fluye a través de la cadena alimentaria a
los consumidores primarios (herbívoros que comen y digieren las plantas), y los
consumidores secundarios y terciaria (ya sea omnívoros o carnívoros). La energía se
pierde a los organismos vivos cuando se utiliza por los organismos para hacer el trabajo, o
se pierde como calor residual.
La materia es incorporada a los organismos vivos por los productores primarios. Las
plantas fotosintetizadoras fijan el carbono a partir del dióxido de carbono y del nitrógeno
de la atmósfera o nitratos presentes en el suelo para producir aminoácidos. Gran parte de
los contenidos de carbono y nitrógeno en los ecosistemas es creado por las instalaciones
de ese tipo, y luego se consume por los consumidores secundarios y terciarios y se
incorporan en sí mismos. Los nutrientes son generalmente devueltos a los ecosistemas a
través de la descomposición. Todo el movimiento de los productos químicos en un
ecosistema que se denomina un ciclo biogeoquímico, e incluye el ciclo del carbono y
del nitrógeno.
Los ecosistemas de cualquier tamaño se pueden estudiar, por ejemplo, una roca y la vida
de las plantas que crecen en ella puede ser considerado un ecosistema. Esta roca puede
estar dentro de un llano, con muchas de estas rocas, hierbas pequeñas, y animales que
pastorean - también un ecosistema-. Este puede ser simple en la tundra, que también es
un ecosistema (aunque una vez que son de este tamaño, por lo general se
denomina ecozonas o biomas). De hecho, toda la superficie terrestre de la Tierra, toda la
materia que lo compone, el aire que está directamente encima de éste, y todos los
organismos vivos que viven dentro de ella puede ser considerados como una solo, gran
ecosistema.
Los ecosistemas se pueden dividir en los ecosistemas terrestres (incluidos los ecosistemas
de bosques, estepas, sabanas, etc), los ecosistemas de agua
dulce (lagos, estanques y ríos), y los ecosistemas marinos, en función
del biotopo dominante.
Relaciones espaciales y subdivisiones de la Tierra[editar]
Artículos principales: Bioma y Ecozona.

Montículos de termitas con chimeneas de diferentes alturas para regular el intercambio


de gases, temperatura y otros parámetros ambientales necesarios para mantener la
fisiología de toda la colonia.3
Los ecosistemas no están aislados unos de otros sino interrelacionadas; por ejemplo, el
agua puede circular entre los ecosistemas por medio de un río o corriente oceánica. El
agua en sí, como un medio líquido, incluso define los ecosistemas. Algunas especies, como
el salmón o la anguila de agua dulce se mueven entre los sistemas marinos y de agua
dulce. Estas relaciones entre los ecosistemas conducen a la idea de "bioma". Un bioma es
una formación homogénea ecológica que existe en una amplia región, como la tundra y
las estepas. La biosfera comprende la totalidad de los biomas de la Tierra - la totalidad de
los lugares donde la vida es posible - desde las montañas más altas a las profundidades
oceánicas.
Los biomas están bastante bien distribuidos a lo largo de las subdivisiones a las latitudes,
desde el ecuador hacia los polos, con las diferencias basadas en el entorno físico (por
ejemplo, los océanos o cordilleras) y el clima. Su variación está generalmente relacionada
con la distribución de las especies de acuerdo a su capacidad para tolerar la temperatura,
la sequedad, o ambos. Por ejemplo, se pueden encontrar algas fotosintéticas solo en la
parte luminosa de los océanos (donde penetra la luz), mientras que las coníferas se
encuentran principalmente en las montañas.
Aunque esta es una simplificación de un sistema más complicado, la latitud y la altitud
representan de manera adecuada la distribución de la diversidad biológica dentro de la
biosfera. En general, la riqueza de la diversidad biológica (así como de los animales como
para las especies de plantas) está disminuyendo más rápidamente cerca del ecuador y
más lentamente a medida que nos aproximamos a los polos.
La biosfera también puede ser dividida en ecozonas, que están muy bien definidas y sobre
todo hoy en día sigue las fronteras continentales. Las zonas ecológicas son divididas en
las ecorregiones, aunque no hay acuerdo sobre sus límites.
Disciplinas de la ecología[editar]

Anuncio sobre el cuidado de las plantas, Toluca.


Como disciplina científica en donde intervienen diferentes caracteres la ecología no puede
dictar qué es "bueno" o "malo". Aun así, se puede considerar que el mantenimiento de
la biodiversidad y sus objetivos relacionados han provisto la base científica para expresar
los objetivos del ecologismo y, asimismo, le ha provisto la metodología y terminología
para expresar los problemas ambientales.
La economía y la ecología comparten formalismo en muchas de sus áreas; algunas
herramientas utilizadas en esta disciplina, como tablas de vida y teoría de juegos, tuvieron
su origen en la economía. La disciplina que integra ambas ciencias es la economía
ecológica.
 La aerobiología es una ciencia multidisciplinar en la que se incluyen los procesos
ecológicos relacionados con las partículas biológicas transportadas pasivamente a
través del aire.
 La ecología microbiana es la rama de la ecología que estudia a
los microorganismos en su ambiente natural, los cuales mantienen una actividad
continua imprescindible para la vida en la Tierra. En los últimos años se han
logrado numerosos avances en esta disciplina con las técnicas disponibles
de biología molecular. Los mecanismos que mantienen la diversidad microbiana de
la biosfera son la base de la dinámica de los ecosistemas terrestres, acuáticos y
aéreos. Es decir, la base de la existencia de las selvas y de los sistemas agrícolas,
entre otros. Por otra parte, la diversidad microbiana del suelo es la causa de
la fertilidad del mismo.
 La biogeografía: es la ciencia que estudia la distribución de los seres vivos sobre la
Tierra, así como los procesos que la han originado, que la modifican y que la
pueden hacer desaparecer. Es una ciencia interdisciplinaria, de manera que
aunque formalmente es una rama de la geografía, recibiendo parte de sus
fundamentos de especialidades como la climatología y otras ciencias de la Tierra,
es a la vez parte de la biología. La superficie de la Tierra no es uniforme, ni en toda
ella existen las mismas características. El espacio isotrópico que utilizan, o
suponen, los esquemas teóricos de localización es tan solo una construcción
matemática del espacio.
 La ecología matemática se dedica a la aplicación de los teoremas y métodos
matemáticos a los problemas de la relación de los seres vivos con su medio y es,
por tanto, una rama de la biología. Esta disciplina provee de la base formal para la
enunciación de gran parte de la ecología teórica
 La ecología urbana es una disciplina cuyo objeto de estudio son las interrelaciones
entre los habitantes de una aglomeración urbana y sus múltiples interacciones con
el ambiente.
 La ecología de la recreación es el estudio científico de las relaciones ecológicas
entre el ser humano y la naturaleza dentro de un contexto recreativo.
 La ecología del paisaje es una disciplina a caballo entre la geografía física y la
biología. Estudia los paisajes naturales prestando especial atención a los grupos
humanos como agentes transformadores de la dinámica físico-ecológica de estos.
Ha recibido aportes tanto de la geografía física como de la biología: la geografía
aporta las visiones estructurales del paisaje (el estudio de la estructura horizontal o
del mosaico de subecosistemas que conforman el paisaje), mientras que la biología
aporta la visión funcional del paisaje (las relaciones verticales de materia y
energía). Este concepto comienza en 1898, con el geógrafo, padre de la pedología
rusa, Vasily Vasilievich Dokuchaev y fue más tarde continuado por el geógrafo
alemán Carl Troll. Es una disciplina muy relacionada con otras áreas como
la geoquímica, la geobotánica, las ciencias forestales o la pedología.
 La limnología es la rama de la ecología que se centra en el estudio de los sistemas
acuáticos continentales: ríos, lagos, lagunas, etcétera.
 La dendroecología se centra en el estudio de la ecología de los árboles.
 La ecología regional es una disciplina que estudia los procesos ecosistémicos como
el flujo de energía, el ciclo de la materia o la producción de gases de invernadero a
escala de paisaje regional o bioma. Considera que existen grandes regiones que
funcionan como un único ecosistema.
 La agronomía, pesquería y, en general, toda disciplina que tenga relación con la
explotación o conservación de recursos naturales, en especial seres vivos, pueden
interpretarse como ecología aplicada. Es decir, tienen la misma relación con la
ecología que gran parte de las ingenierías con la matemática, la física o la química.
Otras disciplinas[editar]
 Biología de la conservación
 Derecho ambiental
 Ecología de comunidades
 Ecología de la recreación
 Ecología de poblaciones
 Ecología evolutiva
 Ecología del comportamiento
 Etoecología
 Ecología humana
 Ecología reproductiva
 Ecología social
 Ecología cultural
Ecólogos célebres[editar]
 Margalef, Ramón
…………………………………………………………………………
DEFINICIÓN DE ECOLOGÍA
La ecología es la especialidad científica centrada en el estudio y análisis del vínculo que
surge entre los seres vivos y el entorno que los rodea, entendido como la combinación de
los factores abióticos (entre los cuales se puede mencionar al clima y a la geología) y
los factores bióticos(organismos que comparten el hábitat). La ecología analiza también la
distribución y la cantidad de organismos vivos como resultado de la citada relación.

Cabe destacar que Ökologie es un concepto que data de fines de la década de 1860 y fue
acuñado por el biólogo y filósofo de origen alemán Ernst Haeckel. Esta palabra está
compuesta por dos vocablos griegos: oikos (que significa “casa”, “residencia” u “hogar”)
y logos (término que, traducido al español, se entiende como “estudio”). Por eso, la
ecología se define con precisión como “el estudio de los hogares”.
Pese a que el origen del término es dudoso, se reconoce al investigador Haeckel como
uno de sus creadores, quien al comenzar a desarrollar sus experimentos, Haeckel, quien la
definía como aquella rama de la ciencia que gira en torno a la interacción de todo ser vivo
con la superficie que lo rodea. Sin embargo, con el tiempo extendió el concepto hasta
abarcar el análisis de las propiedades del medio, incluyendo el desplazamiento de
materia y energía y su evolución a raíz de la presencia de conjuntos biológicos.
En la actualidad y desde hace varios años, la ecología se encuentra muy relacionada con
un heterogéneo movimiento político y social, que intenta actuar en defensa del medio
ambiente. Los ecologistas realizan distintas denuncias sociales, proponen la necesidad de
reformas legales y promueven la concienciación social para alcanzar su objetivo principal,
que es la conservación de la salud del hombre sin dañar ni alterar el equilibrio de los
ecosistemas naturales.
Por eso, la causa ecologista (también conocida como movimiento verde o ambientalista)
se centra en tres grandes cuestiones de alcance universal: la preservación y regeneración
de recursos naturales; la protección de la vida salvaje y la reducción del nivel de
contaminación generado por la humanidad.
Un elemento fundamental de la ecología es la homeostasis que consiste en que todas las
especies que habitan en un entorno natural equilibrado tienden a autoregularse y
permanecer más o menos constante en número de habitantes, de este modo el medio
ambiente se asegura una distribución equitativa de los recursos y nunca se sufre carencia
de estos. En un entorno que ha sido modificado por la mano del hombre la homeostasis es
más difícil de encontrar, y por esta razón se producen los desequilibrios naturales.
Actualmente se considera que la ecología es una rama de las ciencias biológicas, y es la
encargada de estudiar las interacciones entre los organismos vivos y el entorno natural en
el que habitan. Es una ciencia multidisciplinaria que para desarrollarse como tal necesita
de otras ciencias para comprender la totalidad del estudio del medio ambiente. Entre
estas otras ciencias se encuentran la climatología, la biología, la ética y la ingeniería
química.

Todos los procesos bióticos se caracterizan


por la transferencia de energía por eso pueden ser estudiados por la física y
comprendidos dentro de sus leyes naturales; de los procesos metabólicos y fisiológicos de
los subsistemas se ocupa la química porque dependen de reacciones químicas.
La estructura de los biomas es estudiada por la geologíaporque está íntimamente
relacionada con la estructura geológica del sueño y los seres vivos al interaccionar con el
medio pueden modificar su geología. En lo que respecta a cálculos, estadísticas y
proyecciones para elaborar conclusiones a partir de una información específica y
numérica, las encargadas de estudiarlos son las matemáticas. Para realizar el estudio de
cada aspecto de la vida en un ecosistema, la ecología se sirve de las otras ciencias, por
esta razón se dice que es multidisciplinaria.
Para estudiar los ecosistemas la ecología establece diferentes niveles de organización, los
cuales son: ser (toda cosa que existe, viva o inerte), individuo(cualquier ser vivo sea cual
sea su especie), especie (grupo de individuos que comparten genoma, con características
fenotípicas), población (individuos de una especie que comparten
hábitat), comunidad(conjunto de poblaciones que comparten
hábitat), ecosistema(combinación e interacción entre factores bióticos y abióticos en la
naturaleza), bioma (comunidades de vegetales que comparten un área geográfica)
y biósfera (conjunto de ecosistemas que forman parte del planeta. Es una unidad
ecológica que hace referencia a toda la parte habitada del planeta).
Los científicos que investigan y elaboran teorías sobre ecología son
denominados ecólogos. Existen dos ramas de la ecología que son
la autoecología (especies individuales y sus múltiples relaciones con el medio ambiente) y
la sinecología (comunidades y sus relaciones con el medio ambiente). A su vez, de
acuerdo a lo que los ecólogos investiguen colaboran con un tipo de ecología determinada,
tales como:
La ecología del comportamiento es la que se encarga de estudiar las técnicas de
recolección de los alimentos, las adaptaciones ante la depredación o catástrofes naturales
y las relaciones de reproducción.
La ecología de poblaciones es la encargada de estudiar los procesos que tienen que ver
con la homeostasis, la distribución y abundancia de las poblaciones, tanto animales como
vegetales. Las fluctuaciones en el número de individuos de cada especie, las relaciones
depredador-presa y la genética de las poblaciones.
La ecología de comunidades es la encargada de estudiar el funcionamiento y las formas
de organizarse de una comunidad, formadas por poblaciones interactuantes. Estos
ecólogos investigan sobre los rangos de las especies, las razones que hacen que unas sean
más numerosas que otras y los factores que afectan a la estabilidad de la comunidad.
La paleoecología, por su parte, es un área importante que estudia los organismos fósiles.
A partir del estudio de las especies del pasado se pueden comprender las técnicas de
recolección, reproducción y demás que poseen organismos actuales.

Cadena
epistemologica
Cadena alimentaria
La cadena alimentaria o cadena trófica muestra como pasa la materia y energía de un ser vivo a
otro. Nos enseña las relaciones alimenticias entre los seres vivos, o dicho de un modo más
sencillo: que animal se come a quién. Todo ser vivo se alimenta del que le precede en la cadena, y
este a su vez será comido por otro.

Los seres vivos que forman esta cadena se organizan en 3 grupos:

 Los productores: son las plantas, ya que son capaces de fabricar su propio alimento a
partir de sustancias muy simples y la energía del Sol.

 Los consumidores de primer orden: son los seres vivos que se alimentan de las plantas.
Este lugar lo ocupan los animales herbívoros.
 Los consumidores de segundo orden: son los seres vivos que se alimentan de otros
animales. Los animales carnívoros ocupan este eslabón de la cadena alimenticia.

 Los descomponedores: se alimentan de restos de otros seres vivos, los descomponen y


hacen que los restos pasen a formar parte del suelo. Pertenecen a este eslabón los hongos
y algunos seres microscópicos.

Para representar como funciona esta cadena alimenticia se suele utilizar la llamada pirámide
trófica. Se trata de un dibujo geométrico donde aparecen los diferentes niveles siguiendo un
orden de mayor a menor. En la parte superior aparecen los consumidores terciarios, los
depredadores, mientras que en la zona inferior aparecen los productores:
…………………………………………………………………………………………

Historia de ls enfermedad
Se le llama historia natural de una enfermedad al curso de acontecimientos que ocurren en el
organismo humano desde que se produce la acción secuencial de las causas componentes
(etiología) hasta que se desarrolla la enfermedad y posteriormente ocurre su desenlace (curación,
estado crónico o muerte).30 jun. 2009

…………………………………………………..

La historia natural de la enfermedad es la evolución de un proceso patológico sin intervención


médica. Representa el curso de acontecimientos biológicos entre la acción secuencial de las causas
componentes (etiología) hasta que se desarrolla la enfermedad y ocurre el desenlace (curación,
paso a cronicidad o muerte).1

El interés que tiene la medicina por conocer la evolución natural de cada enfermedad es descubrir
las diferentes etapas y componentes del proceso patológico, para intervenir lo más temprano
posible y cambiar el curso de la enfermedad, con el objetivo de evitar el deterioro de la salud.2

Hay dos perspectivas complementarias para caracterizar la historia natural de la enfermedad: la


del médico de cabecera, que mediante la historia clínica registra todo el proceso de cada paciente,
y puede determinar tanto que hay un nuevo problema de salud, como sus peculiaridades; es
una visión individualizada. La del epidemiólogo, que mediante los múltiples registros sanitarios
que maneja, y el apoyo de la bioestadística puede descubrir una nueva enfermedad y su
evolución; es una visión poblacional.

Anatomía del corazón (1890) de Enrique Simonet.

Índice

 1Etapas de las enfermedades

o 1.1Período prepatogénico

o 1.2Período patogénico

 1.2.1Período de incubación o de latencia

 1.2.2Período clínico
 2Tipos de prevención

o 2.1Prevención primaria

o 2.2Prevención secundaria

o 2.3Prevención terciaria

o 2.4Prevención cuaternaria

 3Véase también

 4Referencias

 5Bibliografía

Etapas de las enfermedades[editar]

Artículo principal: Etapas de la enfermedad

Período prepatogénico[editar]

Artículo principal: Período prepatogénico

En esta fase se inicia la enfermedad, pero el ser vivo no presenta manifestaciones clínicas, ni
cambios celulares, tisulares u orgánicos. Está conformado por las condiciones del huésped, el
agente y el medio ambiente.

Período patogénico[editar]

Es la etapa en la que hay cambios celulares, tisulares u orgánicos, pero el paciente aún no percibe
síntomas o signos de enfermedad, es una fase subclínica.

Se subdivide en dos etapas:

Período de incubación o de latencia[editar]

Artículo principal: Periodo de incubación

Artículo principal: Período de latencia

En las enfermedades transmisibles se habla de Período de incubación, ya que los microorganismos


se están multiplicando y produciendo toxinas, es de rápida evolución, puede durar horas o días
(ejemplo: gripe).

Sin embargo, en las enfermedades de tipo degenerativo se habla de Período de latencia, por su
lenta evolución, que puede durar meses o años, o enfermedades crónicas (ejemplo: artrosis,
demencia senil, etc.)

Período clínico[editar]

Artículo principal: Cuadro clínico


"Christian Bindslev está enfermo" (1889) óleo de Viggo Johansen.

Es cuando el ser vivo presenta síntomas o signos clínicos. Es decir, cuando se manifiesta
clínicamente la enfermedad, y el afectado demanda ayuda sanitaria. Pero si el proceso patológico
siguiera evolucionando de manera espontánea, sin intervención médica, tendría un desenlace que
podría ser la curación, la incapacidad (secuelas) o la muerte. A su vez tiene 3 períodos:

1. Prodrómico: aparecen los primeros signos o síntomas, que indica el inicio clínico de una
enfermedad.34

2. Clínico: aparecen los síntomas y signos específicos, lo que permite determinar la patología
que afecta al huésped y a su vez el tratamiento a aplicar para curar al paciente y evitar
secuelas.

3. De resolución: es la etapa final. La enfermedad desaparece, se vuelve crónica o el paciente


fallece.

Tipos de prevención[editar]

Artículo principal: Medicina preventiva

La medicina ha desarrollado diferentes actuaciones sanitarias para diagnosticar, prevenir, tratar y


rehabilitar el curso natural de las enfermedades, cambiando artificialmente su evolución con el
objetivo de curar, mitigar las secuelas, e intentar evitar la muerte del paciente.

Visión del médico

Tipos de prevención5 Enfermedad

ausente presente

Prevención primaria Prevención secundaria


ausente (enfermar ausente (enfermar ausente
Visión enfermedad ausente) enfermedad presente)
del Enfermar
paciente Prevención cuaternaria Prevención terciaria
presente (enfermar presente (enfermar presente
enfermedad ausente) enfermedad presente)
Prevención primaria[editar]

Artículo principal: Prevención primaria

Son un conjunto de actividades sanitarias que se realizan tanto por la comunidad o los gobiernos
como por el personal sanitario antes de que aparezca una determinada enfermedad. Comprende:

1. La promoción de la salud, que es el fomento y defensa de la salud de


la población mediante acciones que inciden sobre los individuos de una comunidad, como
por ejemplo las campañas antitabaco para prevenir el cáncer de pulmón y otras
enfermedades asociadas al tabaco.

2. La protección específica de la salud como por ejemplo la sanidad ambiental y la higiene


alimentaria. Las actividades de promoción y protección de la salud que inciden sobre
el medio ambiente no las ejecuta el personal médico ni de enfermería, sino otros
profesionales de la salud pública, mientras que la vacunación sí son llevadas a cabo por
personal médico y de enfermería.

3. La quimioprofilaxis, que consiste en la administración de fármacos para prevenir


enfermedades como por ejemplo la administración de estrógenos en mujeres
menopáusicas para prevenir la osteoporosis.

Según la OMS, uno de los instrumentos de la promoción de la salud y de la acción preventiva es


la educación para la salud, que aborda además de la transmisión de la información, el fomento de
la motivación, las habilidades personales y la autoestima, necesarias para adoptar medidas
destinadas a mejorar la salud. La educación para la salud incluye no sólo la información relativa a
las condiciones sociales, económicas y ambientales subyacentes que influyen en la salud, sino
también la que se refiere a los factores y comportamientos de riesgo, además del uso del sistema
de asistencia sanitario.

Prevención secundaria[editar]

Artículo principal: Prevención secundaria

También se denomina diagnóstico precoz, cribado, o screening. Un programa de detección precoz


es un programa epidemiológico de aplicación sistemática o universal, para detectar en una
población determinada y asintomática, una enfermedad grave en fase inicial o precoz, con el
objetivo de disminuir la tasa de mortalidady puede estar asociada a un tratamiento eficaz o
curativo.

La prevención secundaria se basa en los cribados poblacionales y para aplicar estos han de darse
unas condiciones predeterminadas definidas en 1975 por Frame y Carslon para justificar
el screening de una patología.

1. Que la enfermedad represente un problema de salud importante con un marcado efecto


en la calidad y duración del tiempo de vida.

2. Que la enfermedad tenga una etapa inicial asintomática prolongada y se conozca su


historia natural.
3. Que se disponga de un tratamiento eficaz y aceptado por la población en caso de
encontrar la enfermedad en estado inicial.

4. Que se disponga de una prueba de cribado rápida, segura, fácil de realizar, con
alta sensibilidad, especificidad, alto valor predictivo positivo, y bien aceptada por médicos
y pacientes.

5. Que la prueba de cribado tenga una buena relación coste-efectividad.

6. Que la detección precoz de la enfermedad y su tratamiento en el periodo asintomático


disminuya la morbilidad y mortalidad global o cada una de ellas por separado.

Prevención terciaria[editar]

"Goya atendido por Arrieta" (1820) óleo de Francisco de Goya.

Artículo principal: Prevención terciaria

Es el restablecimiento de la salud una vez que ha aparecido la enfermedad. Es aplicar un


tratamiento para intentar curar o paliar una enfermedad o unos síntomas determinados. El
restablecimiento de la salud se realiza tanto en atención primaria como en atención hospitalaria.

También se encuentra dentro de Prevención terciaria cuando un individuo, con base en las
experiencias, por haber sufrido anteriormente una enfermedad o contagio, evita las causas
iniciales de aquella enfermedad, en otras palabras evita un nuevo contagio basado en las
experiencias previamente adquiridas.

Prevención cuaternaria[editar]

Artículo principal: Prevención cuaternaria


La prevención cuaternaria es el conjunto de actividades sanitarias que atenúan o evitan las
consecuencias de las intervenciones innecesarias o excesivas del sistema sanitario.

Son «las acciones que se toman para identificar a los pacientes en riesgo de sobretratamiento,
para protegerlos de nuevas intervenciones médicas y para sugerirles alternativas éticamente
aceptables». Concepto acuñado por el médico general belga Marc Jamoulle y recogido en
el Diccionario de medicina general y de familia de la WONCA.

…Historia natural de la enfermedad

Enviado por ISABEL castillo

1. Introducción

2. Describe la historia natural de la enfermedad

3. Identificar los factores que afectan la salud y su influencia en los individuos y en la


comunidad

4. Describe la estructura de los Servicios Públicos en el país y el Sistema Público Nacional


de la Salud

5. Conclusión

6. Bibliografía

Introducción

En el presente trabajo se analizará la definición de Historia Natural de la Enfermedad tomando en


cuenta los elementos que integran la tríada ecológica, Modelo Biomédico, Perspectivas Evolutivas,
Clasificación, Noción De Riesgo, los factores que afectan la salud y su influencia en los individuos y
en la comunidad, servicios públicos en el país y el sistema público nacional de la salud.

Es de gran importancia aportar que Cualquier enfermedad del hombre es el resultado de


un proceso dinámica en donde diferentes elementos ambientales y característicos propios del
hombre entran en interacción y concluyen con la ruptura del equilibrio llamado homeostasis. La
enfermedad responde al fenómeno de adaptación ecológica del organismo humano y a las
condiciones sociales y económicas que facilitan o dificultan el proceso adaptativo.

No existe además un límite preciso entre salud y enfermedad, ya que ciertos eventos fisiológicos o
patológicos suceden silenciosamente durante periodos de latencia más o menos prolongados
durante los cuales el ser humano puede funcionar saludablemente dentro de su sociedad.

Uno de los principales objetivos de la salud pública es conocer, a través de observaciones y


de investigaciones bien diseñadas, cada una de las diferentes etapas o componentes de ese
proceso con el propósito de intervenir lo más tempranamente posible y evitar que el deterioro de
la salud siga su curso.

Toda esa red de interacciones ecológicas y humanas que concluyen finalmente con
manifestaciones clínicas, incapacidad o muerte es lo que se conoce como la historia natural de
las enfermedades.

Describe la historia natural de la enfermedad

HISTORIA NATURAL DE LA ENFERMEDAD

Son los acontecimientos que ocurren en el organismo humano, desde las causas componente
hasta que se desarrolla la enfermedad y ocurre el desenlace. Es cómo evoluciona la enfermedad
sin intervención médica, mientras que el curso clínico es el que describe la enfermedad que se
encuentra bajo atención medica.

Es la evolución natural de cualquier proceso patológico, desde su inicio hasta su resolución, sin
que intervenga la mano del hombre. El hombre forma parte del proceso salud-enfermedad y sus
periodos como lo es el primero, el ¨Periodo Prepatogenico¨ el cual corresponde al tiempo en
que las personas están sanas, es decir, se encuentra en equilibrio con su ambiente. El hombre se
interrelaciona con el medio ambiente y sus determinados factores: Ambientales, Conductuales y
Endógenos, los cuales favorecen o determinan el desarrollo de la enfermedad. El proceso de
Salud-Enfermedad en el hombre depende de las características de los tres elementos de la triada
con la cual tiene interacción constante. Su segundo periodo es El periodo patogénico inicia
con: Signos y síntomas inespecíficos. Esta caracterizado por la respuesta orgánica del huésped
ante el agente y el huésped se realiza inicialmente en un plano subclínico (por abajo del horizonte
clínico), y posteriormente se manifiesta por síntomas y signos.

TRIADA ECOLÓGICA DE LA HISTORIA NATURAL DE LA ENFERMERÍA

El pasaje de un estado a otro, se debe a la ruptura del equilibrio existente entre los tres elementos
responsables del estado de salud, que componen la triada ecológica:

 Agente: Es el factor que proveniente del ambiente o del propio individuo, por alteración,
presencia o ausencia, se constituye en responsable de la presentación de la enfermedad.

 Huésped: Así se denomina al individuo que aloja al agente y que por sus características
biológicas, facilita el desarrollo de la enfermedad.

 Ambiente: Es el conjunto de factores físicos, biológicos y socioculturales que intervienen


en el proceso Salud Enfermedad.

El Estado de salud, o sea, el equilibrio dinámico entre Agente-Huésped-Ambiente, se representa a


través de la imagen de una balanza. La interdependencia entre el agente, el huésped y el
ambiente, permite que cualquier modificación en alguno de ellos implique la modificación de los
restantes. En el Proceso Salud enfermedad, se habla de un conjunto de factores causales, de
fenómenos, de problemas, que se interconectan, y a veces potencian, constituyendo la
multicausalidad de la enfermedad.

MODELO BIOMÉDICO DE LA HISTORIA NATURAL DE LA ENFERMEDAD


 El modelo biomédico es el único que se acepta como explicación al proceso salud-
enfermedad. El cuidado se centra en personas enfermas.

 Se trata a los enfermos como personas dependientes y pasivas.

 Existen enfermos buenos y malos.

 Se considera el sufrimiento como algo que no hay que evitar.

 Los únicos cuidados son para la curación o el diagnóstico.

 Los médicos de los hospitales valoran las actividades que tiene que ver con la satisfacción
de las necesidades vitales (higiene, confort...) Las que no los valoran son las enfermeras.
Ellas valoran la maestría en la técnica (tratamiento médico) Cuanto más técnica sea la
enfermera más reconocida o valorada será.

 Aparecen las primeras enfermeras (en España a partir de los 40-50) con titulación,
auxiliares de médico. Tienen vocación de servir al enfermo, servir al médico y a la
institución. Están cumpliendo una misión que requiere conocimientos médicos y vocación.

