See

discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/302476464

Distribution and localization of 3β-

hydroxysteroid dehydrogenase (3β-HSD) in the
brain and its regions...

Article in General and Comparative Endocrinology · May 2016

DOI: 10.1016/j.ygcen.2016.04.031

CITATIONS READS

0 54

2 authors:

Surabhi Mishra Radha Chaube

Banaras Hindu University Banaras Hindu University
13 PUBLICATIONS 20 CITATIONS 74 PUBLICATIONS 278 CITATIONS

SEE PROFILE SEE PROFILE

All in-text references underlined in blue are linked to publications on ResearchGate, Available from: Radha Chaube
letting you access and read them immediately. Retrieved on: 09 November 2016
 General and Comparative Endocrinology xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

General and Comparative Endocrinology

journal homepage: www.elsevier.com/locate/ygcen

Distribution and localization of 3b-hydroxysteroid dehydrogenase

(3b-HSD) in the brain and its regions of the catfish Heteropneustes fossilis
Surabhi Mishra, Radha Chaube ⇑
Department of Zoology, Institute of Science, Banaras Hindu University, Varanasi 221005, India

a r t i c l e i n f o a b s t r a c t

Article history: In vertebrates, steroids are synthesized de novo in the central and peripheral nervous system, indepen-
Received 5 November 2015 dent of peripheral steroidogenic glands, such as the adrenal, gonads and placenta. 3b-Hydroxysteroid d
Revised 26 April 2016 ehydrogenase/D5-D4-isomerase (3b-HSD) is a key steroidogenic enzyme in vertebrate gonads, placenta
Accepted 28 April 2016
and adrenal. It mediates the oxidation and isomerization reactions of progesterone from pregnenolone,
Available online xxxx
17-hydroxyprogesterone from 17-hydroxypregnenolone and androstenedione from dehydroepiandros-
terone. In the present study, we examined the expression of 3b-HSD cDNA by real time-PCR and localiza-
Keywords:
tion of the mRNA by in situ hybridization in the brain and its regions during the different phases of the
3b-Hydroxysteroid dehydrogenase
Catfish
reproductive cycle of the catfish Heteropneustes fossilis. Further, 3b-HSD activity was assayed biochemi-
Brain cally to show seasonal variations. We showed significant seasonal and sexual dimorphic changes in
Sex the levels of transcript abundance in the whole brain and its regions. In whole brain, level was the highest
Seasonal in post-spawning phase and lowest in spawning phase in males. In females, there was a progressive
In situ hybridization increase through resting phase to pre-spawning phase, a decline in the spawning phase and increase
Real time-PCR in the post-spawning phase. In the preparatory phase, the highest transcript level was seen in medulla
oblongata and the lowest in pituitary in males. In females, the level was the highest in the hypothalamus
and lowest in olfactory bulb and pituitary. However, in the pre-spawning phase, in males it was the high-
est in telencephalon and hypothalamus and lowest in pituitary. In females, the highest transcript level
was in olfactory bulb and lowest in pituitary. 3b-HSD enzyme activity showed significant seasonal vari-
ation in the brain, the highest in the resting phase and lowest in the preparatory and spawning phases.
In situ hybridization showed the presence of 3b-HSD transcript was especially high in the cerebellum
region. The presence of 3b-HSD in the brain may indicate steroidogenesis in the catfish brain.
Ó 2016 Elsevier Inc. All rights reserved.

1. Introduction feeding, sexual behaviour, and learning and memory (Majewska,

Earlier it was thought that steroidogenesis in vertebrates was
restricted to gonadal and adrenocortical tissues. Neurosteroidoge-
nesis from cholesterol is well established in the vertebrate brain
(Baulieu, 1997; Tsutsui et al., 1999; Diotel et al., 2011; Do Rego
and Vaudry, 2016). The neurosteroids are important to neural
development and function in a number of vertebrate species.
Recently, a growing body of research in teleost brain indicates
that the locally-produced steroids are involve in a variety of
physiological functions including proliferation, differentiation
and development of brain during embryonic life. It has been well
documented that neurosteroids regulate various physiological
and behavioural processes in adult brain controlling locomotion,
⇑ Corresponding author.
E-mail addresses: chauberadha@rediffmail.com, radhachaube72@gmail.com
(R. Chaube).
1992; Kavaliers and Kinsella, 1995; Baulieu, 1998; Do Rego et al.,
2000; Schlinger et al., 2008; Do Rego et al., 2009, 2012; Chaube
et al., 2015).
The ability of neurons to produce steroids was demonstrated by
various researchers (Baulieu, 1981; Corpéchot et al., 1983; Baulieu,
1997). In several neuroanatomical studies have demonstrated the
presence of key steroidogenic enzymes in the central nervous sys-
tem (CNS) in different vertebrates, including fishes (Pasmanik and
Callard, 1985; Pasmanik et al., 1988; Mathieu et al., 2001; Vallarino
et al., 2005). 3b-Hydroxysteroid dehydrogenase/D5-D4-isomerase
(3b-HSD) is a key enzyme of steroidogenesis in all peripheral
steroidogenic glands (gonads, adrenal cortex and placenta) and is
involved in oxidation and isomerization of 3b-hydroxy-D5-steroids
(pregnenolone and dehydroepiandrosterone (DHEA) into
D4ketosteroids (progesterone and androstenedione), (Hanke and
Chester Jones, 1966; Vanson et al., 1996; Ukena et al., 1999a;
Payne and Hales, 2004; Schlinger et al., 2008; Raghuveer and

http://dx.doi.org/10.1016/j.ygcen.2016.04.031
0016-6480/Ó 2016 Elsevier Inc. All rights reserved.

