Revista

titel_SiS_Issue17_RZ:scienceinschool 23.11.
2010 14:38 Uhr Seite 1
How many schools Winter 2010 Issue 17
and teachers
do you reach –
worldwide? In this issue:
The science of
humour: Allan Reiss
Also:
Stage lights:
physics
and drama
Advertising in Science in School

· Choose between advertising in the quarterly print journal or on our website.
· Website: reach 30 000 science educators worldwide – every month.
· In print: target up to 15 000 European science educators every quarter, including
3000 named subscribers.
· Distribute your flyers, brochures, CD-ROMs or other materials either to 3000 named
subscribers or to all recipients of the print copies.
For more details, see www.scienceinschool.org/advertising
Published by
EIROforum:
Initially supported by ISSN: 1818-0353

the European Union:
Subscribe free online: www.scienceinschool.org Highlighting the best in science teaching and research
sis_17_RZ_.qxq:Layout 1 24.11.2010 9:25 Uhr Seite 2
About Science in School

Science in School promotes inspiring science
Editorial teaching by encouraging communication between
teachers, scientists and everyone else involved in
European science education.
The journal addresses science teaching both across
Europe and across disciplines: highlighting the best
in teaching and cutting-edge research.
It covers not only biology, physics and chemistry,
Welcome to the seventeenth but also earth sciences, engineering and medicine,
focusing on interdisciplinary work.
The contents include teaching materials; cutting-edge
issue of Science in School science; interviews with young scientists and inspiring
teachers; reviews of books and other resources; and
European events for teachers and schools.
Science in School is published quarterly, both online
and in print. The website is freely available, with
D o men and women share the same sense of humour?

Perhaps, but their brains react differently to it, as
Allan Reiss explains in this issue’s feature article (page 8).
articles in many European languages. The English-
language print version is distributed
free of charge within Europe.
Contact us
Dr Eleanor Hayes / Dr Marlene Rau
Of course, people differ not only in their humour but also in Science in School
many other ways, including skin colour, hair thickness and European Molecular Biology Laboratory
Meyerhofstrasse 1
the ability to digest starch or lactose. What is the genetic 69117 Heidelberg
basis of such differences, and could they have been evolu- Germany
editor@scienceinschool.org
tionary adaptations to a changing environment? Jarek Bryk
Subscriptions
tells us how scientists investigate these questions (page 11). Register online to:
Once scientists have the genetic data, how do they analyse it? Bioinformatics · Receive an email alert when each issue is
published
is an important tool; with Cleopatra Kozlowski’s activity you can try some of · Request a free print subscription (within Europe)
the techniques yourself, exploring phylogeny with a pen and paper (page 28). · Swap ideas with teachers and scientists in the
Science in School online forum
Do you teach physics rather than biology? Then you might like two of this · Post comments on articles in Science in School.
Submissions
issue’s teaching activities: modelling the trajectory of a projectile (page 23), or We welcome articles submitted by scientists, teachers
a laser pen for beaming music across the classroom (page 41). For chemistry and others interested in European science education.
See the author guidelines on our website.
teachers, our nanoscale experiments offer an interdisciplinary activity (page 34).
Referee panel
Before publication, Science in School articles are
Nanoparticles are also at the heart of cloud formation, as Karin Ranero Celius reviewed by European science teachers to check that
explains (page 54). The physics of these masses of water droplets or ice crystals they are suitable for publication. If you would like to
join our panel of referees, please read the guidelines
is quite complex, and scientists are still learning how clouds and climate influ- on our website.
ence each other. Book reviewers
If you teach science in Europe and would like to
Tim Harrison and Dudley Shallcross also have their heads in the clouds: they review books or other resources for Science in
commemorate the 25th anniversary of the discovery of the hole in the ozone School, please read the guidelines on our website.
layer by investigating the chemistry of how the hole formed and why it’s going Translators
We offer articles online in many European languages.
to get smaller (page 46). Ice clouds in the stratosphere are at the core of the If you would like to volunteer to translate articles into
matter, yet amazingly, even at very low temperatures, clouds can consist of your own language, please read the guidelines for
translators on our website.
water droplets rather than ice. Tobias Schülli investigates this phenomenon,
known as supercooling (page 17).
Advertising in Science in School –
new lower prices
Moving even further away from Earth, into space, we enter the realm of Science in School is the only European journal aimed
astronomers. Marvel with Jochen Liske at huge telescopes in remote places and at secondary-school science teachers across Europe
and across the full spectrum of sciences. It is freely
learn about his involvement in Das Auge 3D, a 3D film about the Very Large
available online, and 15 000 full-colour printed
Telescope in Chile’s Atacama Desert (page 60). copies are distributed each quarter.
The readership of Science in School includes everyone
Making science visually appealing definitely helps in the classroom – but how involved in European science teaching, including:
do you do this when teaching blind and visually impaired youngsters? Werner · Secondary-school science teachers
· Scientists
Liese shares his experiences in this issue’s teacher profile (online). This and · Primary-school teachers
several other articles in this issue are available online only – so do visit the · Teacher trainers
Science in School website. To learn more about its features, see our new help
· Science communicators.
Web advertisements
page: www.scienceinschool.org/help Reach 30 000 science educators worldwide every
month.
Finally, don’t forget that there are many ways in which you, too, can contribute · € 200-350 per week
Print advertisements
to Science in School. Find out more online: www.scienceinschool.org/information Reach over 15 000 readers per issue.
· Full page: € 1495
Marlene Rau · Half page: € 999
Editor of Science in School · Quarter page: € 560
editor@scienceinschool.org
· Back cover (full page): € 1995
Distribution
www.scienceinschool.org Distribute flyers, DVDs or other materials to 3000
named subscribers or to all 15 000 print recipients.
For more information, see
www.scienceinschool.org/advertising
or contact advertising@scienceinschool.org
Contents
Editorial
Welcome to the seventeenth issue of Science in School
Events
2 Science on Stage: searching for the best teachers in Europe
5 Teachers fly high at the European Space Agency
Feature article
8 The science of humour: Allan Reiss
8
Cutting-edge science
11 Human evolution: testing the molecular basis
17 Science is cool... supercool
Teaching activities
23 Going ballistic: modelling the trajectories of projectiles
28 Bioinformatics with pen and paper: building a phylogenetic tree
Projects in science education

11 34 School experiments at the nanoscale
41 Stage lights: physics and drama
Science topics
46 A hole in the sky
54 Clouds: puzzling pieces of climate
Scientist profile
60 An astronomer in a 3D world
41
Additional online material
Teacher profile
Blind date in the science classroom
Reviews
Very Short Introductions to Evolution, Human Evolution
54 and the History of Life

A Private Universe online resources
Resources on the web

Educational resources for the International Year of Biodiversity
See: www.scienceinschool.org/2010/issue17
Forthcoming events for schools: www.scienceinschool.org/events
60
Science in School Issue 17 : Winter 2010 1
Science on Stage:
searching for the best
teachers in Europe
In more than 20 European countries, teachers are sharing their
inspiring teaching ideas with colleagues, students and the general
public via Science on Stage. Eleanor Hayes reviews some of the
recent events.
Teachers presenting their Can physics be experienced The project ‘Radioactivity –

ideas in the fair at a scale of 1:87? A physics curse or blessing?’ project
theme park addresses the scientific, his-
te sy of Science on
cour Sta
a ge g eG toric and social aspects of
Im
er
m
a
nuclear fission. The origami
tesy of Science o
cour cranes relate to the book
ny
n St
age age
Im Ge
Sadako’s story, about a girl
rm
a
who developed leukaemia
ny
after the nuclear bomb fell

on Hiroshima
r te sy of Science on
cou Sta
age ge
Ge
Im rm
a
ny
Alice in Chemistryland
Im
age
cou
r te s
y of
the P
alace of Wonders
2 Science in School Issue 17 : Winter 2010 www.scienceinschool.org

Events
e on Stage Slovakia
i enc
f Sc
yo
t es
ur
co
Investigating
ge
Ima
Germany: chocolate and soap 50:50 mixture of alcohol and water; as the relative
humidity
bubbles the alcohol burned, the water evapo-
of air
On 1 October 2010, 47 of Germany’s rated, keeping the paper below its
most creative science teachers and ignition point.) Also full of drama
educators met in Berlin to present was the stage performance by Beáta
their teaching ideas and compete to Jarosievitz’s secondary-school stu-
represent Germany at the Science on dents, in which Alice found herself in
Stage international teaching festival in Chemistryland, and the White Rabbit
Copenhagen, Denmark, in April and his friends guided her through
2011w1, w2. the wonders of chemical reactions.
Chemistry teacher Angela Köhler- They made ice cream and sorbet
orvath
Krützfeldt and her students, for using liquid nitrogen, transformed a t er H
f Pe
yo
example, investigated the science of cup of tea into lemonade and finished t es
ur
co
chocolate, while Dieter Legl and the performance with a colourful fire- Investigating
ge
Ima
Alexander Frisch developed a play: work display. the moment
‘The Light at the End of the Tunnel’, Endre, Beáta and seven other lucky of inertia
using CDs
which took a trip through the human participants were chosen to represent
digestive system. Martin Busch and Hungary at the international teaching
Patrick Woldt’s project was similarly festival in Copenhagen.
creative: their students were ‘hired’ as
trainees in a fictional nanotechnology Slovakia: recycling materials for
company, where they learned all the science classroom
about what the job involved. For From 4-7 May 2010, the Smolenice
younger students, Wilfried Meyer Castle echoed with the noise of the
developed a workshop in which pri- Science on Stage Slovakia teaching
mary-school children investigated the fair: 50 primary-school, secondary- e on Stage Slovakia
i enc
f Sc
yo
shapes, sizes, colours and other school and university teachers shar- ur
t es
co
characteristics of soap bubbles. ing ideas and inspirationw4. How to

ge
Ima
Representatives of these and eight Peter Horvath, for example, devel- introduce
other projects were chosen to join oped ways to teach the moment of young
about 350 colleagues from across inertia of rotating objects, using very children
Europe, celebrating the importance of simple materials. In one of his to torque,
centre of
science teaching, under the motto demonstrations, he connected CDs
gravity
‘Science teaching: winning hearts and together using screws either close to and equi-
minds’, at the Science on Stage inter- the centre or close to the edge; how librium
national festival. did this affect the moment of inertia?
Other activities included simple
Hungary: drama in science experiments about the relative
On 2 October 2010, one room of the humidity of air, electricity and
Palace of Wonders science centre in magnetism; a workshop about using
Budapest, Hungary, was packed: as coloured wooden blocks to introduce Romania: reaching out to the
many as 300 members of the public young children to the concepts of public
arrived to watch the demonstrations, torque, centre of gravity and equilibri- For the organisers of the Romanian
performances and experiments at the um; and a presentation about a Science on Stage eventw5, it was
Science on Stage Hungaryw3 festival, physics summer camp for children important to involve the public and
opened by the president of the aged 10-15. raise their awareness of science. For
Hungarian Academy of Sciences, The final decision has not yet this reason, the event took place in
József Pálinkás. been made, but representatives the city centre park in Cluj, attracting
The audience watched with bated of five projects will be heading 800 members of the public, as well as
breath as chemistry teacher Endre to Copenhagen in 2011 to share 200 teachers and 1200 school students
Szórád set fire to a bank note – with- their ideas with their European from both primary and secondary
out damaging it. (It was soaked in a colleagues. schools.
www.scienceinschool.org
www.scienceinschool.org Science in School Issue 17 : Winter 2010 33
sy of Science on
ourte
a ge c Sta
ge
Im Ro
m
a
Olga Riscau's paper project
ni
sy of Science o
ourte
a
n St
a ge c a ge
Im Ro
of Science o m
tesy a
cour n St
age a ge
ni
Im
a
Ro
m
a
ni
a
From each school, teams of students
took turns at their stand, describing
and demonstrating their projects to
w4 – To find out more about the
visitors. Olga Riscau’s primary-school central Romania, which simulated
Science on Stage Slovakia event,
students, for example, produced their both the flow of water through the
see: www.science-on-stage.sk
own paper, used it for their paintings lake and the heliothermic phenome-
– and exhibited the beautiful results non that occurs in saline lakes, caus- w5 – For more information about
on their stand. In the project, Olga ing the water further down to be Science on Stage Romania, see:
and her students were assisted by the warmer than at the surface. Other www.isjcj.ro/scienceonstage
science teacher from a local secondary winning projects included Olga’s w6 – To learn more about the
school. paper project, Corina Toma’s Jacob’s international festival and how to
With so many people involved, it Ladder, in which a high-voltage elec- apply to take part, see:
was an important event in its own tric current climbed two brass rods, http://science-on-stage.eu/?p=3
right – a chance for teachers and Monica Vascan’s impressive model of
school students to present their ideas, the kidney and Dana Fenesan’s proj- Resources
and for the general public to see some ect about biology and chemistry used After each of the previous interna-
of the exciting science that is being in traditional farms in the Carpathian tional Science on Stage festivals
done in Romanian schools. In addi- mountains. (and the Physics on Stage festivals
tion, a small number of particularly that preceded them), the Irish
inspiring projects were selected to Attending the international delegates produced a book
attend the Science on Stage interna- festival describing how to carry out their
tional teaching festival in At each national Science on Stage favourite experiments in the festi-
Copenhagen. event, a fixed number of teachers are val. These books can be down-
Among the lucky winners was selected to represent their country at loaded free of charge from the
Laszlo Papp, whose students built a the international Science on Stage fes- Science on Stage Ireland website:
model of Lake Ursu in Transylvania, tival in Copenhagen. For these teach- www.scienceonstage.ie/resources.html
ers, participation will be free.
To view all other Science in School arti-
For other science teachers who wish
cles about Science on Stage, see:
to attend the international festival,
A working model of Lake www.scienceinschool.org/sons
there are a limited number of places
Ursu in Sovata
for which a registration fee will be
sy of Science o charged. See the Science on Stage
ourte n St
a ge c a ge website for detailsw6. Dr Eleanor Hayes is the editor-in-
Im Ro
m
a chief of Science in School. She studied
ni
a
Web references zoology at the University of Oxford,

w1 – To find out more about Science UK, and completed a PhD in insect
on Stage Europe and to contact ecology. She then spent some time
your national organisers, see: working in university administration
www.science-on-stage.eu before moving to Germany and into
science publishing, initially for a
w2 – To learn more about Science on
bioinformatics company and then for
Stage Germany, see:
a learned society. In 2005, she moved
www.science-on-stage.de
to the European Molecular Biology
w3 – For more information about Laboratory to launch Science in School.
Science on Stage Hungary, see:
www.szinpadon-a-tudomany.hu

Events
Teachers fly high at the

European Space Agency
Eleanor Hayes reports on the recent teacher workshop at
the European Space Research and Technology Centre.
Image courtesy of Anneke Le Floc’h / ESA
I n June 2010, I was delighted to be

invited to take part in the European
Space Agency’s first human space-
Centre. He asked us to consider the
best route from Earth to Mars (not the
shortest one) and what the many
flight teacher workshop at the challenges of the Martian environ-
European Space Research and ment are. Did you know, for example,
Technology Centre (ESTEC) in the that at the very low atmospheric pres-
Netherlands. Not only did I enjoy sure on Mars, your blood would boil
the contact with many enthusiastic instantly at well below body tempera-
European science teachers – the target ture? Or that the force of the air rush-
audience of Science in School – but I ing out of your lungs could knock
was able to take part in some your front teeth out? No wonder
fascinating workshops. Mars explorers will need space suits!
‘What are the obstacles to Martian Over the course of 90 minutes, Anu Teachers building their own radios
exploration?’ asked Anupam Ojha, took us on a dizzying tour of the
physics teacher and director of educa- interplanetary and Martian environ-
tion at the UK’s National Space ment – with the aid of hypodermic a memory stick full of pictures, teach-
syringes, marshmallows, liquid nitro- ing ideas and other useful resources.
gen, an orange and other basic mate- In the neighbouring room, a further
rials. The emphasis of his workshop group of 20 teachers was learning
The Melas Chasma, part of was to show how the topic of space how to assemble a radio – and receive
the huge Valles Marineris rift can be used to teach science. At the signals from local radio stations.
valley on Mars
end of the day, each teacher received “This is the first time I have ever sol-
dered anything !” commented several
of the teachers.
Image courtesy of ESA / DLR / FU Berlin (G Neukum)

Listening to teachers
Shamim Hartevelt-Velani explains why During the workshop, the teachers also suggested pos-
ESA values the involvement of teachers. sible future demonstrations and experiments that could
be done on the International Space Station by the astro-
In my work – as a teacher working in the human space- nauts, similar to the outcome of the ‘Take your class-
flight education department at ESA – it has always been room into space’ competition – which was very suc-
important to listen to what teachers want. This work- cessful in engaging students and teachers from all over
shop was one such opportunity, when we brought Europe. We’re even investigating how the students
together 40 enthusiastic teachers from 18 member themselves can get involved in future: carrying out
states of ESA. Not only did we immerse them in three space experiments in short educational films.
days of hands-on activities, we also introduced them to
BAC K G R O U N D
The feedback we continue to receive from our work-

some of the education materials that we have devel-
shop participants and other teachers helps us to
oped at ESA, and discussed how they could be used in
improve our materials and gives us new ideas about
the classroom.
what teachers need to assist them in making science
The teachers were able to provide us with useful feed- teaching more innovative and interesting to students. It
back on some of the educational resources such as the also illustrates that the workshop was the exciting
DVD Feeding our Future – Nutrition on Earth and in beginning of an iterative process of sharing and collab-
Spacew3, the educational game ‘Spaceflight Challenger oration between teachers and the ESA human space-
1’w4 and the competition ‘Take your classroom into flight education group.
space’ (see Patterson, 2009).
Image courtesy of Carmen Guerra
Later that afternoon, a panel led an

animated discussion about how to use
students’ enthusiasm for space to engage
them in science lessons. One of the out-
comes of the discussion was a new
thread in the Science in School online
forumw1 – in which teachers can share
their space-related teaching materials
with other Science in School readers.
Later, the teachers met one of ESA’s
astronauts, Frank De Winne, who
described some of the highlights of his
OasISS mission as well as his role in the
educational projects on the International
Space Station (ISS). Being able to talk to
Frank informally and ask questions
about his work was one of the high
points of the workshop.
Teachers Bernhard Sturm (left) For both the teachers and ESA, the
and Javier Mendez inside a repli- workshop was a big success – and there
ca of the Columbus module of will be another one in Summer 2011.
the International Space Station Why not apply to participate? Keep
watching the ESA Human Spaceflight
websitew2 for details.

Events
References space. To order a free DVD or Warmbein B (2007) Down to Earth:

download the video (available with interview with Thomas Reiter.
Patterson L (2009) A classroom in
subtitles in 13 European languages), Science in School 5: 19-23.
space. Science in School 12: 50-54.
see: www.esa.int or use the direct www.scienceinschool.org/2007/
www.scienceinschool.org/2009/
link: http://tinyurl.com/262fl52 issue5/thomasreiter
issue12/spaceclassroom
w4 – Become an astronaut on the For a complete list of ESA-related
To find out more about the ‘Take
International Space Station. articles, see:
your classroom into space’
'Spaceflight Challenge 1' features www.scienceinschool.org/esa
competition, see: www.esa.int or
science topics from across European To browse all space-related articles
use the direct link:
secondary-school curricula. To in Science in School, see:
http://tinyurl.com/2cpk4sq
find out more about this role-play- www.scienceinschool.org/space
The ‘Take your classroom into space’ ing game, see: www.esa.int or use
education kit can be ordered online the direct link:
here: http://esa-hme-education.org http://tinyurl.com/39tvgsy
Dr Eleanor Hayes is the editor-in-
Web references Resources chief of Science in School. She studied
w1 – To join the discussion about Below is a selection of space-related zoology at the University of Oxford,
how to use space to teach science, articles previously published in UK, and completed a PhD in insect
visit the Science in School Science in School. ecology. She then spent some time
discussion forum: working in university administration
Hartevelt-Velani S, Walker C,
www.scienceinschool.org/forum/ before moving to Germany and into
Elmann-Larsen B (2008) The
esahs science publishing, initially for a
International Space Station: life in
w2 – To find out when the next space. Science in School 10: 76-81
teacher workshop will be, and to www.scienceinschool.org/2008/
learn about the wealth of materials issue10/iss
Laboratory to launch Science in School.
developed by the ESA Human Hartevelt-Velani S, Walker C (2008) Shamim Hartevelt-Velani is a
Spaceflight education department, The International Space Station: a secondary-school teacher currently
see: foothold in space. Science in School working under contract at ESTEC, in
www.esa.int/esaHS/education.html 9: 62-65. www.scienceinschool.org the Directorate of Human Spaceflight.
For details of many more education /2008/issue9/iss She is the didactics specialist in the
materials produced by ESA, see Wegener A-L (2008) Laboratory in education group.
www.esa.int/educationmaterials space: interview with Bernardo
All education materials produced Patti. Science in School 8: 8-12.
by ESA are freely available to teach- www.scienceinschool.org/2008/
ers in the 18 ESA member states. issue8/bernardopatti
Many are translated into several Williams A (2008) The Automated
European languages. A perspective view of the Hebes
Transfer Vehicle – supporting Chasma, obtained by the High
w3 – Feeding our Future – Nutrition on Europe in space. Science in School 8: Resolution Stereo Camera (HRSC)
Earth and in Space examines food as 14-20. www.scienceinschool.org/ on ESA’s Mars Express spacecraft
a vital part of life on Earth and in 2008/issue8/atv
Image courtesy of ESA / DLR / FU Berlin (G Neukum)

Image courtesy of lisegagne / iStockphoto
What happens inside your brain

when you find something funny?
Using advanced brain imaging, it is
possible to see inside the head, to
measure changes in different parts of
the brain. The scientists therefore put
healthy volunteers into a functional
magnetic resonance imaging (fMRI)
machine and showed them cartoons.
During the brain scan, the volunteers
noted whether they found each car-
toon funny or not. Afterwards, they
gave each cartoon a score from 0-10
on a funniness scale.
“To create the unfunny cartoons, we
took funny cartoons and changed
them to spoil the joke. I was fascinat-
ed by what very small changes were
necessary – changing just one word in
esy of Allan Reiss
ourt
ec the caption could make the difference
ag
Im
between a hilarious cartoon and a

totally unfunny one.”
When the volunteers saw a funny
cartoon, the scientists were able to
detect changes to several parts of the
brain. In particular, brain regions
involved in language and executive
processing – organising information –
The science of
were activated. Given that many of
Allan Reiss the cartoons had captions, this was
not unexpected.
However, Allan and his colleagues
humour: Allan Reiss wanted to see not only how the

human brain reacts to humour, but
also whether there were differences in
Men and women react differently to humour. the responses of men and women.
They therefore used both male and
Allan Reiss tells Eleanor Hayes why this is news. female volunteers.
So do men and women have a dif-
ferent sense of humour? “Not exactly,
I magine suddenly losing all volun-

tary control of your muscles, col-
lapsing in a heap on the ground.
when someone suffers a cataplectic
attack. He knew that attacks could be
triggered by strong emotions such as
no. Men and women rated the same
number of cartoons as funny, and
they also rated the funniness [0-10] of
Being conscious but temporarily anger or sexual arousal, but was sur- the cartoons similarly. When we
unable to move. This is cataplexy, a prised to learn from a colleague, looked at the changes within the
phenomenon that, in some people, Emmanuel Mignot, that the most brain, though, the picture was rather
can be triggered by strong emotions. important trigger is humour. different.”
It is also what first got Allan Reiss However, before Allan and his When exposed to funny cartoons,
interested in studying humour in 2002. team began investigating how women showed higher activity of the
Allan, a professor of psychiatry and humour could induce a cataplectic language and organisation regions of
behavioural science at Stanford attack, they needed a baseline – they the brain than men. “That was no real
University, USA, initially wanted to needed to see how humour affects surprise. We know that men and
investigate what happens in the brain people in normal circumstances. women’s brains are different, and it’s

Feature article
Reprinted from Neuron 40(5), Mobbs D et al. Humor modulates the mesolimbic reward centers, 1041-1048, © 2003,
with permission from Elsevier
already been shown that, for certain

Activation in females Activation in males
types of task, women use these 0.3 0.3
regions of the brain more than men
do.
Activation level
Activation level
“What was unexpected was a differ- 0.15 0.15
ence in the mesolimbic reward region
of the brain: the funny cartoons stim-
0 0
ulated this part of the brain much
more in women than in men.” The
-1.0 -1.0
mesolimbic reward region is associat- 0 5 10 15 0 5 10 15
ed with happiness: seeing beautiful Time (seconds) Time (seconds)
faces, cocaine-induced euphoria and –– Funny cartoon –– Unfunny cartoon
other ‘positive’ stimuli. “The male