 La enfermera es un agente de información para el equipo médico y el de gestión del


hospital, también es un agente de ejecución..

 A partir de mediados de 1940 (1980 en España) aparecen nuevas enseñanzas relacionadas


con el comportamiento humano. Las enfermeras empiezan a plantearse los cuidados y el
dar cuidados psicológicos a la persona. Ya no se habla de paciente sino de cliente.

 Se empieza a hablar de la planificación de los cuidados siguiendo un método determinado


y empieza a florecer la idea de los cuidados centrados en la persona y no en la
enfermedad.

 Empiezan a aparecer libros escritos por profesionales enfermeras. Se asume


la responsabilidad de la persona cuidada de manera que cada enfermera se encarga
siempre de los cuidados de las mismas personas.

 En la mayoría de casos la enseñanza se inicia en las Universidades. La formación recae en


enfermeras. En España la enfermería llega al ámbito universitario en 1977.

PERSPECTIVA EVOLUTIVAS DE LA HISTORIA NATURAL DE LA ENFERMEDAD

Hay dos perspectivas complementarias:

 A. la del médico de cabecera, que mediante la historia clínica registra todo el proceso de
cada paciente, y puede determinar tanto que hay un nuevo problema de salud, como sus
peculiaridades; es una visión individualizada.

 B. La del epidemiólogo, que mediante los múltiples registros sanitarios que maneja, y el
apoyo de la bioestadística puede descubrir una nueva enfermedad y su evolución; es una
visión poblacional.

CLASIFICACIÓN DE LA HISTORIA NATURAL DE LA ENFERMEDAD


La clasificación de las enfermedades como entidades nosológicas son gobernadas por la nosotaxia,
una disciplina dependiente de la nosología. Las clasificaciones son variadas y dependen de los
criterios que se toman en cuenta.

La clasificación de las enfermedades expresa el resultado de una inmensa cantidad de


observaciones, de un intento de imprimirles orden y de una pretensión de que dicho orden no
procede de una interpretación, sino de una correspondencia, un acercamiento al orden natural.

Se puede realizar atendiendo a distintos criterios:

 -Rapidez con la que aparecen y por su duración

Agudas: Se manifiestan rápidamente, pero son de corta duración ( por ejemplo la gripe)

Crónicas: se desarrollan con lentitud y duran mucho tiempo, en ocasiones toda la vida (por
ejemplo la artritis)

-Por la frecuencia:

 Esporádicas: solamente se producen algunos casos en la población (por ejemplo, los


derrames cerebrales)

 Endémicas: Exclusivas de una región concreta, donde se registran casos de manera


habitual (por ejemplo, el paludismo en las zonas tropicales)

 Epidémicas: Atacan a gran números de personas en un período corto de tiempo. Si la


epidemia afecta a muchos países, o incluso a todo el planeta, se denomina pandemia

 -Por su origen:

 Infecciosas: Son causadas por microorganismos patógenos

 No infecciosas: No son provocadas por microorganismos.

NOCIÓN DE RIESGO

Noción de Riesgo En cada sociedad existen comunidades, grupos de individuos, familias o


individuos que presentan más posibilidades que otros, de sufrir en un futuro
enfermedades, accidentes, muertes prematuras; se dice que son individuos o colectivos
especialmente vulnerables.

La vulnerabilidad se debe a la presencia de cierto número de características de tipo genético,


ambiental, biológicas, psicosociales, que actuando individualmente o entre sí desencadenan la
presencia de un proceso. Surge entonces, la noción de riesgo en medicina.

Riesgo: implica la presencia de una característica o factor (o de varios) que aumenta


la probabilidad de consecuencias adversas.

Factor de riesgo: Una característica o circunstancia detectable en individuos o en grupos de


individuos asociada con la probabilidad incrementada de experimentar un daño a la salud. Estos
factores de riesgo (biológicos, ambientales, de comportamiento, socio-culturales, económicos..)
pueden sumándose unos a otros, aumentar el efecto aislado de cada uno de ellos produciendo un
fenómeno de interacción.

Identificar los factores que afectan la salud y su influencia en los individuos y en la comunidad

FACTORES DETERMINANTES DE LA SALUD

Los factores que determinan la salud se Pueden dividir en las siguientes categorías:

 Comportamiento y estilo de vida personal.

 influencias dentro de las comunidades que pueden reforzar la salud o dañarla.

 Las condiciones de vida y de trabajo y el acceso a los servicios sanitarios.

 Las condiciones generales de tipo socioeconómico, cultural y medioambiental.

FACTORES BIOLÓGICOS

Las causas capaces de originar una enfermedad son muy numerosas, así como muy complejos los
mecanismos de acción que ejercen sobre el cuerpo. Existen causas exógenas; por ejemplo las
infecciones y las enfermedades parasitarias- y endógenas –que pueden aparecer por disfunción de
un órgano (por ejemplo del páncreas en la diabetes mellitus), por una reacción anormal (como
ocurre en la cirrosis hepática), o por un trastorno metabólico y funcional de las células (por
ejemplo en las neoplasias, esto es, tumores).

Los factores biológicos son inherentes a la fisiología del organismo y menos susceptibles de
modificación que los demás factores. En las sociedadesdesarrolladas, estos factores influyen de
forma muy relevante en la mortalidad de los niños menores de un año, pues, al estar muy
controladas las enfermedades infecciosas, las causas más frecuentes de mortalidad infantil son las
alteraciones congénitas y las hereditarias; pero a partir de cierta edad la importancia de estos
factores como causantes de enfermedades disminuye de forma importante.

FACTORES AMBIENTALES

El hombre no es un ser aislado, sino inmerso en un medio, y no puede vivir ajeno a él. Los factores
que afectan al entorno del hombre influyen también decisivamente en su salud. No sólo el
ambiente natural, sino también el seminatural y artificial que el hombre ha creado, pueden verse
alterados por distintos factores: físicos (temperatura, ruidos, radiaciones...), químicos
(contaminación por plaguicidas, metales pesados...), biológicos (presencia de bacterias, virus y
otros microorganismos patógenos) y psicológicos, sociales y culturales
(como drogadicción, estrés , etc.).

Se conocen numerosas causas no infecciosas de enfermedad, muchas de ellas ocupacionales. Por


ejemplo, la exposición prolongada al polvo del carbón predispone a los mineros a padecer una
enfermedad respiratoria denominada neumoconiosis, y de la misma forma, la exposición al
polvillo del algodónpredispone a las personan que lo manipulan a padecer bisinosis. En estos
casos, de nuevo, la exposición al polvo de la mina o al algodón no son la única causa de la
enfermedad. En ambas situaciones se sabe que los trabajadores que fuman presentan un riesgo
más elevado de padecer una alteración de la función respiratoria. Esto mismo es cierto en la
enfermedad pulmonar causada por la exposición al asbesto (asbestosis), un mineral (variedad del
amianto utilizado para fabricar tejidos y materiales incombustibles). Más recientemente, se ha
observado que la exposición ocupacional a finas partículas de polvo o a sustancias químicas
orgánicas produce alergias. Los científicos que se ocupan de las enfermedades profesionales están
estudiando la causa de que algunos trabajadores padezcan dificultades respiratorias
y crisis severas de estornudos, mientras que otros que trabajan en las mismas áreas no presentan
estos síntomas.

ESTILO DE VIDA

Cada día hay más evidencia científica de que los comportamientos y los hábitos de vida
condicionan no sólo la salud, sino la situación sanitaria de las poblaciones y los recursos a ellas
destinados. La conducta personal en determinados aspectos influye enormemente en el binomio
salud-enfermedad. Esta conducta se forma por decisiones personales y por influencias de nuestro
entorno y grupo social y puede modificarse con la adecuada educación.

En la década de 1970 se introdujo en el vocabulario médico un tipo nuevo de enfermedad llamada


"estilo de vida nocivo". Hoy en día se considera que fumar tabaco, beber alcohol en exceso, comer
demasiado o no hacer ejercicio, y/o vivir en un estado de estrés permanente son factores que
predisponen a la enfermedad. No son causas en el sentido tradicional. Por ejemplo, la relación
entre una alimentación basada en una dieta muy rica en grasas y el sufrir un infarto cardiaco, es
incluso más complicada que el proceso por el cual una infección produce síntomas.

ATENCIÓN SANITARIA

La asistencia sanitaria encaminada a diagnosticar y tratar a la persona individualmente, no tiene


demasiado efecto sobre la salud de la población. Sin embargo los programas de salud dirigidos a
un grupo social más amplio elevan el nivel de salud de la sociedad. Por ello debe ser amplia,
de calidad, ofrecer cobertura suficiente y accesibilidad desde todos los puntos de vista
(económico, de situación, etc.) a toda la sociedad.

Los recursos que un país destina a la salud, y los resultados de éstos, pueden medirse mediante
diversos indicadores (índices y valores numéricos), cuyo estudio y correcta interpretación es
fundamental para una adecuada política sanitaria. Describir el nivel de salud de una población
significa medir todos los aspectos que aporten información sobre cómo se distribuye el proceso
salud-enfermedad entre sus habitantes.

Existen una gran cantidad de indicadores. Los más utilizados son aquellos que indican falta de
salud de una población, como la mortalidad y morbilidad. Algunos indicadores sanitarios son: los
recursos financieros y humanos, el porcentaje de gasto dedicado a sanidad pública en relación con
el PIB (Producto Interior Bruto), el número de médicos u otros profesionales de la salud por
habitante, el número de camas hospitalarias por habitante, la accesibilidad y calidad de los
servicios sanitarios, demanda de atención primaria y atención especializada.etc. Son ejemplos de
indicadores de la salud de una población: la Morbilidad general y mortalidad global; Principales
causas de muerte; Tasa de mortalidad; Esperanza de vida y Esperanza de vida libre
de discapacidad; Indicadores de estilo de vida (tabaquismo y consumo de drogas legales e ilegales;
ejercicio físico y descanso...); Indicadores medioambientales (contaminación atmosférica y
acústica; control y distribución del agua y alimentos...); Indicadores socio demográficos, que
incluyen datos del crecimiento de la población, migraciones, envejecimiento, etc.

Describe la estructura de los Servicios Públicos en el país y el Sistema Público Nacional de la


Salud

SERVICIO DE SALUD EN VENEZUELA

Para nadie es un secreto que el sistema de salud público en Venezuela está colapsado. La
demanda de salud supera ampliamente la oferta. Un ejemplo de ello es la escasez de servicios
de radio y quimioterapia para los enfermos de cáncer en los oncológicos del país.

La escasez de la oferta de servicios de salud público ha originado una migración hacia el servicio de
salud privado. A este servicio solo pueden acceder aquellos que tengan un seguro o que puedan
pagar con sus propios recursos. Ahora bien, el servicio de salud privado, al menos en el centro del
país, también está experimentando problemas en la provisión del servicio de salud. Si bien, no
existen encuestas en cuanto a demora en la asignación de habitación una vez el paciente ingresa
por emergencias, entrega de exámenes, demora en la asistencia de emergencias, entre otros
problemas; es común escuchar que los exámenes se retrasan, que los pacientes tienen que
esperar muchas horas e incluso días para la asignación de una habitación, y obviamente ser
atendidos en emergencias.

Existe obviamente una falla en la provisión de la salud como bien público, sin embargo esta falla
no es la única causante de los problemas que experimenta el sector privado en la provisión de la
salud.

Sin embargo en Venezuela se está conformando un nuevo sistema de salud. Constituye uno de los
segmentos socioeconómicos de mayor incidencia social por su valor cuantitativo en el índice
de desarrollo humano. El sistema de salud venezolano se encuentra en avance, sin duda es el
resultado de las enormes inversiones públicas del Gobierno Nacional. La nueva visión del sistema
de salud venezolano se apoya en la Misión Barrio Adentro, uno de los programas sociales de
mayor trascendencia en la reciente historia nacional, si es medido por sus efectos territoriales en
salubridad masiva. Como todo lo que se hace con la movilización social.

SISTEMA DE SALUD Y ATENCIÓN SANITARIA DE LOS SERVICIOS DE SALUD EN VENEZUELA

Un sistema de asistencia sanitaria, sistema sanitario o sistema de salud es una organización y el


método por el cual se provee la asistencia sanitaria. Los sistemas sanitarios son producto de la
historia y de la cultura de las sociedades en que se desarrollan, y expresan los
valores predominantes en las mismas.

En Venezuela se está conformando un nuevo sistema de salud. Constituye uno de los segmentos
socioeconómicos de mayor incidencia social por su valor cuantitativo en el índice de desarrollo
humano. En Venezuela la red hospitalaria era muy deficiente, sin un mínimo de personal y
sin medios para tratar la mayoría de los males. El sistema de salud venezolano se encuentra en
avance, sin duda es el resultado de las enormes inversiones públicas del Gobierno Nacional.
La nueva visión del sistema de salud venezolano se apoya en la Misión Barrio Adentro, uno de los
programas sociales de mayor trascendencia en la reciente historia nacional, si es medido por sus
efectos territoriales en salubridad masiva. Como todo lo que se hace con la movilización social.

CARACTERÍSTICAS DE LOS SISTEMAS DE SALUD

En la práctica, estos sistemas varían ampliamente de un país a otro. La comparación de sistemas


es el enfoque de la política e investigación actual de la asistencia sanitaria, pero generalmente los
sistemas son comparados por la manera en que son financiados y manejados. Pueden ser
financiados y/o manejados por el sector público, por el sector privado, en forma mixta o por
entidades sin fines de lucro.

Un sistema sanitario está integrado por diversos sub-sistemas: el de administración de recursos


humanos, el financiero, el estructural, el político; donde intervienen causas demográficas,
socioeconómicas, científicas y éticas. Se busca que todos los sistemas de asistencia sanitaria o de
atención de salud pongan en práctica los principios de universalidad,
accesibilidad, solidaridad, ética, eficacia y eficiencia.

La atención primaria ayuda a prevenir la enfermedad y la muerte. En contraste con la atención


especializada, la primaria se asocia con una distribución más equitativa de la salud en las
poblaciones del mismo o de distinto país. Los sistemas nacionales de atención de la salud con una
fuerte infraestructura de atención primaria tienen poblaciones más saludables, menos
desigualdades relacionadas con la salud y menores costos generales para el cuidado de la salud.

NIVELES DE ATENCIÓN

¿Qué es un Nivel de Atención? Conjunto de Establecimientos de Salud con niveles de complejidad


necesaria para resolver con eficacia y eficiencia necesidades de salud de diferente magnitud y
severidad. Constituye una de las formas de Organización de los Servicios de Salud, en la cual se
relacionan con la magnitud y severidad de las necesidades de salud de la población.

Las Direcciones Municipales de Salud y Desarrollo Social son responsables de la gestión de los
servicios de salud. La red de establecimientos públicos de salud contempla diferentes niveles de
atención y se encuentra distribuida a lo largo de todo el país. Existen notorias insuficiencias en la
cobertura de los servicios de salud.

CLASIFICACIÓN DE LOS NIVELES DE ATENCIÓN

Nivel Primario de Atención: Los establecimientos destinados a la prestación de servicios de


atención integral de salud del subsector público deben ajustarse a las características que les
correspondan de acuerdo a la siguiente clasificación 15 Ambulatorios Rurales Tipo I y II, los cuales
prestan atención médica integral, general y familiar a nivel primario, excepto hospitalización y se
encuentran ubicados en poblaciones menores de 10.000 habitantes. Ambulatorios Urbanos Tipo I,
II y III, los cuales prestan atención médica integral, general, familiar y especializada, no disponen
de hospitalización y se encuentran ubicados en poblaciones de más de 10.000 habitantes. En la
práctica, la cobertura es precaria, la mayoría de las intervenciones de promoción de la salud,
participación comunitaria y prevención de enfermedades, se llevan a cabo por el profesional
médico en año social y por los Auxiliares de Medicina Simplificada, en los Ambulatorios Rurales I y
II, orientados al medio rural disperso y a poblaciones menores de 1.000 habitantes. En este nivel,
el personal de salud (auxiliares de enfermería y promotores sociales) llevan a cabo visitas
domiciliarias para promover la salud y mejorar los estilos de vida.

El modelo de atención a la salud en Venezuela, ha estado centrado en programas de salud


pública aislados, con visión fragmentada, centrada en lo asistencial, en desmedro de
las acciones integrales de prevención y promoción. Las coberturas de atención de los grupos
especiales (prenatal, infantil y preescolar), muestran serias deficiencias por estados y de forma
consolidada, ubicándose en 25.5%, 36.7% y 15.2% respectivamente para 1997.

Exceptuando la vacunación con B.C.G, que alcanzó una cobertura de 99.5% durante el 2000, las
coberturas de vacunas tradicionales (Trivalente bacteriana, Anti Polio y Trivalente viral), no
superaron los estándares internacionales de 95.%, reportándose ese año coberturas de 77.2%,
86.0% y 83.7% respectivamente. A partir de 2000 se incorporaron en el esquema oficial las
vacunas Anti Hepatitis B, Anti Haemophilus influenza y Anti malárica. Las coberturas para éstas
resultaron inferiores al 50%, debido, en parte, a retrasos en su llegada al país y en la distribución
nacional.

Nivel Secundario de Atención: Los establecimientos destinados a la prestación de servicios de


hospitalización del subsector público prestan atención médica integral de nivel primario,
secundario y terciario. Según su categoría se clasifican en Hospitales Tipo I, II, III y IV, de acuerdo a
diferentes características entre las que destacan: población a servir, número de camas y nivel de
complejidad.

Hospital Tipo I, se encuentran ubicados en poblaciones hasta de 20.000 habitantes, con un área de
influencia demográfica de hasta 60.000 habitantes. Tienen entre 20 y 50 camas y están
organizados para prestar los servicios de medicina, cirugía, pediatría y ginecología y obstetricia.

Hospital Tipo II, se encuentran ubicados en poblaciones mayores de 20.000 habitantes, con un
área de influencia demográfica de hasta 100.000 habitantes. Tienen entre 50 y 150 camas y están
organizados para prestar los servicios de mayor complejidad que el nivel previo.

Hospital Tipo III, se encuentran ubicados en poblaciones mayores de 60.000 habitantes, con un
área de influencia demográfica de hasta 400.000 habitantes. Tienen entre 150 y 300 camas y están
organizados para prestar los servicios de mayor complejidad que el nivel previo.

Hospital Tipo IV, se encuentran ubicados en poblaciones mayores de 100.000 habitantes, con un
área de influencia demográfica superior a los 1.000.000 habitantes. Tienen más de 300 camas y
están organizados para prestar los servicios de mayor complejidad que el nivel previo.

13 Los hospitales con mayor capacidad de resolución se encuentran en la ciudad capital y en las
capitales de los Estados. Los hospitales reflejan una baja utilización en el total de egresos y en el
porcentaje de ocupación de camas (53%). La capacidad de resolución de los hospitales es precaria,
las listas de espera para cirugías y atención ambulatoria son extensas y es frecuente la
carencia/insuficiencia de algunos insumos esenciales para la atención de las personas. Con la
finalidad de hacerle frente a esta problemática, se conformó una Comisión Nacional coordinadora
del abordaje de la problemática hospitalaria. Esta goza de relativa autonomía y de apoyo político y
financiero. Han identificado los principales problemas y han formulado proyectospara atenderlos
con soluciones en el corto, mediano y largo plazo. En el corto plazo se contrataron servicios
privados y se establecieron convenios con países amigos, lo que permitió aliviar las necesidades de
atención inmediatas que no podrían ser resueltas en la red oficial. Adicionalmente, se asignó una
partida extrapresupuestaria importante para el equipamiento y fortalecimiento de la
infraestructura en hospitales seleccionados y se formuló una propuesta de marco legal y
administrativo que permita el desarrollo de la autonomía de gestión.

La mayoría de los hospitales disponen de algún tipo de sistema computarizado de información


para la contabilidad de costos y recursos humanos, más no así para la gestión clínica y/o
administrativa.

Recientemente el MSDS ha iniciado el desarrollo de un sistema de información para la gestión de


hospitales, basado en el WINSIG/OPS. La propuesta consiste en el desarrollo de un módulo de
gestión de hospitales dentro del SISMAI que se viene promoviendo para los establecimientos
ambulatorios, de modo que en el mediano plazo se cuente con un sistema de información único.
Se inició el desarrollo de esta herramienta en cinco hospitales del Distrito Federal y cinco del
Estado Bolívar y se espera expandirla en todo el país al término de este año. No se registran en el
nivel central del MSDS las cinco causas más frecuentes de alta hospitalaria para las
principales redes de prestadores.

TERCER NIVEL DE ATENCION Este nivel se ubica a nivel del ámbito nacional y constituye el centro
de referencia de mayor complejidad nacional y regional. Aquí laboran especialistas para la
atención de problemas patológicos complejos, que necesitan equipo e instalaciones especiales. En
este nivel su categoría de los cuidados tienen el propósito de ayudar a los usuarios a conseguir un
grado de funcionamientos tan elevada como sea posible.

FUNCIONES DEL TERCER NIVEL Hospitales de Mayor COMPLEJIDAD

 Creación de Escuelas Saludables, Comunidad Saludable

 Fomento de Estilos de Vida Saludables

 Prevención de Riesgos y Daños

 Recuperación de la Salud

 Análisis de la Situación Local: Censo

MISIÓN BARRIO ADENTRO 1,2,3,4

Misión Barrio Adentro es un programa social promovido por el presidente de la


República Bolivariana de Venezuela, Hugo Chávez con ayuda del gobierno de Cuba, que se
caracteriza por la utilización de profesionales cubanos y venezolanos, para ofrecer servicios de
salud a la población venezolana en las zonas pobres del país (llamadas barrios), zonas inaccesibles
y que generalmente quedan lejos de los hospitales.

CLASIFICACIÓN

 Barrio Adentro I

 Consultorios Populares
 Puntos de consulta y clínicas odontológicas

 Ópticas Populares

 Barrio Adentro II

 Centros Médicos de Diagnóstico Integral (CDI)

 Salas de Rehabilitación Integral (SRI)

 Centros Médicos de Alta Tecnología (CAT)

 Barrio Adentro III

 Clínicas Populares

 Hospitales

 Barrio Adentro IV

 Centros de Investigación, como el Hospital Cardiológico Infantil.

El programa Barrio Adentro está integrado por tres niveles que conforman un sistema. El primero
de ellos es conocido como Barrio Adentro I, que consiste en consultorios populares ubicados en
zonas de alta concentración e intricadas. Donde prestan medicina general, pediatría, atención de
niños sanos, y adulto mayor, control prenatal, control post-natal, vacunación y odontología. Su
función es principalmente preventiva.

El segundo nivel de este sistema se llama Barrio Adentro II y comprende una red de clínicas
Populares, Centros de Diagnóstico Integral (CDI), Salas de Rehabilitación Integral (SRI) y Centro de
Alta Tecnología (CAT). Los CDI, prestan servicios de rayos X, ultrasonido diagnóstico,
endoscopia, electrocardiograma, Sistema Ultra Micro Analítico (SUMA), oftalmología clínica,
emergencia y anatomía patológica.

Las Salas de Rehabilitación hacen Electroterapia, Tracción cérvico-lumbar, Termoterapia,


Hidroterapia, Terapia Ocupacional, Medicina natural y tradicional, Terapia de Lenguaje y Foniatría
y Podología.

Existen CAT, donde realizan Resonancia Magnética Nuclear, Tomografía Axial Computarizada,
Ultrasonido Tridimensional, Mamografía, Videoendoscopia. Para el establecimiento de esta Misión
se encadenaron decisiones y convicciones políticas dentro y fuera de Venezuela (por ejemplo,
Cuba que aportó médicos y su experiencia internacional en asistencia primaria). Barrio Adentro ha
influido en una mejoría en la calidad de vida del venezolano en un tiempo rápido; esto se ve
claramente en el cuidado de la salud de las personas.

Conclusión

En conclusión, pudimos entender que Dado que la salud- enfermedad es un proceso, este es
susceptible de interrumpirse. Debido a que el proceso salud- enfermedad se da mediante la
interacción entre agente – huésped y ambiente, actuar sobre ellos, posibilita la prevención a
diversos niveles.
La necesidad de hacer una prevención lo más temprano posible, hace necesario definir estándares
operativos sobre normalidad. Debido a que las acciones preventivas son menos costosas si se
realizan más tempranamente, es indispensable realizar esfuerzos para lograrlo

A la enfermedad se le combate con el conocimiento de nuestro ser. No basta negar su existencia,


sino que debemos comprender que la enfermedad es irreal. Sabiendo que la salud es lo auténtico
y real.

1. ………………………………….Historia de la enfermería en América latina

2. Filosofía de la enfermería

3. Características de la profesión de enfermería

Según indica Colliere, el origen de las prácticas de cuidados está ligado a las intervenciones
maternales que aseguraban la continuidad de la vida y de la especie. La alimentación, como
necesidad básica que implica suplencia y ayuda (por parte de la madre o sustituta) en los primeros
estadios evolutivos del hombre es considerada como la práctica de cuidados más antigua.

Febe (60 d. C.) es la única mujer a la que se cita como diaconisa en el Nuevo Testamento
(Romanos, 16, 1-2). Atendía a los pobres en sus hogares y con el tiempo se convirtió esta labor en
parte primordial del trabajo de las diaconisas. No obstante, no se la relaciona con la Enfermería.

El cristianismo y su organización tuvo vínculos históricos importantes con las prácticas de cuidados
de enfermería desde los monasterios a través de las Órdenes Religiosas, así como desde
la conquista de Tierra Santa con las cruzadas. Como consecuencia del pensamiento medieval
relacionado con la Reconquista de Santos Lugares, surgió un movimiento organizado, que cristalizó
con el fenómeno histórico de las cruzadas, las cuales dieron lugar a la aparición de tres tipos de
figuras: el guerrero, el religioso y el enfermero. La demanda de hospitales y sanitarios en las rutas
seguidas por los cruzados propició la aparición de las Órdenes Militares dedicadas a la enfermería:
los Caballeros Hospitalarios de San Juan de Jerusalén, los Caballeros Teutónicos, y los Caballeros
de San Lázaro. En España, la primera institución destinada a acoger enfermos fue el Hospital del
Obispo Masona, en Mérida, en el siglo VI, según Domínguez Alcón y el Diccionario Eclesiástico de
España.

Entre los hospitales medievales donde se desarrollaban actividades de enfermería, se encuentran


El Hôtel-Dieu de París y Lyon, el Santo Spirito deRoma, el Hospital de la Seo de Tortosa, el Hospital
de Mérida, y el Hospital d'en Clapers de Valencia, de los cuales, según datos recogidos por
Domínguez Alcón, los dos primeros perduran en la actualidad. El llamado movimiento Beguino,
constituido por «mujeres santas» que cuidaban enfermos, se diferencia dentro del entramado
histórico-cristiano-caritativo ligado a los cuidados de enfermería fundamentalmente en no asumir
los votos preceptivos de las órdenes religiosas.

Las denominaciones de las personas encargadas de proporcionar cuidados de Enfermería han


variado a lo largo de la historia en función de la época y el contexto donde éstos se desarrollaban
(hospitales, leproserías, órdenes militares, órdenes religiosas y ámbitos domésticos): macipa,
mossa, clavera, donado, donada, hospitaler, hospitalera, enfermero, enfermera.
Según la historiografía estudiada hasta ahora, los administradores o procuradores de los
hospitales eran varones, salvo en el Hospital del Rey de Burgos.

Hasta el año 1500, la escasa atención en cuanto a la reglamentación de los cuidados de


enfermería, practicados en ámbitos domésticos, propició una variedad de grupos que ejercían
estas actividades fuera de los ámbitos institucionales: Nodrizas (didas). Parteras o comadronas,
grupos dedicados al cuidado a domicilio y grupos dedicados a otras prácticas sanadoras.

En el siglo XVI, la Reforma Protestante tuvo graves consecuencias para los cuidados de salud,
debido a la supresión de las instituciones de caridad. Lafilosofía protestante indica que «no son
necesarias las obras de caridad para obtener la salvación». Esto se traduce en un abandono de la
consideración del cuidado de enfermería que continuaba existiendo en el ámbito católico. Entre
los años 1500 y 1860, la enfermería tuvo su peor momento, debido a que la idea predominante
era que la enfermería constituía más una ocupación religiosa que intelectual, por lo que su
progreso científico se consideraba innecesario. Además, tras la Reforma Protestante se produjo
una desmotivación religiosa para dedicarse al cuidado de enfermos entre las personas laicas y una
relegación a antiguas pacientes, presas y otras personas de los estratos más bajos de
la sociedad de la actividad de aplicar cuidados. Donahue denominó a este período la "Época
oscura de la Enfermería".

El Instituto de Diaconisas de Kaiserwerth, creado en 1836 por el pastor protestante Theodor


Fliedner (1800-1864), supuso para la enfermería el inicio de una formación reglada, para
enfermeras. Este hecho, acaecido en el ámbito protestante, puede suponer en
un análisis superficial una contradicción; sin embargo, el propio caos y desorganización de los
cuidados de enfermería protestantes fue lo que exigió una reglamentación formal y específica
para ejercer la profesión.

Partes: 1, 2

Historia de la Enfermería (página 2)

Enviado por Sergio González

Partes: 1, 2

Según Robinson, el libro Notas sobre la enfermería (Notes on Nursing), publicado por Florence
Nightingale en 1859 —tras sus experiencias en la guerrade Crimea—, supuso «un texto de crucial
influencia sobre la enfermería moderna». En 1860 se inauguró la Nightingale Training School for
Nurses("Escuela Nightingale de Formación para Enfermeras"), la cual constituyó una institución
educativa independiente financiada por la Fundación Nightingale. La originalidad del proyecto fue
considerar que debían ser las propias enfermeras las que formasen a las estudiantes de
enfermería mediante programas específicos de formación y haciendo hincapié tanto en las
intervenciones de enfermería hospitalarias como extrahospitalarias, para el mantenimiento y
prevención de la salud tanto del individuo como de las familias.