Please cite this article in press as: Mishra, S., Chaube, R. Distribution and localization of 3b-hydroxysteroid dehydrogenase (3b-HSD) in the brain and its
regions of the catfish Heteropneustes fossilis. Gen. Comp. Endocrinol. (2016), http://dx.doi.org/10.1016/j.ygcen.2016.04.031
2 S. Mishra, R. Chaube / General and Comparative Endocrinology xxx (2016) xxx–xxx
Senthilkumaran, 2012). Therefore, its presence in the brain is an
important feature of steroidogenesis. The expression/activity of
3b-HSD has been demonstrated in the mammalian brain
(Weidenfeld et al., 1980; Jung-Testas et al., 1989; Dupont et al.,
1994; Guennoun et al., 1995; Sanne and Krueger, 1995; Kohchi
et al., 1998; Robert et al., 2001; Yu et al., 2002). In non-
mammalian vertebrates, 3b-HSD expression/activity has been
reported mainly in birds (Vanson et al., 1996; Ukena et al.,
1999a; Tsutsui and Yamazaki, 1995; Usui et al., 1995; Matsunaga
et al., 2001; London et al., 2006; Schlinger et al., 2008) and amphib-
ians (Mensah-Nyagan et al., 1994; Do Rego et al., 1998, 2000, 2001,
2007; Takase et al., 1999; Inai et al., 2003; Bruzzone et al., 2010). In
fish, 3b-HSD-expressing cells have been demonstrated in the brain
of dipnoans and teleosts (Mathieu et al., 2001; Sakamoto et al.,
2001a,b; Diotel et al., 2011). In order to elucidate the physiological
significance of neurosteroids in the brain, it is necessary to have a
detailed study on sex, seasonal and brain regional differences in
the biosynthesis of neurosteroids. The catfish Heteropneustes fos-
silis (H. fossilis), popularly, ‘stinging catfish’, belongs to a group of
fish having characters close to primitive bony fishes (Bruton,
1996). The catfish is an economically important edible fish. Its
flesh is high on protein and low on fat content. It is the lone
member of the family Heteropneustidae or Saccobranchidae and
is therefore important for phylogenetic/molecular studies. It is an
air-breathing fish with great aquaculture potentials especially for
in derelict and waste water culture. The catfish has been investi-
gated extensively for reproductive endocrinology and endocrinol-
ogy research in India (Sundararaj, 1981). Thus, in the present
investigation, an attempt was made to study the seasonal and
regional distribution of 3b-HSD in the siluroid catfish H. fossilis
during the annual reproductive cycle. We report 3b-HSD mRNA
expression, in situ hybridization of the transcript localization and
biochemical analysis of enzyme activity in the catfish brain to
indicate neurosteroid formation.
2. Material and methods
2.1. Animal collection and acclimation
H. fossilis is a freshwater, air breathing catfish whose reproduc-
tive cycle is divided into five phases: resting (November–January,
10.5L:13.5D, 18 ± 2 °C), preparatory – (February–April, 11.5
L:12.5 D, 22 ± 2 °C), prespawning (May–June, 13.5 L:10.5D,
28 ± 2 °C), spawning (July–August, 13.0L:11.0D, 29 ± 2 °C) and post
spawning (September-October, 11.5L:12.5, 22 ± 2 °C) phases. Adult
catfish (40–60 g) were purchased from a local fish market from
Varanasi during all the above reproductive phases and were main-
tained in tanks (1
1
0.2 M) with circulating water under natu-
ral conditions for 48 hours after arrival to overcome stress due to
transportation and were fed daily with goat liver ad libitum. After
acclimatization, both male and female catfish in each reproductive
phase were killed by decapitation between 9.00 and 11.00 h (local
time). The whole brain and its regions such as olfactory bulb, telen-
cephalon (minus olfactory tract and bulb), hypothalamus, pituitary
and medulla oblongata were dissected (Chaube and Joy, 2002) and
were stored at 80 °C. The thawed tissues were used for various
investigations of 3b-HSD assay (mRNA, biochemical and in situ
hybridization).
All experiments were performed in accordance with the guide-
lines of the Animal Ethics Committee of Banaras Hindu University,
Varanasi and all care was taken to prevent cruelty of any kind.
2.2. Chemicals and reagents
In the present study, the following molecular biology kits
and reagents were used: Revert-Aid Hminus first-strand cDNA
Please cite this article in press as: Mishra, S., Chaube, R. Distribution and localization of 3b-hydroxysteroid dehydrogenase (3b-HSD) in the brain and its
regions of the catfish Heteropneustes fossilis. Gen. Comp. Endocrinol. (2016), http://dx.doi.org/10.1016/j.ygcen.2016.04.031
synthesis kit (Fermentas, Hanover, MD, USA), DNase I, RNase-free
(Ambion Inc., Austin, TX, USA), RNA later (Ambion Inc., Austin,
TX, USA), RNeasy lipid tissue mini kit (Qiagen, Hilden, GmBH,
Germany), 2X PCR master mix (Fermentas, Hanover, MD, USA).
Pregnenolone (5-pregne-3b-ol-2one), DHEA (5-androsten-3b-ol-
17 one) and other chemicals such as phenol, chloroform, agarose,
tris base, glacial acetic acid, EDTA-Na2, alcohol, methanol were of
molecular biology grade and purchased from Sigma-Aldrich Ltd.,
St. Louis, MO, USA. The primers used in the present study were
synthesized by integrated DNA Technologies (Coralville, IA, USA).
Nicotinamideadenine dinucleotide sodium salt (NAD), nicoti-
namideadenine dinucleotide reduced form (NADH), iodonitrate
trazoliumchloride (INT), nicotinamide adenine dinucleotide phos-
phate (NADP), and phenazenemethosulfate (PMS) were purchased
from Sisco Research Laboratory, Mumbai, India.
2.2.1. Reagents for biochemical assay
(a) Phthalate in-buffer (50 mM, pH 3.0): 2.55 g of potassium
hydrogen phthalate dissolved in a mixture of 51 mL N/10 HCL
and 2.5 mL Tween 20; pH was adjusted to 3.0 and the volume
made up to 250 mL with distilled water; (b) Tris–HCL buffer
(0.1 M, pH 7.8) (c) NAD (5 mM) and (d) colour reagent: 40 mg
INT, 10 mg PMS, and 0.5 mL-Tween 20 were dissolved in 50 mL
distilled water for standard curve. For the enzyme assay, PMS
was omitted from the reagent. The reagent containing PMS was
stored in a dark bottle. (e) The substrate (Pregnenolone or DHEA)
was first dissolved in 0.3–0.5 ml of dimethyl formamide (DMF)
and the stock solution (1 mM) prepared in 50 or 100 Tris–HCl
buffer (0.1 M, pH 7.8).
2.3. Total RNA isolation and cDNA synthesis
Total RNA was extracted from brain (70–80 mg). Tissue was
homogenized using a T10 basic ULTRA-TURRAX homogenizer
(IKA, Steaufen, Germany) in 1 mL QIAZOL (Qiagen) buffer and total
RNA was isolated with RNeasy Lipid Tissue Mini Kit (Qiagen) and
treated with 2U DNase I RNase-free (Ambion) for 30 min at
37 °C, following the manufacturer’s protocol. The total RNA yield
was determined in a Nano Drop (ND-1000 Spectrophotometer,
Nano Drop Technologies, Rockland, DE, USA) and quality assessed
by formamide RNA gel electrophoresis. The RNA samples with
A260/A280 ratio of 1.8–2.0 were used in the cDNA synthesis
reaction.
For Reverse transcription (RT), 5 lg of total RNA of each sample
was reverse transcribed in a 20 ll reaction with the Revert Aid H
Minus First Strand cDNA Synthesis Kit (Thermo Scientific, Lithua-
nia, EU), following the manufacturer’s protocol. Briefly, in a sterile
nuclease – free tube on ice, the following reagents were added:
total RNA template (5 lg), 1 lL of random hexamer primer
(100 pM) and nuclease – free water to 12 lL. After mixing gently
and centrifuging briefly, the mixture was incubated at 65 °C for
5 min. Then it was chilled on ice, centrifuged and the vial placed
back on ice to add 4 lL of 5X reaction buffer, 1.0 lL of RiboLock
RNase Inhibitor (20U/ll), 2ulof 10 mM dNTP Mix and 1.0 lL of
Revert Aid H Minus M-MuLV Reverse Transcriptase (200U/lL). The
