Sunteți pe pagina 1din 21

Sources of taxonomic information

Prof. Stephen Boatwright


Department of Biodiversity and Conservation Biology
TAXONOMIC EVIDENCE

Morphology
Anatomy Chemistry Chromosomes Semantides
Popularity

Today:
Combined
/total
evidence
approach

Time
SOURCES OF TAXONOMIC INFORMATION

• Any data that show differences from species to species are of taxonomic significance
• Forms part of taxonomic evidence
• Wide range of information from different sources should be utilised to obtain natural
classification systems
• Characters selected are those that are easily observed and which show promise of
being reliable and discriminating in taxon delimitation
• Traditionally morphological characters used as they are easy to observe, even in
pressed material
• Forms the basis of virtually all classification systems
• Still most common feature used

Macromorphology:

• Study of structure and form of plants


• Extensive terminology used to describe morphological features (see practical notes)
• Distinction between vegetative and reproductive characters
• In plants vegetative characters often unreliable because of superficial similarities
between unrelated plants
SOURCES OF TAXONOMIC INFORMATION
Vegetative morphology:

• Growth form (habit), root type, stem type, structure of buds,


leaves, stipules etc.
• In Poaceae for example growth habit, branching of stems,
structure of ligule and colour of stems generally used

Reproductive morphology:

• Structure and form of the inflorescence, flower, calyx, corolla,


stamens, ovaries, ovules, fruit, seeds etc. Examples:
• Asteraceae and Poaceae – inflorescence and scale leaves
• Fabaceae – stamens and floral symmetry
• Scrophulariaceae and Lamiaceae – fusion of corolla,
stamens
• Brassicaceae and Apiaceae – fruits
• Caryophyllaceae – fruits
SOURCES OF TAXONOMIC INFORMATION
Micromorphology (anatomy):

• A study of the structure of cells and tissues


• Metcalfe and Chalk (1950) ‘Anatomy of the dicotyledons’ and Metcalfe (1960)
‘Anatomy of the monocotyledons’ are among the classical reference works on
anatomy
• Not more or less reliable than other characters, mostly used in addition to other
characters
• More often used to prove that taxa are not related and particularly useful in
determining correct position of deviating or isolated taxa
• Characters mostly conservative in nature and useful in supraspecific ranks (genera,
tribes, families)
• Qualitative differences of greater value than quantitative (e.g. type of hairs as
opposed to hair density)
• Practical applications of anatomy:
• Ontogenetic studies to determine true nature of organs and tissues
• Identification of fossils, e.g. petrified wood
• Identify herbarium material without flowers or fruit
• Identification of small pieces of plant tissue (forensic studies, narcotics, animal
feeding)
SOURCES OF TAXONOMIC INFORMATION
• Representative material is chosen (three or more repetitions)
• Comparable material is used, e.g. from middle portion of
petiole, branch wood vs trunk wood etc.
• Voucher specimens lodged in herbarium of material used
• Characters studies:
Secondary xylem:
1. Growth layers – present or absent
2. Trachea – distribution and number; shape, wall thickness, size,
perforation plates; pores
3. Tracheids and fibes – types, wall thickness, length, sculpture
4. Rays – types, abundance, size, pores
5. Axial parenchyma – distribution, stippels
6. Other – crystals, intercellular canals and more
Leaf anatomy:
1. Cuticle – thickness, surface sculpturing
2. Epidermis – trichomes; shape of cells, wall thickness
3. Stomata – distribution and position; guard cells and subsidiary
cells; different types (anomocytic, anisocytic, paracytic, diacytic,
actinocytic, tetracytic, cyclocytic)
4. Hypodermis – shape of cells, cell wall thickness
5. Schlerenchyma – sclereids, fibres
6. Mesophyll – types, morphology, dorsiventral vs bilateral; canals
7. Venation – structure of veins
SOURCES OF TAXONOMIC INFORMATION
• Anatomy of petiole has taxonomic value as
not influenced by environmental factors
• Trichomes (hairs and glandular hairs) of
practical value, view under SEM which gives
high resolution and is quick and easy

Preparation of microscope slides:

1. Fixation: to kill all cells and minimize


distortion. FAA (formalin, acetic acid, alcohol,
90:5:5)
2. Dehydration: remove all water from tissue
3. Embedding: to support tissues, paraffin wax
or plastic resin used. Wax or resin must
penetrate the tissues in fluid form and then
harden
4. Sectioning: section by hand or by using a
microtome
5. Staining: to make different cells and tissues
visible. Toluidine blue, Saffranin and Fast green
used mostly
6. Mounting: stained sections mounted
temporarily or permanently to microscope slide
SOURCES OF TAXONOMIC INFORMATION
Cytology: study of taxonomic value of chromosomes

