Developmental and Pathological Roles

of BMP/Follistatin-like 1 in the Lung

 
PhD thesis

to obtain the degree of PhD at the

University of Groningen
on the authority of the
Rector Magnificus Prof. E. Sterken
and in accordance with
the decision by the College of Deans.

This thesis will be defended in public on 

Friday 6 October 2017 at 12.45 hours

by

Navessa Padma Tania

born on 12 April 1986
in Bandung, Indonesia
Supervisors
Prof. R. Gosens 
Prof. M. Schmidt 

Co-supervisor
Dr. H. Maarsingh

Assessment Committee
De rol van BMP/Follistatin-like 1 in
Prof. G. Folkerts  de ontwikkeling en de pathologie van de long
Prof. C. Bingle 
Prof. F.A.E. Kruyt

 
Proefschrift 

ter verkrijging van de graad van doctor aan de

Rijksuniversiteit Groningen
op gezag van de
rector magnificus prof. dr. E. Sterken
en volgensbesluit van het College voor Promoties.

De openbare verdediging zal plaatsvinden op 

vrijdag 6 oktober 2017 om 12.45 uur

door

Navessa Padma Tania

geboren op 12 april 1986
te Bandung, Indonesië
Paranymphs:
Christel Seegers
Thea van den Bosch

The research described in this thesis was carried out at the Department
of Molecular Pharmacology (Groningen Research Institute of Pharmacy,
University of Groningen, The Netherlands) according to the requirements
of the Graduate School of Science (Faculty of Science and Engineering,
University of Groningen, The Netherlands).

The research was financially supported by the Lung Foundation Netherlands

(grant 3.2.12.083).

Printing of this thesis was financially supported by the University Library of

the University of Groningen, the Graduate School of Science, and the Lung
Foundation Netherlands.

Cover story: COPD lung vs. developing lung– Putri Astri Wulandari
Printing: Ipskamp Printing B.V., Enschede, the Netherlands

ISBN (printed version): 978-94-034-0016-7

ISBN (electronic version): 978-94-034-0015-0

Copyright © 2017 by Navessa Padma Tania. All rights reserved. No parts of

Science knows no country, because knowledge belongs to humanity,
this thesis may be reproduced or transmitted in any form or by any means
and is the torch which illuminates the world – Louis Pasteur
without the prior permission from the author.
DEVELOPMENTAL AND PATHOLOGICAL ROLES OF BMP/FOLLISTATIN-LIKE 1

IN THE LUNG

Chapter 1. General Introduction.

Chapter 2. Endothelial follistatin-like-1 regulates the postnatal development of

the pulmonary vasculature by modulating BMP/Smad signaling.

Pulm Circ. 2017; 7(1):219-231

Chapter 3. The effect of cigarette smoking on pulmonary Follistatin-like 1 expres-

sion: potential implication in chronic obstructive pulmonary disease

Chapter 4. Activin-A: active in inflammation in COPD.

EurRespir J. 2014; 43: 954–955

Chapter 5. Pro-inflammatory roles of Follistatin-like 1 in coordinating epitheli-

al-mesenchymal communication in inflammatory cytokine release in
the lung

Submitted

Chapter 6. Regulation of pulmonary inflammation by mesenchymal cells.

Pulm.Pharmacol.Ther. 2014; 1-10

Chapter 7. Variant club cell differentiation is driven by bone morphogenetic pro-

tein 4 in adult human airway epithelium: Implications for goblet cell
metaplasia and basal cell hyperplasia in COPD.

Chapter 8. General discussion and summary.

Chapter 9. Dutch summary/Nederlandse samenvatting

Chapter 10. Indonesian summary/Rangkuman dalam bahasa Indonesia

Acknowledgement

Biography and list of publications

1
 CHAPTER 1 1

GENERAL
INTRODUCTION

3
Preface
The primary aim of this thesis is to explore the functional roles of an endogenous
bone morphogenetic protein (BMP) antagonist, Follistatin-like 1 (Fstl1), in lung
development and in the pathological processes of chronic obstructive pulmonary
disease (COPD). BMP signaling plays active roles in lung development as evident in
embryonic and perinatal lethality and lung developmental defect of BMP-deficient
mice.1 It is now apparent that BMP signaling also plays crucial regulatory roles in
adult lung homeostasis by modulating inflammation and repair in the lung.2,3
However, the involvement of BMP signaling has not been previously explored in the
pathophysiology of COPD. We hypothesized that the imbalance between BMP and
its antagonist Fstl1 contributes to dysregulation of early postnatal lung development,
airway inflammation, and adult airway epithelial cell differentiation similar to that
observed in COPD. This thesis sheds light on Fstl1 as a novel mediator of airway
epithelial-driven inflammation in the lung and potentially of goblet cell metaplasia
and the loss of club cells in COPD epithelium. Therefore, targeting Fstl1 is worth
pursuing for the treatment of airway inflammation and epithelial remodeling in
COPD.The first part of this chapter provides an overview of COPD pathophysiology,
including chronic airway inflammation, airway epithelial remodeling, vascular
remodeling, and currently available treatment. The second part of this chapter
covers the current understanding of BMP pathway in lung development and chronic
respiratory diseases. The third part of this chapter focuses on the latest discoveries
on developmental and pathological roles of Fstl1. Finally, the scope of this thesis and
the specific aims of our studies are described in the last part of this chapter.
1. Chronic Obstructive Pulmonary Disease (COPD)
The Global Initiative for Chronic Obstructive Lung Diseases (GOLD) guidelines
stated COPD as “a common preventable and treatable disease, characterized by
persistent airflow limitation that is usually progressive and associated with an
enhanced chronic inflammatory response in the airways and the lung to noxious
particles or gases. Exacerbations and comorbidities contribute to the overall severity
in individual patients’’.4 According to the World Health Organization, COPD will be
the third major cause of death worldwide by 2020, surpassing stroke.5 Cigarette
smoking accounts for 85-90% of COPD cases and is the best-known etiological
factor for the development of COPD. However, 10-15% of COPD patients are never
smokers and only about 15-20% of smokers manifest COPD,6 suggesting a role for
environmental factors and susceptibility-associated (epi)genetic make-up. This
has led to the concept that impaired inflammatory responses to cigarettes smoke-
induced injury manifest to COPD in susceptible persons.7 Accumulating evidence
from genome-wide (epi)genetic association studies discovered several loci that are
strongly associated with COPD susceptibility.8–12 The major loci that associated with
COPD susceptibility include HHIP (hedgehog interacting protein) and FAM13A (family
with sequence similarity 13 member A) on chromosome 4 as well as CHRNA3/5
(cholinergic nicotinic acetylcholine receptor) on chromosome 15.8,9,13,14 The common
4 5
symptoms of COPD include breathlessness, chronic and progressive dyspnea, chronic
cough, and excessive sputum production.4 The episodes of acute worsening of COPD
symptoms, the-so-called exacerbations, aggravate primarily in patients with severe 1
disease, and approximately 78% is linked with respiratory infections.4 The molecular
and cellular mechanisms underlying the symptoms and pathobiology of COPD are
not completely understood. The current understanding from histopathology and
current available treatment of COPD is summarized below.
1.1. The pathology of COPD
The pathology of COPD displays highly heterogeneous phenotypes involving
abnormal airway wall architectures, peribronchial fibrosis, destruction of alveolar
septa (emphysema), and altered airway epithelial composition, including goblet cell
metaplasia and loss of club cells.15,16 Major remodeling throughout the respiratory
tracts (including proximal, distal and peripheral airways, lung parenchyma and
pulmonary vasculature) and changes in the cellular differentiation profile of the
airway epithelium collectively manifest in a progressive decline of lung function.17 The
staging of COPD that reflects disease severity is typically determined by spirometry.4
A new hypothesis addresses the potential involvement of developmental pathways
in COPD based on accumulating data from genome-wide association studies and
microarray profiling, indicating dysregulation of developmental factors originally
known for their roles in embryonic development.18 BMP signaling is pivotal during
lung development, nevertheless, it has been largely unexplored in adult lung as
well as the pathogenesis of COPD. BMP signaling is found decreased in the lung of
pulmonary fibrosis patients and following bleomycin injury in mice.19,20 Accordingly,
accumulating evidence indicates a marked increase of the endogenous BMP
antagonist Fstl1 in the lung of patients suffer from respiratory diseases.21–25 This
thus raises the possibility that an imbalance between BMP and its endogenous
antagonists may lead to airway inflammation and airway epithelial remodeling in
COPD.
1.2. Persistent inflammation of the airways in COPD
Chronic airway inflammation is the primary pathophysiological feature of COPD and
is believed to be the major contributor of structural changes in COPD airways.17 The
number of neutrophils and macrophages is positively correlated with COPD severity.26
Airway inflammation in COPD is associated with infiltration of various innate and
adaptive immune cells with prolonged retention time in the respiratory tracts,
primarily in peripheral airways (bronchioles), lung parenchyma, and pulmonary
arteries.27,28 Previously, infiltrating leukocytes were considered to be the key player
of airway inflammation and the major factor in COPD development. However, latest
discoveries show that the structural cells, such as bronchial epithelial cells, lung
fibroblasts, and airway smooth muscle cells also express and secrete molecules that
regulates innate airway inflammation and defense mechanisms.29–31
 As a part of the normal repair mechanism to injury, airway epithelium of Disruption of epithelial-driven innate immune functions is also strongly affected
healthy individuals mediate the activation of innate immune responses via pattern by impaired airway epithelial structure and composition following epithelial injury
recognition receptors (PRRs) to release “danger signals” which subsequently activate which will be described on the next section. Persistent airway inflammation leading 1
Toll-like receptor (TLRs).32 Activation of TLR receptor promotes release of cytokines to recruitment and activation of neutrophils and macrophages in COPD is illustrated
to recruit inflammatory cells to the site of injured epithelium in the lung. Resolution in Figure 1.
of inflammation is responsible for switching “off” the inflammatory response when
the toxic insults are successfully cleared out. However, chronic exposure to inhaled goblet cells ciliated cells club cells

toxic compounds, such as cigarette smoke, activates airway epithelial cells to secrete
a myriad of pro-inflammatory cytokines and chemokines, including interleukin-6 (IL-
6), CXC-chemokine ligand 1 (CXCL1), CXCL8, CC-chemokine ligand 2 (CCL2), C-X-C- Healthy epithelium
basal cells
Motif ligand 8, IL-1β, tumor necrosis factor (TNF)-α and granulocyte macrophage
colony-stimulating factor (GM-CSF).33–35 Airway inflammation in COPD is associated
with persistent and exaggerated innate and adaptive inflammatory responses
involving recruitment of CD8+ T-helper-1 (Th1) cells, neutrophils, monocytes, and
lymphocytes. Inflammatory mediators released by bronchial epithelial cells following
? Chapter 7
cigarette smoke-induced injury have a paracrine effect on neighboring mesenchymal BMP4

