Molecular Ecology Notes (2003) doi: 10.1046/j.1471-8286 .2003.0340.

PRIMER NOTE
Blackwell Science, Ltd

Novel universal primers establish identity of an enormous

number of animal species for forensic application
S . K . V E R M A and L . S I N G H
Centre for Cellular and Molecular Biology, Hyderabad 500 007, India

Abstract
This study describes a polymerase chain reaction (PCR)-based approach, which without
knowing the history of a forensic sample, is able to reveal whether the source of the sample
is human or animal, and, if animal, which of the 221 animal species included in the study,
simply by using one set of novel primers to amplify and sequence the PCR amplicons. The
primers described in this study universally amplify a specific segment of mitochondrial
cytochrome b sequence from a sample of unknown origin and delineate its identity to the
level of family, genus and species. Because these primers are universal, this approach can
be applied to an enormous number of other species, which are not included in the study,
and could be an ultimate solution for the identification of species for forensic application.
Keywords: forensics, species identification, universal primers, wildlife

Received 2 July 2002; revision received 23 September 2002; accepted 23 September 2002

Accurate identification of confiscated biological material
is central to the investigation of crime in forensics. Vari-
ous DNA fingerprinting techniques, such as, Southern
hybridization-based minisatellite analysis ( Jeffreys et al.
1985a,b,c; Singh 1991) and polymerase chain reaction
(PCR)-based microsatellite genotyping (Nakamura et al.
1987; Webber & May 1989) are the methods of choice for
individual human identification. The situation becomes
critical when the forensic sample belongs to an animal and
we need to establish its identity at species or subspecies
level in order to investigate the wildlife-related offence.
Morphological markers, described for certain species,
allow the identification of complete specimens (Espinoza
et al. 1990). However, a complete specimen is seized very
rarely by investigating agencies; therefore, these markers
are not practically applicable in wildlife forensics. Bio-
chemical traits, such as bile characteristics (Hagey et al.
1993) and blood heam analysis (Espinoza et al. 1996, 1999)
have also been used to establish identity. The difficulty
with these markers is that they are limited in number and
are rarely found in their natural forms, i.e. those in which
they were originally described as being characteristic of a
particular species. Molecular approaches (Wolf et al. 1999;
Parson et al. 2000; Russell et al. 2000) used for this purpose
require prior information of the species to establish
Correspondence: Lalji Singh. Tel: + 91 40 716 0789; Fax: + 91 40
716 0252; E-mail: lalji@ccmb.res.in
identity. Because prior information about the origin of
confiscated animal parts and products is never available in
forensics; these methods are also not useful and practical in
wildlife identification. In this study we describe a PCR-
based approach, which can be applied universally with
forensic samples of unknown history, and give results
beyond reasonable doubt.
The primers we used were designed from the aligned
cytochrome b sequences of 221 distantly related species,
including 67 animal species, which are considered as either
endangered or threatened by the Wildlife Protection Act
no. 53 of 1972 of India (list available as supplementary
material). The 3′-ends of the primers were located on the
evolutionary conserved regions of cytochrome b gene
to ensure its universal nature (Kocher et al. 1989). The
sequences of the primers and PCR conditions are as fol-
lows: Primer mcb398 ‘TACCATGAGGACAAATATCAT-
TCTG’ and mcb869 ‘CCTCCTAGTTTGTTAGGGATTG
ATCG’. The numbers 398 and 869 refer to the position of 5′
base of the primers in the complete cytochrome b sequence
of Antelope cervicapra (NCBI Accession no. AF022058).
Amplification was carried out in a 20 µL reaction volume
containing 20 ng of template DNA, 100 µm each of dNTPs,
5 pmole of each primer, 1.5 mm MgCl2, 0.5 units of Ampli-
Taq Gold (Perkin-Elmer-Cetus, USA) and 1× PCR buffer
(10 mm Tris–HCl, pH 8.3, and 50 mm KCl). The PCR
conditions were: an initial denaturation at 95 °C for 10 min,
followed by 35 cycles each of denaturation at 95 °C for 45 s,

