Documente Academic
Documente Profesional
Documente Cultură
net/publication/278030425
CITATIONS READS
0 2,500
1 author:
Prakash S Bisen
Jiwaji University
483 PUBLICATIONS 3,623 CITATIONS
SEE PROFILE
Some of the authors of this publication are also working on these related projects:
I am currently involved with the metagenomics of some macrofungus, medicinal plants, probiotics against life style diseases with networking (bioinformatic approach)
analysis of bioactive compounds. View project
All content following this page was uploaded by Prakash S Bisen on 12 June 2015.
Appendix 227
FIGURE CONTENT
FIGURE
S.N. LIST & TITLE OF FIGURES
NUMBER
Consensus tree, based on comparative sequence analysis
1 Figure 2.1 of 16S rRNA, showing major phylogenetic groups of
lactic acid bacteria
TABLE
S.N. LIST & TITLE OF TABLES
NUMBER
Examples of industrial fermentation products and their
1 Table 2.1
producer microorganisms
Examples of microorganisms classified as GRAS
2 Table 2.2
(Generally regarded as safe)
3 Table 2.3 Examples of aseptic and non-aseptic fermentations
Differentiating Lactic acid bacteria and a comparison
4 Table 2.4
with current taxonomic classification
Some of the major fermented food products along with
5 Table 2.5
the microbe involved around the world
Differences between Probiotics, Prebiotics and
6 Table 2.6
Synbiotics
Health benefits along with the proposed mechanism of
7 Table 2.7
action of lactic acid bacteria
8 Table 2.8 Classification of cocci lactic acid bacteria
9 Table 2.9 Characterizing features of S. thermophilus
Genomic details of Streptococcus thermophilus strains
10 Table 2.10 with whole genome sequencing available data till Feb
2014
Taxonomy of dairy Starter Cultures with old and new
11 Table 2.11
names and their products
Major starter culture producer companies all over the
12 Table 2.12
world
13 Table 2.13 Characteristics of sweet and sour Dahi
14 Table 3.1 pH indicators for carbohydrate fermentation media
15 Table 3.2 Details of the analytical tools and reference genome used
Percentage lactic acid yield and pH drop results of the
16 Table 4.1
128 isolates after first selective enumeration.
Phenotypic characterization, colony observation and gas
17 Table 4.2
production results of the selected 32 isolates.
Results of complete morphological and phenotypical
18 Table 4.3
analysis of 10 selected strains
Fermentation results of selected isolates from different
19 Table 4.4
sugars
20 Table 4.5 Results of enzyme assays conducted on selected isolates
Biochemical characterization results on the basis of
21 Table 4.6
different biochemical test analysis
Quality Control reports of all of sample isolates. DNA
22 Table 5.1 Concentration and purity of samples estimated using
nanodrop spectrophotometer
16s rDNA sequencing results of selected 10 isolates with
23 Table 5.2
best hit similarities at data in NCBI
24 Table 5.3 Qubit values of prepared library
Summary of the platforms and alignments of WGS of
25 Table 5.4
ST-500
Details of alignments and Raw data sequences obtained
26 Table 5.5
from WGS
Alignment statics of ST-500 in comparison with
27 Table 5.6 S.thermophilus MN-ZLW-002 and S. thermophilus
MTCC_5461
Results of different media compositions concluded after
28 Table 6.1 individual studies of media ingredients for mass cell
production of Streptococcus thermophilus NCIM 5539
Media per litre cost comparison between MRS and M17
29 Table 6.2 on individual ingredient basis from Himedia, India
catalogue.
Costing of the designed media on the basis of ingredient
30 Table 6.3
prices available with Himedia
Costing of the designed media on the basis of
31 Table 6.4
commercial prices provided by Himedia
Comparison of Batch results with complete up-stream
32 Table 6.5
analysis of ST-500
33 Table 6.6 Cell growth rate with respect to incubation hours
Combinations of protectants along with the ratio of
34 Table 6.7
addition
35 Table 6.8 Viability loss during up-downstream bio-processing
Results of application testing done on the basis of certain
36 Table 7.1 parameters
Milk and milk products provide wealth of nutrition benefits with their healthy
contents along with the micro-flora these products carry. The major group present in milk
and dairy products with tremendous potential and most desirable in domestic and
commercial food fermentation is lactic acid bacteria (LAB) group. Some bacteria in this
group are described as psychrophilic, which means that they grow best at cold
temperatures, while others are severely retarded by being in the refrigerator and grow
rapidly only at warmer temperatures. Fermentation was invented long before
microorganisms were discovered, and therefore the process seemed mysterious. The need
for an inocolum was understood and usually satisfied by keeping a sample from the
previous production. But with advancement in science and technology over years, the
capability of microorganisms to perform fermentation leading to various useful end
products is well documented now. LAB are widely used in the production of fermented
food, and they constitute the majority of the volume and the value of the commercial
starter cultures. The demand of a cost economic starter culture is also swelling with
modernization in fermented food industries. It is; therefore, very attractive to develop a
low cost single strain starter culture for Indian food fermentation industries for
manufacturing of Indian traditional curd, as in India, food industries are still using
imported starter cultures due to the unavailability of any domestic starter culture
producer.
Isolated lactic acid bacteria could produce lactic acid as end product leading to
production of mild flavored Indian traditional curd and capable of multiplying fast on low
cost medium with high yield. The behavior of the strain could be analyzed on complete
characterization and positive approach will lead this type of study to the development of
an economical starter culture with commercial viability.
• Low cost high yield viable cell mass from the fermentation process under the
optimum conditions.
• Standardized nutritional and lyophilization parameters with minimum cell loss
during agitation and freezing shocks.
• Successful continuous recovery of cell mass from both laboratory scale and
commercial scale pilot plant bioreactors.
• A final lyophilized product with all potentials of a good starter culture, to resist
competition with the available imported cultures in the market.
Chapter 2
Literature Review
The microorganisms are the most successful group of all living species occupying
each habitat in water, soil, plants and animals including humans with enormous success.
This leads to a fundamental impact on all research areas in modern biology and medicine.
Microorganisms are capable of growing on a wide range of substrates and can produce a
remarkable spectrum of products. The advent of in vitro genetic manipulation has
extended the range of products that may be produced by microorganisms and has
provided new methods for increasing the yields of existing ones. The commercial
exploitation of the biochemical diversity of microorganisms has resulted in the
development of the fermentation industry and the techniques of genetic manipulation
have given this well-established industry the opportunity to develop new processes and to
improve existing ones. The term fermentation is derived from the Latin verb fervere, to
boil, which describes the appearance of the action of yeast on extracts of fruit or malted
grain during the production of alcoholic beverages. However, fermentation is interpreted
differently by microbiologists and bio-chemists. To a microbiologist the word means any
process for the production of a product by the mass culture of microorganisms. To a
biochemist, however, the word means an energy-generating process in which organic
compounds act as both electron donors and acceptors, that is, an anaerobic process
where energy is produced without the participation of oxygen or other inorganic
electron acceptors.
Surprisingly enough an estimated 99% of all living microorganisms have not even
been discovered although (or maybe because) they colonies any habitat with great
success. From an evolutionary point of view the microbes show a large degree of
biodiversity, commonly being unified by the feature of their small size.
Biotechnologically designed and employed microorganisms significantly increase the
importance of microbes for applications in food industry, chemistry and pharmacy.
Industrial microbiology is primarily associated with the commercial exploitation of
microorganisms, and involves processes and products that are of major economic,
environmental and social importance throughout the world. There are two key aspects of
industrial microbiology, the first relating to production of valuable microbial products via
fermentation processes. These include traditional fermented foods and beverages, such as
bread, beer, cheese and wine, which have been produced for thousands of years. In
addition, over the last hundred years or so, microorganisms have been further employed
in the production of numerous chemical feed stocks, energy sources, enzymes, food
ingredients and pharmaceuticals. The second aspect is the role of microorganisms in
providing services, particularly for waste treatment and pollution control, which utilizes
their abilities to degrade virtually all natural and man-made products. However, such
activities must be controlled while these materials are in use, otherwise consequent
biodeterioration leads to major economic losses. Over the last twenty years, many
traditional and established industrial fermentation processes have been advanced through
the contribution of genetic engineering (in vitro recombinant DNA technology) which
has also facilitated the development of many novel processes and products. It not only
accelerates strain development, leading to improvement in the production of
microorganisms, but can aid in downstream processing and other elements of the process.
It involved the manipulation of bacteria, cloning in yeasts, filamentous fungi, and plant
and animal cells. Microbial biosurfactants with high ability to reduce surface and
interfacial surface tension and conferring important properties such as emulsification,
detergency, solubilization, lubrication and phase dispersion have a wide range of
potential applications in many industries. Significant interest in these compounds has
been demonstrated by environment, bioremediation, oil, petroleum, food, beverage,
cosmetic and pharmaceutical industries with their low toxicity, biodegradability and
sustainable production technologies. Despite having significant potentials associated with
emulsion formation, stabilization, antiadhesive and antimicrobial activities, significantly
less output and applications have been reported in food industry (Campos et al., 2013).
Enzymes are considered as a potential biocatalyst for a large number of reactions.
Particularly, the microbial enzymes have widespread uses in industries and medicine. In
addition, the microorganisms represent an alternative source of enzymes because they can
be cultured in large quantities in a short time by fermentation and owing to their
biochemical diversity and susceptibility to gene manipulation. Industries are looking for
new microbial strains in order to produce different enzymes to fulfill the current enzyme
requirements (Anbu et al., 2013).
Agricultural Products
Gibberellins, Fungicides Bacillus thuringiensis, Fusarium moniliforme,
Insecticides, Silage Lactic acid bacteria Coniothyrium minitans
Corynebacterium
Amino acids glutamicum,
l-Glutamine, l-Lysine Brevibacterium
l-Tryptophan lactofermentum,
Klebsiella aerogenes
Enzymes Aspergillus niger
Carbohydrates Kluyveromyces species
a-amylase, b-amylase Bacillus subtilis Kluyveromyces lactis
amyloglucosidase, glucose Streptomyces olivaceus Trichoderma viride
isomerase, invertase, Candida cylindraceae
lactase (b-galactosidase) Aspergillus wentii
Cellulases
Lipases, Pectinases
Clostridium species
Fuels and chemical Clostridium Saccharomyces cerevisiae
feedstock acetobutylicum Zygosaccharomyces rouxii
Acetone, Butanol, Ethanol Zymomonas mobilis
Glycerol, Methane Methanogenic archaeans
Lantibiotics
Nisin, Macrolides Lactococcus lactis
Erythromycin, Peptides Saccharapolyopora
bacitracin gramicidin erythraea
Tetracyclines, Bacillus licheniformis
chlortetracycline Bacillus brevis
Streptomyces
aureofasciens
Hormones Recombinant
Human growth hormone Recombinant Saccharomyces cerevisiae
Insulin Escherichia coli
Vitamins
B12 (cyanocobalamin) Pseudomonas Blakeslea trispora
b-Carotene (provitamin A) denitrificans Ashbya gossypii
Ascorbic acid (vitamin C) Acetobacter suboxydans
Riboflavin Recombinant Bacillus subtilis
Polymers
Alginates Cellulose Azotobacter vinelandii Aureobasidium pullulans
Dextran, Gellan Acetobacter xylinum Sclerotium rolfsii
Polyhydroxybutyrate Leuconostoc Xanthomonas campestris
Pullulan Scleroglucan mesenteroides
Xanthan Sphingomonas
paucimobilis
Ralstonia eutropha
Candida utilis
Kluyveromyces marxianus
YEASTS Kluyveromyces lactis
Saccharomyces cerevisiae
Aspergillus niger
Aspergillus oryzae
FILAMENTOUS FUNGI Mucor javanicus (Mucor circinelloides f.
circinelloides)
Penicillium roqueforti
2.1.2 Fermentation Technology and Microbes
Lactic acid bacteria are the most important bacteria in desirable food fermentations,
being responsible for the fermentation of sour dough bread, sorghum beer, all fermented
milks, and most "pickled" (fermented) vegetables. L. acidophilus, L. bulgaricus, L.
plantarum, L. pentoaceticus, L. brevis and S. thermophilus are examples of lactic acid-
producing bacteria involved in food fermentations. Some of the species are
homofermentative, because they produce lactic acid only, while others are
heterofermentative and produce lactic acid plus other volatile compounds and small
amounts of alcohol. Leuconostoc mesenteroides is a bacterium associated with the
sauerkraut and pickle fermentations. This organism initiates the desirable lactic acid
fermentation in these products. L. mesenteroides produces carbon dioxide and acids
which rapidly lower the pH and inhibits the development of undesirable microorganisms.
The carbon dioxide produced replaces the oxygen, making the environment anaerobic
and suitable for the growth of subsequent species of lactobacillus. Removal of oxygen
also helps to preserve the colour of vegetables and stabilises any ascorbic acid that is
present. Organisms from the Gram-positive Propionibacteriaceae family are responsible
for the flavor and texture of some fermented foods, especially Swiss cheese, where they
are responsible for the formation of 'eyes' or holes in the cheese. These bacteria break
down lactic acid into acetic, propionic acids and carbon dioxide. Several other bacteria,
for instance Leuconostoc citrovorum, Streptococcus lactis and Brevibacterium species are
important in the fermentation of dairy products (Table 2.3). Microorganisms vary in their
optimal pH requirements for growth. Most bacteria favour conditions with a near neutral
pH. The varying pH requirements of different groups of microorganisms are beneficial
for the fermented foods where successions of microorganisms take over from each other
as the pH of the environment changes. Certain bacteria are acid tolerant and will survive
at reduced pH levels. Notable acid-tolerant bacteria include the Lactobacillus and
Streptococcus species playing a key role in the fermentation of dairy and vegetable
products. Most lactic acid bacteria work best at temperatures of 18 to 22 ºC and tolerate
high salt concentrations.
The salt tolerance gives them an advantage over other less tolerant species and
allows the lactic acid fermenters to begin metabolism, which produces acid that further
inhibits the growth of non-desirable organisms. In general, bacteria require a fairly high
water activity (0.9 or higher) to survive. There are a few species which can tolerate water
activities lower than this, but usually the yeasts and fungi will predominate on foods with
a lower water activity. Nearly all food fermentations are the result of more than one
microorganism, either working together or in a sequence. Bacteria from different species
and the various microorganisms – yeast and moulds - all have their own preferences for
growing conditions, which are set within narrow limits. There are very few pure culture
fermentations. An organism that initiates fermentation will grow there until its by-
products inhibit further growth and activity. During this initial growth period, other
organisms develop which are ready to take over when the conditions become intolerable
for the former ones. In general, growth will be initiated by bacteria, followed by yeasts
and then moulds.
The advantages of the use of starter cultures against spontaneous fermentation are
well known and widely spread especially for dairy and meat products, but are not often
used in the vegetable fermentations. The spontaneous fermentation of sauerkraut can
result in the formation of biogenic amines. The utilization of starter culture enables
producers to make food products with a standard quality in a shorter time. Selection of
starter culture, however, should not be only done considering the lactic acid production of
the strains but also their activity for biogenic amine synthesis. Although numerous
studies have been carried out on cabbage, olive and pickle fermentation, little is known
on the lactic fermentation of other vegetables. Usually, lactofermented vegetables are
pasteurized and there is no information on the behavior of lactobacilli during storage of
unpasteurized fermented vegetables. With fermentation of beetroot by appropriately
selected lactobacilli a juice could be produced which combines benefits of betalains and
lactobacilli (Halász et al., 1999).
Non-starter lactic acid bacteria (NSLAB) can be commonly isolated from Cheddar
cheese. The majority of NSLAB are Lactobacillus sp., although Pediococcus and
Leuconostoc sp. also can be present (Peterson and Marshall 1990). According to their
proteolytic activity lactobacilli can contribute to the development of desirable flavours in
cheese but can also cause the accumulation of bitter peptides that result in off-flavours. In
addition NSLAB can cause defects such as gas formation and calcium lactate
crystallization on the surface of the cheese, which forms a white haze. These crystals are
the end result of lactate racemization by some NSLAB that convert L(+) -lactic acid to
the less soluble D(-) isomer. The source of NSLAB contamination is believed to be
originated from post-pasteurization, usually through contact with equipment surfaces or
from the air.
Table: 2.3 Examples of aseptic and non-aseptic fermentations
Lactic acid bacteria (LAB) are regarded as a major group of probiotics (Sharma et
al., 2012; Schrezenmeir and de Vrese 2001). These lactic acid bacteria are industrially
important organisms recognised for their fermentative ability as their health and
nutritional benefits. They are comprised of an ecologically diverse group of
microorganisms united by formation of lactic acid as the primary metabolite of sugar
metabolism (Carr et al. 2002). These bacteria are basically Gram-positive non-spore
forming cocci, cocci-bacilli or rods, non-rispiring, catalase-negative bacteria that are
devoid of cytochromes and are of non-aerobic habit but are aero-tolerant, fastidious, acid
tolerant and strictly fermentative; lactic acid is the major end-product of sugar
fermentation. They are chemo-organotrophic and grow in complex media and generally
are non pathogenic to man and animals. LAB consist of several genera, which include
Carnobacterium, Enterococcus, Lactobacillus, Lactococcus, Lactosphaera, Leuconostoc,
Melissococcus, Oenococcus, Pediococcus, Streptococcus, Tetragenococcus, Vagococcus
and Weissella (Ercolini et al. 2001; Holzapfel et al. 2001). Based on similarities in
physiology, metabolism and nutritional needs, these genera are grouped together. A
primary similarity is that all members produce lactic acid as a major or virtually sole end
product of the fermentation of sugars.
LAB were first isolated from milk (Carr et al. 2002) and have since been found in
such foods and fermented products as meat, milk products, vegetables, beverages and
bakery products (Liu 2003; O’Sullivan et al. 2002). These bacteria occur naturally in
fermented food and have been detected in soil, water, manure and sewage (Holzapfel et
al. 2001). LAB exist in human (Martin et al. 2003; Schrezenmeir and de Vrese 2001) and
in animal. However, some lactic acid bacteria are part of the oral flora which can cause
dental caries (Sbordone and Bortolaia 2003). LAB can work as spoilage organisms in
foods such as meat, fish and beverages (Liu 2003). Several lactobacilli, lactococci and
bifidobacteria are held to be health-benefiting bacteria (Rolfe 2000; Tuohy et al. 2003),
but little is known about the probiotic mechanisms of gut microbiota (Gibson and Fuller
2000). LAB constitute an integral part of the healthy gastrointestinal (GI) microecology
and are involved in the host metabolism and Streptococcus thermophilus, inhibit food
spoilage and pathogenic bacteria and preserve the nutritive qualities of raw food material
for an extended shelf life (O’Sullivan et al. 2002; Heller 2001). The taxonomy of LAB
based on comperative 16S ribosomal RNA (rRNA) sequencing analysis has revealed that
some taxa generated on the basis on phenotypic features do not correspond with the
phylogenetic relations. Molecular techniques, especially polymerase chain reaction
(PCR) based methods, such as rep-PCR fingerprinting and restriction fragment length
polymorphism (RFLP) as well as pulse-field gel electrophoresis (PFGE), are regarded
important for specific characterization and detection of LAB strains (Gevers et al., 2001;
Holzapfel et al., 2001). Recently, culture-independent approaches have been applied for
the detection of intestinal microbiota (Zoetendal et al., 2002). Denaturing gradient gel
electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) analysis of
faecal 16S rDNA gene and its rRNA amplicons have shown to be powerful approaches in
determining and monitoring the bacterial community.