cells, such as lung fibroblasts and airway smooth muscle cells.30,36 Several studies goblet cell metaplasia loss of club cells

have shown that these mesenchymal cells are more than just structural cells as they
express and release inflammatory mediators, like IL-6, IL-8, TNF-α, which contribute
to the neutrophil and monocyte infiltration to the lung.30,31 COPD epithelium
The number of inflammatory cells, such as macrophages, neutrophils and ? Chapter 3
CD8+ T cells, is increased in sputum and bronchoalveoalar lavage (BAL) of COPD Fstl1
patients.37,38 Neutrophil chemotactic proteins including leukotriene B4 (LTB4), IL- Chapter 5 ? ? Chapter 5
8, CXCL1 and CXCL8, GRO-a (growth-related oncogene-a), and ENA-78 (epithelial
neutrophil-activating protein of 78 kDa) are increased in the sputum and BAL fluid
of COPD patients.39–41 Macrophages also induce release of LTB4, IL-8, TNF-α, MCP-1, lung fibroblasts airway smooth muscle cells

and reactive oxygen species upon cigarette smoke-induced injury. These secreted
factors activate and recruit neutrophils to the lung, leading to increase secretion IL-6
IL-8
of proteases (neutrophil elastase, proteinase-3, matrix metalloproteinases (MMP)-
8, MMP-9, cathepsin G) which is associated with emphysema.42,43 In addition, GM- Recruitment and ac�va�on of innate immune cells

CSF and granulocyte colony-stimulating factor (G-CSF) promote neutrophil survival,

proliferation, and differentiation.44,45 The transcription factor nuclear factor-κB
(NF-κB) is known to be the central regulator of inflammatory protein expression.46
In addition, E-selectin which mediates neutrophil adhesion to endothelial cells is neutrophils macrophages

increased on endothelial cells of bronchial mucosa of COPD patients.47 Macrophages

secrete chemokines interferon-c inducible protein (IP-10), interferon-inducible
T-cell chemoattractant (I-TAC), and monokine-induced by interferon-c (Mig).48 The
increased numbers of macrophages in COPD patients can be a result of increased
recruitment of circulatory monocytes and/or increased cell proliferation and survival.
Collectively, accumulation of inflammatory cells in the lung aggravates a chronic
inflammatory state and results in airway structural changes, airway obstruction, and
respiratory symptoms observed in COPD.49,50
Figure 1. Persistent airway inflammation is a major hallmark of COPD pathogenesis. The
healthy epithelium lining of adult airways is composed of a mixture balance of goblet cells,
ciliated cells, basal cells and club cells. Cigarette smoke and inhaled toxic pollutants promotes
airway epithelial remodeling, including goblet cell metaplasia, mucus hypersecretion,
and loss of secretory club cells. In addition, cigarette smoke and inhaled toxic pollutants
induce release of inflammatory mediators from epithelial cells with autocrine and paracrine
effects on neighboring mesenchymal cells, such as fibroblasts and airway smooth muscle
cells. Pulmonary mesenchymal cells secrete IL-6 and IL-8 that contributes to an infiltration
of neutrophils and macrophages to the lungs. The abnormal accumulation of inflammatory
cells aggravates airway inflammation in the lungs and leads to the development of COPD. The
expression of Fstl1 in COPD compared to non-COPD lungs is investigated in Chapter 3. The
role of Fstl1 in inflammatory cytokine release from pulmonary mesenchymal cells is shown
in Chapter 5.The effect of BMP4 on adult airway epithelial cells is examined in Chapter 7.

6 7
1.3. Remodeling of airway epithelium in COPD
Airway epithelium acts as the first protective barrier between the external
environment and the internal lung tissue and the rest of the body. The healthy
epithelium lining of adult large cartilaginous airways is made up of a layer of basal
cells that are attached to the basal lamina underneath a layer of airway lumen
columnar cells with a balanced mixture of goblet cells, ciliated cells and club cells.
This epithelial structure is important for the mucociliary clearance function.16 In
trachea, up to 60% of the total cell number are ciliated cells and approximately 20%
are mucus secreting goblet cells.51,52 The number of ciliated cells falls to approximately
15% by the 5th airway generation. The distal airways predominantly consist of serous
and secretory club cells.29 In the proximal bronchioles, the epithelial cells become
more cuboidal and, in addition to ciliated cells, contain secretory club cells. Finally,
in the most distal bronchioles, only club cells are identified.53
The cellular composition and function of COPD airway epithelium was found to
be altered as evident by the loss of tight junctions, basal and goblet cell hyperplasia,
and loss of secretory club cells and ciliated cells, resulting in loss of its barrier
function and excessive mucus production.16,54 Cigarette smoke causes the goblet
cell hyperplasia and the loss of ciliated cells, resulting in a reduction of mucociliary
clearance and mucus plug formation. In COPD, increased numbers of goblet cells
are also found in the small bronchi and bronchioles, where there are normally very
few.55 The cellular events in epithelial repair after injury have been described.49,56,57
The airway epithelium is more than just a physical barrier as evidenced by the
fact that bronchial epithelial cell transcribe and secretes numerous soluble factors,
such as cytokines, chemokines and growth factors. Club cells are important in
controlling lung inflammation by secreting a number of anti-inflammatory agents,
such as secretoglobin (SCGB3A) and uroplakin (UPK3A).58 Surfactant proteins
(SP-A, SP-B, SP-D), also called collectins, are produced by club cells and alveolar
epithelial cells and play an important role in airway epithelial defense mechanism.
At the bronchiolar level, the club cell secretory protein (CCSP), also called CC10, is
able to modulate lung inflammatory and immune responses. However, club cells
are reduced in bronchial biopsies from COPD patients59,60 and in peripheral and
central airways in lung tissue of COPD patients,61 which could contribute to the
aggravated inflammatory process. The air-liquid culture provides a valuable system
to mimic a well differentiated epithelial cells in vitro and permits the study of the re-
epithelialization after injury.62,63 Therefore, this is an excellent tool to study epithelial
cell differentiation under various condition. However, there are limited studies
addressing the functional roles of BMP signaling in the adult lung epithelial cells
which may enlighten the consequence of aberrant BMP signaling in the context of
COPD.
1.4. Remodeling of extracellular matrix in COPD
In healthy lung, non-cartilaginous small airways (<2 mm) contribute to only ~25%
to the total airway resistance, whereas in COPD lungs, it becomes the major site
of increased airway resistance as a result of increased deposition of extracellular
8 9
matrix, thickening of airway smooth muscle and narrowed airway lumen.64–66 In
COPD, infiltrating inflammatory cells release inflammatory mediators that promote
production of extracellular matrix from pulmonary mesenchymal cells which 1
contribute to tissue remodeling and respiratory dysfunction.30 Multiple studies have
reported increased extracellular matrix protein expression, such as fibronectin,
collagen I, hyaluronan, and laminin in COPD airway and lung parenchyme.67–70 Airway
smooth muscle cell hyperplasia and hypertrophy cause thickening of smooth muscle
bundles surrounding COPD airways, whereas airway fibroblasts contribute to sub-
epithelial fibrosis in the airway wall. The primary roles of pulmonary fibroblasts are
tissue repair and remodeling by producing diverse extracellular matrix proteins, such
as fibronectin, collagen, and airway smooth muscle actin, whereas airway smooth
muscle cells are mainly responsible for airway contraction. Transforming growth
factor (TGF)-β1 produced by epithelial cells in the small airways is a key player in
tissue remodeling and is found to be markedly increased in COPD. It is associated
with increased deposition of extracellular matrix within and surrounding the smooth
muscle bundles of COPD, which results in thickened airway walls and increased in
stiffness.71 An imbalance between the production and degradation of extracellular
matrix could possibly explain excessive matrix deposition and may lead to airway
fibrosis in COPD in addition to proliferating airway smooth muscle cells induced by
cigarette smoking.72 In COPD, the number of myofibroblasts (airway fibroblasts with
a more contractile phenotype) is increased and contributes to reduction of airway
elasticity.73 Fibroblasts from individuals with COPD have reduced capacity for tissue
repair due to increased prostaglandin E (PGE) and TGF-β1 expression.74 The thickness
of small airway wall is associated with COPD severity. The obstructed small airways
are characterized by abnormal architecture of epithelium and smooth muscle layers
and the presence of fibrosis.65,75
1.5. Remodeling of the pulmonary vasculature in COPD
Patients with COPD also frequently suffer from pulmonary arterial hypertension
(PAH), one of the common comorbidities of COPD. PAH is characterized by
increased arterial pressure in the lungs as a result of narrowing of vessel lumen
due to vascular remodeling and increased vasoconstriction.76,77 Endothelial cells are
important for vascular homeostasis by maintaining vascular tone and remodeling.78
Cigarette smoking disrupts endothelial functions of pulmonary arteries in COPD.79,80
Endothelial cells are key players in regulation of cell and vessel growth, thus it is
believed that endothelial dysfunction initiates vascular remodeling in COPD.
Endothelial dysfunction leads to uncontrolled intimal endothelial cell proliferation
consequently resulting in thickened pulmonary muscular arteries observed in
smokers and patients with mild COPD.79,80 Inflamed lung tissue is hypoxic and
promotes angiogenesis by increasing growth factors such as vascular endothelial
growth factor (VEGF), fibroblast growth factor (FGF), and epidermal growth factor
(EGF).77,81 These growth factors are involved in tissue repair and vascular remodeling
which eventually contribute to microvascular remodeling observed in COPD. The
opposing effects of angiogenic and angiostatic factors such as chemokines (CXC
family) that induce or inhibit neovascularization, respectively, determines the
angiogenesis process.77,82 VEGF and its receptor seem to be important for endothelial
and epithelial cell survival following injury. Numerous studies showed increased
expression of VEGF and VEGF receptors (Flk-1 and Flt-1) in pulmonary muscular
arteries of patients with mild and moderate COPD and in current smokers without
airway obstruction.81,83–85 An increase of angiogenic factors are also associated with
thickening of the pulmonary arterial walls.76,81,83–85 However, VEGF expression is low
in total lung homogenates of severe emphysema patients.86 It has been proposed
that low VEGF may be involved in the emphysema process through cell apoptotic
mechanisms, as the lung microvascular endothelial cells and alveolar septal capillary
cells needs VEGF for cell survival.86,87 Endothelial cell death leads to loss of capillaries
may be a major mechanism of emphysema.86 Macrophages, CD8+ T lymphocytes,
neutrophils, fibroblasts that involves in immune response can promotes angiogenesis
in many ways by secreting TNF-α which also is an angiogenic factor. Additionally,
the protein expression of endothelin-1 (ET-1) and ET-1 receptor ETA that mediate
vascular smooth muscle conctration is increased in PAH.88,89
1.6. Current treatments
Currently, there is no effective cure for COPD. Inhaled corticosteroids (e.g.
fluticasone, budesonide), phosphodiesterase 4 inhibitors (roflumilast), short-
acting (e.g. albuterol) or long-acting b2-adrenoreceptor agonists (e.g. salmeterol,
formoterol), and long-acting anti-cholinergics (e.g. tiotropium, ipratropium,
glycopyrronium bromide, umeclidinium) are used alone or in combination to relieve
the symptoms and inflammation.90 However, these therapies do not change the
course of the disease.90 Therefore, understanding the molecular mechanism of COPD
is undoubtedly important to identify a novel molecular target that can decelerate
the progression of COPD. A better understanding of impaired repair process which
contributes to COPD may lead to the identification of new molecular targets and
more effective therapy options in COPD treatment.
2. Bone morphogenetic protein (BMP) signaling in the lung
In 1965, Marshall R. Urist discovered osteogenic factors present in bone matrix
extracts capable of promoting de novo cartilage formation and bone formation
in vivo, namely bone morphogenetic protein (BMP).91,92 BMP signaling belongs to
the TGF-β superfamily, which is phylogenetically conserved.91 Genetic studies in
mice demonstrate the importance of BMP signaling in embryonic dorsal-ventral
paterning93–95 and embryonic lung development.3,96,97 It is now evident that
BMPs govern diverse cellular effects including stem cell maintenance, migration,
differentiation, proliferation, and programmed cell death.98 A growing body of
evidence indicates the involvement of BMP signaling in normal lung physiology and
pathology conditions in adulthood, strongly suggesting that BMP signaling also plays
a pivotal role in adult lung homeostasis, including epithelial repair after injury.3
10
2.1. Players in BMP signaling
2.1.1. BMP ligands
BMPs (which are also referred to as growth and differentiation factors (GDFs)) 1
are secreted glycosylated proteins, with 20 different members identified and
characterized.98 BMP polypeptides consist of an N-terminal secretory signal peptide,
a prodomain that ensures proper folding, and a C-terminal mature peptide. Mature
BMPs are derived from cleavage of the BMP precursors by serine endoproteases in
the trans-Golgi network and subsequently secreted. Homo or heterodimerization
of BMP ligands forms an active BMP agonist. Secreted BMPs bind either to the
extracellular matrix, extracellular antagonists, co-receptors or to transmembrane
receptors. Activation of BMP signal transduction leads to either transcriptional
responses (e.g. Smad-dependent signaling) or non-transcriptional responses (e.g.
Smad-independent signaling, cytoskeletal rearrangements).98
2.1.2. BMP receptors and co-receptors
The BMP receptors are composed of two types of transmembrane serine/threonine
kinase receptors, type I and type II receptors, which are highly homologous but
not redundant, and are capable of activating both Smad-dependent and Smad-
independent signaling. The receptors encompass an extracellular ligand binding
domain and a cytoplasmic serine/threonine kinase domain. The type I receptor
has two additional motifs in its kinase domain, a glycine/serine-rich region prior
the GS-box kinase domain and a L45 loop composed of eight amino acids.99 Type
I receptors include activin receptor-like kinase 1 (ALK1), activin receptor type Ia
(ActRIa or ALK2), BMP receptor type Ia (BMPRIa or ALK3) and BMP receptor type
Ib (BMPRIb or ALK6). These receptors form heteromeric complexes with the type
II receptors, including BMP receptor type II (BMPRII) and activin receptors type IIA
(ACVRIIA also known as ActRIIA) and activin receptors type IIB (ACVRIIB also known
as ActRIIB).100 The specificity of BMP signaling is tightly controlled by selective
extracellular regulators, receptors, co-receptors, and cytosolic receptor-associated
proteins to exert specific BMP functions which will be described in more detail
below. Activation of BMP signaling is preceded by oligomerization of BMP ligands
and type I receptor kinase. Activated type I receptor undergo transphosphorylation
of its GS-box via constitutively active type II BMP kinase receptors.98,99 After the
formation of a heterotetrameric complex, the signal propagates to the nucleus either
in intracellular regulator Smad-dependent (canonical) or Smad-independent (non-
canonical) manner.98 Co-receptors that positively regulates BMP signaling are the
repulsive guidance molecules (RGM)-a and -c, Dragon (RGMb), the receptor tyrosine
kinase (RTK) c-Kit, and the TGF-β1/BMP type III receptors Endoglin and Betaglycan.
In contrast, BMP signaling is negatively regulated by the pseudoreceptor BMP and
activin membrane-bound protein (BAMBI) and the RTKs Ror2 and TrkC.98
11
2.1.3. Downstream BMP/Smad-dependent signaling contains a nine-membered cysteine ring and the DAN/Cerberus family contains an
In the canonical pathway, the transduction of extracellular signals to regulation of eight-membered cysteine ring.110 Molecular regulation of BMP signaling pathway is
gene transcription inside the nucleus is mediated by Smad proteins.99 There are illustrated in Figure 2. 1
three types of Smad proteins, BMP receptor-regulated Smads (R-Smads), common
mediator Smad (co-Smad), and inhibitory Smads (I-Smads). BMP ligands bind to the
type I BMP receptors resulting in phosphorylation of R-Smads (Smad1/5/8), followed BMP Extracellular regulators
by trimeric complex formation with co-Smad (Smad4), and translocation of the (e.g.: Fstl1)
Gremlin