Chromosome number:
• Number of chromosomes in all individuals of a species
normally constant and closely related species of same
genus usually have same number. Thus a conservative
character and useful and subfamilial, tribal and generic
levels
• Mitotic counts (in sporophytic tissue) diploid number
(2n) of chromosomes given
• Meiotic counts (and mitotic counts in gametophytic
tissue) haploid number (n) given
• Chromosomes often occur in multiples of each other –
polyploidy. Known as diploids, tetraploids, hexaploids,
etc.
• Basic set of chromosomes which transfers genetic
information known as the base number or basic
chromosome number
• Euploidy – when ploidy levels form multiples of each
other, e.g. 2n=14, 28, 42, 56, 70
• Aneuploidy – when there is a loss or gain of one or
more chromosomes
SOURCES OF TAXONOMIC INFORMATION
Chromosome structure:
• Position of centromeres: metacentric – middle;
acrocentric – near one point; telocentric - terminal
• Size: relative sizes rather than absolute size
• Secondary thickenings (satellites): presence of satellites
important (may be confused for extra chromosomes
• Appearance of basic set of chromosomes under light
microscope at metaphase – karyotype
• Represented schematically by ideograms or karyograms

Chromosome behaviour:
• Pairing and migration of chromosomes during meiosis is
studied, especially for occurrences of deviating
behaviour
• Study of pairing behaviour (genome analysis) is most
important aid in cytogenetics (study of the role of
chromosomes in heredity)
• Chromosomes studies in any rapidly dividing cells
• Mitosis – meristems of stem buds and root tips
• Meiosis – spore mother cells in anthers of young flower
buds
SOURCES OF TAXONOMIC INFORMATION
Reproductive Biology:
Breeding systems of a plant is the manner, pattern and degree to which it interbreeds
with plants of the same taxon or of different taxa

Breeding systems of taxonomic value because:


• Degree of interbreeding which occurs determines the variation pattern of a taxon to a
large extent and as a result also the circumscription of taxa
• Knowledge of breeding system of plants often helps to solve complex taxonomic
problems
• Study of breeding systems is somewhat necessary to deduce lines of genetic
development
• Inbreeders are plants that produce seed predominantly or exclusively through self-
fertilization
• Outbreeders produce seed by cross-fertilization
• In outbreeding species variation within populations similar to variation between
populations as a result of exchange of genes
• Inbreeding species have relatively uniform populations, often with much variation
between populations because of little or no gene exchange
• Inbreeding (endogamy): crossing of very closely related individuals, purest form is
self-fertilization (autogamy)
• Inbreeding promotes homozygoty – species consists of various more or less
homozygous individuals
SOURCES OF TAXONOMIC INFORMATION
• Variation between populations discontinuous because taxon divided into various more
or less pure lines which breed purely through many generations with little or no gene
flow between populations
• Such populations often limited to ecological niches or have limited distribution
• Outbreeding (exogamy, allogamy): active gene flow takes place between populations
which leads to continuous morphological variation between populations
• Mechanisms which promote outbreeding are especially dioeciousness, protandry,
protogyny and self-incompatibility

Ideal species:
• One with which no taxonomic problems are experienced – it is thus clearly delimited
and there is no gradual transition to other species
• Such species mostly genetically isolated and interbreeding does not occur. Species is
the basic unit in taxonomy but no agreement about the degree of variation
permissible within a species
SOURCES OF TAXONOMIC INFORMATION

Two species definitions:

Taxonomic species concept (including typological, morphological, morphological-


geographical concepts):
• Species is a group of individuals with common morphological characters, separated
from other groups by correlated morphological discontinuities in a number of
characters. Mostly used

Biological species concept (including biosystematics, genetic and cytogenetic concepts):