mixture was incubated for 5 min at 25 °C, followed by 60 min at
42 °C. The reaction was terminated by heating at 70 °C for 5 min.
cDNA was stored at 80 °C. Negative control reactions were per-
formed without the addition of the reverse transcriptase for a subset
of the RNA sample. Determinations of optimal template concentra-
tion and annealing temperature were validated routinely.
2.4. Sequencing of 3b-HSD gene from H. fossilis
A gene specific primer of 3b-HSD was designed from mRNA
sequence of 3b-HSD of closely related species Clarias batrachus
 S. Mishra, R. Chaube / General and Comparative Endocrinology xxx (2016) xxx–xxx
Table 1
Primers used for cloning, sequencing and expression analysis of Heteropneustes fossilis 3b-HSD and b-actin.
Adaptation
Specific primers Clarias batrachus
qPCR Primers H. fossilis
Probe
DNA Control b-actin
(Accession No. HQ 6809831), of 192 bp, Table 1. Transcripts encod-
ing the 3b-HSD were amplified from 1 lL cDNA using 10 pM each
of a set of the gene-specific primers in 12.5 lL 2X PCR Master
mixes to make 25 lL of the reaction mixture. The thermal cycling
conditions for 3b-HSD were 94 °C for 5 min, 35 cycles of 94 °C for
50 s, 53 °C for 1 min and 72 °C for 1 min, followed by 72 °C
for 7 min and b-actin were 94 °C for 5 min, 35 cycles of 94 °C for
50 s, 55–57 °C for 1 min and 72 °C for 1 min, followed by 72 °C
for 7 min. The PCR products were resolved on 2% agarose gel and
then stained with ethidium bromide to visualize the bands. Images
of the gels were taken with Typhoon FLA 7000, and the signal
intensity was quantified with Image Quant TL Plus, image analysis
software (GE Healthcare). The PCR product was purified and
sequenced by taking services of Eurofin genomics, Bangalore, India.
Partial cDNA sequences of catfish 3b-HSD were checked by BLASTN
software (NCBI).
2.5. Sex, regional and seasonal variation by qPCR
Whole brain (n = 5, for each group, wt 80–90 mg) was taken. For
brain regions, pooling of the tissues were done to make a sample.
(Olfactory bulb n = 10, 20 mg, pituitary n = 20, 20 mg), hypothala-
mus (n = 3, 80–70 mg), telencephalon (n = 3, 60–70 mg) and
medulla oblongata (n = 3, 60–70 mg). For each group, the size
was N = 5 in each reproductive phase [Resting (Dec), Preparatory
(March), Prespawning (May), Spawning (July) Post-spawning
(September)]. Total RNA was extracted using RNeasy Lipid Tissue
mini kit (Qiagen) and first strand cDNA was synthesized from
2 lg total RNA using Revert-Aid H minus first strand cDNA synthe-
sis kit as per manufacturer’s instructions. Gene-specific primers
were designed for 3b-HSD from the respective sequences. Primers
for b-actin were used for the internal control. The primer speci-
ficity of each primer pair was confirmed by dissociation curve anal-
ysis. The qRT-PCR assays were performed in triplicate for different
samples using the specific primers (Table 1) and VeriQuest TM
SYBR Green qPCR master mix with ROX (Affymetrix, Inc. Cleveland,
Ohio USA) in a ABI Prism 7500 thermal cycler (Applied Biosystems,
Foster, CA, USA) at 95 °C (15 s), 60 °C (1 min) for 40 cycles. Each
sample was run in a final volume of 20 lL containing 1 lL of cDNA,
10 pM of each primer, and 10 lL of SYBRÒ Green PCR master mix.
Specificity of amplicons was verified by melting curve analysis
(60–95 °C) after 40 PCR cycles. As controls, the assays were
performed without templates. No amplification was observed in
the control studies. Cycle threshold (Ct) values were obtained from
the exponential phase of PCR amplification and target gene
(3b-HSD) expression was normalized against the b-actin gene
expression to generate a DCt value. Comparative Ct (DDCT) method
(Livak and Schmittgen, 2001) was used to quantify the target gene
abundance. b-actin was taken as the reference gene as its expres-
sion in the tissues was found to be consistent throughout the
season. All the tissues were processed for gene expression studies
by qPCR as described above.
Please cite this article in press as: Mishra, S., Chaube, R. Distribution and localization of 3b-hydroxysteroid dehydrogenase (3b-HSD) in the brain and its
regions of the catfish Heteropneustes fossilis. Gen. Comp. Endocrinol. (2016), http://dx.doi.org/10.1016/j.ygcen.2016.04.031
3
Sequence (50 –30 )
Forward AGACGAGAGCTGTGGTTGGT
Reverse ATGGACGGAGAATGACTTGC 192bp
Forward GAGAGGGTTGCCGGTTTACT
Reverse TCCCACGTACACAGGATTGA 192bp
Forward CAGCCAGACCAAAAAGGAAG
Reverse TCCCACGTACACAGGATTGA 220bp
Forward TGGGCGTGACCTCACAGAT
Reverse CCTGCTCGAAGTCCAGAGCG 134bp
2.6. Synthesis of probes for in situ hybridization
2.6.1. Cloning of 3b-HSD
A 220 bp of coding region of 3b-HSD gene of H. fossilis was
amplified using the gene specific primer given in Table 1. The
amplicon was cloned into TA cloning vector pTZ57R/T, using The
Ins TA cloneTM PCR cloning Kit (Thermo Scientific, India). Briefly,
the protocol included overnight ligation of the 220 bp purified
PCR product with the vector pTZ57R/T using T4 DNA ligase,
DH5a competent cell preparation by the calcium chloride method
and transformation of the competent cells with the ligation mix.
After transformation, bacteria were plated into LB agar plate
having ampicillin for selection of transformed bacterial colonies
and X-Gal/IPTG for blue-white screening of recombinant colonies.
3b-HSD gene was amplified using 3b-HSD forward and reverses
primer to get a 220 bp product, which was cloned using the same
method as described above.
2.6.2. Screening of recombinant clones
Plasmids were prepared from the white recombinant colonies
using alkaline lysis method. The orientation of ligation of the PCR
product with respect to the T7 promoter sequence was known by
PCR on the extracted plasmids and T7 promoter primer and
3b-HSD, forward primer. A positive amplification indicated reverse
orientation of the 3b-HSD, coding strand with the T7 promoter
sequence. Such plasmids were selected for generation of antisense
riboprobes. Plasmid giving positive amplification with reverse
primer (RP) and T7 primers was used for the generation of sense
probe.
2.6.3. Synthesis of sense and antisense probes
The selected plasmids were used as template for PCR amplifica-
tion with T7 promoter primer and 3b-HSD gene forward primer.
The resulting amplicon was purified using Nucleopore PCR clean-
up gel extraction kit (Genetix) and used as a template for in vitro
transcription of antisense riboprobe using MAXIscriptÒ T7
in vitro transcription kit (Ambion). In vitro transcription was
carried out in a 20 lL reaction volume using T7 polymerase and
1 lL of 10 mM stock of each ATP, CTP, GTP, UTP and Digoxigenin-
11-UTP (Roche) (3.5 mM stock), used as the labelled UTP. The reac-
tion was allowed to proceed at 37 °C for 1 h. One lL of the resulting
reaction was checked by agarose gel electrophoresis to confirm the
formation of the riboprobe and stored at 80 °C, to be used for
in situ hybridization. Sense probes were generated in the same
way with the in vitro transcription reaction having the PCR product
using the primer sets of 3b-HSDRP and T7 promoter primer as the
template.
2.6.4. In situ hybridization of tissue sections
2.6.4.1. Tissue processing, block preparation and sectioning. All
solutions and reagents were prepared in DEPC-treated water to
maintain RNAse free conditions (0.1% DEPC in water at 37 °C
4 S. Mishra, R. Chaube / General and Comparative Endocrinology xxx (2016) xxx–xxx
overnight and then autoclaved to remove DEPC). Paraffin sections,
8 lm thick transverse and sagittal sections, were deparaffinised
with xylene, rehydrated through grades of ethanol (100–40%) for