En España la enfermeria esta por delante de los medicos. En Estados Unidos, según Donahue, el
primer texto sobre enfermería se publicó en 1885 por la señora Clara Weeks Shaw, y la
primera revista nacional sobre enfermería, The Trained Nurse and Hospital Review, apareció en
1888. Según Donahue, Lilian Wald fue la precursora de lo que hoy se entiende como Enfermería
Comunitaria, por medio de un proyecto que comenzó en Nueva York en 1893 como
una organización filantrópica, y que constituiría la base para el posterior desarrollo de la Salud
Pública en dicho país. En España no se puede hablar de un origen específico de la Enfermería de
Salud Pública, ya que las ideas anglosajonas no tuvieron mucho eco entre las enfermeras
españolas, hasta que en 1933 se crearon las 50 primeras plazas de enfermeras visitadoras y
sanitarias. Posteriormente, Mrs. Benford Fenwick fundaría el Consejo Internacional de Enfermeras,
la más antigua de todas las organizaciones internacionales para trabajadores profesionales. En
1922, en la Universidad de Indiana, se fundó la Sigma Theta Tau, una organización que
promueve la investigación y dirección de Enfermería. Sus miembros son seleccionados de acuerdo
con sus logros académicos y calidad profesional, y entre ellos figuran estudiantes, estudiantes
graduados en Programas de Enfermería y dirigentes de Enfermería Comunitaria.

A principios del siglo XX, en los Estados Unidos se admitía, por lo general, que la legislación sobre
la aprobación estatal para la Enfermería elevaría a las personas que la practicaban a un nivel
profesional mediante el establecimiento de unas normas educativas mínimas para las escuelas de
Enfermería. Sin embargo, a medida que la demanda de enfermeras crecía, se establecieron más
escuelas de Enfermería de distinta calidad, circunstancia que hizo poco por mejorar el nivel de la
profesión.

En la Segunda Guerra Mundial, la enfermería adquirió mayor importancia y relieve. En los últimos
días de la guerra un artículo de Bixler y Bixler en la revista American Journal of Nursing valoraba la
enfermería como una profesión. Los siete criterios para una profesión identificados por estos
autores eran aplicables a la enfermería de la forma en que se practicaba en ese momento y
justificaban la consideración de la enfermería como profesión. Bixler y Bixler revisaron sus criterios
y el nivel profesional de la enfermería 14 años después y observaron que ambos continuaban
siendo válidos.

En España, el 4 de diciembre de 1953 se unifican en ATS (Asistente Técnico Sanitario) los estudios
de auxiliares sanitarios siguiendo el modelo de especialidades médicas con el objeto de
proporcionar mayor formación posbásica a las profesiones
de matronas, practicantes y enfermeras, de modo que las matronas pasan a ser una especialidad
de ATS (BOE del 12 de febrero de 1957, Decreto de enero de 1957. Para Fisioterapia, BOE del 23
de agosto, Real Decreto del 26 de julio de 1957). En 1977 (Decreto 2128), se transforman en
España las enseñanzas conducentes al título de ATS por las de DUE (Diplomado Universitario en
Enfermería). Este hecho histórico supuso el reconocimiento por parte de la Institución
Universitaria de la Enfermería como disciplina en proceso de construcción y como profesión
de carácter universitario con todo lo que ello implica: reconocimiento científico y académico de la
antigua actividad del cuidado de enfermería, crecimiento doctrinal y la posibilidad futura de
acceder a todos los grados académicos (licenciatura y doctorado).
Más recientemente, Hall ha identificado los siguientes cinco criterios de actitud con la
profesionalidad:

 Uso de organizaciones profesionales como referentes importantes.

 Creencia en la autorregulación, lo que conlleva a la idea de que sólo los profesionales que
de un área especifica pueden establecer las normas para su práctica.

 Creencia en el servicio al público como parte esencial de la profesión.

 Sentimiento de considerar el campo o el compromiso con la profesión como


un interés fundamental y un deseo que va más allá de la recompensa económica.

 Autonomía cuando el profesional debe tomar decisiones sobre su trabajo basadas en las
normas del mismo y en el código deontológico.

En la actualidad, en Estados Unidos se ofrecen dos programas de doctorado en Enfermería: el


doctorado académico y el doctorado en Ciencias de la Enfermería. Esto supone la consecución
del máximo grado académico para la Enfermería en el contexto estadounidense. Asimismo, este
"doble doctorado" supone exigencias académicas que configuran, sin duda, el conocimiento de
Enfermería y la identidad profesional. Para pertenecer a la Academia de Enfermería
Estadounidense (American Academy of Nursing) es necesario haber realizado trabajos
de investigación inéditos que supongan un aumento del corpus de conocimientos de Enfermería.
Este hecho es análogo para todas las disciplinas científicas así como para sus respectivas
academias. En España, con el programa de estudios resultante del Proceso de Bolonia, la
enfermería ha alcanzado su máximo desarrollo, pues es posible obtener el doctorado en
Enfermería, que facilita la labor de investigación y consecuentemente el desarrollo de la
profesión.

HISTORIA DE LA ENFERMERÍA EN AMERICA LATINA

El término enfermera habitualmente se aplica a la persona que, habiendo recibido una


preparación especial, trabaja como miembro de un equipo de salud, en el cuidado y atención de
los pacientes encomendados a su asistencia, bajo la dirección de un profesional médico.
La misión y formación de la enfermera o enfermero han ido variando en el tiempo, de acuerdo al
desarrollo científico y tecnológico y a la demanda de la sociedad.

Para la Asociación Americana de Enfermeras, el ejercicio de la enfermería significa la iniciación y


ejecución, de manera independiente, de cualquieracción de carácter profesional
en materia de observación, cuidado y asesoramiento de los clientes, supuestos sanos, lesionados o
enfermos; la conservación de la salud y prevención de las enfermedades; y
la supervisión y enseñanza del personal técnico y auxiliar de la enfermería.

Estos cambios importantes en la preparación de las alumnas de enfermería coincidieron con el


creciente desarrollo de la medicina preventiva en los países latinoamericanos, aún cuando por
algunos años los servicios preventivo promocionales de salud funcionaron en centros apartados de
los establecimientos que brindaban servicios de recuperación de la salud.
Consciente de la importancia de la enfermería en el desarrollo de los servicios de salud
en América, la Oficina Sanitaria Panamericana en cuanto pudo contar con personal de asesoras en
enfermería, inicialmente comisionadas por el Servicio de Salud Pública de los EE.UU., colaboró con
los gobiernos miembros en la solución de tres aspectos de la enseñanza: la enfermería básica, la
enfermería posbásica y la capacitación de los auxiliares de enfermería.

La Organización conjuntamente con las autoridades nacionales de salud acordaron preparar dos
tipos de personal de enfermería: la enfermera graduada o titulada y la auxiliar de enfermería. Así
como, en la década de 1850, apareció la enfermera...

Definiciones de enfermería

Según el Consejo Internacional de Enfermeras, la enfermería se define del siguiente modo:

La enfermería abarca los cuidados, autónomos y en colaboración, que se prestan a las personas de
todas las edades, familias, grupos y comunidades, enfermos o sanos, en todos los contextos, e
incluye la promoción de la salud, la prevención de la enfermedad, y los cuidados de los enfermos,
discapacitados, y personas moribundas. Funciones esenciales de la enfermería son la defensa, el
fomento de un entorno seguro, la investigación, la participación en la política de salud y en
la gestión de los pacientes y los sistemas de salud, y la formación.

La Asociación Norteamericana de Enfermeras declara desde 1980 en un documento denominado


«Nursing: A Social Policy Statement» que la enfermería es: «El diagnóstico y tratamiento de las
respuestas humanas ante problemas de salud reales o potenciales».

La anterior definición ha sido ampliada o adaptada como la que propone la Facultad de Enfermería
de la Universidad de Moscú, en Rusia, «ciencia o disciplina que se encarga del estudio de las
respuestas reales o potenciales de la persona, familia o comunidad tanto sana como enferma en
los aspectos biológico, psicológico, social y espiritual».

La enfermería es una profesión de titulación universitaria que se dedica al cuidado integral del
individuo, la familia y la comunidad en todas las etapas del ciclo vital y en sus procesos de
desarrollo.

Conceptos de la Enfermería

 Autocuidado

 Investigación en cuidados

 Metaparadigma de Enfermería

 Metodología de los cuidados enfermeros: Proceso de Atención de Enfermería

 Modelos y teorías de la Enfermería

Filosofía de la Enfermería

En la Facultad de Ciencias Médicas de Sancti Spíritus se desarrolla un nuevo modelo formativo de


los recursos humanos en Enfermería, el cual se extiende debido a la Universalización, a todos los
municipios de la provincia. Por la importancia de esta revolución educacional se realiza
un análisissobre la importancia que reviste en los tiempos actuales, la formación consciente de
una filosofía en las enfermeras, así como su relación con el desarrollo de la Ciencia y su vinculación
con esta disciplina. En este trabajo se exponen los aspectos fundamentales que se deben tener en
cuenta para que la actual filosofía de la enfermería contribuya a la formación integral del
enfermero que exige actualmente el encargo social de esta profesión.

DeCS: Enfermería / recursos humanos, FILOSOFÍA EN ENFERMERÍA

La Universidad la vemos en la dimensión de los aspectos sociopolíticos, dado que todas


las estrategias del desarrollo reconocen el papel del hombre y sus potencialidades como el factor
fundamental de las mismas. Como plantea Daniel Filmus "Nunca como ahora el conocimiento se
convirtió en un elemento central para el desarrollo sostenido", y por otra parte, en la dimensión
de los aspectos de carácter económico siendo esta última acepción no sólo lo referido a lo
estrictamente productivo, sino que compete a cualquier expresión de la actividad humana.

Del papel e importancia que la sociedad le otorga a las transformaciones y a la elevación de la


calidad de los sistemas educativos, dependerá en gran medida el sentido integrador o restricto
que adopten los cambios de orden económico, científico – técnico, social en nuestros países, de
ahí su importancia y valor. (1)

La filosofía de las enfermeras respecto a la enfermería es de vital importancia para la práctica


profesional. La filosofía comprende el sistema de creencias de la enfermera profesional e incluye
también una búsqueda de conocimientos. El sistema de creencias y la comprensión determina su
forma de pensar sobre un fenómeno o situación, y la forma de pensar define en gran medida su
manera de actuar. La enfermera debe comprender la definición, objetivos, importancia y
elementos de la filosofía como objeto de elaborar una filosofía personal de enfermería.

En términos generales se acepta que la filosofía abarca tres elementos: preocupación por el
conocimiento, los valores y el ser, o las creencias que tiene el individuo sobre la existencia. En
todos estos aspectos, la filosofía emplea como método los procesos intelectuales. El conocimiento
es importante para la enfermería porque ésta es una ciencia y su proceso se basa en la lógica y en
el método científico. La importancia concedida a los valores es esencial para la enfermería porque
las enfermeras efectúan de manera constante declaraciones de actitud, preferencia y valores
conforme se comprometen en la relación que existe entre la enfermera y el paciente. De igual
manera como la enfermera ha participado activamente en el desarrollo de una teoríapropia,
resulta evidente que está comprometida con sus propias creencias respecto a su existencia
profesional.

El objeto de estudio de la profesión es el cuidado de enfermería al hombre, la familia y la


comunidad sanos y/o enfermos en relación reciproca con su medio social y tomando como base
las necesidades humanas y su satisfacción a través de la aplicación del Proceso de Atención de
Enfermería, bajo un prisma dialéctico materialista.

La definición literal de la filosofía es "amor a la sabiduría", que se deriva de la combinación de los


sustantivos griegos "philia", que significa amor y "sophia" que quiere decir sabiduría, es decir amor
a lo sabio o a la sabiduría. La definición dada por el diccionario de la Real Academia indica que la
filosofía es la "ciencia que trata de la esencia, propiedades, causas y efectos de las cosas
naturales" (2)
Teniendo en cuenta las definiciones de filosofía y la suposición de que los seres humanos tienen
una inagotable sed de conocimientos, definimos la "filosofía de la enfermería" como los resultados
intelectuales y afectivos de los esfuerzos profesionales que realizan las enfermeras para:

 Comprender las razones y relaciones fundamentales de los seres humanos y el medio


ambiente.

 Enfocar la enfermería como una disciplina científica.

 Elaborar un sistema personal de creencias en el hombre como ser humano que se


desarrolla y transforma en el medio social donde vive, medio ambiente, salud y
enfermería como proceso (3)

Las ciencias se benefician de la filosofía esencialmente porque la filosofía rige sus métodos a
través de la lógica y la ética. Si bien es cierto que existen diferencias entre los fines específicos de
la filosofía y los de las distintas ciencias, ambos comparten la meta de incrementar los
conocimientos de la humanidad. (Silva 1977)

En el caso de una disciplina joven en desarrollo como la enfermería, la cual ha transformado


su plan de formación de los recursos humanos instaurándose un Nuevo Modelo Pedagógico desde
hace dos cursos, acompañándose de la Universalización de la Enseñanza Superior de esta carrera,
la participación activa en la creación de una "filosofía en enfermería" sirve para recordar a la
profesión su sistema de creencias en el hombre como un ser biopsico social, guiarla en la
obtención de metas éticas dentro de la educación, práctica e investigación de la enfermería, así
como regir el desarrollo de la base teórica de la práctica de enfermería. Sin dudas todas estas
consecuencias darán como resultado el mejoramiento de la salud y de sus cuidados al alcance de
todos los seres humanos.

Por tal razón el objetivo del presente trabajo radica en valorar las perspectivas filosóficas y
del pensamiento científico, para la educación y práctica de enfermería de los estudiantes de
Licenciatura en Enfermería en la Facultad de Ciencias Médicas de Sancti Spíritus.

CARACTERÍSTICAS DE LA PROFESIÓN DE ENFERMERÍA

 Intelectual

 Práctica

 Académica

 Habilidad técnica

 Bases éticas

 Autonomía

 Social

INTELECTUAL
 Se basa en un conjunto de conocimientos

 Emplea el método científico en la práctica

 Utiliza los conocimientos con pensamiento analítico

 Crítico y creativo

PRÁCTICA

 Debe poseer habilidades y destrezas

ACADÉMICA

 La práctica de le enfermería se caracteriza por la solidez de su formación teórica

 El personal de enfermería debe especializarse con el fin de mejorar la calidad de atención


de los usuarios.

HABILIDAD TÉCNICA

 La práctica de enfermería se apoya en principios o bases científicas que guían la práctica y


a su vez proporciona la base para la legitimidad y autonomía de la profesión.

BASES TEÓRICAS

 La enfermería se ejerce dentro de un marco ético. Estos valores se señalan en el Código


Deontológico de Enfermería.

AUTONOMÍA

 La enfermería como profesión controla sus propias funciones,


posee independencia y responsabilidad de sus actos.

SOCIALES

 Su principio consiste en ayudar a que las personas conserven su salud

 Debe ser sensible a las necesidades humanas y tener consciencia de su responsabilidad al


contribuir al bienestar de los demás

 Existe una fuerte motivación o vocación en la elección de la carrera que sugiere un


compromiso de la profesión al servicio de la sociedad

El personal de enfermería durante el ejercicio de su profesión, es importante que posea o


adquiera la capacidad de:

 Formar juicios sobre la realidad que la conduzca a actuar con pleno conocimiento

 Trabajar en equipo inter y multidisciplinario

 Servir y ayudar a quienes lo requieran

 Comunicarse cordial y efectivamente con el usuario, colegas y demás miembros del


equipo de salud
 Mostrar seguridad y confianza en sí misma (o)

 Realizar investigaciones de proyección social

 Aplicar el sentido y valor de las normas éticas y jurídicas de la profesión

 Participar con organismos de influencia en el desarrollo de la profesión

……………

HISTORIA DE LA ENFERMERÍA EN VENEZUELA.

Dadas las urgencias locales y en gran medida como resultado de losesfuerzos de otro ministro del
presidente López Contreras, el de educación, en1937 se organizó una escuela de enfermeras
dependiente de ese ministerio,conocida como la "Escuela Normal rofesional de Enfermeras"
! inisterio deEducación, 1937, p #$$$%$&# La escuela a'rió sus puertas en fe'rero de 193(con )*
estudiantes, "+ó enes muy selectas de 1( a3- a.os, con se/to grado "Elprincipal propósito del
inisterio de Educación con respecto a esta
escuelaera la preparación de enfermeras profesionales 0ue a su ez pudierancon ertirse en
docentes de las futuras escuelas de enfermeras a a'rirse a lolargo y a lo anc o del pa2s # l parecer,
'as4ndose en la recomendación de la56, el go'ierno enezolano contrató a dos antiguas 'ecarias
espa.olas de laD% como administradoras y docentes8 la se.orita ontserrat 6ipol No'le,0uien fue
nom'rada directora y la se.orita urora as aminde, como lasegunda en el mando# m'as
estudia'an en la :estern 6eser e ;ni ersitycuando la uerra Ci il espa.ola les impidió regresar a
Espa.a# <a'2a sólootras dos integrantes del personal para ayudarlas a poner la escuela enmarc a8
la se.orita ara Colmenero, egresada de la ;ni ersidad de Californiaen Los ngeles y de la escuela
de enfermeras de Los ngeles County <ospital,contratada como instructora a tiempo parcial y una
maestra 0ue ense.a'atemas de 0uinto y se/to grado, en un intento del go'ierno por reducir
lasdeficiencias de las estudiantes y 0uien sir ió como secretaria de la escuela! inisterio de
Educación, 193(, p# *=&# Estudiantes a anzados de medicina ense.a'an la ciencia
m>dicade'ido a la dificultad de conseguir 0ue los m>dicos dieran clase conregularidad# El
presupuesto era reducido y el e0uipo inadecuado# Los salonesde clase consist2an en un pe0ue.o
la'oratorio para el arte de enfermer2a, unasala de aula y un la'oratorio, no menos inadecuado, de
0u2mica ! rc ila, 19?=,p#)?(&# La residencia esta'a repleta con cuatro a oc o camas por
a'itación#Las estudiantes no paga'an ni matr2cula ni mensualidades# Ninguna
escuelap@'lica en el pa2s, incluyendo la Escuela de edicina de la ;ni ersidadCentral, co'ra'a matr2
cula# La escuela proporciona'a alo+amiento,alimentación, uniformes, zapatos y medias a las
internas# En dos a.os de
funcionamiento, a comienzos de 19*-, el personal de la escuela,
algunosfuncionarios m>dicos del ministerio y la 56 a'2an identificado ariospro'lemas# <asta
entonces sólo tres enfermeras se a'2an encargado de unapo'lación numerosa8 las se.oritas 6ipol,
as y Colmenero# Ellas com2an
ydorm2an en la escuela, tratando de atender todos los pro'lemas, tantoescolares como
personales, de un "grupo de +o encitas indisciplinadas y sineducación"# Era e idente 0ue el
e0uipo docente se a'2a e/cedido en susesfuerzos intentando lo imposi'le al admitir a un grupo de
alumnas tan grandey con tan limitada 'ase educati a# En septiem're de ese a.o se llegó a
unasituación cr2tica cuando ingresó un nue o grupo de 11? estudiantes,
totalizando1?= estudiantes inscritos# En 19*-, la 56 en ió a Caracas a miss aryEliza'et
Aennant del programa de enfermer2a de salud p@'lica de la D% ,
conel propósito de estudiar el proyecto de la escuela# Despu>s de analizar diferentes aspectos del
pro'lema y las necesidades sanitarias del pa2s, ellarecomendó fundar una escuela nacional
independiente 0ue tomara como puntode partida la Escuela Normal rofesional de Enfermeras#
En no iem're de19*-, por medio de un decreto gu'ernamental, se creó la Escuela Nacional
deEnfermeras dependiente del inisterio de anidad y sistencia ocialEstudiantes e instructoras
de la Escuela Normal fueron transferidas a la nue aEscuela Nacional# En el 2nterin, una de las dos
escuelas restantes a'2adescontinuado la inscripción y se recomendó oficialmente 0ue la segunda
fueracerrada# La Escuela Nacional fue mudada del edificio en 0ue a'2a enidofuncionando, en la
laza del anteón, a un moderno edificio en Cotiza, Construido como asilo de ancianas aun0ue
nunca fue usado para esefin, 0ue permitió me+ores condiciones para el funcionamiento y la
residencia delas estudiantes# El lugar 0ueda'a fuera de la ciudad, "sin ruido, en una0ue'rada con
4r'oles tropicales y altas monta.as como marco#" La 56 cola'oró con cantidades sustanciales de
nue os e0uipos para lossalones de clases y los la'oratorios de 0u2mica, 'acteriolog2a, diet>tica y
artede enfermer2a
Está leyendo una previsualización gratis. Desbloquee el acceso completo con una prueba gratis.
Pages 3 to 20 are not shown in this preview.

Descargar con una prueba gratis

<% AB6% DE L EN5E6 E6 EN E6%C


L A%N El t>rmino enfermera a'itualmente se aplica a lapersona 0ue, a'iendo reci'ido una prepar
ación especial, tra'a+a como miem'ro de une0uipo de salud, en el cuidado yatención de
los pacientes encomendados a suasistencia, 'a+o la dirección de un profesional m>dico#
Lamisión y formación
dela enfermera o enfermero an ido ariando en eltiempo, de acuerdo aldesarrollo cient2fico y
tecnológico y a la demanda de lasociedad# ara la sociación mericana de Enfermeras, el
e+ercicio de la
enfermer2asignifica la iniciación y e+ecución, de manera independiente, decual0uieracción de
car4cter profesional enmateria deo'ser ación, cuidado yasesoramiento de losclientes, supuestos
sanos, lesionados o enfermos
laconser ación de la salud y pre ención de lasenfermedades y lasuper isión yense.anza delperso
nal t>cnico y au/iliar de la enfermer2a#Estos cam'ios importantes en la preparación de las alumnas
de enfermer2acoincidieron con el creciente desarrollo de lamedicina pre enti a en los
pa2seslatinoamericanos, a@n cuando por algunos a.os losser icios pre enti opromocionales de s
alud funcionaron en centros apartados de losesta'lecimientos 0ue 'rinda'an ser icios de
recuperación de la salud#Consciente de la importancia de la enfermer2a en el desarrollo de los
ser iciosde salud en m>rica, laBficina anitaria anamericana en cuanto pudo contar con
personal de asesoras en enfermer2a, inicialmente comisionadas por el er icio de alud @'lica de
los EE#;;#, cola'oró con los go'iernos miem'rosen la solución de tres aspectos de la ense.anza8 la
enfermer2a '4sica, laenfermer2a pos'4sica y lacapacitación de los au/iliares
de enfermer2a#La Brganización con+untamente con las autoridades nacionales de saludacordaron
preparar dos tipos de personal de enfermer2a8 la enfermeragraduada o titulada y la au/iliar de
enfermer2a# s2 como, en la d>cada de1(?-, apareció la enfermera###

Definiciones de enfermería

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

eg@n el Conse+o %nternacional de Enfermeras, la enfermer2a se define delsiguiente modo8La


enfermer2a a'arca los cuidados, autónomos y en cola'oración, 0ue seprestan a las personas de
todas las edades, familias,grupos y comunidades,enfermos o sanos, en todos los conte/tos, e
incluye lapromoción de la salud, lapre ención de la enfermedad, y los cuidados de los enfermos,
discapacitados,y personas mori'undas#5unciones esenciales de la enfermer2a son la
defensa,el fomento de un entornoseguro, la in estigación, la participación enlapol2tica de salud y
en lagestión de los pacientes y lossistemas de salud, y laformación#La sociación Norteamericana
de Enfermeras declara desde 19(-
en undocumento denominado Nursing8 ocial olicy tatementF 0ue laenfermer2a es8 Eldiag
nóstico y tratamiento de las respuestas umanasantepro'lemas de salud reales o potencialesF#La
anterior definición a sido ampliada o adaptada como la 0ue propone la5acultad de Enfermer2a
de la ;ni ersidad de osc@, en6usia, ciencia odisciplina 0ue se encarga del estudio de las
respuestas reales o potenciales
dela persona,familia ocomunidad tanto sana como enferma en los aspectos'iológico, psicológico,
social y espiritualF#La enfermer2a es una profesión de titulación uni ersitaria 0ue se dedica
alcuidado integral del indi iduo,la familia y la comunidad en todas las etapas delciclo ital y en
susprocesos de desarrollo#5lorence Nig tingale,B ,66C !5lorencia, ran Ducado de
Aoscana, 1)de mayo de1()-GLondres,13 de agosto de191-
&, fueunaenfermera,escritora yestad2stica 'rit4nica, considerada pionera delaenfermer2amodern
a y creadora del primer modelo conceptual de enfermer2a# e destacó desde muy +o en
enmatem4ticas, y aplicó sus conocimientos deestad2stica a laepidemiolog2a y a la estad2stica
sanitaria# 5ue la primera
mu+er admitida en la6oyal tatistical ociety 'rit4nica, y miem'ro onorario dela merican
tatistical ssociation#

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

entó las 'ases de la profesionalización de la enfermer2a con elesta'lecimiento, en 1(=-, de su


escuela de enfermer2a en el ospital
aintA omas deLondres, actualmente parte integrante delHingIs College deLondres y delN< #

5ue la primera escuelalaica de enfermer2a en el mundo# u tra'a+o fue la fuente de inspiración


de<enri Dunant, fundador de laCruz6o+a y autor de las propuestas umanitarias adoptadas por
lacon ención de ine'ra#

De fe anglicana, cre2a 0ue Dios la a'2a inspirado para ser enfermera# lcanzófama mundial por
sus tra'a+os pioneros de enfermer2a en la asistencia a los eridos durante laguerra de Crimea#
partir de ese momento fue conocidacomo la dama de la l4mparaF, por su costum're de realizar
rondas nocturnascon una l4mpara para atender a sus pacientes#En 1((3, lareina Jictoria le otorgó
la6eal Cruz 6o+a, y en 19-7 secon irtió en la primera mu+er en reci'ir laBrden de >rito del 6eino
;nido#
3

En19-(, le fueron otorgadas lasLla es de laCiudad de Londres#

ElKuramento Nig tingale efectuado por los enfermeros al graduarse, fuecreado en su onor en
1(93# ElD2a %nternacional de la Enfermer2a se cele'raen la fec a de su cumplea.os#%nspirada
por lo 0ue ella interpretó como una llamada de Dios, anuncióen fe'rero de 1(37, mientras se
encontra'a enEm'ley ar , su decisión dededicarse a la enfermer2a a partir de 1(**# Esta decisión
constitu2a un desaf2opara las con enciones sociales de la >poca, donde la mu+er esta'a destinada
acumplir con el rol de esposa y madre# Aras muc os sacrificios y la fuerteoposición de su familia,
en especial de su madre y de su ermana, logróformarse como enfermera# El pol2tico y
poeta 6ic ard onc ton ilnes, 0uienser2a uno de sus m4s firmes apoyos pol2ticos e intelectuales,
llegó a proponerlematrimonio, pero ella rec azó su propuesta,

con encida de 0ue interferir2a consu decisión de consagrarse a la enfermer2a# Aam'i>n mantu o
una estrec arelación con Men+amin Ko ett, de 0uien se presume 0ue le propusomatrimonio#

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

El )) de agosto de 1(?3, asumió el cargo de superintendente en el%nstituto para el Cuidado de


e.oras Enfermas !%nstitute for t e Care of ic entle omen& u'icado en ;pper <arley treet,
Londres, puesto 0ue ocupó asta octu're de 1(?*#

13

u padre la pro e2a de un ingreso anual de O?--, enese entonces una cifra importante, lo cual
le permitió durante ese per2odo lle ar una ida conforta'le y proseguir su
carrera# principios delsiglo $$, se acepta'a 0ue la gestión de Nig tingaleredu+o el2ndice de
mortalidad del *) P al ) P ya sea realizando me+oras en la igiene o reclamando a la Comisión
anitaria# La primera edición del Dictionaryof National Miograp y !1911& ac2a esta afirmación,
pero la segunda edición!)--
1& ya no# De ec o, la cantidad de muertes no disminuyó, sino 0uecomenzó a aumentar# El
n@mero de muertes era el mayor de todos los ospitales de la región#Durante la guerra ella no
reconoció 0ue la falta de igiene era una de lascausas principales de muerte, creyendo 0ue el
ele ado 2ndice de mortalidad sede'2a a la mala nutrición, a la falta de suministros m>dicos y al
agotamientoe/tremo de los om'res, y nunca reclamó cr>dito alguno por ayudar
a disminuir el n@mero de muertes#

17
ero a su regreso a Londres comenzó a reunir prue'as para la Comisión 6eal para la alud en el
E+>rcito a fin de sustentar suposición de 0ue los soldados fallec2an a causa de las deplora'les
condicionesde ida en el ospital# Esta e/periencia influyó decisi amente en su carreraposterior,
lle 4ndola a a'ogar por la importancia de me+orar las condicionessanitarias ospitalarias# En
consecuencia, ayudó a a reducir las muertes en ele+>rcito durante tiempos de paz y promo ió
el correcto dise.o sanitario de
los ospitales# lrededor de 1((), las enfermeras de Nig tingale goza'an de unacreciente e
influyente presencia en el desarrollo de la em'rionaria
profesióndeenfermer2a# lgunas se con irtieron en matronas de ospitales de anguardia en toda
ran Mreta.a y
en ustralia# partir de 1(?7, comenzó a padecerdepresión e intermitentespostraciones en la cam
a# La mencionada 'iograf2a de Mostridge citó a

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

la'rucelosis y a laespondilitis como la causa de sus padecimientos#

)*

;nae/plicación alternati a para su depresión se 'asa en 0ue despu>s de la guerradescu'rió 0ue


a'2a estado e0ui ocada respecto a las razones del alto 2ndicede mortalidad#

17

in em'argo, no ay e idencia documental 0ue respalde estateor2a# En la actualidad se cele'ra,


en el ani ersario de su nacimiento, el

DíaInternacional de Concienciación de las Enfermedades Neurológicas eInmunológicas Crónicas

, de'ido a 0ue se considera 0ue los s2ntomas de suenfermedad coinciden con un


trastorno neurológico#

)=

pesar de sus dolencias, permaneció fenomenalmente producti a en el4rea de la reforma social#


Durante sus a.os de postración en la cama, tam'i>nrealizó tra'a+os pioneros en el campo de la
planificación ospitalaria, y sutra'a+o se propagó r4pidamente a tra >s de ran Mreta.a y del resto
delmundo#

M er!e

El 13 de agosto de 191-, a los 9- a.os, falleció mientras dorm2a en


su a'itación del 1- de out treet, ar Lane# La oferta de sepultura enla 'ad2a de
:estminster fue rec azada por sus familiares, y fue sepultada
enel cementerio de la %glesia de t# argaret enEast :ello ,<amps ire#Contri'ucionesEl primer
programa oficial de entrenamiento de enfermeras, la EscuelaNig tingale para enfermeras, fue
inaugurado en 1(=-# La misión de la
escuelafue entrenar enfermeras para tra'a+ar en ospitales, asistir a los menospudientes, y
ense.ar# e pretend2a 0ue los estudiantes estu iesen capacitadospara cuidar a los enfermos en
sus domicilios, un enfo0ue 0ue a@n oy esa anzado#

3?