complex into the nucleus,98,100,101 which subsequently induces transcription of BMP

downstream target genes,102 presumably in collaboration with other co-repressors
and co–activators.103 I-Smads (Smad6 and Smad7) negatively regulate BMP/Smad
type III/ co-receptor ALK1
signaling by preventing phosphorylation of R-Smads, instead targeting R-Smads (e.g.: Endoglin) BMPRII
ALK2
ACVRIIA
and type I receptor for ubiquitin–proteasome degradation. Two conserved domains ACVRIIB
type II type I ALK3
ALK6 Extracellular
of R-Smads are the N-terminal DNA and protein binding MH1 (mad homology 1)
domain and the C-terminal MH2 domain which are connected by a variable proline- Cytoplasm

rich linker region.104,105 P

P

2.1.4. Downstream BMP/Smad-independent signaling

Smad-dependent Smad-independent
In addition to canonical BMP signaling, BMP ligands activate gene transcription
in a Smad-independent manner. BMP ligands can activate the MAPK pathway by TAK1
recruitment of TAK1, TAB1, and XIAP to type I BMP receptors, which subsequently P
Smad1/5
phosphorylate p38 MAPK or JNK.106 Additionally, ERK mediates transcription of
Smad4 P
BMP2-regulated genes.107 BMP regulates sets of genes which are involved in lung and Smad1/5 MAPK

vascular homeostasis, including epithelial and vascular remodeling. BMP regulated Erk JNK p38
genes, including jagged1, GATA2, and endoglin, have been identified in endothelial
cells.102 BMPs can also activate TGF-β activated kinase 1 (TAK1) leading to p38/ Nucleus
JNK/Erk MAP kinase activation.108,109 TAK1 mediates phosphorylation of Smad1 at
C-terminal serine residues, suggesting it functions as an upstream activating kinase Smad1/5
P

for Smad1/5/8 in BMP signaling.109 ON

Smad4 P ON
Smad1/5

2.1.5. Fine tuning of BMP signaling BRE BRE

BMP functions are tightly modulated by BMP antagonists, co-receptors, and
intracellular regulatory proteins. BMP antagonists function through direct binding
with BMP ligands and prevent BMPs from binding to their transmembrane receptors.
Pseudo-receptors sequester BMP ligands at the cell surface. Co-receptors and
intracellular regulatory proteins interact with the receptors to regulate downstream
BMP functioning. The spatiotemporal interplay between BMP and its regulators
govern developmental and cellular processes. BMP antagonists are cysteine knot
containing motif which form a functional homodimer. BMP antagonists bind
selectively to distinct BMP ligands in a context- and concentration-dependent
manner to maintain BMP gradients, which have been extensively studied during
embryonic lung development. BMP antagonists include Noggin, gremlin, twisted
gastrulation (Tsg), and Fstl1. Antagonists are categorized based on their cysteine
knot motif: the Chordin/Noggin family contains a ten-membered cysteine ring, Tsg
Progenitor cell maintenance Proliferation
Differentiation
Figure 2. Molecular regulation of BMP signaling. Activation of BMP signaling is initiated by
binding of BMP ligands to the type I BMP receptors (ALK1, 2, 3, 6) followed by recruitment
of constitutively active type II BMP receptor receptors (BMPRII, ACVRIIA, ACVRIIB) to form
a signal-activating complex. In cytoplasm, the signal propagates either via Smad-dependent
or Smad-independent manner. In a Smad-dependent signaling, the transduction of BMP
signals is mediated by Smad1/5 proteins. Phosphorylated Smad1/5 proteins form a complex
with Smad4 protein which subsequently translocate to nucleus and bind to a 52 base-pair
BMP response element (BRE) on the promoter region of the target genes. In a non-Smad
signaling, BMP ligands can activate the MAPK pathway by recruitment of TAK1 to type I BMP
receptors, which subsequently phosphorylate Erk/JNK/p38. Thereby, phosphorylated Erk/
JNK/p38 can translocate into the nucleus. Among others, BMP functions are tightly regulated
by co-receptors (e.g. Endoglin) and extracellular regulators (e.g. Fstl1).