Brain activation in males and females
and female volunteers said they
found the cartoons equally funny, so seems that the male volunteers had At this point, I can’t resist asking
this difference in brain activity seems higher expectations: they expected to what Allan’s interpretation of the
to have more to do with their expecta- be amused. The women, however, data is. Did the men really have high-
tions than their actual experiences.” were more cautious – and thus, more er expectations than the women?
This could be explained by what are pleasantly surprised by the funny car- What if they simply hadn't listened to
known as dopaminergic neurons – a toons. The reactions to the unfunny the instructions? With a laugh, he
group of nerve cells that respond not cartoons also fitted this explanation: agreed that there are many possible
to reward as such, but to the differ- the unfunny cartoons caused the interpretations of the demonstrated
ence between the reward you were mesolimbic reward region of the brain differences in brain activation.
expecting and what you actually get. to be deactivated in men (they didn't
Before the experiments, all the volun- get the expected reward), whereas in
teers had been told that they were women there was little or no activity
going to be shown 80 cartoons, only (they were not expecting to be
some of which would be funny. It amused; see graph).
Biology
Images courtesy of slowgogo / iStockphoto Neurobiology
Ages 16+
Do men and women

react differently to
humour? Do boys have a
different sense of humour
or do girls understand
jokes better? This could
be an interesting project
for students in a biology
class. Reading this article
should help students to
think about possible
humour-related differ-
ences between the sexes
and how they could be
studied.
REVIEW
Who would have thought

that there is actually a sci-
ence of humour!
Andrew Galea, Malta

there are huge changes going on in Azim E et al. (2005) Sex differences in
the brain. And that affects humour brain activation elicited by humor.
too: what a 10-year-old finds funny is Proceedings of the National Academy
very different to what a 16-year-old of Science of the USA 102(45):
does. It could be interesting to investi- 16496-16501. doi:
gate those changes at the level of the 10.1073/pnas.0408456102
brain.” This article is available freely from
Finally, if a class of 15-year-olds the journal’s website: www.pnas.org
wanted to do an experiment on Mobbs D et al. (2003) Humor modu-
humour at school, what would he lates the mesolimbic reward centers.
recommend? Neuron 40(5): 1041-1048. doi:
“Well, they could investigate just 10.1016/S0896-6273(03)00751-7
that: what sort of humour appeals to This article is available freely from
different ages. They could give stu- the journal’s website:
dents in each year in their school a www.cell.com/neuron
choice of cartoons and get them to say
Image courtesy of Stalman / iStockphoto Schultz W (2002) Getting formal
which they find funniest. Or ask each
with dopamine and reward. Neuron
class for their favourite jokes and then
36(2): 241-263. doi: 10.1016/
I ask Allan what the next steps will categorise the jokes into different
S0896-6273(02)00967-4
be for him and his colleagues. “We’d types of humour and see if this
like to see how early this gender dif- changes with age.” This article is available freely from
ference appears, so we’re going to do the journal’s website:
www.cell.com/neuron
the same type of experiment with
young children, ages six to ten.” In Scientific research often leads us off Schultz W, Tremblay L, Hollerman JR
preparation for this experiment, Allan at a tangent; Allan began researching (2000) Reward processing in pri-
and his colleagues (with the help of cataplexy and ended up doing rather mate orbitofrontal cortex and basal
lots of young children) have been a lot of research on humour instead. It ganglia. Cerebral Cortex 10: 272-283.
scouring the online video collection occurs to me after the interview that I doi: 10.1093/cercor/10.3.272
YouTube for funny video clips. The never even asked if he ever did the This article is available freely
scientists want to look not only for experiments on humour in cataplectic from the journal’s website:
gender differences, but also for differ- people. A quick search on the Internet http://cercor.oxfordjournals.org
ences that depend on the type of shows that he did, but I’ll let you read
If you enjoyed this article, you might
reward – does the brain react differ- that paper for yourselves (Reiss et al.,
like to browse other feature articles
ently to funny videos (e.g. a child try- 2008).
in Science in School. See:
ing to hit a balloon with a stick and
www.scienceinschool.org/features
accidentally hitting his father) and to References
other ‘rewarding’ videos (e.g. lots of Reiss AL et al. (2008) Anomalous
cute puppies or a child scoring the hypothalamic responses to humor
winning goal in a football match)? in cataplexy. PLOS One 3(5): e2225. Dr Eleanor Hayes is the editor-in-
“It’s been surprisingly difficult to find doi: 10.1371/journal.pone.0002225 chief of Science in School. She studied
videos that are not funny but This article, like all articles in PLOS zoology at the University of Oxford,
nonetheless equally rewarding in One, is freely available from the UK, and completed a PhD in insect
other ways: the children rate humour journal’s website: www.plosone.org ecology. She then spent some time
above anything else we can find,” working in university administration
Allan comments. Resources before moving to Germany and into
I point out to Allan that most of the At ESOF, the Euroscience Open science publishing, initially for a
readers of Science in School teach neither Forum, in July 2010, Allan Reiss bioinformatics company and then for
adults nor young children – our read- described some of his research. a learned society. In 2005, she moved
ers teach mostly teenagers. If he had a To watch the video, see the video to the European Molecular Biology
class of 15-year-olds to experiment on, collection on the ESOF website Laboratory to launch Science in School.
what would he like to find out? (www.esof2010.org/webesof)
“Puberty is a momentous time. It’s or use the direct link:
not only the body that’s changing – http://tinyurl.com/3ynca4s

Human evolution: testing

the molecular basis
In the second of two articles, Jarek Bryk describes how
Images courtesy of Henrik5000/ iStockphoto

scientists dig deep into our genes – to test the molecular
basis of an evolutionary adaptation in humans.
Biology variation in the human population or as a starting

Genetics point for investigating the Sanger Institute and the
Biochemistry Human Genome Mapping Project.
Ages 16+ The students could discuss evolutionary advantage,

with reference to the particular variation described in
the article. This could lead on to a discussion of selec-
Despite all our knowledge of the sequence of the
tion, population genetics and Hardy-Weinberg equi-
human genome, the precise function of huge segments
librium. To complement this discussion, there is an
of it and how and why DNA sequences have changed
excellent activity in Issue 6 of Science in School
within populations remain largely undiscovered.
(Pongsophon et al., 2007).
Evolutionary adaption in humans has obviously
Suitable comprehension questions include:
occurred but it is very hard to demonstrate. This article
describes how one such change has been identified. 1. In your own words and giving an example that is
Experiments with genetically modified mice have not in the text, describe what a SNP is.
demonstrated how a single base change in the DNA, 2. Explain the significance of SNPs.
which changes the amino acid sequence of the pro- 3. Which amino acid does the nucleotide triplet GTT
tein, leads to an alteration in the structure and function code for?
REVIEW
of a protein. This can result in phenotypic variation. 4. Describe the changes that were found in the mice
In science lessons, the article could be used when with a genetically modified EDAR pathway, and
addressing the topics of codon usage and degeneracy; suggest ways in which the observed changes could
protein structure and function; and population genet- be quantified.
ics. It could also be used as background reading on Shelley Goodman, UK

T he DNA of every organism holds

information about its recent and
ancient evolutionary history. By
One of the ways potentially benefi-
cial regions of our genome can be
identified is simply by comparing
HapMap databasew1. The SNP in
Figure 1, rs3827760, is found in two
variants or alleles: at that point in the
studying the patterns and changes in DNA sequences of many individuals sequence, one of two bases may be
the DNA sequence – comparing the from different populations. In a very found – either thymine (T) or cytosine
sequences between different individu- simple scenario, if one of these popu- (C).
als or species – we can uncover what lations has been under selective pres- Each circle in the figure represents a
has happened to them. We can find sure (for example, high UV radiation single population, and depicts the fre-
out which genes or fragments of the in a sunny region) that was absent in quency in that population of the two
genome are likely to have provided the other populations, the DNA possible alleles.
an advantage to those individuals and sequence responsible for an appropri- The thymine-containing allele is
species that carried them, allowing for ate adaptation (for example, a darker present in all African and most
their better survival and reproduction skin colour) should be different. European samples, but is almost com-
(see glossary for all terms in bold). In the vast majority of cases, how- pletely absent in East Asia and the
In a previous article (Bryk, 2010), I ever, we do not know what selective Americas, where cytosine is most
described a few examples of such pressures populations were exposed prevalent at that position in the
beneficial genetic changes in humans to in the past, or which genetic sequence (Sabeti et al., 2007, 2006; Xue
and other organisms. Demonstrating sequences are responsible for the et al., 2009).
which genetic changes might have adaptations. Let us begin, therefore, If we did this comparison for all the
been beneficial is difficult – especially by comparing DNA sequences other three million SNPs from the
in humans – but an even greater chal- between human populations without HapMap we would see that the distri-
lenge is demonstrating the mechanism any assumptions about what we may bution of rs3827760 variants among
by which these changes could have find. Figure 1 shows one such com- human populations is very unusual.
improved the organisms’ survival and parison, for a single nucleotide of the Thus rs3827760 definitely deserves a
reproduction. human genome. more detailed look, even though the
In this article, I present one of the When individuals have different distribution does not tell us anything
approaches that scientists can use first nucleotides at a particular position in about the potential benefit of the vari-
to identify regions of our genome that the DNA sequence, we call this a sin- ants (their adaptive value), or even
could have helped us survive and gle nucleotide polymorphism (SNP, pro- whether they are adaptive at all. All
reproduce, and then to test how these nounced ‘snip’); three million such we know so far is that for some rea-
regions might have provided our variants of the human genome are son, the original thymine that was
ancestors with an advantage. catalogued in the publicly available present at this position in ancestral
Adapted with permission from Macmillan Publishers Ltd: Nature, Sabeti et al. (2007), © 2007
Figure 1: The distribution

of SNP rs3827760. Each
circle represents a single
population and depicts the
frequency of the two pos-
sible variants of this SNP –
white: thymine (T) or blue:
cytosine (C)
Derived variant (cytosine)

Ancestral variant (thymine)

Image courtesy of Jarek Bryk
Figure 2: Panels A1, A2 and B1-B3 each illustrate

Two p p
populations of 10 chromosomes each 10 individuals sampled from each of two popula-
tions of the same species. For each individual,
one chromosome is shown (e.g. chromosome 9).
Population A does not experience positive selec-
A1 PAST B1
Chromosome tive pressure and remains relatively unchanged
over time, apart from acquiring some random
genetic changes that do not influence fitness
Polymorphism (mutation
(orange squares in panel A2; variants which
w
with no influence on
o
organisms’ fitness) reduce fitness are removed from the population) –
compare panels A1 and A2.
Advantageous mutation Population B moves to a new environment, how-
ever, where it faces new selective pressures. In
that new environment, a particular genetic
change (the blue square on panel B1) provides an
B2
Chromosome fragment advantage to the individuals carrying it and
with an advantageous spreads quickly through the population (individu-
mutation spreads in a als carrying it leave more offspring). The genetic
population, reducing variants close to the selected SNP get dragged
genetic diversity and
'dragging' nearby variants
along with it (the closer two variants are, the
along smaller the chance that they will be separated
during recombination, when parts of the DNA are
exchanged between maternal and paternal chro-
Chromosome fragments mosomes – see Figure 3).
brought in by
A2 B3 recombination and new The result of this rapid spread of a DNA sequence
polymorphisms through the population is a reduction in genetic
diversity in that region; most individuals will have
the advantageous SNP, together with the genetic
variants close to it (compare panels B1 and B2).
This process happens quickly.
After some time, however, new genetic changes
and recombination events introduce new variants
PRESENT (green rectangles and orange squares in panel
B3). The longer the time since the spread of the
original selected variant, the more difficult it is to
detect, because the pattern of reduced diversity
(B2) will eventually be masked (B3)
human populations in Africa changed To see whether the DNA change fer between populations. To under-
to cytosine, and that this change (thymine to cytosine) was positively stand why that is, see Figure 2.
spread through East Asians and selected, we look at the DNA When the DNA sequences around
Americans. Even the estimates of sequence around the SNP. If the DNA rs3827760 are compared, it becomes
when this change happened are very sequence surrounding rs3827760 were obvious that the diversity around the
imprecise: somewhere between 1000 similar in all populations, we would cytosine variants in the East Asian
and 70 000 years ago, all individuals have no evidence that the SNP had an populations is indeed much lower
in East Asian populations had the effect on the organism’s fitness. If, than the diversity around the thymine
cytosine variant. however, one population (East Asian, variants found in the African and
How, then, can we decide whether for example) were exposed to a selec- European populations (the Americans
this pattern arose due to positive tive pressure and rs3827760 con- were not tested). This suggests that
selection (cytosine conferred an tributed to the development of adap- positive selection was responsible for
advantage in East Asia and the tation to that selective pressure, DNA the cytosine variant spreading in the
Americas) or is simply due to chance? sequences around the SNP would dif- East Asian populations. But was this

Image courtesy of Nicola Graf

SNP really selected – does it in fact do
anything?
Not all changes to the DNA
sequence have an effect on protein
sequences: most of the SNPs cata-
logued in the HapMap database
A a A a A a
either are located in the non-coding
parts of the genome (e.g. between B b B b B b
genes) or are synonymous – that is,
they are located in the coding part of
the genome but do not cause a change c c C c C
C
in the protein sequence encoded (see
Figure 4).
In the case of rs3827760 we are
lucky, because it is located in the cod-
ing part of a gene – towards the end
of a gene called EDAR, which is
involved in the development of hair
follicles, sweat glands and teeth. A a A a
Furthermore, the thymine-to-cytosine
B b B b
DNA sequence change results in a
change in the protein sequence:
Africans and Europeans (carrying the
SNP variant with thymine) have the c C c C
amino acid valine at position 370 of
the protein, whereas East Asians and
Americans (with the nucleotide cyto-
sine) have the amino acid alanine.
This part of the protein is involved in
interactions with other proteins, and
mutations there are known to cause
ectodermal dysplasias – abnormal A a
development of the teeth, hair and
A a
sweat glands – in humans and mice b B
(see Figure 5). This fact strongly sug- b B
gests that an amino acid change at
position 370 may not only change the c C c C
sequence of the protein but also how
the protein behaves, affecting the
physical characteristics of the organ-
ism itself. Figure 3: During recombination, parts of the DNA are exchanged between mater-
nal (green) and paternal (grey) chromosomes and passed on to the next generation
To see whether the change in pro-
in a new configuration. The closer two regions are together, the less likely they are
tein sequence really does affect its
to be separated during recombination: A and B are closer together than B and C,
function, we turn to experiments on thus are less likely to be separated
the biochemical pathway in which the
EDAR protein takes part: a series of
reactions which are involved in the was found to make the pathway more people with the valine variant. For a
development of hair follicles, sweat active than the valine variant (found more direct demonstration, mice were
glands and teeth. When these reac- in Africans and Europeans, encoded genetically modified to increase the
tions were carried out in the laborato- by the thymine SNP variant) did. This activity of the EDAR pathway. These
ry, the alanine variant of the protein ties in with comparisons of hair struc- mice had visibly denser fur with
(found in East Asians and Americans, ture, which show that people with the thicker hair, as well as larger salivary
encoded by the cytosine SNP variant) alanine variant have thicker hair than glands, than mice with normal EDAR

Image courtesy of Jarek Bryk
ments, and we can only speculate

SNP1 SNP2 SNP1 SNP2 about the selective pressures that the
Asian and American populations
DNA GAGAAGGCTGTTGTGAAAACG GAGAAAGCTGCTGTGAAAACG
CTCTTCCGACAACACTTTTGC GAGAAAGCTGCTGTGAAAACG were exposed to, which encouraged
the spread of the cytosine allele. But
the combination of genomic studies,
mRNA GAGAAGGCUGUUGUGAAAACG GAGAAAGCUGCUGUGAAAACG laboratory experiments and animal
models makes it possible to test
protein GluLys Ala ValValLysThr GluLys AlaAlaValLysThr hypotheses about the functional roles
of genetic differences between popu-
Original sequence Mutated sequence
lations or species. Using these
approaches, we may uncover the
Figure 4: Not all changes to the coding DNA sequence cause a change in the
molecular basis of past adaptations in
encoded protein sequence. In this example, replacing guanine (G) with adenine our ancestors and other organisms,
(A) in the codon AAG makes no change to the protein: both AAG and AAA encode highlighting how we adapt to a con-
the protein lysine (SNP 1). This is known as a synonymous mutation. stantly changing environment.
In the case of the SNP rs3827760 (SNP 2 in this figure), thymine (T) is replaced
with cytosine (C) in the codon GTT. Changing the codon from GTT to GCT References
changes the encoded protein from valine (Val) to alanine (Ala). This is known Bryk J (2010) Natural selection at the
as a non-synonymous mutation
molecular level. Science in School 14:
58-62. www.scienceinschool.org/
Adapted with permission from Macmillan Publishers Ltd: Nature, Sabeti et al. (2007), © 2007
2010/issue14/evolution
Chang SH et al. (2009) Enhanced
EDAR signalling has pleiotropic
effects on craniofacial and cuta-
neous glands. PLoS ONE 4(10):
e7591. doi: 10.1371/
journal.pone.0007591
This article describes the phenotype
of various glands of mice with
enhanced EDAR signalling, and
speculates which traits could have
been positively selected in human
history. The article is freely avail-
able from the journal website:
www.plosone.org
Chunyan M et al. (2008) Enhanced
Figure 5: Hypothetical structure ectodysplasin-A receptor (EDAR)
of part of the EDAR protein. signaling alters multiple fiber char-
Mutations marked in green acteristics to produce the East Asian
cause ectodermal dysplasia in
hair form. Human Mutation 29(12):
humans. The putatively selected
1405-1411. doi: 10.1002/humu.20795
SNP is marked red
This article details in vitro studies
of EDAR and the transgenic mice,
with very nice pictures and photos.
activity (Chunyan et al., 2008; Chang may lead to physical differences in Pongsophon P, Roadrangka V,
et al., 2009). humans: differences in hair thickness Campbell A (2007) Counting
Taken together, these findings sug- and, potentially, the size of the sali- Buttons: demonstrating the Hardy-
gest that the two SNP variants (con- vary glands. Weinberg principle. Science in School
taining either thymine or cytosine) The differences in the DNA 6: 30-35. www.scienceinschool.org/
may affect both the structure and sequences that we observe now are 2007/issue6/hardyweinberg
function of the EDAR protein, and historical records of natural experi- Sabeti PC et al. (2006) Positive natural

Glossary
Adaptive value: a trait has an adaptive value if it on the US National Library of Medicine websitew2.
enables an individual to survive and reproduce better Positive selection: natural selection is one of the
in a given environment than individuals that do not mechanisms of evolution; it describes the different
possess this trait. More formally, a trait is regarded as survival and reproduction of individuals in a given
adaptive if it increases fitness. environment. Natural selection is called ‘positive’
Allele: a variant of a gene. when it promotes certain traits that help individuals to
BAC K G R O U N D
Fitness: a hard-to-define formal term from evolution- survive and reproduce better than others.
ary biology and population genetics; it describes the Selective pressure: a feature of the environment (e.g.
average number of offspring over one generation that temperature; presence of parasites; predation or
is associated with one genotype compared to another aggression from members of the same species) that
genotype in a population. Thus genotypes that pro- imposes differential survival and reproduction of
duce more offspring have greater fitness. individuals.
Genome: usually the total nuclear DNA of an organ- SNP: a single nucleotide polymorphism, or single
ism, as opposed to including mitochondrial or plastid letter in the DNA sequence that differs between
DNA. For further information, see ‘What is a genome’ individuals. Pronounced ‘snip’.
selection in the human lineage. This paper contains discussion Resources

Science 312(5780): 1614-20. doi: about EDAR and other similar To browse other evolution-related
10.1126/science.1124309 genes. It is freely available via articles in Science in School, see:
This is an excellent overview of PubMed Central: www.ncbi.nlm. www.scienceinschool.org/evolution
various methods used to investigate nih.gov/pmc or using the direct
positive selection from the genomic link: http://tinyurl.com/26xte2h
perspective.
Sabeti PC et al. (2007) Genome-wide Web references Jarek Bryk is a post-doctoral
detection and characterization of w1 – The HapMap project is a part- researcher at the Max Planck Institute
positive selection in human popula- nership of scientists and funding for Evolutionary Biology in Plön,
tions. Nature 449: 913-918. doi: agencies from Canada, China, Germany, where he tries to find and
10.1038/nature06250 Japan, Nigeria, the UK and the USA analyse adaptive genes in mice.
Download the article free of charge to develop a public resource that
from the Science in School website will help researchers find genes
(www.scienceinschool.org/2010/ associated with human disease and
issue16/evolution#resources), or the response to pharmaceuticals.
subscribe to Nature today: See: www.hapmap.org
www.nature.com/subscribe
w2 – For more information about
This paper describes one of the
genomes and the Human Genome
approaches to genome-wide
Project, see ‘What is a genome’
searches for positive selection.
on the US National Library of
Xue Y et al (2009) Population differen- Medicine website:
tiation as an indicator of recent http://ghr.nlm.nih.gov/handbook/
positive selection in humans: an hgp/genome
empirical evaluation. Genetics
183(3): 1065-77. doi: 10.1534/
genetics.109.107722

Science is cool...
supercool Physics
Ages 13-18
One of nature’s strange

When we cool something below its freez- phenomena is that, for
ing point, it solidifies – at least, that’s what some substances, the
melting point is not always
we expect. Tobias Schülli investigates why the same as the freezing
point. In this article,
this is not always the case. Tobias Schülli leads us
into the world of con-
densed matter; he intro-
H ow is it possible that clouds
at high altitude, at a tem-
perature lower than 0 °C, consist
well below their melting point.
Although this phenomenon,
known as supercooling, was dis-
duces the differences
between the states of mat-
ter, and provides an expla-
of tiny droplets of water instead of covered in 1724 by Daniel Gabriel
nation of this apparent
ice? Actually, under certain condi- Fahrenheit (Fahrenheit, 1724), it is
anomaly: supercooling.
tions, liquids can remain liquid still the subject of much research.
The article can be used in
various ways as a teaching
aid. Teachers could get
their students to read the
article and then initiate a
classroom discussion, not
only about changes in
states of matter but also
about modern research
methods in the field of
condensed matter physics.
To ensure that the students
had understood the text,
the teacher could question
them, for example about
conditions of crystal
growth.
Image courtesy of ktsimage / iStockphoto
The article could also

inspire some readers to
develop their own educa-
tional material on the
topic of supercooling.
Furthermore, the simple
classroom activity in the
REVIEW
article may demonstrate to

students that it is not only
temperature that deter-
mines the state of matter.
Vangelis Koltsakis, Greece

The different states of matter the optimisation of chemical bonds migrate around, inhibiting the forma-
For scientists, the liquid phase is a and binding energies, this generally tion of the perfect regular pattern of a
curious state of matter between order leads to the densest packing of the crystal. The density of a liquid (com-
and disorder. The disordered state of atoms, in a repeated three-dimensional pared to a gas) thus differs very little
matter is well illustrated by the per- arrangement, which is called a crystal. from that of the solid state (see Figure
fect gas: the thermal movement of the Therefore, what we call a solid is in 1).
individual atoms (or molecules) is so fact, most of the time, a crystalline Although a liquid is considered to
important that the attractive forces solid. be mainly disordered, atoms may
between them play no role and they In the liquid – intermediate – state, arrange themselves locally in small
move freely through space. At the the neighbouring atoms touch each clusters, giving rise to the notion of
other extreme, in the solid state, every other as in the solid state (both states local order. The exact nature of these
atom remains at a fixed site, tightly are thus referred to as condensed states of local order is very difficult to
bound to its neighbours. Driven by matter), but the individual atoms can observe experimentally, but is
believed to play a crucial role in the
transition of a substance from a disor-
dered phase to an ordered one.
a Whether a particular substance is in
Figure 1: the gaseous, solid or liquid phase
The states of matter: depends on the temperature and pres-
a) In the solid or crystalline state sure. Ice at atmospheric pressure will
of matter, each atom remains at a melt at 0 °C, mercury at -39 °C and
Image courtesy of Tobias Schülli
fixed site. It can be considered to gold at 1064 °C. As they get warmer,
be tightly bonded to its neigh- solids (crystals) melt at exactly these
bours. If we heat a crystal, the temperatures. However, the opposite
atoms begin to move (thermal is not true: when a liquid is cooled to
vibration).
b its melting point, the formation of a
b) In the liquid state (at tempera- crystal is possible but does not neces-
tures above the melting point),
sarily happen at exactly the melting
thermal movement allows the
individual atoms to move around point (Figure 2). In the striped area of
freely, although the attractive the figure, a pure liquid (with no crys-
forces between the atoms ensure talline impurities) will remain liquid.
that they are almost as close We say that the liquid is supercooled.
together as in the solid state. A This state of matter is said to be
liquid therefore has almost the metastable (Figure 3).
same density as a solid, and
resists compression as does a
solid.
How can we explain
supercooling?
c) At elevated temperatures, the
thermal movement of the individ-
The first explanation of supercool-
ual atoms in a gas becomes so ing lies in the physics of crystallisa-
important that the attractive tion. The formation of a crystal
c forces between the atoms no requires a nucleus of regularly
longer play a role and the atoms arranged atoms, around which the
can move freely through space. crystal can grow. Crystallisation most
The density of a gas depends on commonly occurs when the liquid is
the surrounding pressure and
in contact with a solid surface or
temperature. At high pressure or
low temperature, the atoms may when the liquid contains crystalline
Gas impurities; it is as if the liquid mimics
start to stick together again and
condense into denser arrange- the ordered structure of the neigh-
ments to form a liquid or a solid. bouring surface. This is called hetero-
For this reason, these two states geneous nucleation, starting from a seed.
are also called condensed matter In the absence of a crystalline solid,
the spontaneous formation of a large
and regular structure from the disor-

