Gene 658 (2018) 136–145

Contents lists available at ScienceDirect

Gene
journal homepage: www.elsevier.com/locate/gene

Research paper

Molecular cloning and expression analysis of ammonium transporters in tea T

plants (Camellia sinensis (L.) O. Kuntze) under different nitrogen treatments
⁎
Fen Zhang, Yuan Liu, Liyuan Wang , Peixian Bai, Li Ruan, Chengcai Zhang, Kang Wei,
⁎
Hao Cheng
Key Laboratory of Tea Biology and Resources Utilization, Ministry of Agriculture, National Center for Tea Improvement, Tea Research Institute Chinese Academy of
Agricultural Sciences, 9 Meiling South Road, Hangzhou 310008, China

A R T I C LE I N FO A B S T R A C T

Keywords: Ammonium is a major inorganic nitrogen source for tea plant growth and is mainly taken up and transported by
Camellia sinensis ammonium transporters (AMTs). Here, we analyzed the NH4+ uptake kinetics of three tea cultivars, Longjing43
NH4+ uptake kinetics (LJ43), Zhongcha108 (ZC108) and Zhongcha302 (ZC302). The results revealed that ZC302 had a higher NH4+
Ammonium transporters uptake efficiency than the other two cultivars. The full CDS sequences of three Camellia sinensis ammonium
Cloning
transporter (CsAMT) genes, i.e., CsAMT1.1, CsAMT1.2 and CsAMT3.1, were cloned. Analysis of tissue-specific
Gene expression
expression showed that CsAMT1.2 followed a root-specific expression pattern, while transcripts of CsAMT1.1 and
CsAMT3.1 were mainly accumulated in leaves. The temporal course experiment on gene expression levels
showed CsAMT1.1 and CsAMT3.1 followed a reciprocal expression pattern in leaves as CsAMT1.1 was up-
regulated by a short time (2 h, 6 h) nitrogen (N) supply both in the leaves and buds of LJ43 and ZC108; and the
expression of CsAMT3.1 in leaves was increased by a long time (72 h) N supply, particularly in ZC302. Therefore,
we inferred that CsAMT1.1 and CsAMT3.1 might play important roles in photorespiratory ammonium meta-
bolism. The expression of CsAMT1.2 was extremely high in roots and can be greatly induced by N over a short
period of time, especially in ZC302; thus, we concluded CsAMT1.2 might play an important role in ammonium
uptake from soils in tea plant roots.

1. Introduction
Nitrogen (N) is one of the most important fundamental nutrients for
plant growth and productivity, and can exist as ammonium (NH4+),
nitrate (NO3−), amino acids, and other N-containing substances in soils
(Krapp et al., 2014). During the past several decades, the production
and application of chemical N fertilizers and crop breeding have re-
sulted in greatly increased global food production (Good et al., 2004).
However, excess use of N fertilizer has caused water eutrophication and
environmental pollution. It is therefore critically important to under-
stand how plants uptake, transport, and metabolize N to increase the N
utilization efficiency (NUE) in plants and reduce the consumption of N
fertilizer (Wang et al., 2012). Plant species differ greatly in their ca-
pacity of nitrogen utilization, and different cultivars of the same plant
species always have different characteristics in terms of their nitrogen
uptake and assimilation (Bao et al., 2015).
Tea is an aromatic beverage and is usually made from the leaves of
tea plants. The productivity of tea plant growth is mostly determined by
N fertilization. NH4+ and NO3− are the main available inorganic forms
of nitrogen. Plants mainly use NO3− in aerobic soils, while they use
NH4+ in flooded wetlands or acidic soils (Krapp, 2015). Tea plants have
been shown to be acid tolerant and are well adapted to NH4+-rich
conditions because of the high capacity for assimilation in their roots
(Ruan et al., 2007). Isotope tracing studies have revealed that tea plants
supplied with 15NH4+ absorbed significantly more 15N than those
supplied with 15NO3−. The kinetics of 15NH4+ and 15NO3− influx into
tea plants follow a classic biphasic pattern (Yang et al., 2013). Phy-
siological studies on NH4+ uptake in plant roots have provided evi-
dence of the existence of two transport systems for NH4+: a high-affi-
nity transport system (HATS) and a low-affinity transport system
(LATS) (Wang et al., 1993; Kronzucker et al., 1996; Couturier et al.,
2007).

Abbreviations: N, nitrogen; NUE, nitrogen utilization efficiency; HATS, high-affinity transport system; LATS, low-affinity transport system; DCD, dicyandiamide; AMT, ammonium
transporters; CDS, coding sequences; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Vmax, maximum absorption rate; Km, Michaelis Constant; α, Vmax/Km; SD, standard de-
viation; ANOVA, one-way analysis of variance; RT-PCR, reverse transcription PCR; qRT-PCR, quantitative real-time PCR; 1B2L, young shoots with two leaves and a bud; ML, mature
leaves; NN, normal nitrogen level; LN, low nitrogen level; TM, transmembrane helix
⁎
Corresponding authors.
E-mail addresses: wangly@tricaas.com (L. Wang), chenghao@tricaas.com (H. Cheng).