The term Lactic Acid Bacteria (LAB) was gradually accepted in the beginning of
the 20th century (Carol et. al., 2010). In earlier times some other terms were used for
lactic acid bacteria like milk sourcing and lactic acid producing which created confusion.
All the confusion came to an end in 1919 when Orla-Jensen proposed a monograph about
lactic acid bacteria having great impact over systematic lactic acid bacteria (Axelsson,
1989). Classification of LAB genera was based on morphology, mode of glucose
fermentation, growth at certain temperatures, and range of sugar utilization and
configuration of the lactic acid produced, ability to grow at high salt concentrations, and
acid or alkaline tolerance. Even though the taxonomy has been revised since then,
characters used by Orla-Jensen are still very important in current classification of LAB.
Lactic acid bacteria constitute a group of bacteria that have morphological, metabolic and
physiological similarities with relatively closely related phylogeny. For some of the
newly described genera (Pilar et. al., 2008), additional characteristics such as fatty acid
composition and motility are used in classification.
Table: 2.4 Differentiating Lactic acid bacteria and a comparison with current
taxonomic classification
These characters are still very important in current lactic acid bacterial
classification (Figure 2.2). The general description of the bacteria within the group is
gram-positive, nonsporulating, non-respiring cocci or rods, which do, through
fermentation of carbohydrates, produce lactic acid as their major end product. The
common agreement is that there is a core group consisting of four genera; Lactobacillus,
Leuconostoc, Pediococcus and Streptococcus (Table 2.4). The taxonomic revisions have
proposed several new genera and the remaining group now comprises the following:
Aerococcus, Alloiococcus, Carnobacterium, Dolosigranulum, Enterococcus,
Globicatella, Lactococcus, Oenococcus, Tetragenococcus, Vagococcus, and Weissella.
Lactobacilli, Carnobacteria and some Weissella are rods while the remaining genera are
cocci (Jin et al., 2009).
Figure 2.1: Consensus tree, based on comparative sequence analysis of 16S rRNA,
showing major phylogenetic groups of lactic acid bacteria with low
mol% guanine plus cytosine in the DNA and the nonrelated gram-
positive genera Bifidobacterium and Propionibacterium. (Schleifer and
Ludwig, 1995).
Lactic acid bacteria lack the ability to synthesize cytochromes and porphyrins
(components of respiratory chains) and therefore cannot generate ATP by creation of a
proton gradient. The LAB can only obtain ATP by fermentation, usually of sugars. Since
they do not use oxygen in their energy production, lactic acid bacteria happily grow
under anaerobic conditions.
Figure 2.2: Characterization of Lactic acid bacteria
Lactic acid bacteria are chemotrophic; they find the energy required for their
entire metabolism from the oxidation of chemical compounds. The oxidation of sugars
constitutes the principle energy producing pathway. Lactic acid bacteria of the genera
Lactobacillus, Leuconostoc and Pediococcus, the important bacteria to winemaking,
assimilate sugars by either a homofermentative or heterofermentative pathway.
2.2.2.1 Homo-fermentative metabolism
Homo-fermentative bacteria ferment glucose with lactic acid as the primary by-
product. Homofermentative LAB includes Lactococcus sp., used in dairy starter culture
applications where the rapid development of lactic acid and reduced pH is desirable.
Other homofermentative LAB include yogurt strains consisting of rods (Lactobacillus
delbruckii subsp. bulgaricus, L. acidophilus) and cocci (Streptococcus salivarius subsp.
thermophilus) and thermophilic strains that might be used in cheese (L. helveticus).
Other homofermentative cocci that might be found in milk and dairy products, but are
rarely used as starter cultures include other Streptococcus sp., Enterococcus, Pediococcus
and Aerococcus.Lactic acid bacteria utilize sugars (glucose) to form lactic acid by either
the homo- or hetero-fermentative pathway. The homo-fermentative pathway (Figure 2.3)
results in the transformation of glucose to pyruvate through the Embden–Meyerhof–
Parnas pathway (EMP, or glycolysis), eventually yielding lactic acid. NADH produced
by the oxidation of glyceraldehyde-3-phosphate to 1,3-bisphosphoglycerate is reoxidized
to NAD+ in the formation of lactate from pyruvate through the action of lactate
dehydrogenases (LDHs). The LDH enzymes vary in their stereospecificity and can yield
d- or l-lactic acid or the racemic mixture.
2.2.2.2 Hetero-fermentative metabolism
Hetero-fermentors, ferment glucose with lactic acid, ethanol/acetic acid and
carbon dioxide (CO2) as by-products. Testing for heterofermentative fermentation
generally involves the detection of gas (CO2). With the exception of certain fermented
milk products, hetero-fermentative LAB are rarely used as dairy starter cultures, although
they are not uncommon in milk and dairy products. If allowed to grow to significant
numbers, they can cause defects related to their acid and CO2 production, such as slits in
hard cheeses or bloated packaging in other dairy products. Hetero-fermentative LAB
includes Leuconostoc sp. (Gram-positive cocci) and Gram-positive rods such as
Lactobacillus brevis, L. fermentum, and L. reuteri. Other Lactobacillus species are
considered “facultatively” hetero-fermentative, meaning they will produce CO2 and other
by-products only under certain conditions or from specific substrates. These strains
would include L. plantarum, L. casei and L. curvatus. Other hetero-fermentors like
Oenococcus oeni (known as Leuconostoc oeni until 1995) L. brevis, L. hilgardii,
L.fructivorans, and L. kunkeei) lack aldolase and must divert the flow of carbon through a
different series of reactions, the pentose phosphate, or phosphoketolase, pathway (Figure
2.4).
Figure 2.3: Homo-fermentative pathway illustrating the production of lactic acid
from glucose.
Figure 2.4: Hetero-fermentative pathway showing the production of lactic acid,
carbon-dioxide and either ethanol or acetic acid.
Gene gains in the LAB also reflected a shift toward a nutrient-rich lifestyle during
specific niche adaptations. Soon after the divergence of the Lactobacillales, there
occurred duplication of genes involved in the transport and metabolism of carbohydrates,
including genes for enolases and phosphotransferase (PTS) systems. Genes involved in
amino acid transport and peptidases were also duplicated, further enhancing the ability of
these species to exploit protein-rich environments (Makarova and Koonin, 2007).
Horizontal gene transfer (HGT) has also shaped these genomes. For example, many sugar
transport and metabolism genes in Lactobacillus plantarum are clustered in a lower GC
content area of the genome, and it is possible that many of these genes were acquired as a
result of HGT (Kleerebezem et al. 2003). HGT has also shaped the genome of S.
thermophilus, which possesses a 17-kb region that contains extensive identity with genes
in L. lactis and L. bulgaricus subsp. delbrueckii, two species that are also associated with
growth in milk. The genes from L. bulgaricus enable S. thermophilus to synthesize
methionine, which is rare in milk.
Genome sequencing has shown that the metabolic capabilities of these two
organisms make them reliant on each other for maximum growth. For example, L.
bulgaricus encodes a complete folate biosynthesis pathway, but lacks the ability to
produce p-aminobenzoic acid (PABA), a key intermediate that is supplied by S.
thermophilus (van de Guchte et al. 2006). In addition, an exchange of polyamines might
occur between these organisms that could have a role in their oxidative stress tolerance.
A major difference in the genomes of L. bulgaricus and S. thermophilus is reflected in
their biosynthetic capabilities. The presence of an extracellular protease in L. bulgaricus,
but the absence of many amino acid biosynthesis pathways, reflects the adaptation of this
species to the protein-rich milk environment. By contrast, S. thermophilus has retained
the pathways to synthesize all amino acids except histidine. It is unclear if S.
thermophilus exploits the proteolytic capabilities of L. bulgaricus or retains some
advantage in synthesizing its own amino acids (van de Guchte et al. 2006).
The lactic acid bacteria associated with foods now include species of the genera
Carnobacterium, Enterococcus, Lactobacillus, Lactococcus, Leuconostoc, Oenococcus,
Pediococcus, Streptococcus, Tetragenococcus, Vagococcus and Weissella. The genus
Lactobacillus remains heterogeneous with over 60 species (ymol% G+C content ranging
from 33 to 55), of which about one-third are strictly heterofermentative. However, many
changes have been made and reorganization of the genus along lines that do not follow
previous morphological or phenotypic differentiation from Leuconostoc and Pediococcus
is being studied (Figure 2.5). Phylogenetically belonging to the Actinomyces branch of
the bacteria, Lactobacillus bifidus has been moved to the genus Bifidobacterium also on
account of its greater than 50 mol% G+C content. It is therefore no longer considered one
of the lactic acid bacteria senso strictu, which form part of the Clostridium branch of the
bacteria.
The new genus Weissella has been established to include one member of the
genus Leuconostoc (L. paramesenteroides) and heterofermentative lactobacilli with
unusual interpeptide bridges in the peptidoglycan. Contrary to the clear-cut division of
the streptococci, morphological and physiological features of Weissella do not directly
support this grouping which now incorporates species that produce D(-)- as well as DL-
lactate. The new genus Carnobacterium is morphologically similar to the lactobacilli, but
it shares some physiological similarities (growth at pH 9.5) and a common phylogenetic
branch with the genus Enterococcus (Stiles and Holzapfel, 1997).
LAB can be isolated from various natural sources. For example, Lactococci,
Streptococci, Lactobacillus can be found in milk and milk products. Studies revealed the
presence of lactic acid bacteria in goat, cow, sheep, buffalo and camel milk (Sharma et
al., 2013). Recent studies suggest that composite bio-waste is a preferred habitat of lactic
acid bacteria, suggesting that the unsterilized bio-waste and its natural flora could be used
in a fermentation process for lactic acid production (Probst et al., 2013). The sequencing
of multiple complete genomes has created unprecedented opportunities for evolutionary
genomics of LAB. Some of the genes acquired by Lactobacillales are clearly adaptations
to existence in the nutrient-rich habitats of these bacteria (Makarova and Koonin, 2007).
Barley is also a natural habitat for lactic acid bacteria. The numbers of LAB on barley
have been shown to increase as a result of the malting process during brewing, possibly
because the steeping conditions create a favorable environment for their growth.
However, LAB counts start to decrease during barley germination and continue to decline
throughout the kilning process (Rouse et al., 2008). Diversity and density of lactic acid
isolated from Algerian raw goats' milk in arid zones were studied by determination of
morphological, cultural, physiological and biochemical characteristics. Two hundred and
six lactic acid bacterial strains were isolated, 115 of them belonging to lactic acid cocci
and others to the genus Lactobacillus. The representative species of the total cocci were
Lactococcus sp. (76.16%), S. thermophilus (14.78%) and Leuconostoc sp. (8.6%),
respectively. The dominating species is L. lactis subsp. lactis. Lactobacilli species found
in local raw goats' milk and their proportion were: L. curvatus (25.25%), L. helviticus
(10.98%), L. plantarum (9.89%), L. reuteri (9.89%), L. casei (7.69%), L. brevis (5.49%),
L. bulgaricus (5.49%), L. paracasei (4.39%) and L. acidophilus (2.19%) (Badis et al.,
2004). It has also been reported that some lactic acid bacteria isolated from the
gastrointestinal tract of fish can act as probiotic (Olympia et al., 1995). The variation of
the ecological parameters acting on the microbial association such as the nature of cereal,
temperature, size of inoculum, and length of propagation intervals leads in each case to a
characteristic species association. Cereals are suitable fermentable substrates for the
growth of potentially probiotic microorganisms. Previous studies showed that four
potentially probiotic strains (Lactobacillus fermentum, L. reuteri, L. acidophilus and L.
plantarum) were cultured in malt, barley and wheat media. All strains attained high cell
log10
populations (8.1-10.1 cfu/g). The malt medium supported the growth of all strains
more than barley and wheat media due to its chemical composition, while L. plantarum
and L. fermentum appeared to be less fastidious and more resistant to acidic conditions
than L. acidophilus and L. reuteri (Talamond et al., 2002). Another study showed that the
natural sour cassava starch fermentation was mainly due to the action of lactic acid
bacteria. Fermentation temperature and duration as well as the composition of the
microflora influenced the expansion properties of the final cassava sour starch. However,
some LAB strains (such as L. lactis, Streptococcus sp., Enterococcus saccharolyticu, L.
plantarum, and L. mesenteroides) involved in the natural sour cassava starch
fermentation were isolated, identified and characterized using classical microbiological
techniques (Ampe et al., 2001).
LAB has a long tradition of use in the food industry, and the number and diversity
of their applications has increased considerably over the years. These are the most
important group of microorganisms used in the food industry for the production of
various fermented products, such as yogurts, cheese, and pickled vegetables (Figure 2.6).
In addition, LAB can inhibit the growth of spoilage microbes and/or pathogens in their
environment by lowering the pH and/or through the production of antimicrobial peptides,
called bacteriocins. Both LAB and Bifidobacteria are also thought to have health-
promoting abilities and many are used as probiotics for the prevention, alleviation, and
treatment of intestinal disorders in humans and animals. LAB is very important in the
food and dairy industries because lactic acid and other organic acids produced by these
bacteria act as natural preservatives as well as flavor enhancers. LAB find increasing
acceptance as probiotic which aid in stimulating immune responses, preventing infection
by enteropathogenic bacteria, and treating and preventing diarrhea. Fermented foods
constitute a substantial part of the diet in many African countries are considered as an
important means of preserving and introducing variety into the diet, which often consists
of staple foods such as milk, cassava, fish and cereals. For example, Ben saalga is a
traditional Burkinabè gruel obtained by cooking a diluted fermented paste of pearl millet
(Pennisetum glaucum). This fermented food is widely accepted and consumed by the
population, particularly by young children.
The processing of pearl millet into ben saalga comprises the following successive
main steps: soaking the grains (first fermentation), grinding and 13 filtration of humid
flour, decanting (second fermentation) and cooking (Sanni et al., 2002). The production
of this fermented food is still largely a traditional art associated with poor hygiene,
inconsistent quality presentation and short shelf life. The preparation of this indigenous
food generally depends on a spontaneous or chance inoculation by naturally occurring
lactic acid bacteria and the use of starter cultures is still at very early development stages.
LAB play an essential role in the majority of food fermentations, and a wide variety of
strains are routinely employed as starter cultures in the manufacture of dairy, meat, and
vegetable and bakery products. One of the most important contributions of these
microorganisms is the extended shelf life of the fermented product by comparison to the
raw substrate.
Figure: 2.6 Silent features of lactic acid bacteria
Table: 2.5 Some of the major fermented food products along with the microbe
involved around the world.
Probiotics can be defined as a food (feed) or drug containing live microbes, when
ingested, is expected to confer beneficial physiologic effects to the host animal through
microbial actions. Microbial components and metabolites are essentially excluded from
the definition of probiotics. Microbes used in probiotics should be able to express their
activities in the host body. The first consideration is the bacteria that normally inhabit the
intestinal tract, and ingestion of these bacteria may affect the intestinal microbial balance.
The human digestive tract is inhabited by numerous microbes. For bacteria to exert any
probiotic effect, they have to be able to survive both the stomach acids (pH as low as 1.5)
and the bile acids (pH as low as 2). This is true of most lactobacilli. Secondly, the
bacteria must arrive in the intestines in sufficient quantities to have an effect. The amount
required depends on the strain and the health benefit being studied. The minimum
effective level for individual bacteria and specific health benefits is not yet established.
The bacteria may need to adhere to the wall of the intestine (“implant”) and colonize in
order for there to be an effect. Sherwood Gorbach, one of the discoverers of
Lactobacillus GG, states, “Our research over the previous 20 years had established
beyond doubt that implantation in the gut was the critical feature that a strain must
possess to influence the intestinal mili” (Gorbach, 1996). However, others contend that
continuous transit (continually eating a prebiotic food) is an alternative to the organism
implanting and colonizing (Saloff-Coste, 1997). Finally, the bacteria must show some
beneficial effects on human health. Some examples of beneficial effects under
investigation include alleviation of lactose intolerance, prevention and treatment of
diarrhea, maintenance of normal intestinal flora, antagonism against pathogens, and
stimulation of the immune system, anti-carcinogenic activity, and reduction of serum
cholesterol levels.
Table 2.6: Differences between Probiotics, Prebiotics and Synbiotics
The balance of this microbial flora greatly influences the intestinal environment.
Among the numerous intestinal microbes, those that are expected to beneficially affect
the host by improving the intestinal microbial balance, and hence are selected as
probiotics, include species of the genera Lactobacillus, Bifidobacterium, and
Enterococcus. The representative species include Lactobacillus acidophilus,
Lactobacillus johnsonii, Lactobacillus gasseri, Lactobacillus casei, Lactobacillus
rhamnosus, Lactobacillus plantarum, Bifidobacterium longum, Bifidobacterium breve,
Bifidobacterium bifidum, Bifidobacterium infantis, Enterococcus faecalis, and
Enterocuccus faecium. Bifidobacterium species that specifically inhabit the intestinal
tracts of animals, such as Bifidobacterium thermophilum and Bifidobacterium
pseudolongum, are used in animal probiotics. Some bacteria that do not normally inhabit
the intestinal tract may also come under the category of probiotics. They are used as
starters in dairy products and include mainly Lactobacillus bulgaricus, Streptococcus
thermophilus, Leuconostoc and Lactococcus species (Sharma et al., 2012). Lactic Acid
bacteria are beneficial for both human and animals because of various properties which
directly or indirectly enhance the immune system and help us to fight against various
infectious diseases. This group of bacteria have been placed among the best human
friendly microbe which not only reduce the effect of infections and kill pathogens; they
even modulate our immune system and reduce hypertension.
In some countries the use of Enterococcus sp. as a probiotic has been questioned
because of safety aspects with regard to transfer of genes conferring antibiotic resistance.
Most scientists agree that probiotic strains shall be able to survive transit through the
gastric acid environment as well as exposure to bile and pancreatic juice in the upper
small intestine to be able to exert beneficial effects in the lower small intestine and the
colon, although there are convincing data on beneficial immunological effects also from
dead cells (Mottet and Michetti, 2005). Best effect is achieved if the microorganisms
colonise the intestinal surface mucus layer since they then can affect the intestinal
immune system, displace enteric pathogens, provide antioxidants and antimutagens, and
possibly other effects by cell signalling. The intake of LAB influences multiple systems
was elegantly shown for Lactobacillus GG using microarray analysis (Di Caro et al.,
2005). One month treatment resulted in up-regulation of 334 genes and down-regulation
of 92 genes involved in inflammation, apoptosis, cell-cell signalling, cell adhesion and
differentiation and signal transcription and transduction. In recent years, multiple reports
have described beneficial effects from various aspects on important diseases, like
intestinal infections, inflammatory bowel disease (IBD), and allergy by addition of
selected strains to food products, often together with fiber or a prebiotic substance. In
many countries, there are now several probiotic products on the market but the
documentation is often based upon case reports, animal studies or uncontrolled small
clinical trials.
Furthermore, there is no general acceptance on how to characterize prebiotic
microorganisms, and few products declare the actual content of live microorganisms.
There are various health modulating properties of the bacteria some most
effective and commonly known are:-
• Immunomodulation
• Anti-cancerous
• Bio-therapeutic
• Anti-inflammatory
• Prevention from diarrhoea
• Hypocholesterolemic effects
• As Live Vaccine
• Anti-viral properties.