5 min each. After 5 min in PBS, the sections were treated with pro-
teinase K at 40 lg/mL concentration for 7 min. This was followed
by a 5 min wash in PBS and post fixation of the sections in 4%
PFA in PBS for 20 min. Next, slides were washed in PBS for 5 min,
followed by 2X SSC for 5 min. Then sections were quickly dehy-
drated in graded series of alcohol (40–100%). The slides were
allowed to air dry for a short time in dust free condition before
putting the probe. 100 lL of probe diluted 1:100 in hybridization
buffer (50% deionized formamide/1X salts having NaCL, tris base,
tris HCL, NaH2PO4, Na2HPO4, EDTA/10% dextran sulfate/1 mg/mL
yeast t-RNA/1X Denhardt’s reagent) was placed in each slide and
cover slip was put in such a way so as to spread the solution over
the entire slide. The sections were allowed to hybridize at 65 °C
overnight in a moist chamber made by keeping tissue papers
soaked in moist chamber solution in tightly sealed box. The humid-
ity level inside the hybridization oven was maintained. After over-
night hybridization, the slides were washed in washing solution of
50% formamide/1X SSC/0.1% Tween 20, 3 times for 30 min each at
65 °C. Next, the slides were washed twice in MABT buffer (Maleic
acid buffer with Tween 20) for 30 min each at room temperature.
The sections were then blocked in blocking solution (2% blocking
reagent, Roche/10% sheep serum prepared in MABT) for 1.5 h at
room temperature. After blocking, 100 lL of 1:2000 diluted anti-
digoxigenin AP antibody (Roche) (diluted in a solution of 2% block-
ing reagent and 1% sheep serum in MABT) was applied to the slides
and cover slipped to spread the solution evenly. The antibody incu-
bation was allowed for overnight at room temperature in a moist
chamber. Overnight antibody incubation was followed by washing
in MABT solution 5 times, 30 min each. This was followed by a
15 min wash in alkaline phosphatase buffer (100 mM tris
pH = 9.5, 100 mM NaCl). A 1% solution of the NBT/BCIP stock solu-
tion (Roche) prepared in the alkaline phosphatase buffer was
applied to the slides and the reaction was allowed to proceed in
dark for 2–4 h. The reaction was stopped by a 5 min wash in PBS,
followed by fixation in 4% PFA for 20 min. The slides were washed
in PBS and mounted in 80% glycerol. Tissues were microscopically
photographed under Leica DM 2000 microscope and images were
taken with Leica digital camera (DFC 295) with 3-megapixel.
2.7. Estimation of 3b-HSD activity
A 1.0 mM solution of NADH prepared in distilled water. Aliquots
of graded concentrations of NADH (0–150 nmol) were reacted the
assay with the color reagent (0.5 ml) and after color formed, 2.0 ml
of phthalate buffer was added to each tube and, the absorbance
read at 490 nm. A standard curve was prepared by plotting NADH
concentration vs absorbance, (Shivanandappa and Venkatesh,
1997). The supernatant was used as the enzyme source. The
enzyme was assayed in 0.1 M Tris-HCL buffer (pH 7.8) containing
NAD (500 lM), and the substrate DHEA or Pregnenolone
(100 lM) in a total volume of 3.0 mL The reaction was stopped
by addition of 2.0 mL phthalate buffer (pH 3.0) and absorbance
was taken at 490 nM in a Systonics Spectrophotometer
(UV-Visible spectrophotometer UVI, Aquamate, BiomateThermo
Fisher Scientific, Cambridge, Great Britain). The enzyme activity
was calculated for standard curve of NADH and expressed as nmol
NADH formed per hour per mg protein. Protein estimation was
done by Lowry et al. (1951).
2.8. Statistical analysis
Data were expressed as mean ± SEM and checked for homo-
geneity and normality. In Levene’s test of equality of error
Please cite this article in press as: Mishra, S., Chaube, R. Distribution and localization of 3b-hydroxysteroid dehydrogenase (3b-HSD) in the brain and its
regions of the catfish Heteropneustes fossilis. Gen. Comp. Endocrinol. (2016), http://dx.doi.org/10.1016/j.ygcen.2016.04.031
variances, the error variances of the dependent variables are equal
across groups (p > 0.05) and the data were homogeneous. The data
followed a normal distribution in Kolmogorov–Smirnov test. Data
were tested for statistical significance using the Statistical Package
for the social science software program (version 10.0; SPSS). One
and two-way analysis of variance (ANOVA; P < 0.001), followed
by Newman–Keuls’ and Tukey’s test was used to compare differ-
ences at a significance level of P < 0.05. F-statistics, degrees of free-
dom (df) of interaction (DFn), the total degrees of freedom (DFd),
and P values are reported in results section.
3. Results
3.1. Sex and seasonal variation in the whole brain
In the whole brain, there was significant seasonal and sexual
dimorphic variations in transcript abundance of 3b-HSD gene
obtained in different reproductive stages (Fig. 1; one way ANOVA,
P < 0.001). In males (F = 3.81, df = 4, P = 0.018; Fig. 1A), the highest
mean transcript level was noticed in the post-spawning, which
insignificantly different from the resting and prespawning levels.
Lower expression was noticed in the preparatory and spawning
seasons. In females (F = 17.30, df = 4, P = 2.8E06; Fig. 1B), the
transcript level increased from the resting phase to the prespawn-
ing phase and decreased sharply in the spawning phase. The level
increased again in the postspawning phase. The overall transcript
abundance was, higher in males than females.
3.2. Sex and regional variations in preparatory and prespawning
season
There were significant sexual dimorphic and regional variations
in the transcript level of 3b-HSD in the preparatory phase (Fig. 2;
one way ANOVA, P < 0.001). In males (F = 822.04, df = 5,
P = 5.27E26; Fig. 2A), the transcript level was the highest in
medulla oblongata, moderate expression in olfactory organ, telen-
cephalon, followed by hypothalamus. However, in females
(F = 47769.75, df = 5, P = 3.84E47; Fig. 2B), the gene was highly
expressed in the hypothalamus, followed by medulla oblongata
and telencephalon. The lowest transcript level was in the pituitary
in males, in olfactory bulb and pituitary in females.
In the prespawning phase, there were significant sexual and
regional variations in the transcript level of 3b-HSD (Fig. 3; one
way ANOVA, P < 0.001). The highest transcript abundance was in
the telencephalon and hypothalamus, followed by medulla oblon-
gata and olfactory bulb, and the lowest level in the pituitary in
males (F = 5020.017, df = 5, P = 2.09E35; Fig. 3A). In females
(F = 80186.44, df = 5, P = 7.67E50; Fig. 3B), the highest gene
expression was in the olfactory bulb, followed by medulla
oblongata and hypothalamus. The transcript level was low in the
telencephalon and pituitary.
3.3. In situ hybridization of 3b-HSD gene
In the sagittal section of the female brain (resting phase), strong
blue colour signal of 3b-HSD mRNA was detected in the cerebellum
of the mesencephalon region (Fig 4A and B). In the cerebellum, the
corpus cerebelli lies in the central portion and expands dorsally (in
catfishes anteriorly placed). As in other vertebrates, the cerebellum
consists of three layers but the Purkinje cell layer is referred to as
the ganglionic layer because it includes not only the purkinje cells
but also the eurydendroid cells which are the projection neurons in
the teleost cerebellum (Ikenaga et al., 2006). The granular layer
showed strong transcript abundance. The signal was sparse or
none in the telencephalon, hypothalamus, and pituitary and in
 S. Mishra, R. Chaube / General and Comparative Endocrinology xxx (2016) xxx–xxx 5