La m4s duradera contri'ución de 5lorence Nig tingale fue su rol enla fundación de la enfermer2a
moderna como profesión# Ella esta'leció lospar4metros de compasión, dedicación al cuidado del
paciente, diligencia ycuidado en la administración ospitalaria# rimera escuela de enfermer2a

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

La primera escuela de enfermer2a documentada se esta'leció en la %ndiaen el a.o )?- C# ólo los
om'res eran considerados lo suficientemente"puros" como para ser enfermeros# El C a ra
esta'lec2a 0ue de'2an tener 'uena conducta, ser puros, astutos, 4'iles, ama'les, competentes y
estar dispuestos a atender a 0uien esta'a enfermo y 0ue no fueran reticentes a acer cual0uier
cosa 0ue se les pudiera pedir#%nstituto Haiser ort Deaconess%naugurado por A eodore
5liedner en Haiser ort , en lemania en 1(3=,
el%nstituto Haiser ort Deaconess fue la primera escuela de enfermer2aregistrada en la
ci ilización occidental# 5ue a0u2 donde 5lorence Nig tingalereci'ió sus tres meses de
entrenamiento formal# l asistir a los eridos durante la guerra de Crimea, 5lorence Nig tingalese
dio cuenta de 0ue las personas 0ue cuida'an a lo senfermos y a losnecesitados necesita'an alg@n
tipo de entrenamiento formal# Cuando regresó aLondres en 1(=- a'rió la "Escuela de 5ormación
Nig tingale para Enfermeras"#Ella desarrolló un plan de estudios para capacitar a las enfermeras a
un ni elcalificado y competente para atender a los enfermos# las enfermeras se
lesense.a'a a desarrollar a'ilidades de o'ser ación y de empat2a# Lagraduación de la escuela de
enfermer2a lo califica'a a uno para tra'a+ar en ospitales, tanto en el 6eino ;nido como en el
e/tran+ero# La ;ni ersidad de anc ester, en anc ester, %nglaterra, fue la primera escuela para
ofrecer unni el de licenciatura en enfermer2a#Cuerpo de Enfermeras del
E+>rcito utorizado por el Congreso en 19-1, el Cuerpo de Enfermeras delE+>rcito fue creado para
capacitar a las enfermeras en arias t>cnicas paraayudar a sal ar idas y ayudar a sanar a los
soldados 0ue resulta'an eridosen la 'atalla# Este reconocimiento por parte del go'ierno de 0ue
la educaciónde enfermer2a necesita'a ser formalizada permitió 0ue la profesión deenfermer2a se
con irtiera en un tra'a+o 4lido y respetado# Este simple acto

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis


puso en marc a acontecimientos 0ue cam'iar2an para siempre la faz de
laenfermer2a#Qale un0ue un profesor asistente de la ;ni ersidad de Colum'ia, nnie oodric ,
fue la primera mu+er nom'rada presidenta de la ociedad mericanade uperintendentes de
Escuelas de 5ormación de Enfermeras, Colum'ia noreci'ió la distinción de tener la escuela
autónoma m4s antigua de enfermer2a#Esta distinción se la lle a la ;ni ersidad de Qale, 0ue a'rió
sus puertas en 19)3y tu o la primera escuela de enfermer2a totalmente dedicada al tema# En
19)?,Qale creó la primera licenciatura en ciencias en el programa de grado deenfermer2a y
re0uer2a 0ue los solicitantes completaran dos a.os de estudios
deeducación general antes de 0ue pudieran postularse a la escuela deenfermer2a#Btras
escuelasLa ;ni ersidad de ic igan comenzó a formar a los estudiantes deenfermer2a a finales del
siglo $%$# un0ue no clasifica'a formalmente comouna "escuela de enfermer2a", tu o seis
estudiantes graduados en el a.o 1(93#Durante las siguientes d>cadas, las escuelas de enfermer2a
comenzaron
asurgir en los Estados ;nidos# <oy en d2a ay cientos de colegios,uni ersidades y escuelas t>cnicas
0ue ofrecen alg@n tipo de grado enenfermer2a# Aeor2as5lorence Nig tingale y la filosof2a
en Enfermer2a l a'lar de teor2a de enfermer2a no podemos de+ar de referirnos
a5lorenceNig tingale, 0ue a mediado del siglo $%$plantea'a 0ue elconocimiento de enfermer2a
difer2a muc o del conocimiento de las cienciasm>dicas y de+ó clara la función de la enfermer2a
0ue la distingu2a, as2 comosituar al paciente en las mismas condiciones para 0ue la naturaleza
act@eso're >l# dem4s puntualizó 0ue uno de los resultados de la enfermer2aes conser ar la
energ2a ital del paciente# lanteó 0ue la limpieza, entilación y

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

alimentos eran elementos indispensa'les para la recuperación del enfermo por tal moti o
ense.a'a a sus pupilas estosconceptos as2 como los de am'iente,tran0uilidad y dieta#

Supuestos principales:

Enfermer2a# 6esponsa'ilidad de cuidar la salud de otros, para ello


escri'ióNotes on Nursing 0ue e/plica la pr4ctica de enfermer2a# ersona# Despu>s de las personas
como pacientes 0ue reci'en los
cuidadosde las enfermeras# alud# Definió como salud un estado de 'ienestar 0ue se traduce enap
ro ec ar las energ2as de las personas# <ace diferenciación entre el
om'resano y enfermo cuando plantea las medidas de control del entorno parapreser ar la salud#
Entorno# ;n entorno sano y fa ora'le influ2a en el estado de salud f2sico yps20uico del
om're# or todo lo planteado es 0ue se dice 0ue su teor2a tiene car4cter naturalista# Los
principios 0ue plantea en su o'ra se encuentran igentes en laactualidad#


<istoria de 5lorence Nig tingale

Kuramento de 5lorence Nig tingaleJirginia <enderson !19??G19?-&

Tendencia de s "#encia o a$ da.

Nació en 1(97 en Hansa


City# us fuentes teóricas ten2an la influencia de algunas de sus profesorascomo8 su profesora de
Enfermer2a M4sica, 5ilosof2a, icro'iolog2a, sicolog2a y6e a'ilitación#

Henderson

conceptualizó la función propia de la enfermer2a, 0ue consist2a enatender a la persona sana y


enferma en sus acti idades, para contri'uir a su

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

salud o recuperación, y las 0ue realiza, si tienen fuerza, oluntad yconocimientos necesarios#
Declaró 0ue la actuación de enfermer2a depende delm>dico y 0ue los seres umanos tienen
necesidades '4sicas 0ue de'ensatisfacer y normalmente son cu'iertas por el indi iduo
sano#Aam'i>n denominó como necesidades '4sicas a las acti idades 0ue lasenfermeras realizan
para suplir o ayudar al paciente, aun0ue en su o'ra norealizó ninguna definición de
necesidades# Define a la enfermer2a en t>rminos funcionales como8 "La @nica función deuna
enfermera es ayudar al indi iduo sano y enfermo, en la realización dea0uellas acti idades 0ue
contri'uyan a su salud, su recuperación o una muertetran0uila, 0ue este realizar2a sin ayuda si
tu iese la fuerza, la oluntad y elconocimiento necesario acer esto de tal forma 0ue le ayude a
serindependiente lo antes posi'le" Los elementos m4s importantes de su teor2a son8 1# La
enfermera asiste a los pacientes en las acti idades esenciales alcanzarla muerte en
paz# %ntroduce yRo desarrolla el criterio de independencia delpaciente en la aloración de la
salud# )# %dentifica 1* necesidades umanas '4sicas 0ue componen los
cuidadosenfermeros# Las acti idades 0ue las enfermeras realizan para suplir o ayudar alpaciente a
cu'rir estas necesidades es lo 0ue <enderson denominó cuidados'4sicos de enfermer2a estos se
aplican mediante un plan de cuidados deenfermer2a, ela'orados so're la 'ase de las necesidades
detectadas en elpaciente# Descri'e la relación enfermerapaciente y se destacan 3 ni eles
deinter ención8 sustituta, ayuda o compa.era# porta una estructura teórica 0uepermite el
tra'a+o de enfermer2a por necesidades de cuidado, de esta manerafacilita la definición del campo
de actuación, y al ni el m4s pr4ctico, laela'oración de un marco de aloración de enfermer2a so're
la 'ase de las1* necesidades umanas '4sicas#

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.


Descargar Con Una Prueba Gratis

Supuestos principales

La definición de <enderson acerca de los conceptos '4sicosdel metaparadigma de enfermer2a


son8

%ersona

8G %ndi iduo 0ue re0uiere asistencia para alcanzar salud e independencia, o unamuerte en paz,
la persona y la familia son istas como una unidad#G La persona es una unidad corporalRf2sica y
mental, 0ue est4 constituida porcomponentes 'iológicos, psicológicos, sociológicos y
espirituales#G La mente y el cuerpo son insepara'les#G Aanto el indi iduo sano o el enfermo
an ela el estado de independencia, tienenecesidades '4sicas para la super i encia, por lo 0ue
necesita fuerza, deseosy conocimientos para realizar las acti idades re0ueridas para una ida
sana#

En!orno

8 incluye relaciones con la propia familia y las responsa'ilidades de lacomunidad para pro eer
cuidados#

Sa# d

8G La calidad de salud m4s 0ue la ida es el margen de igor f2sico y mental, lo0ue permite a una
persona tra'a+ar con la m4/ima efecti idad y alcanzar suni el potencial m4s alto de satisfacción#G
Considera la salud como la a'ilidad del paciente para realizar sin ayuda los1* componentes de los
cuidados de Enfermer2a e0uipara salud conindependencia#5aye lemm

Abdellah

u teor2a se 'asa en los tipos de pro'lemas de enfermer2a# lanteó0ue un pro'lema en


enfermer2a es una solución aparente a la0ue se enfrenta el

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

paciente o la familia y 0ue la enfermera de'e ayudar aresol er con suactuación profesional# En su
modelo considera 0ue todo indi iduo tienecapacidad para ayudar, pero esta ar2a de uno a
otro 6econocida como una de las in estigadoras m4s destacadas y me+orconocidas del pa2s en
pol2tica sanitaria y una e/perta en internacional enpro'lemas sanitarios, fue conse+era en
materias relacionadas con laenfermer2a, pol2tica de asistencia a crónicos, retraso
mental incapacidadesrelacionadas con el desarrollo, ser icio de salud domiciliaria, tercera
edad# ospicios y
%D # 'della comprendió 0ue para 0ue la enfermera comprendiera un estatusprofesional
completo y plena autonom2a era indispensa'le 0ue dispusiese deuna 'ase sólida de
conocimientos# Escri'ió )1 conceptos para 0ue pudieseme+orar# Esta identificación y clasificación
de los pro'lemas 0ue se llama'a latipolog2a de los )1 pro'lemas de enfermer2a# 'della la
tipolog2a se di idió entres 4reas8!1& Desarrollo f2sico, sociológicas, y emocionales del
paciente,!)& Los tipos de relaciones interpersonales entre la enfermera y el paciente, y!3&
Los elementos comunes de atención al paciente# d'ella y sus colegaspensaron 0ue la tipolog2a
de proporcionar un m>todo para e aluar a unestudiante de e/periencias y tam'i>n un m>todo
para e aluar una enfermerade la competencia 'asada en las medidas de resultado#

Supuestos Principales

Enfermería

8 La asistencia de la enfermer2a es acer algo a o para las personaso suministrar información a


>sta con o'+eto de descu'rir necesidades, ele ar oresta'lecer la capacidad de autoayuda o ali iar el
sufrimiento#

%ersona

8 Descri'e a la gente como entes con necesidades f2sicas,emocionales y sociológicas# Sstas


pueden ser e identes, en forma denecesidades principalmente f2sicas o encu'iertas, como
las necesidadesemocionales o sociales#

En!orno

8 No ten2a un concepto fi+o pero dec2a 0ue se de'2a crear yRo mantener un entorno
terap>utico# firma 0ue si la relación de la enfermera acia elpaciente es ostil o negati a,
la atmósfera de la a'itación tam'i>n lo ser48

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

afirma 0ue los pacientes %nteraccionan y responden a su entorno y 0ue laenfermera es parte de
ese entorno#

Sa# d

8 Es un estado donde el indi iduo no tiene necesidades sin satisfacer nlun deterioro real o
pre isi'le#Dorot ea de Brem

Teoría de# d&fici! de a !oc idado.

Enfermera norteamericana 0ue dio a conocer su modelo de autocuidadode enfermer2a en su


li'ro Nursing8 Concepts of ractice, pu'licado en 1971# uidea coincide con la de <enderson, para
ella el o'+eti o de la enfermer2a esayudar al indi iduo a mantener por s2 mismo acciones de
autocuidadopara preser ar la salud y la ida, recuperarse de la enfermedad y afrontar
lasconsecuencias 0ue de ellas se deri an#
Orem

clasificó su teor2a del d>ficit de autocuidado en enfermer2a comouna teor2a general o gran
teor2a, integrada a su ez por 3 su'teor2as 0ue seinterrelacionan8 1# El autocuidado !TCómo se
cuidan las personas y por 0u>U&# )# El d>ficit de autocuidado !T or 0u> la Enfermer2a puede
cuidar a laspersonasU&# 3# istemas de Enfermer2a !TVu> relaciones de'en crearse y
mantenersepara 0ue e/ista la
Enfermer2aU&# Definió el autocuidado como la pr4ctica de acti idades 0ue el indi iduoaprende y
orienta acia un o'+eti o8 mantener su salud, seguir i iendo yconser ar su 'ienestar, y responde
de manera consciente a sus necesidadesen materia de salud ! arrie er&, e+emplo, necesidades
de alimentarse, agua yreposo los cuales
son fundamentales# Necesidades espec2ficas en determinados momentos de la ida8 ni.ez,em'ara
zo y e+ez# lantea 0ue el autocuidado es imprescindi'le para la ida y,si faltan pro ocan la
enfermedad y la muerte# Los m>todos de asistencia 0ue

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

plateó Brem se 'asa en la relación de ayuda yRo de suplencia de enfermer2a acia el paciente#

Supuestos Principales

%ersona

8 Brem la define como el paciente, un ser 0ue tiene funciones'iológicas, sim'ólicas y sociales, y con
potencial para aprender y desarrollarse#Con capacidad para autoconocerse# uede aprender
a satisfacer los re0uisitosde autocuidado si no fuese as2, ser4n otras personas las 0ue le
proporcionenlos cuidados#

En!orno

8 es entendido en este modelo como todos a0uellos factores, f2sicos,0u2micos, 'iológicos y


sociales, ya sean >stos familiares o comunitarios, 0uepueden influir e interactuar en la persona#

Sa# d

8 es definida como Wel estado de la persona 0ue se caracteriza por lafirmeza o totalidad del
desarrollo de las estructuras umanas y de la funciónf2sica y mentalX, por lo 0ue la salud es un
concepto insepara'le de factoresf2sicos, psicológicos, interpersonales y sociales# %ncluye la
promoción y elmantenimiento de la salud, el tratamiento de la enfermedad y la pre ención
decomplicaciones#

Enfermería como c idados

# El concepto de cuidado surge de lasproposiciones 0ue se an esta'lecido entre los conceptos de


persona, entornoy salud, si 'ien incluye en este concepto el o'+eti o de la disciplina,
0ue esWayudar a las personas a cu'rir las demandas de autocuidado terap>utico o acu'rir las
demandas de autocuidado terap>utico de otrosX# uede utilizarm>todos de ayuda en cada uno de
los sistemas de enfermer2a#

Aeor2a eneral de Brem art a E


6ogers odelos# eres umanos unitarios, se 'asa en la concepción del om'recomo un todo
unificado en constante relación con su
entorno# lantea 0ue el o'+eto fundamental de la enfermer2a es ayudar al indi iduopara 0ue
pueda alcanzar su m4/imo potencial de salud#

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

6ogers e/pone en su o'ra 0ue la enfermera para lograr su o'+eti o de'erecoger datos 0ue
conciernen al paciente y su entorno, utilizar t>cnicasintelectuales y manuales, en especial de
relaciones umanas# Los cuidados de enfermer2a se 'rindan a partir de un proceso planificado0ue
incluye8 1# Jaloración !recogida de datos&# )# lanificación !esta'lecimiento de o'+eti os,
cuidados de enfermeGr2a&# 3# E aluación !percepción durante el proceso de
inter ención&# La atención de enfermer2a era dirigida a pacientes con pro'lemas realeso
potenciales y regula'a las relaciones con el ser umano y su entorno

Supuestos Principales

Enfermería

8 eg@n 6ogers la enfermer2a es una profesión 0ue re0uiereaprendiza+e y 0ue se puede


interpretar como una ciencia y como un arte# El tipode enfermer2a 0ue descri'ió 6ogers se centra
en el inter>s por las personas yel mundo en 0ue i en, papel 0ue enca+a a la perfección con la
enfermer2a,puesto 0ue a'arca a las personas y al entorno en 0ue i en#

%ersona

8 6ogers define el concepto de persona como un sistema a'ierto enproceso continuo con el
sistema a'ierto# Descri'e al ser umano unitario comoW;n campo de energ2a irreduci'le, indi isi'le
y pan dimensionalX

Sa# d

8 6ogers utilizo este supuesto sin una definición como tal en un principio#Ella utilizo el concepto
salud pasi a para sim'olizar un estado saluda'le y laausencia de enfermedad #

Medio Am'ien!e
8 6ogers defin2a este como irreduci'le, un campo de energ2a

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

pan dimensional identificado por patrones y caracter2sticas diferentes# Cadacampo del


medioam'iente esta espec2ficamente para un campo umano yam'os cam'ian continuamente y
creati amente# or Callista 6oy

Mode#o de #a ada"!aci(n.

6oy definió su modelo de adaptación en 19=*, se 'asa en la concepcióndel ser umano como
indi iduo 'iopsicosocial en constante interacción con suentorno cam'iante, y del 0ue reci'e
est2mulos 0ue se de'en adaptar paraconser ar la salud# u o'ra plantea 0ue el paciente de'e
adaptarse en * 4reas como81# Necesidades psicosocial# %ncluye circulación, sue.o, acti idad,
alimentacióny eliminación#)# Necesidad de autoimagen# daptación a nue as im4genes
corporales#3# 5unción real o papel# l enfrentar la función de madre, ni.o, padre, enfermoo
+u'ilado#*# %nterpersonales# El modo adaptaciónGinterdependencia se refiere a lainteracción de
6oy el paciente reci'e cari.o, amor, respeto y estima en lasrelaciones interdependientes# lantea
0ue el proceso de cuidados en el paciente comprende las fasessiguientes81# Jaloración)#
lanificación#3# ctuación*# E aluación#?# La atención se centra en el paciente#

Supuestos Principales

Ada"a!aci(n

# e refiere "al proceso y al resultado por los 0ue las personas,0ue tienen la capacidad de pensar y
de sentir, como indi iduos o comomiem'ros de un grupo, son conscientes y escogen la integración
del ser umano con su entorno"# e trata de 0ue cada ida umana tiene una funciónen un
uni erso creador y las personas no se pueden separar de su entorno#

Enfermería

# 6oy define la enfermer2a como la ciencia y la pr4ctica 0ue ampl2a

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

la capacidad de de adaptación y me+ora la trasnformación del entorno# Laenfermera actua para


me+orar la interacción entre la persona y su entorno parafomentar la adpatación#

%ersona
# 6oy define la persona como sistemas ol2sticos y adapta'les# "Comotodo sistema adapta'le, el
sistema umano se define como un todo, con partes0ue funcionan como una sola unidad para un
propósito concreto"# Laspersonas y el mundo tienen en com@n los modelos, y comparten
relaciones ysignificado# La persona es el foco principal de la enfermer2a el receptor
de laasistencia un sistema de adaptación comple+o y i o compuesto por procesosinternos y 0ue
act@a para mantener la capacidad de adaptación en los cuatromodos de ida !el fisiológico, la
autoestima, la función del rol y lainterdependencia&#

Sa# d.

Es el estado y el proceso de ser y de con ertirse la persona en un serintegrado y comple+o# Es un


refle+o de la adaptación, es decir, es la interrelaciónde la persona y su entorno# La salud y
la enfermedad forman una dimensiónine ita'le y coe/istente 'asada en toda la e/periencia de la
ida 0ue tiene lapersona# La salud no consiste en li'erarse de la muerte, las enfermedades,
lainfelicidad y el estr>s, sino 0ue es la capacidad de com'atirlos del me+or modoposi'le#

En!orno

# Es el con+unto de todas las condiciones, circustancias e influenciasdel desarrollo y de


la conducta de las personas y de los grupos, con unaespecial consideración a la relación entre los
recursos del om're y de la tierra,donde se incluyen los est2mulos focales, conte/tuales y
residuales# Es elentorno cam'iante el 0ue empu+a a la persona a reaccionar para adaptarse#%da
Kean Brlando La teor2a de enfermer2a de Brlando ace incapi> en la relación rec2procaentre el
paciente y el enfermeroRa# am'os les afecta lo 0ue el otro diga
o aga# Brlando facilita con ello el desarrollo de los enfermerosRas comopensadores lógicos y no
como simples e+ecutores de las órdenes del m>dico#5ue una de las primeras enfermeras 0ue izo
incapi> en los elementos delproceso de enfermer2a y en la importancia cr2tica de la
participación delpaciente durante el proceso de
enfermer2a# La disciplina del proceso enfermero de esta autora muestra elementos derelación
terap>utica 0ue incluyen la empat2a, la e/presión, la cordialidad y la

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

autenticidad# La aplicación de la disciplina proporciona una gu2a espec2fica paradescu'rir las


necesidades inmediatas del paciente8

En primer lugar, la enfermera comunica al paciente, parcial o totalmente,su reacción ante la


conducta de >ste#


En segundo lugar, de'e especificar 0ue la opinión e/presada lecorresponde @nicamente a ella,
utilizando la primera persona delsingular#

or @ltimo, de'e conseguir 0ue el paciente erifi0ue o corri+a suspercepciones, pensamientos,


sentimientos y, antes de la decisión final yde actuar, de'e consultarlo con el propio paciente
!Brlando, 199-&# La relación de la teor2a enfermeraGpaciente es glo'al y din4mica#
El fenómenodel encuentro enfermera paciente representa la fuente principal deconocimiento
enfermero# eg@n la autora, el estr>s y la angustia en el pacientees la causa de las reacciones en
su entorno y >l no es capaz de controlarlosolo# El estr>s 0ue supone la ospitalización es m4s la
reacción al entorno ospitalario 0ue a la enfermedad# La angustia y la tensión del
pacienteaparecen como consecuencia de las falsas interpretaciones de sus propiase/periencias,
todas estas situaciones re0uieren una ayuda 0ue la enfermerade'e 'rindar al paciente a tra >s
de su proceso de cuidado

S " es!os "rinci"a#esEnfermería

8 Es una profesión independiente 0ue funciona de una maneraautónoma# La función de la


enfermer2a profesional se conceptualiza como laa eriguación y la atención a las necesidades de
ayuda inmediatas del paciente#El enfo0ue de Brlando so're el proceso de enfermer2a estar2a
compuesto porlos siguientes elementos '4sicos8 la conducta del paciente, la reacción
delenfermeroRa, y las acciones de enfermer2a 0ue se esta'lecen para 'eneficio delpaciente# La
interacción de estos elementos entre s2 constituye el proceso deenfermer2a# Los enfermerosRas
de'en ali iar el malestar f2sico o mental y node'en aumentar el distr>s del paciente#

%ersona

8 Las personas presentan conductas er'ales y no er'ales# on

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

capaces de satisfacer sus propias necesidades de ayuda en algunassituaciones, pero 0ue


sufren cuando son incapaces de acerlo# losenfermerosRas sólo de'en in0uietarle a0uellas
personas 0ue son incapaces dee/presar claramente su necesidad de ayuda#

Sa# d

8 No define la salud# dmite 0ue la ausencia de sufrimiento mental of2sico y la sensación de


comodidad y 'ienestar contri'uyen a la salud#

En!orno

8 No define el entorno# sume 0ue la situación de enfermer2a se dacuando e/iste un contacto


entre enfermeroRa y paciente y tanto uno como otroperci'en, piensan, sienten y act@an en la
situación inmediata# Destaca 0ue unpaciente puede reaccionar sufriendo ante cual0uier aspecto
de un entorno 0ue a sido dise.ado con fines terap>uticos y de ayuda#

Está leyendo una previsualización

Desbloquear el acceso completo con una prueba gratis.

Descargar Con Una Prueba Gratis

………………Servicios de Orientación y Atención al Indígena garantizan la inclusión en el SPNS

3 MARZO 2009SALUDINDIGENA

Cargado originalmente por Salud Indígena Vzla

Con el objetivo de incorporar el enfoque intercultural en el Sistema Público Nacional de Salud


(SPNS) la Dirección de Salud Indígena del Ministerio del Poder Popular para la Salud inició en abril
de 2005 la implementación de los Servicios de Atención y Orientación al Indígena, con una primera
experiencia en el Servicio Autónomo Hospital Universitario de Maracaibo. Basados en esta
experiencia y ampliando el radio de acción se inició el proceso de aperturas en otras instituciones
de referencia nacional en los ocho estados con población indígena.

En estos espacios se desarrollan actividades docentes y de investigación; se emplean recursos


humanos indígenas bilingües que permiten reducir barreras étnicas, culturales y lingüísticas;
brindan soporte a la relación equipo de salud/paciente; desarrollan actividades de capacitación y
sensibilización del equipo de salud en materia de interculturalidad, y enseñanza de idiomas
indígenas; gestionan soluciones a los reclamos, demandas y necesidades de los pacientes;
recolectan, procesan, analizan y transmiten la información obtenida de los pacientes atendidos.

Para la directora de Salud Indígena del Ministerio para la Participación Popular de la Salud la
creación de estas oficinas “tiene que ver con la transversalización de la interculturalidad en salud
en el tercer nivel de atención, con lo contemplado en la Constitución, con el reconocimiento a la
medicina tradicional y el respeto a los usos y costumbres, y tiene que ver con la aplicación de la
Ley Orgánica de los Pueblos y Comunidades Indígenas (LOPCI).”

Explica que frecuentemente muchos pacientes indígenas que requieren atención medica en los
establecimientos hospitalarios del país, suelen encontrarse totalmente desorientados, sin saber a
dónde dirigirse, enfrentándose con un personal sin entrenamiento en interculturalidad ni
sensibilidad hacia los usuarios indígenas, que a veces sin siquiera saberlo, maltratan al
indígena.Cuando el paciente es monolingüe (no habla español) la situación es aún más difícil.
Simplemente no puede hacerse entender ni comprende las indicaciones del médico. Esto genera
mala comunicación e incomprensión entre el personal de salud y el paciente, dificultando el
proceso de diagnóstico y la eficacia terapéutica, con el consiguiente fracaso en el restablecimiento
de su salud.

De allí que desde la Dirección de Salud Indígena del MPPS se han trazado como objetivos mejorar
la comunicación entre el personal de salud y los pacientes indígenas que así lo requieran;
sensibilizar a todo el personal de salud para generar cambios de actitud y prácticas, optimizando el
respeto y tolerancia a los pacientes y familiares según su situación socio cultural y económica,
además de garantizar y consolidar las prácticas, conocimientos y percepciones de los Indígenas de
las zonas rurales y urbanas con relación a la salud-enfermedad.

De igual forma se pretende brindar la orientación y atención oportuna a los pacientes indígenas
que requieran los servicios hospitalarios de la institución;
viabilizar la estadía del familiar y/o paciente en las Casas Interculturales de Hospedaje, realizar
acompañamiento, seguimiento y evaluación de la situación del paciente en sus diferentes fases
que requiera de atención y Coordinar con la unidad de Atención al Paciente del establecimiento
hospitalario las posibles soluciones a las eventualidades que se presenten en la atención del
paciente indígena.

……………………………

UNIDAD I: EVOLUCIÓN HISTÓRICA DE LA ENFERMERÍA Y SU NATURALEZA.