12 13
2.2. BMP signaling in lung development and adult lung homeostasis
Lung development is orchestrated by precise coordination of several molecular
pathways, including BMP signaling. The canonical BMP signaling is important in lung
development.3 Fundamental roles of BMP signaling in lung development are evident
from BMP mutations associated with congenital lung defects in human and genetic
studies in transgenic mice and familial mutation in PAH. Deletion of lung epithelial-
specific Smad1 resulted in impaired airway branching morphogenesis, decreased
sacculation, disruption of distal lung epithelial cell proliferation and differentiation
which contribute to severe postnatal respiratory distress. Wu et al. also revealed
that BMP4/Smad1 signaling modulates other molecular pathways including Wnt/β-
catenin by expressing Wnt inhibitory factor 1 (Wif1) in the developing fetal mouse
lung.111 Overexpression of BMP4 in the epithelium, on the other hand, leads to
smaller lungs and to a marked decrease in epithelial cell proliferation.97 In adults,
lung tissue homeostasis is required for continuous regeneration and subsequent
differentiation of stem cells in order to maintain lung architecture and proper
functions. BMP signaling maintains an undifferentiated state of the airway and
alveolar epithelial progenitors for lung epithelial homeostasis and tissue injury
repair.3
A tight and precise regulation of pulmonary vascular development is required
for normal lung development.112 Canonical BMP signaling plays key roles during
embryonic development of the pulmonary vasculature.3 Activation of BMPRII
promotes pulmonary artery endothelial cell (PAEC) survival, proliferation, and
migration. BMPRII is a novel mediator of endothelial nitric-oxide synthase
activation.113
2.3. BMP signaling in lung diseases
Dysregulation of BMP signaling has been implicated in several lung diseases. Although
in adult lung tissue, active canonical BMP signaling is hardly detectable.3 Reactivation
of canonical BMP signaling is observed after lung injury with naphthalene and
bleomycin in the same pattern as early lung development in bronchial and alveolar
epithelial cells, respectively, presumably as part of repair processes.3 In addition,
BMP ligands expression and BMP/Smad activity are upregulated inflamed bronchial
epithelium of allergic asthma.114,115 It has been demonstrated that activation of BMP
signaling induces expression of its own antagonist, implying a negative feedback
loop in the regulation of BMP signaling. The expression of the BMP4 antagonist
gremlin was found to be upregulated in patients with idiopathic pulmonary fibrosis
(IPH).116 Additionally, the expression of BAMBI is increased in plasma and lung of
COPD patients.117,118 The role of BMP in lung cancer is contradictive. In one hand,
BMP2 is increased along with activation of Smad1/5 and its downstream target Id1
and promote tumor growth in human lung cancer.119 On the other hand, low levels
of BMP7 in lung cancer tissues are correlated with lymph node metastasis. In vitro,
BMP7 negatively regulates cell adhesion and migration of a lung cancer cell line.120
14
2.4. BMP signaling in pulmonary vascular diseases
BMP signaling is important in embryonic vascular development and adult vascular
homeostasis. Consequently, dysregulation of BMP signaling has been strongly 1
associated with the pathogenesis of hereditary vascular diseases, including familial
PAH.121 BMP signaling regulates vascular smooth muscle maturation, endothelial
cell proliferation and angiogenesis.122 Endothelial cells are a major player in vascular
homeostasis. Endothelial dysfunction, including abnormal proliferation, impaired
endothelial mesenchymal communication, decreased endothelial nitric-oxide
synthase (eNOS) activity, and loss of bioactive nitric oxide (NO), play a prominent
role in the development of PAH.113,123 Accumulating studies from genetic association
study in hereditary vascular diseases and genetic studies in transgenic mice pinpoint
the mutation of BMP components to be strongly associated with PAH.124,125 Most
importantly, BMP2 and BMP4 failed to stimulate eNOS phosphorylation in PAECs
derived from patients carry mutations in the BMPRII gene.113 This is supported by
animal studies of lung endothelial-specific BMPR2 KO mice resulting in spontaneous
PAH.126 Interestingly, impaired BMP signaling was also observed in common forms
of PAH, including hypoxic PAH.127 Mechanistically, the negative regulator of vascular
smooth muscle cell proliferation and pro-apoptotic, BMP2 and its downstream non-
canonical BMP signaling are upregulated after acute hypoxia exposure. In contrast,
prolonged hypoxia exposure results in downregulation of BMPRII expression and
inactivation of its downstream signaling in pulmonary vasculature.127 In addition, the
expression of BMPRIb, BMPRII, and Smad4, 5, 6, and 8 was decreased in accordance
with reduced levels of active Smad1 and Smad-regulated genes id1 and id3 in
lungs of monocrotaline model of PAH.128 Furthermore, the expression of the BMP
antagonist gremlin 1 is increased in small pulmonary vessel walls of hypoxic PAH
mouse models.129 Taken together, these studies demonstrate a central role for BMP
and its inhibitors in pulmonary vascular remodeling and the pulmonary vascular
resistance in hypoxic PAH.129
3. Follistatin-like 1
During lung development and adult homeostasis processes, the functions of
BMPs are tightly controlled for proper morphogenesis. Although the expression
of BMPs and their receptors is not strictly limited to certain areas, the expression
of BMP antagonists is spatiotemporally tightly controlled, indicating that BMP
antagonists fine tune the level of BMP functioning and act as molecular switches
of BMP signaling.1 The endogenous antagonist of BMP, Fstl1 (also known as TGF-β-
stimulated clone 36 (TSC-36)), was originally identified as a TGF-β inducible gene in
a mouse osteoblastic cell line with two isoforms.130,131Fstl1 is a secreted cysteine-rich
glycosylated protein of 38 kDa containing an follistatin (FS)-like domain containing
10 conserved cysteine residues and a strong similiarity with BM-40/osteonectin/
SPARC family.130 Human Fstl1 is highly conserved with >92% amino acid sequence
identity with rat and mouse.132 The Fstl1 orthologues have been identified and
sequenced from human, rat, mouse, avian, xenopus, macaques, and fish.132–136 The
15
crystal structure of a truncated form of recombinant Fstl1 containing follistatin-like
domain has been resolved.137 Fstl1 is composed of three distinct domains, including
follistatin N-terminal domain-like (FOLN), extracellular calcium (EC)-binding domain
containing two EF-hand motifs, and a von Willebrand factor type C domain (VWC)
with cell type specific glycosylation. However, unlike other family members, the
calcium-binding domains of Fstl1 are non-functional.131
3.1. Cellular expression of Fstl1
During embryonic development, Fstl1 mRNA is detected in different organs, but
the highest expression is found in the lung, predominantly in mesenchymal cells,
including vascular and airway smooth muscle cells,138,139 but also in endothelial cells
and goblet cells of airway epithelium. In adult tissue, Fstl1 has been proposed as
a cardiokine,140–143 myokine,144,145 adipokine,146 and, osteogenic factor147 due to it
is ubiquitous expression and functions in the heart, muscle, bone, skeletal muscle
tissue,144,145,148 neurons,149 and trophoblasts.150 The effects of Fstl1 on its downstream
targets and the upstream factors known to regulate Fstl1 expression has been
reviewed.151 In response to divers factors, such as TGF-β1, IL-1β, TNF-α and IL-6,
the expression of Fstl1 gene was found to be highly expressed in mesenchymal
lineages, including fibroblasts, cardiomyocytes, chondrocytes, adipocytes, and
osteocytes.151–153However, recent studies showed that Fstl1 is also expressed by
hematopoietic lineages, such as bone marrow-derived osteoclasts147 and lung
alveolar macrophages.24IL-13 triggers lung alveolar macrophages to express a
significant increase of Fstl1 mRNA, whereas TGF-β and Fstl1 increase Fstl1 expression
in lung epithelial cells.22,24 Furthermore, Fstl1 triggers inflammatory cells, ranging
from monocytes, macrophages, and T-cells to express and release pro-inflammatory
cytokines and chemokines, including IL-1β, TNF-α, IL-6, IFN-γ, IL-8, MCP-1, and IP-
10.151,154,155 Among others, expression of Fstl1 is negatively regulated by microRNAs
(miRs), including miR-198,156 miR-27a,157 miR-21,158 and miR-206.159Although Fstl1 is
primarily known as a BMP antagonist,21,160,161 current findings suggest that Fstl1 may
also regulate various physiological processes by interacting with different receptors,
including disco-interacting protein 2 homolog A (DIP2A),162–164 toll-like receptor 4
(TLR4),165,166 and the sodium-potassium pump.149
3.2. Fstl1 signaling in lung and pulmonary vascular development
Fstl1 is expressed in the developing lung.25,138 Embryonic knockout of Fstl1 in mice
results in an extensive distortion in lung morphology and neonatal lethality due
to respiratory failure, demonstrating the functional importance of Fstl1 in lung
development.160,161 Whole body knockout of Fstl1 exhibits smaller and abnormal
lung morphology. Histological analysis demonstrated thickening of alveolar walls
and reduction in airspaces and impaired alveolar epithelial differentiation as seen
in reduction in mature surfactant protein level.160,161 In addition to embryonic