https://doi.org/10.1016/j.gene.2018.03.024
Received 1 October 2017; Received in revised form 2 March 2018; Accepted 7 March 2018
Available online 10 March 2018
0378-1119/ © 2018 Elsevier B.V. All rights reserved.
F. Zhang et al.
The uptake of ammonium and nitrate from the environment through
root cells is the first step in the nitrogen assimilation of plants. Genes
encoding the ammonium transporters, which are always regarded as
the major transfer tools for ammonium uptake, have been cloned and
characterized in many plant species (Sonoda et al., 2003a). There are
six members of the AMT-type ammonium transporter family in Arabi-
dopsis. AtAMT1-1, AtAMT1-2, AtAMT1-3, AtAMT1-5, and AtAMT2-1 are
mainly expressed in roots (Loqué and von Wirén, 2004), while the ex-
pression of AtAMT1-4 has been shown to be pollen-specific (Yuan et al.,
2009). The tomato plant harbors three AMT1 genes, LeAMT1-1,
LeAMT1-2 and LeAMT1-3, which exhibit differential regulation under
nitrogen treatment (von Wirén et al., 2000b). In rice, the ammonium
transporter family has four sub-families, OsAMT1, OsAMT2, OsAMT3
and OsAMT4, all of which are expressed in the roots. OsAMT1 has been
characterized as a HATS transporter, while the other three sub-families
have been characterized as LATS transporter. OsAMT1 members share
highly similar sequences but show distinct expression patterns (Sonoda
et al., 2003b; Loqué and von Wirén, 2004). Several studies have re-
vealed feedback regulation and distinct nitrogen-dependent regulation
for rice AMT genes, which differ from the genes in tomato or Arabidopsis
(Bao et al., 2015). Additionally, AMTs in other plant species, Brassica
napus (BnAMT1-2) (Pearson et al., 2002), Lotus japonicas (LjAMT1-1,
LjAMT1-2, LjAMT1-3, LjAMT2-1) (Simon-Rosin et al., 2003; D'Apuzzo
et al., 2004), the AMT gene family in the perennial poplar plant
(Couturier et al., 2007), and Pyrus betulifolia (PbAMT1-1) (Li et al.,
2014) have also been identified and characterized. The crystal structure
of the AMT protein has not been solved, except in prokaryotes such as
Escherichia coli and Archaeoglobus fulgidus (Zheng et al., 2004; Andrade
et al., 2005). So, the structural models of AMT proteins in plants were
mainly predicted based on the data of prokaryotes.
The process of NH4+ uptake and its relationship to AMTs has been
well studied in bacteria, fungi, and herbaceous plants; however, in tea
plants, as well as in many other perennial woody plants, there is very
little information about the molecular and genetic basis of ammonium
absorption and transport. In this study, we isolated and characterized
three functional ammonium transporter genes (CsAMTs) from the tea
plant. Together with the NH4+ uptake characteristics of different tea
cultivars, we detected the transcript accumulation of CsAMTs in dif-
ferent tissues under various nitrogen treatment conditions. Distinct
expression patterns of CsAMTs may indicate diverse physiological roles
of ammonium uptake in tea plants.
2. Materials and methods
2.1. Plant materials and growth conditions
One-year-old cutting seedlings from three tea cultivars, Longjing 43
(LJ43), Zhongcha108 (ZC108), and Zhongcha302 (ZC302), were se-
lected for this study. The seedlings were grown hydroponically in dis-
tilled water for 7 d and then exposed to 1/8 strength nutrient solution
for 1 week. The strength of the nutrient solution was thereafter in-
creased stepwise to 1/4 (week 2), half (weeks 3 and 4), and full (weeks
5–10). The composition of the full-strength nutrient solution contained
macronutrients (N, 2.0; P, 0.07; K, 0.6; Mg, 0.67; Ca, 0.53 mmol·L−1)
and micronutrients (Fe, 4.2; B, 7; Mn, 1; Zn, 0.67; Cu, 0.13; Mo, 0.33;
and Al, 70 μmol·L−1) (Ruan et al., 2007). NH4NO3 was used as the ni-
trogen (N) source. Each pot contained 16 L of nutrient solution, and
twenty seedlings per pot were used. The nutrient solutions were re-
placed every week, and their pH was adjusted to 5.0 ± 0.2 with 1 M
NaOH or 1 M H2SO4. The plants were grown under natural light and
60% relative humidity at a temperature of 30/22 °C (day/night). Fi-
nally, tea plant seedlings were grown with a normal nitrogen source
(2 mM N) for 6 weeks. Then, seedlings were transferred to a nitrogen-
deficient (without N) growth condition for 2 weeks before being
transferred to a different nutrient solution for treatment.
137
Gene 658 (2018) 136–145
2.2. Determination of NH4+ influx kinetics
A modified depletion method was used to measure NH4+ uptake
kinetics (Tylova-Munzarova et al., 2005; Zhang and Ruan, 2008). After
6 weeks of normal growth, seedlings of equal size were selected and
thoroughly washed with deionized water. They were then transplanted
to the nutrient solutions described above, but without N for 2 weeks to
elicit the starvation-induced maximal uptake response prior to the start
of the uptake experiments. After the starvation period, two seedlings
were transplanted to a pot filled with 400 mL of a continuously aerated
uptake nutrient solution containing N concentrations at 0.1, 0.2, 0.4,
1.0, 1.5, 2.0 mmol·L−1 prepared from (NH4)2SO4. The other nutrients
were the same as those described above, and the pH was adjusted to 5.0
at the beginning of the experiment. Dicyandiamide (DCD) was added
into the different nutrient solutions at the rate of 15% of the solutions'
pure NH4+-N content to prevent any potential nitrification (Cahalan
et al., 2015). Each treatment had three replicates. Water loss from
transpiration was replenished by weighing the pot every 12 h. After
24 h of NH4+ uptake by seedlings, the solutions were sampled and
stored (0 °C) prior to analysis. The NH4+ concentration of the solution
samples was measured by a SAN++ Continuous Flow Analyzer (CFA,
SKALAR, Netherlands). The roots were separated from the tea plant and
dried to a constant weight at 70 °C for 3 days in a drying oven (Med-
center Einrichtungen GmbH, Germany).The uptake rates were calcu-
lated by measuring depletion from the solution based on the root dry
weight (Tylova-Munzarova et al., 2005). The uptake kinetic parameters
were estimated by fitting a Michaelis-Menten model using the non-
linear curve fitting function of the scientific statistical graphics package
(Ritchie and Prvan, 1996).
V = VmaxC/(Km + C); α = Vmax/Km
where Vmax (μmol N g−1 root dry wt d−1) is the maximum absorption
rate; C is the concentration of N in the solution; Km (mmol N·L−1) is the
N concentration required to reach half of the Vmax, which represents
the affinity constant of NH4+ with cytoplasmic membrane binding
sites; and α is the ratio between Vmax and Km and was used to evaluate
the efficiency of NH4+ uptake at low N concentrations (Healey, 1980;
Harrison and Hurd, 2001). Curve fitting of the Michaelis-Menten
Equation was performed by Origin8.6, which gave the Vmax and Km of
the three tea cultivars.
2.3. Gene cloning and sequence analysis
Total RNA was extracted from mixed samples of roots and leaves of
LJ43 using the improved protocol for tea plants (Muoki et al., 2012).
Single-stranded cDNA was synthesized from 1.0 μg of total RNA using
the PrimeScript™ 1st Strand cDNA Synthesis Kit (TaKaRa, Japan), ac-
cording to the manufacturer's instructions. Sequences with complete
CDS of the CsAMT family genes were obtained from a transcriptome
that we previously generated from tea plants. All of the assembled se-
quences from transcriptome sequencing were analyzed with BLASTx
(NCBI) and were used as templates to design specific primers to clone
the full-length cDNA sequences of CsAMTs. Primers were designed by
Primer Premier5 software, as shown in Table 1. Reverse transcription
PCR (RT-PCR) was performed to isolate the full-length CDS of the
cDNA. PCR amplification was performed using Takara PrimeSTAR® HS
DNA Polymerase and LA Taq Hot Start Version (TaKaRa, Dalian,
China), and the sequence accuracy was confirmed by sequencing.
Sequence analyses and comparisons with known sequences were
performed using the NCBI BLAST server (http://www.ncbi.nlm.gov/
BLAST). The Predict protein function was used to predict TM helices
(https://ppopen.informatik.tu-muenchen.de/). The molecular weights
and theoretical pIs were predicted using the ProtParam tool (http://
web.expasy.org/protparam/). ProtCompVersion9.0 (http://linuxl.
Softberry.com/berry.phtml) was combined to predict the subcellular
localization of the proteins. Protscale (http://web.expasy.org/
F. Zhang et al. Gene 658 (2018) 136–145

Table 1
Primers for gene cloning and qRT-PCR analysis.