2 1

Solid
Pressure P
Liquid
Figure 3: The red circle is in a

metastable state: it will remain in this
state only if the conditions remain
unchanged. The blue circle is in a
transition (or unstable) state, moving
towards the stable state represented by
Gas the black circle. Any unstable state
will move towards the stable state,
whereas the metastable state requires
TM specific conditions to do the same
Temperature T
Figure 2: Phase transitions. When the temperature is raised, the solid (crystal) melts, a)
transforming into a liquid (white arrow) at exactly the melting point, TM. When the
liquid is cooled below TM (black arrow 1), solidification is possible but does not
necessarily occur. In the striped area, a pure liquid (with no crystalline impurities)
will not solidify. If the liquid is cooled further, it will solidify (black arrow 2)
dered liquid is unlikely. Although 40 degrees below its melting point of

small numbers of atoms may sponta- 0 °C, are metals, which can exist as

neously form a regular arrangement, liquids at several hundred degrees
these clusters are usually too small to below their melting point. This is b)
serve as crystallisation nuclei, and known as deep supercooling and has
quickly re-dissolve in the liquid. A challenged scientists to go beyond the
pure liquid, therefore, needs to be sig- crystal nucleation theory to explain
nificantly supercooled before homoge- the metastability of liquids (Turnbull,
neous nucleation occurs: a few atoms in 1952).
the liquid spontaneously order in the Scientists have speculated that the
right manner to form a crystal that is internal structure of some liquids Figure 4: Nucleation, the formation of
large and stable enough to serve as could be incompatible with crystalli- a crystal from a liquid.
the nucleus for further crystal growth sation. In the 1950s, Frederick Charles a) Crystal formation usually begins
(Figure 4). Frank suggested that the densest around an already crystalline solid in
Most of the tiny droplets of water arrangement of a small number of contact with the liquid (heterogeneous
which constitute stratiform and atoms may be different to the local nucleation).
cumulus clouds do not contain any arrangement of atoms in a crystal, b) As a consequence, the liquid needs
seed crystals; these droplets can and that these clusters in a liquid are to be significantly supercooled before
remain liquid well below 0 °C. therefore ordered in the wrong way to homogeneous nucleation occurs: a few
atoms in the liquid spontaneously
serve as a crystallisation nucleus
order in the right manner to form a
Deep supercooling in metals (Frank, 1952). crystal, which then serves as the
Even more spectacular than water, As a model, Frank used the icosahe- nucleus for further crystal growth
which can be supercooled only about dron: a central atom with twelve sur-

Figure 5: Triangles (three-fold symmetry), squares (four-fold symmetry) and hexagons (six-fold symmetry) can fill a plane perfectly,
whereas pentagons (five-fold symmetry) cannot
rounding atoms. Such a structure, can fill a plane perfectly, whereas pen- tallisation. So far, however, very few
which has a pentagonal symmetry, tagons cannot (Figure 5). In three experiments have allowed the visuali-
cannot form the basis of a crystal. dimensions, pentagonal structures are sation of pentagonal symmetry in liq-
Generally, a crystalline structure has incompatible with the formation of a uids (Reichert et al., 2000).
to repeat in three dimensions, like crystal (Figure 6).
bricks in a wall. A cubic arrangement, Recent simulations and theoretical Supercooling in semiconductor
for example, is an excellent structure models support Frank’s idea, suggest- nanostructures
for a crystal, as it is both dense and ing that a significant fraction of the My own encounter with the phe-
perfectly regular. atoms in liquids arrange themselves nomenon of supercooling was not
Using a two-dimensional compari- in clusters with five-fold symmetry, really intentional. Actually, the focus
son, triangles, rectangles or hexagons thus presenting an obstacle to crys- of my research, within a team at the
Experiment with supercooling

C L A S S R O O M AC T I V I T Y
Place an unopened bottle of still mineral water in the unlikely to work with tap water, which may contain
freezer for 1–2 hours. After this time, the water should crystalline impurities that trigger crystallisation closer
be around -10 to -5 °C. Because the water should to the melting (freezing) point of water.
have no solid impurities in it, it should still be liquid Note: do not leave the bottle in the freezer for too
even at this temperature – it is supercooled. long, because once the water gets below -10 to -5 °C,
Carefully remove the bottle from the freezer, then hit it will freeze, even if there are no crystalline impuri-
it on the table or with your hand. You should be able ties.
to see that the water crystallises (freezes), with the ice
formation progressing very quickly through the whole
bottle. The crystallisation is triggered by the shock
wave travelling through the liquid. (The shock wave is
another possible explanation of why aeroplanes leave
a visible trail of water crystals behind them.)
This can only be achieved in liquids that do not con-
tain seeds that may provoke crystallisation. It is
Images courtesy of Tobias Schülli

Images courtesy of Tobias Schülli
Figure 7: Droplets of liquid gold-silicon alloy all melted at the same temperature.
As they cooled, however, the differences in the crystalline silicon surfaces on
which the droplets sat affected the temperature at which the droplets crystallised.
(a) (a) When the silicon crystal was cut along the cubic facets, the silicon atoms at
the surface that was in contact with the droplet were arranged in a square lattice.
On this surface, the droplets crystallised at about 60 K below their melting point.
X-ray results showed that the droplet had crystallised in a structure and orientation
similar to the silicon crystal on which it sat.
(b) When the silicon crystal was cut in the spatial diagonal of the cube, the silicon
atoms at the surface that was in contact with the droplet were arranged in a trian-
gular lattice. The droplet on this surface crystallised at about 70 K below its melt-
ing point. X-ray results showed that the droplet too had crystallised in a structure
and orientation similar to the silicon crystal on which it sat.
(c) The silicon crystal was cut as in b) but underwent a special treatment at high
temperature that provoked the formation of a pentagonal atomic arrangement of
gold atoms bonded to the silicon surface. On this surface, the droplets remained
(b) in their metastable liquid phase down to 120 K below the melting point – deeply
supercooled
(a)
(b)
(c)
Figure 6: Two examples of structures

that are not compatible with the forma-
tion of a crystal:
(a) An icosahedron, the densest
arrangement possible for 13 atoms.
(b) A cluster of 7 atoms with pentago-
nal symmetry
Solid
Liquid
CEAw1 in Grenoble, France, was to We deposited tiny droplets (0.1-0.2 an experiment at the European
understand and improve novel μm) of a liquid gold–silicon alloy on a Synchrotron Radiation Facility
growth methods for semiconductor silicon surface, prepared under ultra- (ESRF)w2, also in Grenoble. The scat-
nanostructures. In these methods, the high vacuum conditions, a standard tering of very intense X-rays pro-
processes of solidification and nucle- technique used in semiconductor produced in a synchrotron is a unique
ation are crucial. The attention of our cessing. We observed that, while in way to obtain information about the
team was attracted by a report on contact with this crystalline surface, arrangement of atoms in a liquid and
supercooling in droplets of the droplets remained liquid at 240 on solid surfaces.
metal–semiconductor alloys: these °C, well below their melting point We fired X-rays almost parallel to
droplets offered us a good system to (which is 363 °C). To understand this the surface of the silicon crystal on
study the influence of a crystalline extraordinary supercooling behaviour which the droplets of gold–silicon
seed (a silicon surface) on the solidifi- (usually only observed in the absence alloy had been deposited. At an angle
cation of the alloy. of crystalline seeds), we carried out of only 0.1° (a technique called grazing

incidence), the X-rays are reflected by After 60 years of research into Web references
the flat silicon surface and penetrate supercooling of metals, this is finally w1 – The CEA is the French Atomic
the droplets deposited on it. The scat- the experimental demonstration that Energy and Alternative Energies
tered X-rays carry information about five-fold symmetry affects the Commission (Commissariat à l’én-
the atomic arrangement of the last metastability of a liquid (Schülli et al., ergie atomique et aux énergies alterna-
atomic layer of the silicon surface, as 2010; Greer, 2010). tives). To learn more, see:
well as about the structure of the www.cea.fr
droplets. References w2 – The European Synchrotron
These experiments allowed us to Fahrenheit DG (1724) Experimenta & Radiation Facility (ESRF) is an
determine the state (liquid or crys- observationes de congelatione aquæ international research institute for
talline) of the droplets as they were in vacuo factæ. Philosophical cutting-edge science with photons.
cooled, and to determine the exact Transactions 33: 78-84. doi: ESRF is a member of EIROforum,
atomic arrangement of the upper 10.1098/rstl.1724.0016 the publisher of Science in School. To
atomic layer of the silicon surface. learn more, visit: www.esrf.eu
Frank FC (1952) Supercooling of
The X-ray results showed that in the
liquids. Proceedings of the Royal
uppermost atomic layer of the silicon Resources
Society 215: 43-46. doi:
surface, the atoms were arranged For a further consideration of clouds,
10.1098/rspa.1952.0194
with five-fold symmetry. On these see:
surfaces, even when cooled to more Greer AL (2010) Materials science: a
cloak of liquidity. Nature 464: Ranero Celius K (2010) Clouds:
than 100 degrees below their melting
1137-1138. doi: 10.1038/4641137a puzzling pieces of climate. Science
point, the droplets remained liquid.
Download the article free of charge in School 17: x-y.
A more detailed analysis of the
on the Science in School website www.scienceinschool.org/2010/
solid / liquid interface revealed that
(www.scienceinschool.org/ issue17/clouds
these pentagonal surface structures
were formed from a single layer of supercooling#resources), or To see all other Science in School
gold atoms bonded tightly to the sili- subscribe to Nature today: articles about ESRF, see
con crystal. As explained before, we www.nature.com/subscribe. www.scienceinschool.org/esrf
generally expect liquids to mimic the Reichert H et al. (2000) Observation of
solid structure with which they are in five-fold local symmetry in liquid
contact, provoking heterogeneous lead. Nature 408: 839-841. doi: Tobias Schülli studied physics and
nucleation. Our measurements 10.1038/35048537 mathematics at the University of
showed that such mimicry of the sur- Download the article free of charge Stuttgart, Germany. He obtained his
face structure takes place, but that it on the Science in School website PhD at the Johannes Kepler
can have the opposite effect: a struc- (www.scienceinschool.org/ University Linz, Austria, for the
ture that is incompatible with the for- supercooling#resources), or development of X-ray scattering
mation of a 3D crystal can force the subscribe to Nature today: methods in the study of semiconduc-
liquid to locally adopt the ‘wrong’ www.nature.com/subscribe. tor nanostructures. In 2003 he joined
type of order. Instead of triggering Schülli TU et al. (2010) Substrate the Commissariat à l’énergie atomique et
heterogeneous nucleation, this enhanced supercooling in AuSi aux énergies alternatives (CEA)
increases the stability of the super- eutectic droplets. Nature 464: 1174- Grenoble, where he studied crystal
cooled phase of the liquid (see 1177. doi: 10.1038/nature08986 surfaces and nanostructure growth in
Figure 7). Download the article free of charge situ using synchrotron radiation at
on the Science in School website the ESRF. In 2009, he moved to ESRF
(www.scienceinschool.org/ and is in charge of the upgrade of one
supercooling#resources), or of its instruments, dedicated to the
subscribe to Nature today: study of nanostructures and interfaces
www.nature.com/subscribe. using highly focused X-ray beams.
Turnbull D (1952) Kinetics of solidifi-
cation of supercooled liquid
mercury droplets. Journal of
Chemical Physics 20: 411-424. doi:
10.1063/1.1700435

Teaching activities
Going ballistic: modelling

the trajectories of projectiles
Students often find it difficult to calculate the trajectories
of projectiles. With the help of Elias Kalogirou’s model,
they can be easily visualised. In addition,
Ian Francis suggests further uses for
the model in the classroom.
Physics
Maths
Arts / design and technology
Ages: 15+
The idea behind the model-building experi-

ment proposed in this article is very creative,
and the students will learn through active
participation, using many skills along the
way. Once constructed, the model will also
serve as a visual aid for theory covered in
class; this is complemented by suggestions
for a set of activities that can be performed
during the lesson.
Images courtesy of yenwen / iStockphoto
Depending on their students’ abilities, teach-

ers may choose to leave the discovery of the
theories behind the experiments to their stu-
dents, or guide them on their way.
The activity would definitely fit into the
physics curriculum, as part of teaching
motion (projectiles), a topic included in most
European curricula. The activity can be con-
sidered as interdisciplinary, since the con-
REVIEW
struction of the model involves the students’

design and technology skills. There is also, of
course, the mathematical component of the
activity.
Jürgen Azzopardi, Malta

Images courtesy of Elias Kalogirou
The projectile trajectory model
Fasten the strings to the ruler by

threading them through paper clips
Attach the ruler to the clamp stand so that

the angle between the two can be adjusted
Building the model

By Elias Kalogirou Construction to fasten it to the clamp stand.
2. Drill 20 holes (I used a diameter of
Introduction Materials 2.5 mm) at intervals of 5 cm in the
When you throw or hit a ball, shoot · A clamp stand ruler, the first one 5 cm from the
a bullet from a gun or drop a stone · A wooden ruler, at least 105 cm hole drilled in step 1.
from a bridge, the ‘flying’ objects all long 3. Attach the ruler to the clamp stand.
have one thing in common: in the · drill and drill bits
A The angle between the two needs
physical sense, they are projectiles. · Thin string, preferably coloured to be adjustable, so fasten the ruler
This term is used for any object that is · 20 wooden or plastic beads, 14 mm on a pivot – I used a clamping boss
given an initial velocity and subse- in diameter, with a hole through and two rings to do so (see image).
quently follows a distinct trajectory: a which the string can be threaded
4. For each of the 20 holes, calculate
path determined by a combination of · 20 paper clips
the corresponding length of string
gravity and air resistance. I have · A tape measure required (see Table 1). Allow about
devised a model to help visualise · A pair of scissors 5 cm extra – for attaching the string
these trajectories in the classroom and to the bead and the ruler – and cut
allows students to investigate hori- Procedure the strings.
zontal and vertical components of 1. At a small distance from one end 5. For each string, tie a bead to one
projectile motion. Note that air resist- of the ruler (I used 3 cm), drill a end, pass the other end through the
ance is not included in the model. hole through the ruler, with which
corresponding hole in the ruler,

Teaching activities
and attach it by threading the

string through a paperclip that will Time Distance along Distance fallen String length String length if
the ruler (cm) a = 0.3652 (cm)
act as a stopper (see image). Do not
use sticky tape instead of the paper t 5 ½ g t2 a 0.3652
clips, as this will gradually work 2t 2 x 5=10 ½ g (2t)2
4a 1.4608
itself loose.
3t 3 x 5=15 ½ g (3t)2 9a 3.2868
6. Adjust the strings to exactly the 2
4t 4 x 5=20 ½ g (4t) 16a 5.8432
calculated length.
… … … … …
The model is now complete. As a 2
guide, it took me about two hours to 20t 20 x 5=100 ½ g (20t) 400a 145
build.
Table 1: Vertical fall using the model
Calculating the lengths of string

stand representing the starting angle Using the model in class
To understand how we calculate the
of the projectile. By Ian Francis
lengths of the strings, we need to
understand what the model repre- The positions of the 20 beads, hang- The actual construction of the
sents. Imagine that at time zero, you ing 5 cm apart, give you the positions model is already a valid act of learn-
fired a bullet at steady speed (no hori- of the bullet at 20 equidistant consec- ing in itself. In addition, the finished
zontal acceleration) from the pivot utive time points – the first bead at product can be used for further work.
point (connecting the ruler and the time t, the second bead (5 cm further It can be used to study either horizon-
clamp stand), in the direction that the along the ruler) at 2t, and so on, up to tal or vertical trajectories, as well as
ruler is pointing in. the last bead, at 20t. those at any angle in between. Below
The model demonstrates two The model represents trajectories at are some suggestions – there will be
aspects of a trajectory. Firstly, the constant horizontal velocity (includ- plenty of others.
direction in which the ruler is pointing zero, if you place the ruler in a
vertical position, parallel to the stand) Experiment 1
ing gives the direction in which the
and constant vertical acceleration. In this experiment, students should
bullet would continue flying if there
were no gravity. Once you have chosen your value for learn that the horizontal and vertical
t, cut the strings and built the model, components of a trajectory are inde-
Secondly, the strings represent the
it will be a model for trajectories with pendent of each other, with the hori-
effect of gravity (g). If you let the bul-
this specific value of t, i.e. also for a zontal velocity remaining constant
let drop from the pivot point at time
specific velocity and acceleration during the ‘flight’.
zero (vertical fall without initial veloc-
ity), the length of string of the first (gravity) – at different angles, 1. Ask the students to position the
bead would give the distance the bul- depending on how you position the ruler so that it is held horizontally
let would have fallen after time t, the ruler, and disregarding air resistance. (at 90 degrees to the clamp stand).
string of the second bead would give How closely the model reflects reality The beads now indicate the posi-
the distance the bullet would have could be an interesting point for dis- tions of a projectile that has an ini-
fallen after 2t, and so on (see Table 1). cussion with your students. tial horizontal velocity but no ini-
The length of the shortest string, at tial vertical velocity (like a coin
Gravity has the same effect on a
time t, is calculated as: flicked horizontally off a table top).
projectile with an initial velocity
greater than zero, so when you shoot a = ½ g t2. 2. Ask the students to estimate how
the bullet rather than letting it drop, it To calculate its length (a), choose long it would take for a projectile
would still fall the same distance by the maximum length of string for to move from the starting position
time t. bead number 20, which is 100 cm (the pivot) to the first bead (or
from the pivot point, and corresponds indeed from any bead to the next).
For an initial velocity greater than
to 400a (see Table 1). Our longest Any time that is less than one sec-
zero, the length of the first string
string (400a) was 145 cm, so a = ond will be fine.
again gives the distance the bullet
would have fallen after time t, the 0.3652. Then you can calculate the Next, we will try to get this number
second string gives the distance the lengths of string you need to cut for closer to a true figure – which will of
bullet would have fallen after 2t, and the 20 different beads using the course vary depending on how quick-
so on. The beads, therefore, represent ‘String length’ column in Table 1 (and ly the projectile is launched.
the parabolic trajectory of a projectile, do not forget the 5 cm extra when cut- 3. Get the students to flick a coin
with the angle of the ruler to the ting, see step 4 on page 24). alongside the model, trying to get

Images courtesy of Marlene Rau and Nicola Graf
The set-up for Experiment 1. Students should The set-up for Experiment 2. Students should
measure the horizontal distance between consecu- measure the horizontal distance between con-
tive and non-consecutive bead pairs and time the secutive and non-consecutive bead / string pairs
travel of a coin flicked alongside the model – this will be smaller than in Experiment 1
the coin to travel a horizontal dis- Make sure that the students meas- Experiment 2
tance similar to the length of the ure the horizontal distance In this experiment, students learn
ruler, and time how long it takes between bead pairs, not the diago- that the horizontal velocity will still
before the coin lands. Dividing that nal distance. If the model has been be constant for a trajectory with initial
time by the number of beads the built accurately, they should find vertical velocity (i.e. at an angle away
coin has passed will give an that the horizontal velocity is con- from the horizontal), but it will be
approximate interval for the flight stant. smaller than that for a trajectory with
time between successive beads, Students may be familiar with the no initial vertical velocity (as in
ignoring air resistance. The longer average velocity formula, but less so Experiment 1).
the trajectory, the less significant with the idea of dividing up a motion 1. Position the ruler of the model at
any timing error should be. into small time intervals. Therefore, it an angle away from the horizontal.
4. With this figure for the time inter- could be worth having them calculate I would suggest using a fairly steep
val, ask the students to calculate the average horizontal velocity = total angle so that students come up
the horizontal velocity for a few horizontal displacement / total time. with a noticeably different horizon-
pairs of beads (both consecutive This should, of course, equal the tal displacement to that in the first
ones and pairs of beads that are velocities worked out from adjacent experiment.
further apart, e.g. between bead 3 bead positions.
2. Using the value for t that you have
and 4, then between beads 3 and 15 5. Ask the students which assump- calculated in Experiment 1 – or the
– make sure the students remember tion we are making when we value for t used to build the model
to use the appropriate time interval assume that the horizontal velocity – ask the students to repeat the cal-
if using non-consecutive beads in of a projectile is constant. The culation of the horizontal velocity,
the pair), using horizontal velocity answer should be that air resist- as in step 4 of Experiment 1.
= horizontal displacement / time ance can be ignored.
Again, if the model has been built
interval: vhoriz = hhoriz / t.

Teaching activities
accurately, the students should find ure all 20, get them to measure at close the model shows an accelera-
that the horizontal distance trav- least the shortest and the longest tion due to gravity of 9.8 m/s2?
elled in equal intervals of time is strings, and 3 strings in between – · Does the determination of vertical
constant, but it will of course be and note down the values. This is acceleration change with the angle
smaller than that for a trajectory the vertical distance fallen at each at which the ruler is held?
with no initial vertical velocity point.
(Experiment 1) – the strings of 4. Get the students to plot vertical
Resources
adjacent beads will be closer to one distance travelled against elapsed
another. time squared (i.e. t2 for point 1, (2t)2 Freier GD, Anderson FG (1981)
for point 2, etc.) for each of the Demonstration Handbook for Physics
Experiment 3 positions measured including (2nd edition). College Park, MD,
In this experiment, the students point zero. USA: American Association of
study the vertical distances travelled Instead of using the value for t built Physics Teachers. ISBN:
in equal intervals of time for a trajec- into the model, students could use the 9780917853326
tory with no initial vertical velocity value calculated in Experiment 1. If To view an animated demonstration
(such as in Experiment 1). The experi- this does not correspond to the value of the projectile motion, see:
ment is best suited to students who of the model, the graph will still be www.phy.hk/wiki/englishhtm/
were not involved in building the the expected straight line, showing ThrowABall.htm
model, although it can be useful rein- the same correlation, but only above Wikipedia has a good explanation
forcement for those students, too. the second point in the graph. of the trajectory of a projectile,
1. Return the ruler to a horizontal especially the section ‘Angle θ
setting.
Experiment 4 required to hit coordinate (x,y)’:
A change in the vertical velocity is This simple experiment serves to http://en.wikipedia.org/wiki/
an acceleration (a), and from the reinforce the fact that the vertical and Trajectory_of_a_projectile
equation F = m a we know that a horizontal components of a velocity
If you enjoyed reading this article,
are independent of each other.
resultant force is needed to produce why not take a look at the list of
such an acceleration – in this case the 1. Place the ruler at a 45 degree angle
physics articles published in
force of gravity acting on the object. to the stand.
Science in School so far? See:
As this force is constant, from equa- 2. Students should satisfy themselves www.scienceinschool.org/physics
tions of uniformly accelerated motion, that the vertical displacements are
we get of course unchanged, i.e. the dis-
tance from any particular bead to Elias Kalogirou has been a physics
vertical distance travelled the ruler will always be the same, teacher for 10 years and really enjoys
(s) = (u t) + (½ a t2) irrespective of the angle at which teaching his students things they can
where u = initial velocity. the ruler is held, as the lengths of apply in everyday life. He is responsi-
the strings have not altered. ble for operating the regional labora-
As the initial vertical velocity (u) is
zero, (u t) can be ignored, and as ½ a Further ideas tory centre of physical sciences in
is a constant, the relationship tells us Pyrgos, Ilia, Greece, at which second-
These are further questions you can
that vertical distance travelled is pro- ary-school science teachers can
ask the students to investigate:
improve their teaching by learning
portional to time squared. It may be
worth pointing out that acceleration
· What angle to the horizontal will
experimental methods for the physics,
give the greatest horizontal dis-
(a) and gravity (g) are interchangeable chemistry and biology classrooms.
placement on level ground? What
in this context, both representing the Ian Francis has taught secondary-
if the ground is not level?
school science and advanced-level
acceleration of freefall.
2. Ask students to calculate the
· How could the model be adapted
physics for around 20 years, mostly in
to account for planets where the
elapsed time for each bead position London, UK, and southeast England.
acceleration due to gravity is small-
(note that at the pivot, t = 0) – this He is also an examiner for national
er or greater than the 9.8 m/s2 on
examinations (GCSE and A levels)
will be 1t for bead 1, 2t for bead 2, Earth?
and has authored teaching materials
etc. (see Table 1), using the value
for t built into the model.
· Can the students determine instan- for various UK projects including ‘I’m
taneous vertical velocities by tak- a scientist, get me out of here!’ and
3. Let the students measure the ing pairs of readings from the SEPnet (South East Physics Network).
lengths of strings at different posi- rulers held at an angle? Can they
tions – if time is too short to meas- use these velocities to see how

Image courtesy of hometowncd / iStockphoto
Bioinformatics with pen

and paper: building a
phylogenetic tree
Bioinformatics is usually done with a

powerful computer. With help from
Cleopatra Kozlowski, however, you can
investigate our primate ancestry – armed
with nothing but a pen and paper.
A s a result of recent technological

advances, it is relatively quick
and easy to determine a DNA or pro- When we think of bioinformatics we probably imagine huge com-
tein sequence. These sequences by puters and sequencing machines, but the methods of this new sci-
themselves, of course, tell us very lit- ence can be presented by means of simple classroom activities to
tle: GAATCCA, for example. We need be carried out with pencil and paper, as Cleopatra Kozlowski does
to know what those sequences mean. in this article.
Which proteins are encoded by that
The author challenges us with the building of the family tree of
DNA sequence; does the sequence
humans and other primates on the basis of the genetic differences
indeed encode a protein at all? What
between short (fake) DNA sequences. The proposed activity can be
effect does a small change in the DNA
profitably (and enjoyably) exploited in secondary schools to address
sequence have on the structure of the
some tricky biology topics such as the use of molecular clocks in
encoded protein? What function does
the study of evolution.
that protein have in the cell? And, of
REVIEW
course, what can our DNA sequence The article is aimed at science teachers, who will find useful com-
tell us about our evolutionary histo- prehension exercises at the end of the text; students can also use the
ry? questions to deepen their understanding of the topic. The quoted
These and other important biologi- web references provide further information and resources.
cal questions can be tackled with Giulia Realdon, Italy
bioinformatics: essentially, by com-