lung morphogenesis,25,138,151,160,161 the crucial roles of Fstl1 in organogenesis have
also been shown in other organs, including brain,167 heart,168 and dorsal/ventral
16
axis patterning.169 However, the role of Fstl1 in the development of pulmonary
vasculature has not been previously explored.
1
3.3. Physiological roles of Fstl1
Several studies reported that Fstl1 has diverse biological functions, including
regulating cell proliferation,170–172 differentiation,171 migration , invasion,157 wound
healing,156 tissue repair,143,173,174 cell fate determination,139 and innate immune
responses.172 The roles of Fstl1 in tissue repair in response to injury have been most
widely studied in the cardiovascular system. Fstl1 was found to be increased in
models of acute and chronic heart injury, including myocardial infarction, pressure
overload-induced hyperthrophy, and ischemia/reperfusion injury.140,173,175,176
Systemic administration of Fstl1 or overexpression of Fstl1 showed to be protective
in the cardiovascular system by reducing cell apoptosis and inflammatory responses,
and promoting endothelial cell survival and trigger a revascularization process and
restore tissue function.140,148,176,177 Recent studies demonstrated that Fstl1 expression
is also induced in response to lung injury.21,23,158 Further investigation is needed to
unravel the impact of upregulation of Fstl1 in the lung. Collectively, these data suggest
that the injury-induced upregulation of Fstl1 play a clinically relevant role in the
modulation of pathological processes. Furthermore, previous studies demonstrate
paracrine signaling of Fstl1 in cell and tissue communication.141,142,144,148,172 However,
the roles of secreted Fstl1 in cell-cell communication in the lung have not been
previously studied.
3.4. The pathological roles of Fstl1 in inflammatory diseases
The function of Fstl1 has been most extensively studied in inflammatory diseases
and a dual role of Fstl1 in inflammatory responses has been reported. It is clear
that Fstl1 modulates inflammatory cytokine expression and release. However, the
precise effect of Fstl1 in inflammatory responses, whether as a pro-inflammatory
or an anti-inflammatory mediator remain controversial. A great body of evidence
identifies Fstl1 as a pro-inflammatory cytokine that is induced by inflammatory
cytokines, in turn Fstl1 triggers inflammatory responses from target cells, particularly
inflammatory cells.178 Several studies have shown that Fstl1 is markedly upregulated
in inflammatory conditions.179–181 Furthermore, silencing of Fst1 decreases the
production of TNF-α, IL-6, and IL-8 from human arterial endothelial cells induced by
oxidized low-density lipoprotein.166 Additionally, high Fstl1 is observed in response
to bacterial infection182 and low degree of inflammation in obese individuals.183
An anti-inflammatory role for Fstl1 is supported by other studies. Mice treated
with recombinant human Fstl1 show a decreased expression of IL-6, MMP3, and
MMP9 in animal models of arthritis.184,185 Immuno suppressant roles of Fstl1 have
been also demonstrated in organ transplantation, and tissue injury.166,186,187 These
discrepancies may be explained by the differences in the experimental conditions
and different organs. However, the inflammatory roles of Fstl1 in COPD have not been
previously explored. Furthermore, Fstl1 has been proposed as a biomarker in several
diseases, including systemic-onset juvenile rheumatoid arthritis,153 osteoarthritis,188
17
systemic juvenile idiopathic arthritis,181 chronic systolic heart failure,189 acute
coronary syndrome,190 inflammatory responses and oxidative stress.191
3.5. The pathological roles of Fstl1 in airway remodeling in the lung
Recent studies showed upregulation of Fstl1 expression in the lungs patients
with severe asthma and idiopathic pulmonary fibrosis.22,23 Further in vivo studies
demonstrated that Fstl1 haploinsufficient mice and specific inactivation of Fstl1
in myeloid cell lineages attenuate airway remodeling in animal models of asthma
and lung fibrosis, respectively.21,22 Studies from the same group demonstrated that
recombinant Fstl1 induces lung macrophages to express pro-remodeling factor
MMP9 mRNA and protein through TLR4 receptor activation.24 Conversely, the other
study showed that Fstl1 attenuates MMP9 expression in animal model of arthritis.185
3.6. The pathological roles of Fstl1 in airway remodeling in cancer
Fstl1 has been implicated in several cancer, including lung cancer,192–194 pancreatic
cancer,195 bone metastasis,196,197 ovarian cancer and endometrial carcinogenesis,198,199
nasopharyngeal carcinoma,172 glioblastoma,200 and prostate cancer.201 However, the
role of Fstl1 in cancer is complex and controversial.
On one hand, Fstl1 has been reported as a pro-cancer metastasis. On the
other hand, Fstl1 shows an anti-cancer effect. High expression of Fstl1 is associated
with poor prognosis of glioblastoma200 and favors the progression of metastatic
prostate cancer.201 Therefore, Fstl1 has been proposed as therapeutic target for
prostate cancer.202 Targeting Fstl1 prevents bone metastasis by regulating the
immune function, suggesting that Fstl1 can mediate cancer cell invasion.197,203
Fstl1 is significantly downregulated in metastatic kidney cancer. Fstl1 mRNA is
significantly lower in cancerous tissue compared to adjacent normal tissue.204 A
recent study demonstrated an association between Fstl1 polymorphisms and renal
cell carcinoma (RCC) risk and prognosis, suggesting that the variant genotype CC of
rs1259293 is associated with RCC development by suppressing Fstl1 expression.205
Fstl1 has been suggested as putative tumor suppressor gene as decreased Fstl1
has been reported,206 including in kidney cancer,204 lung cancer,192,194 ovarian and
endometrial cancer,198,199 nasopharyngeal carcinoma,172and bone metastasis of
prostate cancer.196 Hypermethylation of the Fstl1 promoter is observed in cancer,
leading to cell proliferation and invasion.172 Re-expression of Fstl1 and Fstl1
treatment negatively regulates lung cancer cell invasion and metastasis193,207 and
result in growth inhibition of human lung cancer cell lines. Fstl1 transcripts are not
detectable in highly aggressive and proliferative lung cancer cells and overexpression
of Fstl1 shows an anti-proliferative effect.192 Tumor suppressant effects of Fstl1 in
ovarian and endometrial carcinogenesis has also been suggested.198 Knockdown of
Fstl1 induces apoptosis through a mitotic arrest and caspase-dependent cell death,
suggesting that Fstl1 plays important roles in cellular proliferation and apoptosis in
lung cancer cells.194
18
Scope of the thesis
The notion that developmental signaling pathways are reactivated during chronic 1
lung disease attracted scientists to dissect the roles of these pathways related with
the pathophysiology of COPD. However, little is known about the involvement
of BMP signaling in COPD. BMP/Fstl1 signaling is a key player in embryonic
lung morphogenesis,85,86 with diverse physiological roles including cellular
communication.139,142,172 Recent studies demonstrate that aberrant Fstl1 expression
is associated with several pathological lung conditions21–24,158 and inflammatory
disorders,154,155,180 underscoring its great importance in adult tissue homeostasis
and repair. However, the involvement of Fstl1 in COPD remains unexplored. This
thesis will delineate the role of the endogenous BMP antagonist Fstl1 in lung
development and shed light on its potential contribution to the pathogenesis of
COPD. The specific aims of this thesis are to investigate the role of Fstl1 in pulmonary
vasculature development and COPD, particularly in airway epithelial-mesenchymal
cell communication and adult tracheal epithelial cell differentiation. To this aim, the
developmental roles of Fstl1 were studied in conditional endothelial-specific Fstl1
knockout mice and in vitro study using pulmonary cell lines, including bronchial
epithelial cells, lung fibroblasts, and airway smooth muscle cells.
In Chapter 2, the role of endothelial Fstl1 in the postnatal development of the
pulmonary vasculature was investigated. The changes in molecular signaling, lung
physiology, and morphology of pulmonary vessels were dissected in endothelial-
specific Fstl1 knockout mice compared to littermate controls.
Our investigation of Fstl1 expression and BMP/Smad activation in lung tissue
of COPD patients is presented in Chapter 3, providing evidences of dysregulation of
Fstl1 expression in different parts of COPD lung tissue.
Chapter 4 provides a perspective on the expression levels and contribution of
the TGF-β superfamily members, activin-A and its endogenous follistatin antagonist
in smoking-induced airway inflammation in COPD both in vitro and in vivo.
The role of Fstl1 in inflammatory cytokine release from lung mesenchymal cells
was explored in Chapter 5, which provides evidences on pro-inflammatory roles
of Fstl1 1 in coordinating epithelial-mesenchymal communication in inflammatory
cytokine release in the lung. We identified epithelial-derived factors in culture
supernatants of Fstl1 overexpressing bronchial epithelial cells which mediate Fstl1-
conditioned media-induced IL-6 and IL-8 release from lung fibroblasts.
Chapter 6 describes the latest understanding of the contribution of pulmonary
mesenchymal cells in modulating airway inflammation in various lung diseases.
Furthermore, the effect of BMP4 in differentiation of primary adult