CONTENIDO

UNIDAD I :
EVOLUCIÓN HISTÓRICA DE LA ENFERMERÍA Y SU NATURALEZA.

1.1 Historia de enfermería en el mundo, América y en Venezuela. Historia de la enfermería en


Venezuela: Atención Indígena, Movimientos pro-independentistas.

1.2 Creación de escuelas de enfermería. Proyecciones futuras. Naturaleza de la enfermería.


Concepto de enfermería, filosofía, metas, objetivos y características de profesión, ocupación y
oficio. Teorías de Enfermería, modelos y tendencias en enfermería

INTRODUCCION
La naturaleza de la enfermería como ciencia, se ubica como ciencia humanística del cuidado,
incluidos los aspectos de la práctica, las relaciones que se desarrollan entre las personas cuidadas
y las enfermeras, y la perspectiva de salud y bienestar (Meleis, 1997).

La enfermería a través de la historia ha tenido diversas orientaciones y por ende varias

definiciones que le han otorgado diferentes formas de proyección e impacto profesional y social;
sin embargo, es indiscutible que ha demostrado tener un importante valor en cuanto a dar
respuesta a la demanda de salud y vida de la persona, así como de los colectivos humanos.

Lo anterior evidencia la importancia de reconocer y determinar cuál ha sido y es la naturaleza de la


enfermería, con el propósito de contribuir a la comprensión de su esencia, para reafirmar su
importancia y trascendencia como ciencia del cuidado a las personas, familias y comunidades en
condiciones de salud y enfermedad.

El reconocimiento de dicha naturaleza también constituye un elemento básico para alcanzar y


reforzar la profesionalización, identidad y autonomía profesional en estudiantes y enfermeras(os)
profesionales.

Esta primera unidad propone contenidos que te permitirán reconocer la evolución de enfermería a
través de diferentes definiciones por las que ha transitado a lo largo de su historia; asimismo, te
aportará elementos teóricos para su compresión y diferenciación como profesión y disciplina, por
medio del reconocimiento de los elementos que caracterizan dichos aspectos.

HISTORIA DE LA ENFERMERIA POR ETAPAS

ETAPAS HISTÓRICAS DEL CUIDADO. ETAPA VOCACIONAL. MARCO CONCEPTUAL DE


ENFERMERÍA.
La etapa vocacional surge con el inicio del cristianismo y se prolongaría hasta los inicios de la etapa
contemporánea.

…INICIO DEL MUNDO CRISTIANO…

La primera fase de presencia cristiana en el mundo occidental se denomina Fase Primitiva o


Evangélica y tuvo un siglo y medio de duración (hasta el siglo V).

La enfermedad se entendió como una gracia recibida y un modo de redención. El cristianismo


fomentaba la introducción del consuelo en la asistencia al enfermo y moribundo, y con ello se
conseguía ganar el cielo, las personas debían dejarse de preocupar por sí mismas y debían
ocuparse de forma altruista a servir a los demás. Así nació el cuidado de los enfermos como una
obra de misericordia.

Las primeras cuidadoras fueron diaconisas destacadas Febe y Olimpia, eran mujeres de buena
cuna y elevada posición social que brindaban auxilio a los hogares más necesitados. Las viudas
desempeñaron un papel importante en la creación de hospitales y las vírgenes relacionadas con la
práctica de la caridad entre los necesitados. Las matronas romanas destacaron Marcela, Fabiola y
Paula.

Los cristianos no dieron importancia a la ayuda médica o técnica al enfermo, a lo que también
contribuyo la estructura social de las primeras comunidades cristianas, sin embargo si es
importante la ayuda y asistencia al enfermo.

Para el cuidado del enfermo se tomo como referencia los hospitales militares del Imperio Romano,
la diferencia era que los hospitales cristianos se incluían los cuidados prolongados, mientras que
en los romanos se ofrecía una primera asistencia y un periodo de convalecencia, para devolver
cuanto antes a los soldados al ejército, se construyeron los xenodoquios; es importante tener en
cuenta que en esta época, aunque intentaban curar a los enfermos de sus dolencias físicas, ponían
mayor interés en tratar las afecciones del alma. El xenodoquio mas famoso perteneció a San
Basilio, obispo de Cesárea.
…ALTA EDAD MEDIA…
Aparecieron modos de vida, tales como el feudalismo, el monasticismo y el islamismo.

1. La Europa Medieval.
A pesar de las pestes y epidemias creían que la enfermedad era una gracia enviada por Dios, los
pueblos que no abrazaron la religión de Cristo permanecieron en la convicción de que la
enfermedad era un castigo por una desaprobación divina, cuando se fusionaron esas dos creencias
se generalizó la interpretación de que la causa de la enfermedad era el pecado, cuya curación
pasaba indiscutiblemente por la intervención divina.

“La asistencia al enfermo fue en todo este período más una obra de caridad o de misericordia que
de justicia, más patrimonio de la Iglesia que del Estado, más ejercicio de sacerdotes que de
médicos”.

Estas características de atención al enfermo determinaron una nueva etapa de presencia cristiana
en el cuidado: Fase Medieval o de la Beneficencia Eclesiástica.

Los cuidadores en la época fueron las mujeres de los señores feudales que se dedicaban a cuidar
los enfermos de sus tierras a través de la medicina empírica; también los monjes en lo referente a
los monasterios, Magos y brujos practicaron la superstición y el misticismo, los remedios empíricos
fueron empleados por barberos, sangradores, cirujanos y matronas; existieron los médicos
técnicos pero eran muy escasos y solo ejercieron para las clases altas, así el pueblo recurría a los
medios empíricos y credenciales.

Una de las primeras universidades fue la de Salerno, que representa la transición de la medicina
monástica a la laica, una de las más insignes medicas expertas fueron Trótula y Abella, y el trabajo
más famoso fue el Régimen Sanitatis Salernitanum.

El hospital medieval aparece íntimamente ligado a la religión y presto atención por motivos
exclusivamente caritativos. Los hospitales más importantes y famosos fueron los de Lyon, Paris,
Roma y Londres.

Aunque las primeras cuidadoras fueron seglares, luego fundaron la Orden de las Agustinas,
considerada la más antigua de hermanas puramente enfermeras, hospitales destacados fueron el
Hospital del Santo Spirito de Roma fundado por Inocencio III y el Hospital de Santa Catalina y San
Bartolomé fundado por iniciativa de un bufón de la Corte de Enrique I.

2. El Islam y la Asistencia a los Enfermos.


El saber anatómico de los árabes era muy escaso, por no poder practicar la disección al considerar
impuros los cadáveres, pero la farmacopea progresó mucho.

Los médicos se formaban en escuelas instaladas en mezquitas o cerca de ellas, los ricos tenían sus
propios médicos y los pobres eran atendidos en hospitales públicos. Entre los médicos destacados
están: Rhazes, Avicena, Maimónides y Averroes.

Los conocimientos médicos de los árabes provenían de la unión geográfica del monoteísmo
islámico y la cultura helénica.

Los hospitales se construyeron en grandes ciudades como Damasco y Alejandría, donde se trataba
a los enfermos sus aspectos físicos, mentales y espirituales; los médicos eran expertos que
proporcionaban tratamientos y fármacos gratuitos y entre los hospitales destacados estaban el
Hospital de Bagdad y El Hospital de El Cairo.

…BaJa EdAd MeDiA…


Aumento rápido de los hospitales debido a la demanda. Los existentes estaban organizados para
atender principalmente a huérfanos, viajeros y menesterosos. La iglesia no tuvo como fin primario
la asistencia médica. Los hospitales estaban destinados a los pobres. En ellos se ejercieron
principalmente las obras de misericordia. Se originó un exceso de población, los recursos
sanitarios e higiénicos, como la provisión de agua pura y alimentos, eran limitados o nulos para
atender las necesidades del aumento poblacional. Los barrios se convirtieron en focos de
delincuencia, violencia y muerte.

La cultura europea floreció y se inició la fundación de escuelas de medicina. En el siglo XIV


volvieron a surgir epidemias de peste, favorecidas por la falta de higiene en esta época, brotó la
peste negra y la enfermedad del sudor (probablemente la gripe). Junto a la peste apareció la lepra,
que estuvo muy extendida, llegándose a crear para los enfermos afectados ciudades llamadas
lazaretos. El lazareto tenía una estructura que consistía en una empalizada o una muralla con un
foso de agua para evitar que entrara o saliera nadie. Contaba, además con una iglesia, una serie de
casetas de madera donde vivían los enfermos y un cementerio.

La redistribución de la población y el crecimiento de las ciudades determinaron que los cuidadores


salieran de las instituciones y volvieran de nuevo a los domicilios.

Se fundaron organizaciones de tres tipos: Ordenes Militares, Religiosas y Seglares.

1. Órdenes Militares.
Se le llamó la Orden Hospitalaria porque fundaron muchos hospitales en el camino de las
peregrinaciones. La aportación al cuidado fue la jerarquización de los servicios enfermeros y la
importancia de los uniformes.
Entre las órdenes destacadas están la de los Caballeros Hospitalarios de Jerusalén, la Orden de los
Caballeros Teutónicos y la más antigua la de los Caballeros de San Lázaro.

2. Órdenes Religiosas o Mendicantes.


Se les llamaba mendicantes porque dependían de la mendicidad para su sustento. Surgieron como
respuesta a la rápida propagación de enfermedades epidémicas. Destaco la Orden Franciscana.
San Francisco fundó tres órdenes religiosas: Orden de los Frailes Menores, Orden de las Clarisas
Pobres y la Orden de los Terciarios. Entre los nombres más destacados que pertenecieron a esta
Orden figuran: Isabel de Hungría y Catalina de Siena.

3. Órdenes Seglares.
Fueron órdenes formadas por personal semi-religioso que no seguían votos, destacan los
Hermanos Hospitalarios de San Antonio, Las Beguinas y las Hermanas del Hotel Dieu de Paris.

Aunque en ocasiones ejercieron la enfermería hospitalaria, fundamentalmente realizaron


cuidados en la comunidad a enfermos, pobres, huérfanos y abandonados. Como aportación a la
enfermería se destaca: la secularización del cuidado y la libertad en el trabajo de la comunidad.

Todo esto se conoce como la Época Oscura de la Enfermería, coincidiendo con el inicio del Mundo
Moderno.
…MuNdO mOdErNo….
La incesante actividad intelectual hizo que surgieran nuevos conocimientos de anatomía, fisiología
y patología:

- Paracelso (1493-1541) suizo iniciador de la Farmacología, introduciendo el uso del mercurio en el


tratamiento de la sífilis. fue el primero en advertir que a ciertos tipos de trabajo se asociaba una
patología determinada y específica.
- Bernardino Ramazzini (1633-1717) aparecieron los cimientos de la Medicina del Trabajo,
publicando el libro clásico de Medicina del Trabajo De morbis artificum diatribo, e hizo
recomendaciones de que la historia clínica era un dato esencial para el diagnostico de la
enfermedad.

- Philippe Pinel (1745-1826) francés reformador de la psiquiatría y precursor de la moderna


psicopatología.

- Edward Jenner (1749-1823) inglés que realizo de forma científica las primeras experiencias sobre
la inmunización de la viruela siendo los orientales los primeros en utilizarla de forma empírica.

- Thomas Sydenham (1624-1689) considerado el Hipócrates ingles siendo el clínico más


importantes del siglo XVII. Su estudio sobre las fiebres fue uno de los más destacados.
- Giambattista Morgagni (1682-1771) italiano, su obra fundamental, Sobre los lugares y las causas
de la enfermedad (1761).
- James Lid (1716-1794) descubrió la solución al problema del escorbuto, y sus trabajos sobre la
malaria.
Los científicos de la época desecharon los textos clásicos al conocerse mejor el cuerpo humano,
gracias a la práctica de la disección, como:
- Andrés Vesalio (1514-1564) belga escribió una obra de anatomía titulada: De corporis humani
fábrica.
- William Harvey (1578-1657) ingles que realizo diferentes estudios sobre embriología y probo
científicamente junto con el español Miguel Server la circulación de la sangre, la sístole, diástole y
circulación pulmonar.
- Johannes Kepler (1571-1630) alemán que descubrió la función de la retina y estableció las leyes
que gobiernan los movimientos planetarios.
- Gabriele Fallopio (1523-1562) italiano descubrió los ovarios y las trompas de Falopio.
- Lazzaro Spallanzani (1729-1799) italiano que amplió la teoría de Lavoisier acerca de la
respiración, descubrió la función de la saliva, el jugo gástrico y estudio el desarrollo de los
microorganismos.

A pesar de estos avances, el pueblo llano siguió considerando la enfermedad desde el aspecto
sobrenatural, manteniéndose al margen de las consideraciones basadas en conocimientos
científicos.
Las enfermedades que padecieron estuvieron relacionadas con el género de vida, diferenciándose
las padecidas por los nobles y ricos, y las del pueblo llano. Las enfermedades de los cortesanos por
tener una vida sedentaria y alimentación a base de carne: la gota, el reuma y la litiasis, el
proletariado y el pueblo sufrió desnutrición y raquitismo por el hambre y luego apareció la dieta
del alcohol. Las enfermedades infecciosas estuvieron favorecidas por las deficientes condiciones
de salubridad, por el pueblo llano principalmente gastro-intestinales como las de tipo tifoideo,
sífilis y la gripe, disminuyo la peste por la práctica desaparición de la rata negra, pero apareciendo
la rata gris. Aparecieron las neurosis en las mujeres, fomentadas por las represiones de todo tipo,
denominadas histerias, aunque la mujer y los niños comenzaron a tener una relativa importancia
social y los médicos se dedicaron a la Obstetricia, la Ginecología y la Pediatría.

La calidad del cuidado se vio influenciada por el Protestantismo. Las personas que en esta época
se incorporaron al cuidado de los enfermos fueron en su mayoría mujeres de vida alegre,
entregadas a la bebida y, frecuentemente, procedentes de cárceles. El interés de estas mujeres
por instalarse en los hospitales como enfermeras no fue otro que el de tener aseguradas la cama y
la comida. Los conocimientos y los sentimientos humanitarios eran totalmente nulos. En el trabajo
carecieron de organización y supervisión. El resultado de estos hechos hizo que los cuidados
llegaran al nivel más bajo de la historia, siendo conocida esta etapa como Época Oscura de la
Enfermería. La contrarreforma fue convocada por el Papa el Concilio de Trento, destacados: los
Hermanos de San Juan de Dios (cuidados a enfermos mentales y niños), Hermanos Terciarios
Franciscanos con la Orden de la Visitación de María (basada en visitas domiciliarias, destacaron:
San Francisco de Sales y Juana de Chantal) y Las Hijas de la Caridad (mas tarde pasando a
denominarse Congregación de las Hermanas de la Caridad, destacaron el francés Vicente de Paúl y
Luisa de Marillac).

Los remedios tuvieron carácter religioso, frente a las epidemias hacían grandes procesiones;
astrológico, consideraban un recurso importante la consulta a los astros y mágico, el pueblo llano
creía en el poder real, y que el rey tenia poder curativo con la imposición de las manos.

Igualmente, los grandes inventos que surgieron desde el año 1600 hasta el 1800 tuvieron
relevancia para la aplicación en Medicina. Entre ellos destacan el barómetro, el termómetro, el
microscopio, etc. En el siglo XVI se inició la invención de técnicas para la aplicación en el
diagnóstico y tratamiento de las enfermedades. Se puso en práctica la ligadura de arterias y el
vendaje cuidadoso como tratamiento de la hemostasia, que hasta entonces se realizaba con aceite
hirviendo. La inyección intravenosa se llevó a cabo por primera vez de forma experimental en un
perro, en 1656. La transfusión sanguínea se menciona por primera vez en 1666. Las primeras
experiencias sobre la medida de la presión arterial se deben a Stephen Hales, que introdujo un
tubo en la carótida de un caballo, relacionando la frecuencia cardiaca con el esfuerzo y el reposo.

Por la progresiva secularización del hospital, se crean órdenes religiosas aptas para servir en los
hospitales civiles, la presencia de la iglesia en esta época es considerada como la Fase Moderna o
de la Beneficencia Civil.

…EtApA vOcAcIoNaL eN eSpAñA…


Esta etapa se ha dividido en dos períodos: el primero comprende los primeros quince siglos y el
segundo se centra en la Época Moderna de la Historia (siglos XVI, XVII y XVIII).
1. Primeros Quince Siglos.
De los aproximadamente 100 hospitales que existían antes del año 1500, el primero fue fundado
en el año 580 en Mérida por el obispo Masona. Entre los años 1501 - 1504 se inició la construcción
de tres hospitales monumentales: el de la Santa Cruz en Toledo, destinado a enfermos mentales, y
los Reales Hospitales de Santiago y de Granada. En Madrid, finalizado el siglo XV, Dña. Beatriz
Galindo fundó un hospital al que el pueblo denominó de La Latina, el mismo nombre con el que
era conocida su erudita fundadora.

Hay evidencias de que antes del año 1500 existieron los cuidadores en los hospitales españoles.
Igualmente, está documentada la existencia de un personal que llevó a cabo los cuidados
descritos, ejercidos tanto por órdenes religiosas (Las órdenes religiosas que se establecieron en
España fueron las mismas que lo hicieron en Europa en la Edad Media) como por personal seglar
(mujeres y sirvientas con salario).

2. Época Moderna.
En España no triunfó el Protestantismo, razón por la cual la presencia de las órdenes religiosas en
la atención a los enfermos continuó como en épocas pasadas, así no se hizo tan patente la llamada
Época Oscura de la Enfermería.

El aspecto más remarcable es, tal vez, el alto grado de división del trabajo, en lo relativo a los
cuidados que se prestaban, como ejemplo, el Hospital de la Santa Cruz de Barcelona, que en 1756
describió cuarenta y ocho puestos de trabajo distintos. A partir del siglo XVII se implantaron libros
de registro de pertenencias, de entradas y salidas de enfermos e incluso de control de la
medicación. Por lo general existía un libro de recetas de medicinas, donde el personal cuidador
escribía las órdenes de médicos y cirujanos, actividades que se pueden considerar dentro del
apartado de trabajos de secretaría y escritura.

Como en la época anterior, el personal cuidador lo forman los grupos seglares y las órdenes
religiosas. Destacaron Teresa de Jesús, Juan de la Cruz, Camilo de Lelis, Ignacio de Loyola, los
Hermanos de San Juan de Dios y las Hijas de la Caridad. Entre estas mujeres precursoras de las
enfermeras, destacaron Ana de Obregón y Luisa de Huerta, mujeres de alta esfera social, que
durante muchos años ejercieron en la Corte.

Se evidenció la preocupación por evitar los contagios. Las medidas de prevención se extendieron
en el siglo XVIII entre éstas, la desinfección de viviendas y ropas, las cuarentenas, la purificación de
barcos y correos, el examen de viajeros, etc

Las enfermeras han asumido la responsabilidad de formar a sus propios profesionales, de


organizar y dirigir los servicios de enfermería y de iniciar investigaciones encaminadas a
incrementar su cuerpo disciplinar. Es una actividad basada en el empirismo y centrada en la
técnica, se ha pasado a orientar el cuidado en un marco teórico propio, utilizando una
metodología lógica y racional, como lo demuestra el uso generalizado del proceso de enfermería y
la formulación de diagnósticos enfermeros.
…PROFESIONALIZACIÓN DEL CUIDADO…

La profesionalización del cuidado significa, entre otras cosas, la autonomía de la enfermería.


Existen dos factores que son decisivos para el reconocimiento de la enfermería como profesión: el
formal y sociológico.

1. Factor Formal.
Como algunas Organizaciones que luchan para elevar la calidad de la profesión y del servicio en su
más alto nivel.

- Consejo Internacional de Enfermeras (CIE).


- Asociación Americana de Enfermeras (ANA) fundada en 1890.definio el ejercicio profesional
como “el diagnóstico y tratamiento de las respuestas humanas a problemas de salud reales o
potenciales.”
- En el Reino Unido, el Real Colegio de Enfermería (RCN), fundado en 1916.
- En España, la asociación profesional es el Consejo General de Enfermería, que aglutina a los
diferentes Colegios Oficiales.
- El establecimiento del primer Código de Ética para enfermeras, aprobado en el Congreso de
1953, celebrado en Brasil.
- La Asociación Española de Enfermería Docente (AEED), creada en 1978.

Los Estados Unidos de América fueron los primeros en integrar los programas de enfermería en la
universidad a finales del siglo XIX (1889-1900). Gran Bretaña lo hizo en 1955. En España los
estudios de enfermería se integraron en la universidad en el año 1977.

Las normas legales respaldan jurídicamente la actividad profesional.

2. Factores Sociológicos.
Según Nuria de Aguilera:

- La concepción del ser humano es holísticamente.


- Los cambios en el concepto de salud-enfermedad, actualmente el cuidado se dirige a la
promoción de la salud y a la atención en la enfermedad, reconocida la salud por todas las
naciones, como una de las mayores riquezas y un derecho primordial.
- Las distintas formas de enfermar, depender y morir; los nuevos estilos de vida favorecen la
aparición de problemas de salud, que en muchos casos requieren cuidados más que curación.

Se da una especial atención a enfermos crónicos, ancianos, niños, mujeres embarazadas, los
disminuidos físicos y mentales, personas con problemas de conducta, etc.

…CAMPO DE ACTUACIÓN DE LA ENFERMERA PROFESIONAL



Se ha pasado de una actividad al servicio del médico a un servicio centrado en las personas (sanas
o enfermas). La función de la profesión en la actualidad es cuidar, al conjunto de acciones que las
enfermeras llevan a cabo en su actividad igualmente se les denomina función.

Las actividades que las enfermeras pueden llevar a cabo pueden ser de tipo asistencial, docente,
de administración y de investigación.

1. Asistencial.
Es la más conocida y con la que más se identifica a las enfermeras. En las personas sanas su
objetivo es conservar la vida y prevenir la enfermedad; en las enfermas, seria atender sus
necesidades básicas, reducir molestias, apoyar en la adaptación a la enfermedad, mantener la
motivación en los procesos de atención y/o ayudar a una muerte digna.

La función asistencial la desarrollan las enfermeras a través del proceso de cuidar, que
comprende: valoración, diagnostico, planeación, ejecución y evaluación.

2. Docente.
Obligadas a desarrollar constantemente sus conocimientos para una mejor calidad de la atención.
Su actividad es un conjunto de actividades dirigidas a formar a las personas que integran el equipo
de enfermería en todos los niveles (básico, superior y especializado) a través de conocimientos en
cursos, conferencias, congresos, etc.

3. Administración.
Tiene responsabilidades de planificación, organización y control de los servicios de enfermería. La
administración es actividad sistemática que desarrolla un grupo humano, empleando una serie de
recursos para conseguir un fin eficiente y eficaz y que produce un beneficio social a quien lo ejerce
y a quien va dirigido, trata de asegurar que las actividades que deben desarrollarse en los distintos
campos de actuación se realicen de forma sistemática, racional y ordenada, respondiendo a las
necesidades y asegurando el uso adecuado de los recursos con los recursos con que cuenta.

Las actividades que conforman el proceso de administración son: planificación, organización,


dirección y control.

4. Investigación.
Tiene la obligación de profundizar en sus conocimientos de forma constante, relacionada tanto
con los principios teóricos como con la práctica profesional. Según M. Moliner, investigar es “hacer
gestiones o diligencias para llegar a saber cierta cosa.” La investigación es un proceso sistemático,
formal y riguroso, que trata de obtener soluciones a los problemas y/o descubrir e interpretar
nuevos hechos y sus relaciones. Tiene como meta el aumentar el saber y los conocimientos, por lo
que nos lleva al dominio de lo que nos rodea y, en consecuencia, de los problemas que se
plantean.

El término personal de enfermería abarca a todas las categorías de personas que prestan cuidados
enfermeros. Se establecen para aprovechamiento de los recursos humanos, variando las
categorías según el sistema sanitario de cada país.
1. Enfermera Profesional.
La OIT (Organización Internacional del Trabajo) y la OMS (Organización Mundial de la Salud) la
define así: “El enfermero/a es una persona que ha completado un programa de educación básica
en enfermería y está calificada y autorizada para ejercer la enfermería en su país”.

La enfermera profesional asume funciones de gran complejidad y responsabilidad. Posee


instrucción y formación exigidas oficialmente y está legalmente autorizada para ello.

Los profesionales titulados son los que tienen que responder de todo el trabajo a realizar por su
disciplina, en todos los niveles de complejidad que ésta tenga.

Por todo esto, puede decirse que las acciones que la enfermera delega en el personal auxiliar son
aquellas que no requieren para su ejecución la toma previa de decisiones profesionales, basadas
en principios científicos y técnicos o en determinadas condiciones de tratamiento.

2. Auxiliar de Enfermería.
Es la persona que realiza funciones menos complejas y bajo la supervisión de la enfermera. Posee
la instrucción y la formación necesarias y está habilitada para llevarlas a cabo.

La auxiliar de enfermería trabaja dentro del equipo de salud colaborando en el cuidado del
paciente de forma autónoma y bajo supervisión directa de la enfermera.

…LA DISCIPLINA ENFERMERA EN EL MOMENTO ACTUAL



La enfermería está construyendo su cuerpo disciplinar a partir de diferentes ramas del saber
humano y a la vez está aportando conocimientos a la ciencia.

El primero que analizo estos criterios fue el sociólogo Abraham Flexner (1915). Identifico las
profesiones sobre la base de seis requisitos: intelectual, práctica, con carácter único, organizada,
altruista y responsable. En 1958, el sociólogo Taylor apoyo las profesiones en dos pilares
fundamentales: poseer un código ético y un cuerpo propio de conocimientos. El paradigma actual
establece ocho rasgos que han de considerarse en una actividad profesional. Siguiendo a Cortina,
las características de una profesión son:

- Ofrece un servicio único.


- Es vocacional.
- Está ejercida por profesionales.
- Controla la actividad.
- Requiere preparación específica.
- Es autónoma.
- Asume su responsabilidad.
- Es altruista.
La enfermería actual se define desde tres aspectos diferentes: sociológico, teórico-filosófico y
desde el ejercicio profesional.

1. Aspecto Sociológico.
Se define como la profesionalización de la actividad de cuidar. Una actividad se establece en tres
niveles:

- Autoacción: Actividad realizada por uno mismo. En este caso, la persona posee las capacidades
requeridas (conocimientos y habilidades).
- Acción de apoyo: Si se necesita ayuda de otra persona, que por sus conocimientos, experiencia,
etc., completa la capacidad de la que ha de llevar a cabo la acción.
- Acción profesional: Si la acción requiere de aptitudes específicas que sólo pueden ser llevadas a
efecto por un experto en la materia.

2. Aspecto Teórico-Filosófico.
- La primera que definió la enfermería, en 1860 fue Florence Nightingale, conceptualizándola
como el acto de utilizar el ambiente del paciente para ayudarle en su recuperación. Nightingale
escribe que enfermería es “el uso apropiado del aire, la luz, el calor, la limpieza, la tranquilidad y la
selección de la dieta y su administración, y con el menor gasto de energía por el paciente.”
- V. Herderson: “la función propia de la enfermera consiste en atender al individuo, enfermo o
sano, en la ejecución de aquellas actividades que él realizaría por sí mismo si tuviera la fuerza,
voluntad o conocimientos necesarios. Igualmente corresponde a la enfermera cumplir esta misión
en forma que ayude al enfermo a independizarse lo más rápidamente posible.”
- D. Orem: se podría definir la enfermería de forma genérica como conjunto de conocimientos
organizados para prestar un servicio de ayuda a personas que son total o parcialmente
dependientes, cuando ellos o personas responsables de su cuidado ya no son capaces de prestar o
supervisar el mismo.

La acción enfermera se diferencia de la actividad médica precisamente porque no trata las


enfermedades, sino las respuestas que mantienen incómoda a la persona.

El saber enfermero se configura como un conjunto de conocimientos, riguroso y sistemático, sobre


una materia concreta de la ciencia: el cuidado.

Las enfermeras teorizantes, según los principios de la Filosofía de la Ciencia, han organizado los
conocimientos enfermeros, han descrito métodos propios o han adoptado otros pre-existentes a
su situación concreta y, además, han desarrollado técnicas apropiadas a la naturaleza del cuidado.

Siguiendo a Collière, “cuidar es un acto de vida que significa una variedad infinita de actividades
dirigidas a mantener la vida y permitir la continuidad y la reproducción. Es un acto individual, dado
por uno mismo y para uno mismo, en el momento en que la persona adquiere la autonomía
precisa para ello. Igualmente, es un acto recíproco que supone dar a toda persona que, temporal o
definitivamente, tiene necesidad de ayuda para asumir sus cuidados de vida. Por tanto, el cuidar
es una actividad sencilla y habitual en el ser humano, que practica continuamente como parte
integrante de las actividades diarias de las personas, para responder a la aspiración esencial de
cubrir las necesidades fundamentales”.

El cuidado prestado desde la óptica profesional es diferente. La forma organizada de cuidar


constituye una disciplina humanística y sanitaria, que utiliza conocimientos de las ciencias físicas,
biológicas, sociológicas, etc. Así los métodos de prestación para la salud han de ir modificándose
consecuentemente.

Definir el marco teórico o conceptual de la profesión es importante, porque como dice R. Poletti,
“el cuidado enfermero debe describir lo que es específico y por qué tiene que afirmarse, siento
útil, entre otras cosas, para permitir la explicación de la ciencia de la acción. El marco teórico es la
base conceptual que contribuye al progreso de las investigaciones y, por tanto, a la evolución del
cuidado de enfermería”.

Desechar la herencia de las tres “m” (militarismo, monasticismo y matriarcado) es desterrar las
corrientes que han marcado los cuidados enfermeros. Son virtudes mal entendidas que no
favorecen ni al usuario ni a la profesión.