Gene Forward/reverse sequence (5′-3′) Produce Purpose

CsAmt1.1-F TCTAGTTCTCTCAGGTACCCACTGC 1494 bp Gene cloning

CsAmt1.1-R CTGAAAGTGGTTTGAACAGAGCACA Gene cloning
CsAmt1.2-F AAGTTGTCATGGCTTCCACTTTGGG 1542 bp Gene cloning
CsAmt1.2-R AACCGTCCGATTGCCCTTTGTACTA Gene cloning
CsAmt3.1-F ATATTAGGGGAGTCGCCGGAGT 1458 bp Gene cloning
CsAmt3.1-R GTAGCGACAGGATTAGACCACTTGA Gene cloning
GAPDH-q-F TTGGCATCGTTGAGGGTCT 206 bp qRT-PCR analysis
GAPDH-q-R CAGTGGGAACACGGAAAGC qRT-PCR analysis
CsAmt1.1-q-F TATTCGGCTCCGGCGTAATC 101 bp qRT-PCR analysis
CsAmt1.1-q-R AATTCGCGGACCTTCGATGA qRT-PCR analysis
CsAmt1.2-q-F GTTGTTCTCGGCTCGTTC 110 bp qRT-PCR analysis
CsAmt1.2-q-R CATTGCCCGTAATAAGTC qRT-PCR analysis
CsAmt3.1-q-F TTCCGCAAACCACCCAATA 132 bp qRT-PCR analysis
CsAmt3.1-q-R ATCCCGCCAACAAAATCA qRT-PCR analysis

protscale/) was used for hydrophobicity or hydrophilicity analysis of 3. Results

proteins, and SignalP 4.1 (http://www.cbs.dtu.dk/services/SignalP/)
was used for predicting the presence and location of signal peptide 3.1. Determination of the NH4+ uptake kinetics in different tea cultivars
cleavage sites. Conserved domains in various proteins were identified
using the PFAM database (http://pfam.xfam.org/). The MegAlign The characteristics of ammonium uptake in three tea cultivars were
software in the DNAStar package was used for the sequence alignment, fitted to a Michaelis-Menten model, which showed the uptake rate was
and phylogenetic trees were constructed using MEGA version 6.0. gradually increased in the nitrogen concentration. At the same nitrogen
Automated structure building was conducted by the SWISS-MODEL level, ZC302 had a higher nitrogen uptake efficiency than ZC108 and
services (http://swissmodel.expasy.org/), and the structures were LJ43, demonstrating a higher ammonium absorption affinity (Fig. 1).
analyzed in Chimera (http://www.cgl.ucsf.edu/chimera/) and Swiss- According to the ammonium uptake rate characteristics, LJ43 and
PdbViewer (http://spdbv.vital-it.ch/). ZC108 were more similar to one another.
As shown in Table 2, the Vmax followed the pattern ZC302 >
LJ43 > ZC108, as ZC302 had the highest absorption rate at a higher
2.4. Gene expression analysis by qRT-PCR nitrogen level. The α value indicated the affinity to NH4+ in tea plants
under low nitrogen treatment. ZC302 had the highest α value, which
Hydroponically grown seedlings in normal N level were harvested was far above the average value, indicating that ZC302 might be quite
as roots, young shoots with two leaves and a bud (1B2L), and mature adaptive to the nitrogen-deficiency environment.
leaves (ML) separately, and the mRNA levels of the CsAMT transcripts
were analyzed according to their organ-specificity. To study the tran-
3.2. Cloning and sequence analysis of CsAMTs
scriptional regulation of CsAMTs in different organs under nitrogen
treatment, hydroponically grown tea plant seedlings were exposed to a
Full-length CDSs of the CsAMT genes were amplified from the cDNA
nutrient solution without N for up to 2 weeks. They were then re-
samples reversed from total RNA isolated from LJ43 seedling leaves and
supplied with 0.2 mM N (0.1 mM NH4NO3, LN) and 2 mM N (1 mM
roots. One group of clones was identical to CsAMT1.1, while clones of
NH4NO3, NN). Then, the materials, including the roots, 1B2L and ML,
the other group were 72.8% identical to CsAMT1.1 at the amino acid
were collected at 0, 2, 6, 24, 72, 120, and 168 h after the start of ni-
level and were named CsAMT1.2. The deduced amino acid sequence of
trogen supply. The samples were immediately frozen in liquid nitrogen
CsAMT3.1 was characterized by a blast against OsAMT3.1 (Fig. 2) and
and stored at −80 °C until RNA extraction.
shared only a < 22% identity to CsAMT1.1 and CsAMT1.2. The genes
Total RNA extraction was performed with an improved protocol
were named based on their similarity to other species and the order of
(Muoki et al., 2012) and an RNAprep pure plant kit (TIANGEN, China).
their discovery. Gene sequence analysis indicated that the CDSs of
A total of 800 ng of RNA was used as a template for first strand cDNA
CsAMT1.1, CsAMT1.2 and CsAMT3.1 encoded 497, 513 and 485 amino
synthesis, which was performed using the FastQuant RT Kit (TIANGEN,
China) in a reaction volume of 20 μL according to the manufacturer's
instructions. Quantitative RT-PCR was performed using an ABi7500
real-time PCR machine (Applied Biosystems) with SYBR Green reagents
(Takara, Japan). The expression patterns were analyzed in 20 μL reac-
tions. The tea plant GAPDH gene is a housekeeping gene that was used
to quantify cDNA abundance. Primers were designed by primer-blast of
NCBI and are described in Table 1. RT-PCR was used to confirm the
primer specificity. Transcripts were quantified using the 2−ΔΔCt method
(Livak and Schmittgen, 2001). The qRT-PCR reactions were performed
with three biological replicates and three technical replicates.