Fig. 1. Seasonal variations in the transcript level of 3b-HSD gene in the whole brain of male (A) and female (B) catfish H. fossilis. Data were analyzed by one-way ANOVA
(P < 0.001) followed by Tukey’s post hoc test (P < 0.05). Groups with the same letters are not significantly different and those with different letters are significantly different.
RS-resting phase, PP-preparatory phase, PS-prespawning phase, SP-spawning phase, POS-postspawning phase.

Fig. 2. Changes in the transcript level of 3b-HSD gene in the brain regions [olfactory bulb (OLF), telencephalon (TEL), hypothalamus (HYP), pituitary (PIT), medulla oblongata
(M.O)] of male (A) and female (B) catfish H. fossilis in the preparatory phase. Data were analyzed by one-way ANOVA (P < 0.001) followed by Tukey’s post hoc test (P < 0.05).
Groups with the same letters are not significantly different and those with different letters are significantly different. RS-resting phase, PP-preparatory phase, PS-prespawning
phase, SP-spawning phase, POS-postspawning phase.

Please cite this article in press as: Mishra, S., Chaube, R. Distribution and localization of 3b-hydroxysteroid dehydrogenase (3b-HSD) in the brain and its
regions of the catfish Heteropneustes fossilis. Gen. Comp. Endocrinol. (2016), http://dx.doi.org/10.1016/j.ygcen.2016.04.031
6 S. Mishra, R. Chaube / General and Comparative Endocrinology xxx (2016) xxx–xxx

Fig. 3. Changes in the transcript level of 3b-HSD gene in the brain regions [olfactory bulb (OLF), telencephalon (TEL), hypothalamus (HYP), pituitary (PIT), medulla oblongata
(M.O)] of male (A) and female (B) catfish H. fossilis in the prespawning phase. Data were analyzed by one-way ANOVA (P < 0.001) followed by Tukey’s post hoc test (P < 0.05).
Groups with the same letters are not significantly different and those with different letters are significantly different. RS-resting phase, PP-preparatory phase, PS-prespawning
phase, SP-spawning phase, POS-postspawning phase.