An impressive number of reviews and books have reported the constantly
evolving knowledge and state of the art in lactic acid bacteria. The various health benefits
are summarized in short are as under: -
2.2.6.1 Immunomodulation
The lactic acid bacteria produces some extracellular polysaccharides
(EPS) associated with rheology, mouthfeel and texture of fermented milk products. These
extracellular polysaccharides from Lactobacillus bulgaricus purified from the supernatant
have certain immuomodulatory activities shown in case of mice. The yoghurt containing
immunostimulative EPS would have an immunomodulatory effect on human body
(Makino et al. 2006). A halophilic lactic acid bacterium, Tetragenococcus halophilus,
was found to possess an immunomodulatory activity that promotes T helper type 1 (Th1)
immunity in addition to its important roles in soy sauce brewing (Masuda et al. 2008).
Oncococcus oeni and Pediococcus parvulus also found to have immune-stimulatory
activities as the strains found to stimulate cytokines released by peripheral blood
mononuclear cells (Foligne et al. 2010). Studies on the relationship between nutritional
food and immune-modulation have been increased based on the hypothesis that
consumption of some foods create a barrier for immunological diseases (Sandre et al.
2001). Gut microflora participates in immune exclusion. It prevents other bacteria from
adhering by competition for nutrients and places of adhesion, it produces anti-bacterial
agents, and it stimulates the production of specific antibodies (Premalatha and
Dhasarathan 2011). There are many reports on the immunomodulatory activities of lactic
acid bacteria (Wells 2011; Izumo et al. 2011; Foligne et al. 2010). Probiotics can
influence the microflora composition by increasing the number of Lactobacilli and other
anaerobes (Salminen et al. 1998). Dietary supply of probiotic bacteria stimulates IgA
immune response (Kaila et al. 1992) and the transport of target antigens through Peyer’s
patches (Isolauri et al. 1993).
2.2.6.2 Anti-Cancerous
Lactic acid bacteria play an important role in retarding colon
carcinogenesis by possibly influencing metabolic, immunologic, and protective functions
in the colon (Roberfroid et al. 1995). Concentrations of LAB may increase in the colon
after the consumption of foods containing probiotics; however, probiotic ingestion also
increases the number and metabolic activity of LAB in the colon of humans and animals
(Salminen and Salminen, 1997). In animals, LAB ingestion was shown to prevent
carcinogen-induced preneoplastic lesions and tumors (Rowland et al. 1998). A reduced
activity of pro-carcinogenic enzymes in humans also was shown as a consequence of
prebiotic intake. However, in humans, there is no evidence available on whether
probiotics and prebiotics can prevent the initiation of colon cancer. Epidemiologic studies
are contradictory; some studies could not find an association between the consumption of
fermented-milk products and the risk of colon cancer, whereas other studies showed a
lower incidence of colon cancer in persons consuming fermented- milk products or
yogurt. In spite of various controversies, lactic acid bacteria have been shown to affect
intestinal barrier interfering the metabolic activity of tumor cells preventing and treating a
variety of cancers (Qi-Wei et al. 2011).
2.2.6.4 Anti-inflammatory
The most promising new application for LAB is their use as live delivery
vectors for antigenic or therapeutic protein delivery to mucosal surfaces. Such engineered
lactic acid bacteria are able to elicit both mucosal and systemic immune responses. The
delivery of vaccine in the body through mucosal routes is much beneficial compared to
direct systemic inoculation. But human mucosal surface is a site in which the host
encounters a large variety of micro organisms initiating infections. Lactic acid bacteria
have proved to be effective delivery vehicles for functional proteins to mucosal tissues.
Oral administration of Lactococcus lactis has shown to induce antigen-specific oral
tolerance (OT) to secreted recombinant antigens (Wells 2011). The food manufacturing
sector has developed the so called functional food containing ingredients for promoting
health. Non pathogenic food grade bacteria such as lactic acid bacteria (LAB) are being
tested for their efficacy as live antigen carriers (Mercenier et al. 2000). The advantages of
using live bacterial vaccines include their mimicry of a natural infection, intrinsic
adjuvant properties and their possibility to be administered orally. Derivatives of
pathogenic and non-pathogenic food related bacteria are currently being evaluated as live
vaccines (Detmer and Glenting, 2006).
The first evidence that recombinant commensal bacterium can be used as a live
vaccine vector was obtained with S. gordonii. There are two major approaches being
followed to achieve efficient mucosal delivery of antigens. A variety of synthetic (non-
living) delivery systems, in which purified antigens are entrapped in microspheres,
liposomes, nanoparticules, or ISCOMS, are presently being investigated. An attractive
alternative consists in the use of live viral or bacterial vectors for the production of
replicative particulate antigens in vivo. This technology, which alleviates the drawbacks
of subunit vaccine development, was first described in the early 1980s. Most of the lactic
acid bacteria are quite acid resistant and various strains are able to effectively survive
passage through stomach. The bacterial group has today created a vaccine vehicle system
depending upon their immunization routes and models of antigens they carry. It is found
that the lactic acid bacteria have a low innate antigenicity even though several strains
clearly exhibit immunoadjuvant properties (Pouwels et al. 1998). The ideal GMM for use
in humans should therefore contain the minimal amount of foreign DNA and must not
include an antibiotic resistance marker (Lee 2010).
Streptococcus thermophilus was of major importance for the food industry since it
was massively used for the manufacture of dairy products and it was considered as the
second most important industrial dairy starter after Lactococcus lactis. Nevertheless, over
1021 live cells of Streptococcus thermophilus ingested annually by the human population
(Trevan et al., 2004). Streptoccocus thermophilus (S. thermophilus) belongs to the group
of the thermophilic lactic acid bacteria and is traditionally and widely used as a starter in
manufacturing dairy products (Emmental, Gruyere, Parmigiano, Mozarella, Yoghurt etc).
Yoghurt results from the fermentation of milk by S. thermophilus and Lactobacillus
delbrueckii sp. bulgaricus (L. bulgaricus), fulfils the current specifications required to be
recognized as a probiotic product (Guarner et al., 2005). The health beneficial effect of
yoghurt consumption is linked to the metabolic properties of S. thermophilus and L.
bulgaricus. Streptococcus thermophilus is an important bacterium that is extensively used
in starter cultures in the dairy industry. It is also found growing spontaneously in
traditional products around the world, and is believed to persist in the farm environment.
As such, it improves lactose digestion in the gastro-intestinal tract (GIT) through their
lactose hydrolyzing activity present in yoghurt and in the GIT, thus reducing symptoms
of lactose intolerance (Lomer et al., 2008; Rabot et al., 2010). Yoghurt cultures were
shown to induce other health benefits such as reduction of diarrhoea or allergic disorders
as well as modulation of the immune system (Guarner et al., 2005; Higashikawa et al.,
2010). S. thermophilus is also present at high concentration in VSL#3, a probiotic
mixture of eight different bacterial strains that possesses beneficial effects in several
intestinal conditions (Pagnini et al., 2010; Preidis et al., 2009). Recent data indicate that
strains related to S. thermophilus LMD-9 are among the 57 bacteria species found in 90%
of 124 European individuals intestinal microbiota (Qin et al., 2010). In comparison with
the overall human intestinal microbiota, S. thermophilus is numerically non dominant
species with variable levels (Mater et al., 2005; Elli et al., 2006; Firmesse et al., 2008;
Qin et al., 2010). At birth, Streptococcus genus -with in some studies a precision at the
level of S. thermophilus species- is among the first coloniser of the GIT, since it has been
detected in infant faeces and breast milk (Palmer et al., 2007; Perez et al., 2007). Thus,
Streptococcus, as pioneer bacteria colonising a yet immature GIT, may impact the
maturation and homeostasis of intestinal epithelium after birth.
Fortunately, nature has provided us with different kind of nucleic acids for
different kind of taxonomic studies. Close relations (at species and subspecies level) can
be determined with DNA-DNA homology studies. For determining phylogenetic
positions of species and genera, ribosomal RNA (rRNA) is more suitable, since the
sequence contains both well-conserved and lessconserved regions. It is now possible to
determine the sequence of long stretch of rRNA (~1500 bases of 16S rRNA) from
bacteria (Huili et al., 2011) comparisons of these sequences are currently the most
powerful and accurate technique for determining phylogenetic relationships of
microorganisms (Philippe et. al., 2009).
S. thermophilus prefers the disaccharides lactose and sucrose, and its growth on
the constituent monosaccharides, glucose, fructose and galactose is slower than the
disaccharides suggesting that the transport systems required to accumulate
monosaccharides might be absent or has low activity. It appears that it is dependent on
the availability of the necessary transport system. (Hutkins and Ponne 1991). This
phenomenon has been explained with the findings that the enzymes of the Leloir pathway
for galactose metabolism are present in S. thermophilus, however their activities are very
low and the activity of the first enzyme galactokinase is undetectable under normal
growth conditions (Grossiord et al. 1998). General characters are:
Gram positive, non-motile coccus
Spherical/ovoid cells of 0.7-0.9µm diameter
Occurs in pairs or in long chains of 10-20 cells
Homo-fermentative, L(+) lactic acid as the major end product
Facultative anaerobe
Catalase negative
Lacks cytochromes
Optimum growth temperature is between 40-45°C, a minimum at 20-25°C and
maximum at 50-52°C.
Thermo tolerant, survives at 60°C for 30 min
Weak or no growth at 2 % NaCl
Does not utilize arginine
Lacks group specific antigen
G-C mol ratio is 37-40%
Above 10g of lactic acid/kg of yoghurt, the growth reaches exp8-9 and, the
metabolism of bacterium ceases. The final pH in broth culture is 4-4.5
S. thermophilus has limited proteolytic activity and requires free amino acids for
its growth. These are glutamic acid, histidine, cysteine, methionine, valine, leucine,
isoleucine, tryptophan, arginine and tyrosine. However, free aminoacids naturally found
in milk are not sufficient. The free amino acids are supplemented during heat treatment in
milk or the absorption of short-chain peptides released by the breakdown of milk proteins
by Lactobacillus delbrueckii sub sp. bulgaricus (Pearce and Flint 1999).
Lactococcus + - - L - - V
Streptococcus - + - L - - V
Leuconostoc + + - D + ND -
* ND indicates no data available, V indicates variable: some produce (+) results and
some (-), L indicates levo-lactic acid and D indicates dextro-lactic acid
S. thermophilus is highly adapted to the dairy environment, and in the wild. It can
only be isolated from dairy products. S. waius is a recently identified thermophilic
Streptococcus isolated from stainless still pasteurization machinery of milk. It shares
many phenotypic characteristics with S. thermophilus but can be distinguished by the
fermentation of galactose, salicin, cellobiose, maltose, melibiose and D-raffinose. S.waius
is also tolerant up to 7% NaCl (Pearce and Flint 1999). Unlike other streptococci, S.
thermophilus does not possess a group- specific antigen. The peptidoglycan structure is
identical to Enterococcus faecalis; however it is distinguished from enterococci and
lactococci by its sensitivity to salt. It does not grow in the presence of 4% salt, and some
strains will not grow in as little as 2% salt (Zirnstein and Hutkins 1999). The mechanism
of lactose transport in S thermophilus differs from lactococci, which possess a specific
system for lactose transport, the phosphoenolpyruvate (PEP)-dependent
phosphotransferase system (PTS). Lactose-6-phosphate formed during transport is
hydrolyzed by an intracellular phospho-β -galactosidase into glucose and galactose-6-
phosphate which are then metabolized into lactic acid. S. thermophilus does not possess
lactose PTS or phospho-û- galactosidase, but has a lactose permease system including a
proton dependent membrane-located permease.
Cocci in
Positive chains Negative Negative Homo Positive Negative
Sugar Fermentation Streptococcus thermophilus B4 isolated from Goat Milk (Sharma et al
2013)
Sucrose Lactose Maltose Dextrose Ribose Sorbitol Mannose
DNA hybridization assays are not without their shortcomings, however, being
time-consuming, labor-intensive, and expensive to perform. Today, fewer and fewer
laboratories worldwide perform such assays, and many studies describing new species are
solely based upon small subunit (SSU) sequences or other polyphasic data. In the early
1990s the availability DNA sequencers in terms of cost, methodologies, and technology
improved dramatically, such that many centers can now afford such instrumentation. In
1994, Stackebrandt and Goebel summarized the emergence of SSU sequence technology
and its potential usefulness in the definition of a species. Although it has been
demonstrated that 16S rRNA gene sequence data on an individual strain with a nearest
neighbor exhibiting a similarity score of <97% represents a new species, the meaning of
similarity scores of >97% is not as clear (Petti, 2007). This latter value can represent a
new species or, alternatively, indicate clustering within a previously defined taxon. DNA-
DNA hybridization studies have traditionally been required to provide definitive answers
for such questions. Whereas 16S rRNA gene sequence data can be used for a multiplicity
of purposes, unlike DNA hybridization (>70% reassociation) there are no defined
“threshold values” (e.g., 98.5% similarity) above which there is universal agreement of
what constitutes definitive and conclusive identification to the rank of species.
One of the most attractive potential uses of 16S rRNA gene sequence informatics
is to provide genus and species identification for isolates that do not fit any recognized
biochemical profiles, for strains generating only a “low likelihood” or “acceptable”
identification according to commercial systems, or for taxa that are rarely associated with
human infectious diseases. The cumulative results from a limited number of studies to
date suggest that 16S rRNA gene sequencing provides genus identification in most cases
(>90%) but less so with regard to species (65 to 83%), with from 1 to 14% of the isolates
remaining unidentified after testing (Drancourt et al, 2000).
The use of 16S rRNA gene sequences to study bacterial phylogeny and taxonomy
has been by far the most common housekeeping genetic marker used for a number of
reasons. These reasons include (i) its presence in almost all bacteria, often existing as a
multigene family, or operons; (ii) the function of the 16S rRNA gene over time has not
changed, suggesting that random sequence changes are a more accurate measure of time
(evolution); and (iii) the 16S rRNA gene (1,500 bp) is large enough for informatics
purposes. In 1980 in the Approved Lists, 1,791 valid names were recognized at the rank
of species. Today, this number has ballooned to 8,168 species, a 456% increase. In the
early 1990s the availability DNA sequencers in terms of cost, methodologies, and
technology improved dramatically, such that many centers can now afford such
instrumentation.
However, since the primers are random and not directed to a specific region,
reproducibility is major problem. RAPD-PCR was shown to be superior in distinguishing
individual L. delbrueckii strains. On the other hand, S. thermophilus strains showing
phenotypic anomalisms were not easy to locate within S. thermophilus clusters using this
method (Moschetti et al. 1998). Species-specific PCR is another method which relie on
PCR for rapid and accurate identification for S. thermophilus isolates. Differentiation of
S. thermophilus strains from other Streptococcus species such as S. mutans, S. salivarius,
and other bacteria such as L. delbrueckii subspecies, Lactococcus lactis subspecies,
L.acidophilus, L. brevis, L. fermentum, L. helveticus, L. plantarum, Enterococcus
subspecies and E. coli was accomplished clearly using primers homologous within the
lacZ gene. Phylogenetic tree of Lactobacillales based on concatenated alignments of
ribosomal proteins of Lactobacillaceae, Leuconostocaceae and Streptococcaceae is
presented in Figure 2.9. This method was also justified by a study which makes use of the
polyphasic approach to show the genotypic and phenotypic heterogeneity of S.
thermophilus strains (Giraffa et al. 2001) and also with the study, which investigates the
species composition of commercial dairy starters (Giraffa and Rossetti 2004). Pulsed
Field Gel Electrophoresis (PFGE) is another molecular typing method. It has an
alternating field of electrophoresis to separate large DNA fragments resulting from
restriction with rare cutting enzymes. The crucial point in PFGE is the extraction of intact
chromosomal DNA, which is more time consuming than other fingerprinting techniques.
Since large DNA fragments, representing the whole genome, are analyzed with PFGE, it
has a superior discriminatory power at subspecies and strain levels. Ribotyping combines
an enzymatic restriction digestion and the detection of the restriction fragments by means
of rDNA probes. Fluorescent or radioactively labeled probes can be used for
hybridization. Discriminatory power of this method is dependent on the number and type
of endonucleases and probes. In a study, where ribotyping has been applied to 30
different L. delbrueckii strains, it has been found that only ribotyping with EcoR I
allowed the differentiation of three subspecies on the basis of a typical hybridization
pattern (Miteva 2001). Differentiation at strain level has also been achieved for S.
thermophilus strains both by restriction endonucleases digestion combined with pulsed
field gel electrophoresis and by ribotyping (Salzano et al 1994). 16S or 23S rDNA
sequencing is another useful method, when unknown isolates are to be identified.
Obtained sequences are compared with the sequences previously deposited in a database.
Stackobrandt and Goobel stated that strains that are more than 3% divergent in 16S rRNA
are nearly always members of different species, as determined by DNA-DNA
hybridization studies. Whereas, the strains with less than 3% divergency are generally
members of the same species. A cutoff of 3% is a recommended limit as a conservative
criterion (Cohan 2002). DNA-DNA hybridization has a higher discrimination power than
16S sequencing. Various approaches such as nitrocellulose filter methods, free-solution
methods, and recently the microarray technology have been used. As a general rule,
strains, which have a DNA-DNA relatedness of more than 70% and 5°C or less
difference in melting point, belong to the same species. However, use of isotopes and
lack of database affect the popularity of method negatively. As was observed in Archaea
and Proteobacteria (Snel et al., 2002), genome reduction was an overall trend during the
evolution of the LAB. Divergence of Lactobacillales from their ancestor in the Bacilli
was marked by the loss of 600–1200 genes, including many genes encoding biosynthetic
enzymes (Makarova and Koonin, 2007). Other losses include genes related to
sporulation, a function that is seemingly unnecessary in nutrient-rich food environments
(Hufner et al., 2007). Besides gene losses occurring early in the lineage of the LAB, more
recent events have contributed to shaping these species, including parallel losses in genes
involved in various metabolic processes. The most notable example of gene loss occurred
in Streptococcus thermophilus, which diverged from pathogenic Streptococcus species
through the loss and decay of virulence-associated genes, such as those involved in
antibiotic resistance and adhesion. This genomic record has thus far provided solid
evidence supporting the ‘generally recognized as safe’ status for use of S. thermophilus in
foods.
Figure 2.9: Phylogenetic tree of Lactobacillales based on concatenated alignments
of ribosomal proteins. Colors represent current taxonomy, with
Lactobacillaceae in blue, Leuconostocaceae in red and
Streptococcaceae in green
Table: 2.10 Genomic details of Streptococcus thermophilus strains with whole
genome sequencing available data till Feb 2014
New methods of analysis, such as metabolomics and metagenomics, can also aid
in characterization and should be added to the repertoire of tools for investigation of
complex microbial ecosystems. Humans have relied on the LAB for thousands of years
for food preservation. Our understanding of LAB has increased exponentially with the
applications of genomics and biotechnology, opening up new horizons in bioprocessing,
human health and food production.
However, there are still several researches that need to be addressed in order to
produce lactic acid within the targeted cost, development of high performance lactic acid
producing microorganisms and lowering the cost of the raw material. Many factors
affected in lactic acid fermentation have been investigated. The optimization of
fermentation processes requires profound knowledge of the factors determining microbial
metabolism, and the influence of process parameters
2.3.3.1 Temperature
Temperature and pH are the key environmental parameters that affect the
fermentation process (Yuwono and Kokugan, 2008). Low temperature has been reported
to positively influence the outgrowth of contaminating microorganism, thereby
influencing the performance of the lactic acid production (Neysens and Vuyst, 2005;
Hujanen and Linko, 1996). For Lactobacillus amylophilus, which is known to grow at 15
°C but not at 45 °C, the optimal temperatures were 25 °C and 35 °C for maximum
productivity and yield, respectively (Yumoto and Ikeda, 1995). The results from
measuring the residual starch and reducing sugar in 4 h and 8 h indicated that there was
increased in starch hydrolysis and reducing sugar accumulation as the temperature
increased from 22-30 °C, and a further increase from 30-40 °C resulted in a slight
improvement for the saccharification in both Rhizopus oryzae 2062 and Rhizopus oryzae
36017 cultures (Huang et al., 2005). Naturally occurring lactic acid bacteria (LAB) load
was found to vary between 1.97×105 cfu/g to 4×105cfu/g at10˚C. The yeast and mold
counts decrease from 1.04 ×105cfu/g to 0cfu/gr at 10˚C. Lactic acid bacteria load was
found to vary between1.97×105cfu/g to 4.3×105cfu/g at 20˚C. The yeast and mold counts
decrease from 1.04 ×105cfu/g to 3×104 cfu/g at 20˚C and salt content 0.5%. Lactic acid
bacteria load was found to vary between1.97×105cfu/g to 1.1×106cfu/g at 37˚C. The yeast
and mold counts decrease from 1.04 ×105cfu/g to 3×104 cfu/g at 37˚C and salt content 0.5%.