2.5. Statistical analysis

Results were generated from triplicate experiments, and the data are
expressed as the mean and standard deviation ( ± SD). Differences
between the means were calculated using one-way analysis of variance Fig. 1. Kinetic absorption curves of NH4+ in three different tea cultivars. Data are pre-
sented as the means of three biological replicates ± SD.
(ANOVA) at a significance level of P0.05 in SPSS 19.0 software.

138
F. Zhang et al. Gene 658 (2018) 136–145

Table 2 Table 3
The characteristics of NH4+ uptake in tea plants. Physical and chemical characteristics of CsAMT.

Cultivars Vmax (μmoL J−1 DW h−1) Km (mmol·L−1) α (Vmax/Km) R2 Characteristic CsAMT1.1 CsAMT1.2 CsAMT3.1

ZC302 154.370 ± 20.32 0.869 ± 0.71 0.178 0.966 Number of amino acids 497 513 485
LJ43 73.937 ± 18.26 1.503 ± 0.36 0.049 0.951 Molecular weight (kDa) 52.99 54.68 52.40
ZC108 35.006 ± 7.27 0.652 ± 0.27 0.054 0.840 Theoretical PI 6.29 7.58 6.7
Mean 87.771 1.008 0.094 Total number of atoms 7405 7653 7391
Grand average of 0.452 0.389 0.5
Values are expressed as the means ± SD of three replicate experiments. hydropathicity
(GRAVY)
Signal peptide NO NO NO
acid residues, respectively, with predicted molecular masses of 52.99,
Sub-cellular localization Plasma Plasma Plasma
54.68 and 52.40 kDa (Table. 3). Prediction of the hydrophobicity of the (score) membrane membrane membrane
deduced amino acid sequences indicated that the GRAVY of the three (9.59) (9.60) (9.48)
proteins were all above zero, and they were all predicted to be located Transmembrane helices 11 11 11
prediction
in the plasma transmembrane, including 11 membrane helices. None of
the three proteins had signal peptides, indicating that they were all
hydrophobic non-secretory proteins. clades among the 3 AMT genes in the tea plant, as 2 genes were in the
Blast analysis was conducted through UniProtKB/Swiss-Prot (swis- AMT1 cluster. CsAMT3.1 was in a separate cluster and most similar to
sprot) against the same protein sequences in other species. The blast OsAMT3.1. The motif prediction revealed that CsAMT1.1 and
parameters were used as follows: Algorithm: PSI-BLAST (Position- CsAMT1.2 had the same number of motifs, unlike CsAMT3.1. Con-
Specific Iterated BLAST); Expected threshold: 0.01; Matrix: BLOSUM62; served domain analysis showed that all of the AMT proteins contain a
Gap Costs: Existence: 11 Extension: 1, and Organism: Angiosperms. We single ammonium transporter domain (PF00909).
obtained 19 similar sequences of AMTs in other species, including
Arabidopsis thaliana, Oryza sativa subsp. Japonica and Lycopersicum es-
culentum. All of the amino acid sequences were used to build a phylo- 3.3. Structure prediction of CsAMT proteins by homologous modeling
genetic tree (Fig. 3) with MEGA6.0. The results showed two major
Searching the PDB database allowed us to find a crystal structure

Fig. 2. The alignment of the predicted amino acid sequences of CsAMT1.1, CsAMT1.2 and CsAMT3.1 in tea plants obtained with the MegAlign software. Black boxes indicate conserved
amino acid residues.