© 2003 Blackwell Publishing Ltd


annealing at 51 °C for 1 min, and extension at 72 °C for 2 min.
The extension step at the 35th cycle was held for 10 min.
Using the primers mentioned above, we investigated
various cases of animal identification submitted to our lab-
oratory for a scientific opinion on a wildlife offence. Here,
we present a summary of one of the cases, in which we
received the mutilated flesh of an unknown animal, that
had been confiscated by crime investigation agencies.
DNA was isolated from the material following standard
methods (Sambrook et al. 1989) and was subjected to PCR
amplification, sequencing in triplicate (ABI Prism 3700, PE-
Biosystems). The sequence obtained (421 bp, excluding
primers) was blasted against nr databases of National
Centre for Biotechnology Information (NCBI) using blast
(Altschul et al. 1997) program. The most significant alignments
(highest bits scores 509; E-value e-142; and nucleotide similarity
90%) of this sequence (NCBI Accession no. AY182235) was
produced with the cytochrome b sequences of the members
of genus Cervus (NCBI Accession nos AY070223, AY044861,
AB021098), indicating that the analysed material belonged
to a species of the genus Cervus in the family Cervidae.
Based on this information, we selected reference animals, i.e.
Cervus unicolor and C. axis, the Cervus species found com-
monly in the region where the crime was committed. DNA
isolated from these animals was amplified and sequenced
on both strands in triplicate using the primer pair men-
tioned above. Consensus sequences obtained were (NCBI
Accession no. AY182237 and AY182236 respectively) aligned
using clustal w (Thompson et al. 1994). Sequence compar-
isons identified 47 variable sites between C. unicolor and
C. axis, however, the sequence generated from the confiscated
source was 100% similar to that of C. axis, establishing the
identity of the source of the confiscated material as being of
C. axis origin. In order to validate our approach, we compared
the sequence generated from confiscated samples in this
study with that of the sequences of other species of Cervidae.
The total number of polymorphic sites was found to increase
with increasing phylogenetic distances (data not shown). It
indicates that the molecular signatures (pattern of nucle-
otides among the polymorphic sites) generated using our
primers are very specific to the species from which they are
generated; and the signatures of any two different species
are never similar. This fact is also revealed from various
© 2003 Blackwell Publishing Ltd, Molecular Ecology Notes, 3, 28– 31
P R I M E R N O T E 29
molecular phylogenetic studies showing the enormous
power of cytochrome b sequences to establish the phyloge-
netic relationship of a particular species with other known
species within the families in an order (references availa-
ble as supplementary material). This, in fact, is the basis of
modern molecular taxonomy and systematics.
We tested the universal nature of our primers by com-
puting their primabilty and stability scores with DNA
templates of 221 different animal species using amplify
Version 1.2 (Engels 1993) (data available as supplementary
information). The universal nature and high performance
of our primers among a vast range of animal genera was
further validated by examining their potential to establish
the correct identity of specimens from known animal
sources representing various mammalian genera (with dis-
tribution among major mammalian groups), reptiles and
birds (Table 1). A band of expected size was obtained from
all the animals tested (Fig. 1). The molecular signatures
obtained from these animals established the accurate iden-
tity of the animals. Table 1 summarizes the results of PCR
success and blast scores of the signatures generated from
these animals establishing their identity to the levels of
family, genus and species.
The primers described in our study establish the identity
of the unknown samples by delineation of the phylogenetic
lineages to the level of family, genus and species using the
plesiomorphic, apomorphic and synapomorphic charact-
er states present in the sequence. The PCR conditions
we describe work universally, as the priming sites are
conserved. It avoids the possibility of PCR failure due to
nonstandard PCR conditions with a DNA template of
unknown origin. The short length of amplified product
makes these primers particularly suitable for degraded
DNA, mostly obtained from mutilated remains. The above
features make our primers unique and highly suitable for
forensic applications.
We conclude that the method described above is sim-
ple and very quick. In addition, it is applicable to a vast
range of animal species in a universal manner; and must,
therefore, prove a valuable tool for establishing species
identity for forensic application. It has the potential to
replace the need for expensive laboratory set-ups in which
vast collections of morphological and biochemical markers
Fig. 1 Agarose gel showing the high per-
formance and universal nature of our primers
among a vast range of animal species.
Universal PCR parameters (as described in
our study) were used to perform the ampli-
fications from all the species. Descriptions
of the lanes 1–23 are given in Table 1. Lane
24 is the negative control for PCR (no DNA),
and Lane M is the molecular weight marker
(marker XIII, Boehringer Mannheim).
30 P R I M E R N O T E