The largest increase in the numbers of LAB was noted during the first 24 h of
fermentation and further incubation led to decrease (Tabatabaei-Yazdi et al., 2013).
An increase in lactose utilization and subsequent lactic acid production was found
up to 36 h of incubation and thereafter no improvement in both the functions was
observed (Panesar et al., 2010). This could be attributed to the growth of the culture
reached to the stationary phase and as a consequence of metabolism, microorganisms
continuously change the characteristics of the medium and the environment. The
incubation period of 48 h has been generally used for lactic acid production using
different lactobacilli cultures (Gandhi et al., 2000). In addition, different optimal
conditions reported by various workers for maximum lactic acid production could be
explained by the differences in the nature of the strains and medium composition used in
their studies.
2.3.3.3 pH
The fermentation pH is either set at the beginning and then left to decrease due to
acid production or it is controlled by an addition of alkaline solutions. The optimal pH for
lactic acid production varies between 5.0 and 7.0. A pH below 5.7 was optimal for
Lactobacillus strains, which are known to tolerate lower pH than lactococci. The
optimum pH for cell growth of Enterococcus faecalis RKY1 was seen to be 8.0, the lactic
acid fermentation at pH 7.0 was completed faster than that at pH 8.0. The cell growth at
pH 5.0 almost ceased after 10 h of fermentation (Wee et al., 2004). At initial pH 6.5, cell
started to utilize glucose earlier and at a faster rate than at other initial pH. Maximum
lactic acid concentration was attained at initial pH 6.5. Further increase in initial pH
beyond 6.5 does not improve the lactic acid production (Idris and Suzana, 2006). It is
possible that the higher initial pH brought too much stress on the microorganism
metabolic abilities (Vijayakumar et al., 2008).
2.3.3.4 Agitation
Different lactic acid bacterial strains differed in their requirement for growth
conditions. The maximum lactic acid concentrations from Lactobacillus rhamnosus
strain, could be achieved when fermentation was carried out at pH 6, temperature of 40°C
and agitation speed of 150 rpm, in accordance with a previous report (Hofvendahl and
Hagerdal, 2000) the optimal condition for lactic acid is pH 5.0-6.8, temperature 30- 45°C
with continuously agitating at 100-200 rpm (Timbuntam et al., 2008).
1 Alce Italy
2 ASCRC Australia
6 Danisco Denmark
7 Degussa Germany
9 Gewu¨rzmu¨ller Germany
10 Lallemand Canada
Quest International
12 The Nederlands
13 Rhodia France
Starter cultures can be used as single strain, mixed strain and multiple strains
depending upon the type of products to be prepared. The ability of starter culture to
perform its functions efficiently during manufacture of fermented dairy foods depends
primarily on purity and activity of starter cultures. The major roles of starter culture
during fermentation of milk are:
a) Production of primarily lactic acid and few other organic acids, such as formic acid
and acetic acid.
b) Coagulation of milk and changes in body and texture in final products.
c) Production of flavouring compounds, e.g., diacetyl, acetoin and acetaldehyde.
d) Help in ripening of cheeses by their enzymatic activities.
e) Produce antibacterial substances in the finished product.
f) In addition, they may possess functional properties.
Thus, an ideal starter culture should be selected for the preparation of various fermented
milks with the following characteristics.
• It should be quick and steady in acid production.
• It should produce product with fine and clean lactic flavour.
• It should not produce any pigments, gas, off-flavour and bitterness in the finished
products.
• Should be associative in nature in product development.
There are two major groups of starter cultures which are used in the preparation of
fermented milk products classified on the basis of their physiological, biochemical and
growth characteristics:
These cultures have optimum temperature for growth between 20 to 30°C and
include Lactococcus and Leuconostoc. These mesophillic lactic cultures are used in the
production of many cheese varieties where important characteristics are:
• Acid producing activity
These lactic acid bacteria are characterized for their ability to ferment lactose
almost exclusively to lactic acid while pentoses and gluconate are not fermented. The
examples of these cultures are: L. acidophilus, L. bulgaricus.
Main characteristics of these bacteria are the ability to ferment hexoses and
pentoses to lactic acid, acetic acid, alcohol and CO . The examples of these cultures are
2
Spoilage of fermented milk products on storage also takes place due to non-lactic
contaminants, such as sporeformers, micrococci, coliform, yeast and molds. These
undesirable organisms rapidly increase in number when the starters are weak and the
ratio of non-lactic to lactic organisms is high. Containers having a large surface of air in
contact with the fermented milk accelerate the process of spoilage. Fermented milk
products are generally spoiled by yeasts and molds and also by lactic acid bacteria which
may cause sour, bitter and cheesy flavor. From dietary point of view, sour milk products,
such as yoghurt, dahi, acidophilus milk, kumiss and other fermented milks are far more
valuable than milk. During fermentation of milk, the composition of the minerals remains
unchanged, while those of proteins, carbohydrates, and vitamins and to some extent fat
constituents change which produce special physiological effects. Dietary and therapeutic
qualities of sour milk products are determined by microorganisms and substances formed
as a result of biochemical process accompanying milk souring. These substances are
lactic acid, alcohol, carbon dioxide, antibiotics and vitamins. Following biochemical
processes make fermented milk products more nutritive than milk:
• Milk Proteolysis
Proteolysis in milk takes place by exo- or endo-peptides of lactic acid bacteria. The
biological value of protein increases significantly from a value of 85.4 to 90 per cent.
This increase is due to breakdown of protein into peptones, peptides and amino acids.
The contents of essential amino acids such as leucine, isoleucine, methionine,
phenylalanine, tyrosine, threonine, tryptophane and valine increase considerably to
offer special advantages not only to healthy people but also particularly to the
physically weak persons. Fermented milks (yoghurt, kefir, dahi) are having higher
protein digestibility due to precipitating into fine curd particle by lactic acid that
contributes to its higher nutritional value and capacity to regenerate liver tissue.
During fermentation and storage, the amount of free amino acids increases,
particularly lysine, proline, cystine, isoleucine, phenylalanine, and arginine. Due to
these biochemical changes in milk protein during fermentation make these products
dietetic in nature.
• Lactose Hydrolysis
The homogenization process reduces the size of fat globules, which become
digestible. The production of free fatty acids as a consequence of lipolytic activity
increases due to lactic acid bacteria as compared to milk. This leads to some
physiological effects.
• Changes in vitamins
There is more than two fold increase in vitamins of B-group especially thiamine (B ),
1
approximately one half as they are utilized by the bacteria present in milk. However,
the increase or decrease in vitamin content depends on the type of culture.
• Antibacterial activities
Infact there is not any significant changes in minerals in milk after or during
fermentation process by lactic acid bacteria and the nutritional values of fermented
milk products remain intact.
2.5.4 Bacteriophage
Bacteriophages (phage) are viruses that attack and destroy bacteria. They are very
small and cannot be seen with an ordinary microscope. Phage requires a host cell to
reproduce; one phage per bacterial infection can result in up to 200 phage being released,
each of which can infect a new bacterial cell. Phages are very strain specific, which is
why culture rotation and resistance are used as control mechanisms. Phage can enter the
dairy plant through the raw milk supply although some culture strains are “carriers.”
Problems with “dead vats” due to phage can often be linked to phage in the plant
environment (poor plant hygiene, residual culture). Stringent culture handling and plant
sanitation programs are essential in preventing phage problems.
2.5.5.1 Yogurt
Yogurt (also spelled jugurt or yoghurt) is a semisolid fermented milk product,
which originated centuries ago in Bulgaria. Its popularity has grown and is now
consumed in almost all parts of the world. Although the consistency, flavour and aroma
may vary from one region to another, the basic ingredients and manufacturing processes
are consistent. Yogurt is strictly defined as a milk product produced by the action of two
bacteria – Streptococcus thermophilus and Lactobacillus delbrueckii sub sp. bulgaricus.
In addition, yogurt may contain bifidobacteria and supplementary flora like Lactobacillus
acidophilus for improving its therapeutic significance. Although milk of various animals
has been used for yogurt production in various parts of the world, most of the
industrialized yogurt production uses cow’s milk, whole milk, partially skimmed milk,
skim milk or cream. Good quality milk is clarified and then standardized to achieve the
desired fat content. The various ingredients are then blended together in a mix tank
equipped with a powder funnel and an agitation system. The mixture is then pasteurized
for 30 min at 85°C or 10 min at 95°C. These heat treatments, which are much more
severe than fluid milk pasteurization, are necessary to:
• Produce a relatively sterile and conducive environment for the starter culture
• Denature and coagulate whey proteins to enhance the viscosity and texture
The mix is homogenized using pressures of 2000 to 2500 psi before final heat treatment.
Besides thoroughly mixing the ingredients, homogenization also prevents creaming and
wheying off during incubation and storage (Figure 2.10). Stability, consistency, body and
texture are enhanced by homogenization. After the final heat treatment, the mix is cooled
to an optimum growth temperature and inoculated with the yoghurt starter culture. A ratio
of 1:1 of Streptococcus thermophilus and Lb. bulgaricus inoculation is added to the
jacketed fermentation tank. A temperature of 42°C is maintained for about 4 h without
agitation, till the milk sets. This temperature is suitable for the two microorganisms. The
titratable acidity is carefully monitored until the titrable acidity is 0.85 to 0.90 per cent.
At this time, chilled water is circulated in the jacket and agitation begins, both of which
slow down the fermentation. The coagulated product is cooled to 5-22°C, depending on
the product. Fruit and flavour may be incorporated at this time, and then packaged. The
product is now cooled and stored at refrigeration temperatures (5°C) to slow down the
physical, chemical and microbiological degradation. There are two types of plain yogurt:
stirred yogurt and set yogurt. In set style, the yogurt is packaged immediately after
inoculation with the starter and is incubated in the packages. Other yogurt products
include fruit and flavored yoghurt, frozen yoghurt and liquid yoghurt.
Figure 2.10: Flow diagram of the main steps involved in the production of Stirred
yogurt
2.5.5.2 Acidophilus Milk
Acidophilus milks are sour milk products in which milk is allowed to ferment
under conditions that favour the growth and development of larger number of
Lactobacillus acidophilus alone or in combination with other lactic acid bacteria or
lactose fermenting yeasts.
The milk for this product can be skimmed from full cream milk but because L.
acidophilus does not grow well in milk and would be easily overgrown by usual
microflora, the base milk has to be virtually sterile when the culture is added. The milk is
then left to incubate at 37°C for 12-16 h or till the acidity of the product reaches around
0.8 to 0.9 per cent (as lactic acid). Consequently, the optimum acidity is achieved by
cooling the milk to 5°C or less and halting any further activity by the culture (Figure
2.11). The culture could generate up to 1.0 to 2.0 per cent lactic acid, but the impact of
such levels on cell viability over 2-3 weeks can be devasting in a low solid product. After
cooling, the acidophilus milk is bottled and consumed under chilled conditions.
Acidophilus milk has shelf life of two weeks under refrigeration.
Dahi or curd is an Indian fermented milk product which is equally known for its
palatability, refreshing taste and therapeutic importance as claimed in the ayurvedic
literature. Some of its characteristics are similar to other fermented milk products such as
yoghurt and acidophilus milk but it differs with regard to heat treatment of milk, starter
culture, chemical composition and taste. In addition, dahi also has antibacterial properties
against pathogenic and non-pathogenic organisms.
Types of Curd
Some of the fermented milks and different types of dahi consumed throughout India have
been categorized as follows:
• North Zone : Dahi, Lassi
• South Zone : Dahi, Buttermilk (Mattha)
• East Zone : Payodhi or Lal dahi or Mishti dahi
• West Zone : Shrikhand, Chakka, Chhash, Dahi
Based on the acidity level (% lactic acid), dahi has been classified into categories
such as sweet dahi with a maximum acidity of 0.7 per cent and sour dahi with 1.0 per
cent acidity. Starter culture used in the preparation of dahi is normally dahi left over from
previous day. The composition of microflora varies from one household to another and
from one place to another. In general, it has been found that dahi culture is dominated by
streptococci and lactobacilli. In sour dahi, however, lactobacilli predominate. For
commercial manufacture by organized dairy, single starter culture (Lactococcus lactis
subsp. diacetylactis) or mixed culture is used. The raw materials used are cow and/or
buffalo milk, standardized milk, skim milk and reconstituted skim milk powder. The
traditional method for preparation of dahi invariably involves a small scale, either in
consumers’ household or in the sweet makers shop in urban areas. In the household, milk
is boiled, cooled to about 37°C and inoculated with 0.5 – 1 per cent of starter (previous
day’s dahi or butter milk) and allowed to set overnight (Figure 2.12). It is then stored
under refrigeration and consumed
Figure: 2.12 Flow sheet for the preparation of Curd
A good quality dahi made from whole milk has a cream layer on the top, the rest
being made up of a homogenous body of curd and the surface being smooth and glossy,
while the cut surface should be firm and free from cracks of gas bubbles and it should
have a pleasant acid taste with sweetish aroma. Composition and quality of dahi vary
widely from one locality to another as it is being prepared under different domestic
conditions as well as milk, with variable chemical and bacteriological quality used for the
preparation. However, the chemical composition of dahi has been reported as fat ranging
from 5 to 8 per cent, protein 3.3 to 3.4 per cent, ash 0.75 to 0.79 per cent and lactic acid
0.5 to 1.1 per cent. Quality of dahi can be improved with regard to increase in riboflavin
and folic acid by incorporating propionic acid bacteria such as Propionibacterium
shermani along with dahi starter culture. Regarding palatability and therapeutic
importance of dahi, it has been known to create relish for food, promote the appetite,
increases strength and leads to longevity.
Buttermilk is really the liquid left from butter making. However, cultured
buttermilk is a fermented milk product made from pasteurized skim milk low fat milk in
which mesophilic lactic acid bacteria is added as starter.
• Starter culture for cultured buttermilk
Starter cultures are typically mixtures of flavour and acid producers Leuconostoc sp.
and Lactococcus lactis sub sp. diacetylactis produces diacetyl, the flavour most
commonly associated with flavored butter and Lactococcus lactis is used to produce
lactic acid which contributes to the acidic flavour typically associated with cultured butter
milk.
• Preparation of cultured butter milk
The starting ingredient for buttermilk is skim or low-fat milk. The milk is pasteurized at
82° to 88°C for 10 - 30 minutes. This heating process is done to destroy all naturally
occurring bacteria and to denature the protein in order to minimize wheying off
(separation of liquid from solids). The milk is then cooled to 22°C and starter cultures of
desirable bacteria, such as Lactococcus lactis, L. cremoris, L. citrovorum and L.
dextranicum are added to develop buttermilk’s acidity and unique flavour. These
organisms are used in proper combination to obtain the desired flavour. The ripening
process takes about 12 to 14 hours (overnight). At the correct stage of acid and flavour,
the product is gently stirred to break the curd, and it is cooled to 7.2°C (45°F) in order to
stop fermentation. It is then packaged and stored under refrigeration.
2.5.5.5 Cheese
A dairy product prepared from cow, buffalo, goat or sheep’s milk that is set aside
to thicken until it separates into liquid, called whey, and semisolids, called curd. The
whey is drained off and the curd is formed into the shape as per specification of cheese. It
is packaged immediately; making it a fresh cheese like Ricotta cheese or cottage cheese,
or it is aged using various curing methods.
Types of cheeses
There are 400 varieties of cheeses, of which 18 are distinct. Important varieties of cheeses
are given below:
• Cheddar
Cheddar is a hard variety with about 40% moisture and has a diverse selection of tastes
that range from mild to sharp. This is dependent upon the age of the cheese. Mild
Cheddar is perfect for sandwiches because it has a mellow balance of flavors. Sharp
Cheddar is good for cooking because its flavour is released when heated and it shreds
well with other cheeses.
• Mozzarella
Mozzarella has a mild, milky taste and is more of a cooking cheese due to its good
binding properties, moist texture and ability to melt. It is a “stretched-cured” cheese
meaning that during the manufacturing process the curd is pulled, kneaded and shaped
while it is still pliable. Therefore, it absorbs the flavors and juices of the ingredients
surrounding it and is perfectly designed for cooking. Mozzarella is also low in fat;
therefore, it is ideal to use even when dieting. Mozzarella is an ideal cheese for Pizza
making.
• Swiss
Swiss cheese, which is also known as Emmental or Schweizer, is a firm cheese with a
sweet, mildly nutty flavour. This cheese is known for the holes or eye formation that
develops as it ripens. These holes or eyes range in diameter from ½ inch to 1 inch and
begin forming when the cheese is about 3 weeks old.
• Camembert
Camembert has a soft texture with a buttery taste and mushroom smell. It tastes best
when it is at room temperature and the center becomes soft and it is a mold-ripened
cheese.
• Processed Cheeses
It is prepared by melting one or more pressed cooked or uncooked cheeses, and adding
milk, cream, butter and sometimes flavouring agents. One or several ripened cheeses are
heated and mixed, then pasteurized at high temperature (130-140°C) after other dairy
products, such as liquid or powdered milk, cream, butter, casein, whey, and seasoning
have been added.
Chapter 3
Material & Methods
All chemicals used for chemical reaction were of analytical grades and media
ingredients like yeast extract, casein enzyme hydrolysate, casein peptone, soya peptone,
skim milk powder, beef extract, tryptone, tryptose, protease peptone were of extra pure
grade purchased from Himedia, India. Other chemicals like sodium acetate, tri-
ammonium citrate, di-potassium hydrogen sulphate, magnesium sulphate, manganous
sulphate, di-sodium glycerol phosphate, ascorbic acid, sucrose, lactose, maltose, dextrose,
arabinose, malto dextrin, sodium chloride, potassium chloride, sodium hydroxide,
hydrochloric acid, sulphuric acid were obtained from Fisher Scientific, India; Himedia,
India; Rankem, India; Fluka, UK and Merck, Germany. Some pre-prepared agar medium
were also obtained from Himedia, India like Streptococcus thermophilus isolation agar
(M948), M-16 (M600), Lactobacillus selection agar (M1180), Lactobacillus bulgaricus
agar (M927), Lactobacillus MRS agar (M369), M-17 agar (M929), Brain Heart infusion
agar (M211A), Tomato Juice agar (M048) and L.S differential media (M582). Reference
bacterial strains were purchased from American Type Culture Collection (ATCC), three
lactic acid bacterial strains for reference were purchased from Microbial Type Culture
Collection and Gene Bank (MTCC) Chandigarh, India and five reference strains were
obtained from National Collection of Industrial Microrganism, Pune, India.