tracheobronchial epithelialcells using air-liquid interface culture was studied in
Chapter 7. The potential implications of aberrant BMP signaling related with airway
epithelial remodeling in COPD lungs was discussed.
19
References
1. Yanagita M. BMP antagonists: their roles in development and involvement in pathophysiology.
Cytokine Growth Factor Rev. 2005;16(3):309-317. doi:10.1016/j.cytogfr.2005.02.007.
2. Rock J, Königshoff M. Endogenous lung regeneration: potential and limitations. Am J Respir Crit
Care Med. 2012;186(12):1213-1219. doi:10.1164/rccm.201207-1151PP.
3. Sountoulidis A, Stavropoulos A, Giaglis S, et al. Activation of the canonical bone morphogenetic
protein (BMP) pathway during lung morphogenesis and adult lung tissue repair. PloS One.
2012;7(8):e41460. doi:10.1371/journal.pone.0041460.
4. Vestbo J, Hurd SS, Agustí AG, et al. Global Strategy for the Diagnosis, Management, and Prevention
of Chronic Obstructive Pulmonary Disease. Am J Respir Crit Care Med. 2013;187(4):347-365.
doi:10.1164/rccm.201204-0596PP.
5. Lopez AD, Murray CCJL. The global burden of disease, 1990–2020. Nat Med. 1998;4(11):1241-
1243. doi:10.1038/3218.
6. Corhay J-L, Frusch N, Louis R. [COPD: genetics and environmental interactions]. Rev Médicale
Liège. 2012;67(5-6):292-297.
7. Rovina N, Koutsoukou A, Koulouris NG. Inflammation and Immune Response in COPD: Where Do
We Stand? Mediators Inflamm. 2013;2013:e413735. doi:10.1155/2013/413735.
8. Pillai SG, Kong X, Edwards LD, et al. Loci identified by genome-wide association studies influence
different disease-related phenotypes in chronic obstructive pulmonary disease. Am J Respir Crit
Care Med. 2010;182(12):1498-1505. doi:10.1164/rccm.201002-0151OC.
9. van der Plaat DA, de Jong K, Lahousse L, et al. Genome-wide association study on the FEV1/FVC-
ratio in never-smokers identifies HHIP and FAM13A. J Allergy Clin Immunol. September 2016.
doi:10.1016/j.jaci.2016.06.062.
10. Morrow JD, Cho MH, Hersh CP, et al. DNA methylation profiling in human lung tissue identifies
genes associated with COPD. Epigenetics. August 2016:0. doi:10.1080/15592294.2016.122645.
11. Hobbs BD, Parker MM, Chen H, et al. Exome Array Analysis Identifies a Common Variant in
IL27 Associated with Chronic Obstructive Pulmonary Disease. Am J Respir Crit Care Med.
2016;194(1):48-57. doi:10.1164/rccm.201510-2053OC.
12. Bruse S, Moreau M, Bromberg Y, et al. Whole exome sequencing identifies novel candidate genes
that modify chronic obstructive pulmonary disease susceptibility. Hum Genomics. 2016;10:1.
doi:10.1186/s40246-015-0058-7.
13. Cho MH, Boutaoui N, Klanderman BJ, et al. Variants in FAM13A are associated with chronic
obstructive pulmonary disease. Nat Genet. 2010;42(3):200-202. doi:10.1038/ng.535.
14. Pillai SG, Ge D, Zhu G, et al. A genome-wide association study in chronic obstructive pulmonary
disease (COPD): identification of two major susceptibility loci. PLoS Genet. 2009;5(3):e1000421.
15. Barnes PJ. Chronic Obstructive Pulmonary Disease. N Engl J Med. 2000;343(4):269-
280. doi:10.1056/NEJM200007273430407.
16. Shaykhiev R, Crystal RG. Early events in the pathogenesis of chronic obstructive pulmonary
disease. Smoking-induced reprogramming of airway epithelial basal progenitor cells. Ann Am
Thorac Soc. 2014;11 Suppl 5:S252-258. doi:10.1513/AnnalsATS.201402-049AW.
17. Barnes PJ. Immunology of asthma and chronic obstructive pulmonary disease. Nat Rev Immunol.
2008;8(3):183-192. doi:10.1038/nri2254.
18. Shi W, Chen F, Cardoso WV. Mechanisms of lung development: contribution to adult lung disease
and relevance to chronic obstructive pulmonary disease. Proc Am Thorac Soc. 2009;6(7):558-
563. doi:10.1513/pats.200905-031RM.
19. Myllärniemi M, Lindholm P, Ryynänen MJ, et al. Gremlin-mediated decrease in bone
morphogenetic protein signaling promotes pulmonary fibrosis. Am J Respir Crit Care Med.
2008;177(3):321-329. doi:10.1164/rccm.200706-945OC.
20. De Langhe E, Cailotto F, De Vooght V, et al. Enhanced endogenous bone morphogenetic protein
signaling protects against bleomycin induced pulmonary fibrosis. Respir Res. 2015;16:38.
doi:10.1186/s12931-015-0202-x.
21. Dong Y, Geng Y, Li L, et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary
fibrosis in mice. J Exp Med. 2015;212(2):235-252. doi:10.1084/jem.20121878.
22. Miller M, Beppu A, Rosenthal P, et al. Fstl1 Promotes Asthmatic Airway Remodeling by Inducing
Oncostatin M. J Immunol Baltim Md 1950. September 2015. doi:10.4049/jimmunol.1501105.
20
23. Murphy N, Gaynor KU, Rowan SC, et al. Altered Expression of Bone Morphogenetic Protein
Accessory Proteins in Murine and Human Pulmonary Fibrosis. Am J Pathol. 2016;186(3):600-
615. doi:10.1016/j.ajpath.2015.10.032.
24. Miller M, Esnault S, Kurten RC, et al. Segmental allergen challenge increases levels of airway 1
follistatin-like 1 in patients with asthma. J Allergy Clin Immunol. 2016;138(2):596-599.e4.
doi:10.1016/j.jaci.2016.01.019.
25. Li X, Fang Y, Li X, et al. Apical Secretion of FSTL1 in the Respiratory Epithelium for Normal Lung
Development. PloS One. 2016;11(6):e0158385. doi:10.1371/journal.pone.0158385.
26. Di Stefano A, Capelli A, Lusuardi M, et al. Severity of airflow limitation is associated with
severity of airway inflammation in smokers. Am J Respir Crit Care Med. 1998;158(4):1277-1285.
doi:10.1164/ajrccm.158.4.9802078.
27. Saetta M, Di Stefano A, Turato G, et al. CD8+ T-lymphocytes in peripheral airways of smokers
with chronic obstructive pulmonary disease. Am J Respir Crit Care Med. 1998;157(3 Pt 1):822-
826. doi:10.1164/ajrccm.157.3.9709027.
28. Saetta M, Baraldo S, Corbino L, et al. CD8+ve cells in the lungs of smokers with chronic
obstructive pulmonary disease. Am J Respir Crit Care Med. 1999;160(2):711-717. doi:10.1164/
ajrccm.160.2.9812020.
29. Thorley AJ, Tetley TD. Pulmonary epithelium, cigarette smoke, and chronic obstructive pulmonary
disease. Int J Chron Obstruct Pulmon Dis. 2007;2(4):409-428.
30. Alkhouri H, Poppinga WJ, Tania NP, Ammit A, Schuliga M. Regulation of pulmonary
inflammation by mesenchymal cells. Pulm Pharmacol Ther. 2014;29(2):156-165. doi:10.1016/j.
pupt.2014.03.001.
31. Gosens R, Rieks D, Meurs H, et al. Muscarinic M3 receptor stimulation increases cigarette smoke-
induced IL-8 secretion by human airway smooth muscle cells. Eur Respir J. 2009;34(6):1436-
1443. doi:10.1183/09031936.00045209.
32. Beg AA. Endogenous ligands of Toll-like receptors: implications for regulating inflammatory and
immune responses. Trends Immunol. 2002;23(11):509-512. doi:10.1016/S1471-4906(02)02317.
33. Mio T, Romberger DJ, Thompson AB, Robbins RA, Heires A, Rennard SI. Cigarette smoke
induces interleukin-8 release from human bronchial epithelial cells. Am J Respir Crit Care Med.
1997;155(5):1770-1776. doi:10.1164/ajrccm.155.5.9154890.
34. Mortaz E, Henricks P a. J, Kraneveld AD, Givi ME, Garssen J, Folkerts G. Cigarette smoke
induces the release of CXCL-8 from human bronchial epithelial cells via TLRs and induction
of the inflammasome. Biochim Biophys Acta. 2011;1812(9):1104-1110. doi:10.1016/j.
bbadis.2011.06.002.
35. Hellermann GR, Nagy SB, Kong X, Lockey RF, Mohapatra SS. Mechanism of cigarette smoke
condensate-induced acute inflammatory response in human bronchial epithelial cells. Respir
Res. 2002;3:22.
36. Osei ET, Brandsma C-A, Noordhoek JA, Timens W, Postma D, Heijink I. Crosstalk between
epithelium and fibroblasts; implications for COPD. Eur Respir J. 2014;44(Suppl 58):P3899.
37. Keatings VM, Barnes PJ. Granulocyte activation markers in induced sputum: comparison
between chronic obstructive pulmonary disease, asthma, and normal subjects. Am J Respir Crit
Care Med. 1997;155(2):449-453. doi:10.1164/ajrccm.155.2.9032177.
38. Pesci A, Balbi B, Majori M, et al. Inflammatory cells and mediators in bronchial lavage of patients
with chronic obstructive pulmonary disease. Eur Respir J. 1998;12(2):380-386.
39. Traves S, Culpitt S, Russell R, Barnes P, Donnelly L. Increased levels of the chemokines GROα and
MCP-1 in sputum samples from patients with COPD. Thorax. 2002;57(7):590-595. doi:10.1136/
thorax.57.7.590.
40. Keatings VM, Collins PD, Scott DM, Barnes PJ. Differences in interleukin-8 and tumor necrosis
factor-alpha in induced sputum from patients with chronic obstructive pulmonary disease or
asthma. Am J Respir Crit Care Med. 1996;153(2):530-534. doi:10.1164/ajrccm.153.2.8564092.
41. Nocker RE, Schoonbrood DF, van de Graaf EA, et al. Interleukin-8 in airway inflammation in
patients with asthma and chronic obstructive pulmonary disease. Int Arch Allergy Immunol.
1996;109(2):183-191.
42. Beeh KM, Beier J. Handle with care: targeting neutrophils in chronic obstructive pulmonary
disease and severe asthma? Clin Exp Allergy J Br Soc Allergy Clin Immunol. 2006;36(2):142-157.
21
 doi:10.1111/j.1365-2222.2006.02418.x.
43. Roghanian A, Sallenave J-M. Neutrophil elastase (NE) and NE inhibitors: canonical and
noncanonical functions in lung chronic inflammatory diseases (cystic fibrosis and chronic
obstructive pulmonary disease). J Aerosol Med Pulm Drug Deliv. 2008;21(1):125-144.
doi:10.1089/jamp.2007.0653.
44. Gomez-Cambronero J, Horn J, Paul CC, Baumann MA. Granulocyte-macrophage colony-
stimulating factor is a chemoattractant cytokine for human neutrophils: involvement of the
ribosomal p70 S6 kinase signaling pathway. J Immunol Baltim Md 1950. 2003;171(12):6846-
6855.
45. Hamilton JA. GM-CSF in inflammation and autoimmunity. Trends Immunol. 2002;23(8):403-408.
doi:10.1016/S1471-4906(02)02260-3.