139
F. Zhang et al.
Fig. 3. Phylogenetic tree of proteins encoded by the AMT genes from Arabidopsis thaliana, Oryza sativa subsp. Japonica, Lycopersicum esculentum and Camellia sinensis. Protein sequences
were aligned by ClustalW, and the tree was constructed by MEGA6.0 using the Neighbor-Joining method, with 1000 bootstrap replicates. The different labels show the new CsAMTs in
this study. The color figure represents the motif prediction and the conserved domain identification (PF00909). (For interpretation of the references to color in this figure legend, the
reader is referred to the web version of this article.)
model of Amt-1 from Archaeoglobus fulgidus and of Amt-B from
Escherichia coli; the predicted structure of the CsAMT protein was
mostly based on the structures from these species. The three-dimen-
sional structure of two prokaryotic AMTs has been determined at an
atomic resolution (Ludewig et al., 2007). These AMTs are trimers, in
which each subunit consists of 11 alpha helical transmembrane helices
(TM) arranged with a two-fold quasi-symmetry. Regardless of the de-
tails of the AMT transport mechanism, some properties of the plant
AMTs appear to be more consistent with a transporter-like system, but
not with channel-like transport. As predicted from the phylogenetic tree
(Fig. 3), CsAMT1.1 and CsAMT1.2 were clustered to the HATS sub-fa-
mily (AMT1), and CsAMT3.1 was predicted to be a LATS sub-family
(AMT2). We used Phy2 and Swiss-Model to predict the structural model
of the AMT proteins in the tea plants. The three CsAMTs all had 11
transmembrane helices with different locations (Fig. 4). There were two
beta-sheets between TM4 (S4) and TM5 (S5) of CsAMT1.2, which was
different from what observed in the proteins CsAMT1.1 and CsAMT3.1.
3.4. Tissue expression specificity of CsAMTs
The young shoots with two leaves and a bud (1B2L), mature leaves
(ML) and root samples of LJ43 were harvested separately for total RNA
extraction and transcript accumulation analysis (Fig. 5). The expression
level of CsAMT1.1 in 1B2L was used as a control. CsAMT1.1 had the
lowest expression level among the three CsAMTs and was mainly ex-
pressed in leaves. The accumulation of CsAMT1.2 transcripts was root-
specific, with very low expression levels in 1B2L and ML. CsAMT3.1
showed a ubiquitous expression pattern, with a relatively weak ex-
pression in roots and the highest expression in ML. From these results,
we speculated that CsAMT1.2 might play an important role in ammo-
nium uptake from the soil by roots. Meanwhile, CsAMT3.1 might play a
140
Gene 658 (2018) 136–145
role in ammonium transport between roots and leaves.
3.5. Temporal expression patterns of CsAMTs after nitrogen-resupply
The temporal gene expression levels of three CsAMTs from 2 h to
168 h after nitrogen-resupply were measured in the three tea cultivars.
Two N levels, 2 mM N (NN) and 0.2 mM N (LN) were used in this study.
The expression levels of CsAMT1.1 in 1B2L and ML in LJ43 and
ZC108 were significantly up-regulated at 2 and 6 h after N-resupply
compared with that in ZC302 (Fig. 6). However, the CsAMT1.1 gene in
ZC302 was significantly increased at 72–168 h after the N treatment in
1B2L. Constitutive expression of CsAMT3.1 was observed in LJ43 and
ZC108 at different timepoints after nitrogen resupply. In ZC302, the
transcript levels of CsAMT3.1 were downregulated for a short time (2 h,
6 h) before increasing to their highest level at 72 h under the NN and LN
treatment. In ML, CsAMT3.1 was suppressed for a short time and in-
creased significantly at 72 h. However, for ZC302, treatment with LN
was more significant than the NN treatment, contrary to expression
regulation in ZC108 and LJ43, which had high expression levels after
NN treatment for 72 h. Thus, these results revealed that under nitrogen
treatment, CsAMT1.1 expression was increased earlier, mainly in LJ43
and ZC108, and CsAMT3.1 expression was mainly increased after 72 h,
especially in ZC302. This finding might relate to the tea cultivars' ni-
trogen transport characteristics from roots to leaves.
The expression of CsAMT1.2 in the roots of the three tea cultivars
steeply increased at 2 h and 6 h after nitrogen resupply (Fig. 7A),
especially in ZC302, and was increased by > 20-fold in NN and 10-fold
in LN. Compared to CsAMT1.2, the transcriptional level of CsAMT3.1 in
roots was not obviously induced by nitrogen, which was changed
by < 3-fold (Fig. 7B). Thus, CsAMT1.2 might play a major role in tea
plant roots during ammonium uptake from the environment.
F. Zhang et al.
Fig. 4. Homology modeling of the CsAMTs. Structural homology models were generated in SWISS-MODEL. The protein chain is colored blue at the N terminus and red at the C terminus,
each of the three CsAMTs are predicted to include 11 transmembrane helices, which are numbered in accordance with yellow cube. (For interpretation of the references to color in this
figure legend, the reader is referred to the web version of this article.)
4. Discussion
4.1. The uptake characteristics of ammonium varied in the different tea
cultivars
Increasing plant NUE is essential for the development of sustainable
agriculture (Xu et al., 2012). N uptake as the first step of NUE is dif-
ferent at high and low N supplies, indicating its great potential for
improving the NUE of plants. The Michaelis-Menten model describes
carrier-mediated ion transport in terms of two kinetic parameters,
Vmax and Km. Vmax is the maximal uptake rate, and Km is the nutrient
concentration where V = Vmax/2. The slope of the initial linear por-
tion of the curve (Vmax/Km, α) is more useful than Km for comparing
the uptake abilities of different species at low nutrient concentrations
(Harrison et al., 1989). A high α indicates a high affinity for nutrients at
low concentrations, while a high Vmax indicates an ability to rapidly
141
Gene 658 (2018) 136–145
take up nutrients when their concentration is high (Healey, 1980;
Harrison and Hurd, 2001). In tea plants, the kinetics of ammonium and
nitrate influx followed the classic pattern at low nitrogen levels (Yang
et al., 2013). In this research, we used a modified depletion method to
study the ammonium uptake rate of three different tea cultivars, ZC302,
LJ43 and ZC108. The uptake kinetics for NH4+ under different N
concentrations showed that ZC302 had the highest Vmax and α,
meaning that ZC302 may have good adaptability to the low nitrogen
levels of the environment. LJ43 might prefer higher nitrogen levels, as
it had the lowest α value (Table 2). Compared to ZC302, the char-
acteristics of ZC108 were more similar to those of LJ43, and its Vmax
was the lowest of the three cultivars, suggesting its relative insensitivity
to higher nitrogen fertilizer. The study of the N uptake kinetics of