• Modern tendency which was the results of a study of the genetic basis of variation,
reproductive mechanisms and populations. In this concept a species is a community
of interfertile individuals isolated from other species by certain factors that prohibit
interbreeding
SOURCES OF TAXONOMIC INFORMATION
Hybridisation (interbreeding):
• Taxonomic hybrid the product of crossing between two different taxa. Natural hybrids
may form between sympatric closely related species or even between genera. Hybrids
abundant in nature and new species may arise this way
• Often difficult to determine the origin of a hybrid or to show plant is a hybrid
• One of 5 ways that could provide an answer:
1. Phenetic intermediate between two putative parents – external morphology.
Differences analyses statistically (e.g. hybrid indices, scatter plots etc.). Not always
reliable as hybrids not always intermediate
2. Reduced fertility – hybrids can be absolutely sterile or as fertile as parents. Staining
techniques can test pollen viability or study of meiosis, incomplete synapsis takes place
3. F2 segregation – F2 generation often show lots of variation. Different parental
characters in F1 hybrids show up in the F2 generation which may give an indication that
the F1 generation were hybrids
4. Geographical distribution – parents of alleged hybrid should occur in same
geographical area as the hybrid. May be misleading as pollen distributed over large
areas, extinction and migration
5. Artificial re-synthesis of hybrid – create artificial hybrid through crossing of alleged
parents. Time-consuming and not always reliable
• Factors that prevent interbreeding in nature include geographical isolation, ecological
isolation, seasonal isolation, temporal isolation, ethological isolation, mechanical
isolation, breeding behaviour isolation, gametophytic isolation, gamete isolation, seed
incompatibility, non-viability of F1 or F2 hybrids, sterility of F1 or F2 hybrids
SOURCES OF TAXONOMIC INFORMATION
Reproductive systems
A. Systems based on special arrangement of male and female reproductive organs
1. Individual plants:
• Hermaphroditic (perfect) – plants with bisexual flowers
• Monoecious – plants with male and female flowers
• Andromonoecious – plants with bisexual and male flowers
• Gynomonoecious – plants with bisexual and female flowers
• Polygamonoecious – plants with bisexual flowers as well as male and female flowers

2. Groups of plants:
• Dioecious – male plants and female plants
• Androdioecious – bisexual plants and male plants
• Gynodioecious – bisexual and female plants
• Polygadioecious – bisexual plants, male plants and female plants

B. Systems based on time differences between male and female phases


• Protandric – pollen released before stigma receptive
• Protogynous – stigma receptive before pollen released

C. Systems based on genetic compatibility


• Self-incompatibility vs self compatibility
SOURCES OF TAXONOMIC INFORMATION
D. Systems based on style and anther length
• Heterostyly – plants within a population have two or three different floral forms. The
height of the anthers on one form corresponds to the height of the stigma of the other
form
• Distyly – one form has a long style with the anthers beneath the stigma, the other
form has a short style with the anthers above the stigma
• Tristyly – three different floral forms with long, medium and short styles, each with two
sets of stamens at two different levels
• Enantiostyly – the style is deflected to the left or right
SOURCES OF TAXONOMIC INFORMATION
Chemical evidence
• Three reasons for rapid development of chemotaxonomy:
• Development of new techniques which lead to more rapid and simpler analyses
• Realisation of the large chemical variation which exists in nature
• Present tendency to use as many characters as possible in classification
• Three basic types of chemical compounds:
• Primary metabolites: involved in vital functions of cell and of universal occurance
• Secondary metabolites: metabolic products that accumulate in cells which are not
directly involved in the vital functions of the cell
• Semantides: information carrying molecules, DNA (primary semantides), RNA
(secondary semantides), proteins (tertiary semantides)

Primary metabolites:
• Only one group of importance, the carotenoids. Pigments in all photosynthetic
tissues. Of limited taxonomic value in higher plants because show virtually no
variation. Great taxonomic value in algae

Secondary metabolites:
• Terpenoids: group of compounds of which the structure is based on the uniting of
isoprene units (C6H8), e.g. hemiterpenes, monoterpines, sesquiterpenes etc. Form
part of oils, vitamins, hormones and other substances
SOURCES OF TAXONOMIC INFORMATION
• Phenolic compounds: group of compounds of which structure contains at least one
phenolic function. Largest group of phenolic compounds the flavonoids with a specific
C15 skeleton. Types:
• Flavones – basic type from which most others are derived
• Flavanones – differ from flavones in absence of double bond in the 2,3 position
• Isoflavones and isoflavonoids – isoflavones isomers of flavones with -ring in 3-
position rather than in the 2-position. Isoflavonoids are isoflavones of which double
bond in the 2,3-position is saturated
• Flavonols – differ from flavones in the absence of an OH-group in the 3-position
• Anthocyanidins – red, purple and pink pigments which normally occur in nature as
glycosides with glucose, galactose, arabinose and various sugars. The glycosides are
called anthocyanins and after removal of the sugar anthocyanidins. Colour influenced
by methyl groups (red effect), phenolic groups (blue effect) and pH of sell sap (acid-
red, alkaline-blue)
• Betacyanins – group of compounds (pigments) which occur in cell sap of red beet and
other plants. Contain N. Limited to only 8 families
• Carbohydrates and polysaccharides – structural and nutritional function. Limited
taxonomic importance
• Glycosides – organic compounds with reduced group of a sugar bound to an alcoholic
or phenolic hydroxyl group of a second molecule. Wide variety with divergent
taxonomic applications
• Alkaloids – basic, nitrogen-containing substances which are know for their toxic and
medicinal properties. Largest single class of secondary metabolites and thousands of
compounds known
SOURCES OF TAXONOMIC INFORMATION
Semantides – information carrying molecules (DNA, RNA, proteins)
• Theoretically should lead to perfect classification system, because genetic information
used directly but there are practical problems which are rapidly being overcome by
improved methods
• Proteins, especially enzymes, generally studied as taxonomic characters
• DNA sequencing (chloroplast and nuclear DNA) an important tool for taxonomists and
improved insights at all taxonomic levels
DNA barcoding:
• use of short, highly informative DNA regions to discriminate between species
• world-wide effort on DNA barcoding over last few years (CBOL established 2004)
• two chloroplast regions, matK and rbcL, now used as standard barcodes for land
plants – proposed by CBOL Plant Working Group (2009)
Three methods used to study proteins
• Serology – extract containing proteins injected into test animal and antibodies
extracted from animal’s blood as antiserum and this may now be used to text extracts
from other plants
• Electrophoresis – separation takes place by means of the amphiteric properties of
proteins (that they are positively or negatively charged depending on the pH of the
medium. Proteins move through a gel (starch or acrylamide) at different velocities
over an electric gradient
• Amino acid sequencing – modern development in which pure proteins are identified at
the molecular level. Polypeptide chains broken off and the amino acids which come
free are identified chromatographically one by one
SOURCES OF TAXONOMIC INFORMATION
DNA sequencing
• Used to study the sequence of basis in a selected part of
the genome (chloroplast or nuclear or mitochondrial). After
extraction from the cells of fresh or dried plant material
primers are used to select a specified piece of DNA which is
amplified used polymerase chain reactions (PCR).
Sequence data is aligned into a matrix which is analysed
using phylogenetic computer packages