Lactic acid bacteria (LAB) in this study were isolated from different sources
which includes cow milk, buffalo milk, goat milk, sheep milk, camel milk, Indian
traditional curd and grapes collected from the surrounding area of Gwalior district of
Madhya Pradesh, India. The sources of cow, buffalo and goat milk were urban dairy
farms while as sheep and camel milk samples were obtained from local milk suppliers.
Curd samples were collected from both dairy farms and local curd suppliers. Grape
samples were randomly picked from different fruit markets and grape farms in the city.
Grape sample was taken aseptically and packaged into clean bag, then stored at 4°C
during their transport. These fruit samples were analyzed within 24 hours of acquisition
at the grape farms. On the other hand raw milk samples were collected in sterile tubes
and maintained in chilled condition (8-10o C) during their transport to Microbiology
Biotechnology Laboratory, Tropilite Foods Pvt. Ltd. Gwalior, for further analysis and
research.
Serial dilutions of all raw milk samples in 0.1% peptone saline were used for
microbial isolation separately. All the milk samples were serially diluted one by one and
were pour plated on MRS (DE MAN, ROGOSA and SHARPE), M17 agar,
Streptococcus thermophilus isolation agar and Lactobacillus selection agar. Plates were
incubated for 24-48 hours at 15, 32, 37 and 45°C in both anaerobic and aerobic
conditions. Same protocol was followed every time for different raw milk samples of
cow, buffalo, goat, sheep and camel (Sharma et al., 2013). In case of grapes, 10 g of
grape sample was homogenized with 90 mL of peptone water (mother solution), 1 mL of
mother solution was transferred into 9 mL of slain solution (8.5 g NaCl, 1000 mL
distilled water, pH 7.0) and serial dilutions up to 10 were made. Then, 1 mL form each
dilution was cultivated in the following selective media: M17 (Himedia, India) and
Streptococcus thermophilus isolation agar to count Streptococcus, incubation at 45°C/48h
(Terzaghi and Sandine, 1975), MRS (Himedia, India) to count Lactobacillus and
Pediococcus, incubation at 30°C/48h (De Man et al., 1960) And Elliker (Himedia, India)
to count Lactococcus, incubation at 30°C/48h (Elliker et al., 1956). Randomly picked
colonies were transferred to suitable media and purification of colonies was made by
repeated streaking on suitable media. Randomly picked colonies were transferred to
suitable media and purification of colonies was made by repeated streaking on suitable
media (Patil et al., 2010). The colonies were randomly (different colony types) picked
from plates with 30-300 colonies. Several representative strains displaying the general
characteristics of lactic acid bacteria were chosen from each plate for further studies.
Each of the isolates were repeatedly streaked in order to purify the isolates, which were
maintained on MRS agar slants for immediate use and in 15% glycerol for storage at -20
°C. Strains of LAB were identified according to their microscopical, morphological,
physiological and biochemical properties (Samelis et al., 1994; Bisen 2014).
The previous procedure was repeated in order to purify the isolates, and to be
able to select the high ability in term of growth and good characterization. According to
these tests, the isolates were selected as potential lactic acid bacteria. Biochemical
characterization of the selected strains was carried out with following biochemical tests:
3.2.4.1 MR-VP tests (Methyl red and Voges-Proskauer test)
MR-VP test differentiates bacteria upon the fermentative end product they
produce. Some bacterial strains produce large amount of acids and some produce a
neutral acetoin as the end product. MR-VP are basically two different tests but the reason
behind performing the two tests together is the results they produce as if methyl red tests
gives positive results then Voges-Proskauer must be negative of the same and vice-versa.
Material requirements:
• MRVP broth tubes (Peptone 7g, Dextrose 5g, and Potassium phosphate 5g)
• Methyl Red pH indicator
• Napthol solution
• 40% potassium hydroxide
MR-VP broth was prepared and selected strains were tested against the standard.
Eight tubes were prepared for each bacterial strain separately. Six were inoculated and
incubated at 35°C for 48 hours while as two were kept un-inoculated. On completion of
incubation, five drops of methyl red were added to any three tubes with clear turbidity,
while as 12 drops of napthol solution and 2-3 drops of 40% potassium hydroxide were
added to the remaining three. No color change in the tubes added with methyl red
indicates MR positive and color changing to yellow indicates MR negative. Ruby pink
color on the tubes with napthol indicates VP positive and no color change shows VP
negative. If the MR test is positive it means that the organism produces a large amount of
organic acids like lactic acid, formic acid, succinic acid by fermenting glucose but a
negative MR test shows that the organic acids produced by the organism faced some
enzymatic conversion and get converted into non acidic products like ethanol or acetoin.
On the other hand VP test also determines the presence of acetoin in the under testing
broth. The organisms capable of converting pyruvate into acetoin shows VP positive
(showing red colour) while as no acetoin in broth shows negative test (no colour change).
3.2.4.2 Nitrate reduction test
Bacterial species can also be differentiated on the basis of their ability to reduce
nitrate to nitrite or nitrogenous gases. The reduction of nitrate may be coupled to
anaerobic respiration in some species. Selected isolated strains were also tested against
their nitrate reducing capacity. Material requirements:
• Nutrient broth and KNO3 (Peptone: 5g, Beef Extract: 3g, Nacl: 5g, KNO3: 5g)
• Solution A (Sulfanilic acid 8 g + acetic acid 5N 1000 mL)
• Solution B (Alpha-naphthylamine 5 g + acetic acid 5N 1000 mL)
Inoculate nitrate broth with an isolate and incubate for 48 hours. Add 10-15 drops each
of sulfanilic acid and followed by addition of Alpha-naphthylamine. If the bacterium
produces nitrate reductase, the broth will turn a deep red within 5 minutes at this step. If
no color change is observed, then the result is inconclusive. Add a small amount
of zinc to the broth. If the solution remains colorless, then both nitrate reductase
and nitrite reductase are present. If the solution turns red, nitrate reductase is not present.
When using phenol red as the pH indicator, a yellow color indicates that enough acid
products have been produced by fermentation of the sugar to lower the pH to 6.8 or less.
A delayed fermentation reaction may produce an orange color. In such cases, it is best to
re-incubate the tube. Bubbles trapped within the Durham tube indicate the production of
gas. Even a single bubble is significant and denotes evidence of gas production. No
bubbles within the Durham tube indicate a non-gas-producing or anaerogenic organism.
A reddish or pink color indicates a negative reaction. In negative tubes, the presence of
turbidity serves as control for growth. A reddish or pink color in a clear tube could
indicate a false negative.
3.2.5 Molecular Characterization
Genomic DNA from nearly all prokaryotic and eukaryotic organisms is also
complexed with protein and termed chromosomal DNA. Each gene is located at a
particular position along the chromosome, termed the locus, whilst the particular form of
the gene is termed the allele. In mammalian DNA each gene is present in two allelic
forms which may be identical (homozygous) or which may vary (heterozygous). The use
of 16S rRNA gene sequences to study bacterial phylogeny and taxonomy has been by far
the most common house keeping genetic marker used for a number of reasons.
16S rDNA sequencing has played a pivotal role in the accurate identification of
bacterial isolates and the discovery of novel bacteria in clinical microbiology
laboratories. For bacterial identification, 16S rDNA sequencing is particularly important
in the case of bacteria with unusual phenotypic profiles, rare bacteria, slow-growing
bacteria, uncultivable bacteria and culture-negative infections. The hyper variable regions
of 16S rRNA gene sequences provide species-specific signature sequences useful for
bacterial identification. In medical microbiology, 16S rRNA sequencing serves as a rapid
and cheap alternative to phenotypic methods of bacterial identification.
The genetic interrelationships of members of the lactic acid bacteria have been
studied extensively in 16S rDNA sequence, and DNA-DNA hybridization experiments.
Total genomic DNA of all isolated strains was prepared by using the following procedure
(Cardinal et al., 1997). DNA (214 ng/µl) was subjected to PCR utilizing the primer 1
(AGA GTT TGA TCC TGG CTC AG) and primer 2 BOX A1R (CTA CGG CAA GGC
GAC GCT GAC G) as Versalovic et al described. Each 27 µl PCR reaction contained 5
µl 5× Gitschier buffer (1 M (NH4)2SO4, 1 M Tris-HCl (pH 8.8), 1 M MgCl2, 0.5 M
EDTA (pH 8.8) and 14.4 M β -mercapto-ethanol add double distilled water till 200 mL),
0.6 mg/ mL BSA (Sigma, A-7906), 100% DMSO (Sigma, D-8418), 0.2 mM dNTP
(Sigma, D7295), 0.5 µM oligonucleotide primer, 1 units of Taq DNA polymerase
(Sigma, D1806) and distilled water. PCR amplifications were performed in a DNA
thermal cycler with an initial denaturation step (95°C, 7 min), followed by 30 cycles of
denaturation (94°C, 1 min), annealing (53°C, 1 min) and extension (65°C, 8 min), and a
single final extension step (65°C, 16 min). The amplified fragments were fractionated on
a 1.5% w/v agarose gel during 200 min at a constant voltage of 40 V in 0.5×TAE (Tris-
Acetat EDTA) at 4°C. A 10-kb reference marker (Sigma, D7058) was used to allow
standardization, followed by staining with ethidium bromide and visualization.
Since a potential lactic acid bacterium was isolated, it was essential to test the
growth parameters of the strain on the minimal media and other selective media
prescribed for the strain to check the final bacterial mass. Selective media were studied
for a brief idea on the nutrition requirements of the strain on specific source basis. Effect
of carbon, nitrogen, amino acids, buffers, surfactants were studied.
The optimum conditions for growth and fermentation were investigated by using
the selected lactic acid bacterium. To investigate the requirements for complex carbon
sources, the experiments were performed either omitting one of the organic carbon
sources from the modified MRS medium. Effects of different carbon sources like sucrose,
dextrose, lactose, maltose, glucose, arabinose, malodextrine, and fructose were studied.
The initial concentrations of all the selected carbon sources varied from 20-100 g/L (2-
10%). For cultivation, a modified MRS and M948 (Himedia, India) was used: carbon
source (2- 10%), nitrogen source (5%), sodium acetate (0.5%), tri-ammonuim citrate
(0.2%), di-hydrogen potassium phosphate (0.2%). All the compositions were uniformly
mixed sterilized under total controlled conditions and later inoculated with 5% inocolum
size. The concentrations were in triplicates prepared in 500 mL conical flasks with
working volume of 200 mL. Experiments were carried out with incubating temperature of
40°C in orbital shaking incubator (Remi, India) with agitation speed of 150 RPM. Media
formulations resulting in high cell mass were selected for further analysis by cultivation
on 2L fermenter (BIOSTAT A PLUS, Sartorius Stedim, Germany) with working volume
of 1.5 L. Formulations were selected on the basis of their spectra-photometric results
(UV-Visible spectrophotometer 119, Systronics, India) and differentiated on the basis of
optical density (OD) taken at 660 nm. Sampling was done every 5 hour interval for first
15 hours and then every 2 hour for total 24 hours. The optimized condition and medium
were further used in process development.
Other than nutrition sources, there were several other factors and conditions
which needs to be standardized for successful process optimization like incubation
temperature and pH standardization.
3.4.1 Temperature Optimization
The temperature giving the highest productivity was in some cases lower than the
temperature resulting in highest lactic acid concentration and yield, whereas in others the
same temperature gave the best results in all categories (Hofvendahl and Hagerdal, 2000).
The effect of temperature between 30 °C, 37 °C, 40 °C, 45 °C, 50 °C, or 55 °C were
investigated for lactic acid fermentation (Busairi, 2002). All of determinations were
analyzed and the optimum temperature was selected for further study
3.4.2 pH optimization
Some enzymes have ionic groups on their active site, and these ionic groups must
be in the correct form (acid or base) to function. Variation in the pH of the medium
results in changes in the ionic form of the active site. Therefore, the activity of the
enzymes were significantly affected the reaction rate for cell growth and lactic acid
production. The effects of initial pH (4.0, 5.0, 6.0, 7.0, or 8.0) were investigated for lactic
acid fermentation (Yuwono and Kokugan, 2008). The optimum pH was selected for
further study.
The up-scaling process for bacterial mass production is one of the critical
standardization points in order to obtain maximum cell mass during the fermentation
process for which a number of parameters were standardized staring from inocolum
preparation to viable cell mass as end product.
3.5.1 Inocolum Preparation
Pure viable colonies of the isolated strain were selected after complete
morphological and biochemical observations and were cultured on agar media (M948
Himedia) followed by incubation at 37°C for 24 hours. Sub-cultured colonies were
checked again for any traces of other bacterial contaminants and were cultured on slants
followed by storage at 8°C. Each experiment was performed using a preserved slant by
inoculating loop-full culture in 80 mL of broth medium. After incubation and visible
turbid growth, broth to broth sub-culturing was done for four to five bacterial generations
and further used as inocolum for different generations (Figure 3.1).
Figure 3.1: Step elabaration of Inocolum preparation from 1st. 2nd and 3rd
generation
3.5.2 Process standardization for incubating conditions
Cell viability is defined as the number of living cells present based on a total cell
sample. Quantifying bacteria can be a difficult task to achieve using direct methods of
enumeration. Cell-counting instruments exist that can be used to count numbers of
organisms in a sample using electrical or light impedance, but these tools are often not
found in every lab setting. The viable cell count is an estimate of bacterial population in
an original sample being tested. To perform viable cell counts on agar plates, it is often
necessary to dilute the original sample to make counting easier. Countable plates are
typically considered to hold 30-300 colonies on the surface of the agar. Serial dilution
was performed as per following protocol:
One milliliter of the original sample was transferred to a tube containing 9 mL of sterile
water which makes it a total of 10 mL of solution, 1 part sample and 9 parts water. One
milliliter of solution was moved from this tube to another tube with 9 mL of sterile water
creating a 1:100 dilution. This process is carried out until desired dilution factors were
met. After the proper dilutions the contents of each tube were used to create plates.
• Using a sample of milk, transfer 1 mL into the first sterile water blank. Label this
tube 1:10.
• Mix the tube contents using the vortex mixer on the end of each table.
• Using another transfer pipette, transfer 1 mL of the 1:10 tube to the next sterile
blank tube. Label this tube 1:100.
• Continue making transfers until 1:100 and 1:10000 dilutions have been made.
• After all dilution have been completed, transfer ½ mL from the 1:10 dilution and
place it on a plate labeled 1:20.
• Spread the liquid across the surface of the plate with a clean spreading rod.
• Continue making plates in this fashion from each of the dilution tubes until
created four plates: 1:20, 1:200, 1:2000, 1:20000.
• Place the plates in inverted position in an incubator at fixed temperature.
Down stream process for production of starter culture includes a lot of bio-
instrumentation and a number of processes like centrifugation, ultra micro-filtration,
cryoprotectant standardization, freezing and lyophilization. It also includes the
application testing of the final product on different parameters. The effects of all the
processes were studied in order to obtain a remarkable commercially viable product.
3.7.1 Centrifugation and micro-filtration
The turbid broth samples were then centrifuged at 5000 RPM for 10 minutes
followed by pellet washing with physiological NaCl (0.9%) solution. The pellet were
resuspended in 10% sterile solution of defatted skim milk powder (Himedia, India) and
then distributed in sterile vials of 1 mL capacity followed by immediate freezing at -80°
C for further use. The following compounds were used to check the viability
improvement.
Lactose, monohydrate (min 99.5%, milk sugar, Himedia, India), Sucrose, Extra
pure (min 99.5%, Himedia, India), D-(-)-Fructose, Extra pure (min 99%, Himedia, India),
D-(+)-Glucose monohydrate (min 99.5%, Himedia, India), D-(-)-Mannitol, Extra pure
(min 99%, Himedia, India), D-(-)-Sorbitol (min 99%, Himedia, India), D-(+)-Maltose
monohydrate (min 95%, Himedia, India), Maltodextrine (Himedia, India), D-(-)-Ribose
(Min 99%, Himedia, India), D-(-)-Arabinose (Min 99%, Himedia, India). Polymers,
inorganic compounds and other media: Distilled water, Monosodium-L-glutamate
monohydrate (min 98%, Himedia, India), meso-Inositol (min 98%, Himedia, India),
glycerol, purified (min 99%, Himedia, India), sodium chloride, extra pure (min 99%,
Himedia, India), Skim Milk powder, defatted (Himedia, India), di-Potassium hydrogen
phosphate (min 99%, Himedia, India), Potassium dihydrogen orthophosphate, purified
(min 99%, Himedia, India), tri-ammonium citrate, extra pure (min 97%, Himedia, India),
whey protein concentrate (Fonterra, New Zealand), sweet whey powder (Fonterra, New
Zealand), sodium caseinate (Arla Foods, Denmark). Different lyoprotectant combinations
were prepared to check the cell viability after lyophilization. A total of 18 lyoprotectants
were used to develop 40 combinations for evaluating viability results and escalation. All
the lyoprotectants (10% w/w) were prepared and sterilized except monosodium glutamate
(1% w/w), meso-inositol (0.5% w/w), KH2PO4 (1% w/w), K2HPO4 (1% w/w),
ammonium citrate (1% w/w) which were sterilized with mentioned w/w. These
protectants in single and in combinations were mixed with freezed vials in 1:5 ratios (1
mL inocolum vial and 5 mL lyoprotectant). Lyophilization of the samples was done at
0.04mbar vacuum at -50° C (Alpha 1-2, LO plus, Martin Christ).
Curd is an important part of Indian diet. In most Indian homes curd is prepared
almost every day. Homemade curd is not only very simple to prepare but is also
delicious. Moreover, it has no preservatives and is also economical.
Figure 3.2: Chart for preparation of Indain traditional curd from starter culture
The milk was slowly stirred to distribute the culture organisms uniformly and
the inoculated milk was poured into 250 mL capacity beakers which were then incubated
at 42°C for about 6 h. After fermentation, the beakers were shifted to refrigerator to cool
the curd for about 24 h so that it was cooled to about 5°C. The curd was then analysed for
sensory quality, rheological attributes and physico-chemical attributes. Following
parameters are checked on curd formation:
Texture of Curd: The texture of curd depends mainly upon the heat treatment
given to milk. Cow milk (3.5% fat and 8.5% SNF) was subjected to two separate
treatments: (1) heating at 63oC for 30 min and (2) boiling treatment without
holding period. The milk was cooled to about 40oC and inoculated with S.
thermophilus culture and incubated at 42oC for about 6 hours. The curd formed
was chilled to 5oC and evaluated for quality. Firmness, consistency and index of
viscosity as measured by Texture Analyser increased with increased heat
treatment and the highest values were observed in curd prepared from boiled
milk. Boiling treatment of milk resulted in least syneresis of whey in the curd.
Based on the results, it was recommended that milk be subjected to boiling
treatment to produce best quality curd.
Sensory: The chilled curd (5°C) was served to a panel of seven judges and its
colour and appearance, flavor, body and texture and overall acceptance were
evaluated on 9- point Hedonic scale (Amerine et al., 1965). The sensory
evaluation was conducted in Sensory Evaluation Laboratory of the Institute under
fluorescent lights. The sensory acceptance data were tabulated by taking average
of scores awarded by all the judges for different treatments in three replications.
Acidity: The acidity of the curd samples was analyzed by BIS method and
expressed as per cent lactic acid (Bureau of Indian Standards, 1981).
Rheological: Firmness, consistency and viscosity of curd are important
rheological or textural parameters that govern the quality of curd. These attributes
can be measured objectively by Texture Analyzer or cone penetrometer. The
following method was employed for measuring firmness, consistency and index
of viscosity by Texture Analyzer (Stable Microsystems, UK). The working of
Texture Analyser is based on the principle that a cylindrical steel probe penetrates
into the curd samples and experiences resistance during the penetration. The
resistance offered by the curd sample (5ºC) during the penetration of the probe up
to a specified distance is recorded as firmness of curd.