Teaching activities
paring DNA or protein sequences – required for students to complete this example, whether an organism has a
for example, by comparing newly dis- activity, together with the step-by- backbone, or if it has wings. This may
covered sequences with sequences for step procedure and answers to the cause problems, however. For exam-
which we already have a lot of infor- comprehension questions, can be ple, birds, bats and insects all have
mation (perhaps they have a similar downloaded from the Science in School wings, but are they closely related?
function?) or comparing similar websitew2. How do you measure how recently
sequences in different species. the organisms diverged from a com-
Bioinformatics is, of course, normal- Constructing a phylogenetic tree mon ancestor?
ly done with the aid of a powerful The accumulation of mutations We know from DNA sequencing
computer. However, it is all too easy causes DNA sequences to change over studies that DNA mutations occur
to let a computer do all the work generations. The following activity randomly at a very slow rate and are
without understanding the underly- demonstrates how this can be used to passed from parents to offspring.
ing principles involved. For this rea- deduce evolutionary relationships Thus, if you assume that all organ-
son, these activities are designed to be between organisms. It takes about 90 isms have a common ancestor, , you
done on paper, to get the students to min and requires nothing but a pen can use the differences in homologous
understand how bioinformatic analy- and the tables, which can be down- sequences to measure how long it has
sis works. loaded from the Science in School web- been since the organisms diverged. In
This article includes one of a group sitew2. other words, the longer the time since
of four activities. The two introducto- two species diverged from a common
ry activities (‘Gene finding’ and Introduction ancestor, the more different their
‘Mutations’) and the concluding activ- Think about how you would classi- DNA sequences will be.
ity (‘Mobile DNA’) can be down- fy diverse animals. Traditionally, Homologous sequences are defined
loaded from the website of the physical differences between organ- as those sequences in two organisms
European Learning Laboratory for the isms were used to deduce evolution- that have a common origin. In reality
Life Sciences (ELLS)w1. All the tables ary relationships between them, for we don’t really have proof that any
Indo-European
c. 3500-3000 BC
Indian Armenian Iranian Germanic Balto-Slavic Albanian Celtic Hellenic Italic c. 1000 BC
Sanskrit Old Persian Avestan Baltic Old Slavic Irish Welsh Gaelic Breton Latin
Data source: http://www.linguatics.com/indoeuropean_languages.htm
Lithuanian, Russian, Polish,

Middle Indian Persian Lettish Czech, Bulgarian, Greek c. 500 AD
Serbo-Croatian, etc
Hindustani, Bengali N Germanic E Germanic W Germanic French Provençal Italian Spanish Portuguese Catalan Romanian
and other modern c. 800-1200 AD
Indian languages Gothic
E Norse W Norse High German Low German
Swedish, Norwegian, German Yiddish c. 1300 AD

Danish, Icelandic,
Gothlandic Faroese
Old Frisian Anglo-Saxon Old Saxon Low Franconian
(Old English)
Frisian Middle English Middle Low German Middle Dutch
Modern English Plattdeutsch Dutch, Flemish c.1700-1900 AD
Figure 1: The Indo-European language tree. Note that although Indian, Germanic, Romance and many other European languages
belong to this family, Finnish, Estonian and Hungarian do not: they belong to the Uralic language group

two sequences are homologous (we Note that different regions of the spring. This is discussed in the
were not there to watch the DNA DNA – coding and non-coding ‘Mobile DNA’ activity.
changing over time) but if they are regions – evolve at different speeds. To illustrate the concept of homolo-
sufficiently similar, we often assume In general, coding regions evolve gy, you can use the example of philol-
that they are ‘homologues’. To know more slowly, because a mutation that ogy – the study of the evolution of
how similar two sequences are, you causes a change in a protein is gener- languages. In fact, there are many
need to align them correctly (but this ally more costly to the organism – it is parallels between the methods used
is not part of this activity). less likely to survive and leave off- to study evolution of language and
organisms.
Using the differences between frag-
ments of DNA sequences is a bit like
comparing a word that means the
same thing in different languages, to
see how closely they are related.
Table 1: List of ‘cat’ in Indo-European

languages
Armenian gatz
Basque catua
Dutch kat
English cat
Estonian kass
Finnish kissa
Icelandic kottur
Italian gatto
Norwegian katt
Polish kot
Portuguese gato
Russian kot
Spanish gato
Swedish katt
You can see that the words for ‘cat’

Public domain image; image source: Wikimedia Commons
in Italian, Spanish and Portuguese are

almost the same: gatto, gato and gato.
In both Swedish and Norwegian, the
word is ‘katt’ but you see that in
Finnish it is different: ‘kissa’.
Although, like Sweden and Norway,
Finland is a Nordic country, the
Finnish word for ‘cat’ is more similar
to the Estonian word, ‘kass’. In fact,
the two languages are closely related.
So you can learn a little bit about lan-
guage relationships by studying how
Haeckel’s tree of life from The Evolution of Man (1879)
the words have changed over time.

Teaching activities
Constructing a phylogenetic tree Table 2: Five DNA sequences from primates

of primates Primate Sequence
In this activity, we will construct a
Neanderthal (n) TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
phylogenetic tree using five homolo-
gous DNA sequences from primates. Human (h) TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
Because the sequences have been Chimpanzee (c) TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
made up, we cannot deduce any real
Gorilla (g) TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC
estimates of genetic distance; to create
a meaningful phylogenetic tree from Orangutan (o) ACAACCTGCACTCCTATTCTGCCGAGCCGGGCGCGTGGCAAAGTCC
real data would require far longer
sequences. Nonetheless, the fictional Table 3a: A comparison of Neanderthal and human sequences
sequences (in Table 2) have been cho- Neanderthal TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
sen to give a reasonably accurate pic-
Human TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGG ATGTCC
ture of primate relationships.
Note: all the tables required for stu-
Table 3b: A comparison of chimpanzee and gorilla sequences
dents to complete this activity can be
downloaded from the Science in School Chimpanzee TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
websitew2. Gorilla TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC
1. Count the number of differences
between each pair of sequences,
and record it in Table 4. This is
Table 4: Sequence differences between primates
easy to do if you compare each
sequence side by side. For exam- Neanderthal Human Chimpanzee Gorilla Orangutan
ple, Neanderthals and humans dif-
Neanderthal 0 3
fer at three nucleotides in the
Human 3 0
sequence (Table 3a) whereas chim-
Chimpanzee 0 11
panzees and gorillas differ at 11
Gorilla 11 0
points (Table 3b).
Orangutan 0
Comparison tables for all the pairs
of species, and the completed table of
sequence differences (Table 4), can be
Table 5: Evolutionary distances between primate ancestors and primates
downloaded from the Science in School
websitew2. Differences Proportional difference
The number of nucleotide differ- Neanderthal and human 3 3/46 = 0.065
ences between two sequences divided
by the total number of nucleotides in Neanderthal / human and chimpanzee
each sequence (in this case, 46) gives Neanderthal / human / chimpanzee and gorilla
the proportional distance between the
two sequences. Neanderthal / human / chimpanzee / gorilla
and orangutan
2. Consider the two species with the
most similar sequences:
Neanderthal and human. In Table
5, record the number of nucleotide Table 6a: Sequence differences between the Neanderthal/human ancestor and other
differences (3) and the proportional primates
difference (3/46 = 0.065). Neanderthal Chimpanzee Gorilla Orangutan
/ human
The ‘average sequence’ of two
species is assumed to be their ances- Neanderthal 0 (4+5)/2 = 4.5 (11+12)/2=11.5
tor. In this exercise, we do not directly / human
calculate the average sequence of, for Chimpanzee (4+5)/2 = 4.5 0
example, Neanderthals and humans,
Gorilla (11+12)/2=11.5 0
but the evolutionary distance between
the Neanderthal/human ancestor, Orangutan 0
and all other primates in the group.


3. Calculate the distance between the
Images courtesy of room 101, Tempelmeister / pixelio.de

average sequence of the
Neanderthals and humans, and the Human
other primate species and enter the
data in Table 6a. 0.065
There are four differences between Neanderthal

Neanderthal, and chimpanzee and 0.098
five differences between human and
chimpanzee. Thus the average dis- Chimpanzee
tance between Neanderthal/human
and chimpanzee is 4.5.
There are 11 differences between
Neanderthal and gorilla, and 12 dif-
ferences between human and gorilla.
Thus the average distance between
Neanderthal/human and gorilla
is 11.5.
12.5 10 7.5 5 2.5 0
4. As before, these distances can be
Time (million years)
turned into proportional differ-
ences by dividing by the number
Figure 2: Incomplete phylogenetic tree
of nucleotides in each sequence
(46). Calculate the proportional
distance between the Neanderthal / 1. In your phylogenetic tree, how
distances between the average
human ancestor and the chim- many years ago did gorillas and
sequence of the Neanderthals /
panzee was 0.98. Thus the time humans diverge from a common
humans, and the other primate
since chimpanzees, humans and ancestor? What about orangutans
species. Enter the figures in Table 5.
Neanderthals diverged from a and humans?
For chimpanzees, the proportional
common ancestor is: 2. Can you find out if these and the
distance from the Neanderthal /
(0.065 + 0.098) * 20 million other estimates in your tree are cor-
human ancestor is 4.5/46 = 0.98.
= 0.163 * 20 million rect?
Using Table 5, you can begin to
= 3.3 million years ago. 3. Why may phylogenetic trees con-
construct the evolutionary tree.
7. Continue the calculations. Repeat structed using different regions of
5. Connect Neanderthals and humans
steps 3 to 6 to calculate how long the DNA look different?
with a line. The branch length
ago the Neanderthal /human / 4. What regions of DNA should you
should correspond to how long it
chimpanzee ancestor diverged use to compare organisms that are
took for humans and Neanderthals
from the gorilla and from the closely related?
to diverge from their common
orangutan. Then calculate how
ancestor. 5. What kind of genes should you use
long ago the Neanderthal /human
Let us assume that it would take to compare organisms that are evo-
/ chimpanzee/gorilla ancestor
20 million years for every single lutionarily distant from each other?
diverged from the orangutan. Enter
nucleotide in this particular DNA 6. What should you do if you are
the results in Table 5.
sequence to change. Thus for the comparing two sequences, but one
If you need help, you can download
DNA sequence to change by 0.065, of them has gaps due to deletions
the step-by-step procedure from the
it would take 0.065*20 million = (or insertions in the other
Science in School website.
1.3 million years. The branch sequence)?
8. Use the completed Table 5 to finish
should, therefore, measure 1.3 mil- 7. Can you think of reasons why this
the phylogenetic tree, as shown on
lion years on the time scale (see method of simply comparing the
page 33.
Figure 2). number of differences between the
6. To calculate how long ago the Questions nucleotides may not work if you
ancestor of chimpanzees diverged Below are some questions you are comparing organisms that are
from the ancestor of humans (the could use to test your students’ very different? Remember that we
branch length), add up the propor- understanding of the activity. are assuming it takes 20 million
tional differences in Table 5. Answers can be downloaded from the years for every nucleotide in a
Remember that the proportional Science in School websitew2. sequence to mutate.

Teaching activities
Images courtesy of room 101, Tempelmeister, Stephan Franz Xaver Dietl, Stephan Hahnel / pixelio.de
w2 – Download all the tables required
for students to complete this activity,
Human together with the step-by-step proce-
0.065
dure and answers to the comprehen-
sion questions, from the Science in
Neanderthal School website:
0.098 www.scienceinschool.org/2010/
issue17/bioinformatics#resources
0.245 Chimpanzee
Resources
The website of the US National Center
0.317 Gorilla for Biotechnology Information
(NCBI) offers an introduction to
phylogenetics. See:
www.ncbi.nlm.nih.gov/About/
Orangutan
primer/phylo.html
To learn more about using protein
12.5 10 7.5 5 2.5 0
sequences to establish phylogenetic
Time (million years) trees, see: http://users.rcn.com/
jkimball.ma.ultranet/BiologyPages
Figure 3: Complete phylogenetic tree or use the direct link:
http://tinyurl.com/2wqp7nq
8. Can you think of other reasons Laboratory’s E-STAR Fellows to To learn about how a group of scien-
why it may not be so good to use develop teaching resources for tists recreated the new tree of life,
this method to calculate evolution- schools. Cleopatra Kozlowski was tracing the course of evolution, see:
ary distances? What simplifications supported by an E-STAR fellowship Hodge R (2006) A new tree of life.
have we made? funded by the European Science in School 2: 17-19.
9. Can you think of reasons why if Commission’s Framework www.scienceinschool.org/2006/
you are studying more distant Programme 6 Marie Curie Host issue2/tree
organisms, it is better to compare Fellowship for Early Stage Research The Interactive Tree Of Life is an
amino acid sequences than DNA Training, under contract number online tool for the display and
sequences? MEST-CT-2004-504640. manipulation of phylogenetic trees.
10. In this exercise, we have concen- To learn more, see:
Web references
Image courtesy of Stephan Franz Xaver Dietl / pixelio.de

trated on working out when the http://itol.embl.de
five primate species diverged from w1 – The European Learning To browse other evolution-related arti-
each other (the scale of the tree). Laboratory for the Life Sciences cles in Science in School, see:
Often, however, we do not even (ELLS) is an education facility www.scienceinschool.org/evolution
know the order in which the species which brings secondary-school
diverged from one another (the teachers into the research lab for a
shape of the tree). How do we unique hands-on encounter with
know, for example, that humans state-of-the-art molecular biology
and chimpanzees are more closely techniques. ELLS also gives scien-
related than gorillas and chim- tists a chance to work with teachers,
panzees are? If the latter were true, helping to bridge the widening gap
how would the sequence differ- between research and schools. The
ences (Table 4) differ? activity described in this article was
designed as a teaching resource for
Acknowledgement ELLS’ professional development
This activity was developed in a
programme for European teachers.
special collaboration between the
For more information about ELLS,
European Learning Laboratory for the
see: www.embl.org/ells
Life Sciences (ELLS)w1 and the
European Molecular Biology

School experiments
at the nanoscale
Image courtesy of maggio07 / iStockphoto

Eleanor Hayes highlights some
education resources about the
nanoscale and nanotechnology.
W
Image courtesy of the Deutsches Museum
ith the help of many educa-
tion projects, introducing the
· Our nails grow 1 nm each second.
nanoscale at school has never been · The virus most usually responsible
for the common cold has a diame-
easier – whatever the age of your stu-
ter of 30 nm.
dents. Below are two experiments (for
children aged 8+ and for 14- to 16- · A cell membrane is around 9 nm
year-olds); many more resources are across.
listed at the end of the article. · The DNA double helix is 2 nm
across.
Dilution and the sense of smell · The diameter of one hydrogen atom
In the following experiment, suit- is around 0.2 nm.
able for ages 8 and above, food Encourage students to consider the
colouring is serially diluted, causing things that they cannot see directly,
the colour and smell to fade gradual- for example the ozone layer, dyes in
ly. The colour will fade more quickly stained glass windows or the colloidal
than the smell, illustrating that even the benefits and risks of nanoscale nature of milk.
though our eyes cannot detect the research, engineering and technology. Explain that the olfactory bulb of
chemical responsible for the colour, it The website and materials are avail- the brain is responsible for interpret-
is still present, as verified by the able in nine languages (Dutch, ing the smells that the nose detects.
smell. English, Finnish, French, German, The olfactory bulb is strongly linked
In the same way as we use our eyes Italian, Polish, Portuguese and to a part of the brain that is responsi-
to see large things and our nose to Turkish). The project members – sci- ble for remembering things, which is
smell small things, nanoscientists use ence centres across Europe – also offer why certain smells can make us
special tools to analyse (and manipu- ‘nanodays’, with demonstrations, remember specific things clearly.
late) things at the very small scale: the experiments, games, meetings and The students can calculate that in
nanoscale. Atomic force microscopes discussions about nanotechnology. each tube, the food colouring is ten
can feel and move individual atoms, For more information, see the Time times more dilute than the previous
while special surfaces with nanotex- for Nano websitew1. tube. By the time they reach Tube 9,
tures on them can repel water the original food colouring has been
extremely efficiently. Introduction diluted to the level of one part of
The experiment is taken from the When introducing the activity, the food colouring to a billion parts of
‘Time for nano’ project, which offers following examples may help to illus- water.
informal education materials about trate how small the nanoscale is.

1 ml 1 ml 1 ml 1 ml 1 ml 1 ml 1 ml 1 ml 1 ml
1 2 3 4 5 6 7 8 9
Food colouring Test tubes filled with 9 ml of water
Materials 5. Continue the process by repeating

steps 3 and 4: dilute Tube 2 into
· Some scented (this is important) Tube 3, Tube 3 into Tube 4, and so
food colouring
on.
· A Pasteur pipette At what point can you no longer
· Nine test tubes, numbered 1-9. see any colour in the tubes?
Procedure At what point can you no longer
1. Carefully fill each test tube with smell anything in the tubes?
9 ml of water. How can you explain the differ-
2. Using the Pasteur pipette, carefully ence?
add 1 ml of food colouring to Tube The method you have just used is
1. Mix the tube thoroughly. called a serial dilution. If you wanted,
3. Smell the contents. What does it in just one step, to dilute 1 ml of the
smell of? Does it smell the same as food dye to the same concentration as
the original food colouring? in Tube 9, how much water would
4. Now take 1 ml of liquid from Tube you need?
1, add it to Tube 2 and mix thor-
oughly.
Safety notes
· Do not eat the food colouring.
· Some people might be intolerant of
the food dye. If it comes into con-
tact with skin, wash it off with lots
of water.
· Avoid getting the food colouring on
clothes, as it will stain.

Building a liquid crystal German, Italian, Portuguese and Preparation

thermometer Slovak) from the project websitew2. For this experiment, you will need
Liquid crystals have properties The Nanoyou website is available in four different mixtures prepared from
between those of a conventional liq- 12 languages and offers a range of three liquid crystals:
uid and those of a solid crystal; for free materials, including posters, pre- · Cholesteryl oleyl carbonate (CAS
example, a liquid crystal may flow sentations, card games, role plays and number 17110-51-9, Sigma-Aldrich
like a liquid, but its molecules may be a teachers’ training kit. This kit covers 151157; 25 g costs about €60)
oriented in a particular direction, as the fundamental concepts in · Cholesteryl pelargonate (CAS num-
in a crystal. Liquid crystals are sensi- nanoscience and nanotechnologies; ber 1182-66-7, Sigma-Aldrich
tive to external factors, such as tem- applications of nanotechnologies; four C78801; 100 g costs about €115)
perature, and change their molecular laboratory experiments and a virtual · Cholesteryl benzoate (CAS number
arrangement when these factors vary. experiment. Separate kits are avail- 604-32-0, Sigma-Aldrich C75802;
In response to a change in tempera- able for the 11-13 and 14-18 age 25g costs about €40)
ture, some types of liquid crystal groups. The instructions for preparing each
(thermotropic ones) change colour as Schools that participate in the proj- of these liquid crystal mixtures
a result of a change in assembly. ect work directly with leading (‘Student synthesis procedure’) and
In this experiment, students investi- European nanoscience research cen- supporting material for teachers are
gate colour changes in a thermotropic tres, receiving nanotech-related mate- available to download from the
liquid crystal and then build their rials and taking part in workshops. Nanoyou websitew2.
own liquid crystal thermometer. The Particular focus is given to ethical,
protocol, which is suitable for stu- safety and social implications, as well
dents aged 14-18, was developed as as present and future limits to scien-
part of the ‘Nanoyou’ project. tific development. To learn how to get
Extensive supporting materials are involved, visit the Nanoyou websitew2.
available (in Danish, English,
Images courtesy of setixela / iStockphoto

Materials 4. Place the second piece of sticky-back plastic on top of

the first piece, sticky side down. As you do this, gently
· 4 pre-prepared liquid crystal mixtures press the middle to distribute the liquid crystal evenly,
· 4 10-ml vials creating a thin layer of liquid crystal about 4 x 4 cm. Do
· A sheet of sticky-back plastic (used e.g. for covering not press too hard, otherwise the mixture will leak out;
books)
if it does, clean it up immediately with paper tissue.
· A spatula 5. Cut off any excess plastic and label the corner of the
· Scissors sheet with the number of the liquid crystal mixture (1).
· A permanent marker pen 6. Repeat the same procedure for liquid crystal mixtures
· A room thermometer 2-4.
· An A4 sheet of white paper Image courtesy of the ‘Nanoyou’ project
· An A4 sheet of black paper

· A water bath (or a hotplate, a Pyrex glass water con-
tainer half filled with water, and thermometer)
· A clothes peg
· An A4 sheet of foam
· An A4 sheet of black card
· Gloves
· Safety glasses
· Paper tissue
· Sticky tape (optional)
· A hairdryer (optional)
Safety notes The finished liquid crystal sheet
Solids should not be inhaled. Wear gloves and safety
glasses; contact with skin, eyes or clothing should be Use the room thermometer to determine the tempera-
avoided. Wash your hands thoroughly after handling the ture in the room you are in.
liquid crystals. Could any of your liquid crystal mixtures be used to
determine the room temperature? If so, which one?
Procedure
Preparing the liquid crystal sheets Investigating the temperature changes
1. Using Table 1, prepare four different liquid crystal mix- 1. Place your four liquid crystal sheets on a sheet of white
tures, each of which is sensitive to different ranges of paper. Wait few seconds. What do you see?
temperatures. 2. Wearing gloves, press your finger against each of the
Table 1: Preparing the liquid crystal mixtures liquid crystal sheets. (To make a fair comparison, you
need to keep your finger on each liquid crystal sheet
Liquid Sensitivity Cholesteryl Cholesteryl Cholesteryl for the same length of time.) What do you see now?
crystal temperature oleyl pelargonate benzoate 3. Repeat the procedure on a sheet of black paper.
mixture (°C) carbonate
4. Record your observations in Table 2. (Tables 2-6 can be
Mixture 1 17–23 0.65 0.25 0.10 downloaded from the Science in School websitew3.)
Mixture 2 26.5–30.5 0.45 0.45 0.10
Images courtesy of the ‘Nanoyou’ project
Mixture 3 32–35 0.40 0.50 0.10
Mixture 4 37–40 0.30 0.60 0.10
2. Cut two pieces of sticky-back plastic (about 10 x 10

cm), peel off the backing paper and lay the plastic
(sticky side up) on the bench.
3. Place 2-3 spatulas of the liquid crystal mixture 1 in the
centre of one of the sheets. If the liquid crystal has
solidified, warm the vial first with a hairdryer until the The liquid crystal sheet before and after it has been touched
mixture has the consistency of honey.

Table 2: Testing the four liquid crystal sheets Table 3: Temperature-dependent colour changes of mixture 1
Liquid crystal sheet number 1

White paper Black paper
Temperature (°C) Colour Comments
Sheet 1 (mixture 1)
Sheet 2 (mixture 2) 16
Sheet 3 (mixture 3) 17
18
Sheet 4 (mixture 4)
19
20
Why do you get different results when you test the liquid
crystal sheets against white paper and black paper? 21
Did all four liquid crystal sheets display some colour? If 22
not, why not? What could you do to make these sheets
23
display colour?
5. Rub your hands together and test each of the sheets
again. Do you see any difference?
At what temperature do you start to see some colour in
sheet 1? Does this correspond to the temperature predict-
Testing the liquid crystal sheets ed in Table 1?
1. Fill the water bath with cold water and raise the tem- Does the order of colours that you have recorded in the
perature to 15 °C. table above follow a particular pattern? If so, what pattern
2. Keep a thermometer in the water to check the tempera- and why do you think this might be?
ture. 6. Take the liquid crystal sheet out of the water bath.
3. Place a sheet of black paper behind the water bath, to Does it lose its colour immediately? If not, why not?
make any colours visible. Note: the paper should not Imagine putting sheet 1 in a water bath of unknown
touch the hotplate. temperature. If the sheet turned orange what temperature
4. Holding it with a clothes peg, immerse liquid crystal would the water be?
sheet 1 in the water bath (see image below). Can you 7. Place liquid crystal sheet 2 in the water bath (now at
see any colour? 23 °C) and raise the temperature to 30 °C. Record your
5. Raise the water temperature to 23 °C. In Table 3, record observations in Table 4.
the colours that you see as the temperature increases.
Table 4: Temperature-dependent colour changes of mixture 2
22-23
23-24
25
Image courtesy of the ‘Nanoyou’ project
26
27
28
29
30
Immersing the liquid crystal sheet in the water bath 8. When the water temperature reaches 30 °C, test sheet 1
again. Can sheet 1 detect temperatures around 30 °C?
Why/why not?