El desarrollo profesional, además de la orientación filosófica, exige un método de trabajo que sea
riguroso pero flexible. El ejercicio de la profesión abarca aspectos Deontológicos a la vez que
enmarca en los Derechos Humanos.

El término holismo deriva del griego y significa “todo”. El cuidado holístico se desarrolló en la
década de los sesenta del siglo XX, motivado por la insatisfacción de la sociedad de la atención
sanitaria recibida, centrada fundamentalmente en el aspecto organicista del proceso salud -
enfermedad (la salud como lucha contra la enfermedad). Desde este concepto, las enfermeras
comprenden que al prestar cuidados tienen que relacionar los aspectos fisiológicos y psicológicos,
sin olvidar la relación e interacción del individuo con el medio externo y con los demás.

Se le dice “doméstica” porque la mujer cumple su papel de cuidadora en el hogar, con cuidados
básicos como: una buena alimentación, abrigo, higiene y un contacto maternal para mejorar el
bienestar; utilizando lo que esté a su alcance en el medio que la rodea.

Esta etapa se relaciona con la concepción de la salud como mantenimiento de la vida. Donde el
concepto de salud-enfermedad se relacionaba con una intervención sobrenatural, consideradas
como un premio o castigo ante las conductas del hombre.

Para tratar la enfermedad se hacía por medio de rituales espirituales bajo la responsabilidad de
personas que se les atribuían poderes divinos, como chamanes, curanderos, sacerdotes-magos,
etc.

Con el advenimiento de la civilización greco-romana empezó a verse una transición de los


tratamientos mágicos a algo más racional y científico, donde los cuidados se atribuían a personas
con prácticas empíricas.
…TIEMPOS REMOTOS…

El cuidado se ha practicado desde los tiempos más remotos como en la prehistoria, podemos
hablar de Paleopatología, que es una disciplina que se encarga de estudiar enfermedades a través
de fósiles y momias y la Paleomedicina que es la que se encarga del estudio del tratamiento de la
enfermedad en la Prehistoria.

Es posible que las primeras ideas del cuidado se adquieran a través de la observación de los
animales.

El Australopiteco o “mono del Sur” de hace 3 millones de años, en el que se han identificado
cuadros de enanismo, gigantismo, gota, asimetría pélvica, osteosarcoma, alteraciones dentarias y
fracturas, que fueron inmovilizadas.

En el hombre Pitecántropo (homus erectus) además de han observado trepanaciones curadas y


cicatrizadas por heridas de combates; y el hombre Neanderthal (homo sapiens) se cuestionó sobre
el origen de aquellas enfermedades.

La revolución neolítica la inicia el hombre Cro-magnon que pasó de ser nómada a sedentario y
fueron abundantes las enfermedades infecto-contagiosas así como en nuestros tiempos.

Los grupos menos avanzados aislaban socialmente a una persona que tuviera una enfermedad
grave, porque lo consideraban inútil al grupo, mientras que las sociedades más avanzadas lo
aislaban socialmente porque consideraban su estado de enfermedad como una maldición o
castigo por haber ofendido a una divinidad, un muerto o un ser vivo. Así los enfermos estaban
muy mal amparados porque además de su sufrimiento físico, sufría el aislamiento de la
comunidad.

Para el diagnóstico y pronóstico de la enfermedad, se utilizaba la anamnesis, donde se hablaba


con el enfermo para conocer la falta cometida y buscar una posible causa del castigo recibido; la
observación, donde se exploraba el cuerpo del enfermo para buscar alguna manifestación que
pudiera aparecer; la adivinación, donde se buscaban signos para un buen o mal agüero, como el
vuelo de un ave, el estado de las vísceras de los animales, los nacimientos anormales, etc

. Una vez se conociese la causa del mal, se intentaba la curación a través de aplacar la ira del
ofendido, utilizando para esto el empirismo y la magia; entre sus métodos empíricos utilizaron
recursos de los tres reinos para fabricar sus fármacos, realizaban cirugías, reducían fracturas y
luxaciones, entablillaban miembros, realizaban sangrías, hacían trepanaciones, también hacían uso
de la fisioterapia en masajes y lavados para purificar el alma.

Se decía que los métodos empíricos no eran efectivos, entonces hacían el uso de la magia,
haciéndose preguntas de cómo podían llevarla a cabo, quién ha de hacerlo, dónde y cuándo,
también iban acompañados de unos principios, daba igual de que la persona estuviera presente o
una uña, un cabello, etc. La transferencia de que el mal podría pasarse a otro ser u objeto, el rito
se recitaba o rezaba con elementos secundarios como música, amuletos, bailes, etc.
…SOCIEDADES ARCAICAS SUPERIORES…

1. Babilonia.
Fuente de conocimientos históricos: las tablillas en barro. La enfermedad era sinónimo de shertu,
que se daba por haber comido la cassia, la fruta prohibida de los 8 frutos del paraíso, el enfermo
sufría de un aislamiento social por ser un individuo en pecado. En sus tablillas, las descripciones de
sus enfermedades son en realidad síntomas y tratamientos que servían de recordatorio a los
sanadores. Dividían sus síntomas según las tres cavidades del cuerpo: la cabeza, el tórax y el
abdomen.

Las personas que se dedicaron al cuidado de la salud fueron: los sacerdotes, los escribas y más
inferiores los cirujanos, que realizaban técnicas quirúrgicas simples, además de existir amas de
cría, parteras o cuidadoras de niños. La primera reglamentación que se conoce para el ejercicio
profesional: el código de Hammurabi.

El diagnostico de una enfermedad se basaba en el pecado cometido, y el pronóstico dependía de


la gravedad de la falta, se obtenían a través del interrogatorio y la adivinación fijándose en la
leconomancia, la oniromancia, la astrología, etc. Si la enfermedad se consideraba mortal, no se
intervenía, pues no se podía actuar en contra de los designios de los dioses, y si se consideraba
leve, se ofrecían sacrificios y se hacían oraciones o se utilizaba la magia.

Para sus remedios empíricos utilizaban fármacos extraídos de los tres reinos, hacían uso de la
fisioterapia como en masajes y baños y practicaban la cirugía principalmente amputaciones, estas
no eran practicadas por los escribas o sacerdotes, sino por los cirujanos, hombres artesanos o
plebeyos.

2. Pueblo Hebreo.
Consideraban la enfermedad como un estado de impureza del espíritu, la fuente de la salud era
manteniéndose puros ante Jehová y no mediante prácticas medicas, así la responsabilidad de la
salud pública recaía en los sacerdotes que actuaban como intermediario de Dios mientras este
curaba. Creían que todos los hombres debían tener acceso a la atención médica, sin importar su
posición social.

La Ley Mosaica creada por Moisés es semejante al código de Hammurabi, dicta normas estrictas
sobre la prevención de enfermedades, higiene personal, desecho de excrementos, selección de
alimentos.

Crearon unas casas para forasteros que llamaron xenodochias, también para el cuidado de los
enfermos y fueron financiadas mediante un sistema de recaudación.

3. Egipto.
Fuentes de Conocimiento histórico: los papiros donde se explica la preparación de medicinas,
intervenciones, etc. Entre los papiros más importantes está el de Ebers, Brugsch, Edwin Smith, etc.
Creían que la salud y la enfermedad era designio de los dioses, así como:

- TOTH: la más antigua, especialista en la oftalmia, la enfermedad egipcia más frecuente.


- SECHMET: se le atribuye la virtud de curar las enfermedades de las mujeres.
- SET: era el que difundía y curaba las epidemias.
- IMHOTEP: debió haber sido un rey o sacerdote experto de las más altas cualidades curativas.

De los enfermos se ocupaban los sacerdotes y los médicos técnicos especializados en un único
trastorno. Existían escuelas médicas como la de Sais y Heliópolis.

La asistencia sanitaria tuvo un elevado nivel de progreso: desagües adecuados, buen suministro de
agua, inspección de mataderos, el aseo corporal, la limpieza de sus ropas, y reglas estrictas para
regular cuestiones tales como limpieza, comida, bebida, ejercicio, relaciones sexuales, etc.

Los embalsamamientos eran practicados por hombres de casta especial que se dedicaban
exclusivamente a este oficio, aunque también se refugiaban en esta práctica los criminales que
huían de la justicia. El trato a los cadáveres era muy variado, dependiendo del dinero entregado
por los familiares y de la condición social. De tal manera que los cuerpos de los pobres eran
introducidos en baños de natrón color ocre, se dejaban secar durante treinta días y eran devueltos
a los familiares. Si el cadáver pertenecía a la clase media, inyectaban en las cavidades naturales un
aceite que disolvía las entrañas e introducían cañas mojadas en pez. En cambio, los cuerpos de
clases superiores exigían gran habilidad, se lavaban los intestinos y se colocaban en cofres. Entre
los embalsamadores existían hábiles profesionales, especializados en las diferentes partes del
cuerpo, lo que explica el gran conocimiento de los egipcios del cuerpo humano y la habilidad para
los vendajes, ya que practicaban en los cadáveres esta técnica (momias). Llegaron a utilizar mil
metros de tela de hilo para una sola momia. Las vendas eran de diversos anchos, impregnadas en
una sustancia pegajosa que las endurecía.

La posición de la mujer en el Antiguo Egipto más elevada que en otros países orientales,
disfrutando de una considerable libertad y dignidad, y ocupando en su propio hogar una posición
de autoridad. Pero a su vez existían parteras y amas de cría.

Del diagnostico de la enfermedad el médico egipcio no sólo valoraba la importancia del pulso, sino
que conocía además la palpación, la inspección y probablemente la auscultación.

Respecto a la terapéutica se mezclaban las terapias místicas y racional. Usaron la farmacopea y la


cirugía. Sus fármacos incluían: la miel, la cerveza, la levadura, el aceite, los dátiles, los higos, la
cebolla, los ajos, la semilla de lino, el hinojo, el moho y las telarañas (para curar los abscesos). A los
moribundos se les daba cerveza o estupefacientes para evitar el sufrimiento. Fármacos aún en
uso, como el aceite de ricino, el ajenjo, el aloe, la menta, el opio y el beleño. En cirugía los egipcios
eran expertos en intervenciones craneales, vendajes y circuncisiones.

4. India.
Fuentes de conocimiento histórico: Vedas y Upavedas que tratan sobre medicina, cirugías,
enfermedades infantiles, higiene y prevención de la enfermedad. Los contribuyentes de mayor
influencia fueron dos libros Sushruta y Charaka. El primero representaba el aspecto quirúrgico de
la medicina hindú. Charaka simboliza el aspecto puramente médico.

En el pueblo hindú el concepto salud-enfermedad estuvo influenciado por los dos sistemas
filosóficos imperantes: el brahamanismo y el budismo. Pero a pesar de las influencias de tipo
religioso en relación con el enfermar, sabían que la transmisión de enfermedades específicas era
producida por los mosquitos (malaria).

Las bases para la curación en la India eran el médico, el paciente, los fármacos y el ayudante del
médico. Los maestros afirmaban que sin el médico los demás no tenían ningún valor. Los
cuidadores eran hombres jóvenes y los escritos se refieren a las cualidades que debía poseer el
ayudante del médico: conocimiento de la forma en que deben prepararse o combinarse los
medicamentos para su administración, astucia, dedicación al paciente al que se atiende, pureza,
tanto de mente como de cuerpo. No obstante, en situaciones excepcionales eran mujeres
ancianas, a las que también se les exigían cualidades tales como: altos principios, habilidad,
capacidad de inspirar confianza.

La cirugía estuvo muy perfeccionada y se describen alrededor de 125 instrumentos quirúrgicos


distintos.

Al igual que en todas las demás culturas, los hechiceros y los mantras precedieron a los médicos. El
primer hombre dedicado a la medicina fue sacerdote, Bhisag Atharuan (médico-mago), que
disfrutaba de una posición social superior a la del cirujano.

La terapéutica abarcaba los tres reinos, con preferencia el vegetal. Empleaban la rauwolfia para
calmar la inquietud y tratar enfermedades del corazón. Esta planta es empleada actualmente para
problemas cardiacos. Conocían el valor curativo del aceite de chalmugra para la lepra. Para la sífilis
utilizaban el mercurio.

Durante el reinado de Asoka (296 - 237 a. de C.) se construyeron los primeros hospitales de la
historia, edificados por orden gubernamental. Se cree que existieron edificaciones específicas para
el parto y el puerperio, farmacia para preparar medicamentos y salas de operaciones.

5. China.
En la antigua China, la salud se consideraba como el resultado de un estado de armonía del
espíritu consigo mismo y con el universo. Se pensaba que la naturaleza estaba regida por la
dualidad básica del Yin y el Yang. El primero, oscuro, negativo y femenino; el segundo, claro,
positivo y masculino. El desequilibrio entre estas dos energías contrapuestas originaría la
enfermedad.

Toda la medicina china está basada en textos escritos por los tres emperadores legendarios: Fu
Hsi, el Emperador Rojo (Shen Nung), el Emperador Amarillo (Huang-Ti).
Por el aspecto maléfico y contagioso de la enfermedad, no existieron cuidadores pero figuraba la
responsabilidad de cuidar de los miembros de la familia en el seno del hogar. Puede ser que este
principio fuera la causa de la ausencia de hospitales. Sin embargo, se han identificado salas de
curación situadas junto a los templos con dos funciones: la oración y la recuperación de la salud.

Escaso desarrollo de la cirugía por razones creenciales. Practicaron la castración masculina y


trataron las heridas. Es de resaltar la impimportancia que le dieron al examen del pulso como
técnica de diagnóstico. Fueron los primeros en practicar diversas medidas de vacunación
antivariólica.

Respecto a la farmacopea, los chinos apreciaban 200 clases de polvos que tardaban hasta tres
horas en tomarlos. Emplearon el Ma Huang, del que se obtiene la efedrina para tratar el asma.
También emplearon el ruibarbo, el arsénico, el opio y la raíz de granado.

6. Nuevo Mundo.
Se creía que la enfermedad era desencadenada por el enfado de los dioses, del dios sol en
particular. La salud era simplemente una cuestión de equilibrio entre el hombre, la naturaleza y lo
sobrenatural.

En estas tribus se combinaban con frecuencia la religión, la magia, la medicina, los cuidados y la
farmacia. Estas actividades corrían a cargo de un individuo que estaba apartado del resto de la
tribu. Primero fueron los curanderos (brujos) y más tarde los sacerdotes, que intentaron sanar las
enfermedades tanto de la mente como del cuerpo a través de rituales o ceremonias de tipo
religioso con el tratamiento sobre base de hierbas medicinales y métodos quirúrgicos como la
extracción de piezas dentarias, la sangría, la trepanación, los vendajes, las suturas y las
amputaciones, también la magia y transferir enfermedades a un animal.

Para prevenir las enfermedades usaron amuletos y fetiches, baños para provocar sudor y purificar
el cuerpo, ingestión de hierbas.

…EL MUNDO CLÁSICO…


La sociedad estaba integrada por tres estamentos de hombres: los ciudadanos, los plebeyos o
metecos y los esclavos. Esta diferenciación marco considerablemente los cuidados de la salud que
recibieron cada uno de ellos.

1. Grecia Antigua.
Predominaban las pestes, productoras de un elevado número de muertes. Consideraban a la
enfermedad como un estado de impureza o gran castigo por una infracción cometida.

Los cuidados de la salud eran practicados por diferentes grupos, todos ellos elaboraron un
concepto de enfermedad de forma racional, despreciando las creencias, poderes y saberes
sobrenaturales y considerando solamente la intelectualidad.
Los cirujanos no tenían formación teórica, eran farmacopeas, rizotomas y gimnastas. El trabajo de
los médicos técnicos estaba basado en la inteligencia, dejando de lado el aspecto manual, que era
ejercido por los cirujanos, así el médico técnico no estaba en contacto con el enfermo, alejándose
de la practica medica, podemos mencionar a Hipócrates y Dioscórides. Los esclavos eran los
ayudantes de los médicos técnicos y realizaban la función de cuidadores. Las mujeres fueron
parteras pero no podían ser iniciadas en los misterios de ningún arte.

Hipócrates baso la fisiología en la teoría humoral, así la enfermedad era producto del desequilibrio
de los cuatro humores que regulan la salud. Dioscórides fue su discípulo y escribió un “Tratado de
Medicina” que ha sido un libro importante de consulta durante muchos siglos.

La atención de la salud dependía del nivel social y económico de la persona, si era un ciudadano
libre, era atendido por un medico técnico que ejercía medicina educativa; si era un plebeyo o
meteco los atendía un gimnasta que practicaban una medicina empírica y sintomática y; los
esclavos no eran sujetos de derecho, eran atendidos por esclavos de los médicos técnicos que
aprendían de sus amos.

Los médicos griegos dieron gran importancia a lo que actualmente se considera historia clínica
porque recogían datos del paciente sobre el aspecto general. Finalizada la anamnesis y valoradas
las respuestas del enfermo, el médico pronosticaba las posibilidades de curación de éste. El
diagnóstico de la enfermedad lo hacía en función del pronóstico, contrariamente de lo que ocurre
en la actualidad, pues dieron más importancia al desenlace del problema que al diagnóstico en sí.

Las instituciones para el cuidado fueron evolucionando con el tiempo, primero existió el
tenderete, luego el iatreion culminando con el templo.

2. Roma.
En los inicios tienen las creencias heredadas de los etruscos. Posteriormente por la influencia de
los griegos adoptaron la interpretación natural. Las mujeres romanas eran muy independientes y
se dedicaban a muchas actividades fuera del hogar, su papel seguía siendo el cuidado de los niños
y la atención a los partos, Así, el cuidado del enfermo lo asumían los esclavos y sirvientes
(hombres y mujeres) de la casa. Es de destacar una clase de ordenanzas, los Nosocomi, que hacían
de cuidadores en los hospitales romanos. En los siglos II y I a. de C. Ya se conocía la existencia de
médicos procedentes de Grecia. Fueron estos médicos los que enseñaron la profesión a los
romanos, que hasta entonces ejercían la medicina mágica heredada de los etruscos.

Destaco Galeno de Pérgamo porque describió las fases de la enfermedad, dividió en grados la
acción de los fármacos y definió los temperamentos de los individuos, igualmente Cornelio Celso
que describió los síntomas de la inflamación y descripciones detalladas de procedimientos
quirúrgicos y de la ligadura de los vasos sanguíneos.

El hospital romano por excelencia fue el valetudinaria por su perfecta organización y personal
especifico para el cuidado

La progresiva secularización de la sociedad y de las propias enfermeras comienza a desechar el


aspecto vocacional en el sentido meramente religioso y la enfermería entra en una dependencia a
la clase médica.

…EL MUNDO CONTEMPORÁNEO…


La incesante práctica investigadora da como resultado el desarrollo científico, repercutiendo en los
avances médicos, fue espectacular el avance en las ciencias físicas y biológicas. En el siglo XX se
produce el descubrimiento

de numerosos agentes etiológicos causantes de enfermedades infecciosas. La medicina se orienta


principalmente hacia la búsqueda de un factor causal responsable de la enfermedad (paradigma
de categorización).

Se inicio una lucha contra la enfermedad, básicamente a través de las vacunas. El desarrollo
industrial modifico significativamente el equilibrio ecológico del hombre, apareciendo nuevos
problemas de la salud, los hospitales de caridad se desbordaron y como consecuencia de la mayor
eficacia en los métodos y equipos de diagnostico y tratamiento trajeron consigo los costos de la
atención medica, así el estado fue responsabilizándose de los hospitales que la caridad ya no podía
mantener.

En la Europa de finales del siglo XVIII se exterminó la peste. Tampoco hubo epidemias de lepra, sin
embargo, aparecieron las de viruela. En las colonias de América y África murieron pueblos enteros,
en Europa se comenzó a difundir la vacuna antivariólica. Las enfermedades infecto-contagiosas
sufridas por la población europea fueron principalmente la fiebre amarilla, la fiebre tifoidea y el
cólera. Junto a estas enfermedades se dieron las del proletariado, relacionadas con el trabajo en
las fábricas, tales como las deformidades de la espalda, las intoxicaciones por uso de productos
tóxicos y los accidentes en las grandes obras de construcción y de tendidos eléctricos, etc.

La asistencia sanitaria fue eminentemente curativa e individual, variando según la clase social de
los enfermos. Para las enfermedades crónicas disponían del balneario o casa de reposo, cuyo coste
era elevado, se usaba también la lodoterapia. El elevado coste de la atención médica favoreció la
aparición de seguros (como el Friendly Societies) que fueron la base para la creación de la
“Seguridad Social” y los pobres de solemnidad eran utilizados como objeto de enseñanza médica y
como recurso de investigación en las salas de autopsias.

El descubrimiento más importante del siglo es el de la penicilina, efectuado por Fleming en 1929,
su importancia radica en la importancia de este antibiótico en la lucha contra la infección.

Contrariamente a los centros de caridad del siglo anterior, los nuevos hospitales no fueron
producto de la donación de filántropos, sino de médicos que mediante recaudación de fondos, a
veces con la ayuda de enfermos agradecidos, fundaron los hospitales. El hospital vio completada
su función, hasta entonces puramente asistencial, con la docencia, al hacerse obligatoria la
práctica para los estudiantes de medicina.

El rápido desarrollo de las ciencias aplicadas (química, física, ingeniería, etc.) dio como resultado la
aparición de técnicas de diagnóstico y tratamiento de las enfermedades, ofreciendo a los usuarios
una prestación de servicios sanitarios más amplia y una atención de auxilios a los pobres, lo que
contribuyo al desarrollo de la actividad medica curativa y administrativa como mejora de la calidad
de vida.

Los valores religiosos se impusieron a la razón, hubo una separación de la Iglesia del poder civil. Se
produjo un hecho trascendental para la humanidad, la Declaración de los Derechos del Hombre
(1789) por parte de la Asamblea Constitucional Francesa. Entre los derechos reconocidos se
incluyó el ser asistido en caso de enfermedad. Es así como el estado asume la responsabilidad de
la asistencia hospitalaria de los ciudadanos y comienza a proyectar una auténtica política sanitaria.
La nueva concepción de la asistencia hospitalaria determinó la presencia del médico de una forma
estable en el hospital. La Iglesia acomodo las prácticas de caridad a las nuevas pautas medico-
terapéuticas.

…NUEVA CONCEPCIÓN DE LA ENFERMERÍA…


Surge como consecuencia de la preocupación de los diversos grupos sociales que abogan por el
establecimiento de sistemas de cuidados de naturaleza diferente. Tiene gran significado histórico
El Libro El Arte de la Enfermería escrito por los Hermanos de la Orden de San Juan de Dios en el
año 1833, y cuyo fin fue instruir a los enfermeros de esta Orden sobre el cuidado a los enfermos.
Con los reformadores religiosos y seglares se inicia la profesionalización de la actividad de cuidar,
destacan: los Fliedner, Florence Nightingale y las órdenes surgidas en la Edad Moderna.

Las diaconisas de Kaiserswerth fueron preparadas por los Fliedner con una organización y un
sistema de aprendizaje innovador que fue copiado posteriormente por otros países y ha
mantenido en parte en la formación de las actuales enfermeras europeas. Destacaron también
Elizabeth Fry, fundadora del instituto de hermanas de enfermeras protestantes, el Instituto
Bishopgate, considero la calidad de la enfermería no por el ejercicio de la actividad como vocación
religiosa.

…FLORENCE NIGHTINGALE…
Florence Nightingale (12 de mayo de 1820 - 13 de agosto de 1910) es la pionera de la enfermería
moderna y de la profesionalización, iniciando las artes literarias de la disciplina, la organización de
la profesión y la educación formal de las enfermeras informándose de los cuidados que se
prestaban en distintos países. Fue la primera en utilizar la estadística, la epidemiología y los
conceptos de higiene y saneamiento dentro de la enfermería. Entre sus obras destacar: Notas
sobre enfermería: qué es y qué no es. Fue condecorada por la Reina Victoria, con la Cruz de San
Jorge, por su obra en la Guerra de Crimea.

…LA CRUZ ROJA…


La fundación de la Cruz Roja marca un hito en la organización internacional de la ayuda
humanitaria, tanto en tiempos de guerra como de paz. Particularmente para la enfermería, supuso
la creación de numerosas escuelas que seguían el modelo de formación de los reformadores de
este siglo. La Cruz Roja fue creada en 1863, gracias a un hombre filántropo de gran espíritu social y
de nacionalidad suiza llamado Henry Dunant. Todas las sociedades emplearían el mismo emblema
y su presencia significaría señal de neutralidad. Henry Dunant recibió antes de morir el premio
Nobel de la Paz y donó su importe a la Cruz Roja, esta ha servido eficazmente como lazo de unión
entre países enemigos, conservando siempre su posición neutral, obedeciendo a la finalidad de su
cometido.

…CONSEJO INTERNACIONAL DE ENFERMERAS…


La CIE es la primera asociación internacional de enfermeras y en la actualidad sigue marcando las
pautas para la actuación de la profesión. La señora Bedford Fenwick fue una de las que
comprendieron las ventajas para la enfermería de una organización internacional similar y
presentó en Londres la idea inmediatamente al Consejo de Matronas de Inglaterra.

El CIE tiene como objetivos primordiales:


- Luchar para que la profesión sea autónoma.
- Mejorar los servicios de asistencia al individuo y la colectividad.
- Elevar el nivel y la ética educacional y profesional.
- Favorecer la situación socioeconómica de las enfermeras.
- Fomentar la cooperación y amistad entre las enfermeras de todo el mundo.

Las ventajas que ofrece el CIE son:


- Obtener un reconocimiento oficial, a nivel internacional, de tipo profesional y educativo.
- Proteger los intereses de todos sus miembros.
- Estudiar y discutir los problemas nacionales que tengan relación con la profesión.
- Ofrecer medios de comunicación y contacto entre enfermeras de diversos países.
- Ayudar a que las enfermeras busquen la manera de completar su formación en el extranjero.
- Estimular el desarrollo de los diferentes grupos de la Enfermería, ocupándose de los problemas
que atañen a la práctica de la profesión y a la legislación que la regula.

Cada cuatro años el CIE realiza un congreso en un país distinto. El primero fue en Búfalo en 1910 y
en España se celebró en Madrid en 1993. En cada uno de estos congresos se da una consigna
sobre la que actuarán todos los países durante cuatro años y al llegar el próximo congreso se hace
una evaluación de cómo se ha llevado a cabo.

VENEZUELA, SU ENFERMERÍA, SU HISTORIA

La herencia histórica de la Enfermería es rica y apasionante. Su historia es un relato de


descubrimientos que reflejan los nuevos avances logrados en cada generación. La historia de la
enfermería que hasta los momentos se ha representado en diversas obras, muestra sus aspectos
más valiosos: el cuidado y la entrega.

El origen de la enfermería es el de la misma humanidad. Desde siempre ha existido la enfermedad


y desde que el mundo es mundo, ha habido personas encargadas de cuidar a los enfermos. A lo
largo del tiempo y en todos los lugares, la aportación de la enfermería a la sociedad se centra en
los cuidados de la salud.
La enfermería abarca los cuidados, autónomos y en colaboración, que se prestan a las personas de
todas las edades, familias, grupos y comunidades en todos los contextos, e incluye la promoción
de la salud, la prevención de la enfermedad y los cuidados de los enfermos, discapacitados y
personas moribundas. Históricamente, las funciones esenciales de la enfermería son la defensa de
los enfermos, el fomento de un entorno seguro, la investigación, la participación en la política de
salud en la gestión de los cuidados y los sistemas de salud, así como la formación.

Órdenes religiosas

La enfermería moderna comenzó a mediados del siglo XIX. Uno de los primeros programas
oficiales de formación para las enfermeras comenzó en 1836 en Alemania a cargo del pastor
protestante Theodor Fliedner. Por aquel tiempo, otras órdenes religiosas fueron ofreciendo
también formación de enfermería de manera reglada en Europa, pero la escuela de Fliedner es
digna de mención por haberse formado en ella la reformadora de la enfermería británica Florence
Nightingale. Su experiencia le brindó el ímpetu para organizar la enfermería en los campos de
batalla de la Guerra de Crimen, y, más tarde, establecer el programa de formación de enfermería
en el hospital Saint Thomas de Londres. La llegada de las escuelas de enfermería de Nightingale y
los heroicos esfuerzos y reputación de esta mujer, transformaron la concepción de la enfermería
en Europa y establecieron las bases de su carácter moderno como profesión formalmente
reconocida.

Una sola palabra “Cuidar”, puede definir hoy día a la enfermería, sencillo término pero lleno de
significado. Cuidar es una ciencia social y humana que necesita preparación, conocimientos,
investigación y sobre todo, experiencia de trabajo con los enfermos. Cuidar es poner laboriosidad,
diligencia, atención, disponibilidad y por supuesto, comunicación.

Para finalizar, Domingo A. Socorro Sánchez de la Escuela de Enfermería de la Universidad de los


Andes en Venezuela, decía en su prólogo del libro, que lo que hoy constituye la enfermería es
fruto del pasado, y como tal, nosotros también influiremos en algo en esta magnífica profesión.
Así pues, lo que consigamos ser en el futuro dependerá de nosotros mismos. Somos dueños de
nuestro destino.

UNA BREVE HISTORIA DE LA ENFERMERÍA VENEZOLANA

La historia de la enfermería se remonta a las primeras épocas de la humanidad, pero hace unos
pocos siglos empezó a institucionalizarse la atención al enfermo. Antes se consideraba que las
enfermedades se producían por influencia de espíritus malignos. Posteriormente se reflexionó
acerca de la necesidad de atender a las personas enfermas en un sitio adecuado, lo cual dio origen
a la organización de establecimientos para el cuidado de la salud.
En Venezuela, los estudios de enfermería estuvieron estrechamente conectados al proceso
histórico, social, político, económico propio del país y a la organización del sistema de salud.