Fig. 4. In situ hybridization of 3b-hydroxysteroid dehydrogenase/D5-D4–isomerase (3b-HSD) mRNA in the brain of adult female catfish H. fossilis (sagittal view). Antisense
probe (A) and Sense probe (B), (CCe-corpus cerebelli, M-Molecular layer, G-Ganglionic layer). Scale bar: 10X (200 lm) and 4X (500 lm).

Please cite this article in press as: Mishra, S., Chaube, R. Distribution and localization of 3b-hydroxysteroid dehydrogenase (3b-HSD) in the brain and its
regions of the catfish Heteropneustes fossilis. Gen. Comp. Endocrinol. (2016), http://dx.doi.org/10.1016/j.ygcen.2016.04.031
 S. Mishra, R. Chaube / General and Comparative Endocrinology xxx (2016) xxx–xxx
Table 2
Seasonal variations in 3b-HSD activity in the brain of both male and female catfish H.
fossilis during resting, preparatory, prespawning, spawning and post spawning phases
of the reproductive cycle.
Reproductive Phases Male Female
Resting 38.47 ± 1.43a 49.22 ± 3.74d
Preparatory 26.16 ± 0.68b 23.58 ± 1.37e
Prespawning 27.26 ± 1.09b 40.14 ± 1.42f
Spawning 32.85 ± 1.63c 24.42 ± 1.02g,e
Post-spawning 31.64 ± 0.55c 26.38 ± 0.65h
Data were analyzed by two way ANOVA, followed by Newman-Keul’s test and
expressed as mean ± SEM (n = 5). Groups with the same letters are not significantly
different and those with different letters or numbers are significantly different.
the hindbrain (medulla oblongata). The sections treated with the
sense probe showed negative reaction (Fig. 4B).
3.4. Sex and seasonal variation in 3b-HSD activity
There were significant seasonal variations 3b-HSD activity
(Table 2; two way ANOVA, P < 0.001; FSeason = 41.29, FSeason
Sex =
18.01 and FSex = 2.0, df = 9, P = 0.15). In both the sexes, the highest
activity was in the resting phase and the lowest in the preparatory
phase. In males, activity decreased in the preparatory and pres-
pawning phase, and increased again in the spawning and
postspawning seasons. In females, the activity decreased in the
preparatory phase but increased in the prespawning phase. It
decreased subsequently in the spawning and postspawning phase.
4. Discussion
Conversion of D5–steroids like pregnenolone (P5) to D4-steroids
like progesterone (P4) is a critical step in steroidogenesis in all clas-
sical steroidogenic organs and is catalyzed by 3b-HSD, which is a
mixed function enzyme (dehydrogenase and isomerase activity).
In the catfish brain, we demonstrated the presence of the
enzyme and gene and protein level. The results suggest that the
catfish brain is capable of converting D5–steroids to D4-steroids.
In addition to 3b-HSD, the presence of other key steroidogenic
enzymes, cytochrome P450 side chain cleavage, cytochrome
P450 17a -hydroxylase/c17-20lyase, cytochrome P4507a, cyto-
chrome P450 aromatase, 17b-hydroxysteroid dehydrogenase,
5a-reductase, 3a -hydroxysteroid dehydrogenase, hydroxysteroid
sulphotransferase (HST) has been demonstrated in the CNS of
humans, mammals, aves, reptiles, amphibians and teleost (Jung-
Testas et al., 1989; Compagnone et al., 1995; Takase et al., 1999,
2011; Do Rego et al., 2000; Lea et al., 2001; Inai et al., 2003;
London et al., 2006; Payne and Hales, 2004; Labrie et al., 2005;
Do Rego and Vaudry, 2016).
4.1. Sexual dimorphism and seasonal variations in brain 3b-HSD
transcripts
The present data show that in the adult catfish, overall tran-
script abundance of brain 3b-HSD is higher in males than females.
In adult zebra finches, baseline brain 3b-HSD activity is higher in
females than males (Soma et al., 2004). The seasonal distributions
of the transcript abundance also differ in the two sexes. In males,
the transcript abundance is high in the resting, prespawning and
postspawning phases and low in the preparatory and spawning
phases. In females, it is the highest in prespawning, postspawning
and preparatory phases and low in the resting and spawning
phases. There seems to be no correlation between the gene expres-
sion and enzyme activity measured in this study. The enzyme
synthesis and kinetics involve complex mechanisms. However,
Please cite this article in press as: Mishra, S., Chaube, R. Distribution and localization of 3b-hydroxysteroid dehydrogenase (3b-HSD) in the brain and its
regions of the catfish Heteropneustes fossilis. Gen. Comp. Endocrinol. (2016), http://dx.doi.org/10.1016/j.ygcen.2016.04.031
7
brain contents of the steroid hormones, estradiol-17b (E2), testos-
terone (T), corticosteroids, and progestins were investigated in
both male and female catfish in the prespawning (vitellogenic)
and spawning (post-vitellogenic) phases (Chaube and Mishra,
2012). The data show that the measured steroid hormones showed
both stage-specific and sex-related variations. Previous studies on
zebra finches have reported that stressed males have higher
3b-HSD activity than females (Soma et al., 2004). In breeding male
song sparrows, stress ‘also rapidly affects 3b-HSD activity. In wild
song sparrows under natural conditions, there are seasonal
changes in brain 3b-HSD activity. Brain 3b-HSD activity is up
regulated during the non-breeding season (Schlinger et al., 2008).
In females, the highest transcript level in the pre- and post-
vitellogenic phase and the lowest in the spawning season may be
associated with their reproductive behaviour regulated by the pro-
gesterone and its metabolites, with changing reproductive cycle. It
is well known in mammals, that gonadal progesterone and its
metabolite enhance the secretion of gonadotropins from pituitary
(Krey and Kamel, 1990), similarly mRNA expression of 3b-HSD in
pituitary may be responsible for production of progesterone and
its metabolites might be regulating neurosteroidogenesis in the
catfish.
4.2. Sex and brain regional variations in 3b-HSD transcripts in the
preparatory and prespawning phases
In male quail, 3b-HSD was detected in all of the different brain
regions. 3-HSD activity was the greatest in the cerebrum and low-
est in the mesencephalon. Similarly, in the catfish brain 3b-HSD
gene expression was detected in all the brain regions. But the
regional differences are greatly modified by sex and seasons. It
was the highest in the medulla oblongata of males and hypothala-
mus of females and the lowest in pituitary region during the
preparatory season. In the prespawning phase, in males the
expression was the highest in telencephalon, hypothalamus and
medulla oblongata and in females in the olfactory bulb and
medulla oblongata. In both males and females, it was the lowest
in the pituitary. The functional significance of the expression pat-
tern is not clear at present.
4.3. In situ hybridization
In the brain, 3b-HSD activity and/or mRNA have been reported
in neurons, astrocytes and oligodendrocytes in vitro (Zwain and
Yen, 1999a,b). In the catfish, strong signals for the mRNA of the
enzyme were observed in the cerebellum, other brain regions
showed weak or no signals. It may be due to the seasonal variation
as in the present study, staining results were from resting phase
brain. In teleosts, the cerebellum consists of three layers but the
purkinje cell layer is referred to as the ganglionic layer because it
includes the purkinje cells and also the eurydendroid cells, which
are the projection neurons in the teleost cerebellum (Ikenaga
et al., 2006). In the catfish, the ganglionic layer showed the stron-
gest transcript abundance. In zebrafish Diotel et al. (2011) showed
by in situ hybridization that messengers for key steroidogenic
enzymes such as Cyp11a1 (P450scc), 3b-HSD, Cyp17 and Cyp19a1b
were widely expressed in the forebrain. 3b-HSD- like immunoreac-
tive cells were distributed in several telencephalic, diencephalic,
mesencephalic, metencephalic and rhombencephalic regions in
the zebrafish brain (Sakamoto et al., 2001b) and the presence of
immunoreactive cells in the zebrafish may be correlated with the
gonadotrophin – releasing hormone (GnRH) neurons (Oka and
Ichikawa, 1990; Muske, 1993; Yamamoto et al., 1995). In addition
to brain and spinal cord, abundant 3b-HSD- like immunoreactive
cells were localized in retinal cells of zebrafish, which has been
correlated to modulate neurotransmission and integration of visual
8 S. Mishra, R. Chaube / General and Comparative Endocrinology xxx (2016) xxx–xxx
information. In the African lungfish, 3b-HSD- like immunoreactiv-
ity occurs in cell bodies and fibres in various brain areas notably in
pallium, thalamus, hypothalamus and the tectum and periqueduc-
talgray (Mathieu et al., 2001). In zebrafish, 3b-HSD transcripts
were detected in many brain regions namely at the junction of
between the olfactory bulb and the dorsal telencephalon, in the
ventral and dorsal nuclei of the ventral telencephalon and in the
dorsomedial and dorsolateral telencephalon. The anterior and pos-
terior parts of the preoptic area, the anterior hypothalamus and the
mediobasal hypothalamus exhibited a significant signal, regions
surrounding the lateral and posterior recess, optic tectum and in
the valvula and corpus cerebellum (Diotel et al., 2011).
The strong hybridization signal in the ganglionic layer of the
corpus cerebelli of the cerebellum in the catfish is supported by
other results, such as presence of immunoreactive cell bodies or
fibres in somata and dendrites of Purkinje cells (Tsutsui and
Yamazaki, 1995; Usui et al., 1995). In situ hybridization of 3b-