46. Di Stefano A, Caramori G, Oates T, et al. Increased expression of nuclear factor-kappaB in
bronchial biopsies from smokers and patients with COPD. Eur Respir J. 2002;20(3):556-563.
47. Di Stefano A, Maestrelli P, Roggeri A, et al. Upregulation of adhesion molecules in the bronchial
mucosa of subjects with chronic obstructive bronchitis. Am J Respir Crit Care Med. 1994;149(3
Pt 1):803-810. doi:10.1164/ajrccm.149.3.7509705.
48. Saetta M, Mariani M, Panina-Bordignon P, et al. Increased expression of the chemokine
receptor CXCR3 and its ligand CXCL10 in peripheral airways of smokers with chronic obstructive
pulmonary disease. Am J Respir Crit Care Med. 2002;165(10):1404-1409.
49. Puchelle E, Zahm J-M, Tournier J-M, Coraux C. Airway epithelial repair, regeneration, and
remodeling after injury in chronic obstructive pulmonary disease. Proc Am Thorac Soc.
2006;3(8):726-733. doi:10.1513/pats.200605-126SF.
50. Yoshida T, Tuder RM. Pathobiology of cigarette smoke-induced chronic obstructive pulmonary
disease. Physiol Rev. 2007;87(3):1047-1082. doi:10.1152/physrev.00048.2006.
51. Wanner A, Salathé M, O’Riordan TG. Mucociliary clearance in the airways. Am J Respir Crit Care
Med. 1996;154(6 Pt 1):1868-1902. doi:10.1164/ajrccm.154.6.8970383.
52. Lozewicz S, Wells C, Gomez E, et al. Morphological integrity of the bronchial epithelium in mild
asthma. Thorax. 1990;45(1):12-15.
53. Kotton DN, Morrisey EE. Lung regeneration: mechanisms, applications and emerging stem cell
populations. Nat Med. 2014;20(8):822-832. doi:10.1038/nm.3642.
54. Brune K, Frank J, Schwingshackl A, Finigan J, Sidhaye VK. Pulmonary epithelial barrier function:
some new players and mechanisms. Am J Physiol - Lung Cell Mol Physiol. 2015;308(8):L731-L745.
doi:10.1152/ajplung.00309.2014.
55. Cosio MG, Hale KA, Niewoehner DE. Morphologic and morphometric effects of prolonged
cigarette smoking on the small airways. Am Rev Respir Dis. 1980;122(2):265-221. doi:10.1164/
arrd.1980.122.2.265.
56. Coraux C, Hajj R, Lesimple P, Puchelle E. In vivo models of human airway epithelium repair and
regeneration. Eur Respir Rev. 2005;14(97):131-136. doi:10.1183/09059180.05.00009702.
57. Yahaya B. Understanding Cellular Mechanisms Underlying Airway Epithelial Repair: Selecting the
Most Appropriate Animal Models. Sci World J. 2012;2012:e961684. doi:10.1100/2012/961684.
58. Rokicki W, Rokicki M, Wojtacha J, Dżeljijli A. The role and importance of club cells (Clara cells) in
the pathogenesis of some respiratory diseases. Kardiochirurgia Torakochirurgia Pol Pol J Cardio-
Thorac Surg. 2016;13(1):26-30. doi:10.5114/kitp.2016.58961.
59. Gamez AS, Gras D, Petit A, et al. Supplementing Defect in Club Cell Secretory Protein Attenuates
Airway Inflammation in COPD. Chest. 2015;147(6):1467-1476. doi:10.1378/chest.14-1174.
60. Park HY, Churg A, Wright JL, et al. Club cell protein 16 and disease progression in chronic
obstructive pulmonary disease. Am J Respir Crit Care Med. 2013;188(12):1413-1419.
doi:10.1164/rccm.201305-0892OC.
61. Pilette C, Godding V, Kiss R, et al. Reduced epithelial expression of secretory component in small
airways correlates with airflow obstruction in chronic obstructive pulmonary disease. Am J
Respir Crit Care Med. 2001;163(1):185-194. doi:10.1164/ajrccm.163.1.9912137.
62. Whitcutt MJ, Adler KB, Wu R. A biphasic chamber system for maintaining polarity of
differentiation of cultured respiratory tract epithelial cells. Vitro Cell Dev Biol J Tissue Cult Assoc.
1988;24(5):420-428.
63. Kaartinen L, Nettesheim P, Adler KB, Randell SH. Rat tracheal epithelial cell differentiation in
22
vitro. In Vitro Cell Dev Biol Anim. 1993;29A(6):481-492.
64. Hogg JC, Macklem PT, Thurlbeck WM. Site and nature of airway obstruction in chronic obstructive
lung disease. N Engl J Med. 1968;278(25):1355-1360. doi:10.1056/NEJM196806202782501.
65. Hogg JC, Chu F, Utokaparch S, et al. The Nature of Small-Airway Obstruction in Chronic Obstructive 1
Pulmonary Disease. N Engl J Med. 2004;350(26):2645-2653. doi:10.1056/NEJMoa032158.
66. Hogg JC, Timens W. The Pathology of Chronic Obstructive Pulmonary Disease. Annu Rev Pathol
Mech Dis. 2009;4(1):435-459. doi:10.1146/annurev.pathol.4.110807.092145.
67. Eurlings IMJ, Dentener MA, Cleutjens JPM, et al. Similar matrix alterations in alveolar and small
airway walls of COPD patients. BMC Pulm Med. 2014;14:90. doi:10.1186/1471-2466-14-90.
68. Kranenburg AR, Willems-Widyastuti A, Moori WJ, et al. Enhanced bronchial expression of
extracellular matrix proteins in chronic obstructive pulmonary disease. Am J Clin Pathol.
2006;126(5):725-735.
69. Annoni R, Lanças T, Yukimatsu Tanigawa R, et al. Extracellular matrix composition in COPD. Eur
Respir J. 2012;40(6):1362-1373. doi:10.1183/09031936.00192611.
70. Dentener MA, Vernooy JHJ, Hendriks S, Wouters EFM. Enhanced levels of hyaluronan in
lungs of patients with COPD: relationship with lung function and local inflammation. Thorax.
2005;60(2):114-119. doi:10.1136/thx.2003.020842.
71. Barnes PJ, Shapiro SD, Pauwels RA. Chronic obstructive pulmonary disease: molecular and
cellular mechanisms. Eur Respir J. 2003;22(4):672-688.
72. Pera T, Gosens R, Lesterhuis AH, et al. Cigarette smoke and lipopolysaccharide induce a
proliferative airway smooth muscle phenotype. Respir Res. 2010;11(1):48. doi:10.1186/1465-
9921-11-48.
73. Evanko SP, Potter-Perigo S, Bollyky PL, Nepom GT, Wight TN. Hyaluronan and versican in the
control of human T-lymphocyte adhesion and migration. Matrix Biol J Int Soc Matrix Biol.
2012;31(2):90-100. doi:10.1016/j.matbio.2011.10.004.
74. Togo S, Holz O, Liu X, et al. Lung Fibroblast Repair Functions in Patients with Chronic Obstructive
Pulmonary Disease Are Altered by Multiple Mechanisms. Am J Respir Crit Care Med.
2008;178(3):248-260. doi:10.1164/rccm.200706-929OC.
75. van den Berge M, ten Hacken NHT, Cohen J, Douma WR, Postma DS. Small airway disease in
asthma and copd: Clinical implications. Chest. 2011;139(2):412-423. doi:10.1378/chest.10-1210.
76. Hashimoto M, Tanaka H, Abe S. Quantitative analysis of bronchial wall vascularity in the medium
and small airways of patients with asthma and COPD. Chest. 2005;127(3):965-972. doi:10.1378/
chest.127.3.965.
77. Siafakas NM, Antoniou KM, Tzortzaki EG. Role of angiogenesis and vascular remodeling in
chronic obstructive pulmonary disease. Int J Chron Obstruct Pulmon Dis. 2007;2(4):453-462.
78. Green CE, Turner AM. The role of the endothelium in asthma and chronic obstructive pulmonary
disease (COPD). Respir Res. 2017;18:20. doi:10.1186/s12931-017-0505-1.
79. Santos S, Peinado VI, Ramírez J, et al. Characterization of pulmonary vascular remodelling in
smokers and patients with mild COPD. Eur Respir J. 2002;19(4):632-638.
80. Ferrer E, Peinado VI, Díez M, et al. Effects of cigarette smoke on endothelial function of
pulmonary arteries in the guinea pig. Respir Res. 2009;10(1):76. doi:10.1186/1465-9921-10-76.
81. Santos S, Peinado VI, Ramirez J, et al. Enhanced expression of vascular endothelial growth factor
in pulmonary arteries of smokers and patients with moderate chronic obstructive pulmonary
disease. Am J Respir Crit Care Med. 2003;167(9):1250-1256. doi:10.1164/rccm.200210-1233OC.
82. Nilsson I, Shibuya M, Wennström S. Differential activation of vascular genes by hypoxia in
primary endothelial cells. Exp Cell Res. 2004;299(2):476-485. doi:10.1016/j.yexcr.2004.06.005.
83. Kranenburg AR, de Boer WI, Alagappan VKT, Sterk PJ, Sharma HS. Enhanced bronchial expression
of vascular endothelial growth factor and receptors (Flk-1 and Flt-1) in patients with chronic
obstructive pulmonary disease. Thorax. 2005;60(2):106-113. doi:10.1136/thx.2004.023986.
84. Calabrese C, Bocchino V, Vatrella A, et al. Evidence of angiogenesis in bronchial biopsies
of smokers with and without airway obstruction. Respir Med. 2006;100(8):1415-1422.
doi:10.1016/j.rmed.2005.11.009.
85. Peinado VI, Ramírez J, Roca J, Rodriguez-Roisin R, Barberà JA. Identification of vascular progenitor
cells in pulmonary arteries of patients with chronic obstructive pulmonary disease. Am J Respir
Cell Mol Biol. 2006;34(3):257-263. doi:10.1165/rcmb.2005-0255OC.
23
86. Kasahara Y, Tuder RM, Taraseviciene-Stewart L, et al. Inhibition of VEGF receptors causes lung
cell apoptosis and emphysema. J Clin Invest. 2000;106(11):1311-1319. doi:10.1172/JCI10259.
87. Voelkel NF, Gomez-Arroyo J, Mizuno S. COPD/emphysema: The vascular story. Pulm Circ.
2011;1(3):320-326. doi:10.4103/2045-8932.87295.
88. White DG, Cannon TR, Garratt H, Mundin JW, Sumner MJ, Watts IS. Endothelin ETA and ETB
receptors mediate vascular smooth-muscle contraction. J Cardiovasc Pharmacol. 1993;22 Suppl
8:S144-148.
89. Böhm F, Pernow J. The importance of endothelin-1 for vascular dysfunction in cardiovascular
disease. Cardiovasc Res. 2007;76(1):8-18. doi:10.1016/j.cardiores.2007.06.004.
90. Celli BR, MacNee W, ATS/ERS Task Force. Standards for the diagnosis and treatment of patients
with COPD: a summary of the ATS/ERS position paper. Eur Respir J. 2004;23(6):932-946.
91. Wozney JM, Rosen V, Celeste AJ, et al. Novel regulators of bone formation: molecular clones and
activities. Science. 1988;242(4885):1528-1534.
92. Urist MR. A morphogenetic matrix for differentiation of bone tissue. Calcif Tissue Res.
1970:Suppl:98-101.
93. Wagner DS, Mullins MC. Modulation of BMP Activity in Dorsal-Ventral Pattern Formation by the
Chordin and Ogon Antagonists. Dev Biol. 2002;245(1):109-123. doi:10.1006/dbio.2002.0614.
94. Zuniga E, Rippen M, Alexander C, Schilling TF, Crump JG. Gremlin 2 regulates distinct roles of