Starter cultures are available in Indian market for curd preparation. Starter
culture JAMA and Yoflex (CHR Hansen, Denmark) and FlavoGard (Danisco Dupont,
Copenhagen) collected from sources and local distributors for comparative studies on
performance for curd preparation. Culture packs were equally diluted in milk and were
inoculated in conditions which were maintained similar for both self isolated and market
starters.
The conditions provided were: Milk FAT 6%, Milk SNF 8.5%, Inoculation temperature
42° C, Incubation temperature 42° C, pH check 3-6 hours.
Parameters observed
• Gel formation
• Cut ability
• Creaminess
• Texture
• Taste
• Acidity
• Mouth feel
• Water separation
• Shelf life
3.9 COMMERCIAL UP-SCALING TRIALS
FERMENTATION WAS CARRIED OUT AT 200RPM & 40°C FOR 10-12 HOURS
FERMENTATION WAS CARRIED OUT AT 200rpm & 40°C FOR 10-12 HOURS
Streptococcus thermophilus Isolation (STI) agar, M 17 agar and MRS agar were
employed as selective media for isolation of lactic acid bacteria. 10 colonies were
randomly picked from different agar plates containing 20 to 200 lactic acid bacteria in
each isolation experiment and more than 500 isolation experiments were conducted by
serial dilution of different samples from different region. Plates were examined by eye,
and the different colony types were individually picked. They were propagated twice and
streaked on the selective media to obtain cultures. Gram positive and catalase negative
cultures were maintained on selective media slants for further studies while others were
discarded. A total of 128 isolates of LAB were isolated from curd, ripen grapes, cow
milk, buffalo milk, camel milk, sheep milk and goat milk. Initially, the isolated strains
were named according to their origin. For example; thirty seven isolates were isolated
from curd were named as C (n), twenty two from goat milk were named as G (n), twenty
eight from buffalo milk were named B (n), Twelve from cow milk were named CW (n),
seven from camel milk were named CAM (n), six from grapes were named GP (n),
sixteen from sheep milk were named S (n), respectively.
4.1.2 Selection of LAB for curd trials and lactic acid production
All the isolated LAB strains were subjected to study their ability to coagulate milk
to produce curd. Isolated 128 isolates were maintained in MRS, M17 and STI broth
depending upon their original selective media of isolation at 32, 37 and 45°C temperature
in orbital shaker incubator at 150 rpm for 24 hours. Pellets of the isolates were collected
by centrifugation at 4°C in cooling centrifuge at 5000 rpm for 10 minutes followed by
washing with saline water and supernatant was discarded. 300 mg of fresh cell mass was
inoculated in 300 mL of pasteurized milk (6% FAT, 8.5% SNF) which was allowed to
cool up to 42°C before inoculation. The experiment was carried out in triplicates. After
six hours of incubation, pH was recorded (Table 4.1) for each isolate and potent strains
were selected for further experiments. The concentrations of lactic acid were determined
from the inoculated broth medium after 24 hours of incubation. A 10 mL sample was
collected during fermentation aseptically produced from 100 mg of sugar. Centrifugation
of fermented broth samples was carried out at several intervals at 12000 RPM for 10
minutes and supernatant was analyzed by HPLC. The cultured medium was filtered
through 0.45 µm membrane filter. Organic acids were analyzed by HPLC (Merck–
Hitachi). Five microliters of the sample was injected into the HPLC system equipped
with an Aminex HPX-87 H column and RI detector. The column temperature was
maintained at 65ºC. The mobile phase was 10 mM H2SO4 at flow rate of 0.6 mL/min
(Sharma et al., 2013; Thang and Novalin, 2008). Isolates with tendency to ferment sugar
into lactic acid efficiently were further allowed to multiply individually and
concentrations of lactic acid productivity was determined (Table 4.1) by using HPLC and
the yield was calculated by folowing equation.
It was observed that 32 isolates could produce high yields of lactic acid (more
than 75%) with pH drop to 4.22 - 4.47 after six hours of incubation (Table 4.1). These 32
isolates were also identified for their better milk coagulating properties, fine texture and
taste of the final curd, whereas other 96 isolates may be classified as hetero-fermentative
LAB because of their low yield of lactic acid production. As a result, 32 isolates showing
high product yield were selected for subsequent characterization. However, they could be
readily distinguished by microscopic examination. Identification of strains was further
investigated according to their morphological, cultural, physiological, and biochemical
characteristics by the procedures described in the Bergey’s Manual of Systematic
Bacteriology (Holt et al., 1994).
Table: 4.1 Percentage lactic acid yield and pH drop results of the 128 isolates
Legend: profuse growth (+++), good growth (++), moderate to poor growth or a positive
reaction (+), no growth or no reaction (-).
After continuous sub-culturing of the selected strains, few strains showed poor cell
viability (<10% cell turbidity in broth) which were discarded. For further consideration,
isolates with gas production were discarded because they deemed to be hetero-
fermentative. Homo-fermentative strains with >40% viability on sub-culturing were
selected for further studies and designated according to their morphology. Isolates from
curd C10, C16, C21, C22 and C32 with morphology of cocci in chains (Streptococcus)
were re-designated as ST-100, ST-200, ST-300, ST-400 and ST-500 respectively while as
isolates from goat milk G6 and G18, from buffalo milk B20 were re-designated as ST-
600, ST-700 and ST-800 respectively. Isolates from curd C18 and from camel milk
CAM7 with rod shaped morphology were considered Lactobacillus and re-designated as
LB-100 and LB-200 respectively (Figure 4.2, 4.3).
4.1.3.1 Morphology
Table 4.3 showed general characteristics of the 10 isolated strains selected for
further studies. Most strains possessed cocci or short rods shape with their cell size
ranging from 0.2-1.0 μm. Morphological configuration showed white, creamy, and
circular colonies with entire margin. Surface was observed smooth with raised elevation.
All the isolates were subjected to Gram staining and they were examined under light
microscope. They stained blue- purple hence they all were Gram positive bacteria and
none of the isolate showed catalase activity. For physiological characterization most of
the strains grew well between 35-37°C except LB-100 growing well at 32° C only. ST-
500 showed a wide range of temperature compatibility from 32° C to 50° C. The ability to
grow at high temperature is a desirable trait as this could translate to increased rate of
growth and lactic acid production beneficial for fast curdling of milk and a high
fermentation temperature could reduce the chances of contamination by other
microorganisms (Mohd Adnan and Tan, 2007). Further, ST-400 and ST-500 were found
to tolerat to low pH range from 4.2-5.2. Growth at low pH for a starter is a bit dual
impact property as low pH may resist the growth of other pathogenic bacteria but can
also effect the shelf life and taste of the product due to continuous production of lactic
acid.
ST-500 was the only isolate found to tolerate 3% NaCl. Ability to grow at 3% and 5%
NaCl concentrations were tested for all isolates and only three of them were found to be
resistant to 3% NaCl concentration. Bacteria adapt to hyper-osmolarity by accumulation,
synthesis and transport of compatible solutes to restore turgor. It was well documented
that osmo-protectants (thermo-protection) could play additional positive role and
beneficial effects have been demonstrated on membrane integrity, protein folding and
stability, (Baliarda et al., 2003). Accumulation of osmo-protectants or compatible solutes
in the present studies had been considered to be the potential lactic acid bacteria.
Similarly, a higher tolerance to lactic acid was a desirable trait for an industrial strain of
LAB as it could produce more lactic acid in the fermentation broth without adversely
affecting itself.
The strain ST-500 grew at higher NaCl concentration compared with the other
isolates (Table 4.3). During fermentation process, lactic acid was produced by the cells
whereas alkali was pumped into the broth to prevent excessive reduction in pH. The free
acid would be converted to its salt lactate which would increase the osmotic pressure on
the cell. Therefore, a LAB strain with high osmo-tolerance would be desirable for
industrial application. These rapid screening processes resulted in domination of ST-500
in a wide range of tested conditions. Homo-fermentative lactic acid bacteria grew
substantially faster than other bacteria present in the same ecological niche. The higher
growth rate of lactic acid bacteria is a result of their simple primary metabolism, and their
ability in adaptation to rich environments
Table: 4.3 Complete morphological and phenotypical analysis of 10 selected strains
Code of Isolates
COLONY
MORPHOLOGY
Configuration Circular Circular Circular Circular Circular
Margin Entire Entire Entire Entire Entire
Elevation Raised Raised Raised Raised Raised
Surface Smooth Smooth Smooth Smooth Smooth
Pigment Cream Cream White White White
Opacity Opaque Opaque Opaque Opaque Opaque
COLONY
MORPHOLOGY
Configuration Circular Circular Circular Circular Circular
Margin Entire Entire Entire Entire Entire
Elevation Raised Raised Raised Raised Raised
Surface Smooth Smooth Smooth Smooth Smooth
Pigment Cream Cream White White Cream
Opacity Opaque Opaque Opaque Opaque Opaque
PHENOTYPIC
CHARACTERSTICS
Gram staining + + + + +
Spore Formation - - - - -
Motility - - - - -
Catalase Activity - - - - -
Fermentation Type Homo Homo Homo Homo Homo
Glucose Fermentation + + + + +
Nitrate Reduction - - - - -
Casein Hydrolysis + + + + -
Growth at 10o C - - - - -
Growth at 32o C - - - + +
Growth at 37°C + + + - +
Growth at 45o C + - - - -
Growth at 50 o C - - - - -
Growth with 1.5% Nacl + - + - -
Growth with 3% Nacl - - - + +
Growth with 5% Nacl - - - - +
At pH 4.2 - - - + -
At pH 5.2 + + + + +
At pH 6.2 + + + + +
Figure 4.3: Microscopic views of ST-200 (A), ST-300(B), ST-400(C), ST-500(D),
LB-100(E) and LB-200(F)
4.2) BIOCHEMICAL CHARACTERIZATION OF ISOLATES
The type of carbohydrate and microorganism present in are the important criteria
in the resulting product. They contribute to the aroma, flavor development, and food
preservation (pH drop). The capabilities of LAB to grow at the expense of carbohydrates
and to produce fast acidification (lactic acid) are two criteria for the selection of suitable
candidates for starter strains. From a technological standpoint these criteria are important
for the inhibition of contaminating microflora, consistency of the final product, and
reduction in production time. Detailed physiological characterization of the sugar
fermentation pattern is an important requisite to classify new strains and select those
appropriate for maximal acidification or biomass production in a given carbon source.
Conventional techniques for studying sugar metabolism are usually very time-consuming,
needing long incubation periods and precise standard conditions. For identification of the
lactic acid bacteria, API 50 CH test kit (bioMerieuxΤΜ) was used. The API 50 CHL test
kit is a standard system associated with the study of the assimilation-fermentation of 49
different compounds (plus one control) as per manufacturer’s guideline. Lactic acid
bacteria could live in the absence as well as in the presence of the atmospheric oxygen
indicating that they are facultative anaerobes. All the isolates were tested against 42
sugars for their fermentation property (Table 4.4) and results obtained were used for
other purpose, for example, epidemiological grouping into types of the lactic acid
bacteria, taxonomical analysis of a group of lactic acid bacteria, and classification of an
unknown bacterial population into homogeneous groups. Among all the 42 sugars, almost
all the selected strains were observed positive fermentation against sucrose, lactose,
dextrose, maltose and fructose and negative against sorbitol, trehalose, raffinose, salicin,
glycogen, starch etc (Table 4.4)
Table 4.4 Fermentation results of selected isolates from different sugars
Code of Isolates
D-arabinose - - - - -
L-arabinose - - - - -
D-xylose - - - - -
L-xylose - - - - -
D-galactose + + + + +
D-glucose + + + + +
D-fructose + + + + +
D-mannose - - - - -
D-mannitol + + + + +
D-sorbitol - - - - -
D-cellobiose + + + + +
D-sucrose + - - + +
D-trehalose - - - - -
D-melibiose + - + - -
D-lactose + + + + +
D-maltose - - - - -
D-raffinose - - - + +
D-melezitose + + + + +
D-turanose + + + + +
D-fucose - - - - -
D-arabitol - - - - -
L-arabitol - - - - -
Code of Isolates
Dulcitol - - - - -
Erythritol - - - - -
Inositol + + - - -
Amygdalin - - - - -
Arbutin - - - - -
Glycerol - - - - -
Esculin + + + + +
Salicin - - - - -
Inulin + + + + +
Glycogen - - - - -
Xylitol + + + + +
Gentiobiose + - + - -
L-rhamnose - - - - -
N-acetylglucosamine + - + - -
Amidon (starch) - - - - -
Potassium gluconate - - - - -
potassium 2- - + - - -
ketogluconate
potassium 5- - - - - -
ketogluconate
Methyl-αD- - - - - -
Mannopyranoside
Methyl-αD- - - - - -
Glucopyranoside
Continued.
Sugars ST-600 ST-700 ST-800 LB-100 LB-200
D-arabinose - - - - -
L-arabinose - - - - -
D-xylose - - - - -
L-xylose - - - - -
D-galactose + + + + +
D-glucose + + + + +
D-fructose + + + + +
D-mannose - - - - -
D-mannitol + + + + +
D-sorbitol - - - - -
D-cellobiose + + + + +
D-sucrose + - - + +
D-trehalose - - - - -
D-melibiose + - + - -
D-lactose + + + + +
D-maltose - - - - -
D-raffinose - - - + +
D-melezitose + + + + +
D-turanose + + + + +
D-fucose - - - - -
D-arabitol - - - - -
L-arabitol - - - - -
` Continued
.
Code of Isolates
Sugars ST-600 ST-700 ST-800 LB-100 LB-200
Dulcitol - - - - -
Erythritol - - - - -
Inositol - - - + +
Amygdalin - - - - -
Arbutin - - - - -
Glycerol - - - - -
Esculin + + + + +
Salicin - - - - -
Inulin + + + + +
Glycogen - - - - -
Xylitol + + + + +
Gentiobiose + - + - -
L-rhamnose - - - - -
N-acetylglucosamine + - + - -
Amidon (starch) - - - - -
Potassium gluconate - - - - -
potassium 2- - + - - -
ketogluconate
potassium 5- - - - - -
ketogluconate
Methyl-αD- - - - - -
Mannopyranoside
Methyl-αD- - - - - -
Glucopyranoside
Legend: positive (+), negative (-).
Enzymatic activities of all the selected isolates were studied as there are few enzymes
from lactic acid bacteria having many dairy applications including lactase responsible for
the treatment of lactose intolerance. Lactase activity was observed in five out of ten
strains and all the lactase positive strains were streptococci. Phosphatase and glycosidase
activities were observed negative for all the strains (Table 4.5) as was also observed by
Tamang et al., 2007. They were all esculin hydrolase and arylamidase positive.
CODE OF ISOLATES
ST-
ENZYME ASSAYS ST-100 ST-200 ST-300 ST-400
500
PHOS (PHOSPHATASE) - - - - -
BGAL (BETA-
- - - - -
GALACTOSIDASE)
BMAN (BETA-
- - - - -
MANNOSIDASE)
LACTASE + + - - +
ProA (L-Proline
- - - - -
ARYLAMIDASE)
LeuA (Leucine
+ + - - +
ARYLAMIDASE)
TyrA (Tyrosine
+ - - - -
ARYLAMIDASE)
ESC (ESCULIN
+ + + + +
Hydrolase)
APPA (Ala-Phe-Pro-
+ + + + +
ARYLAMIDASE)
NAG (N-ACETYL-D-
- - - - -
GLUCOSAMINE)
BMAN (BETA-
- - - - -
MANNOSIDASE)
ProA (L-Proline
- - - - -
ARYLAMIDASE)
URE (UREASE) - - - - -
CODE OF ISOLATES
BGAL (BETA-
- - - - -
GALACTOSIDASE)
BMAN (BETA-
- - - - -
MANNOSIDASE)
LACTASE + + - - -
ProA (L-Proline
- - - - -
ARYLAMIDASE)
LeuA (Leucine
+ + - - +
ARYLAMIDASE)
TyrA (Tyrosine
+ - - - -
ARYLAMIDASE)
ESC (ESCULIN
+ + + + +
Hydrolase)
APPA (Ala-Phe-Pro-
+ + + + +
ARYLAMIDASE)
NAG (N-ACETYL-D-
- - - - -
GLUCOSAMINE)
BMAN (BETA-
- - - - -
MANNOSIDASE)
ProA (L-Proline
- - - - -
ARYLAMIDASE)
URE (UREASE) - - - - -
ORIGINAL
COLOR OF POSITIVE NEGATIVE
S.N. TEST PRINCLIPLE
THE REACTION REACTION
MEDIUM
Detects acetonin Colourless/Light Pinkish Colourless/Slight
1 VP
production yellow red/Red copper
Esculin Detects acetonin
2 Cream Black Cream
Hydrolysis production
Detects PYR enzyme
3 PYR Cream Cherry Red Cream
activity
Detects β -galactosidase
4 ONPG Colourless Yellow Colourless
activity
No change in
Arginine Detects arginine Olive green to
5 dark Purple colour or yellow
utilization decarboxylation light purple
colour
Carbohydrate
6 Glucose Pinkish red/Red Yellow Red/Pinkish red
Ulilization
Carbohydrate
7 Lactose Pinkish red/Red Yellow Red/Pinkish red
Ulilization
Carbohydrate
8 Arabinose Pinkish red/Red Yellow Red/Pinkish red
Ulilization
Carbohydrate
9 Sucrose Pinkish red/Red Yellow Red/Pinkish red
Ulilization
Carbohydrate
10 Sorbitol Pinkish red/Red Yellow Red/Pinkish red
Ulilization
Carbohydrate
11 Mannitol Pinkish red/Red Yellow Red/Pinkish red
Ulilization
Carbohydrate
12 Raffinose Pinkish red/Red Yellow Red/Pinkish red
Ulilization
CODE OF ISOLATES
CODE OF ISOLATES
Casein hydrolysis was also conducted in which skim milk powder was used as
casein source; all the strains produced a clear zone around the area of bacterial contact
indicating the presence of caseinase enzyme. Starch hydrolyzing test was also conducted
in which maize and potato starch were used along with nitrogen and carbon sources to
check the hydrolysis. All the selected isolates were negative against starch hydrolysis.
The strains were urease and catalase negative indicating that the strains belong to LAB
origin.
Chapter 5
Molecular Characterization
Despite the wide application of lactic acid bacteria, they are currently
differentiated by the determination of DNA-DNA similarity, their G+C content and, by
physiological characterization (Tanasupawat et al., 1993). Biochemical identification is
not accurate for determining the genotypic differences of microorganisms. The molecular
technique (genotypic characterization) has been applied to characterize the LAB bacteria.
Molecular technique is fast, practical and accurate. The use of 16S rRNA gene sequences
to study bacterial phylogeny and taxonomy has been by far the most common
housekeeping genetic marker used for a number of reasons. These reasons include (i) its
presence in almost all bacteria, often existing as a multigene family, or operons; (ii) the
function of the 16S rRNA gene over time has not changed, suggesting that random
sequence changes are a more accurate measure of time (evolution); and (iii) the 16S
rRNA gene (1,500 bp) is large enough for informatics purposes. A preliminary estimation
of taxonomic distribution was used as criteria in the selection for further investigations.
Identification by using selective PCR amplification and subsequent sequencing of the
16S rDNA genes directly from the isolated LAB was carried out. Ten selected strains
were identified on the basis of their 16S rDNA homologies with entries in the GenBank-
EMBL databases used as an additional taxonomic criterion for distinguishing these
bacteria from other members of the family (genotypic characterization). DNA were
extracted, and used as template for PCR amplification (Figure 5.1). PCR products were
detected for the partial nucleotide sequences. 16S rDNA gene sequences have been
performed to infer organismal phylogeny reflecting the organismal evolutionary history.