HSD mRNA showed the expression in the Purkinje cells and exter-
nal granule cells, and the expression in the mammalian cerebellum
increased during the neonatal life (Ukena et al., 1999a,b). The Purk-
inje cells are responsible for biosynthesis of progesterone from
pregnenolone (Ukena et al., 1999b; Sakamoto et al., 2001a). RT-
PCR and biochemical techniques combined with high performance
liquid chromatography (HPLC) analysis showed expression of 3b-
HSD gene and enzymatic activity in rat cerebellum (Ukena et al.,
1999a,b). The present results clearly establish that adult catfish
brains have the ability to convert pregnenolone to progesterone.
It is also interesting to note that the adult catfish brain may pro-
duce a significant amount of progesterone. In the catfish, the
expression of 3b-HSD mRNA matches relatively well with the dis-
tribution of 3b-HSD immunoreactivity reported previously
(Sakamoto et al., 2001a; Diotel et al., 2011), notably in the valvula
cerebelli and the cerebellum. However, in zebrafish it was detected
in additional regions such as the hypothalamus and optic tectum
and also in cells of the surrounding the lateral recess. Obviously,
species difference and methods of detection may be responsible
for the varied results. In our study, the localization results do not
support the RT-PCR data.
4.4. 3b-HSD enzyme activity
In the present study, biochemical estimation of 3b-HSD activity
showed significant sex and seasonal variation in the brain. The
peak enzyme activity was noticed in the resting phase, in both
sexes. The activity decreased and fluctuated subsequently in other
phases. In the resting phase, the gonads are inactive and steroido-
genesis is impaired. The high activity in the brain may compensate
the gonadal low production for normal physiological and beha-
vioural functions in the brain. Progesterone and upstream steroid
hormones were described in the brain of the catfish (Chaube and
Mishra, 2012). In the gonad-active phase, plasma steroids can
reach the brain and modulate various functions. Progesterone
and other steroid hormone receptors have been characterized in
the teleost brain (Hanna et al., 2010). Progesterone is known to
influence neuronal myelination (Schumacher et al., 2001) and
metabolites of progesterone can bind to GABAA receptors, there
by potentiating neuronal hyperpolarisation (Majewska, 1992).
3b-HSD activity was reported in the brain of adult zebrafish
(Sakamoto et al., 2001a; Diotel et al., 2011). Biochemical studies
combined with HPLC analysis showed that the zebrafish brain con-
verts pregnenolone in to progesterone, indicating 3b-HSD enzyme
activity involve progestins actively and specifically bind and acti-
vate zebrafish Pgr (progesterone receptor). Similarly, in the catfish
brain significant sex and seasonal variation in the enzyme activity
suggest its potential and differential role in the biosynthesis of
Please cite this article in press as: Mishra, S., Chaube, R. Distribution and localization of 3b-hydroxysteroid dehydrogenase (3b-HSD) in the brain and its
regions of the catfish Heteropneustes fossilis. Gen. Comp. Endocrinol. (2016), http://dx.doi.org/10.1016/j.ygcen.2016.04.031
neurosteroids. The data clearly indicate that not only peripheral
steroids, but also neurosteroids, affect brain functions.
5. Conclusion
In conclusion, the present data indicate that catfish brain has
the potential to synthesize steroids upstream pregnenolone, 17-
hydroxypregnenolone and androstenedione, which are substrates
for 3b-HSD. The enzyme gene is expressed widely in the brain
and showed, sex, seasonal and brain regional differences. Cerebel-
lar ganglionic layer containing purkinje cells and eurydendroid
cells and their fibres showed strong transcript signals. The signifi-
cance of neurosteroids in neural and behavioural functions of the
catfish needs future work.
Acknowledgments
SM is a recipient of UGC-BSR Research Fellowships for merito-
rious students (RFSMS), Department of Zoology, Banaras Hindu
University. This work was partially supported by a University
Grants Commission and Department of Science and Technology,
New Delhi, India grant to RC. We are grateful to the Coordinator,
ISLS, BHU for the qRT-PCR facility.
References
Baulieu, E.E., 1981. Steroid hormone regulation of the brain. In: Fuxe, K., Gustafsson,
J.A., Wetterber, L. (Eds.), Proceedings of International Symposium at Wenner-
Gren Center, Stockholm. Pergamon, Oxford, pp. 3–14.
Baulieu, E.E., 1997. Neurosteroids: of the nervous system, by the nervous system,
for the nervous system. Recent Prog. Hormone Res. 52, 1–32.
Baulieu, E.E., 1998. Neurosteroids: a novel functions of the brain.
Psychoneuroendocrinology 23 (8), 963–987.
Bruton, M.N., 1996. Alternative life-history strategies of catfishes. Aquat. Living
Resour. 9, 35–41.
Bruzzone, F., Do-Rego, J.L., Luu-The, V., Pelletier, G., Vallarino, M., Vaudry, H., 2010.
Immunohistochemical localization and biological activity of 3b-hydroxysteroid
dehydrogenase and 5a-reductase in the brain of the frog, Rana esculenta, during
development. J. Chem. Neuroanat. 39, 35–50. http://dx.doi.org/10.1016/j.
jchemneu.2009.08.001.
Chaube, R., Joy, K.P., 2002. Effects of ovariectomy and estradiol-17b replacement on
brain tyrosine hydroxylase in the catfish Heteropneustes fossilis: changes in
in vivo activity and kinetic parameters. J. Endocrinol. 175, 329–342.
Chaube, R., Mishra, S., 2012. Brain steroid contents in the catfish Heteropneustes
fossilis: sex and gonad stage-specific changes. Fish. Physiol. Biochem. 38, 757–
767.
Chaube, R., Rawat, A., Joy, K.P., 2015. Molecular cloning and characterization of
brain and ovarian cytochrome P450 aromatase genes in the catfish
Heteropneustes fossilis: sex, tissue and seasonal variation in, and effects of
gonadotropin on gene expression. Gen. Comp. Endocrinol. 22, 120–133.
Compagnone, N.A., Bulfone, A., Rubenstein, J.L., Mellon, S.H., 1995. Steroidogenic
enzyme P450c17 is expressed in the embryonic central nervous system.
Endocrinology 136, 5212–5223. http://dx.doi.org/10.1210/
endo.136.11.7588260.
Corpéchot, C., Synguelakis, M., Talha, S., Axelson, M., Sjövall, J., Vihko, R., Baulieu, E.
E., Robel, P., 1983. Pregnenolone and its sulfate ester in rat brain. Brain Res. 270,
119–125.
Diotel, N., Do Rego, J.L., Anglade, I., Vaillant, C., Pellegrini, E., Gueguen, M.-M.,
Mironov, S., Vaudry, H., Kah, O., 2011. Activity and expression of steroidogenic
enzymes in the brain of adult zebrafish. Eur. J. Neurosci. 34, 45–56. http://dx.
doi.org/10.1111/j-1460-9568.2011.07731.x.
Do Rego, J.L., Vaudry, H., 2016. Comparative aspects of neurosteroidogenesis: from
Fish to mammals. In: Gen. Comp. Endocrinol. 226, 120–129. http://dx.doi.org/
10.1016/j.ygcen.2015.05.014.
Do Rego, J.L., Mensah-Nyagan, A.G., Feuilloley, M., Ferrara, P., Pelletier, G., Vaudry,
H., 1998. The endozepine triakontatetraneuropeptide diazepam-binding
inhibitor [17–50] stimulates neurosteroid biosynthesis in the frog
hypothalamus. Neuroscience 83, 555–570.
Do Rego, J.L., Mensah-Nyagan, A.G., Beaujean, D., Vaudry, D., Sieghart, W., Luu-The,
V., Pelletier, G., Vaudry, H., 2000. GABA, acting through GABAA receptors,
inhibits biosynthesis of neurosteroids in the frog hypothalamus. Proc. Natl.
Acad. Sci. USA 97, 13925–13930.
Do Rego, J.L., Mensah-Nyagan, A.G., Beaujean, D., Leprince, J., Tonon, M.C., Luu-The,
V., Pelletier, G., Vaudry, H., 2001. The octadecane neuropeptide ODN stimulates
neurosteroid biosynthesis through activation of central–type benzodiazepine
receptors. J. Neurochem. 76, 128–138.
Do Rego, J.L., Tremblay, Y., Luu-The, V., Repetto, E., Castel, H., Vallarino, M., Belanger,
A., Pelletier, G., Vaudry, H., 2007. Immunohistochemical localization and
 S. Mishra, R. Chaube / General and Comparative Endocrinology xxx (2016) xxx–xxx
biological activity of the steroidogenic enzyme cytochrome P450 17a-
hydroxylase/C17, 20-lyase (P450c17) in the frog brain and pituitary. J.
Neurochem. 100, 251–268.
Do Rego, J.L., Seong, J.Y., Burel, D., Leprince, J., Luu-The, V., Tsutsui, K., Tonon, M.C.,
Pelletier, G., Vaudry, H., 2009. Neurosteroid biosynthesis: enzymatic pathways
and neuroendocrine regulation by neurotransmitters and neuropeptides. Front.
Neuroendocrinol. 30, 259–301.
Do Rego, J.L., Seong, J.Y., Burel, D., Leprince, J., Vaudry, D., Luu-The, V., Tonon, M.C.,
Tsutsui, K., Pelletier, G., Vaudry, H., 2012. Regulation of neurosteroid
biosynthesis by neurotransmitters and neuropeptides. Front.
Neuroendocrinol. 3 (4). http://dx.doi.org/10.3389/fendo.2012.00004.
Dupont, E., Simard, J., Luu-The, V., Labrie, F., Pelletier, G., 1994. Localization of 3b-
hydroxysteroid dehydrogenase in rat brain as studied by in situ hybridization.
Mol. Cell. Neurosci. 5, 119–123.
Guennoun, R., Fiddes, R.J., Gouezou, M., Lombes, M., Baulieu, E.E., 1995. A key
enzyme in the biosynthesis of neurosteroids, 3b-hydroxysteroid
dehydrogenase/D5-D4-isomerase (3b-HSD), is expressed in rat brain. Mol.
Brain Res. 30, 287–300.
Hanke, W., Chester Jones, I., 1966. Histological and histochemical studies on the
adrenal cortex and the corpuscles of stannius of the European eel (Anguilla
anguilla L.). Gen. Comp. Endocrinol. 7, 166–178.
Hanna, R.N., Daly, S.C., Pang, Y., Anglade, I., Kah, O., Thomas, P., Zhu, Y., 2010.
Characterization and expression of the nuclear progestin receptor in zebrafish