Phragmites and Glyceria revealed species-specific differences (Tylova-
Munzarova et al., 2005); moreover, our study showed that the ammo-
nium uptake character also varied among different cultivars of the same
F. Zhang et al.
Fig. 5. Organ specificity of CsAMT genes. The different colored columns indicate the
different tissues. 1B2L represents young shoots with two leaves and a bud, while ML
represents mature leaves.
species, and ZC302 had the highest affinity to ammonium at low ni-
trogen level.
4.2. Molecular cloning and characteristics of the CsAMT genes
Ammonium acquisition by plant roots is mainly dependent on am-
monium transporters (AMTs), ubiquitous plasma membrane proteins
with essential roles in transporting ammonium/ammonia in all organ-
isms. Ammonium-triggered feedback inhibition could control AMT ac-
tivity to avoid cellular ammonium toxicity (Yuan et al., 2013). In
plants, the kinetic properties and regulatory mechanisms of AMTs vary,
and AMTs can be subdivided according to their amino-acid sequences
into three subfamilies: a large subfamily of AMT1 genes and two ad-
ditional subfamilies (von Wirén et al., 2000a). The molecular char-
acteristics and evolutionary history of AMTs in woody species are re-
latively poorly understood. In the Populus trichocarpa genome, 16 AMT
genes forming four clusters have been identified (Wu et al., 2015). We
isolated three functional ammonium transporters from tea plants that
were cloned from the transcription level and could be divided into two
different subfamilies: AMT1 and AMT2. CsAMT1.1 and CsAMT1.2 were
similar to each other, in both their amino acid sequences and protein
structures. They all had three conserved domain motifs and clustered to
the same AMT1 subfamily. CsAMT3.1 was distantly related to the two
members of the CsAMT1 family and only had one motif similar to the
other two genes, which could be divided into the AMT2 subfamily.
More than 200 genes have been discovered in ammonium transport
proteins (methylamine permeases/ammonium transporters/rhesus),
including bacteria, fungi, plants, and animals. These genes are 400–450
aa in length and are predicted to have 10–12 transmembrane helices,
142
Gene 658 (2018) 136–145
with a C-terminal cytoplasmic extension (Zheng et al., 2004). AtAMT1.1
and AtAMT1.3 is localized to the plasma membrane of Arabidopsis root
cells (Loqué et al., 2006). CsAMTs also have 11 transmembrane helices
of 485–513 aa and are predicted to be localized to the plasma mem-
brane (Table 3). Ammonium is the primary nitrogen source for plant
nitrogen metabolism; therefore, plasma membrane localization re-
presents a common feature of plant AMT proteins (Yuan et al., 2009).
The crystal structure of AmtB of Escherichia coli revealed that AmtB may
be considered a slowly conducting channel rather than a transporter
(Zheng et al., 2004). Amt-1 from Archaeoglobus fulgidus seemed to be an
ammonium transporter with a compact timer of 11 transmembrane
helices per monomer and a central channel for substrate conduction in
each monomer (Andrade et al., 2005). However, no crystal structures of
this protein in plants have been reported; thus, the structures of the
CsAMTs are mostly based on the two known prokaryote structures.
4.3. The expression patterns of the CsAMT genes under different nitrogen
treatments in different tea cultivars
The CsAMT1 genes followed organ-specific expression patterns.
CsAMT1.1 was mainly expressed in young aerial tissues, and the ac-
cumulation of CsAMT1.2 transcripts was root-specific, with almost no
expression in buds and leaves. Unlike the CsAMT1s, CsAMT3.1 was
found in almost all major organs and had the highest expression in
mature leaves. These findings were consistent with results obtained in
rice (Sonoda et al., 2003a; Suenaga et al., 2003), Arabidopsis thaliana
(Gazzarrini et al., 1999; Sohlenkampa et al., 2000), and tomato (von
Wirén et al., 2000b). Ammonium transporters allow ammonium to be
moved from intracellular production sites to consumption sites (Howitt
and Udvardi, 2000). Plant AMT proteins are believed to play major
roles in the uptake of soil ammonium in roots (Loqué and von Wirén,
2004) and may have the potential to improve nitrogen use efficiency
(Ranathunge et al., 2014). AMTs which are also expressed in shoots and
leaves, may play roles in ammonium recycling. AtAMT2 is expressed in
various tissues, indicating that the transporter is likely to play diverse
roles in plants (Sohlenkamp et al., 2002). These distinct expression
patterns may support the fact that individual members of the AMT fa-
mily may function not only in ammonium uptake in roots but also in
ammonium recycling during leaf senescence or photorespiration
(Howitt and Udvardi, 2000; von Wirén et al., 2000a; Couturier et al.,
2007).
As AMT1 members have been characterized as high-affinity am-
monium transport genes, we considered to utilize them for demon-
strating the molecular mechanisms of ammonium uptake and transport
in tea plants. CsAMT3.1 also needs to be studied for its function in a
sufficient nitrogen environment. Based on the tissue-specific char-
acteristics of the CsAMT genes, we separately analyzed the gene ex-
pression in young shoots with two leaves and a bud (1B2L), mature
leaves (ML) and roots in tea plants under varied nitrogen treatments.
The members of the AMT gene family always had different expression
Fig. 6. The gene expression levels in the young
shoots with two leaves and a bud (1B2L) and the
mature leaves (ML) of CsAMT1.1 and CsAMT3.1
under different N concentrations varied over
time. NN represents normal N (2 mM), and LN
represents low N (0.2 mM). The average values of
three biological replicates were used to generate
a heat map using MeV software. The intensity
value bars are shown above the heat map. Green
represents low expression, and red denotes high
expression. (For interpretation of the references
to color in this figure legend, the reader is re-
ferred to the web version of this article.)
F. Zhang et al.
Fig. 7. The temporal expression patterns of CsAMT1.2 (A) and CsAMT3.1 (B) in roots subjected to nitrogen-resupply treatment. The error bars indicate the standard deviation among the
three replicates. The data are given as the means of three biological replicates ± SD. The lowercase letters represent significant differences at P < 0.05.
levels at different nitrogen levels. It is generally accepted that nitrate
and ammonium uptake systems are partly controlled by the level of
gene expression (Rawat et al., 1999). In Arabidopsis, ammonium influx
into roots and the AtAMT1.1 mRNA expression levels are highly cor-
related when the plant nitrogen (N) status is varied (Kaiser et al., 2002).