Desde la antigüedad, uno de los efectos generados como consecuencia de las terribles pandemias
extendidas por todo el mundo producto del fenómeno colonizador, ha sido la necesidad de una
demanda de cuidados que, por fortuna, han venido evolucionando a lo largo de la historia.

Comenzó como un período empírico de los cuidados iniciado con los cuidados propios de los
pueblos indígenas, pasando por una atención a los enfermos en el hogar, acompañado de
sentimientos cristianos, vocación, afecto, observación, conocimiento y habilidades, hasta un
período científico y técnico que permitió la creación de los primeros programas de formación de
enfermeras y el surgimiento de una educación formal y sistemática hasta la actualidad.

El desarrollo histórico de la enfermería en Venezuela ha pasado por las etapas clásicas de la


evolución universal. En la antigüedad se caracterizó por el culto de la salud, las supersticiones, las
creencias sobre la enfermedad y la muerte, así como el uso de plantas medicinales, pasando por
un proceso de sociogénesis o causación social del proceso salud – enfermedad íntimamente ligado
a los pasos histórico – sociales, políticos y económicos propios de la nación y del sistema sanitario,
coyunturas éstas que representaron hitos históricos con repercusión y eco en el devenir social y,
por ende, en el desarrollo de la enfermería.

A finales del siglo XIX, la enfermería en Venezuela estaba en manos de las religiosas que atendían
en centros de salud. En los años treinta era evidente que requería un nuevo modelo para formar
enfermeras profesionales que elevaran los estándares de la profesión. Sin embargo, el precario
nivel educativo con que llegaban las aspirantes y las exigencias de los servicios hospitalarios, que
buscaban una manera económica de llenar sus demandas con personal adiestrado pero sin
mejoras educativas, impidió que se cumpliera tal aspiración. La enfermería se centró en la
dimensión técnica y en la subordinación médica, aunados a la resistencia de la medicina curativa
de la época que impidió una visión integral de la salud.

Los estudios de enfermería se iniciaron entre 1837 y 1900 con la formación de enfermeras
obstétricas, y luego, de forma discontinua hasta 1937. En 1940 nace formalmente la Escuela
Nacional de Enfermeras (ENE), y entre los años 1944 y 1959, por decretos presidenciales
publicados en gacetas, se establecen reglamentos y parámetros a seguir por las distintas escuelas
de enfermería en Venezuela. Pero es sólo a mediados del año 1959 cuando se modifica el currículo
relacionado con la formación de enfermeras en base a dos pensa de estudios otorgándose el título
de Enfermera Profesional.

Período precolombino
El concepto de cuidado y ayuda a los demás está presente desde el inicio de las civilizaciones, lo
que se ha dado en llamar actualmente “cuidados de enfermería” ha estado presente de manera
intrínseca en los cuidados de la vida del hombre en su esencia, en su mundo, en fin, en su vida
cotidiana.

En la época precolombina venezolana, nuestros pueblos indígenas combinaban diversas formas de


cuidar. Esta primera etapa, llamada por algunos autores de la historia de la enfermería universal
etapa doméstica de los cuidados, se caracterizó por la división de roles, en la cual, la mujer
encargada de algunos cuidados de la vida cumplía un papel importante en cada hogar, de la misma
manera que lo hizo el hombre indígena llamado de diferentes formas, como sostiene Sánchez
(2005): “…pinches, voz chaima y tamanaca con formas afines en otras lenguas caribes; entre los
caquetíos, boratios; entre los curamanagotos, guisidatus; entre los guajieros, antishi; y entre los
banivas, kamajáiminares”.

Es así como la mayor preocupación del indígena primitivo fue combatir las agresiones externas y
las enfermedades, así como cuidar sus necesidades y su entorno para sobrevivir. De su relación
con la naturaleza, nuestros indígenas no solamente observaron su ecosistema, los elementos
naturales y animales salvajes, que les proporcionaron alimentos, abrigo y medios para la
elaboración de objetos y herramientas, sino también el uso de plantas, raíces y hojas con
propiedades terapéuticas que les permitieron sobrevivir en un ambiente primitivo y hostil.

Es necesario señalar que las diferencias biológicas determinaron la participación y el reparto n el


seno de las diversas comunidades indígenas asignando a la mujer las actividades de protección,
promoción y mantenimiento de la vida frente a las condiciones adversas del medio y utilizando
para ello elementos naturales como el agua, las pieles, las plantas y los aceites. Los cuidados
básicos fueron dirigidos a la alimentación, la asistencia durante la gestación, el parto, la crianza y
el cuidado de los niños, ancianos y enfermos.

Esta época se basó en el animismo, por eso la magia, los ritos y las creencias primitivas
(exorcismos, utilización de hierbas, amuletos, cantos, uso de maracas y tabaco), aunado todo al
uso de baños en ríos (abluciones), el arropamiento húmedo (arcilla mojada) y la sangría, que
constituyeron asuntos íntimamente relacionados con los procesos de salud – enfermedad, tanto
en lo que concierne al propio concepto y a su evolución en el tiempo como a las prácticas de las
distintas civilizaciones no sólo para mantener la salud, sino también para curar las enfermedades.

Período Colonial
La época colonial comienza con el descubrimiento o encuentro de las civilizaciones (1498 en
Venezuela) y la independencia en 1810. La primera parte de este período consistió básicamente
en lo que se podría llamar la conquista del nuevo territorio por parte de los españoles, es decir, la
época de guerra y colonización de los indígenas, la fundación de ciudades y el primer poblamiento.
Se desarrolló en gran parte del siglo XVI.

La segunda parte del período colonial corresponde al desarrollo y población del territorio por los
españoles, negros y mestizos.

En cuanto a la medicina de la época, al arribar los españoles e iniciar la colonización guiados por la
codicia, imbuidos por el misticismo cristiano y provistos de una “mejor tecnología”, trajeron
también su medicina, que no era otra cosa que una medicina medieval aún, galénica o hipocrática,
una medicina de examinar el pulso y la orina prescribiendo purgas y sangrías.

Es importante destacar que las diversas culturas prehispánicas se vieron afectadas por una serie
de enfermedades infecciosas endémicas de características regionales, pero con el arribo de los
colonizadores españoles surgieron nuevas enfermedades que produjeron estragos en la población
local, entre ellas el sarampión, la varicela, la tos convulsiva, la difteria, la malaria, la fiebre amarilla,
la peste bubónica, el tifus exantemático y la lepra, traídas de Europa y África principalmente con
los grupos de esclavos africanos o los navegantes españoles.

Como las enfermedades afectaban a los indios y españoles, se vieron en la necesidad de


establecer centros de atención médica como hospitales, casas de reposo, refugios ya silos. En
general, la atención en estos hospitales estaba destinada a la gente pobre, los abandonados,
desprotegidos, incurables o desahuciados. Los españoles de buena posición económica solían ser
atendidos en sus domicilios, en donde recibían atención médica y religiosa. Los que ejercían los
cuidados de la salud a las personas se encontraban dispuestos en estamentos según sus
características de clase social y de estudios cursados. Según Archiva, citado por Sánchez (2005),
“…el ejercicio de la profesión médica estuvo sin control legal, uno de los rasgos típicos de la
medicina colonial, consistió en la obligada convivencia de médicos, curanderos, barberos,
cirujanos, comadronas, parteras, sangradores y flebotomistas”.

Los doctores en medicina eran los togados o facultativos (a partir de 1777 mediante el
Protomedicato de la capitanía General de Venezuela), los que se habían graduado en una facultad
o colegio de medicina, y eran españoles o descendientes “legítimos” por ambas ramas paternas.
Como en el siglo XVI aún no había ocurrido la fusión entre la medicina y la cirugía en Europa, la
parte manual la ejercían los cirujanos, quienes también tenían que haber cursado estudios en un
colegio o facultad y debido a su conocimiento del latín eran conocidos como cirujanos latinos, a
diferencia de los cirujanos romancistas, quienes habían cursado y rendido exámenes en español.
Por su parte, los flebotomistas eran practicantes menores cuya principal labor era hacer sangrías
por orden de los doctores. La boticaria o farmacopea, era parte de la medicina en ese entonces, y
la labor de los boticarios consistía en preparar y expender las recetas ordenadas por los doctores.

En esa época, las damas de la nobleza criolla contribuyeron a organizar los primeros servicios
elementales de asistencia pública en Caracas y Maracaibo utilizando sus conocimientos
domésticos. Se da la apertura del Hospital de San Pablo a cargo de practicantes de la escuela de
medicina y enfermeros empíricos (Jamieson, Sewall y Suhrie, 1968).

Asimismo, la lepra vino a constituir un problema en aquel momento (conocida como mal de
Lázaro), por lo que fue fundada, según Jamieson por Real Orden del 21 de marzo de 1752, el
Hospital de Lazarinos “Esquina de San Lázaro”. Posteriormente, los “leprosos” fueron enviados a
las colonias de cabo Blanco, Distrito Federal y Providencia en el estado Zulia.

No habiendo en Santiago de León de Caracas hospitales para la clase pudiente, eran mujeres las
que asistían a los enfermos a domicilio, entre quienes figuraron Francisca de Torres, Margarita
Díaz y Antonia de Becerra. En cuanto a la atención obstétrica figuran como primeras parteras
Isabel de Montes y Juana Henríquez.

Durante la Colonia hubo otro tipo de cuidados de la salud y medicina no tradicionales: las prácticas
curanderas tanto de indígenas como de africanos, quizás de mayor arraigo y extensión que la
misma medicina tradicional. Los curanderos, fieles a la tradición oral de sus antepasados, siguieron
haciendo uso del rico herbario medicinal, las prácticas curativas y los ritos míticos que venían
haciendo desde la época precolombina y que son aún parte de nuestra cultura.

La República

La Venezuela independiente, caracterizada por profundas transformaciones, entre ellas el cambio


generado en las condiciones demográficas y la introducción de nuevas enfermedades por parte de
los colonizadores (las desastrosas epidemias de fiebre amarilla y viruela), trajeron graves
consecuencias sobre la población. Consecuentemente se establecieron medidas defensivas, y de
este modo, mediante la lucha anti-epidémica, se inició el desarrollo del Sistema de Salud en
Venezuela (Archila 1956).

Algunos acontecimientos después de la Guerra de la Independencia (1810 – 1823) o comienzos de


la vida republicana (1830), influyeron en lo relacionado con la salud. Según Archila 1956, …

…la ley de Organización Política y de Régimen de las Provincias de 1830, estableció que los
Alcaldes Municipales velasen por la salubridad y ordenó la creación de Juntas Municipales de
Sanidad en las Capitales de Provincias y las Subalternas en las cabeceras de Cantones y Parroquias

Enfermedades como malaria, fiebre amarilla, peste bubónica, tifus y disentería constituyeron la
forma de vivir, enfermar y morir de la población. Las acciones del Estado fueron llevadas por las
juntas de sanidad u otros organismos, cuyo funcionamiento fue irregular e intermitente (García
1981).

Este período se caracterizó por una práctica empírica de la enfermería, cuya prestación de
cuidados se llevaba a cabo principalmente en el hogar, siendo su marco referencial el ejercicio del
cuidado a los enfermos. Este cuidado exigía un sentimiento cristiano, vocación y servicio, así como
observación, conocimiento y habilidades para curar.

En 1837, el Dr. José María Vargas autorizó al Dr. Santos Gásperi para dictar cursos a las mujeres
que quisieran dedicarse a la atención de partos.

El 24 de julio de 1874, en el convento de las Dominicas de Caracas se crea la casa de beneficencia


para los pobres de la solemnidad con un apartamento separado para los enfermos mentales,
reglamentándose por decreto el 20 de febrero de 1877 la administración y servicio de esta casa,
en donde también se crea una sala de maternidad.

Entre 1865 y 1889 aparecieron los primeros reglamentos, en los cuales se describieron las
funciones del personal de enfermería en instituciones sanitarias. Durante esta época, el grueso de
la población estaba ubicado en áreas rurales y los cuidados de enfermería eran llevados a cabo en
las distintas localidades por practicantes empíricos con escasa formación o por asistentes médicos.

Los cuidados de salud relacionados con la enfermería fueron llevados a cabo sobre todo por
mujeres, y se caracterizaron por el uso de plantas en infusiones, cataplasmas, vigilancia de la
alimentación, abrigo, masajes, cuidado de los enfermos en el hogar y asistencia como parteras.

Por otro lado, los curanderos, “brujos o brujas”, eran personas a las que la población atribuía
poderes especiales, puesto que combinaban ritos mágicos con conocimientos propios de los
cuidados de la salud, uso de hierbas, rezos y amuletos.

Por resolución del 11 de febrero de 1889, el gobierno de entonces contrató a monjas francesas de
la orden Hermanas de la Caridad de San José de Tarbes (1a) y a dos capellanes para la dirección
económica y atención de pacientes en lo que es actualmente el Hospital vargas, fundado en 1888.
Pese a su valiosa contribución, el control por parte de las congregaciones religiosas retrasó el
desarrollo de la enfermería (en 1907 se inicia la preparación del personal auxiliar de enfermería en
Ciudad Bolívar con un curso de dos años en el Hospital Ruiz Páez).
No es sino hasta el año 1912 cuando se crea la primera escuela de enfermería en el Hospital
vargas. Es importante señalar que las religiosas no permitieron a las estudiantes hacer su trabajo
práctico, aunado eso a su oposición a que ingresaran las primeras enfermeras graduadas.
Restricciones como estas ocasionaron el cierre de la escuela de enfermería.

Ahora bien, las cuidadoras religiosas tenían un modo de vida basado en la estricta disciplina, la
obediencia, la humildad y la sumisión. Las hermanas daban énfasis a la ayuda y asistencia al
enfermo, pero sus conocimientos empíricos no cubrían los requerimientos médicos de los
pacientes. La enfermería, desde esta perspectiva, no requería ningún tipo de formación
profesional especializada, a no ser su dedicación religiosa. Lo antes señalado se relaciona
significativamente con la influencia de la etapa vocacional descrita por algunos autores como
Martín Caro, para quien “…las actividades de cuidar se basan en el consuelo, con un enfoque
humanitario y en estrecha relación con la religión”.

Para 1916, se recibió en Venezuela la primera visita de una comisión de higienistas de los Estados
Unidos, de carácter cívico-militar, para asesorar la lucha contra la fiebre amarilla, dirigida por el
mayor general William C. Gorgas. Según la Fundación Rockefeller, la apertura del Canal de Panamá
podía favorecer que la fiebre amarilla se propagase al oriente, y considerando que era posible
extinguir totalmente los focos de endemicidad de las regiones en donde existían, resolvió
constituir, como en efecto hizo, una comisión destinada a erradicar dichos focos y a cooperar con
los gobiernos respectivos en su eliminación (Machado 1982).

Después de la experiencia del programa de malaria y fiebre amarilla, comenzado en 1916 y


finalizado abruptamente en 1932 por las condiciones políticas desfavorables, las relaciones entre
el Gobierno venezolano y la División Internacional de Salud (DIS) de la Fundación Rockefeller se
reestablecieron en 1936 tras la caída del régimen del dictador Juan Vicente Gómez (1908 – 1935),
en un período de intensa reinstitucionalización del país bajo un signo modernizador.

1935 – 1960 La institucionalización de la enfermería

En el transcurso de 1930, las nuevas demandas de salud, los cambios sociales y demográficos y el
crecimiento del sistema de salud, demandaron un nuevo modelo de formación de personal de
enfermería que diera una respuesta real a las necesidades existentes. Sin embargo, el atraso
educativo de la población en general impuso ciertas limitaciones para formar un personal
altamente capacitado. De acuerdo con Sawyer, citado por Vessuri (2001), “…las actividades
estaban dispersas y se carecía de personal adecuadamente adiestrado. Por encima de todo, el país
tenía demasiada prisa, lo cual de por sí, constituía un problema”.

Al principio de este período se asignaba el cuidado de los enfermos a estudiantes de medicina,


congregaciones religiosas y pacientes convalecientes, en su mayoría analfabetos, quienes
aprendían de forma empírica a cuidar de otros en el único hospital civil de la época (Hospital
Vargas). Los enfermos de familias pudientes eran atendidos en su domicilio por el médico de
cabecera (2), encomendándose a los familiares procedimientos simples como aplicación de calor,
frío, enemas, fricciones, cataplasmas, alimentos y cuidados de higiene personal; asimismo, algunos
enfermos de clases humildes eran también atendidos en sus domicilios por vecinos y curanderos.

Con la creación de los cursos de enfermería dirigidos por el Dr. Francisco Antonio Rísquez, se
mejora la asistencia técnica de los enfermos, ya que las egresadas de estos cursos comenzaron a
prestar sus servicios en instituciones públicas y privadas, así como también en el domicilio de las
familias adineradas (Jamieson 1968).

En cuanto a la enfermería asistencial se crearon “servicios de puericultura” con un médico jefe,


dos médicos adjuntos y cuatro enfermeras auxiliares. Estas últimas visitaban especialmente a las
madres y niños inscritos para comprobar que las prescripciones médicas se cumpliesen. También
había consultas de tuberculosis, venereología y lepra en los dispensarios, con médicos
especializados y auxiliares.

Al respecto, Jamieson 1968, señalaban que “…para 1931, el gobierno contrató enfermeras
puertorriqueñas, no solamente para la labor docente, sino también para cargos administrativos en
hospitales, escuelas de enfermería, unidades sanitarias y clínicas particulares”.

Las secuelas de la Segunda Guerra Mundial propiciada entre 1936 y 1945 aumentaron el flujo de
inmigrantes europeos, en su mayoría exiliados españoles, a quienes el Estado acogió y contrató
para aumentar la fuerza de trabajo capacitada.

En 1956 se creó el Ministerio de sanidad y Asistencia Social (MSAS), entre cuyas tareas estaban la
capacitación de recursos humanos, la contratación de peritos extranjeros y el otorgamiento de
becas a personas, entre ellas a estudiantes de enfermería, para formarse en el extranjero
mediante convenios con la Fundación Rockefeller, el Instituto de Asuntos Sanitarios y la Oficina
Sanitaria panamericana (Maldonado 1970).
Desde la perspectiva descrita anteriormente, el MSAS junto con el de Educación, determinaron la
formación de Enfermeras en los años sucesivos. Para 1937 ya Caracas contaba con la Escuela de
Enfermería del Hospital Vargas, creada en el año 1912 (3). El Dr. Francisco Antonio Rísquez (1856 –
1954), ilustre representante de la medicina clínica y miembro fundador de la Academia Nacional
de Medicina, apoyó la creación de esta escuela, anexa a la de Artes y Oficios para mujeres, siendo
su primer director (Boyle 1954).

Asimismo, durante los años que precedieron la década de 1940, los estudios y avances en materia
de pediatría y puericultura eran muy incipientes. No existían centros de salud especializados en la
atención del niño, que pudieran suplir las necesidades médicas de la población infantil, hasta la
fundación del Hospital Municipal de Niños “Dr. José Manuel de los Ríos” (4). Ante la imperiosa
necesidad de formar profesionales de la salud, esta institución médica se convirtió en sede de otra
Escuela de Enfermeras.

Otro centro de enseñanza de la época fue la Escuela de Enfermeras de la Cruz Roja “Dr. Francisco
Antonio Rísquez” (Actualmente Colegio Universitario de Enfermería de la Cruz Roja) (5), que
graduaba desde 1914 enfermeras en cursos de dos años. También desde 1914, la formación de
enfermeras por parte de la Cruz Roja se realizaba en otras ciudades fuera de la capital como eran:
Maracaibo, Puerto Cabello y San Cristóbal. En 1928, su director el Dr. Rísquez, implementó un
sistema de formación con cursos abreviados. Para 1937, la formación fue una modalidad de
internado de 2 años en un régimen semestral.

En 1937, el Ministerio de educación Dr. Rafael E. López, organiza una escuela de enfermería
adscrita a ese ministerio y conocida como la “Escuela Normal Profesional de Enfermeras” (Boley
1954). Como se señaló anteriormente, las circunstancias de la época permitieron al Gobierno
venezolano la acogida de recursos humanos capacitados para aligerar el desarrollo de un país que
cimentaba las bases de un nuevo tiempo.

Así fue como dos exiliadas españolas fueron contratadas por el Gobierno por recomendación de la
Fundación Rockefeller. La primera se formó en Cataluña, poseía una experiencia profesional de 18
años, había llevado a cabo estancias de especialización en Londres, Paris y Norteamérica, así como
ocupado la dirección de la Escuela de Enfermeras de la Generalitat catalana (7). La segunda se
formó en Madrid, en donde adquirió una experiencia de diez años. También se había especializado
en el extranjero y ocupado el puesto de directora del Instituto Infantil de Sevilla

. Ambas conocieron a fondo los principios de la enfermería anglosajona liderada por Florence
Nightingale y consideraron que la única vía de progreso de la enfermería como disciplina era su
profesionalización. La primera tomó el cargo de directora y a la segunda se le asignó el de
subdirectora. Sus tareas en Venezuela consistieron en organizar y dirigir la escuela de enfermería
pese al bajo presupuesto, la falta de equipos y los inadecuados salones de clase.

En cuanto a la preparación profesional de la época, su formación estuvo a cargo de las


instructoras, médicos y estudiantes avanzados de medicina. Con la creación del MSAS se
estableció una estructura gubernamental que potenció la adopción de programas de envergadura
en salud pública, como las luchas antimalárica y antituberculosa, sumadas a una creciente
inversión en la construcción de un sistema público nacional y la adquisición de equipos e inversión
en la formación de recursos humanos, entre ellos los de enfermería, y se iniciaron los estudios de
postgraduadas en el exterior y en el país (6) en las diferentes ramas de la enfermería: salud
pública, arte de la enfermería, anestesia, pediatría, puericultura, obstetricia, nutrición, dietética,
tuberculosis, psiquiatría, quirófano, cuidado de los niños prematuros, administración de
hospitales, planificación, desarrollo de la comunidad, así como cursos docentes para directoras,
coordinadoras e instructoras de escuelas de enfermería y campos clínicos.

En 1940 la enfermera Mary Elizabeth Tennat, enviada por la Fundación Rockefeller del Programa
de Enfermería de Salud Pública de la DIS, recomendó fundar una escuela nacional independiente
que tomó como punto de partida la Escuela Normal Profesional de Enfermeras.

Las primeras escuelas de enfermería en Venezuela pasaron por un proceso discontinuo de


crecimiento, incluso con desaparición o integración, ya que inicialmente eran programas para
enfermeras planificados por médicos con un contenido programático elemental básico y teórico
de la medicina más que nada. La educación para enfermeras se fundamentó en el modelo
pedagógico del “aprender haciendo”, así como en la vigilancia moral y técnica de los aprendices
por parte de sus instructores.

La formación fue principalmente llevada por médicos o estudiantes de medicina para contar con
un personal de apoyo cuya preparación les permitiera asumir de manera competente algunas
actividades de atención a los enfermos en los hospitales, pero principalmente bajo la conducta y
tutela médica, lo cual determinó marcadamente el quehacer de las enfermeras de la época,
caracterizado sobre todo por las conductas socialmente aceptadas de obediencia y sumisión, así
como un mecánico cumplimiento de funciones y asistencia basado principalmente en las
necesidades de los médicos.

Cambios sociopolíticos y su influencia en la salud


Entre 1945 y 1960 acontecen cambios que transforman profundamente la sociedad venezolana.
En 1947 se creó el Instituto nacional de Hospitales, en 1949 sólo había 7 hospitales nacionales
para todo el país, el resto eran municipales y privados.

En 1950 ya había 23 hospitales, con 2.932 camas y en 1960 se contaban con 22.773 camas oficiales
(Archiva 1954).

Escuela Nacional de Enfermeras (ENE)

La Escuela se crea por decreto ejecutivo el 22 de julio de 1940, según la Gaceta nº 20.400, siendo
su asiento principal la ciudad de Caracas, adscrita al MSAS con personalidad jurídica, autonomía y
patrimonio propio. Su inauguración fue el 15 de noviembre de ese mismo año.

A la ENE se transfirieron las estudiantes e instructoras de la Escuela Normal. Comienza con 38


alumnas de la Escuela Normal y 115 nuevas. El proyecto contó con la presencia de las enfermeras
Montserrat Ripol y Aurora Mas Gaminde (7), ocupando los cargos de directora y subdirectora,
además de los de docencia y supervisión que venían desempeñando anteriormente. Hacia 1941 se
incorporó otra enfermera española, ex becaria de la Fundación Rockefeller, Manolita Ricart
procedente de Barcelona y con un amplio bagaje profesional, la cual desempeñó importantes
funciones como docente, así como también de subdirectora.

Al fallecer Montserrat, Aurora Mas pasa a ocupar el cargo de directora, bajo cuya dirección
comenzó a publicarse la revista de la ENE (Se empezó a publicar en 1942, imprimiéndose la última
en 1950.

En 1943 es nombrada directora de la ENE de Caracas Antonia Fernández, enfermera venezolana


graduada en Panamá y con amplia experiencia en salud pública, quien contrató como instructora
del arte de la enfermería a la enfermera estadounidense Evelyn A. Sturner, integrante de la Oficina
Panamericana de la Salud (OPS). Su labor fue de gran valor para la preparación y formación de la
escuela e instructoras de otras escuelas de enfermería del país. Para el 19 de marzo de 1946, con
la colaboración de Marieta Lares S., integrante de la primera promoción de enfermeras de la ENE
de Caracas, la enfermera Sturner elabora el “Manual Técnico de Enfermería” (Dolores 2011).

Los objetivos de estas enfermeras que llevaban la dirección de la Escuela Nacional de Enfermeras
eran:

Formar enfermeras profesionales.

Servir como modelo para la organización de la instrucción de enfermeras en el país.


Elevar los estándares de la profesión en Venezuela.

Coordinar los esfuerzos de todas las agencias interesadas en proporcionar mejores servicios de
enfermería.

El propósito primordial de la ENE fue preparar enfermeras para el ámbito de la Salud Pública
(Fernández 1942). Estas escuelas se crearon por todo el territorio venezolano, resaltando las
siguientes según su orden cronológico de creación:

1947, Valencia, Escuela Nacional de Enfermeras “Dr. Francisco Antonio Rísquez”, cuya primera
directora fue Aurora Vivas.

1948, Barquisimeteo, Escuela Nacional de Enfermeras “Dr. Juan Alberto Olivares”, y su directora
fue Ramona Contreras.

1949, Cumaná, Escuela Nacional de Enfermeras “Dr. Domingo Badaraco Bermúdez”, cuya directora
fue Lastenia Izaguirre.

1954, Maracaibo, Escuela Nacional de Enfermeras de Maracaibo, cuya directora fue Antonia
Campos.

1957 Caracas, Escuela Nacional de Enfermeras “María de Almenar”.

1963, Mérida, Escuela Nacional de Enfermeras, cuya primera directora fue Maruja Rivas Belandria.

En Caracas se crearon también la Escuela de Enfermería de la Cruz Roja (1937), la Escuela del
“Trabajo y Estudio” (1959), la Escuela “Municipal de Enfermeras” (1960), la Escuela “Florence
Nightingale” (1963), la Escuela de Enfermería de las Fuerzas Armadas y la Escuela de Enfermería
del Hospital Coromoto en Maracaibo.

NOTAS

(1) Las Hermanas de San José de Tarbes vinieron desde Cantaous (Francia) a Venezuela en 1889.
Las 18 primeras religiosas dirigidas por la Reverenda Madre Saint Simón, llegaron a La Guaira,
Venezuela, el 13 de junio de 1889, con el objeto de desempeñarse en centros hospitalarios y
educativos. A petición de las familias de Caracas, el 1 de marzo de 1891, se abrió una casa
particular contigua a la Iglesia de San Juan, el "Internado de San José de Tarbes", con una
matrícula inicial de 40 alumnas. En 1902 el colegio se traslada a su nueva sede en “El Paraíso”,
donde continúa su funcionamiento.

Al transcurrir del tiempo, el Colegio ha crecido hasta alcanzar una matrícula considerable,
incorporando de nuevo la educación mixta. En función de las exigencias pedagógicas, acorde con
los nobles objetivos de la Institución y de una Venezuela de avance, fue necesario ampliar
sustancialmente la infraestructura del Plantel

Durante los primeros 30 años de funcionamiento, además de la formación integral que se impartía
a las alumnas, se cultivaba el buen gusto por las bellas artes, se fomentaba el amor al deber, se
formaba su corazón inspirándoles una piedad sólida, cualidades que eran y continúan siendo el
encanto de la sociedad y aseguran el bienestar de la familia como Institución. Junto a la educación
Primaria, el Colegio impartía la enseñanza del idioma francés como segunda lengua. Otorgaba a las
alumnas el Diploma Francés, Título máximo reconocido en este Instituto.

En 1936, se crea la Educación secundaria y la Educación Preescolar, ajustándose a las exigencias


legales establecidas por el Ministerio de Educación. Esta apertura de la Institución a los diferentes
niveles educativos, impone la necesidad de construir una edificación dedicada a tales fines, la cual
es llevada a cabo por la compañía Guinand y Brillembourg, gracias al dinamismo de la Reverenda
Madre Saint Jacques, quien con grandes esfuerzos adquirió terrenos adyacentes al edificio central
y gradualmente fue impulsando nuevas instalaciones, hasta lograr lo que constituye el actual
Colegio San José de Tarbes - El Paraíso.

(2) Dentro de los cuidados médicos estaban el control de la temperatura, las inyecciones, los
vendajes, las sangrías y las ventosas, entre otros).