DNA quantity and purity of the sample isolates was estimated using nanodrop
spectrophotometer (Table 5.1).
Figure: 5.1 Digest results of the 16s rDNA genes of representative isolates along
with the reference. Sample IDs of the different lanes are mentioned on
the top of the lane along with the last lane of Ladder (L) Hind III
digested lambda ladder.
Table: 5.1 Quality Control reports of all of sample isolates. DNA Concentration and
purity of samples estimated using nanodrop spectrophotometer.
ABSORBA
ABSORBANC DNA TOTAL QC
S. SAMPLE NCE QC QC
E VALUE CONCENTRA YIELD in INTEGRIT
No NAME VALUE PURITY YIELD
260/230 TION ng/µl ng Y
. 260/280
Query 27 ATA-ATGC-AGTAGAACGCTGAAGAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGG 84
||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 17864 ATACATGCAAGTAGAACGCTGAAGAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGG
17923
Query 30 ATA-ATGCAAGTAGAACGCTGAAGAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGG 88
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 17864 ATACATGCAAGTAGAACGCTGAAGAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGG
17923
Query 8 TGTAAGTC-AG-ACCGGTGTGAGAGTGGAA-GTTCAC-TTG-GACGGTAGC-TA-CAG-A 59
|||||||| || || ||||||||||||||| |||||| || ||||||||| || ||| |
Sbjct 372 TGTAAGTCAAGAACGGGTGTGAGAGTGGAAAGTTCACACTGTGACGGTAGCTTACCAGAA 431
EZTAXON RESULTS
Pairwise Diff/Total megaBLAST BLASTN
Rank Name/Title Authors Strain Accession
Similarity nt score score
Streptococcus (Orla-Jensen
ATCC
1 salivarius subsp. 1919) Farrow AY188354 96.660 34/1018 1679 1592
19258(T)
thermophilus and Collins 1984
Streptococcus Whiley and ATCC
2 GL831116 96.464 36/1018 1671 1584
vestibularis Hardie 1988 49124(T)
Streptococcus
Andrewes and ATCC
3 salivarius subsp. AY188352 96.464 36/1018 1671 1584
Horder 1906 7073(T)
salivarius
ATCC
Streptococcus Kawamura et al.
4 700780( GL732464 94.401 57/1018 1514 1461
peroris 1998
T)
Streptococcus 682-
5 Vela et al. 2011 FN643224 94.401 57/1018 1493 1429
porcorum 03(T)
5.1.5 16s rDNA sequencing results for ST-500
SANGER TRACE FOR ST-500 PRIMER P1 (AGAGTTTGATCCTGGCTCAG)
Best BLAST Hit Results Streptococcus thermophilus MN-ZLW-002
Query 1 ATACATGCAAGTAGAACGCTGAAGACTTTTCGCTTGGCTAAAGTTGGAAGAAGTTGCGAA 60
|||||||||||||||||||||||||||||| |||| |||||||||||||| |||||||||
Sbjct 24 ATACATGCAAGTAGAACGCTGAAGACTTTTAGCTT-GCTAAAGTTGGAAG-AGTTGCGAA 81
mega
Pairwise BLASTN
Rank Name/Title Authors Strain Accession Diff/Total nt BLAST
Similarity score
score
Query 5 GGGCGTGCCTATACATGCAGTAGAACGCTGAAGAGAGGAGCTTGCTCTTCTTGGATGAGT 64
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 7 GGGCGTG-CTATACATGCAGTAGAACGCTGAAGAGAGGAGCTTGCTCTTCTTGGATGAGT 65
Query 38 ACGCTGAGAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGGGTGAGTAACGCGTAGG 97
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 30 ACGCTGAGAGAGGAGCTTGCTCTTCTTGGATGAGTTGCGAACGGGTGAGTAACGCGTAGG 89
Query 1 CTTTGGGCATTGCAGACTCCCATGGTGTGACGGGCGGTGTGTACAAGGCCCGGGAACGTA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1439 CTTTGGGCATTGCAGACTCCCATGGTGTGACGGGCGGTGTGTACAAGGCCCGGGAACGTA 1380
Query 1 TATCCCACCGACTTTGGGCATTGCAAACTTCCATGGGGGGACGGGCGGGGTGTACAAGGC 60
||||||||||||||||||||||||| |||||||||| | ||||||||| |||||||||||
Sbjct 1466 TATCCCACCGACTTTGGGCATTGCAGACTTCCATGGTGTGACGGGCGGTGTGTACAAGGC 1407
PERCENTAGE QUERY
STRAIN STRAIN ACCESSION
S. No.
DESIGNATION HOMOLOGY SIMILARITY COVER
Streptococcus
1 ST-100 thermophilus strain 99% 96% NR 042778.1
ATCC 19258
Streptococcus
2 ST-200 thermophilus strain MN- 99% 96% NR 074827.1
ZLW-002
Streptococcus
3 ST-300 thermophilus strain MN- 99% 97% NR 074827.1
ZLW-002
Streptococcus
salivarius subsp
4 ST-400
thermophilus strain
96.66% 95% AY188354
ATCC 19258(T)
Streptococcus
5 ST-500 thermophilus strain MN- 99% 97% NR 074827.1
ZLW-002
Streptococcus
6 ST-600
infantarius subsp. coli
99.92% 97% AF429763
Streptococcus
7 ST-700 thermophilus strain 99% 98% NR 042778.1
ATCC 19258
Streptococcus
8 ST-800 thermophilus 100% 97% KF286609.1
CGLBL208
Lactobacillus
9 LB-100 acidophilus NCFM 99% 99% NR 075045.1
strain
Lactobacillus
10 LB-200 delbrueckii subsp. 96% 100% NR 029106.1
indicus NCC725
Figure 5.3 Results of phylogenetic analysis of ST-400, ST-500 and ST-700 in the
form of Phylogenetic tree
Figure 5.4 Results of phylogenetic analysis of LB-100 and LB-200 in the form of
Phylogenetic tree
ST-200, ST-300 and ST-500 were found similar to Streptococcus thermophilus
strain MN-ZLW-002 (accession NR 074827.1) with percentage similarity of 99% and
query cover of 97% (Table 5.2). The phylogenetic trees for all the isolates were prepared
(Figure 5.2, 5.3 and 5.4). ST-100 (96%), ST-200 (96%) and ST-700 (97%) were found
similar Streptococcus thermophilus strain ATCC 19258 (accession NR 042778.1) with
maximum query cover of 98%. ST-600 was identified as Streptococcus infantarius subsp.
coli (99.92% similarity) and was excluded form further studies. Isolate LB-100 was
identified as Lactobacillus acidophilus and observed 99% similar with Lactobacillus
acidophilus NCFM strain (accession NR 075045.1). LB-200 was identified as L. indicus
with similarty of 96% with Lactobacillus delbrueckii subsp. indicus NCC725.
ST-500 was selected for whole genome sequencing on the basis of its dairy
applications and efficient performance as starter for curd and yogurt. The strain was
submitted to NCIM (National Collection of Industrial Microorganisms) facility, Pune,
under safe deposit agreement with accession number NCIM 5539.
Total genomic DNA of the selected strain was prepared essentially by using
Cardinal et al., 1994 procedure. DNA (214 ng/µl) was subjected to PCR utilizing primer
1 (AGAGTTTGATCCTGGCTCAG) and primer 2 BOX A1R (TACGGTTACCTTGTTACGACTT) as per
procedure described by Versalovic et al.1994.
1.6 ug of Qubit quantified DNA was sonicated for 300sec on Covaris. 950 ng of DNA
was taken for library preparation. End-repair and adapter ligation was done according to
the protocol. The sample was bar coded at this step. The sample was cleaned using
Ampure XP beads. Sample was size selected using 2% Low melting agarose gel. The gel
purified sample was amplified as per the protocol. The amplified product was cleaned up
using Ampure XP beads. The sample was run on Bioanalyzer HS chip to check the
distribution and was quantified using Qubit Fluorometer. A final yield of 1567.2 pg was
obtained (Table 5.3). WGS ePCR results showed the highest peak range of 10380-12152
bp (Figure 5.5).
No. of Chromosomes/Transcripts NA
Analysis Steps:
QC and Raw data processing
B block trimming NO
Alignment Information
GOAL:-
To identify lactic acid genes (at protein level) in the sequenced sample ST500
METHODS:-
1 Predicted proteins of Sample ST500 were subjected to homology search
(BLAST) against Uniprot bacterial proteins (reviewed) involved in lactic acid
metabolism.
2 BLAST output were filtered to pass 30% Identity and 30% Query*/Subject**
coverage
*Query: Predicted proteins
**Subject: Bacterial Lactic Acid proteins (Uniprot reviewed)
Results:
Total Predicted Protein 2912
Total Predicted proteins passing the filters 907
Chapter 6
Media Standardization
Figure 6.1: (B) Influence of carbon sources on lactic acid fermentation for mass
cell production supplied with modified MRS broth and 2% of the
selected carbon sources. All the carbon sources were tested indiviually
with their 20g/L content in media.
Figure 6.1: (C) Influence of carbon sources on lactic acid fermentation for mass
cell production supplied with modified MRS broth and 3% of the
selected carbon sources. All the carbon sources were tested indiviually
with their 30g/L content in media
Figure 6.1: (D) Influence of carbon sources on lactic acid fermentation for mass
cell production supplied with modified MRS broth and 4% of the
selected carbon sources. All the carbon sources were tested indiviually
with their 40g/L content in media
Prepared media was inoculated and incubated for 24 hours at 42 °C. The
experiment was conducted in duplicates and media samples were tested after 24 hours,
fresh cell mass calculation, optical density and percentage yield of lactic acid was
recorded. The maximum cell growth and the highest lactic acid concentration were
obtained after 24 h of the fermentation time. These experiments were operated with non
controlled pH: therefore; pH of fermentation broth rapidly decreased due to accumulation
of lactic acid. Interestingly, sucrose showed better results than lactose and other carbon
sources with more than 2% fresh cell mass and 34% lactic acid yield (Figure 6.1C).
Sucrose was followed by lactose with 1.6% cell mass yield and 26% lactic acid yield.
Other carbon sources including dextrose, xylose, maltose and fructose showed 1.4%,
0.8%, 1.1% and 1.2% cell mass yield, respectively.
All the carbon sources were increased in quantity with modified MRS broth. The
experiments were conducted in duplicates and observed that sucrose showed much better
result compared to other carbon sources. Both fresh cell mass yield and lactic acid yield
was increased (Figure 6.1D). There was a slight fall in growth in trials when there was
more than 4% sucrose was added in media. A fresh cell mass yield of 3.4% was achieved
with 2% sucrose content which was increased to 4.5% with 3% sucrose and 5.2% with
4% sucrose content in media. Percentage concentration of lactic acid was also recorded
and a symmetrical increase was observed with the increase in cell mass viz. 44%, 55%
and 81% lactic acid with 2, 3 and 4% sucrose content, respectively. Lactose also played a
crucial role in maintaining viable cell mass with 2.3%, 3.1%, and 3.8% fresh cell mass
yield with 2, 3 and 4% lactose in media. Other carbon sources were found to be
unsuitable for fast multiplication and fermentation of S. thermophilus. The percentage
cell mass yield for xylose, dextrose, fructose and maltose was 1.8%, 2.9%, 2.8% and
2.7%, respectively. As a result, the suitable carbon source for (ST-500) S. thermophilus
was in the order of sucrose > lactose > dextrose > fructose > maltose > xylose
respectively (Figure 6.1D).
6.2.2 Effect of Nitrogen Sources
The LAB are able to respond to changes in nitrogen availability by regulating the
activity of the proteolytic system to ensure proper nitrogen balance in the cell. It was
found that the synthesis of many exoproteins influenced, in part at least, by the level of
individual nutrients in the extracellular environment (Rollan et al., 1998). Cell
multiplication rate and fresh weight was observed higher in tryptone (casein enzyme
hydrolysate) and casein peptone compared to other nitrogen sources. A cell mass yield of
4.1% with 1% tryptone was observed which was increased to 5.1% with 2%, 6% with 3%
and 7.6% with 4% tryptone in media, (Figure 6.2 D) while casein peptone produced
3.4%, 4.4%, 5.3% and 6.6% with 1, 2, 3 and 4% concentration, respectively.
Figure 6.2: (A) Effect of nitrogen sources on lactic acid fermentation for mass cell
production supplied with modified MRS broth and 1% of the selected
nitrogen sources. All the nitrogen sources were tested indiviually with
their 10g/L content in media
Figure 6.2: (B) Effect of nitrogen sources on lactic acid fermentation for mass cell
production of supplied with modified MRS broth and 2% of the
selected nitrogen sources. All the nitrogen sources were tested
indiviually with their 20g/L content in media
Figure 6.2: (C) Effect of nitrogen sources on lactic acid fermentation for mass cell
production supplied with modified MRS broth and 3% of the selected
nitrogen sources. All the nitrogen sources were tested indiviually with
their 30g/L content in media
Figure 6.2: (D) Effect of nitrogen sources on lactic acid fermentation for mass cell
production supplied with modified MRS broth and 4% of the selected
nitrogen sources. All the nitrogen sources were tested indiviually with
their 40 g/L content in media
This reflected the complex nutritional demand of this fastidious lactic acid
bacterium due to its limited biosynthesis capacity. The percentage cell mass yield
observed for proteose peptone, meat extract, beef extract and soya peptone was 4%,
4.1%, 4.6% and 4.3%, respectively. The suitable carbon source for (ST-500) S.
thermophilus was in the order of tryptone > casein peptone > beef extract > meat extract
> soya peptone > proteose peptone respectively (Figure 62 D).
The protein concentrations were autoclaved separately and mixed at the time of
inoculation with the other ingredients of modified MRS. Selected protein sources were:
whey proteins concentrate, sweet whey powder, soy protein, wheat peptones, casein
proteins and vegetable casein protein. 2% and 4% quantity was selected for all the protein
sources and results of the study revealed that whey protein concentrate is a much better
option to carry forward followed by casein protein showing good results with 2% content
in media (Figure 6.3A). Whey protein concentrate showed 4.5% cell mass yield and 30%
lactic acid yield with 2% concentration and 5.7% cell mass yield and 40% lactic acid
yield with 4% concentration in medium. Casein protein showed 4.8% cell mass yield and
34% lactic acid yield with 2% concentration and 5.6% cell mass yield and 39% lactic
acid yield with 4% concentration in medium.
Figure 6.3: (A) Effect of vegetable protein and milk protein sources on lactic acid
fermentation for mass cell production supplied with modified MRS
broth and 2% of the selected sources. All the sources were tested
indiviually with their 20g/L content in media
Figure 6.3: (B) Effect of vegetable protein and milk protein sources on lactic acid
fermentation for mass cell production supplied with modified MRS
broth and 4% of the selected sources. All the sources were tested
indiviually with their 40g/L content in media
The percentage cell mass yield observed for sweet whey powder, soy protein,
wheat peptone, veg casein peptone was 4.8%, 4%, 2.2% and 3.7% respectively. As a
result, the suitable source for (ST-500) S. thermophilus was in the order of whey protein
concentrate > casein protein > sweet whey powder > soy protein > veg casein peptone >
wheat peptone respectively (Figure 6.3 B).
Figure 6.5: Influence of yeast extract (amino acid source) on lactic acid
fermentation for mass cell production supplied with modified MRS
broth and were tested indiviually with 1g/L to 5g/L content in media.
The increase of yeast extract concentration between 4 and 6 g/L had very little
effect on increasing the lactic acid production. Bacterial Cells were also provided with
sodium, potassium, ammonium and magnesium for their survival. Di potassium hydrogen
sulphate, hydrogen potassium suplhate, sodium acetate, tri-ammonium citrate,
magnesium sulphate, manganous sulphate were added to modified MRS broth in different
concentrations. Cell mass of 4.6% along with lactic acid percentage of 60% was obtained
from 5 g/L sodium acetate followed by 2g/L K2HPO4 with 4.5% fresh cell mass yield
along with 55% of lactic acid yield (Figure 6.4). It was observed that all the buffers had
its own role in media with different conditions provided to the cells and media. Based on
the experimental research conducted on different ingredients in different concentrations,
media formulations were designed and tested for combined action of ingredients with
standardized concentrations.
Lactic acid
Media Fresh Cell
Nutrient Supplementation (g/L) concentration
Designation Mass yield g/L
g/L
Yeast Extract 5g/L, Tryptone 20g/L,
1 61.22 ± 0.15 78.62 ± 0.16
Sucrose 30g/L, K2HPO4 2g/L
Yeast Extract 5g/L, Tryptone 20g/L,
2 Sucrose 30g/L, Lactose 10g/L, 63.67 ± 0.22 79.99 ± 0.19
K2HPO4 2g/L
Yeast Extract 5g/L, Tryptone 20g/L,
3 Sucrose 30g/L, Lactose 10g/L, 64.29 ± 0.13 81.22 ± 0.23
Sodium acetate 5g/L, K2HPO4 2g/L
Yeast Extract 5g/L, Tryptone 20g/L,
Sucrose 30g/L, Lactose 10g/L, WPC
4 53.78 ± 0.11 67.47 ± 0.15
10g/L, Sodium acetate 5g/L,
K2HPO4 2g/L
Yeast Extract 5g/L, Tryptone 20g/L,
Sucrose 40g/L, Lactose 15g/L,
5 73.37 ± 0.26 88.34 ± 0.07
Sodium acetate 5g/L, K2HPO4 2g/L,
MgSO4 0.1g/L.
Yeast Extract 5g/L, Tryptone 20g/L,
Sucrose 40g/L, Lactose 20g/L,
6 68.26 ± 0.11 84.32 ± 0.17
Sodium acetate 5g/L, K2HPO4 2g/L,
MnSO4 0.05g/L
Media 5 was selected for further studies as the output observed from this media
was far better compared to other minimal media and readymade media available in
market. Media 5 was also observed better compared to MRS and M17 broth media for the
identified isolated strain.
Figure 6.6: The influence of temperature on cell mass yield on self designed
Media 5 by Streptococcus thermophilus NCIM 5539
The optimum temperature and time for high cell mass yield was 42°C for 24
hours on the basis of cell mass obtained by centrifugation and absorbance of the samples.
Temperature is the most important factor on nutrient utilization and cell viability. Higher
temperature stimulated the rapid growth of lactic acid bacteria resulting in a rapid decline
in pH, and consequently suppressed the growth of S. thermophilus. Although, S.
thermophilus could grow at 50 °C, the optimum temperatures for its growth were
observed between 40-45 °C. Some literatures reported that the rate of reaction for
microorganism increases with increasing temperature until a limiting maximum
temperature is reached (55°C), after which the growth rate decreases very rapidly (Peleg,
1996).
However, when the temperature of the medium is above or below that required for
optimum growth, the microbial activity is substantially reduced and the organisms may
eventually die. The pH value of the fermentation broth decreased from 6.0 to values less
than 4.5 as fermentation proceeded reaching conditions unfavorable for cell growth. Cell
population was a measure of the increase in biomass over time and it was determined
from the exponential phase. Growth rate was one important way of expressing the
relative ecological success of a species or strain in adapting to its natural environment.
The duration of exponential phase in cultures depended upon the size of the inoculums,
the growth rate and the capacity of the medium and culturing conditions to support cell
growth. At 37 °C and 42 °C, the yield and productivity of lactic acid were also similar.
