Documente Academic
Documente Profesional
Documente Cultură
Abstract
Recent years have seen an explosion in the development and application of molecular tools for identifying microbes and
analyzing their activity. These tools are increasingly applied to strains of lactic acid bacteria (LAB), including those used in
fermentation and as well as those marketed as probiotics, for identification and analysis of their activity. Many of these tools
are based on 16S ribosomal DNA sequences and exploit either hybridization or PCR techniques. Furthermore, complete or
partial genomes of various LAB and bifidobacteria have been determined and offer omics-based approaches to analyze the
activity of the bacteria provided that the mechanisms of their action are known. Finally, fluorescent probes coupled to flow
Many of the modern molecular tools are based on 16S ribosomal tools can be used to trace and track LAB including probiotics in
DNA sequences, complete or partial genomes, or specific the production phase and in food products as well as after
fluorescent probes that monitor the physiological activity of consumption in the intestinal tract. Moreover, many of these
microbial cells. These high throughput approaches are increas- identification tools can be instrumental in the selection of new
ingly applied to strains of lactic acid bacteria (LAB)4 and strains or species of LAB or bifidobacteria as starters, for flavor
bifidobacteria that provide health benefits and are marketed as developments, or to be developed into probiotics. Finally, a
probiotic bacteria. The primary purpose of these approaches is series of functional approaches are being developed and
to provide proper strain identification as required for legal and validated that can further be used in controlling quality. These
good manufacturing practices. In addition, these identification are either based on generic microbial properties or specifically
address the mechanisms by which LAB and probiotics may exert
1
their functional or benefical effects. The generic systems are used
Published as a supplement to The Journal of Nutrition. The articles included in
to monitor the viability, vitality, or stress response of LAB during
this supplement are derived from presentations and discussions at the World
Dairy Summit 2003 of the International Dairy Federation (IDF) in a joint IDF/FAO fermentation or in bioreactors or food products, whereas the
symposium entitled ‘‘Effects of Probiotics and Prebiotics on Health specific ones have the potential to determine the performance of
Maintenance—Critical Evaluation of the Evidence,’’ held in Bruges, Belgium. probiotic bacteria in all these systems as well as in the intestinal
The articles in this publication were revised in April 2006 to include additional tract of the consumer. In this article we provide an overview of
relevant and timely information, including citations to recent research on the
topics discussed. The guest editors for the supplement publication are Michael
these tools and their potential, provide examples of their use
de Vrese and J. Schrezenmeir. Guest Editor disclosure: M. de Vrese and with LAB with an emphasis on probiotic cultures, and present a
J. Schrezenmeir have no conflict of interest in terms of finances or current grants listing of the developed 16S ribosomal DNA (rDNA) probes that
received from the IDF. J. Schrezenmeir is the IDF observer for Codex have served in the identification of LAB and bifidobacteria.
Alimentarius without financial interest. The editors have received grants or
compensation for services, such as lectures, from the following companies that
market pro- and prebiotics: Bauer, Danone, Danisco, Ch. Hansen, Merck, Müller Overview of molecular tools
Milch, Morinaga, Nestec, Nutricia, Orafti, Valio, and Yakult. The tools that have been developed for identifying microbes and
2
Author disclosure: no relationships to disclose.
3 analyzing their activity can be divided into those based on
Part of this work was supported by the EU Quality of Life projects Microbe
Diagnostics (QLK1-2000-00108), EU and Microfunction (QLK1-2001-00135) and nucleic acids and other macromolecules and approaches directed
Progid (QLK1-2000-00563). at analyzing the activity of complete cells. The nucleic acid–
4
Abbreviations used: AFLP, amplified fragment length polymorphism; DGGE, based tools are more frequently used because of the high through-
denaturing gradient gel electrophoresis; FCM, flow cytometry; FISH, fluorescent put potential provided by using PCR amplification or ex situ or
in situ hybridization; LAB, lactic acid bacteria; PFGE, pulsed-field gel electropho-
resis; RAPD, randomly amplified polymorphic DNA; RFLP, restriction fragment
in situ hybridization with DNA, RNA, or even peptide nucleic
length polymorphism; rDNA, ribosomal DNA; rRNA, ribosomal RNA. acid probes. Notably, these include 16S rDNA sequences that
* To whom correspondence should be addressed. E-mail: willem.devos@wur.nl. can be used to place diagnostics into a phylogenetic framework
0022-3166/07 $8.00 ª 2007 American Society for Nutrition. 741S
and can be linked to databases providing up to 100,000 se- probes have been developed and applied. Species-specific probes
quences (1). These 16S rDNA–based methodologies are robust include probes for B. lactis, B. adolescentis, B. breve, B. infantis,
and superior to traditional methods based on phenotypic ap- B. dentium, and B. longum (9–11).