Table 1 Various animal species included in the study to validate the universal nature of our primers

Animal % NCBI
species NCBI Highest BLAST Nucleotide Accession Specimen identity
tested PCR success Accession no.* Bits E-value Similarity no.† revealed as

Mammal
Rodent
Mus musculus Lane 14 AF540912 835 0.0 100% BC006023 M. musculus
Mesocricetus auratus Lane 8 AF540913 835 0.0 100% AF119265 M. auratus
Carnivore
Canis familiaris Lane 5 AF540914 835 0.0 100% U96639 Canis sp.
Cetacean
Platanista gangetica (3)‡ Lane 9–11 AF540915–17 827 0.0 99% AF304070 Platanista sp.
Ruminant
Bubalus bubalis (2) Lane 22, 23 AF540918 –19 835 0.0 100% AY079132 B. bubalis
Ovis aries Lane 3 AF540920 827 0.0 99% AF010406 Ovis sp.
Antelope cervicapra (2) Lane 1, 2 AF540921–22 819 0.0 99% AF036283 Antelope sp.
Suina
Sus scrofa Lane 4 AF540923 835 0.0 100% AF304200 S. scrofa
Proboscidean
Elephas maximus§ Lane 16 AF540924 511 e-142 88% D50846 Elephas maximus
Sirenian
Dugong dugong Lane 18 AF540925 811 0.0 99% AY075116 Dugong sp.
Primate
Pan troglodytes Lane 6 AF540926 795 0.0 99% X93335 Pan sp.
Homo sapiens Lane 7 AF540927 827 0.0 99% AF382011 Homo sp.
Bird
Ploceus benghalensis§ (3) Lane 19–21 AF540928 –30 565 e-158 92% AF255709 Ploceinae
Gallus gallus§ Lane 17 AF540931 793 0.0 98% AY029583 Gallus sp.
Reptile
Naja naja§ Lane 15 AF540932 492 e-136 89% AF217835 Naja sp.
Lepidochelys sp. (2)§ Lane 12, 13 AF540933–34 486 e-134 89% U81352 Cheloniidae

*NCBI accession numbers of the sequences generated in this study.

†NCBI accession showing best blast hit with the corresponding sequences generated in our study from known animal sources.
‡Number in the parenthesis indicates the number of individuals tested, where N > 1.
§The lower bits score of these animal species was due to following reasons:
High levels of heteroplasmy in Elephas maximus cytochrome b sequence possibly due to coamplification of nuclear pseudogene copies
(Reviewed by Bensasson et al. 2001). Presence of ambiguous nucleotides in Gallus galluss cytochrome b sequence available for comparison
in NCBI database. The sequences of Ploceus benghalensis, Naja naja and Lepidochelys sp. are novel. These sequences were not available in NCBI
database for comparison and further delineation of exact identity; therefore the closest family, genus or species was picked up by blast.