9. Place liquid crystal sheet 3 in the water bath (now at 2. Cut the four letters out of the foam, leaving a single
30 °C) and raise the temperature to 35 °C. Record your sheet of foam with holes spelling the word ‘nano’.
observations in Table 5. 3. Turn the sheet of foam over and cover each letter with
one liquid crystal sheet, as follows:
N – sheet 1
Liquid crystal sheet number 3 A – sheet 2
N – sheet 3
Temperature (°C) Colour Comments O – sheet 4
4. Using sticky-back plastic or sticky tape, fasten the liq-
30
uid crystal sheets to the foam, making sure that each
31 letter only exposes one sheet.
5. Cover the liquid crystal sheets with the sheet of black
32
card, fastening it to the white foam. Your room ther-
33 mometer is now complete.
34 Does your room thermometer show any colour? If not,
why not?
35
If your thermometer does not show any colour, try plac-
ing it over a working laptop computer. It will demon-
10. Place liquid crystal sheet 4 in the water bath (now at strate what we all know – that they heat up.
35 °C) and raise the temperature to 40 °C. Record your
observations in Table 6.
Image courtesy of the ‘Nanoyou’ project
35
36
37
38
39
The finished thermometer
40
Your thermometer will last 3-6 months, after which it

Was the colour sequence that you observed for sheets can be disposed of as normal waste.
2-4 the same as for sheet 1? Why/Why not?
When you take sheets 2, 3 and 4 out of the water bath, How is this nano?
do they behave like sheet 1? If not, what is the difference? The properties of materials at the macroscale are affect-
Why? ed by the structure of the material at the nanoscale.
Which of the four liquid crystal mixtures would you Changes in a material’s molecular structures are often too
use to see whether you have a raised temperature? Why? small to see directly with our eyes, but sometimes we can
see changes in the material’s properties. Liquid crystals
are an excellent example, in particular the type used in
Constructing the liquid crystal room thermometer
this experiment, since their optical properties (colour)
1. On the sheet of white foam, use the permanent marker change visibly as the temperature of the liquid crystal is
pen to write the word ‘NANO’. You will need to cover changed. In nanotechnology, scientists take advantage of
each letter with one of the four liquid crystal sheets, so the peculiar properties of materials at the nanoscale to
make sure the single letters are large enough but not engineer new materials and devices.
too large (see image right).

Acknowledgements Science Education network The Understanding Nanotechnology

Time for Nano is funded by the (http://www.nisenet.org) website offers an introduction to
European Commission under the 7th or use the direct link: nanotechnology; explanations of
Framework Programme. http://tinyurl.com/35el37p nanotechnology applications,
The liquid crystal experiment pub- including medicine, fuel cells and
food; and a discussion of
lished on the Nanoyou website was Resources
adapted from the ‘Preparation of cho- nanomaterials. See:
For some nanotechnology experi- www.understandingnano.com
lesteryl ester liquid crystals’ – one of ments published in a previous issue
the many experiments listed on the For German speakers, Science on
of Science in School, see:
website of the University of Stage Germany has produced a
Mallmann M (2008) 120 page textbook describing the
Wisconsin-Madison, USAw4 – and
Nanotechnology in school. complexity and diversity of the
from the ‘Exploring materials: liquid
Science in School 10: 70-75. nano-world, covering research,
crystals’ activity developed by the
www.scienceinschool.org/2008/ applications, history, education and
Nanoscale Informal Science Education
issue10/nanotechnology job offers. Teaching tips, teaching
networkw5.
The ‘Nanoyou’ (Nano for Youth) The Nano and Me website includes materials and worksheets are also
project is funded by the European a discussion of what we mean available. The book costs €2.50.
Commission under the 7th Framework by ‘nano’ in food. See: For more information, see:
Programme (FP7/2007-2013) under www.nanoandme.org/ www.scienceonstage.de or
grant agreement 233433. nano-products/food-and-drink use the direct link:
To learn more about our sense of http://tinyurl.com/3yqgasa
Web references smell, see the Nanooze website: If you found this article useful, you
www.nanooze.org/english/articles may like to browse the other
w1 – To learn more about the Time
/5senses_noseknows.html project-related articles on the
for Nano project, enter the video
For a video of serial dilution, see Science in School website:
competition, download experimen-
the website ‘Dr Shawn’s Science www.scienceinschool.org/projects
tal protocols or find out about
forthcoming events, see: Fair Success Series’:
www.timefornano.eu http://web.mac.com/drshawn1
w2 – Supporting materials for the The Nano mission website offers
downloadable educational games Dr Eleanor Hayes is the editor-in-
liquid crystal experiment, including
that introduce basic concepts in chief of Science in School. She studied
details of how to synthesise the
nanoscience through real-world zoology at the University of Oxford,
liquid crystals, are available from
practical applications, from UK, and completed a PhD in insect
the Nanoyou project website
microelectronics to drug delivery. ecology. Eleanor then spent some time
(www.nanoyou.eu) or via the direct
See: www.nanomission.org working in university administration
link: http://tinyurl.com/2ulmsta
before moving to Germany and into
w3 – All the tables needed for The Wellcome Trust’s free Big Picture
science publishing, initially for a
recording the results of the experi- series for teachers and students
ment can be downloaded from the (aged 16 and above) explores issues
Science in School website: around biology and medicine. It can
www.scienceinschool.org/2010/ be downloaded or ordered online.
Laboratory to launch Science in School.
issue17/nano#resources In June 2005, the Big Picture focused
w4 – For the instructions for prepar- on nanotechnology. See:
ing cholesteryl ester liquid crystals, http://www.wellcome.ac.uk
see the website of the University or use the direct link:
of Wisconsin-Madison’s Materials http://tinyurl.com/344mpws
Research Science and Engineering The Discover Nano website from the
Center (http://mrsec.wisc.edu) Northwestern University, Chicago,
or use the direct link: USA, offers an interactive timeline
http://tinyurl.com/34kq8qn tracing the history of nanotechnolo-
w5 – For the ‘Exploring materials: gy from medieval glass to the pres-
liquid crystals’ activity, see the ent. See: http://www.discovernano.
website of the Nanoscale Informal northwestern.edu

Stage lights: physics and drama
Images courtesy of Xacto / iStockphoto

Imagine sending music across the room by laser.
Sounds impossible, doesn’t it? But Alessio Bernardelli’s
students did just that – and then developed a play to
explain the science behind it. Here’s how to do it.
The
circuit
diagram
T o encourage our Year 12 students

(ages 16-17) not to consider
everyday technology as a ‘black box’
Switch
but to ask themselves how it works, Input AC

signal from
my colleagues and I asked them to
audio device 10 Ω Laser
research, design and build a modulat-
ed laser, based on a cheap commercial resistor
laser pen. When they found a plausi- Laser
battery
ble design, they were astonished at
100 μF
how simple it was. Even some of the capacitor
teachers had doubted that it would
work.
In fact, it exceeded all our expecta-
Image courtesy of Alessio Bernardelli
tions. Not only did the modulated
laser send an audio signal across the
room, the music received by the light least scientifically minded can see The laser beam, of varying intensity,
sensor and played on the speaker was how the circuit is connected. is sent to a light sensor attached to a
loud and clear. Our students were mini-amplifier. Because the number of
amazed that they had made some- Building the modulated laser photons reaching the light sensor
thing that they hadn’t even known The input signal from the audio changes with the frequency of the
was possible. In fact, it is quite a sim- device is sent across a resistor. audio input signal, the current gener-
ple process and can be used to Because this signal is AC (alternating ated by the light sensor also changes
explain a wide range of physics topics current), it causes variation in the with that frequency. This AC signal is
– as our students did in the next stage voltage across the resistor, which in sent to the mini-amplifier, causing the
of their project. turn causes the overall current in the cone of the speaker to move – and we
What I like about our device is that circuit to change with the same fre- can hear the music.
it is very cheap and very visual. You quency as the input signal. This caus- The capacitor in the modulating cir-
could buy a similar device for about es the intensity of light in the laser cuit is essential to let the AC signal
£250, but ours cost about £15 to make. diode to change with the same fre through and prevent the batteries’ DC
Also, you can see exactly how our quency. (direct current) from feeding back into
device is constructed, so that even the the audio device.

Physics (ages 16-19), hence students can use this opportunity

Ages 13-19 to apply them to a practical situation.
It is important to show students that physics is not only
This project is innovative in two main ways. It merges a set of theories listed under compartmentalised top-
different concepts of physics to produce an alternative ics, but is also a means of explaining incredible phe-
use of lasers and then uses a novel pedagogy to facili- nomena, and can be enjoyable. This article shows how
tate the students’ learning of these topics. The students script-writing and role-playing can help students to
were given the opportunity to be independent and do better understand the topics and to explain them to
their own research, producing an amazing result – younger students while showing them that physics can
they managed to link different aspects of physics (elec- be a source of enjoyment and satisfaction.
trical circuits, sound waves, light as a means of com-
For advanced or intermediate physics students (ages
munication and the photoelectric effect) and devise a
16-19), the project could be used to explain complex
system that actually works! The interesting part is that
electrical circuits and introduce photoelectricity. For
they didn’t stop at that, but they shared their project in
younger students (ages 13-15), the simplified concepts
a very original way: drama. Their script is ingeniously
in the play can be used to consolidate the topics
adapted to include complex topics in an action story,
already learned and give them an insight into what can
to explain those concepts in a simpler, entertaining
be learnt at a more advanced level, stimulating their
way.
interest and perhaps encouraging them to continue
This article is an ideal guideline for hands-on experi- their studies in physics.
ence, where students are asked to try building the
It is interesting to see that when physics is made fun
same circuit or variants of it. It would be a great expe-
and engaging for students, no matter what age, they
rience for students to ultimately see it functioning. The
are better able to understand even the most difficult
apparatus can be easily built, due to the circuit dia-
REVIEW
concepts. As the authors state, students who were pre-

gram and detailed instructions. The equipment
viously struggling with physics improved after taking
required is usually easily found in physics labs or
part in this activity. This is impressive and these sorts of
bought in stores at very reasonable prices. The con-
projects should be promoted and encouraged.
cepts involved are all discussed at A-level standard
Catherine Cutajar, Malta
Materials · Battery holder for 3 AAA batteries · Phototransistor or light sensor

· Laser pen (at least 5 mW) · Small light switch (press on / press · An audio device such as an mp3 or
· Mini-amplifier off type) CD player (any audio device that
The Radio Shack ones seem to be · Solder and wire uses a 3.5 mm jack lead)
the best and cheapestw1 · 2 crocodile clips · 2 stands and clamps
· 3.5 mm mono jack lead (one jack · 100 μF capacitor
plug at each end) · 10 Ω resistor
· 3 AAA batteries
The
materials
required

Images courtesy of Alessio Bernardelli

Step 3 Step 6
Step 5
Step 9
Assembly
The modulating circuit
1. Open the laser pen and remove the
batteries.
2. Attach one crocodile clip to the bat-
tery spring inside the laser pen.
3. Attach the other crocodile clip to
the case of the laser pen; do not let
the clips touch each other. Step 10
4. If the laser beam does not work
when the circuit is complete, swap
the crocodile clips on the spring
and the case (the laser diode only
works if the current is flowing in
the right direction).
5. Solder a wire to connect one of the 8. You will see that the lead is made from the jack lead to the opposite
crocodile clips to one end of the of thin copper wires wrapped end of the resistor.
battery holder. around another wire covered in 12. Using the jack plug, you can now
6. Solder a wire to connect the other rubber. Gather all the thin copper connect your laser pen to the audio
end of the battery holder to the wires, separating them from the device.
resistor. rubber-covered central wire (you
The receiver
This completes the DC part of your might need to strip the rubber off
1. Strip the coating from the wires in
circuit, but to modulate the laser to expose the central wire).
the other jack lead, as in steps 7
beam you must alter the voltage 9. Solder one of the two wires (either
and 8.
across the resistor, so that an AC will the bunch of thin copper wires or
2. Solder one of the two wires (it does
be generated and superimposed on the central wire; it does not matter
not matter which) to one end of the
the DC from the laser diode battery. which) to one end of the capacitor.
light sensor, and the other wire to
7. Cut the double jack lead in half. At 10. Solder wires to connect the other the other end.
one of the cut ends, strip the coat- end of the capacitor to the resistor. 3. Use the jack lead, plug the light
ing off the wire. (Save the other 11. To complete your modulated laser sensor into the mini-amplifier and
half of the lead for the receiver, see pen, solder the remaining wire the receiver is finished.
page 44).
Our Year-12 students wrote an

amusing script, full of sound physics
and with plenty of audience partici-
pation. It was aimed at Year-9 stu-
dents (ages 13-14), to make them
appreciate physics more – and
encourage them to consider studying

physics at school or even university.
During the course of the play, the
older students explained concepts
The from the GCSE curriculum (ages
completed 14-16), including signal modulation,
receiver the visible spectrum as a means of
communication, optical fibres and the
reflection of light, as well as some
more advanced topics such as the
photoelectric effect. The script, which
can be downloadedw2, is self-explana-
tory and shows clearly how the con-
cepts were presented.
The students not only performed

the play in our own school but also
visited other schools in Wales. The
audience was impressed by the quali-
ty of the play, the students’ knowl-
edge and their ability to transmit it
effectively to younger people. The
younger students in the audience
thought it was a fun way to learn
physics and liked the fact that older
pupils rather than teachers were
The showing them these concepts.
device in action.
The Year-12 students’ attitudes also
The laser is coming towards
changed. One girl commented that it
the camera and hits the light
sensor held to the wooden was only after she scripted and pre-
block by sticky tape. The sented the photoelectric effect to
haziness is caused by a younger students that she started to
Operation smoke machine to make really understand the phenomenon.
the beam visible This is a common experience for
Point the laser beam at the light
sensor, aligning them carefully using teachers: it is only when we have to
clamps and stands at both ends. teach the topics that we start to
Switch on the audio device. The understand them thoroughly our-
music will be played by the mini- Communicating the physics selves. Partly as a result of this proj-
amplifier – to which it is transferred So we’d built a great gadget, but ect, all of the Year-12 students
via the laser. To make the demonstra- what were we going to do with it? involved chose to study physics or
tion even more dramatic, connect the My colleagues and I thought the stu- engineering at university.
output of the mini-amplifier to a more dents could design an interactive lec-
powerful speaker. ture show – but they came up with a The legacy of the project
Safety note: Even relatively small much more creative idea. They decid- The project started in June 2008 but
amounts of laser light can lead to per- ed to write a play based on James its effects are still being felt. When we
manent eye injuries, so make sure you Bond, using situations in the play to visited other schools, our play was
follow the safety instructions with explain the physics concepts behind not only for the Year-9 students, but
your laser pen. our device. also for their teachers. It demonstrat-

Matt
Im
Smith a ge
c ou
r
te
sy
of
Ale
ss
io Be
att Smith
During school develops educational materials
rnardelli
hours, we devoted about science. See:
y of M
about two months of www.sciencemadesimple.co.uk

rtes
one-hour lessons (two w6 – The Rolls-Royce Science Prize

ou
ec
per week) to the proj- helps teachers in the UK to imple-

g
a
Im
ect. The rest of the ment science teaching ideas in their
Alessio
work was done after schools and colleges. For details, see
Bernardelli
school. http://science.rolls-royce.com
Imag
w7 – The National Grid for Learning
Acknowledgements
e c ourtesy o
Cymruw7 provides nearly 3000

John Alessio Bernardelli led the proj- downloadable educational
Ivins ect, but it would not have been resources to all stages of Welsh
f Joh
possible without the help of Matt school education. For more details,
nI
v in
Smith and John Ivins, colleagues at see: www.ngfl-cymru.org.uk

s
Croesyceiliog School.
w8 – The Microsoft Innovative
At the time of the project, Matt was
Teachers Forums are a set of nation-
ed how much physics can be an exceptional trainee teacher at
al, regional, and worldwide events
explained with our device; and Croesyceiliog School. He played an
that identify and reward exception-
because we presented them with their essential role in the design of the cir-
al examples of technology use in the
very own modulated laser pen, they cuit, and solved many problems that
classroom. For more details, see:
could do similar demonstrations with arose during the course of the project.
www.microsoft.com/education
their own classes. And of course, my He is now the director of physics in
colleagues at Croesyceiliog Schoolw3 an international school in Rome, Italy.
continue to use the device in their John Ivins was a key member of the Resources
own lessons. team thanks to his rapport with the For more details of the project, see the
The impact of the project also students. He is currently the acting report on Alessio Bernardelli’s blog:
extended beyond our region of Wales. head of physics at Croesyceiliog http://alessiobernardelli.wordpress
In October 2008, together with some School in Cwmbran in Wales, UK. .com/page/2
of our students, we ran a hands-on You can also follow his activities via
workshop for teachers at the Welsh Web references Twitter: http://twitter.com/asober
Physics Teachers’ Conference, organ- w1 – We used a Radio Shack mini To browse other Science in School
ised by the UK’s Institute of Physicsw4. audio amplifier, which can be pur- articles about science education
In April 2009, Science Made chased from T2Retail (T2 product projects, see:
Simplew5 visited our school and incor- reference number 2771008): www.scienceinschool.org/projects
porated aspects of our project into www.t2retail.co.uk
their new show for primary and sec-
w2 – The script of the play and the
ondary schools, taking our project
Powerpoint presentation used dur- At the time of the project, Alessio
even further afield – across England
ing it can be downloaded from the Bernardelli was the deputy team
and Wales.
Science in School website: leader of science at Croesyceiliog
www.scienceinschool.org/2010/ School in Cwmbran, Wales, UK. He
Timing
issue17/laser#resources taught science to 11- to 14-year-olds,
The project ran for a whole year, as
w3 – To learn more about and physics to the older students
part of the Rolls-Royce Science Prize
Croesyceiliog School, see: (ages 14-18).
2008-09w6, for which we were one of
www.croesyceiliog.org.uk He is now a field officer for the
nine finalists. The research and design
National Grid for Learning in Walesw7
stage took a couple of weeks, and the w4 – The UK’s Institute of Physics
and the coordinator of the Institute of
device itself was built in a few days. teacher network provides support
Physics teacher networkw4 in
The theatre phase – writing the script, for physics teachers across Great
Gloucestershire. In 2007, he was an
rehearsing and giving the perform- Britain and Ireland. See:
award winner at the Microsoft
ances – took about two months. Over www.iop.org/education
Worldwide Innovative Teachers
the course of the rest of the year, we w5 – Science Made Simple offers Forumw8 held in Helsinki, Finland.
collaborated with the Institute of inspirational and educational
Physics and Science Made Simple. shows for schools and festivals, and

Im
ag
e
co
ur
te
sy
of
NA
AS
A hole
in the sky
Twenty-five years ago,
the discovery of the
hole in the ozone layer
hit the news. How have
things developed since?
Tim Harrison and Dudley
Shallcross investigate.
The Antarctic ozone hole at its annual maximum on
12 September 2008, stretching over 27 million
square kilometres. This is considered a moderately
large ozone hole, according to NASA
Discovering the hole

It was a serendipitous find, as Jonathan Shanklin, one of
the hole’s discoverers, remembers: having joined the 35
British Antarctic Surveyw1 in 1977, he was supposed to
digitise their backlog of ozone measurements – until then, 30
handwritten data sheets. As it turned out, this included
the crucial decade, the 1970s, when ozone levels began to
Altitude (kilometres)
25 Stratospheric
drop. Ozone layer ozone

There had already been growing concern that industrial
20
chlorofluorocarbons (CFCs) – organic compounds such as
trichlorofluoromethane (CFCl3) and dichlorodifluo-
romethane (CF2Cl2), then widely used as refrigerants, pro- 15
pellants (in spray cans) and solvents – might destroy the
ozone layer. For an open day in 1983, Shanklin prepared a 10
Ozone Tropospheric
graph – ironically to show that the ozone data from that increases ozone
year were no different from 20 years before. Although this 5 from pollution
was true for the overall ozone levels, he noticed that the
springtime values did look lower from one year to the 0
next. Further studies corroborated this, and in 1985 Ozone concentration
Shanklin and his colleagues Joe Farman and Brian
Gardiner published their findings: each Southern
Ozone is present throughout the lower atmosphere. Most
Hemisphere spring, a hole gaped in the ozone layer above
ozone is in the stratospheric ozone layer. Near Earth’s surface,
the Antarctic, it was probably caused by CFCs, and it was the ozone levels increase as a result of pollution from human
growing (Farman et al., 1985). activities

Science topics
What is the chemistry behind this, and why is the ozone (hν) with a wavelength (λ) around 200 nm and dissociates
hole dangerous? into two oxygen atoms (O•) (reaction 1). Each of these can
then combine with another oxygen molecule to form
Ozone in the stratosphere ozone, if the pressure (M) is high enough (approximately
Ozone (O3) is a much less stable triatomic form of oxy- one thousandth of an atmosphere) to stabilise the newly
gen (O2). It is a pale blue gas present at low concentrations formed ozone molecule (reaction 2). The higher the alti-
throughout the atmosphere – and a double-edged sword: tude, the faster the rate of reaction 1 (below 20 km alti-
in the troposphere (see image on page 48), ozone is an air tude, no 200 nm photons occur because they have all been
pollutant which can damage the respiratory systems of absorbed in reaction 1). The rate of reaction 2, however, is
humans and other animals and burn sensitive plants. The faster closer to the ground, where atmospheric pressure is
ozone layer in the stratosphere, however, is beneficial, pre- higher. As a result, the maximum amount of ozone is cre-
venting most of the harmful ultraviolet (UV) light emitted ated between about 25 and 30 km altitude (see graph on
by the Sun from reaching Earth’s surface. page 46).
The rate of ozone formation maximises in the strato- The stratosphere has two important consequences for
sphere, the second highest layer of Earth’s atmosphere (at life on Earth. First, ozone itself absorbs high-energy
about 10-50 km altitude; see image), through a photo- UV radiation at around 250 nm
chemical mechanism: (reaction 3):
O2 + hν → O• + O• λ ∼ 200 nm (1) O3 + hν → O• + O2 λ ∼ 250 nm ΔH = - 90 kJ mol-1 (3)
O• + O2 + M → O3 + M (2) Between them, oxygen (reaction 1) and ozone (reaction
An oxygen molecule (O2) absorbs a photon of UV light 3) therefore filter out of the atmosphere most of the short-
Earth sciences catalytic cycles. Where do those organisms live?