gonads and brain. Biol. Reprod. 82, 112–122.
Ikenaga, T., Huesa, G., Finger, T.E., 2006. Co-occurrence of calcium-binding proteins
and calcium-permeable glutamate receptors in the primary gustatory nucleus
of goldfish. J. Comp. Neurol. 499, 90–105.
Inai, Y., Nagai, K., Ukena, K., Oishi, T., Tsutsui, K., 2003. Seasonal changes in
neurosteroid concentrations in the amphibian brain and environmental factors
regulating their changes. Brain Res. 959, 214–225. http://dx.doi.org/10.1016/
S0006- 8993(02)03745-9.
Jung-Testas, I., Hu, Z.Y., Baulieu, E.E., Robel, P., 1989. Neurosteroids: biosynthesis of
pregnenolone and progesterone in primary cultures of rat glial cells.
Endocrinology 125, 2083–2091.
Kavaliers, M., Kinsella, D.M., 1995. Male preference for the odors of estrous female
mice is reduced by the neurosteroid pregnenolone sulfate. Brain Res. 682, 222–
226.
Kohchi, C., Ukena, K., Tsutsui, K., 1998. Age- and region-specific expressions of the
messenger RNAs encoding for steroidogenic enzymes P450scc, P450c17 and 3b-
HSD in the postnatal rat brain. Brain Res. 801, 233–238.
Krey, L.C., Kamel, F., 1990. Progesterone modulation of gonadotropin secretion by
dispersed rat pituitary cells in culture. III. A23187, cAMP, phorbol ester and
DiC8-stimulated luteinizing hormone release. In: Mol. Cell. Endocrinol. 70, 21–
29.
Labrie, F., Luu-The, Belanger, A., Lin, S.X., Simard, J., Pelletier, G., 2005. Is
dehydroepiandrosterone a hormone? In: J. Endocrinol. 187 (2), 169–196.
Lea, R.W., Clark, J.A., Tsutsui, K., 2001. Changes in central steroid receptor
expression, steroid synthesis, and dopaminergic activity related to the
reproductive cycle of the ring dove. Microsc. Res. Tech. 55 (1), 12–26.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using
real-time quantitative PCR and the 2-DDCT method. Methods 25, 402–408.
London, S., Monks, D.A., Wade, J., Schlinger, B.A., 2006. Widespread capacity for
steroid synthesis in the avian brain and song system. Endocrinology 147, 5975–
5987. http://dx.doi.org/10.1210/en.2006-0154.
Lowry, O.H., Rosebrough, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement
with the Folin phenol reagent. J. Biol. Chem. 193, 265–275.
Majewska, M.D., 1992. Neurosteroids: endogenous bimodal modulators of the
GABAA receptor. Mechanism of action and physiological significance. Prog.
Neurobiol., 379–395
Mathieu, M., Mensah-Nyagan, A.G., Vallarino, M., Do Rego, J.L., Beaujean, D., Vaudry,
D., Luu-the, V., Pelletier, G., Vaudry, H., 2001. Immunohistochemical localization
of 3b-hydroxysteroid dehydrogenase and 5a-reductase in the brain of the
African lungfish Protopterus annectens. J. Comp. Neurol. 438, 123–135.
Matsunaga, M., Ukena, K., Tsutsui, K., 2001. Expression and localization of
cytochrome P450 17a-hydroxylase/c17, 20-lyase in the avian brain. Brain Res.
899, 112–122. http://dx.doi.org/10.1016/S0006-8993(01)02217-X.
Mensah-Nyagan, A.G., Feuilloley, M., Dupont, E., Do Rego, J.L., Leboulenger, F.,
Pelletier, G., Vaudry, H., 1994. Immunocytochemical localization and biological
activity of 3b-hydroxysteroid dehydrogenase in the central nervous system of
the frog. J. Neurosci. 14, 7306–7318.
Muske, L.E., 1993. Evolution of gonadotropins releasing hormone (GnRH) neuronal
systems. Brain Behav. Evol. 42, 215–230.
Oka, Y., Ichikawa, M., 1990. Gonadotropin-releasing hormone (GnRH)
immunoreactive system in the brain of the dwarf gourami (Colisa lalia) as
revealed by light microscopic immunocytochemistry using a monoclonal
antibody to common amino acid sequence of GnRH. J. Comp. Neurol. 300,
511–522.
Pasmanik, M., Callard, G., 1985. Aromatase and 5alpha-reductase in the teleost
brain, spinal cord, and pituitary gland. Gen. Comp. Endocrinol. 60, 244–251.
Please cite this article in press as: Mishra, S., Chaube, R. Distribution and localization of 3b-hydroxysteroid dehydrogenase (3b-HSD) in the brain and its
regions of the catfish Heteropneustes fossilis. Gen. Comp. Endocrinol. (2016), http://dx.doi.org/10.1016/j.ygcen.2016.04.031
9
Pasmanik, M., Schlinger, B.A., Callard, G.V., 1988. Invivo steroid regulation of
aromatase and 5alpha-reductase in gold fish brain and pituitary. Gen. Comp.
Endocrinol. 71, 175–182.
Payne, A.H., Hales, D.B., 2004. Overview of steroidogenic enzymes in the pathway
from cholesterol to active steroid hormones. Endocr. Rev. 25, 947–970.
Raghuveer, K., Senthilkumaran, B., 2012. Cloning and expression of 3b-
hydroxysteroid dehydrogenase during gonadal recrudescence and after hCG
induction in the air-breathing catfish, Clarias gariepinus. Steroids 77, 1133–1140.
Robert, F., Guennoun, R., Désarnaud, F., Do-Thi, A., Benmessahel, Y., Baulieu, E.E.,
Schumacher, M., 2001. Synthesis of progesterone in Schwann cells: regulation
by sensory neurons. Eur. J. Neurosci. 13, 916–992.
Sakamoto, H., Ukena, K., Tsutsui, K., 2001a. Effects of progesterone synthesized de
novo in the developing purkinje cell on its dendritic growth and synaptogenesis.
J. Neurosci. 21, 6221–6232.
Sakamoto, H., Ukena, K., Tsutsui, K., 2001b. Activity and localization of 3b-
hydroxysteroid dehydrogenase/D5-D4-isomerase in the zebrafish central
nervous system. J. Comp. Neurol. 439, 291–305.
Sanne, J.L., Krueger, K.E., 1995. Expression of cytochrome P450 side-chain cleavage
enzyme and 3b-hydroxysteroid dehydrogenase in the rat central nervous
system: a study by polymerase chain reaction and in situ hybridization. J.
Neurochem. 65, 528–536.
Schlinger, B.A., Pradhan, D.S., Soma, K.K., 2008. 3b-HSD activates DHEA in the
songbird brain. Neurochem. Int. 52, 611–620. http://dx.doi.org/10.1016/j.
neuint2007.05.003.
Schumacher, M., Guennoun, R., Mercier, G., Desarnaud, F., Lacor, P., Benavides, J.,
Ferzaz, B., Robert, F., Baulieu, E.E., 2001. Progesterone synthesis and myelin
formation in peripheral nerves. Brain Res. Rev. 37, 343–359.
Shivanandappa, T., Venkatesh, S.A., 1997. Colorimetric assay method for 3beta-
hydroxy-delta5-steroid dehydrogenase. Anal. Biochem. 254 (1), 57–61.
Soma, K.K., Alday, N.A., Hau, M., Schlinger, B.A., 2004. Dehydroepiandrosterone
metabolism by 3b-hydroxysteroid dehydrogenase/D5-D4-isomerase in adult
zebra finch brain: sex difference and rapid effect of stress. Endocrinology 145,
1668–1677. http://dx.doi.org/10.1210/en.2003-0883.
Sundararaj, B.I., 1981. Reproductive Physiology of Teleost Fishes: A Review of
Present Knowledge and Needs for Future Research. United Nations
Development Programme, Food and Agriculture Organization of the United
Nations, Rome, pp. 1–82, FAO, ADCP/ REP/81/16.
Takase, M., Ukena, K., Yamazaki, T., Kominami, S., Tsutsui, K., 1999. Pregnenolone,
pregnenolonesulfate and cytochrome P450 side-chain cleavage enzyme in the
amphibian brain and their seasonal changes. Endocrinology 140, 1936–1944.
Takase, M., Haraguchi, S., Hasunuma, I., Kikuyana, S., Tsutsui, K., 2011. Expression of
cytochrome P450 side-chain cleavage enzyme mRNA in the brain of the Red
bellied newt Cynops pyrrhogaster. Gen. Comp. Endocrinol. 170, 468–474.
Tsutsui, K., Yamazaki, T., 1995. Avian neurosteroids I. Pregnenolone biosynthesis in
the quail brain. Brain Res. 678, 1–9.
Tsutsui, K., Ukena, K., Takase, M., Kohchi, C., Lea, R.W., 1999. Review: neurosteroid
biosynthesis in vertebrate brains. Comp. Biochem. Physiol. C Toxicol.
Pharmacol. 124, 121–129.
Ukena, K., Honda, Y., Inai, Y., Kohchi, C., Lea, R.W., Tsutsui, K., 1999a. Expression and
activity of 3b-hydroxysteroid dehydrogenase/D5-D4-isomerase in different
regions of the avian brain. Brain Res. 818, 536–542.
Ukena, K., Kohchi, C., Tsutsui, K., 1999b. Expression and activity of 3b-
hydroxysteroid dehydrogenase 5-4-isomerase in the rat purkinje neuron
during neonatal life. Endocrinology 140, 805–813.
Usui, M., Yamazaki, T., Kominami, S., Tsutsui, K., 1995. Avian neurosteroids. II.
Localization of a cytochrome P450scc-like substance in the quail brain. Brain
Res. 678, 10–20.
Vallarino, M., Mathieu, M., Do-Rego, J.L., Bruzzone, F., Chartrel, N., Luu-The, V.,
Pelletier, G., Vaudry, H., 2005. Ontogeny of 3b-hydrozysteroid dehydrogenase
and 5a-reductase in the frog brain. Ann. N.Y. Acad. Sci. 1040, 490–493. http://
dx.doi.org/10.1196/annals.1327.100.
Vanson, A., Arnold, A.P., Schlinger, B.A., 1996. 3b-hydroxysteroid dehydrogenase/
isomerase and aromatase activity in primary cultures of developing zebra finch
telencephalon: dehydroepiandrosterone as substrate for synthesis of
androstenedione and estrogens. In: Gen. Comp. Endocrinol. 102, 342–350.
http://dx.doi.org/10.1006/gcen.1996.0077.
Weidenfeld, J., Siegel, R.A., Chowers, I., 1980. In vitro conversion of pregnenolone to
progesterone by discrete brain areas of the male rat. J. Steroid. Biochem. 13,
961–963.
Yamamoto, N., Oka, Y., Amano, M., Aida, K., Hasegawa, Y., Kawashima, S., 1995.
Multiple gonadotropin – releasing hormones (GnRH)-immunoreactive systems
in the brain of the dwarf gourami, Colisa lalia: immunohistochemistry and
radioimmunoassay. J. Comp. Neurol. 355, 354–368.
Yu, L., Romero, D.G., Gomez-Sanchez, C.E., Gomez-Sanchez, E.P., 2002. Steroidogenic
enzyme gene-expression in the human brain. Mol. Cell. Endocrinol. 190, 9–17.
Zwain, I.H., Yen, S.S.C., 1999a. Neurosteroidogenesis in astrocytes, oligodendrocytes,
and neurons of cerebral cortex of rat brain. Endocrinology 140, 3843–3852.
Zwain, I.H., Yen, S.S.C., 1999b. Dehydroepiandrosterone: biosynthesis and
metabolism in the brain. Endocrinology 140, 880–887.