of different animals are maintained to provide scientific

evidence on wildlife offences. Another potential application
of this technique may be in food fortification where we
need to establish the identity of edible meat sources.
Acknowledgements
This work was supported by grants from Department of Biotech-
nology, Government of India and Central Zoo Authority, Ministry
of Environment, Government of India.
Supplementary material
The following material is availiable from http://www.blackwell-
science.com/products/journals/suppmat/MEN/MEN340/
MEN340sm.htm
References
Altschul SF, Madden TL, Schaffer AA et al. (1997) Gapped blast
and psi-blast: a new generation of protein database search pro-
grams. Nucleic Acids Research, 25, 3389–3402.
Bensasson D, Zhang DX, Hartl DL, Hewitt GM (2001) Mitochon-
drial pseudogenes: evolution’s misplaced witnesses. Trends in
Ecology and Evolution, 16, 314–321.
Engels WR (1993) Contributing software to the Internet: the
amplify program. Trends in Biochemical Sciences, 18, 448 – 450.
Espinoza EA, Kirms MA, Filipek MS (1996) Indentification and
quantitation of source from hemoglobin of blood and blood
mixtures by high performance chromatography. Journal of
Forensic Sciences, 5, 804–811.
Espinoza EO, Lindley NC, Gordon KM, Ekhoff JA, Kirms MA (1999)
Electrospray ionization mass spectrometric analysis of blood for
differentiation of species. Analytical Biochemistry, 15, 252 – 261.

© 2003 Blackwell Publishing Ltd, Molecular Ecology Notes, 3, 28–31


Espinoza EO, Mann MJ, LeMay JP, Oakes KA (1990) A method for
differentiating modern from ancient proboscidean Ivory in
worked objects. Current Research in the Pleistocene, 7, 81– 83.
Hagey IR, Crombie DL, Espinoza EO, Carey MC, Igimi H,
Hofmann AF (1993) Ursodeoxycholic acids in the ursidae:
biliary bile acids of bears, pandas, and related carnivores. Journal
of Lipid Research, 34, 1911–1918.
Jeffreys AJ, Brookfield JFY, Semeonoff FR (1985a) Positive iden-
tification of an immigration test-case using human DNA
fingerprints. Nature, 317, 818 – 819.
Jeffreys AJ, Wilson V, Thein SL (1985b) Hypervariable ‘minisatel-
lite’ region in human DNA. Nature, 314, 67–73.
Jeffreys AJ, Wilson V, Thein SL (1985c) Individual-specific ‘finger-
prints’ of human DNA. Nature, 316, 76 –79.
Kocher TD, Thomas WK, Meyer A et al. (1989) Dynamics of
mitochondrial DNA evolution in animals: amplification and
sequencing with conserved primers. Proceedings of the National
Academy of Sciences of the USA, 86, 6196 – 6200.
Nakamura Y, Leppert M, O’Connel P et al. (1987) Variable number
of tandem repeats (VNTR) markers for human gene mapping.
Science, 235, 1616–1622.
© 2003 Blackwell Publishing Ltd, Molecular Ecology Notes, 3, 28– 31
P R I M E R N O T E 31
Parson W, Pegoraro K, Neiderstatter H, Foger M, Steinlechner M
(2000) Species identification by means of cytochrome b gene.
International Journal of Legal Medicine, 114, 23–28.
Russell VJ, Hold GL, Pryde SE et al. (2000) Use of restriction
fragment length polymorphism to distinguish between salmon
species. Journal of Agriculture and Food Chemistry, 48, 2184–2188.
Sambrook J, Fritish EF, Maniatis T (eds) (1989) Molecular Cloning.
Cold Spring Harbor Press, Cold Spring Harbor, NY.
Singh L (1991) DNA profiling and its applications. Current Science,
60, 580–585.
Thompson JD, Higgins DG, Gibson TJ (1994) clustal w: improv-
ing the sensitivity of progressive multiple sequence alignment
through sequence weighting, position-specific gap penalties
and weight matrix choice. Nucleic Acids Research, 22, 4673–
4680.
Webber JL, May PE (1989) Abundant class of human DNA poly-
morphisms which can be typed using the polymerase chain
reaction. American Journal of Human Genetics, 44, 388–396.
Wolf C, Rentsch J, Hubner P (1999) PCR-RFLP analysis of mito-
chondrial DNA: a reliable method for species identification.
Journal of Agriculture and Food Chemistry, 47, 1350–1355.