Ages 16+ Which chemical substances do they produce?
The ozone hole is a topical global issue, and you will

· The chemical composition of the atmosphere and
its influence on the climate. Which gases is the
find this article really helpful to get into the subject. atmosphere composed of? In which way do the
The chemical processes involved are described in atmosphere’s properties determine climatic con-
full detail. In chemistry lessons, the article can be ditions on Earth’s surface, and how does this dif-
used to teach atomic structure and chemical bonds, fer on other planets?
free radicals, catalytic cycles, and the influence of The article could also form the basis of a lesson on
light and temperature on chemical reactions. how science is reported in the media. Students could
For the earth science classroom, the article would fit compare this article to those in the general press: do
in the context of the following topics: they provide a balanced view of the question, men-
tioning both chemical and natural components lead-
· Atmospheric influence on climate ing to the formation of the ozone hole? Do they min-
· Biological processes occurring on Earth’s surface imise or overemphasise the phenomenon as a
and affecting marine organisms whole? Why – due to journalists’ ignorance, political
· Earth’s morphology and the distribution of moun- strategy or both? For further ideas on using news in
tain ranges on Earth’s surface the science classroom, see Veneu-Lumb & Costa
· The changing of the seasons, Earth’s axial tilt and (2010).
rotation. Finally, the text is suitable as the basis of a compre-
There is the opportunity for interdisciplinary work hension exercise, too. Possible questions are:
REVIEW
linking chemistry and earth sciences. Possible topics

include:
· Why is this topic a much debated question
nowadays?
· The geographical distribution of the organisms · What is the role of natural factors in the growth
that produce chemicals that are active in natural of the ozone hole? What about human factors?
Teresa Celestino, Italy

Image courtesy of Marlene Rau
Layers of atmosphere leading to space
10 000 km
Exosphere
690 km
The four main reactions of oxygen in the ozone layer. Blue arrows indicate reac-
tions, green dotted arrows indicate that a molecule from one reaction goes on to
take part in another reaction. M denotes the pressure required for reaction 2
wave UV radiation between 200 and 300 nm, which would otherwise be very
damaging to life on Earth.
Second, reaction 3 produces a lot of heat, so the stratosphere is a warmer
layer than the top of the troposphere (see image left), making the weather in
the troposphere less extreme than it would otherwise be.
Thermosphere
Reactions 2 and 3 rapidly interconvert oxygen atoms and ozone. There is

another slow reaction, though, which is known to destroy both oxygen atoms
and ozone, namely the reaction between these two species:
O• + O3 → O2 + O2 (4)
Reactions 1-4 are summarised in the diagram above.
85 km
Natural catalytic cycles reduce the levels of ozone

Mesosphere
In 1995, Paul Crutzen, Mario Molina and F Sherwood Rowland were awarded
the Nobel Prize in Chemistry for their work on the formation and decomposi-
tion of ozone in the stratosphere. What had they learned? In the 1970s, Crutzen
and others discovered the existence of natural catalytic cycles that speed up
50 km reaction 4 and reduce the amount of ozone in the stratosphere (Crutzen, 1970,
1971): water (H2O), methane (CH4), nitrous oxide (N2O) and chloromethane
(CH3Cl) are released into the atmosphere from biological processes occurring on
Stratosphere
Earth’s surface, and lead to the formation of radicals such as hydroxyl (OH•),
nitric oxide (NO•) and chlorine (Cl•), which catalyse the decomposition of ozone.
Reaction 5 shows how chloromethane releases chlorine radicals into the strat-
osphere through photolysis, and reactions 6 and 7 are an example of a catalytic
6-20 km
cycle (see diagram on page 49). The reactions of the other catalysts are analo-
gous with reactions 6 and 7. Chloromethane is released in part by both marine
Troposphere
and terrestrial organisms, such as red macroalgae, white rot fungi and higher
plants, to regulate chloride ion levels in the cells and – after 30 to 40 years – can
reach the upper stratosphere (around 40 km altitude) where it is broken down
0 km
by sunlight (photolysis):

Science topics
Image courtesy of Marlene Rau
Chlorine radicals
(for example from
reaction 5) enter a
catalytic cycle
(reactions 6 and 7)
of net ozone
decomposition,
which can be ter-
minated by reac-
tions 8 and 9. Blue
arrows indicate
reactions, green
dotted arrows indi-
cate that a mole-
cule from one reac-
tion goes on to take
part in another
reaction. M denotes
the pressure
required for reac-
tion 9
CH3Cl + hν → •CH3 + Cl• λ~ 200 nm (5) predicted that CFCs would cause a significant additional
The resulting chlorine free radical (Cl•) can then partici- loss of ozone at around 40 km altitude (see Molina &
pate in a catalytic cycle: Rowland, 1974). However, when the ozone hole was final-
ly found in 1985, it was in fact at around 20 km altitude,
Cl• + O3 →ClO• + O2 (6)
ClO• + O• →Cl• + O2 (7) over the South Pole in the Southern Hemisphere spring-
time (see Farman et al., 1985).
Reactions 6 and 7 taken together are in fact equivalent to
It soon emerged that chlorine free radicals from the
reaction 4, but happen much faster – in the case of the
CFCs were responsible, but many questions remained
chlorine / chlorine monoxide (ClO•) radical cycle, about
unanswered. Why did the hole occur over the Pole? If it
30 000 times faster. So why do these catalytic cycles not
occurred over the South Pole, why not also over the North
destroy all the ozone? The answer lies in the termination
Pole? Why only in spring? And why was the ozone hole at
of these cycles via the formation of stable molecules:
20 km altitude instead of at 40 km, as predicted? After all,
Cl• + CH4 →•CH3 + HCl (8) CFCs could not be broken down by sunlight at an altitude
ClO• + •NO2 + M → ClONO2 + M (9) as low as 20 km, since the photon density was insufficient.
Eventually, a chlorine free radical will encounter a For the same reason, not enough oxygen atoms are pro-
methane molecule and react to form hydrochloric acid duced at this altitude for reaction 7 to occur. Many years
(HCl, reaction 8). Similarly, a chlorine monoxide radical of further research revealed the complete story.
will bind to a nitrogen dioxide radical, forming chlorine First, chlorine free radicals released from the CFCs, e.g.
nitrate (ClONO2, reaction 9) – another pressure-dependent
CFCl3 + hν→•CFCl2 + Cl• λ~ 200 nm (10)
reaction that therefore works better at lower altitudes.
Both hydrochloric acid and chlorine nitrate are very stable, could react with methane (reaction 8) forming hydrochlo-
and the removal of chlorine and chlorine monoxide radi- ric acid, or with ozone (reaction 6) forming chlorine
cals eventually stops the catalytic cycle. monoxide radicals, and through reaction 9 could subse-
quently form chlorine nitrate. This sequence of reactions
The Antarctic ozone hole puzzle would increase the concentrations of hydrocholoric acid
It was not long before scientists realised that CFCs could and chlorine nitrate at around 40 km altitude globally.
trigger a similar catalytic cycle of ozone degradation: in Each Southern Hemisphere winter, the South Pole is
1974, Molina and Rowland not only warned that levels of plunged into darkness for approximately three months.
CFCs continued to increase without regulation, but also The air in the stratosphere above the South Pole cools

All year round over the Equator,

in summer and autumn over the South Pole Early winter
The formation and dissolution of
the ozone hole over the year. 40 km (10) CFCl3 + hv (λ ~ 200 nm) → CFCl2 + Cl•
Reactions 5 to 9 happen over (6) Cl• + O3 → ClO• + O2 (8) Cl• + CH4 → CH3• + HCl
the Equator all year round, and (7) ClO• + O → Cl• + O2 (9) ClO• + NO2 → ClONO2
over the South Pole in summer
and autumn. In early winter, the 30 km HCl and
vortex forms over the South ClONO2
Pole, followed by the formation Vortex forms
of polar stratospheric clouds in
winter. In early spring, the sun- 20 km Cold and dark
shine returns, but the vortex air sinks
remains, and the reactions lead-
ing to ozone removal over the
South Pole take their course. In Equator
late spring, the vortex breaks
down, and ozone from mid-lati-
tudes can mix in
down; without UV radiation, reaction 3 does not occur, so HCl + ClONO2 →HNO3 + Cl2 polar stratospheric clouds (11)
no heat is released. The air sinks and Earth’s rotation causes This reaction can take place all winter, if it is cold
it to spin and form a vortex as it does so, like water going enough to form polar stratospheric clouds. When the sun-
down a plughole. This vortex is so strong that no air from
shine returns in spring, there are plenty of chlorine mole-
outside can get in, and no air from inside can get out. Air
cules at around 15-25 km altitude, which are photolysed to
that is rich in hydrochloric acid and chlorine nitrate from 40
produce chlorine radicals:
km altitude is drawn down into this cold and dark vortex.
Cl2 + hν→ Cl• + Cl• λ~ 350 nm (12)
In the extreme cold of the polar winter, the air in this
vortex becomes so cold that below -78°C (195 K) and at an and subsequently chlorine monoxide radicals via reaction 6.
altitude of 15-25 km, polar stratospheric clouds form from However, in the polar spring, reaction 7 (the formation
water and / or acid ice crystals. of chlorine radicals and oxygen molecules from chlorine
The first peculiar bit of chemistry is that hydrochloric monoxide radicals and oxygen radicals) is very slow, since
acid and chlorine nitrate can adsorb onto polar stratos- there are so few oxygen atoms present due to the lack of
pheric clouds and undergo a fast heterogeneous reaction 200 nm photons at this altitude, and here is where a sec-
from gaseous to solid phase, producing nitric acid (HNO3) ond peculiar piece of chemistry occurs. At low tempera-
that becomes incorporated into the ice crystals, whilst the tures, such as in the polar vortex – which is still very cold
chlorine (Cl2) is released back into the gas phase. even in spring – chlorine monoxide radicals can form a
3%
15%
HCI
Image courtesy of Andrew Ryzhkov; image source: Wikimedia Commons
CH3CI Natural
28% 3%
HCFC-22
CFC-12 CFC-113
6%
Anthropogenic CH3CCI3
10%
CFC-11 CCI1
23% 12%
Sources of stratospheric chlorine accord-

ing to the WMO / UNEP Scientific
Assessment of Ozone Depletion: 1998 Polar stratospheric clouds in Asker, Norway

Science topics
Image courtesy of Dudley Shallcross, Tim Harrison, Marlene Rau and Nicola Graf
Winter Early spring Late spring
HCl and Light returns, but vortex remains

ClONO2 (12) Cl2 + hv (λ ~ 350 nm) → Cl• + Cl• Vortex breaks down and
(6) Cl• + O3 → ClO•+ O2 ozone from mid-latitudes
Polar stratospheric
(13) ClO• + ClO• → ClOOCl can mix in
clouds form
(14) ClOOCl + hv (λ ~ 300 nm) → Cl•+Cl•+O2
(11) HCl + ClONO
→ HNO3 + Cl2
South Pole
dimer, chlorine peroxide (ClOOCl): In late spring, the flow of ozone-rich air from above
ClO• + ClO•→ ClOOCl (13) eventually warms the vortex via reaction 3, allowing the
This dimer is unstable at room temperature but forms vortex to eventually break down. Since exchange with
quite readily at low temperatures (below -30 °C) and can other parts of the atmosphere then becomes possible
be photolysed: again, the ozone hole is filled with ozone from the sur-
ClOOCl + hν→ Cl•+O2+Cl• λ~ 300 nm (14) rounding air.
So even though reaction 7 cannot occur, reaction 14 In some years, the ozone hole over Antarctica has grown
provides a way to regenerate chlorine free radicals with large enough to reach Australia, New Zealand, Chile and
the help of light, and the catalytic cycle for ozone deple- Argentina, growing to 1.5 times the size of the USA; and
tion can start in earnest now that the sunshine has when the ozone hole breaks up, the ozone-depleted air
returned. drifts out into nearby (populated) areas, including South
In what way does this differ from the natural catalytic Africa. For the people in these countries, the ozone hole
cycles we looked at before – why is there a total removal poses a direct health threat. The main concern is the
of ozone at some altitudes in this vortex? First, reaction 8 increased exposure to UV, which may cause skin cancer
(which removes chlorine radicals and can terminate the and ocular cortical cataracts, as well as damage to the
cycle) is very slow at the low temperatures found in the immune system. Furthermore, excessive UV radiation
vortex, and therefore ineffective. Second, all the nitrogen damages plants and building materials.
dioxide required for reaction 9 (which could likewise ter-
minate the cycle, through the formation of ClONO2) has CFCs and ozone today
been converted to nitric acid throughout the winter (e.g. Today, we have a good understanding of the physics
through reactions 9 and 11) and it is not available to be and chemistry governing the ozone layer. Once the true
regenerated since there is no upward flow in the vortex (at impact of CFCs on ozone depletion became apparent, gov-
the base of the vortex, air flows from the South Pole to the ernments passed regulations to stop the use of CFCs,
Equator, where the upward flow takes place). Therefore replacing them with alternative, shorter-lived, species
the cycle carries on unchecked and destroys all the ozone (hydrofluorocarbons and hydrochlorofluorocarbons),
at that level. Finally, without ozone, reaction 3, which which were to be phased out eventually too: the Montreal
would otherwise warm this region, is absent, and so the Protocol of 1987 and especially its amendments in 1990
vortex lasts well into the spring, exacerbating the ozone and 1992, which speeded up the phase-out, were an envi-
depletion. ronmental success.
The only reason that the ozone hole is more severe over The most recent data from AGAGE (The Advanced
the South Pole than the North Pole is that the spring tem- Global Atmospheric Gases Experiment)w2, which has been
peratures in the stratosphere above the North Pole are monitoring levels of CFCs and their replacements since
slightly warmer than those above the South Pole, because 1978, shows that even the atmospheric levels of dichlorod-
there are more mountain ranges in the mid to high lati- ifluoromethane (CF2Cl2), the longest-lived CFC, are now
tudes of the Northern Hemisphere, which change the decreasing: the legislation has been effective (see graph on
dynamics of atmospheric flow, so there are fewer polar page 52). An ozone hole still forms each spring over the
stratospheric clouds. South Pole, but estimates are that by 2050 this will no

Image courtesy of AGAGE
longer happen, and that by 2080 the

global ozone will return to 1950s levels. The atmospheric con- 550
centration of CFCs
The ozone hole is the result of an
CF2Cl2 mole fraction (ppt)

increased rapidly and is 490
increased use of CFCs, which began now slowly decreasing
in the 1930s – like any other gas, again. Data are given 430
CFCs take 30-40 years to reach the for CF2Cl2 , at the five
upper stratosphere, which means that AGAGE surface meas- 370
there is a corresponding lag in their urement stations from
effect on the ozone layer. We are cur- 1978 to the present day, 310
taken from the AGAGE
rently experiencing the stratospheric
websitew2 in September 250
chlorine peak resulting from the high- 2010 1980 1985 1990 1995 2000 2005 2010
est levels of CFC use in the 1980s – so
the maximum size the ozone hole I Ireland I Oregon / California I Barbados I Samoa I Tasmania
reaches each year should begin to

decrease a few years from now.
Although recovery is slow, we have Molina MJ, Rowland FS (1974) including CFCs and most non-CO2
definitely stopped a disaster: scien- Stratospheric sink for chlorofluo- greenhouse gases specified in the
tists have calculated that if the use of romethanes – chlorine atomic- Kyoto protocol. To access their data
CFCs had continued at its 1970s catalysed destruction of ozone. and for more information, see:
growth rate of 3% per year, this Nature 249: 810-812. doi: http://agage.eas.gatech.edu
would have led to a global ozone hole 10.1038/249810a0
Resources
by 2060, with all the health problems The article is freely accessible on the
that would bring (see image on page Nature website (www.nature.com) Sidney Chapman first derived the
53; Newman et al., 2009). or using the direct link: photolytic mechanism by which
Perhaps the most important lesson http://tinyurl.com/2u69cul ozone is formed and degraded. See:
to be learned from the ozone hole is Newman PA et al. (2009) What would Chapman S (1930) On ozone and
just how quickly our planet can have happened to the ozone layer if atomic oxygen in the upper
change as a result of human impact – chlorofluorocarbons (CFCs) had not atmosphere.
especially for the worse, but also for been regulated? Atmospheric Philosophical Magazine Series 7
the better – and that change is possi- Chemistry and Physics 9: 2113-2118. 10(64): 369-383. doi:
ble if we take action concertedly, doi: 10.5194/acp-9-2113-2009 10.1080/14786443009461588
effectively and quickly.
Patterson L (2010) A chemical bond: Jonathan Shanklin, one of the
References Nick Barker, linking schools and scientists who discovered the
universities in the UK. Science in ozone hole, published his reflec-
Crutzen PJ (1970) Influence of nitro-
School 15. www.scienceinschool.org tions 25 years after the discovery:
gen oxides on atmospheric ozone
/2010/issue15/nickbarker
content. Quarterly Journal of the Shanklin J (2010) Reflections on the
Veneu-Lumb F, Costa M (2010) Using ozone hole. Nature 465: 34-35. doi:
Royal Meteorological Society 96: 320-
news in the science classroom.
325. doi: 10.1002/qj.49709640815 10.1038/465034a.
Science in School 15: 30-33.
Crutzen PJ (1971) Ozone production www.scienceinschool.org/2010/ Download the article free of charge
rates in an oxygen-hydrogen-nitro- issue15/news from the Science in School website
gen oxide atmosphere. Journal of (www.scienceinschool.org/2010/
Geophysical Research 76(30): 7311- Web references issue17/ozone), or subscribe to
7327. doi: 10.1029/JC076i030p07311 w1 – The British Antarctic Survey is Nature today:
Farman JC, Gardner BG, Shanklin JD responsible for the UK’s national www.nature.com/subscribe
(1985) Large losses of total ozone in scientific activities in Antarctica. Nature has also published a collection
Antarctica reveal seasonal See: www.antarctica.ac.uk of articles that have advanced our
ClOx/NOx interaction. Nature 315: w2 – The Advanced Global understanding of the stratosphere
207-210. doi: 10.1038/315207a0 Atmospheric Gases Experiment, and the ozone layer, or told the
The article is freely accessible on the AGAGE, is a NASA-sponsored ini- story of the discovery, some of
Nature website (www.nature.com) tiative that has been measuring the which are freely available. See:
or via the direct link: composition of the global atmos- www.nature.com/nature/focus/
http://tinyurl.com/2wemxhn phere continuously since 1978, ozonehole

Science topics
NASA images courtesy of the Goddard Space Flight Center Scientific Visualization Studio
The Ozone Depletion website by scien-

tist and author Rod Jenkins contains
comprehensive information:
www.ozonedepletion.info
The website of the United Nations
Environment Programme’s
OzonAction branch provides a
1974 1994 large collection of data and
information about ozone and
the Montreal Protocol. See:
www.unep.fr/ozonaction
See also the pages of the United
Nations Environment Programme
Ozone secretariat, in English, French
and Spanish: http://ozone.unep.org
2009 2020
NASA offers two online videos of
atmospheric developments over the
Arctic, as measured with the Upper
Atmosphere Research Satellite
(UARS).
You can watch the increasing
concentration of chlorine nitrate
2040 2060 in February / March 1993. See
Ozone concentration (Dobson units) www.nasaimages.org or use
the direct link:
http://tinyurl.com/2w6wgh4
0 100 200 300 400 500 600
This video shows the formation of
polar stratospheric clouds. See
This is how the ozone layer would look if CFCs had not been banned www.nasaimages.org or use the
direct link:
NASA’s Ozone Hole Watch page eruptions. See: www.gcrio.org or http://tinyurl.com/33dfn6e
offers historical ozone maps, ozone use the direct link: In addition, NASA has published
facts, an ozone-related multimedia http://tinyurl.com/2wpvf9r images of a season in the life of the
gallery, a collection of teaching Introduction to Atmospheric Chemistry ozone hole. See: www.nasa.gov
modules about ozone-related by Harvard University’s Professor /vision/earth/lookingatearth/
topics, and more. See: Daniel J Jacob, which is freely 25TOMSAGU.html
http://ozonewatch.gsfc.nasa.gov accessible as a PDF, contains a For the complete list of climate-related
The University of Cambridge, UK, section on ozone, including the articles published in Science in School,
diagram ‘Chronology of the ozone
has compiled a virtual tour of the see: www.scienceinschool.org/climate
hole’ (chapter 10.3.3). See:
ozone hole, its history and science.
http://acmg.seas.harvard.edu or
The tour is available in English,
use the direct link:
French and German. See:
http://tinyurl.com/39vhy6a Dudley Shallcross is a professor in
www.atm.ch.cam.ac.uk/tour or use
Ozzy Ozone is a United Nations atmospheric chemistry and Tim
the direct link: Harrison is a school teacher fellow at
Environment Programme website
http://tinyurl.com/2wpvf9r the School of Chemistry, University of
offering educational cartoons,
The 74 scientists who attended the games, a glossary and more – Bristol, UK. For more information
panel review meeting for the 2002 including downloadable education about the post of school teacher fellow,
ozone assessment in Les Diablerets, packs with student and teacher see Patterson (2010).
Switzerland, published 20 Questions handbooks for both primary and
and Answers about the Ozone Layer, secondary school. All material is
including the contributions of cycles available in English, French, and
of solar activity and volcanic Spanish. See: www.ozzyozone.org

Clouds:
puzzling pieces
of climate
The physics of clouds and their role in
our climate have perplexed scientists
for decades. Karin Ranero Celius
investigates.
Image courtesy of Olaf Brust
D o clouds affect our climate, or

does the climate have an effect
on clouds? Both are true. However,
Image adapted from Russell et al. (2007); courtesy of the Institute of Physics
Cirrostratus
High-level clouds
clouds are so difficult to understand Cirrocumulus

Cirrus
that they are not yet well incorporat-
ed into climate models. That would
6000 m
require us to understand how clouds
form, why they appear and disappear, Altostratus
and why and when they precipitate.
To this end, scientists must analyse Altocumulus
the behaviour of individual clouds,

2000 m Medium-level clouds Cumulonimbus
their components and their effect on
the surroundings. Nimbostratus
Essentially, clouds are visible mass- Low-level clouds
es of water droplets (or even crystals),
suspended in Earth’s atmosphere. To
study them, researchers divide them S tratus Stratocumulus Cumulus
into categories. Thin and wispy

clouds are called cirrus clouds. Clouds are classified into different categories

Science topics
Image courtesy of Stephan Borrmann
Geography
Physics
General science
Ages 10-19
At a time when many countries worldwide are working together to

increase the use of renewable resources and reduce climate change
and its effects as much as possible, this article brings a new perspec-
tive. The author provides detailed and interesting information about
the relationship between clouds and climate change, giving exam-
ples from various parts of Earth.
The article can be used for several science subjects, such as:
· General science: formation of clouds and precipitation (ages 10-
12). The article would have to be simplified by the teacher and
probably some details such as fluctuations in acceleration would
have to be omitted to keep it simple enough for young students.
· Geography: weather observations, types of clouds, altitude of
clouds (ages 10-16+)
· Physics: reflection and radiation of heat, greenhouse effect, cli-
mate change (ages 13+)
The article can also serve as an introduction to further activities.
Younger students could be involved in observations of clouds, tem-
perature, humidity and the amount of precipitation, after which they
could present their results in class. They could also discuss the effect
of clouds on climate change and the effect of a polluted atmosphere
on precipitation.
The author mentions some specific examples of how clouds affected
temperatures and climate in northern China and the southeast
Pacific, as well as some current research in this research field. Older
students should be motivated to do further research about the rela-
Formation of clouds by convec- tionship between cloud formation and cloud types with climate
tion (rising air): sunlight heats the change.
ground so that the air above heats The large amount of detail also makes this article suitable for com-
up and rises. With increasing alti- prehension exercises in class. Some suggestions for questions could
tude, it expands and cools until be:
the vapour condenses. Turbulent
flow mixes the moist cloud air 1. What are clouds made of?
REVIEW
with the surroundings so that low- 2. How are they formed?

level cumuli sometimes disperse 3. How do cloud altitude and cloud seeds impinge on the tempera-
again (third image). Temperature ture of Earth’s surface?
and pressure decrease with alti-
tude, as illustrated at the left and 4. What consequences does this have on climate change?
right edges Catherine Cutajar, Malta
Cotton-puffs, or heaps of cotton-puffs, Furthermore, clouds are classified energy they radiate. High-level clouds
are cumulus clouds. On a cloudy day, according to their altitude into: low- are cold and radiate little heat into
the sky is usually covered by flat, level (up to 2000 m), medium-level space; instead, they reflect heat radia-
hazy and featureless stratus clouds. (2000-6000 m), and high-level clouds tion back towards Earth’s surface,
Each cloud can be classified as one or (over 6000 m). The height of the warming the atmosphere and magni-
a combination of these types of clouds clouds determines their temperature, fying the greenhouse effect. Low-level
(see diagram on page 54). which then determines how much clouds, more compact and warmer,

Image courtesy of NASA
emit more heat radiation into space

Smog over the Po Valley. The
than back towards Earth. They act as fine particles in the grey mist
a parasol, reflecting sunlight and thus can delay the rain
cooling Earth’s surface.
A cloud’s altitude, therefore, deter-
mines its effect on the climate. By
studying the occurrence of high-level
and low-level clouds, we can begin to
understand the roles they play. If both
types of clouds were to occur equally,
then the warming and cooling effects
would counteract each other, result-
ing in little heating or cooling of
Earth’s surface. If the occurrence of
high-level clouds increased while that
of low-level clouds decreased, there
would be a notable increase in atmos-
pheric temperature.
So, why do clouds appear and dis-
appear, and what determines their
formation and precipitation?
Cloud seeds
All clouds have one thing in com-
mon: they form from cloud seeds – diameter of 0.5-1 mm, they will fall – air, so the drops forming around
also known as aerosols. When water colliding with other droplets, assimi- those few seeds are very large, and it
evaporates under the Sun’s heat, the lating them and swelling into rain- rains heavily.
vapour rises into the air and the drops, which can fall at up to 35 km/h. In a polluted atmosphere, the large
water molecules condense on the Aerosols play an important part not number of aerosol particles prevents
aerosols – which can be natural, such only in cloud formation, but also in much of the Sun’s radiation from
as salt, or anthropogenic, such as sul- precipitation: they determine when reaching the ground, causing less
phates. If the cloud seed is at least 60- and where it rains. In a pristine water to evaporate. As the vapour
80 nm in diameter, a water envelope atmosphere with very few particles, rises, it finds many seeds, creating
can collect around it, forming a sunlight evaporates a great deal of more, but smaller droplets. This slows
droplet. The cloud consists of many of water. As it rises, the vapour finds down the formation of raindrops
these droplets. If the droplets reach a very few condensation seeds in the (droplets only fall once they reach 0.5-
In a pristine atmosphere (left), large rain-

drops quickly form and soon rain down.
Only a small portion of the cloud
droplets rise further, whereupon they
freeze and drift away. In a polluted
atmosphere (right), the vapour finds
many aerosol particles, so it forms only 0 oC
very small cloud droplets that rise to high
altitudes and freeze while they are up
there. Additional vapour then condenses
on the ice crystals. This is how energy-
filled thunderclouds form, which bring
heavy precipitation
Growing cloud Mature cloud Dissipating cloud

Science topics
Image courtesy of NASA
Image courtesy of the Max Planck Institute for Chemistry, Mainz, Germany
Dust storms – like this one over the Red
Sea off the coast of Saudi Arabia – are
natural sources of aerosols
Fly ash particles as seen under a

scanning electron microscope
do not explain another crucial factor

in climate: why do clouds change
shape, and why do they appear and
disappear?
The shape and lifespan of clouds,
and thus their influence on climate, is
determined by turbulence. At the
edges of a cloud, turbulence mixes the
1 mm), so it does not rain on the point precipitation. On a global scale, of dry surrounding air with the moist
of origin. More water condenses on course, all water that evaporates must cloud air. This is called ‘mixing
the seeds as the cloud continues to eventually precipitate. Thus clouds entrainment’. On a microscopic scale,
rise and the low temperatures freeze that only rarely empty their contents entrainment changes the distribution
the drops. So the cloud does not rain, will do so in the form of heavy rain- and size of the cloud droplets, affect-
but continues to climb higher. fall, causing floods, landslides and ing the cloud’s tendency to rain or
High concentrations of aerosols can mudslides. dissipating the cloud completely. But
inhibit precipitation and even cloud its effect can also be global. For exam-
formation entirely. The aerosol con- Puzzling hurly-burly ple, if clouds over the frequently
centration in northern China, for Although aerosols explain the for- cloud-covered southeast Pacific Ocean
example, is thought to be the cause of mation of clouds, and to some extent disperse, there will be more solar
the major shift in the frequency of the occurrence of precipitation, they radiation, contributing to phenomena
like El Niño, which is characterised by
Images courtesy of Roland Wengenmayr an increase in the ocean’s tempera-
ture.
0 oC Wind current
Ice and snow
Sleet or small hailstones
Raindrops
Large cloud drops
Medium-sized cloud drops
Small cloud drops
Growing cloud Mature cloud Dissipating cloud Aerosol particles

To forecast the fate of a cloud, scien- Closing in on clouds Stevens and his colleagues are now
tists must know how turbulent the While some scientists try to recreate incorporating their newly gained
droplets are: this determines how fast the conditions of turbulence in clouds information on cloud behaviour into
the raindrops form and fall. However, using huge wind canals, others study the global climate computer models.
studying turbulence in clouds is a it using computer simulations and In these models, the atmosphere is
complex task due to the different fieldwork. For example, Björn divided into grid boxes; for each box,
dimensions of clouds’ components (a Stevens, a researcher at the Max the computer calculates average val-
tiny droplet, a larger raindrop, an air Planck Institute for Meteorologyw1 in ues of temperature, humidity and
current) and the physical processes Hamburg, Germany, studies marine other characteristics of the atmos-
taking place within and between stratocumulus clouds, which form over phere, and predicts cloud formation.
them. cold regions of the subtropics, such as Although the models are not yet pre-
To understand the effect of turbu- off the Californian and South cise enough to predict the exact loca-
lence, not only the droplets’ velocity American Pacific coasts and over the tions where the clouds will form, they
and trajectory but also their accelera- Atlantic coastline near Namibia. They can now calculate the degree of cloud
tion is important. Acceleration fluctu- exert a great influence on the global cover and type of clouds in each grid
ates considerably, and can peak at climate, covering more than one tenth box, thus allowing the influence on
more than 20 times gravity. The fre- of the oceans’ area. Stevens found out heat and solar radiation on cloud for-
quency of collisions, which increase that these clouds are quite peculiar: mation to be quantified.
the chances of precipitation, is deter- satellite images show ‘holes’ in the Scientists, therefore, are still investi-
mined by particularly strongly accel- solid cloud blanket and although the gating the relationship between cloud
erated groups of droplets. These clouds do not normally cause heavy cover, precipitation, aerosols and the
strong fluctuations in acceleration rain, they do so around the holes. properties of air surrounding clouds –
could explain why droplets are found And when these clouds rain, turbu- all fundamental for understanding
to collide more quickly than conven- lence – the circulation of air between the link between clouds and climate
tional physics theories allow. the ocean and the cloud – can change change. So far, they are not even close
radically. to deciphering all the different mecha-
Image courtesy of Jacques Descloitres, MODIS Land Rapid Response Team, NASA / GSFC
Marine stratocumuli like these off

the coast of southwest Africa reflect
the sunlight. Will their number
increase as the climate changes?