The production yield and volumetric productivity were calculated with the time at the
exponential phase of the cell growth. It was, therefore, important that the fermentation
temperature must be maintained as stable as possible since bacteria grow optimally
within a narrow temperature range. In general, subsequent experiments were conducted at
42 °C in order to reduce the cost of electricity of the production process. For this reason,
the control of temperatures were necessary during lactic acid fermentation for lactic acid
production.
Figure 6.7: The influence of initial set point of pH on cell mass yield on self
designed Media 5 by Streptococcus thermophilus NCIM 5539
Agitation is important for adequate mixing, mass transfer and heat transfer,
respectively. It assists not only the mass transfer between the different phases presented
in the culture, but also maintains homogeneous chemical and physical conditions in the
culture by means of mixing, eliminating gradients of concentration. However, at high
agitation speed the biomass concentration may decrease because of cell damage, cell loss
by the impeller and shear force (Senthuran et al., 1999), while at low agitation speed, the
liquid or fermentation broth could not homogeneous mix well and the substrate could not
be utilized completely.
The effect of agitation speed on cell mass production were studied at three
different agitation speeds (100, 200, 300 rpm). The influence of cultivation factors on the
lactic acid fermentations was observed for cell growth, substrate and product
concentrations, respectively. 100 rpm agitation speed significantly affected the
fermentation performance.
(A)
(B)
(C)
Figure 6.9: Effect of agitation speed on the cell growth, reducing sugar
concentration and mass production by Streptococcus thermophilus
NCIM 5539: 100 rpm (A), 200 rpm (B), and 300 rpm (C).
Interest in the physiology of lactic acid bacteria has been stimulated by the
industrial importance of these bacteria and the potential use of genetic engineering in
strain optimization. For metabolic investigations, a defined growth medium for these
bacteria is desirable which (i) supports growth at a reasonably high rate and (ii) allows
for exponential growth over a wide range of cell concentrations. Fermentation medium
can represent almost 30% of the cost for a microbial fermentation (Hofvendahl and
Hahn-Hagerdal, 2000). Complex media commonly employed for growth of lactic acid
bacteria are not economically attractive due to their high amount of expensive nutrients
such as yeast extract, peptone and salts (Jensen and Hammer, 1993).
Cost of media ingredients is one of the major hurdles which are continuously
creating a barrier for dairy industries to launch their starter cultures in market. In current
study, it was observed that the isolated strains were not performing well on economical
ingredients of media. The cost of ingredients based on the composition of MRS or M17
was also too high. Himedia, India was selected for price comparison of media
ingredients because of its consistent product quality and easy availability. Few other
media ingredient vendors were also tested for their availability and price like
Both the media are not economically viable for commercial production of starter
culture. In order to reduce the production cost, the media was modified to increase cell
mass. Several experiments were conducted for optimization as per variation in methods
described in Chapter 5. We developed a medium, self optimized media MEDIA 5 (M5),
and the cost was calculated on the basis of prices/Kg of different ingradients from
Himedia (Table 6.3). The cost per ingredient provided in Himedia catalogue was for
laboratory scale experimental use only.
Table: 6.3 Costing of the designed media on the basis of ingredient prices available
with Himedia
Himedia was later contacted for their commercial prices. Surprisingly, the total cost per
litre for media 5 was reduced to almost 50% by new prices of ingredients from Himedia
(Table 6.4). Still other Indian suppliers of media ingredients were contacted for their
samples in order to reduce the cost of the media. Suppliers contacted were:
• Chaitanya Chemicals, Maharashtra, India
• Titan Biotech, Delhi, India
• Warkem Biotech, Mumbai, India
Samples from these companies were tested on the designed parameters for their
efficiency to produce cell mass along with the price evaluation and found that Warkem
Biotech, Mumbai, India has low commercial price with better quality of raw material. Per
Litre media cost from Warkem was around INR 55±2 with 60g/L fresh mass yield.
Table: 6.4 Costing of the designed media on the basis of commercial prices provided
by Himedia
The prices of media ingredients from Warkem Biotech, India were also evaluated
and implemented on the compositions of MRS and M17 media. Some difference was
observed between the cost/L of MRS and cost/L of media 5 (Figure 6.10) but huge
difference in overall fresh weight was observed in both media. The morphology and
characterization of ST-500 was also critically studied to notice the impact of new
ingredients and performance of the same strain in its dairy applications.
Figure 6.10: Price & Fresh cell mass weight g/L comparison of media from
different vendors.
Figure 6.11: Price & Fresh cell mass weight g/L comparison of media M17, MRS
and Media 5 from same vendor.
The overall performance of the strain ST-500 was studied with new nutritional
ingredients and it was observed that highest cell mass of 65g/L was obtained from
ingredients of pilot scale (Laboratory grade) due to their content purity. Price variation
will depend on the size and quality of packaging. Himedia, India are very economical
(Figure 6.11) as compared to lab grade ingredients. But the issue with price was still
there.
The commercial prices of Chaitanya Chemicals, Maharashtra, India, Titan Biotech,
Delhi, India and Warkem Biotech, Mumbai, India were tested. The individual ingredient
price issue was not mentioned due to some confidential issues with the dealer. But the
final price was calculated to be INR 55 and the yield of fresh cell mass obtained from the
same was 58 g/L.
6.5 BATCH FERMENTATION OF ST-500 AND PROCESS
STANDARDIZATION
Upstreaming of ST-500 on different vessel sizes (2L, 5L, 50L and 300L) of
fermenter was evaluated on the basis of final cell mass (g/L), OD, lactic acid content and
cell viability. Maximum cell mass and maximum OD was obtained from 300L vessel but
maximum cell viability was observed in 5L vessel size of fermenter (Table 6.5). Cell
viability and OD from 5L vessel was further explored on the basis of incubation hours
(Table 6.6).
Table: 6.5 Comparison of Batch results with complete up-stream analysis of ST-500
12 0.694 371×105
16 0.755 489×105
20 0.841 592×105
24 0.946 825×105
CFU of the inocolum tube recorded by 285×105, 0.2% EDTA was blank for OD
6.6 DOWN STREAM PROCESSING OF ST-500
6.6.1 Lyophilization
All the compounds used as lyoprotectants in this study were found to be effective
in most of the cases, providing protection to various lactic acid bacteria (Carvalho et al.
2004). Eighteen lyoprotectants were used separately as medium to provide protection
from high vacuum and freeze shock during lyophilization along with a blank sample.
Skim milk powder was used in sample preparation before freezing because of its property
of preventing cellular injury by stabilizing the cell membrane constituents and creating a
porous structure in the freeze dried product (Castro et al., 1996; Salmer-Olsen et al.,
1999). Skim Milk also contains proteins that provide a coating to the bacterial cells
(Abadias et al., 2001). On testing the viability of S. thermophilus with skim milk (10%
w/w) shows highest cell viability of 74% when observed in dry form. On the other hand
sugar and sugar derivatives were also used for their protective effect during lyophilization
and also during after lyophilization storage (Carvalho et al., 2002, 2003c). Sugar alcohol
like sorbitol has found to be one of the strong protective agent during lyophilization and
storage of L. bulgaricus, L. plantarum, L. rhamnosus, E. faecalis and E. durans
(Carvalho et al., 2003c), but in current study, its performance as protective agent for
lyophilization of S. thermophilus was dull and discouraging. Infect cheaper sugar sources
like sucrose (72%), glucose (51%), lactose (66%) and maltodextrine (67%) showed better
results compared to high cost sugars like mannitol (44%), fructose (45%), maltose (32%),
ribose (39%) and arabinose (28%) as high cost compounds would likely to restrict their
large scale industrial use. The ability of mono sodium glutamate (MSG) to protect
microbial cells during lyophilization and cryopreservation is also described by several
workers (Font de Valdez et al., 1983; Martos et al., 1999). Use of 1% (w/w) MSG for S.
thermophilus also showed protective effect with 57% viability, while as more than 1%
quantity showed viability loss. Lyophilization of ST-500 with all the seven lyophilization
media was conducted at 0.004 mbar vacuum pressure individually in plates and vials
(Figure 6.27).
The effect of K2HPO4 and KH2PO4 on cell viability of B. bifidum has been
studied by Qin et al. (2013) showing cell survival viability up to 77.80% with KH2PO4
and 79.82% with K2HPO4. But studying the effect of these compounds on S.
thermophilus reveals opposite results with K2HPO4 (1% w/w) 21% and KH2PO4 (1%
w/w) 17%. Milk proteins present in skim milk leads to stabilization of protein structures
via reactions between the amino group of the microbial cell proteins and with protectant.
Other mixtures with casein protein and whey proteins were also tested revealing
interesting results by providing high cell viability to S. thermophilus. Sodium caseinate
resulted in highest viability of 81% while as whey protein concentrate (WPC) with 65%
and sweet whey powder (SWP) 58% (Figure 6.26).
A total of 40 combinations were prepared based on the results obtained on their role as
individual protectant in providing the viability to S. thermophilus on lyophilization.
After initial studies combinations producing more than 50% viability were considered for
further studies in which only 7 combinations were observed significant with high
viability (Table 6.7). The ratio of addition was also studied and implemented on the basis
of thickness and viscosity of the prepared lyophilization medium. Lyophilization medium
(LM) 2, 4, 6 and 7 were found efficient in maintaining the cell viability both during
freezing and drying state of lyophilization. LM 7 was observed as unique viability
escalator providing better results compared to other lyophilization media (Figure 6.29).
The reason behind the success of LM 7 is the role of protective milk proteins which are in
abundance in this particular formulation playing a role in stabilizing the protein structures
of this microbe and sugar source playing a crucial part in maintaining the physical state
of the membrane lipids and enzyme level. All the protective compounds in lyophilization
medium 7 have their unique role in maintaining the cell viability, also the medium is cost
efficient and can easily be implemented on large scale industrial production of S.
thermophilus for its role in starter culture. After final lab scale evaluation, lyophilization
media 7 was used for lyophilization of 300 L batch at TBI (Technology Based Incubator),
Delhi University with output of 82% viability (Figure 6.28).
Process viability loss during the up-stream and down-stream processing was also
recorded by taking samples after regular intervals from fermentation to freeze drying. In-
process, samples were diluted four times to equalize the proportion of fresh liquid culture
and pellet. Optical density was recorded at 660 nm and CFU (colony forming units) were
calculated by serially diluting the samples followed by pour-plate method and colony
counting. An average viability loss of 1.5×106±2 was observed after each standard step
process towards down-streaming with a total viability loss of 6.1×106 (Table 6.8). Cell
multiplication ratio in the final product was also recorded. It was observed that
lyophilized culture with viability of CFU size of 5×109 was sufficient enough to work as
an inocolum in 1L milk for curd preparation. On inoculation of 4 hours at 42°C the initial
CFU of 5×109 was increased to a prebiotic level of 2×1014 with per curd CFU content in
curd of 2×1011.
Chapter 7
Dairy Applications
Bacterial isolate ST-500 was tested for various dairy applications like curd,
fermented milk, cheese, mishthi dahi and frozen fruit dessert. During milk fermentation,
organic acids, mainly lactic acid, are produced by the microorganisms lowering the pH
value. This acid production can be used to characterize milk fermentation and is therefore
an important method to test the activity of starter cultures. Curd is an important part of
Indian diet. In most Indian homes curd is prepared almost every day. Homemade curd is
not only very simple to prepare but is also delicious.
The isolate was tested for following applications:
• Curd
• Yogurt
• Flavored yogurt
• Mishti Dahi (Sweet Curd)
• Butter Milk
• Fruit dessert
• Yogurt Softy
• Cheese
7.1.1 Application testing for curd, yogurt, butter milk, mishti dahi
Pasteurized milk was allowed to cool up to 42°C followed by stirring the milk
slowly to distribute the culture organism (ST-500) uniformly throughout the milk and the
inoculated milk was poured into 100 mL capacity sterile plastic cups, which were then
incubated at 42°C for about 6 hours for curd. (a) Incubation period of 12 hours for butter
milk, (b) 7 hours for misthti dahi (10% sugar), (c) Incubation period of 6 hours for
yogurt, (d) Incubation period of 7 hours for flavored yogurt. For preparation of yogurt
LB-200 and ST-500 were used in combination with ratio of 1:1 mixed culture. Flavored
yogurt (set) and flavored yogurt (stirred) were also prepared in 100 mL volume cups with
same combination of St-500 and LB-200. Mango, orange, strawberry, pineapple,
blueberry and lichi flavors were prepared using both fruit pulp and natural flavors
available in market. After fermentation, the cups were shifted to refrigerator for
overnight. All the fermented products were then analyzed for sensory quality, rheological
attributes and physico-chemical attributes (Table 7.1).
7.1.2.3 Syneresis
The set curd at 5°C was slowly transferred to 15 mL capacity centrifuge tubes
causing minimum disturbance to the coagulum. The centrifuge tubes were balanced by
adjusting their weights and centrifuged at 2000 rpm in a Remi centrifuge for 5 min. The
quantity of whey separated at the top of the coagulum inside centrifuge tubes was
recorded as milliliters. The higher the volume of whey separated, the higher was the
syneresis and vice versa. Syneresis in case of curd and mishti dahi prepared from ST-500
was observed up to mark. Syneresis was not checked for buttermilk as the product is a
noncoagulum type fermented drink.
7.1.2.4 Acidity
The acidity of the curd samples was analyzed by BIS method and expressed as
per cent lactic acid (Bureau of Indian Standards, 1981).
7.1.2.5 pH
pH was determined by potentiometric method i.e. by potential difference between
the sample and electrolyte solution present inside the electrode of pH meter, using digital
pH meter (Systronic Co., Bangalore). The electrode of the pH meter was directly dipped
in the set curd and the pH was recorded (5°C). pH was recorded to check the lactic acid
secreting capability of the culture in specific duration with favorable temperature. Curd
was prepared in cups with 100 mL volume and was incubated. pH was recorded after 3,
3.5, 4, 4.5, 5, 5.5, 6 hours on incubation from different cups of same experiment, so that
the coagulation will not get disturbed (Figure 7.3). Curd prepared with different fat
concentrations was also checked for coagulation and pH drop during incubation (Figure
7.5)
Figure 7.3 Graphical presentation of pH drop rate after inoculation of ST-500 with
different fruit and sugar percentages on incubation at 42°C
Figure 7.5: Graphical presentation of pH drop rate after inoculation of ST-500
with different percentage of milk fat on incubation at 42°
7.2) APPLICATION TESTING FOR CHEESE PRODUCTION FROM ST-500
In current study, ST-500 took a much longer time to coagulate which was
different according to fat concentrations of the milk. The acidity on coagulation was on
much higher level and observed between 4-5 final pH. The texture, taste and pH of the
cheese were observed on aging period of 10, 20 and 30 days. The taste of the cheese was
found increasingly better with aging. The final product obtained after 30 days was with a
little loose texture as compared to other lactic cheese available in the market.
Table: 7.1 Results of application testing done on the basis of certain parameters
Parameters tested
S.N Applicatio
. n Tested Post Gel Taste Water/Whe
Fina Textur
Acidificatio Firmnes Flavor/Arom y
l pH e
n s a Separation
Quality
Creamy
Testing of Smoot
1 4.45 4.45 ± 0.1 High Mild Curd Nil
ST-500 for h
flavor
Curd
Quality
Cream
Testing of
2 4.92 4.92 ± 0.1 Loose Low yogurt flavor Low
ST-500 for
and aroma
yogurt
Quality
Testing of Sweet
Smoot
3 ST-500 for 4.53 4.53 ± 0.2 High creamy Dahi Low
h
Mishti aroma
Dahi
Quality
Sour and
Testing of
4 4.87 4.87 ± 0.4 Grainy N/A fatty Cheese Nil
ST-500 for
aroma
Cheese
Quality
Testing of Creamy
5 ST-500 for 5.02 5.02 ± 0.2 Loose Low Fruit flavor Low
Fruit/Flavo and aroma
r Yogurt
Quality
Testing of
Very Very Salty butter
6 ST-500 for 4.44 4.44 ± 0.1 N/A
Loose Low Curd flavor
Butter
Milk
Quality
Rich
Testing of Smoot
Creamy
7 ST-500 for 4.88 4.88 h and N/A N/A
yogurt flavor
yogurt Soft
and aroma
softy
7.3.1 Chemical & Physiological Parameters for Fermented Milk (set curd)
3 Inoculation temperature 40
4 Incubation temperature 42
Additional Fortification of
6 None
milk
Parameters tested
Starter Water/
S.N.
Testing Final Post Gel Taste Whey
Texture
pH Acidification Firmness Flavor/Aroma Separat
ion
Creamy Mild
1 ST-500 4.45 4.45 ± 0.1 Smooth High Nil
Curd flavor
Creamy Mild
2 JAMA 4.48 4.48 ± 0.1 Smooth High Nil
Curd flavor
Creamy
3 Flavogard 4.63 4.63 ± 0.1 Smooth High Nil
yogurt flavor
Final product ST-500 starter culture was observed effective against all the major
applications of dairy industries. Most importantly, the application of its use as starter
culture for Indian traditional curd is of great commercial and industrial value. As
described in Table 7.3 the curd prepared from ST-500 was observed almost equivalent to
the curds prepared by the available starter cultures in the market. The other dairy
applications were also observed significant in terms of its commercial use.
The culture showed tremendous potential in yogurt production also when analyzed
with LB-200. Both the bacteria worked in synchronization to produce both flavored and
plain yogurt with rich and creamy taste and texture. However, this synchronization of ST-
500 and LB-100 is a matter of more experimental study which can be the future prospect.
Chapter 8
Summary & Conclusion
The requirement for making a good meal is to have ingredients of a good quality
available, and to have sufficient variety to generate interesting taste and flavor. This is,
however, not as simple as it sounds, as a large number of our basic food items are
perishable, and quality is also not always easy to recognize. In the industrialized world,
the fraction of our food prepared outside the private kitchen is exceeding 50% and this
fraction is still rising. With the knowledge about the genetics and the physiology of lactic
acid bacteria we now possess, it is possible to engineer starters for a variety of purposes
where a suitable starter culture cannot easily be found in nature.
Ten selected strains were, further, identified at molecular level (16s rDNA
sequencing) and found that seven strains are of cocci type (chain) in morphology
belonging to Streptococcus thermophilus , one strain belong to Streptococcus infantarius
subsp. coli and two strains with short and long rod morphology belong to Lactobacillus
acidophilus and Lactobacillus delbrueckii subsp indicus, respectively. Phylogenetic tree
were prepared for all 10 strains with the help of BLAST at NCBI for best hit results.
Whole genome sequencing of one selected strain of S. thermophilus was studied to
observe the overall genetic expression of the strain. The selected strain is the new
discovery in the world as the ninth strain of S. thermophilus for which the complete
genomic profile has been investigated (data will be submitted to NCBI after patenting).
Batch fermentation was conducted with maximum cell mass achieved (7%).
More than 100 lab scale fermenter batches (2L & 5L) and 25 pilot scale batches (50L to
300L) were prepared and performed for detailed analysis of cell multiplication,
fermentation, freezing and lyophilization. The final starter culture produced after
complete up and down stream processing was tested for its efficiency in dairy industrial
application of fermented food products. Curd prepared from S. thermophilus starter was
observed completely fine on parameter testing. Other fermented foods like buttermilk,
flavored/ plain yogurt, mishti dahi, frozen dessert, yogurt softy and cheese were prepared
with fine taste, texture, creaminess, flavor, aroma and low post acidification. Finally, the
culture market can also be increased by expanding the application of cultures and by
increasing the value of the products. In both cases, the cultures developed will contribute
a larger part of the value of the final product compared to the current applications.
References
Citation indices