A reciprocal expression type of AtAMT1.1 suggests that Arabidopsis
could undergo rapid resource reallocation in plants grown under dif-
ferent nitrogen supply regimens (Engineer and Kranz, 2007). Higher
expression of AtAMT2 in shoots compared to in roots implies that this
protein may play a role in photorespiratory ammonium metabolism
(Sohlenkampa et al., 2000). AtAMT1.2 transposon insertion lines have a
reduced high-affinity ammonium uptake capacity in roots (Yuan et al.,
2007). In rice, the accumulation of OsAMT1.2 suggests that it mainly
functions in ammonium-enriched soils (Sonoda et al., 2003a). In our
study, CsAMT1.1 and CsAMT3.1 were mostly expressed in leaves and
buds, and CsAMT1.1 expression could be induced by nitrogen in short
time (2 h, 6 h) in LJ43 and ZC108, but was weakly changed in ZC302
(Fig. 6); CsAMT3.1 was suppressed for a short time and increased more
significantly at 72 h after nitrogen resupply in the three tea cultivars,
especially in ZC302 (Fig. 6). These results showed that CsAMT1.1 and
CsAMT3.1 showed a reciprocal expression pattern during the nitrogen
treatment period. The regular transcriptional levels of the AMT genes
were changed among the three tea cultivars, and the change of AMT
genes in ZC108 and LJ43 was more similar to that in ZC302 based on
their ammonium uptake characteristics. CsAMT1.2 was a high-affinity
ammonium transporter gene that was involved in NH4+ uptake and
showed significant increases at the transcriptional level after nitrogen
143
Gene 658 (2018) 136–145
resupply (Fig. 7). The Vmax of ZC302 was higher than those of LJ43
and ZC108, and the transcript level increases of the CsAMT1.2 gene
were higher under the LN and NN treatment conditions among the three
cultivars, suggesting the possibility that increased NH4+ influx in tea
plants is mainly related to CsAMT1.2 expression.
Trees are adapted to survive over a much longer time-scale than
annual plant species (Couturier et al., 2007). Plants have developed
adaptive responses that allow them to cope with nitrogen (N) fluctua-
tion in the soil and maintain growth despite changes in external N
availability (Krapp et al., 2014). To study the regulation of ammonium
uptake in tea plants, we isolated three ammonium transporter genes
(CsAMT). The transcript levels of CsAMT were detected in different
tissues from three tea cultivars under nitrogen treatment. Thus far, the
present data demonstrated that both the adapted substrate affinities
and transcriptional regulation of CsAMT genes made the plant to re-
spond differently to varying nutritional conditions in the environment.
5. Conclusion
In summary, three ammonium transporter family members in tea
plants have been cloned, and the sequence characteristics and expres-
sion patterns were analyzed. Expression analysis indicated that
CsAMT1.1 and CsAMT3.1 in leaves followed a reciprocal expression
pattern over the time of nitrogen supply. CsAMT1.2 was root-specific
and could be rapidly induced by nitrogen. ZC302 had the highest affi-
nity for NH4+ at low N level and the highest CsAMT1.2 expression level
induced by different nitrogen treatments. We inferred that CsAMT1.1
F. Zhang et al.
and CsAMT3.1 might play important roles in photorespiratory ammo-
nium metabolism, and CsAMT1.2 might play a vital role in promoting
NH4+ uptake in tea plants from soils.
Availability of supporting data
The nucleotide and amino acid sequences of CsAMT1.1, CsAMT1.2
and CsAMT3.1 had been submitted to NCBI and accepted by GenBank,
and the accession numbers were as follows: KU361592, KU361593,
KP338998.
Conflict of interest
The authors declare that they have no conflict of interest.
Authors' contributions
HC, LW and FZ conceived and designed research. CZ and LR pro-
vided valuable research design insights. YL conducted the NH4+ uptake
experiment. FZ and PB performed tissue sampling and RNA prepara-
tion. FZ carried out data analysis and wrote the manuscript draft. LW,
KW and HC edited and revised the manuscript. All authors read and
approved the final manuscript.
Acknowledgements
The study was supported by the National Natural Science
Foundation of China (31570695), Central Public-interest Scientific
Institution Basal Research Fund (NO. 1610212016009), Earmarked
Fund for China Agriculture Research System (CARS-19) and the Major
Project of Agricultural Science and Technology in Breeding of Tea Plant
in Zhejiang Province (2016C02053).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://
doi.org/10.1016/j.gene.2018.03.024.
References
Andrade, S.L., Dickmanns, A., Ficner, R., Einsle, O., 2005. Crystal structure of the ar-
chaeal ammonium transporter Amt-1 from Archaeoglobus fulgidus. Proc. Natl. Acad.
Sci. U. S. A. 102, 14994–14999.
Bao, A., Liang, Z., Zhao, Z., Cai, H., 2015. Overexpressing of OsAMT1-3, a high affinity
ammonium transporter gene, modifies rice growth and carbon-nitrogen metabolic
status. Int. J. Mol. Sci. 16, 9037–9063.
Cahalan, E., Ernfors, M., Müller, C., Devaney, D., Laughlin, R.J., Watson, C.J., Hennessy,
D., Grant, J., Khalil, M.I., McGeough, K.L., Richards, K.G., 2015. The effect of the
nitrification inhibitor dicyandiamide (DCD) on nitrous oxide and methane emissions
after cattle slurry application to Irish grassland. Agric. Ecosyst. Environ. 199,
339–349.
Couturier, J., Montanini, B., Martin, F., Brun, A., Blaudez, D., Chalot, M., 2007. The
expanded family of ammonium transporters in the perennial poplar plant. New
Phytol. 174, 137–150.
D'Apuzzo, E., Rogato, A., Simon-Rosin, U., El Alaoui, H., Barbulova, A., Betti, M., Dimou,
M., Katinakis, P., Marquez, A., Marini, A.M., Udvardi, M.K., Chiurazzi, M., 2004.
Characterization of three functional high-affinity ammonium transporters in Lotus
japonicus with differential transcriptional regulation and spatial expression. Plant
Physiol. 134, 1763–1774.
Engineer, C.B., Kranz, R.G., 2007. Reciprocal leaf and root expression of AtAmt1.1 and
root architectural changes in response to nitrogen starvation. Plant Physiol. 143,
236–250.
Gazzarrini, S., Lejay, L., Gojon, A., Ninnemann, O., Frommer, W.B., von Wirén, N., 1999.
Three functional transporters for constitutive, diurnally regulated, and starvation-
induced uptake of ammonium into Arabidopsis roots. Plant Cell 11, 937–949.
Good, A.G., Shrawat, A.K., Muench, D.G., 2004. Can less yield more? Is reducing nutrient
input into the environment compatible with maintaining crop production? Trends
Plant Sci. 9, 597–605.
Harrison, P.J., Hurd, C.L., 2001. Nutrient physiology of seaweeds: application of concepts
to aquaculture. Cah. Biol. Mar. 42, 71–82.
Harrison, P., Parslow, J.S., Conway, H.L., 1989. Determination of nutrient uptake kinetic
parameters: a comparison of methods. Mar. Ecol. Prog. Ser. 52, 301–312.