Science topics
Image courtesy of David Ausserhofer
Science in School 11: 38-43.

issue11/climate
Björn Stevens explains
which factors influence Shallcross D, Harrison T, Henshaw
the structure of tropical S, Sellou, L (2009) Looking to the
rain clouds heavens: climate change experi-
ments. Science in School 12: 34-39.
http://scienceinschool.org/2009/
issue12/climate
Shallcross D, Harrison T (2008)
Climate change modelling in the
classroom. Science in School 9:
28-33. www.scienceinschool.org
/2008/issue9/climate
Shallcross D, Harrison T (2008)
Practical demonstrations to
nisms involved in the behaviour of Web references augment climate change lessons.
clouds and thus, their effect on our w1 – To learn more about the Max Science in School 10: 46-50.
climate. But the scientists will not Planck Institute for Meteorology, www.scienceinschool.org/2008/
give up, because, as the French see: www.mpimet.mpg.de issue10/climate
Renaissance philosopher and natural- w2 – To download each issue of Max
ist René Descartes said: “Clouds pro- In this issue, there are two further
Planck Research (available in English
vide the key to understanding all related articles:
and German), visit the website of
things wonderful on Earth.” the Max Planck Society Harrison T, Shallcross D (2010) A
(www.mpg.de) or use the direct hole in the sky. Science in School 17:
Acknowledgement link: http://tinyurl.com/35aunrs 46-53. www.scienceinschool.org/
This article was compiled from 2010/issue17/ozone
three articles published in Max Planck Resources Schülli T (2010) Science is cool...
Research: Meier (2010), Hergersberg To learn more about climate change supercool. Science in School 17: 17-22.
(2010) and Wengenmayr (2010). Max and its causes, see: www.scienceinschool.org/2010/
Planck Research is published by the issue17/supercooling
Benestad R (2007) What do we
Max Planck Society and describes – in To browse all science topic articles
know about climate? The evidence
simple language – the work of its in Science in School, see:
for climate change. Science in School
research institutes. The quarterly pub- www.scienceinschool.org/
7: 49-51. http://scienceinschool.org
lication is freely available to down- sciencetopics
/2007/issue7/climate
loadw2.
Benestad R (2008) What do we
References know about climate? Investigating Karin Ranero Celius obtained a
the effects of anthropogenic global bachelor’s degree in physics and psy-
Meier C (2010) Water with a
warming. Science in School 8: 48-51. chology, and then an MSc in museum
Nebulous Effect. Max Planck
http://scienceinschool.org/2008/ studies. Her passion for educating
Research 2.2010: 17-23
issue8/climate others about the wonders of science
Hergersberg P (2010) Droplets on a
For activities related to clouds see: has led her to become a science com-
Roller Coaster. Max Planck Research
Bultitude K (2009) Take the weather municator. She has been dedicated
2.2010: 32-37
with you. Science in School 11: 52-57. mainly to outreach and education,
Russell A, Ricketts H, Knight S (2007) first at the Instituto de Astrofisica de
http://scienceinschool.org/2009/
Clouds. Physics Education 42(5): Canarias, in Spain, then at the
issue11/weather
457-465. doi: 10.1088/0031- European Southern Observatory in
9120/42/5/002 For activities for the classroom about
climate change see: Munich, Germany, and now at the
Wengenmayr R (2010) The Seeds of European Molecular Biology
Climate. Max Planck Research 2.2010: Shallcross D, Harrison T, Henshaw
Laboratory in Heidelberg, Germany.
24-31 S, Sellou L (2009) Fuelling interest:
climate change experiments.

An astronomer in a 3D world
What do astronomy and film have in common? Both can
involve Jochen Liske, astronomer and actor. Karin Ranero
Celius takes us on a trip to the Paranal Observatory in Chile
and tells us about Jochen’s latest film: Das Auge 3D.
Image courtesy of Swinburne Astronomy Productions / ESO
Artist’s rendering of the E-ELT
Image courtesy of Dr Jochen Liske
A s darkness approaches, a glow-

ing band of light, the Milky
Way, extends from one horizon to the
a passion for finding out how the
world around us works, and has
devoted his life to trying to uncover
other, and stars shimmer over the site and explain its nature. “I’ve always
where a privileged few are investigat- been interested in science. I realised I
ing the beginning of the Universe: the had a passion for finding out what
Atacama Desert, in Chile. makes the world tick, when popular
A curiosity-driven astronomer from science magazines no longer satisfied
the European Southern Observatory Dr Jochen Liske my curiosity and always left me
(ESO)w1, Jochen Liske, has always had wanting more.”

Scientist profile
Aerial view of the ESO Very

Large Telescope platform atop
Cerro Paranal, in the Chilean The Paranal Observatory is at one of the driest places on Earth. The water supply
Atacama Desert is regularly brought in big tanks from Antofagasta, the next city, which is one and
a half hours away by car
Image courtesy of JL Dauvergne & G Hüdepohl / ESO
Image courtesy of ESO

Particularly drawn to the ‘funda-
mental’ sciences of particle physics
and cosmology, Jochen pursued a
career in physics, studying at the
University of Bonn, Germany, and
then gaining a PhD at the University
of New South Wales, in Australia. able to literally watch how the speed Starring in a 3D world
“Astronomy is developing very rapid- with which the Universe expands “Being an astronomer implies being
ly, and it is very exciting and inspir- changes. This means that I need to a communicator: you end up talking a
ing to watch it all happen, and to be a make extremely precise measure- lot in front of audiences in confer-
part of it in some small way. As an ments of the speed at which distant ences, schools, and public outreach
astronomer, I get to travel to very objects move away from Earth. A very events, so fear of public speaking is
exotic and remote places, and I have large ground-based telescope is need- not something you frequently
the privilege of ‘playing’ with some ed to perform these measurements, so encounter among astronomers.”
pretty amazing equipment and this will only be possible with the E- Jochen is not only an astronomer and
analysing photons that have been zip- ELT. This and other experiments car- a communicator, but also a talented
ping across the universe for a few bil- ried out with the E-ELT could provide actor. “I was always part of the the-
lion years and suddenly crash into important clues to the nature of the, atre group in secondary school and
‘my’ telescope.” as yet, unexplained acceleration of the performed in a number of plays. This
Jochen is currently working in the Universe’s expansion, leading to a has helped me in my job and to stand
science team of the European more fundamental insight into the up in front of the camera.” His acting
Extremely Large Telescope (E-ELT)w2: basic laws that govern nature.” ability has been a key tool for com-
“I use computer simulations to try municating science in a world that is
and see how far we will get with this Image courtesy of Parallax Raumprojektion
unthinkable without modern science.
telescope in answering certain scien- As well as being ‘Dr J’, the host of
tific questions.” The Parallax two popular video podcasts, the
His main research goals, however, Raumprojektion crew Hubblecastw3 and the ESOcastw4,
will be achieved only once the tele- during filming which bring the latest science from
scope is completed: “I want to use the the Hubble Space Telescope and from
E-ELT to observe, in real time, the ESO to a wide audience, Jochen has
evolution of the Universe, which participated in various astronomy-
occurs over billions of years, by related documentaries and frequently
watching it very closely over a time gives media interviews and public
frame of only 20 years. I hope to be talks. His participation in the E-ELT

Rare 360-degree panorama of the Southern Sky
Image courtesy of ESO / HH Heyer

Image courtesy of ESO / G Lombardi
15 years ago, Cerro Paranal,

the site of the VLT, looked like We accompany Marcelo, a crucial
Cerro Ventarrones does today person in the operation of Paranal, on
his daily three-hour drive to supply the
entire VLT complex with 27 000 litres of
water. Without him, the observatory
would not function.
Leaving the heat of the desert, we are
then taken on a breathtaking tour of
the site. One moment we are inside the
giant domes, nearly touching the mir-
rors of the 8.2 m diameter telescopes.
Then we are outside on the telescope
platform, where one of the Unit
Telescopes moves towards us as it is
positioned for its next observation. And
project, however, has led to his most ity, and how curiosity led to science, then we suddenly find ourselves
stellar appearance thus far: in Das and science led to devices to explore beneath the summit of Cerro Paranal,
Auge 3D (The Eye 3D)w5. the stars. It is the story of one of these in the dark blue realm of the Very Large
Once we don our 3D glasses, the devices: the Very Large Telescope Telescope Interferometer (VLTI)w7 delay
movie theatre merges with the arid (VLT), its people and the environment tunnel: the world of Nicolas Schuhler.
landscape, and we are virtually trans- of the Paranal Observatory. It is the He is an engineer who is living his
ported to Cerro Paranal, one of the story of an age-old fascination.” schoolboy dream: to work on the VLTI.
most remote locations on the planet, Building and operating technological
Eventually, we are taken to a desert-
and the site of one of the best obser- masterpieces such as the VLT requires
ed area about 30 km from Paranal.
vatories in the world, the Paranal many years of hard work, money and
Observatoryw6. the efforts of countless individuals – Jochen climbs the small tower atop a
According to Nikolai Vialkowitsch, without which the science could not bare mountain and looks into the
director of Das Auge 3D, “it is not a be done. desert.
movie about science, it’s about curios-

Scientist profile
Das Auge 3D: The next best thing to really being

at Paranal
In June 2009, a crew of German 3D film experts from German in cinemas in Germany and Austria. The
Parallax Raumprojektion travelled to Chile’s Atacama English version will be released soon. It has been
Desert, one of the most arid places on Earth, where bought by National Geographic and will soon be
BAC K G R O U N D
ESO’s Very Large Telescope is located on Mount released worldwide.

Paranal. Das Auge 3D is the first 3D documentary pro- Interested schools can contact Stefanie Knoll (email:
duced in Germany. Directed by Nikolai Vialkowitsch, distribution@raumprojektion.de) to book a German-
the film, lasting about 45 minutes, transports the view- language screening in collaboration with a 3D cinema
ers to one of the world’s greatest observatories. The nearby. It is also possible to invite the director or one of
motion picture was appointed a special project of the the astronomers from the film as interview partners. The
International Year of Astronomyw8 and has won a spe- film website offers a teaching unit on the telescopes, to
cial prize for its images at the 2010 Dimension3 film better integrate the screening in the curriculum, as well
festivalw9 in Seine-Saint-Denis, France. Although not yet as a physics teacher’s report on his experiences with
available on DVD, it is currently being shown in watching the film in schoolw5.
This is Cerro Ventarrones. It was In Das Auge 3D, Nikolai and Jochen compass alone. Although astronomy
one of the possible sites for the con- aim to bring astronomy closer to the won’t give us a cure for cancer and it
struction of the E-ELT before Cerro public and inspire them to want to won’t provide us with clean, free
Armazones was finally chosen. Jochen know more. Have you ever wondered energy either, I strongly believe that it
tells us “It is just this rickety little five what the world would be like if is worth doing. And communicating.”
or six metre high tower with a small humans had not been curious and
telescope and a meteorology station, eager to answer questions? Jochen Acknowledgement
so it’s all very rough and desert-like thinks that “we would still think that The author would like to thank
up there. It’s quite an achievement to Earth is the centre of the Universe, we Parallax Raumprojektion for their
build such high-tech structures like still wouldn’t know why apples fall cooperation.
the VLT or the E-ELT out here.” from trees, and we’d be navigating by

Artist’s rendering of the E-ELT
Image courtesy of ESO
Web references w6 – Paranal is an ESO-operated

Education resources for the
w1 – ESO, the European Southern astronomical observatory located on
International Year of Astronomy.
Observatory, is the foremost inter- Cerro Paranal in Chile, at an alti-
Science in School 13.
governmental astronomy organisa- tude of 2635 m. It is home to the
www.scienceinschool.org /2009/
tion in Europe, and the world’s Very Large Telescope (VLT), the
issue13/iya
most productive astronomical world’s most advanced visible-light
astronomical observatory, which w9 – To find more information on the
observatory. See: www.eso.org
consists of four unit telescopes with Dimension3 film festival, see:
w2 – ESO’s E-ELT will be 42 m in www.dimension3-expo.com/uk/
diameter and will be the world’s main mirrors of 8.2-m diameter and
four movable 1.8-m diameter auxil- festival.php
biggest eye on the sky. For more
information see: www.eso.org/ iary telescopes. For more informa-
tion about Paranal visit the ESO Resources
public/teles-instr/e-elt.html
websitew1. To learn more about the To browse all Science in School articles
w3 – Hubblecast is a scientific and about ESO, see:
VLT, see:
educational videocast about the www.scienceinschool.org/eso
Hubble telescope, offered for down- Pierce-Price D (2006) Running one
load in several formats: standard of the world’s largest telescopes.
(mov, mpeg, mp4, m4v), HD (High Science in School 1: 56-60.
Definition) and Full HD. To watch www.scienceinschool.org/2006/ Karin Ranero Celius obtained a
Hubblecasts see: issue1/telescope bachelor’s degree in physics and psy-
www.spacetelescope.org/videos/ w7 – The Very Large Telescope chology, and then an MSc in museum
archive/category/hubblecast Interferometer (VLTI) combines two studies. Her passion for educating
w4 – ESOcast is a videocast series or three of the VLT telescopes, others about the wonders of science
dedicated to bringing you the latest allowing astronomers to see details has led her to become a science com-
news and research from ESO, up to 25 times finer than with the municator. She has been dedicated
available in the same formats as individual telescopes. To learn more mainly to outreach and education,
the Hubblecastw3 except for Full HD. about the VLT and interferometry, first at the Instituto de Astrofísica de
To watch the episodes, see: search the ESO website Canarias, in Spain, then at the
(www.eso.org) or use the direct European Southern Observatory in
www.eso.org/public/videos/
links http://tinyurl.com/35we9qg Munich, Germany, and now at the
archive/category/esocast
and http://tinyurl.com/38ov7s4 European Molecular Biology
w5 –For more information on Das Laboratory in Heidelberg, Germany.
Auge 3D (The eye 3D), where it is w8 – For a collection of education
being screened, and material for resources surrounding the
schools, see: International Year of Astronomy, see:
http://dasauge3d.wordpress.com Starr C, Harwood C (2009)

Publisher: EIROforum, Safety note website). We are, however, unable to

www.eiroforum.org For all of the activities published in check the individual translations and can-
Editor-in-chief: Dr Eleanor Hayes, Science in School, we have tried to check not accept responsibility for their accuracy.
European Molecular Biology that all recognised hazards have been
Laboratory, Germany identified and that suitable precautions are Copyright
suggested. Users should be aware, howev- With very few exceptions, articles in
Editor: Dr Marlene Rau,
er, that errors and omissions can be made, Science in School are published under
European Molecular Biology
and safety standards vary across Europe Creative Commons copyright licences that
Laboratory, Germany
and even within individual countries. allow the text to be reused non-commer-
Editorial board: Therefore, before undertaking any activity, cially. Note that the copyright agreements
Dr Giovanna Cicognani, Institut users should always carry out their own refer to the text of the articles and not to
Laue Langevin, France risk assessment. In particular, any local the images. You may republish the text
rules issued by employers or education according to the following licences, but
Dr Dominique Cornuéjols,
authorities MUST be obeyed, whatever is you may not reproduce the image without
European Synchrotron Radiation
suggested in the Science in School articles. the consent of the copyright holder.
Facility, France
Unless the context dictates otherwise, it is Most Science in School articles carry one
Elke Delvoye, European Space assumed that: of two copyright licences:
Agency, the Netherlands
· Practical work is carried out in a proper- 1) Attribution Non-commercial Share
Russ Hodge, Max Delbrück ly equipped and maintained science lab- Alike (by-nc-sa):
Zentrum, Germany oratory
Dr Rolf Landua, European · Any electrical equipment is properly
Organization for Nuclear maintained
This license lets others remix, tweak, and
Research (CERN), Switzerland · Care is taken with normal laboratory
build upon the author’s work non-
operations such as heating
Dr Dean Madden, National Centre commercially, as long as they credit the
for Biotechnology Education, · Good laboratory practice is observed author and license their new creations under
when chemicals or living organisms are the identical terms. Others can download
University of Reading, UK
used
and redistribute the author’s work, but they
Dr Douglas Pierce-Price, European
Southern Observatory, Germany
· Eye protection is worn whenever there is can also translate, make remixes, and pro-
any recognised risk to the eyes duce new articles based on the work. All
Lena Raditsch, European · Pupils and / or students are taught safe new work based on the author’s work will
Molecular Biology Laboratory, techniques for activities such as han- carry the same license, so any derivatives
Germany dling living organisms, hazardous mate- will also be non-commercial in nature.
rials and equipment. Furthermore, the author of any derivative
Dr Fernand Wagner, European
Association for Astronomy Credits work may not imply that the derivative
Education, Luxembourg Science in School is published by work is endorsed or approved by the
EIROforum (a collaboration between seven author of the original work or by Science
Chris Warrick, European Fusion
European inter-governmental scientific in School.
Development Agreement, UK
research organisations: 2) Attribution Non-commercial
Copy editor: Dr Caroline Hadley
www.eiroforum.org) and is based at the No Derivatives (by-nc-nd)
Composition: Nicola Graf, European Molecular Biology Laboratory
Email: nicolagraf@t-online.de (EMBL: www.embl.org) in Heidelberg,
Printers: ColorDruckLeimen, Germany.
This license is often called the ’free adver-
Germany Science in School is a non-profit activity. tising’ license because it allows others to
www.colordruck.com Initially supported by the European download the author’s works and share
Commission, it is now funded by
Webmaster: Alexander Kubias them with others as long
EIROforum.
as they mention and link back to the
Email: mail@alexander-kubias.net
Disclaimer author, but they can’t change them in any
ISSN: Views and opinions expressed by authors way or use them commercially.
Print version: 1818-0353 and advertisers are not necessarily those of
For further details, see:
Online version: 1818-0361 the editors or publisher.
http://creativecommons.org
Cover images: We are grateful to all those who volunteer All articles in Science in School carry the
Images courtesy of Chepko and to translate articles for the Science in relevant copyright logos or other copyright
Xacto / iStockphoto School website (see the guidelines on our notice.

Blind date in
Image courtesy of Dr Werner Liese

the science
classroom
Biology and chemistry teacher
Werner Liese talks to Marlene Rau
about the challenges of performing
Swelling paper is a special kind of paper
which swells up when combined with ink science experiments with blind
and heat, for 3D representations of dia-
grams, such as this set-up for the fused-salt and visually impaired students.
electrolysis of sodium hydroxide
W erner Liese is no ordinary

teacher – and his students
aren’t ordinary either. The day a
friend invited him to sit in on a chem-
istry lesson he was teaching at the
Carl-Strehl-Schulew1 in Marburg,
Germany, changed Werner’s life. He
realised that with his hobby – fiddling
with electronics – he could make a
real difference here. Werner had just
finished his training as a secondary-
school biology and chemistry teacher
and gained a PhD in inorganic chem-
istry at Marburg University, so he
went straight to the school’s head- A blind student uses a Braille terminal to check the text she has just typed on her
master and asked for a job: he wanted laptop. A Braille terminal is actually more expensive than the laptop itself
to apply his skills to using and devel-
oping tools for blind and visually
impaired students, to help them do
experimental work in the science oper, and has brightened up numer- the way scientists work – it is the only
classroom. ous students’ lives. viable way to make even complex
Werner got the job, and over the “It is so important that the students topics transparent for the students –
past 29 years has been very successful can do their own experiments. This otherwise they remain just theories. It
as both a teacher and technical devel- not only helps them to understand makes all the difference.”
Science in School Issue 17 : Winter 2010 www.scienceinschool.org

Teacher profile
Image courtesy of Sonja Dörrich-Liese
Today, the Carl-Strehl-Schule the blind and visually impaired. A

accommodates more technology than full-time electronics engineer was
your average school: students take employed to help, and a dedicated
notes mostly on laptops; visually workshop was fitted for the task.
impaired students use digital enlarg- “Not one teaching-materials supplier
ers to magnify the text they are read- worldwide offers ready-made materi-
ing; and blind students can scan in als adapted for blind students – the
text, after which it is either read aloud market is just too small,” Werner
to them by a computer or represented states sadly. “I was very lucky that,
on a Braille terminal – an electro- for a time, the school relieved me of
mechanical device for displaying one the majority of my teaching duties so
line of Braille characters at a a time by that I could dedicate my time to
raising pins on a flat surface. developing these tools. This, and sev-
When Werner started his job, things eral generous grants made it all possi-
were very difficult. There was not a ble.”
lot of technological support for his What special needs do his students
students, let alone for the science have? “Of course it wouldn’t make
classroom. Many experiments had to sense to concentrate for weeks on end
be explained and the students had no on the chemistry of coloured pig-
Werner Liese in the electronics lab at
opportunity to experience them first- ments in a classroom full of blind stu- the Carl-Strehl-Schule, developing the
hand. Shortly after he joined the dents. But basically, you can teach any interface for the talking digital burette
school, Werner started developing science topic at our school, just as you
electronic tools for teaching science to can at any other. For grades 5 to 10,
The Carl-Strehl-Schule
The Carl-Strehl-Schule is the only school for blind and Abitur, which qualifies them to study any subject at
visually impaired students in German-speaking coun- university. For these students, the school offers an
tries that provides secondary-school education begin- optional detailed course in economics. Alternatively,
ning as early as grade 5 (aged 11). To cover such a large students who want to study sociology or economics at
geographic area, it needs to be a boarding school. It is a technical university (Fachhochschule) can spend two
part of the German Institute for the Blind (Deutsche or three years focusing on these subjects.
Blindenstudienanstalt)w4 which also offers training pro-
In addition, the school offers two-year full-time voca-
grammes for blind adults, a library of Braille and audio
tional courses to prepare their students for a range of
books, and a publishing house for Braille books.
jobs in IT or as foreign-language secretaries.
The institute was founded in 1916 to cater for the many
BAC K G R O U N D
The Carl-Strehl-Schule also offers advice and practical

young men who had lost their eyesight in World War I.
Today, the school’s 300 students, who are taught in help for blind and visually impaired students at other
small groups of eight to twelve students, arrive at vari- schools.
ous ages and for different reasons – some have been Outside the classroom, students can choose from a
born blind or visually impaired, others lose their eye- variety of extracurricular activities, such as acting, a
sight gradually due to a disease, while others have had choir, a rock band, horse-riding, football, judo, swim-
an accident. ming, athletics, gardening, excursions to watch and lis-
The Carl-Strehl-Schule has a range of secondary-school ten to bats, or participation in the environmental club
branches. After grade 10 (at the age of 16), students can which has installed solar and cogeneration power
choose three years of general education leading to the plants in the school.
www.scienceinschool.org Science in School Issue 17 : Winter 2010


we have adapted the curricula to our students’ needs, but
from grade 11 onward, they need to prepare for the gener-
al school-leaving certificate (Abitur), which enables them to
go to university. The exam questions are the same for all
students in the federal state, so our students need to learn
the same material as their peers. We actually collaborate
with other secondary schools in Marburg to offer joint
courses for sighted and visually impaired students in sub-
jects for which there are very few students.
“The main task for the teacher is to translate visual
impressions into impressions our students can perceive
with their other senses – mostly acoustic or tactile. Similar
tools are employed in all sciences, but chemistry requires
the most complex adaptations. For our visually impaired
students, we use cameras with special optics to transmit
details of the experiments to computer screens. With this
the students are able to zoom in sufficiently to easily fol-
A visually impaired student performs an acid-base titration low experiments being demonstrated by the teacher or
experiment with the talking digital burette, using the large other students. In our media centre and electronics lab, we
LCD display design instruments that convert light or colours into sound
or synthetic speech: students weigh out chemicals with
special precision tools, and we fit standard measuring
instruments with large digital displays and voice output.
“I had to learn a lot about analogue and digital electron-
Image courtesy of Dr Werner Liese ics as well as computer-aided design to be able to tackle
more complex projects, such as a digital burette which for
the first time enables blind people to perform precise titra-
tions. We fitted a standard burette with an electronic inter-
face that sends the data to an adapter we built, which has
a voice output and a very large display. Coupling the
burette to a data-recording programme allows the students
to produce not only tables but also graphical representa-
tions of the data. These can then be made available in tac-
tile form by printing them onto ‘swelling paper’, a special
kind of paper that swells up when combined with ink and
heat.
“Many of the tools we have produced in our workshop
are not available anywhere else. However, two of the
instruments that we developed are also commercially avail-
able: a talking digital multimeter, and an ‘optophone’ – an
instrument to measure light intensity and electrical conduc-
tance and translate this into sounds at different pitch.”
The optophone is used to identify the colour change in an
acid-base reaction with bromothymol blue indicator. A Another project Werner is particularly proud of is the
strong light is shone through the solution, and the opto- LiTeX programmew2, which he has been working on over
phone sensor (held by the blind girl on the left) measures the past nine years; it is now the most comprehensive
the incoming light. As long as the solution is yellow German-language writing tool for the blind and visually
(acidic) and the incoming light is strong, the optophone impaired. “It is a freely downloadable template for
emits a high-pitched sound. When the solution becomes Microsoft WordTM which enables the simple integration of
basic and turns blue, optophone will emit a low-pitched
formulae, equations, structural formulae and Lewis nota-
sound. The instrument can also be used to measure electri-
tion for maths, physics and chemistry, and offers a number
cal conductance, emitting differently pitched sounds for
different conductivity values of important help functions for writing normal texts which
weren’t available before. Even many sighted people find it
useful.”