Methods in DNA sequencing:

• DNA extraction: Grind fresh or dried leaf material and mix


with enzymes and buffers
• Amplification: Polymerase chain reactions used to amplify
portion of DNA. primers are used to select a specified piece
of DNA
• DNA prepared and sequenced using an automated
sequencer
• DNA sequences assembled and aligned in a matrix
• Analysed using parsimony or likelihood analyses
SOURCES OF TAXONOMIC INFORMATION
DNA sequence matrix
Barcoding
Identification

?
Unknown species Extraction and sequencing

BOLD
DNA sequence for rbcL or matK
AAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAATACGAAACCAAA
GATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCCGAAGAAGCAGGGGCTG
CGGTAGCTGCTGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACCAGCCTTGATCG
TTACAAAGGGCGATGCTACCACATCGAGCCCGTTCCTGGAGAAGAAGATCAATATATTGCTTATGTAGCT
TACCCCTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTAGGTAATGTATTTG
GGTTCAAAGCCCTACGCGCTCTACGTCTGGAAGATTTGCGAATCCCTACGGCTTATATTAAAACCTTCCA
AGGCCCGCCTCATGGGATCCAGGTTGAGAGAGATAAATTGAACAAATATGGTCGTCCCCTGTTGGGATGT
ACTATTAAACCTAAATTGGGGTTATCCGCTAAAAACTACGGTAGGGCATGTTATGAATGTCTTCGTGGTG
GACTTGATTTTACCAAAGATGATGAAAACGTGAACTCCCAACCGTTTATGCGTTGGAGAGATCGTTTCTT
ATTTTGTGCCGAAGCAATTTATAAAGCACAGGCTGAAACCGGTGAAATCAAAGGGCATTACTTGAATGCT
ACTGCAGGTACATGCGAAGAAATGATGAAAAGAGCTATATTTGCTAGAGAATTGGGAGTTCCTATCGTAA
TGCATGACTACTTAACAGGGGGATTCACTGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGCCT
ACTTCTGCACATCCACCGTGCAATGCACGCAGTTATTGATAGACAGAAGAATCATGGTATCCACTTCCGC
GTACTAGCTAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTACCGTAGTAGGTAAACTTG
AAGGGGAAAGAGACATCACTTTGGGCTTTGTTGATTTACTGCGTGATGATTTTATTGAAAAAGATCGAAG
TCGCGGTATTTATTTCACTCAAGATTGGGTCTCTCTACCAGGTGTTCTGCCGGTGGCTTCAGGGGGTATT
CACGTTTGGCACATGCCCGCTCTGACCGAGATCTTTGGGGATGATTCTGTACTACAGTTTGGTGGAGGAA
CTTTAGGACACCCTTGGGGTAATGCACCAGGTGCCGTAGCGAATCGAGTAGCTCTAGAAGCATGTGTACA
AGCTCGTAATGAAGGGCGCGATCTTGCTCTTGAGGGTAATGAAATTATCCGTGAGGCTAGCAAATGGAGT
CCTGAACTGGCTGCTGCTTGTGAGGTATGGAAGGAGATCAGATTTAATTTTAAAGCAGTGGATACTTTGG AT

S-ar putea să vă placă și