proaches, which are often unreliable and lack the resolving power Nucleic acid probing is based on 2 major techniques: dot-blot
to analyze the microbial composition and activity of bacterial hybridization and whole-cell in situ hybridization. Dot-blot
populations. In addition, a panoply of approaches that are based hybridization is an ex situ technique in which total RNA is
on DNA sequences other than rDNAs have been applied fre- extracted from the sample and is immobilized on a membrane
quently to probiotic bacteria. These have been shown to be par- together with a series of RNAs of reference strains. Subse-
ticularly useful for strain identification, as detailed below. quently, the membrane is hybridized with a radioactively labeled
Recently, approaches based on complete or partial genomes probe, and after stringent washing, the amount of target rRNA
have been introduced in the food industry. These include DNA is quantified. Because cellular rRNA content is dependent on the
arrays that can be used in comparative genomics or genome- physiological activity of the cells, no direct measure of the cell
wide expression profiling (2). These omics approaches have now counts can be obtained. In contrast to dot-blot hybridization,
become feasible for probiotic bacteria since the recent realiza- fluorescent in situ hybridization (FISH) is applied to morpho-
tion of the complete genome sequences of human isolates of logically intact cells and thus provides a quantitative measure of
Bifidobacterium longum (3) and Lactobacillus plantarum (4). the target organism. The listed probes can all be used for dot-
Other functional approaches may be based on the properties of blot hybridizations, but for application in FISH, specific
other macromolecules such as proteins. Notably, the link with validation is required because some regions of the rRNA are
the complete or partial genomes provides the basis for the not accessible because of their secondary structure and protec-
further development of proteomics and other omics-related tion in the ribosome. Hence, the number of validated FISH
approaches to detect, identify, and analyze the functionality of probes is much smaller than that of the probes suitable for ex
LAB and bifidobacteria (5). situ analysis. This is illustrated in the listing of the probes for
In addition to analysis of individual macromolecules or their LAB and bifidobacteria in which the validated FISH probes are
collective set in a LAB strain, whole cells can also be targeted. underlined (Tables 1–3).
cytometry was found to be faster and more sensitive than PFGE, ribotyping vary from partial sequences of the rDNA genes or
and this technique is also amenable to automation. the intergenic spacer regions to the whole rDNA operon (19).
Ribotyping has been used to characterize strains of Lactobacil-
Ribotyping lus and Bifidobacterium from commercial products as well as
Ribotyping is a variation of the conventional RFLP analysis. It from human fecal samples (20,21). However, ribotyping pro-
combines Southern hybridization of the DNA fingerprints, vides high discriminatory power at the species and subspecies
generated from the electrophoretic analysis of genomic DNA level rather than on the strain level. PFGE was shown to be more
digests, with rDNA-targeted probing. The probes used in
TABLE 3 rRNA-targeted oligonucleotide probes used for the
TABLE 2 rRNA-targeted oligonucleotide probes used for the identification of Bifidobacterium spp.
identification of Lactococcus, Leuconostoc (Lc.),
Pediococcus, and Enterococcus spp. Probe Sequence (5# to 3#) Specificity Reference
*
Lm3 GGTGCTI CCCACTTTCATG Bifidobacterium genus (66)
Probe Sequence (5# to 3#) Specificity Reference
Bif1641 CATCCGGCATTACCACCC Bifidobacterium genus (67)
Strc4931 GTTAGCCGTCCCTTTCTGG Lactococcus-Streptococcus (62) Bif2281 GATAGGGACGCGACCCCAT Bifidobacterium genus (68)
Llc TGCAAGCACCAATCTTCATC L. lactis subsp. lactis (63) Bif TCTACACATTCCACCGTTACACCGGGAA Bifidobacterium genus (69)
PLl1 AGTCGGTACAAGTACCAAC L. lactis subsp. lactis (60) PAD GCTCCCAGTCAAAAGCG B. adolescentis (11)
212RLa CTTTGAGTGATGCAATTGCATC Lacotococcus genus (64) PBI GCAGGCTCCGATCCGA B. bifidum (11)
LactV5 GCTCCCTACATCTAGCAC L. lactis (61) PBR AAGGTACACTCAACACA B. breve (11)
Lla CTATAATGCTTAAGTCCACG L. lactis (63) PIN TCACGCTTGCTCCCCGATA B. infantis (11)
PLc TTCAAATTGGTGCAAGCACC L. lactis subsp. cremoris (60) PLO TCTCGCTTGCTCCCCGATA B. longum (11)
68RCa TGCAAGCACCAATCTTCATC L. lactis subsp. cremoris (64) BDE ACGTCACGGTGGGAACTCA B. dentium (10)
LeucV5 CCTCCTAACACCTAGTGT Lc. mesenteroides (61) BAN CCGGTTCACAGGTGGT Bifidobacterium sp.2 (10)
Plcm CAGCTAGAATAGGAAATCAT Lc. mesenteroides (60) NG3 GTGGAGACACGGTTTCCCTT B. lactis (9)
Ppento89 AATCAGTACAAGTACGTCATA P. pentosaceus (65) 1
These probes have been used in FISH.