Teacher profile
Werner is also active outside the school walls. When

his former PhD supervisor founded the Chemikumw3
teaching lab at Marburg University, Werner was called
in to develop experiments and adaptations to enable
blind and visually impaired people to use the lab. This
experimental chemistry lab is open for anyone aged

four and above – school classes, groups or individuals –
to attend demonstrations or take part in hands-on
experiments.
This project fulfils Werner’s ambitions for science edu-
cation: “Anyone can enjoy science. But it is extremely
important for teachers to be creative in their use of
equipment. This is true not only at a school like ours,
but in any classroom. Besides, he or she has to be enthu-
siastic and transmit this enthusiasm to the students.”
Werner’s students demonstrate his success – one of his In the chemistry classroom, students at the Carl-Strehl-
former students, a blind boy, has graduated in biology Schule use magnetic boards for Lewis notation and
at Marburg University, while another visually impaired studying chemical reactions, such as the reaction of
student has successfully completed a PhD in chemistry. sodium with water
Werner has achieved his goal: he has made science more
accessible to everyone – including the blind.
Image courtesy of Conny Peil, Carl-Strehl-Schule
Web references
w1 – Find out more about the Carl-Strehl-Schule on the
school’s website (in German): www.blista.de/css
w2 – The LiTeX programme is freely available on
Werner Liese’s website, which also contains more
information about Werner and his work (in German):
www.werner-liese.de
w3 – The Chemikum Marburg offers anyone aged
four and above the possibility to do chemistry
experiments (in German).
See: www.chemikum-marburg.de
w4 – Learn more about the German Institute for the
Reaction of sulphuric acid with sodium chloride in a
Blind (Deutsche Blindenstudienanstalt) here (in miniature apparatus. The modular design of this system
German): www.blista.de enables blind and visually impaired students to set up the
experiment more easily, while the smaller amounts of
Resources chemicals used reduce experimental hazards. The small
size of the set-up allows the camera to capture the whole
To browse all teacher profiles in Science in School, see: set-up in one image, and small vials reduce disruptive
www.scienceinschool.org/teachers reflections. The cameras show two different magnifica-
tions of the experiment
Dr Marlene Rau was born in Germany and grew up in

Spain. After obtaining a PhD in developmental biology blind people, meeting them on the street every day,
at the European Molecular Biology Laboratory in going horse-riding with them, teaching them Latin, shar-
Heidelberg, Germany, she studied journalism and went ing a house with a blind friend and living opposite the
into science communication. Since 2008, she has been Carl-Strehl-Schule for a couple of years. Blind people
one of the editors of Science in School. have always been an integral part of her life – and she
Marlene’s father has been blind since he had an acci- finds that their lives are not so very different, really.
dent at the age of 20, and she has lived in Marburg for
much of her life – going to school and university with

Very Short Introductions to

Evolution, Human Evolution and
the History of Life
By Brian and Deborah Charlesworth (Evolution), Bernard Wood (Human

Evolution) and Michael J Benton (The History of Life)
Reviewed by Colin Johnson, UK
H ow short is ‘very short’? Well,

pretty short – between 120 and
150 pages. The pages are small, too,
read for an advanced teacher, but
unlikely to engage many school stu-
dents. It’s a book for the teacher’s
The History of Life: A Very Short
Introduction would appear to have the
toughest task of all: the origins of life,
175 mm x 110 mm, but then so is the shelf – perhaps to be dipped into as a sex, skeletons, life on land, forests and
type. ‘Introduction?’ …well, it refreshing summary of a key topic: the flight, the biggest mass extinction, the
depends what’s being introduced. ‘evidence for evolution’ chapter would origin of modern ecosystems and the
These are cleverly written books, be a good brief source of reference. origins of humans. Happily, however,
compressing a great deal of material Human Evolution: A Very Short the author manages to cover all this
and a reasonable number of black and Introduction is by ‘a medically quali- ground deftly – almost conversation-
white illustrations into a small space. fied palaeo-anthropologist’ – and it ally – and with considerable clarity.
It would be a mistake to confuse shows. It deals with the fossil record, Of course, the depth of detail isn’t
brevity with accessibility, however. So early hominins, transitional hominins there and a few academic noses may
– from the point of view of a school- and early Homo before turning to the be turned up at the lively personal
teacher considering purchases – what people who inhabit the globe today. style, but this book communicates
are we looking at here? There’s a chronology “of thought and with the non-specialist reader in a
Evolution: A Very Short Introduction science relevant to human origins and way that the others struggle to
follows a path you would expect: the evolution”, which – though brief – is achieve. It is indeed an ‘introduction’,
evolutionary processes, evidence for seriously academic. Individual sec- and many a school student will enjoy
evolution, adaptation and natural tions of this book contain engaging reading it. Try leaving it lying around
selection, and the formation and narratives, and thorough explana- in your lab for someone to pick up, or
divergence of species. Had the book tions, but the sheer density of the – in more traditional mode – make
been written today, the word ‘cre- writing must take it beyond school sure that it is on your students’ read-
ationism’ would surely have been in science and well into specialist reading list.
the index, but the final chapter does ing at university level. Teachers will
not shirk what the authors have find the ‘points to watch’ sections at
called “difficult problems” – complex the end of each chapter very valuable, Details
adaptations, ageing, the evolution of however. They provide caveats for Evolution: A Very Short Introduction
sterile social castes, and the origin of teaching and some really good start- Publisher: Oxford University Press
living cells and of human conscious- ing points for discussion and wider Publication year: 2003
ness. This is tough going – a solid reading. ISBN: 9780192802514

Reviews
A Private Universe
online resources
By Dr Matthew H Schneps and Dr Philip M Sadler

Reviewed by Erik Stengler, Spain
A Private Universe depicts a very

familiar situation for teachers
worldwide, namely that students do
often the case in countries where pri-
mary-school teachers are not taught
any content related to the topics they
not let go of their misconceptions as will be teaching at school. Instead, the
easily as might be expected after a focus lies on educational issues,
detailed and thorough learning assuming the candidates still know
Human Evolution: A Very Short process. the topics they will teach well enough
Introduction This series started with an award- from their own days at school. The
Publisher: Oxford University Press winning short documentary feature in reality is quite different, as is clearly
Publication year: 2005 1987. Even 23 years after its produc- seen in the first minutes of A Private
ISBN: 9780192803603 tion, a collaboration between the Universe.
The History of Life: A Very Short Harvard-Smithsonian Center for But A Private Universe does not stop
Introduction Astrophysicsw1 and Annenberg at detecting the problem. In order to
Publisher: Oxford University Press Mediaw2 (then Annenberg / CPB), it diagnose its scope and possible caus-
Publication year: 2008 has not lost its relevance. This first es, the documentary closely follows
ISBN: 9780199226320 part focuses on the astronomical topic the learning process of a particular
of the seasons, particularly on the fact high-school student, considered to be
Resources that despite years of education in one of the brightest of her class. Her
For a review of two other Very physical sciences and astronomy, even teacher makes quite an effort to
Short Introductions, see: Harvard graduates still think that it is explain how Earth orbits around the
hotter in summer because the Sun is Sun, and how the seasons are pro-
Demoncheaux E (2007) Review of
nearer to the Earth than in winter. The duced by a combination of this and
Fossils: A Very Short Introduction
film also mentions another aspect in the 23.5˚ tilt of Earth’s axis of rotation.
and Dinosaurs: A Very Short
which misconceptions prevail over Viewers will be as surprised as the
Introduction. Science in School 6: 85.
formal teaching: the phases of the teacher herself when the student, after
moon, which are often wrongly having shown clear signs of under-
issue6/fossils
explained in terms of obscuration by standing, still tries to save and
To browse all the other reviews clouds, rather than by the relative include her previous misconceptions
of resources published in Science positions of the Sun, Moon and Earth. into her new and even elaborate view
in School, see: This situation is indeed quite wide- on the matter.
www.scienceinschool.org/reviews spread, and it is not uncommon to Particular misconceptions can be
hear complaints by teachers and pro- traced back to confusing or ambigu-
fessors about it. It becomes even more ous graphics in a school book, but to
alarming when it is the teachers lay the blame solely on these accesso-
themselves who pass on these mis- ry aspects would be to completely
conceptions to their students. This is miss the point, and is definitely not

sufficient to explain the widespread These resources are an invaluable Resources

endurance of these misconceptions tool not only for primary- and sec- To browse all the other reviews of
throughout the educational system. ondary-school teachers of science or resources published in Science in
A Private Universe does not come up mathematics, but also for anyone School, see:
with a magical solution. It is however involved in teacher preparation. www.scienceinschool.org/reviews
a valuable resource to help teachers
become aware of the power of the Web references
misconceptions that students bring w1 – Find out more about the
with them into the classroom. The Harvard-Smithsonian Center for
documentary can be watched freely Astrophysics here:
onlinew3 and is the start of a series of www.cfa.harvard.edu
videos and resources produced by
w2 – Learn more about Annenberg
this collaboration, which can all be
Media and browse the resources
accessed freely online. DVDs and
and workshops they offer to
VHS cassettes of the videos are also
teachers here: www.learner.org
available for purchase, but only with-
in the USA. w3 – To watch A Private Universe
The follow-up series, entitled Minds online, see:
Of Our Ownw4, explores further mis- www.learner.org/resources/
conceptions and strategies to avoid series28.html
them. In the A Private Universe w4 – To watch Minds of Our Own
teacher’s labw5, a web resource built online, see:
around the misconceptions on astron- www.learner.org/resources/
omy facts that are highlighted in the series26.html
first documentary, you can test your w5 – Access the A Private Universe
own knowledge and misconceptions, online teacher’s lab here:
comparing them with the most popu- www.learner.org/teacherslab/pup
lar answers given so far, or print out a w6 – To watch the A Private Universe
survey for your students. It contains a project in science workshop videos,
discussion forum on how misconcep- see: www.learner.org/resources/
tions arise, and a small collection of series29.html
teaching activities to avoid the most
w7 – The support materials to the A
misconceptions about the Sun, Moon
Private Universe project in science can
and Earth.
be found here:
The A Private Universe project in sci-
www.learner.org/catalog/extras/
encew6 is a collection of nine workshop
puptwsup.html
videos, of 90 minutes each, focusing
on one theme and content area of sci- w8 – To watch the A Private Universe
ence – from biology, chemistry or project in mathematics videos, see:
physics – and using specific examples www.learner.org/resources/
to show how students’ preconceived series120.html
ideas can create critical barriers to w9 – The Patterns in Mathematics
learning. Education experts also teacher’s lab can be found here:
review classroom strategies and www.learner.org/teacherslab/
results and recommend new ways to math/patterns
involve students and approach diffi-
cult topics. Short summaries are avail-
able online as support materialsw7.
A similar workshop series (A Private
Universe project in mathematics)w8 with
an accompanying online teacher’s
labw9 is available for mathematics.

Educational resources
for the International
Year of Biodiversity
The United Nations has declared
2010 the International Year of
Biodiversity (IYB). Ivo Grigorov,
Lise Cronne and Giulia Realdon
provide a collection of web
resources for teachers and students
on the occasion.
Images courtesy of Alejandro Morellón
T he aim of the IYB is to raise awareness of the acceler-

ated rate of species extinction, caused primarily by
human impact on our environment. The resources below
offer teachers and students participation in long-term proj-
ects, background reading, a wealth of suggested teaching
activities, multimedia galleries and much more, aiming to
put biodiversity in the context of earth sciences as well as
climate change and human impact.
The list is far from exhaustive, so if you have come
across other structured and engaging resources that Teacher resources
have captured your students’ attention and that help
Teaching Issues and Experiments in Ecology
put biodiversity into context, please add your comments
on our websitew1. In this open-access, peer-reviewed journal, university
Unless stated otherwise, all resources are in English. professors provide and report on the efficacy of a variety
of ecological educational activities for undergraduates.
The official IYB website Some of the information may be useful for secondary-
The official website of the IYB, run by the United school teachers, too. The ‘Teaching resources’ section offers
Nations Environment Programme, provides a variety of general information on teaching ecology and getting the
multimedia resources and external links covering biodi- most out of the journal:
versity basics, news and initiatives: www.unep.org/iyb http://tiee.ecoed.net/teach/teach.html

Nature collection of biodiversity articles Classroom resources

In honour of the IYB, the research journal Nature offers
a collection of previously published articles addressing ARKive
the ecological and economic importance of biodiversity. ARKive gathers films and photographs of organisms
The articles, some of which are freely available, vary in from around the world, focusing on endangered species
their technicality; teachers or particularly interested stu- and ecosystems. The ‘Learning resources’ section pro-
dents wishing to deepen their understanding of the sub- vides teachers with ready-made PowerPoint® presenta-
ject would benefit most from the materials: tions, handouts and links to relevant ARKive images for
www.nature.com/nature/supplements/ the primary- and secondary-school classroom activities
collections/biodiversity built around Darwin’s voyage on HMS Beagle and his the-
ory of evolution: www.arkive.org/education/resources
Science literacy guides
Funded by the US National Science Foundation, the Breathing Places
National Marine Educators Association and the National Aimed at schools and communities supporting younger
Oceanic and Atmospheric Administration, these literacy students, the BBC’s Breathing Places project encourages
guides are developed by scientists for non-experts and biodiversity awareness and education by suggesting a
educators (primary and secondary school). The guides
variety of low-cost outdoor activities to help wildlife.
are constructed around the current science syllabus and
Multimedia guides can be downloaded for free, and a
extensively address the relationships between biodiversi-
small selection of specific classroom resources are offered.
ty, the geosphere, the hydrosphere, climate change and
The website is available in English and Welsh:
human impact.
www.bbc.co.uk/breathingplaces/schools
Earth science literacy: www.earthscienceliteracy.org
Climate literacy: www.climateliteracynow.org KeyToNature
Ocean literacy: http://oceanliteracy.wp.coexploration.org KeyToNature supports biodiversity education by pro-
Image courtesy of Alejandro Morellón viding European schools and universities with interactive
software and online tools for identification of organisms.
Project partners from 11 countries (Austria, Belgium,
Bulgaria, Estonia, Germany, Italy, Netherlands, Romania,
Slovenia, Spain, UK) offer materials in 10 languages for a
variety of platforms, including Apple®, Windows® and
mobile phone, but some require the user to register with
the website and / or purchase online access, CD-ROMs
or DVDs: www.keytonature.eu/wiki
The BEAGLE project

Students in a class that has registered with the free,
online EU-funded BEAGLE project choose a tree in their
area and monitor it for a year, contributing to research
while learning about biodiversity. Seven hundred and
sixty classes from more than 370 schools in 14 European
countries are registered on the website, where they enter
data, submit photos and compare their results. The web-
site is available in English, German, Hungarian,
Norwegian, Polish and Slovene: www.beagleproject.org
Norwegian Environmental Education Network

This website hosts several projects (like the BEAGLE
project described above) to which students can contribute
local data while learning about sustainable development.
More than 2500 participants from 85 countries are already
registered. It is available in English and Norwegian:
http://sustain.no

Image courtesy of microgen / iStockphoto

Young Reporters for the Environment
Young Reporters for the Environment is an interna-
tional platform for secondary-school students to research
and report on local environmental issues, encouraging
them to connect with the public and other young envi-
ronmental journalists. To celebrate the IYB, they are put-
ting a particular emphasis on the topic:
www.youngreporters.org
Resources for both teachers and students

Virtual expeditions with the Chicago Field
Museum
Anyone can follow scientists from the Chicago Field
Museum of Natural History, USA, on their current and
past expeditions around the world through video
reports, interactive online activities, photos, live web-
casts and an email list to receive updates directly from
the researchers. The expeditions focus on ecology, con-
servation and archaeology:
www.fieldmuseum.org/expeditions
Tree of Life web project

This collaborative project between experts and enthusi-
asts seeks to create a complete database of all living
organisms, with articles and activities focusing on evolu-
tion and biodiversity. Resources for teachers wishing to
incorporate ToL activities in the classroom can be found
in the ‘Learning’ section, and they and their students are
invited to contribute: www.tolweb.org/tree
Encyclopedia of life
Similar to the Tree of Life web project (with which it
has a partnership), EoL aims to create a webpage for
each of the 1.9 million species currently thought to exist.
EoL provides resources for classroom activities and
invites teachers to encourage their students to contribute
to the Encyclopedia’s vast organism inventory. The web-
site is available in English, French, German, Russian,
Spanish and Ukrainian: www.eol.org. The ‘Learning and
education’ pages can be found at:
http://education.eol.org
The International Union for Conservation of Nature

IUCN considers conservation of biodiversity to be fun-
damental in addressing global issues that, ultimately,
affect human wellbeing. The biodiversity section of
IUCN’s website does not provide specific educational
resources, but is a thorough source of information on
why biodiversity matters and what kinds of projects
have been undertaken to preserve it. It is available in
English, French and Spanish:
www.iucn.org/what/tpas/biodiversity

The Complete Work of C Darwin Online Web reference

The title is self-explanatory; this website freely pro- w1 - To add your own suggestions for further biodiversi-
vides tens of thousands of pages of searchable text and ty-related resources, use the comment function at the
images, including Darwin’s original handwritten manu- bottom of this article's HTML version. See:
scripts, notes and data. The texts are available in 12 lan- www.scienceinschool.org/2010/issue17/web
guages (use the search functions for manuscripts and
publications to find them), and some are available in Further resources
downloadable audio format (English only): If you found this article helpful, you may like to read
www.darwin-online.org.uk the other ‘Resources on the web’ articles published in
Science in School. See: www.scienceinschool.org/web
Smithsonian National Museum of Natural History
The ‘Education’ section of this museum, based in
Washington DC, USA, provides lesson plans and web- Ivo Grigorov is an oceanographer who manages EU
based activities on several topics related to the museum’s research programmes for CNRS, France. He has partici-
exhibitions, many of which do not require visits to the pated in numerous marine science outreach activities
institution. Topics include biodiversity, anthropology and (www.eur-oceans.info) and is the author of a Bulgarian
ecology, though most activities focus on North American blog on popular science (www.sinia-planeta.com).
ecosystems: www.mnh.si.edu Lise Cronne is a geographer working as an outreach
officer for the EU research programmes EuroSITES
Marine Bio Conservation Society (www.eurosites.info) and SESAME (www.sesame-ip.eu)
The Marine Bio Conservation Society from California, on global climate change and the marine environment.
USA, provides an extensive multimedia collection featur- For the past three years, she has also organised the
ing ocean biodiversity. Forums and educational resources ‘Researchers’ night’ events in Brest, France, funded by
invite students to interact with scientists and conserva- the European Commission.
tion organisations, to volunteer, or even to pursue Giulia Realdon has been a secondary-school teacher of
degrees and careers in marine science: biology, chemistry and earth sciences for 34 years. She
http://marinebio.org holds a degree in biology and a master’s in science
communication from Padua University, Italy. She is also
OceanLink – All about the ocean
a teacher trainer and the author of science teaching
Like the Marine Bio Conservation Site, the Canadian
materials.
OceanLink website provides a wealth of information on
ocean life. However, OceanLink also features a ‘For
Images courtesy of JoeGough / iStockphoto
teachers’ page that links to free, comprehensive PDF

guides on classroom activities exploring many aspects of
marine science: www.oceanlink.info

How many schools Winter 2010 Issue 17
and teachers
do you reach –
worldwide? In this issue:
The science of
humour: Allan Reiss
Also:
Stage lights:
physics
and drama
Advertising in Science in School

· Choose between advertising in the quarterly print journal or on our website.
· Website: reach 30 000 science educators worldwide – every month.
· In print: target up to 15 000 European science educators every quarter, including
3000 named subscribers.
· Distribute your flyers, brochures, CD-ROMs or other materials either to 3000 named
subscribers or to all recipients of the print copies.
For more details, see www.scienceinschool.org/advertising
Published by
EIROforum:
Initially supported by ISSN: 1818-0353

the European Union:
Subscribe (free in Europe): www.scienceinschool.org Highlighting the best in science teaching and research

Revista

Încărcat de

Informații document

Drepturi de autor

Formate disponibile

Partajați acest document

Partajați sau inserați document

Opțiuni de partajare

Vi se pare util acest document?

Este necorespunzător acest conținut?

Drepturi de autor:

Formate disponibile

Revista

Încărcat de

Drepturi de autor:

Formate disponibile

titel_SiS_Issue17_RZ:scienceinschool 23.11.

2010 14:38 Uhr Seite 1

How many schools Winter 2010 Issue 17

Advertising in Science in School

For more details, see www.scienceinschool.org/advertising

Initially supported by ISSN: 1818-0353

About Science in School

D o men and women share the same sense of humour?

Editor of Science in School · Quarter page: € 560

Projects in science education

54 and the History of Life

Resources on the web

Forthcoming events for schools: www.scienceinschool.org/events

Teachers presenting their Can physics be experienced The project ‘Radioactivity –

after the nuclear bomb fell

2 Science in School Issue 17 : Winter 2010 www.scienceinschool.org

characteristics of soap bubbles. ing ideas and inspirationw4. How to

Web references zoology at the University of Oxford,

4 Science in School Issue 17 : Winter 2010 www.scienceinschool.org

Teachers fly high at the

I n June 2010, I was delighted to be

www.scienceinschool.org Science in School Issue 17 : Winter 2010 5

The feedback we continue to receive from our work-

Image courtesy of Carmen Guerra

Later that afternoon, a panel led an

6 Science in School Issue 17 : Winter 2010 www.scienceinschool.org

References space. To order a free DVD or Warmbein B (2007) Down to Earth:

www.scienceinschool.org Science in School Issue 17 : Winter 2010 7

Image courtesy of lisegagne / iStockphoto

What happens inside your brain

between a hilarious cartoon and a

humour: Allan Reiss wanted to see not only how the

I magine suddenly losing all volun-

8 Science in School Issue 17 : Winter 2010 www.scienceinschool.org

already been shown that, for certain

faces, cocaine-induced euphoria and –– Funny cartoon –– Unfunny cartoon

other ‘positive’ stimuli. “The male

Do men and women

Who would have thought

www.scienceinschool.org Science in School Issue 17 : Winter 2010 9

10 Science in School Issue 17 : Winter 2010 www.scienceinschool.org

Human evolution: testing

Images courtesy of Henrik5000/ iStockphoto

Biology variation in the human population or as a starting

Ages 16+ The students could discuss evolutionary advantage,

www.scienceinschool.org Science in School Issue 17 : Winter 2010 11

T he DNA of every organism holds

Figure 1: The distribution

Derived variant (cytosine)

12 Science in School Issue 17 : Winter 2010 www.scienceinschool.org

Image courtesy of Jarek Bryk

Figure 2: Panels A1, A2 and B1-B3 each illustrate

www.scienceinschool.org Science in School Issue 17 : Winter 2010 13

Image courtesy of Nicola Graf

14 Science in School Issue 17 : Winter 2010 www.scienceinschool.org

Image courtesy of Jarek Bryk

ments, and we can only speculate

www.scienceinschool.org Science in School Issue 17 : Winter 2010 15

selection in the human lineage. This paper contains discussion Resources

16 Science in School Issue 17 : Winter 2010 www.scienceinschool.org

One of nature’s strange

The article could also

article may demonstrate to

www.scienceinschool.org Science in School Issue 17 : Winter 2010 17