(3) Esta Escuela funcionó hasta 1919 y luego pasó a formar parte de la Escuela Normal de
Maestros.

(4) Hospital Municipal

5) Escuela de Enfermeras “Dr. Francisco Antonio Rísquez” (Actualmente: Colegio Universitario de


Enfermería de la Cruz Roja Venezolana)

La creación de la Escuela de Enfermeras de la Cruz Roja se debe al Dr. Francisco Antonio Rísquez
(1856-1941), quien se dedicó, entre otras cosas, a idear y llevar a cabo proyectos en la formación y
capacitación de Enfermeras.

Desde 1914, la Escuela Pública de Enfermeras graduaba Enfermeras en cursos de 2 años, pero para
el Dr. Francisco Antonio Rísquez había necesidad de formar Enfermeras a la brevedad posible, por
lo que en 1928 en su carácter de Director de la Escuela Oficial y Secretario de la Cruz Roja, creó
cursos abreviados de 4 meses. Funcionaron hasta 1934 y su éxito puede medirse por la aparición
de los cuatro grupos de Samaritanas, que ganaron su diploma de la Cruz Roja con que se las
distingue y son hoy la gala y honor de la Cruz Roja Venezolana.
El 24 de julio de 1936, Risquez inaugura el primer curso definitivo. Dicha inauguración se hizo
junto con la del Hospital.

En 1937 la Escuela es una Institución sólida. Su sede está en la Cruz Roja, en un pabellón de dos
pisos construido especialmente para el plantel. Las alumnas son todas internas y el personal
directivo habita igualmente en la sede. El curso consta ahora de dos años, cada uno dividido en
semestres.

En 1947 los estudios son de tres años y, para la fecha, han egresado de la Escuela 105
profesionales que trabajan en distintos hospitales, clínicas e institutos médicos-asistenciales. Para
ese mismo año se construye una nueva sede.

En sesión del 20 de mayo de 1948, el Comité Ejecutivo de la Cruz Roja Venezolana decide dar el
nombre de Francisco Antonio Risquez a la Escuela de Enfermeras Profesionales de la Cruz Roja. En
el mismo año, la Primera Convención de la Cruz Roja dicta nuevos Estatutos, en cuyo artículo 37 se
basa el Comité Central Nacional para redactar y promulgar un Reglamento para el funcionamiento
de los Comités de Samaritanas.

La Escuela de Enfermeras Francisco Antonio Rísquez se desenvuelve en forma progresiva en los


años siguientes, hasta que le es otorgado el voto oficial favorable para que pase al rango de
Colegio Universitario de Enfermería de la Cruz Roja de Venezuela (Según Gaceta Oficial No.
267.281 del 11/10/1988) Hay que tener en cuenta que esta profesión, si bien provee de un modo
de vida, requiere de una gran dosis de entrega, de humanidad, de servicio a la colectividad.

(6) Los estudios de postgraduadas apoyados por el Ministerio de Sanidad comenzaron a partir de
1938 y se desarrollaron de forma discontinua a lo largo del siglo XX.

(7) Aurora Mas Gaminde, enfermera visitadora madrileña que a sus 36 años fue becada durante el
gobierno de la IIa República para cursar sus estudios de Salud Pública en la Fundación Rockefeller.
En 1940 por sugerencia de Mary E Tennant fue a Venezuela junto con Montserrat Ripol, y participó
en la recién creada Escuela Nacional de Enfermeras (ENE).

Fue directora de la ENE de 1941 a 1943 durante los cuales creó la revista también llamada ENE en
la que publicó cuatro artículos. Carlos Álvarez Nebreda recoge esta revista en “Catálogo
Bibliográfico de Publicaciones Enfermeras - 1864 – 1977”. También trabajo con Manolita Ricart en
Maracaibo cuando abandonó la escuela ENE. En 1933 había participado en la nueva revista La
Visitadora Sanitaria. (Grupo de investigación, Cuidados Invisibles. Aurora Mas.

HISTORIA DE LA ENFERMERIA POR MODELOS Y TEORISTAS


· Florence Nightingale, considerada la madre de la Enfermería moderna. Orientó los
cuidados de Enfermería al control del ambiente para facilitar la recuperación de los enfermos.

· Virginia Henderson, autora del modelo conceptual basado en las 14 necesidades


básicas de la persona.

· Dorothea Orem, autora de la teoría general del déficit de autocuidado.

· Hildegard Peplau, autora del modelo de las relaciones interpersonales (incluido en su


libroInterpersonal relations in nursing, 1952).

· Callista Roy, enfermera autora del modelo de adaptación (Introduction to Nursing: An


Adaptation Model, 1976).

· Jean Watson, autora de The Theory of Human Caring («Teoría del cuidado humano»),
y de losfactores curativos filosóficos, en 1975.

· Madeleine Leininger, autora de la teoría de la diversidad y la universalidad.

· Martha Rogers, autora de la teoría de los seres humanos unitarios, en la que propone
que el individuo es más que la suma de sus partes, un ser pensante con sentimientos e ideas y el
cuidado que se brinda no puede ser dividido sino pandimensional.

OBJETIVO GENERAL:

Formar un(a) enfermero(a) mediante un proceso que permita al profesional de enfermería ser
capaz de planear, ejecutar y evaluar el cuidado integral de enfermería brindando al individuo,
familia y comunidad en las diferentes etapas de su vida y en los diferentes niveles de prevención y
de atención primaria, para ayudar a conservar la salud y contribuir al desarrollo profesional y
socio-económico del país.

OBJETIVO ESPECIFICO:

1. Tomar decisiones adecuadas en cualquier situación de Enfermería, haciendo uso de su


pensamiento crítico, creativo y reflexivo de tal manera que se constituya en agente de cambio
dentro de la sociedad.

2. Realizar el estudio de la situación de salud del individuo, familia y comunidad,


estableciendo prioridades para brindar la atención de enfermería, promoviendo la integración
docente asistencial (IDA).

3. Brindar educación sanitaria al individuo, familia y comunidad haciendo uso de los


recursos existentes y aplicando la metodología más adecuada.

4. Planificar, organizar, coordinar, supervisar y evaluar el trabajo de Enfermería en las


Unidades de Atención de una Institución de Salud o en otras Instituciones de la Comunidad.
5. Desarrollar a plenitud su rol personal, social y profesional, considerando al paciente
como centro de su atención y demostrando una amplia formación humanística, científica,
tecnológica, ética y bioética.

PERFIL PROFECIONAL:

1. El fundamento de su perfil es la educación sanitaria, el individuo, la familia y la


comunidad, participando en la búsqueda de cambios que mantengan e incrementen condiciones
sanitarias saludables, utilizando la metodología que más se adecúe a la situación real encontrada y
a las posibilidades de participación de la comunidad en el cuidado de su propia salud, ayudando a
utilizar la tecnología apropiada de su localidad o región.

CONCEPTO ENFERMERÍA

La Enfermería es la ciencia del cuidado de la salud del ser humano. Es una disciplina que en el
último siglo y particularmente en los últimos años ha ido definiendo cada vez más sus funciones
dentro de las ciencias de la salud. Según la definición elaborada por la Facultad de Enfermería de
laUniversidad de Moscú, en Rusia, es la «ciencia o disciplina que se encarga del estudio de las
respuestas reales o potenciales de la persona, familia o comunidad tanto sana como enferma en
los aspectos biológico, psicológico, social y espiritual». La enfermería es una profesión de
titulación universitaria que se dedica al cuidado integral del individuo, la familia y la comunidad en
todas las etapas del ciclo vital y en sus procesos de desarrollo.

ENFERMERAS RELEVANTES:
§ Florence Nightingale, considerada la madre de la Enfermería moderna. Orientó los cuidados de
Enfermería al control del ambiente para facilitar la recuperación de los enfermos.

§ Virginia Henderson, autora del modelo conceptual basado en las 14 necesidades básicas de la
persona.

§ Dorothea Orem, autora de la teoría general del déficit de autocuidado.

§ Hildegard Peplau, autora del modelo de las relaciones interpersonales (incluido en su libro
Interpersonal relations in nursing, 1952).

§ Callista Roy, enfermera autora del modelo de adaptación (Introduction to Nursing: An


Adaptation Model, 1976).

§ Jean Watson, autora de The Theory of Human Caring ("Teoría del cuidado humano"), y de los
factores curativos filosóficos, en 1975.

§ Madeleine Leininger, autora de la teoría de la diversidad y la universalidad.

§ Elvira Dávila Ortiz, pionera en la profesión de enfermería y de la transfusión de sangre en


Iberoamérica.

§ ANTECEDENTES DE ENFERMERÍA:

§ El cuidado de la salud en el México prehispánico fue sobresaliente en los pueblos


mesoamericanos, su enfoque era preventivo y sus acciones aprendidas desde niños, ya que la
atención de los enfermos recaían sobre la familia.

§ Existían especialistas que diagnosticaban el problema de salud, decidían la terapéutica e


indicaban a la familia, la atención que el enfermo requería, entre los Mexicas, denominaban Tacitl
a éstos “médicos”. Tlamaqueticitl se llamaba a la partera, a ella se encomendaba desde la atención
prenupcial, los cuidados prenatales, del parto, el puerperio y la atención del niño.

§ La conquista de México vino a desarticular la estructura económica, política y social de las


culturas americanas, amenazándolas casi con la extinción a consecuencia de la guerra, la
explotación, los malos tratos y sobre todo, las epidemias que azotaron a la Nueva España, lo que
obligó a los conquistadores a construir hospitales junto a los conventos religiosos, así, hombres y
mujeres actuaron como “Enfermeros”. Ya en las cofradías sin tener conocimientos, o en los
hospitales para españoles cuando se tenían conocimientos médicos, adquiridos y practicados
desde antes de la conquista.
§ El crecimiento de la población inmigrante y el desarrollo de la vida económica, requirió la
incorporación del sexo femenino al mercado de trabajo; en 1798 se abolió en la Nueva España la
prohibición de que la mujer trabajara, así se empleó como lavandera, cocinera, hilandera y
maestras; entre otras, por lo que las actividades de enfermería fueron quedando en manos de
mujeres, los hombres se incorporaban a la minería, agricultura, construcción y el estudio de
profesiones que les aseguraban un mayor prestigio social.

§ La práctica de las parteras, mostraba una amalgama de procedimientos prehispánicos,


judeocristianos y negros, donde la magia, la religión, los conjuros y la herbolaria se mezclaban con
su experiencia y compromiso social. Su ejercicio era libre en función de las necesidades de la
comunidad a la que prestaban sus servicios como partera, yerbera, curandera o adivina. Su
actividad se modificó en función de la práctica médica a partir del establecimiento del
Protomedicato de Ciencias Médicas, después llamado Colegio de Medicina.

§ Finalmente se puede decir, que tanto en el campo educativo como en el de prestación de


servicios, el desarrollo de la enfermería se ha visto influenciado por el modelo Nightingale y por los
cambios políticos, sociales y económicos ocurridos en los pueblos desde el inicio del siglo XX.

§ Algunos acontecimientos influyeron directa o indirectamente en el sistema de atención que se


impartía y en las funciones de quienes la proporcionaban. En la primera mitad del mencionado
siglo, las dos guerras mundiales incrementaron la demanda de enfermeras, propiciaron el
desarrollo de las técnicas quirúrgicas y de curaciones requeridas en el frente de batalla, así como
la legislación general y la particular de la profesión.

§ Al iniciar el siglo XX, el médico necesitó formar enfermeras porque con la expulsión de las
órdenes religiosas, ya no contaba con atención cristiana y gratuita para sus enfermos; en 1902, se
efectúo el primer curso básico para enfermeras, estableciendo como requisito previo de estudio el
cuarto año de primaria.

§ En 1907, la enfermería evoluciona de manera acelerada en relación a un mercado de trabajo


que demanda puestos por cubrir; a partir de eso, la enfermera pierde su autonomía e ingresa a un
mercado cautivo subordinada a grupos de poder hospitalario. En este año se formaliza la
educación de enfermería, al fundarse la primera escuela reconocida, que exigía como requisito de
ingreso el certificado de primaria completa y se desarrolla con sede en el Hospital General de
México. La orientación práctica es hacia el hospital, pues se considera en esos momentos
dominante a pesar se sus grandes deficiencias.
§ En 1922 una de las prácticas más destacas de la enfermería fue en el campo de la salud pública
al implementarse un programa de saneamiento ambiental, su desempeño era como “visitador
domiciliario” y se creo la Dirección de Enfermeras de la hoy Secretaría de Salud y la enfermera
asume funciones de gestión y liderazgo.

§ En 1929, la UNAM pone en marcha el plan de estudios de la carrera de enfermería y obstetricia


con duración de cinco años. En 1935, se establece como requisito previo para estudiar
enfermería, los estudios de nivel secundaria.

§ En 1941 el Plan Nacional de Gobierno, propone como indicador nacional, una enfermera por
cada cinco mil habitantes. Logrando la Secretaría de Salubridad y Asistencia, el indicador de una
enfermera por cada siete mil habitantes.

De 1945 a 1955 La Ley General de profesiones incluye a la enfermería dentro del catálogo de las
profesiones. Se crean las Jefaturas estatales de enfermería dependientes de la S.S.A. y se
establecen nuevos centros de salud con personal

EVOLUCIÓN TEÓRICA:

Enfermería es una ciencia joven, tenemos que recordar que la primera teoría de enfermería es la
de Flórense, a partir de a qui nacen nuevos modelos. Cada modelo aporta una filosofía de
entender la enfermería y el cuidado.
La enfermería desde sus orígenes era considerada como una ocupación basada en el experiencia
practica y el conocimiento común, y no contemplaba el conocimiento científico de la profesión,
este nace con la primera teoría de enfermería. También las enfermeras centraban su atención a la
adquisición de conocimientos técnicos que habían sido delegados. En 1852 Florence con su libro
“NOTAS DE ENFERMERÍA” sentó la base de la enfermería profesional, ella intento definir cual era
la aportación especifica de la enfermería al cuidado de la salud.

Entre 1950-1960 se formo una corriente de opinión para buscar cuales eran los fundamentos de
la profesión.

El marco teórico conceptual de la enfermería es el armazón que encuadra y delimita la existencia


de una determinada forma de actuar. Trata de guiar la acción profesional en la función asistencial,
docente, administrativa e investigadora. Este está constituido por:

- Ideas y conceptos inherentes a la propia disciplina.

- Ideas y conceptos seleccionados entre otras áreas o disciplinas de la ciencia.

Los elementos que configuran el marco conceptual de la enfermería y que están presentes y todas
las teorías o modelos son:

- El concepto de Hombre.

- El concepto de Salud.

- El concepto de Entorno.

- El concepto de Rol Profesional o de Enfermería.

§ profesional en varios estados de la República Mexicana, entre ellos Jalisco.

BASES DE LA PROFESIÓN DE ENFERMERÍA:

Profesión:

Es una ocupación con componentes éticos encaminados a incrementar el bienestar humano y


social, dichos conocimientos desarrollados científicamente y sometidos a la prueba de la
experiencia, son especializados y sistematizados.
Propedéutica:

La palabra propedéutica proviene del latín pro que significa ante o delante y del sufijo padet

ulike, referente a las enseñanza o instrucciones preliminares a una enseñanza mas completa.

Propedéutica de la Enfermería:

Es la base fundamental de las técnicas aplicadas a la enfermería y atención del individuo enfermo.
Resulta del estudio científico de las necesidades y comprensión del cuerpo humano.

Enfermería:

Es el conjunto de conocimientos, habilidades y destrezas, basados en principios científicos,


encaminados a lograr el bienestar humano social. Se aplica al cuidado de los enfermo, al manejo y
restauración de la salud y la prevención de las enfermedades.

La enfermería comprende el diagnóstico y tratamiento de las relaciones humanas a los problemas


relacionados con la salud, tanto existente como potencial.

Filosofía de la Enfermería:

Se basa en las necesidades y relaciones humanas para dirigir acciones de enfermería con
fundamentos científicos y principios legales para el logro del equilibrio bio-psico –social y
espiritual sin discriminación y respetando la idiosincrasia de cada persona.

La Ética en la Enfermería:

Todo individuo tiene la facultad de elegir su profesión, una vez elegida esta, se tiene el deber
para prepararse en su ejercicio.

La moral profesional, es el conjunto de facultades y obligaciones que tiene un individuo en virtud


de la profesión que elige.

La razón del profesional es servir a la humanidad, y su principal objetivo es el bienestar individual ,


familiar y social basado en los principios.
Cada profesión tiene sus exigencias particulares, pero todos tienen un objetivo común; cumplir
con la sociedad.

Los deberes profesionales son formas concretas de llevar la práctica los valores de la veracidad, la
valentía y la justicia, la lealtad y otras virtudes del ser humano.

Es la base fundamental de las técnicas aplicadas a la enfermería y a la atención del individuo


enfermo.

Resulta del estudio del cuerpo humano.

PRINCIPIOS BÁSICOS DE ENFERMERÍA:

Respetar la individualidad del paciente:

Todo hombre forma parte de una sociedad que tiene derechos, deberes, privilegios y libertades,
asimismo, temores y necesidades personales que comúnmente se exacerban con la enfermedad.

El nombre, la ropa las pertenecías sirven a menudo de su identidad , representan seguridad por lo
que la enfermera ayudara al paciente a conservar su identidad al llamarlo por su nombre
tratándolo como un individuo único.

Mantener las funciones fisiológicas normales:

El ser humano requiere de un equilibrio fisiológico.


El respirar, comer, dormir, reposo, eliminación, etc. al observar al paciente durante la realización
del procedimiento permitirá detectar a tiempo complicaciones ya que una necesidad no cubierta
se convierte en un problema; la observación significa más que mirar, incluye escuchar hablar con
el paciente, etc.

Proteger al paciente de causas externas que puedan causar enfermedad:

En el ambiente existen agentes patógenos.

Evitar infecciones cruzadas, al usar las técnicas asépticas, al protegerlo de cualquier daño físico y
biológico.

Ayuda a la rehabilitación del paciente:

Comprende el restablecimiento del paciente al nivel mas completo de funcionamiento social, físico
y mental, los cuidados de enfermería permiten prevenir complicaciones que retrasen o impidan la
recuperación completa.

OBJETIVOS BÁSICOS DE ENFERMERÍA:

§ Promover la salud

§ Prevenir la enfermedad

§ Restaurar la salud

§ Aliviar el sufrimiento

OBJETIVOS DE LOS MODELOS DE ENFERMERÍA:

La tendencia naturalista: también denominada ecologista, se incluye en este apartado los


conceptos formulados por Florence Naghtingale, que enfoca los cuidados de enfermería como
facilitadotes de la acción que la naturaleza ejerce sobre los individuos enfermos.

La tendencia de suplencia o ayuda: los modelos representativos de esta tendencia son los de
Virginia Henderson y Dorotea Orem. Estas autoras conciben el papel de la enfermera como la
realización de las acciones que el paciente no puede llevar a cabo en un determinado momento de
un ciclo vital (enfermedad, niñez, y ancianidad), fomentando ambas, en mayor o menor grado, el
auto cuidado por parte del paciente.

La tendencia de interrelación: en este grupo se incluyen los modelos Hildegarde Peplau, Callista
Roy Martha Roguers y Levine. Estas enfermeras usan como base fundamental para la actuación de
enfermería, el concepto de relación, bien sea las relaciones interpersonales (enfermera-paciente)
o las relaciones del paciente con su ambiente.
CLASIFICACION DE LOS MODELOS DE ENFERMERIA SEGÚN TEORIAS UTILIZADAS:

Modelo de interacción:

Se basa en la teoría de la comunicación-interacción de las personas. Se basan en las relaciones


entre las personas.

El foco primario están las personas como participante activo en el proceso de la salud. El énfasis
en las percepciones de la persona debe ser el : auto concepto, y la habilidad para comunicar y
desarrollar diferentes roles. El principal objetivo del modelo a seguir es obtener logros
determinados mediante la interacción reciproca.

Destaca dentro de estos modelos las siguientes teorías: Orlando (1961), Riehl (1980), Kim (1981).

Modelos evolucionistas:

Se centran en la teoría del desarrollo o cambio para explicar los elementos en una situación de
enfermería. Son útiles en cualquier campo de la enfermería relacionado con la edad.

Modelos evolucionistas:

Se centran en la teoría del desarrollo o cambio para explicar los elementos en una situación de
enfermería. Son útiles en cualquier campo de la enfermería relacionado con la edad.

Dicho cambio puede predecirse y ocurre en unas determinadas fases o etapas. El principal objetivo
del modelo es potenciar el crecimiento personal del individuo destacan las siguientes teorías:
Thibodeau (1983), Peplau (1952).

Modelo de las necesidades humanas:

Parten de las teorías de las necesidades humanas para la vida y la salud como núcleo para la
acción de enfermería.

Basadas en la teoría de la motivación y personalidad de A.Maslow. En el desarrollo de su teoría,


Maslow define 5 categorías de necesidades que se ordenan por prioridades en cuanto a su
satisfacción y establece primero, se ha de satisfacer las necesidades de orden mas básico (al
menos la mayoría de ellas) para pasar posteriormente a satisfacer las necesidades de su orden
superior.

Las categorías de Maslow son las siguientes:

§ Fisiológicas.

§ De seguridad.

§ De amor y pertenencia.

§ De estima.

§ Y autorrealización.

Existe una serie de diferencias entre las necesidades superiores y las inferiores según la primera
pirámide de Maslow:

Cuanto más elevada la necesidad menos impredecible es para la supervivencia del individuo.
Cuanto mas elevada es la necesidad mas específicamente humana es.

A medida que se cubren las necesidades superiores existe un mayor nivel de supervivencia de la
persona; la cobertura de las necesidades superiores representa una tendencia general para la
salud.

Si se cubren las necesidades superiores se producen resultados subjetivos más deseables, por
ejemplo más felicidad. Es necesaria una serie de condiciones externas buenas para la cobertura de
las necesidades superiores, son precisas unas condiciones muy buenas para hacer posible la
autorrealización.

La satisfacción de las necesidades inferiores es mucho más palpable, más tangible que la
satisfacción de las necesidades superiores, y se mide más en términos cuantitativos.

Las necesidades superiores son desarrollo de evolución tardía; son menos exigentes y se pueden
retrazar más en el tiempo.

La satisfacción de las necesidades superiores depara más felicidad y conducirá a un crecimiento


mayor de la persona, así mismo requiere de un entorno externo mas apropiado.

La cobertura de las necesidades tiende hacia en perfeccionamiento, el fortalecimiento y el


desarrollo sano de la persona. Destacan las siguientes teorías: Henderson (1966). Rogers (1970),
Oren (1980), Roper (1980).

Modelo de sistemas:

Usan la teoría general del sistema como base para describir los elementos para una situación de
enfermería.
El concepto de sistema constituye la noción central, entendiendo por tal el conjunto organizado de
elementos o partes que actúan e interactúan coordinadamente para alcanzar determinados
objetivos.

Existen dos tipos de sistemas:

1.- Sistemas cerrados. Se basan en si mismos, se consideran aislados del medio circundante, no
existen en ellos importación o exportación de energía en cualquiera de sus formas.

2.- Sistemas abiertos: funciona en base al intercambio con el exterior; todo organismo vivo es,
ante todo, un sistema abierto.

Una diferencia fundamental entre ambos es que los sistemas cerrados deben alcanzar un estado
de equilibrio químico y termodinámico independientemente del tiempo. Por el contrario, los
sistemas abiertos pueden alcanzar en ciertas condiciones, un estado que se denomina uniforme,
también independiente del tiempo. En este estado uniforme, la composición del sistema se
mantiene constante, a pesar del continuo intercambio de componentes.

Los sistemas se organizan internamente mediante una estructura de niveles jerárquicos llamados
subsistemas. Las propiedades de los sistemas abiertos son las siguientes:

· Totalidad: cada una de las partes esta relacionada de tal modo con las otra que un cambio en
una de ellas provoca un cambio en todas las demás y en el sistema total.

· Equifinalidad: puede alcanzarse el mismo estado final partiendo de diferentes condiciones


iniciales y por diferentes caminos.

· Retroalimentación: parte de la salida de un sistema vuelve a introducirse en un sistema como


parte informativa acerca de dicha salida. La retroalimentación negativa se utiliza para disminuir la
desviación de salida con respecto a una norma establecida y la positiva actúa como una medida
para aumentar la desviación de salida.

Si aplicamos la teoría del sistema a las personas, podríamos decir que:

Cada persona es un compuesto dinámico que presenta interrelaciones variables, fisiológicas,


psicológicas, socioculturales y de desarrollo.

Cada una de las personas esta rodeada por un campo de percepciones en equilibrio dinámico.

El núcleo principal es la organización del campo y su impacto sobre la conducta funcional del
individuo. Todos los sistema aspiran al equilibrio (entran las fuerzas internas y externas del
sistema).

Los sistemas abiertos reciben-procesan-producen y se retroalimentan con y el entorno.

Destacan las siguientes teorías: Roy (1980), Jhonson (1980), Neoma

……………………………………Historia de la Escuela de Enfermería


En junio de 1906 se fundó la Escuela de Enfermeras del Estado, dependiente de la Facultad de
Medicina y Farmacia de la Universidad de Chile, constituyéndose en la primera de esta índole en
Sudamérica. La enseñanza se desarrolló en el Hospital San Vicente de Paul, y las primeras
generaciones pudieron ingresar sin el requisito de estudios completos, pero a partir de 1937 se
exigió a las nuevas estudiantes haber rendido el Bachillerato con mención en Humanidades.

Integrantes de su cuerpo docente fueron becadas por organizaciones norteamericanas para


perfeccionarse en el extranjero; ello, junto a la llegada de asesores internacionales, contribuyó al
desarrollo de exitosos programas de salud, entre los que destacan las Unidades Sanitarias, en cuya
organización y funcionamiento tuvieron activa participación las enfermeras egresadas de la
Universidad de Chile.

En 1951 se fusionaron las Escuelas de Enfermería Hospitalaria y de Enfermería Sanitaria,


modalidad de formación que perdura en la actualidad. Dos años después, y dado el crecimiento de
la enseñanza de la disciplina en el país, se estableció un reglamento nacional para la formación de
estas profesionales.

En 1963 nació la Sociedad de Educación de Enfermería, organización que agrupa a los docentes de
todas las escuelas del país. En esa misma época, y con el fin de aportar profesionales de
Enfermería a las regiones, la Universidad de Chile creó los Centros Universitarios Regionales en
Temuco, Talca, Antofagasta, La Serena, Osorno y Ñuble; durante estos años, los planes de estudio
fueron revisados periódicamente, tratando de mantener cierto grado de homogeneidad en la
formación profesional impartida por las diferentes casas de estudios.

En 1980, las Escuelas de Enfermería dependientes de la Universidad de Chile existentes en


Santiago se unificaron, conformando la única Escuela de Enfermería de la Facultad de Medicina de
la Casa de Bello, existente hasta la fecha. Por su parte, las escuelas que impartían la carrera en
provincias, dependientes de esta Casa de Estudios, se incorporaron a las universidades regionales.

Una de las últimas grandes reformas se realizó en 1995, con la creación del Programa de
Licenciatura, que extendió la formación de pregrado de cuatro a cinco años y, en el caso de esta
disciplina, otorga el grado de Licenciado en Enfermería.

……………………………..

La primera Escuela Superior de Enfermería y Matronas fue creada, en el año 1832, en Abú Zabel,
El Cairo, Egipto, según una investigación dada a conocer en el IX Congreso Internacional de
Historia de la Enfermería por Ahmed Dusuky y Ángel Pozuelo.
Los investigadores Ahmed Dusuky y Ángel Pozuelo, neurocirujano y bibliotecario,
respectivamente, del Hospital General Universitario de Ciudad Real, centro dependiente del
Servicio de Salud de Castilla-La Mancha, han logrado datar la creación de la primera Escuela
Superior de Enfermería y matronas creada en el mundo, en el año 1832, en Abú Zabel, El Cairo,
Egipto.

Así lo presentaron en el IX Congreso Internacional de Historia de la Enfermería celebrado


recientemente en Santander, con motivo de la conmemoración del primer centenario del
reconocimiento oficial por el Gobierno español de la titulación de Enfermería, y el programa
educativo correspondiente a la profesión. Al congreso, en el que destacaron especialmente los
estudios españoles, asistieron más de 300 investigadores procedentes de Estados Unidos,
Portugal, Canadá y otros países, destacando los estudios españoles.

El objetivo del estudio del Hospital de Ciudad Real fue poner en valor el papel de la Enfermería a lo
largo de la Historia, y las aportaciones que estos profesionales vienen realizando desde los inicios
en la mejora de los cuidados y el desarrollo de la sanidad.

Población femenina e infantil

La investigación de Dusuky y Pozuelo analizó la reforma sanitaria egipcia llevada a cabo a partir de
1825, por un grupo de médicos occidentales bajo el patrocinio del virrey de Egipto. En este
contexto, los investigadores del Hospital de Ciudad Real dataron la creación en el año 1832, de la
primera escuela de Enfermería y matronas del mundo, o escuela de hakimas denominada
Madrasat al Kabilat.

Según el estudio, la escuela fue creada por la necesidad de ofrecer una atención sanitaria más
amplia a la población femenina e infantil de Egipto. No obstante, inicialmente estuvo vinculada al
ejército y fue haciéndose extensiva posteriormente al resto de la población civil, ofreciendo
asistencia sanitaria en vacunaciones, cirugía menor y curas, entre otras.

Desde el punto de vista educativo, contaba con un programa tanto teórico como práctico de seis
años de duración, patrocinado por el gobierno, con un importante impacto social y desarrollo
demográfico del país, debido a las nuevas técnicas sanitarias que las tendencias científicas,
médicas y de cuidados demandaban para el pueblo egipcio