Healey, F.P., 1980. Slope of the Monod equation as an indicator of advantage in nutrient
144
Gene 658 (2018) 136–145
competition. Microb. Ecol. 5, 281–286.
Howitt, S.M., Udvardi, M.K., 2000. Structure, function and regulation of ammonium
transporters in plants. Biochim. Biophys. Acta 1465, 152–170.
Kaiser, B.N., Rawat, S.R., Siddiqi, M.Y., Masle, J., Glass, A.D., 2002. Functional analysis of
an Arabidopsis T-DNA “knockout” of the high-affinity NH4+ transporter AtAMT1;1.
Plant Physiol. 130, 1263–1275.
Krapp, A., 2015. Plant nitrogen assimilation and its regulation: a complex puzzle with
missing pieces. Curr. Opin. Plant Biol. 25, 115–122.
Krapp, A., David, L.C., Chardin, C., Girin, T., Marmagne, A., Leprince, A.S., Chaillou, S.,
Ferrario-Mery, S., Meyer, C., Daniel-Vedele, F., 2014. Nitrate transport and signalling
in Arabidopsis. J. Exp. Bot. 65, 789–798.
Kronzucker, H.J., Siddiqi, M.Y., Glass, A.D., 1996. Kinetics of NH₄+ influx in spruce. Plant
Physiol. 110, 733–779.
Li, H., Cong, Y., Lin, J., Chang, Y.H., 2014. Molecular cloning and identification of an
ammonium transporter gene from pear. Plant Cell Tissue Organ Cult. 120, 441–451.
Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2−ΔΔCT method. Methods 25, 402–408.
Loqué, D., von Wirén, N., 2004. Regulatory levels for the transport of ammonium in plant
roots. J. Exp. Bot. 55, 1293–1305.
Loqué, D., Yuan, L., Kojima, S., Gojon, A., Wirth, J., Gazzarrini, S., Ishiyama, K.,
Takahashi, H., von Wirén, N., 2006. Additive contribution of AMT1;1 and AMT1;3 to
high-affinity ammonium uptake across the plasma membrane of nitrogen-deficient
Arabidopsis roots. Plant J. 48, 522–534.
Ludewig, U., Neuhauser, B., Dynowski, M., 2007. Molecular mechanisms of ammonium
transport and accumulation in plants. FEBS Lett. 581, 2301–2308.
Muoki, R.C., Paul, A., Kumari, A., Singh, K., Kumar, S., 2012. An improved protocol for
the isolation of RNA from roots of tea (Camellia sinensis (L.) O. Kuntze). Mol.
Biotechnol. 52, 82–88.
Pearson, J.N., Finnemann, J., Schjoerring, J.K., 2002. Regulation of the high-affinity
ammonium transporter (BnAMT1;2) in the leaves of Brassica napus by nitrogen status.
Plant Mol. Biol. 49, 483–490.
Ranathunge, K., El-Kereamy, A., Gidda, S., Bi, Y.M., Rothstein, S.J., 2014. AMT1;1
transgenic rice plants with enhanced NH4+ permeability show superior growth and
higher yield under optimal and suboptimal NH4+ conditions. J. Exp. Bot. 65,
965–979.
Rawat, S.R., Silim, S.N., Kronzucker, H.J., Siddiqi, M.Y., Glass, A.D., 1999. AtAMT1 gene
expression and NH4+ uptake in roots of Arabidopsis thaliana: evidence for regulation
by root glutamine levels. Plant J. 19, 143–152.
Ritchie, R.J., Prvan, T., 1996. A simulation study on designing experiments to measure
the km of Michaelis-Menten kinetics curves. J. Theor. Biol. 178, 239–254.
Ruan, J., Gerendas, J., Hardter, R., Sattelmacher, B., 2007. Effect of nitrogen form and
root-zone pH on growth and nitrogen uptake of tea (Camellia sinensis) plants. Ann.
Bot. 99, 301–310.
Simon-Rosin, U., Wood, C., Udvardi, M.K., 2003. Molecular and cellular characterisation
of LjAMT2;1, an ammonium transporter from the model legume Lotus japonicus. Plant
Mol. Biol. 51, 99–108.
Sohlenkamp, C., Wood, C.C., Roeb, G.W., Udvardi, M.K., 2002. Characterization of
Arabidopsis AtAMT2, a high-affinity ammonium transporter of the plasma membrane.
Plant Physiol. 130, 1788–1796.
Sohlenkampa, C., Sheldenb, M., Howittb, S., Udvardia, M., 2000. Characterization of
Arabidopsis AtAMT2, a novel ammonium transporter in plant. FEBS 467, 273–278.
Sonoda, Y., Ikeda, A., Saiki, S., von Wirén, N., Yamaya, T., Yamaguchi, J., 2003a. Distinct
expression and function of three ammonium transporter genes (OsAMT1;1-1;3) in
Rice. Plant Cell Physiol. 44, 726–734.
Sonoda, Y., Ikeda, A., Saiki, S., Yamaya, T., Yamaguchi, J., 2003b. Feedback regulation of
the ammonium transporter gene family AMT1 by clutamine in rice. Plant Cell
Physiol. 44, 1396–1402.
Suenaga, A., Moriya, K., Sonoda, Y., Ikeda, A., von Wirén, N., Hayakawa, T., Yamaguchi,
J., Yamaya, T., 2003. Constitutive expression of a novel-type ammonium transporter
OsAMT2 in rice plants. Plant Cell Physiol. 44, 206–211.
Tylova-Munzarova, E., Lorenzen, B., Brix, H., Votrubova, O., 2005. The effects of NH4+
and NO3− on growth, resource allocation and nitrogen uptake kinetics of Phragmites
australis and Glyceria maxima. Aquat. Bot. 81, 326–342.
Wang, M.Y., Siddiqi, M.Y., Ruth, T.J., Glass, A.D.M., 1993. Ammonium uptake by rice
roots (II. Kinetics of 13NH4+ influx across the Plasmalemma). Plant Physiol. 103,
1259–1267.
Wang, Y.Y., Hsu, P.K., Tsay, Y.F., 2012. Uptake, allocation and signaling of nitrate. Trends
Plant Sci. 17, 458–467.
von Wirén, N., Lauter, F.R., Ninnemann, O., Gillissen, B., Liu, P.R., Engels, C., Jost, W.,
Frommer, W.B., 2000a. Differential regulation of three functional ammonium
transporter genes by nitrogen in root hairs and by light in leaves of tomato. Plant J.
21, 167–175.
von Wirén, N., Gazzarrini, S., Gojon, A., Frommer, W.B., 2000b. The molecular phy-
siology of ammonium uptake and retrieval. Curr. Opin. Plant Biol. 3, 254–261.
Wu, X., Yang, H., Qu, C., Xu, Z., Li, W., Hao, B., Yang, C., Sun, G., Liu, G., 2015. Sequence
and expression analysis of the AMT gene family in poplar. Front. Plant Sci. 6, 337.
Xu, G., Fan, X., Miller, A.J., 2012. Plant nitrogen assimilation and use efficiency. Annu.
Rev. Plant Biol. 63, 153–182.
Yang, Y.Y., Li, X.H., Ratcliffe, R.G., Ruan, J.Y., 2013. Characterization of ammonium and
nitrate uptake and assimilation in roots of tea plants. Russ. J. Plant Physiol. 60,
91–99.
Yuan, L., Loque, D., Kojima, S., Rauch, S., Ishiyama, K., Inoue, E., Takahashi, H., von
Wiren, N., 2007. The organization of high-affinity ammonium uptake in Arabidopsis
roots depends on the spatial arrangement and biochemical properties of AMT1-type
transporters. Plant Cell 19, 2636–2652.
Yuan, L., Graff, L., Loque, D., Kojima, S., Tsuchiya, Y.N., Takahashi, H., von Wiren, N.,
F. Zhang et al.
2009. AtAMT1;4, a pollen-specific high-affinity ammonium transporter of the plasma
membrane in Arabidopsis. Plant Cell Physiol. 50, 13–25.
Yuan, L., Gu, R., Xuan, Y., Smith-Valle, E., Loqué, D., Frommer, W.B., von Wirén, N.,
2013. Allosteric regulation of transport activity by heterotrimerization of Arabidopsis
ammonium transporter complexes in vivo. Plant Cell 25, 974–984.
145
Gene 658 (2018) 136–145
Zhang, L., Ruan, J., 2008. Comparison on research methods for fluoride uptake kinetics of
tea plant. J. Tea Sci. 28, 195–200 (in Chinese).
Zheng, L., Kostrewa, D., Berneche, S., Winkler, F.K., Li, X.D., 2004. The mechanism of
ammonia transport based on the crystal structure of AmtB of Escherichia coli. Proc.
Natl. Acad. Sci. U. S. A. 101, 17090–17095.