Enc16S CTTTCGGGTGTCGCTG E. faecalis (56) 2
The probe targets the following species: B. animalis DSM 20104, B. asteroides DSM
Efs GGTGTTGTTAGCATTTCG E. faecalis (63) 20089, B. coryneforme DSM 20216, B. cuniculi DSM 20435, B. globosum DSM
Efm CACACAATCGTAACATCC E .faecium (63) 20092T, B. magnum DSM 20222T, B. minimum DSM 20102T, B. subtile DSM 20096T.
3
NG, not given.
1
This probe has been used in FISH. * I denotes inosine.
746S Supplement
54. Pot B, Hertel C, Ludwig W, Descheemaeker P, Kersters K, Schleifer KH. fluorescent In situ hybridization with group-specific 16S rRNA-
Identification and classification of Lactobacillus acidophilus, L. gasseri targeted oligonucleotide probes. Appl Environ Microbiol. 1998;64:
and L. johnsonii strains by SDS-PAGE and rRNA-targeted oligonucle- 3336–45.
otide probe hybridization. J Gen Microbiol. 1993;139:513–7. 63. Beimfohr C, Krause A, Amann R, Ludwig W, Schleifer KH. In situ
55. Vogel RF, Bocker G, Stolz P, Ehrmann M, Fanta D, Ludwig W, Pot B, identification of lactococci, enterococci and streptococcin. Syst Appl
Kersters KH, Hammes W. P. Identification of lactobacilli from Microbiol. 1993;16:450–6.
sourdough and description of Lactobacillus pontis. nov. Int J Syst 64. Salama M, Sandine W, Giovannoni SJ. Development and application of
Bacteriol. 1994;44:223–9. oligonucleotide probes for identification of Lactococcus lactis subsp.
56. Laitinen R, Malinen E, Palva A. PCR-ELISA I:Application to simulta- cremoris. Appl Environ Microbiol. 1991;57:1313–8.
neous analysis of mixed bacterial samples composed of intestinal 65. Sujaya N, Amachi S, Saito K, Yokota A, Asano K, Tomita F. Specific
species. Syst Appl Microbiol. 2002;25:241–8. enumeration of lactic acid bacteria in ragi tape by colony hybridization
57. Hertel C, Ludwig W, Pot B, Kersters K, Schleifer KH. Differentiation of with specific oligonucleotide probes. World J Microbiol Biotechnol. 2002;
lactobacilli occuring in fermented milk products bu using oligonucle- 18:263–70.
otide probes and electrophoretic protein profiles. Syst Appl Microbiol. 66. Kaufmann P, Pfefferkorn A, Teuber M, Meile L. Identification and
1993;16:463–7. quantification of Bifidobacterium species isolated from food with genus-
58. Ehrmann M, Ludwig W, Schleifer KH. Reverse dot blot hybridization: A specific 16S rRNA-targeted probes by colony hybridization and PCR.
useful method for the direct identification of lactic acid bacteria in Appl Environ Microbiol. 1997;63:1268–73.
fermented food. FEMS Microbiol Lett. 1994;117:143–9. 67. Langendijk P, Schut F, Jansen G, Raangs G, Kamphuis G, Wilkinson
59. Ampe F. Design and evaluation of a Lactobacillus manihotivorans M, Welling G. Quantitative fluorescence in situ hybridization of
species-specific rRNA-targeted hybridization probe and its application Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes
to the study of sour cassava fermentation. Appl Environ Microbiol. 2000; and its application in fecal samples. Appl Environ Microbiol. 1995;61:
66:2224–6. 3069–75.
60. Klijn N, Weerkamp AH, de Vos WM. Identification of mesophilic lactic 68. Marteau P, Pochart P, Dore J, Bera-Maillet C, Bernalier A, Corthier G.
acid bacteria by using polymerase chain reaction-amplified variable Comparative Study of bacterial groups within the human cecal and fecal
regions of 16S rRNA and specific DNA probes. Appl Environ microbiota. Appl Environ Microbiol. 2001;67:4939–42.
Microbiol. 1991;57:3390–3. 69. Nebra Y, Jofre J, Blanch AR. The effect of reducing agents on the
61. Ercolini D, Hill PJ, Dodd CER. Bacterial community structure and recovery of injured Bifidobacterium cells. J Microbiol Methods 2002;