BMP and Endothelin 1 signaling in dorsoventral patterning of the facial skeleton. Development.
2011;138(23):5147-5156. doi:10.1242/dev.067785.
95. Hsu DR, Economides AN, Wang X, Eimon PM, Harland RM. The Xenopus dorsalizing factor
Gremlin identifies a novel family of secreted proteins that antagonize BMP activities. Mol Cell.
1998;1(5):673-683.
96. Weaver M, Yingling JM, Dunn NR, Bellusci S, Hogan BL. Bmp signaling regulates proximal-distal
differentiation of endoderm in mouse lung development. Dev Camb Engl. 1999;126(18):4005-
4015.
97. Bellusci S, Henderson R, Winnier G, Oikawa T, Hogan BL. Evidence from normal expression
and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse
embryonic lung morphogenesis. Dev Camb Engl. 1996;122(6):1693-1702.
98. Sieber C, Kopf J, Hiepen C, Knaus P. Recent advances in BMP receptor signaling. Cytokine Growth
Factor Rev. 2009;20(5-6):343-355. doi:10.1016/j.cytogfr.2009.10.007.
99. Shimasaki S, Moore RK, Otsuka F, Erickson GF. The bone morphogenetic protein system in
mammalian reproduction. Endocr Rev. 2004;25(1):72-101. doi:10.1210/er.2003-0007.
100. Miyazono K, Maeda S, Imamura T. BMP receptor signaling: transcriptional targets, regulation of
signals, and signaling cross-talk. Cytokine Growth Factor Rev. 2005;16(3):251-263. doi:10.1016/j.
cytogfr.2005.01.009.
101. Massagué J, Chen YG. Controlling TGF-beta signaling. Genes Dev. 2000;14(6):627-644.
102. Morikawa M, Koinuma D, Tsutsumi S, et al. ChIP-seq reveals cell type-specific binding patterns
of BMP-specific Smads and a novel binding motif. Nucleic Acids Res. 2011;39(20):8712-8727.
doi:10.1093/nar/gkr572.
103. Shi Y, Massagué J. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell.
2003;113(6):685-700.
104. Wrana JL. Regulation of Smad activity. Cell. 2000;100(2):189-192.
105. Xu L. Regulation of Smad Activities. Biochim Biophys Acta. 2006;1759(11-12):503-513.
doi:10.1016/j.bbaexp.2006.11.001.
106. Yamaguchi K, Nagai S, Ninomiya-Tsuji J, et al. XIAP, a cellular member of the inhibitor of
apoptosis protein family, links the receptors to TAB1-TAK1 in the BMP signaling pathway. EMBO
J. 1999;18(1):179-187. doi:10.1093/emboj/18.1.179.
107. Lai C-F, Cheng S-L. Signal transductions induced by bone morphogenetic protein-2
and transforming growth factor-beta in normal human osteoblastic cells. J Biol Chem.
2002;277(18):15514-15522. doi:10.1074/jbc.M200794200.
108. Derynck R, Zhang YE. Smad-dependent and Smad-independent pathways in TGF-beta family
signalling. Nature. 2003;425(6958):577-584. doi:10.1038/nature02006.
109. Shim J-H, Greenblatt MB, Xie M, et al. TAK1 is an essential regulator of BMP signalling in cartilage.
EMBO J. 2009;28(14):2028-2041. doi:10.1038/emboj.2009.162.
24
110. Gazzerro E, Canalis E. Bone morphogenetic proteins and their antagonists. Rev Endocr Metab
Disord. 2006;7(1-2):51-65. doi:10.1007/s11154-006-9000-6.
111. Xu B, Chen C, Chen H, et al. Smad1 and its target gene Wif1 coordinate BMP and Wnt signaling
activities to regulate fetal lung development. Dev Camb Engl. 2011;138(5):925-935. doi:10.1242/ 1
dev.062687.
112. Kool H, Mous D, Tibboel D, de Klein A, Rottier RJ. Pulmonary vascular development goes awry in
congenital lung abnormalities. Birth Defects Res Part C Embryo Today Rev. 2014;102(4):343-358.
doi:10.1002/bdrc.21085.
113. Gangopahyay A, Oran M, Bauer EM, et al. Bone morphogenetic protein receptor II is a novel
mediator of endothelial nitric-oxide synthase activation. J Biol Chem. 2011;286(38):33134-
33140. doi:10.1074/jbc.M111.274100.
114. Rosendahl A, Pardali E, Speletas M, Ten Dijke P, Heldin C-H, Sideras P. Activation of bone
morphogenetic protein/Smad signaling in bronchial epithelial cells during airway inflammation.
Am J Respir Cell Mol Biol. 2002;27(2):160-169. doi:10.1165/ajrcmb.27.2.4779.
115. Kariyawasam HH, Xanthou G, Barkans J, Aizen M, Kay AB, Robinson DS. Basal expression of
bone morphogenetic protein receptor is reduced in mild asthma. Am J Respir Crit Care Med.
2008;177(10):1074-1081. doi:10.1164/rccm.200709-1376OC.
116. Koli K, Myllärniemi M, Vuorinen K, et al. Bone morphogenetic protein-4 inhibitor gremlin is
overexpressed in idiopathic pulmonary fibrosis. Am J Pathol. 2006;169(1):61-71. doi:10.2353/
ajpath.2006.051263.
117. Zhang J-C, Chen G, Chen L, et al. TGF-β/BAMBI pathway dysfunction contributes to peripheral
Th17/Treg imbalance in chronic obstructive pulmonary disease. Sci Rep. 2016;6:31911.
doi:10.1038/srep31911.
118. Drömann D, Rupp J, Rohmann K, et al. The TGF-beta-Pseudoreceptor BAMBI is strongly expressed
in COPD lungs and regulated by nontypeable Haemophilus influenzae. Respir Res. 2010;11:67.
doi:10.1186/1465-9921-11-67.
119. Langenfeld EM, Kong Y, Langenfeld J. Bone morphogenetic protein 2 stimulation of tumor
growth involves the activation of Smad-1/5. Oncogene. 2006;25(5):685-692. doi:10.1038/
sj.onc.1209110.
120. Chen J, Ye L, Xie F, Yang Y, Zhang L, Jiang WG. Expression of bone morphogenetic protein 7 in lung
cancer and its biological impact on lung cancer cells. Anticancer Res. 2010;30(4):1113-1120.
121. Atkinson C, Stewart S, Upton PD, et al. Primary Pulmonary Hypertension Is Associated With
Reduced Pulmonary Vascular Expression of Type II Bone Morphogenetic Protein Receptor.
Circulation. 2002;105(14):1672-1678. doi:10.1161/01.CIR.0000012754.72951.3D.
122. Yao Y, Jumabay M, Wang A, Boström KI. Matrix Gla protein deficiency causes arteriovenous
malformations in mice. J Clin Invest. 2011;121(8):2993-3004. doi:10.1172/JCI57567.
123. Frank DB, Lowery J, Anderson L, Brink M, Reese J, Caestecker M de. Increased susceptibility to
hypoxic pulmonary hypertension in Bmpr2 mutant mice is associated with endothelial dysfunction
in the pulmonary vasculature. Am J Physiol - Lung Cell Mol Physiol. 2008;294(1):L98-L109.
doi:10.1152/ajplung.00034.2007.
124. International PPH Consortium, Lane KB, Machado RD, et al. Heterozygous germline mutations
in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. Nat
Genet. 2000;26(1):81-84. doi:10.1038/79226.
125. Machado RD, Aldred MA, James V, et al. Mutations of the TGF-beta type II receptor BMPR2 in
pulmonary arterial hypertension. Hum Mutat. 2006;27(2):121-132. doi:10.1002/humu.20285.
126. Hong K-H, Lee YJ, Lee E, et al. Genetic ablation of the BMPR2 gene in pulmonary endothelium is
sufficient to predispose to pulmonary arterial hypertension. Circulation. 2008;118(7):722-730.
doi:10.1161/CIRCULATIONAHA.107.736801.
127. Takahashi H, Goto N, Kojima Y, et al. Downregulation of type II bone morphogenetic
protein receptor in hypoxic pulmonary hypertension. Am J Physiol - Lung Cell Mol Physiol.
2006;290(3):L450-L458. doi:10.1152/ajplung.00206.2005.
128. Morty RE, Nejman B, Kwapiszewska G, et al. Dysregulated bone morphogenetic protein signaling
in monocrotaline-induced pulmonary arterial hypertension. Arterioscler Thromb Vasc Biol.
2007;27(5):1072-1078. doi:10.1161/ATVBAHA.107.141200.
129. Cahill E, Costello CM, Rowan SC, et al. Gremlin plays a key role in the pathogenesis of pulmonary
25
 hypertension. Circulation. 2012;125(7):920-930. doi:10.1161/CIRCULATIONAHA.111.038125.
130. Shibanuma M, Mashimo J, Mita A, Kuroki T, Nose K. Cloning from a mouse osteoblastic cell line
of a set of transforming-growth-factor-beta 1-regulated genes, one of which seems to encode a
follistatin-related polypeptide. Eur J Biochem FEBS. 1993;217(1):13-19.
131. Hambrock HO, Kaufmann B, Müller S, et al. Structural characterization of TSC-36/Flik: analysis of
two charge isoforms. J Biol Chem. 2004;279(12):11727-11735. doi:10.1074/jbc.M309318200.
132. Zwijsen A, Blockx H, Van Arnhem W, et al. Characterization of a rat C6 glioma-secreted follistatin-
related protein (FRP). Cloning and sequence of the human homologue. Eur J Biochem FEBS.
1994;225(3):937-946.
133. Patel K, Connolly DJ, Amthor H, Nose K, Cooke J. Cloning and early dorsal axial expression of Flik,
a chick follistatin-related gene: evidence for involvement in dorsalization/neural induction. Dev
Biol. 1996;178(2):327-342. doi:10.1006/dbio.1996.0222.
134. Okabayashi K, Shoji H, Onuma Y, et al. cDNA cloning and distribution of the Xenopus follistatin-
related protein. Biochem Biophys Res Commun. 1999;254(1):42-48. doi:10.1006/bbrc.1998.9892.
135. Tochitani S, Liang F, Watakabe A, Hashikawa T, Yamamori T. The occ1 gene is preferentially
expressed in the primary visual cortex in an activity-dependent manner: a pattern of gene
expression related to the cytoarchitectonic area in adult macaque neocortex. Eur J Neurosci.
2001;13(2):297-307.
136. Sun Y-W, Li F-G, Chen J, Jiang X-Y, Zou S-M. Two follistatin-like 1 homologs are differentially
expressed in adult tissues and during embryogenesis in grass carp (Ctenopharyngodon idellus).
Gen Comp Endocrinol. 2015;223:1-8. doi:10.1016/j.ygcen.2015.09.017.
137. Li L, Li X, Liu X, et al. Expression, characterization, and preliminary X-ray crystallographic
analysis of recombinant murine Follistatin-like 1 expressed in Drosophila S2 cells. Biosci Trends.
2013;7(2):93-100.
138. Adams D, Larman B, Oxburgh L. Developmental expression of mouse Follistatin-like 1 (Fstl1):
Dynamic regulation during organogenesis of the kidney and lung. Gene Expr Patterns.
2007;7(4):491-500. doi:10.1016/j.modgep.2006.10.009.
139. Umezu T, Yamanouchi H, Iida Y, Miura M, Tomooka Y. Follistatin-like-1, a diffusible mesenchymal
factor determines the fate of epithelium. Proc Natl Acad Sci U S A. 2010;107(10):4601-4606.
doi:10.1073/pnas.0909501107.
140. Oshima Y, Ouchi N, Sato K, Izumiya Y, Pimentel DR, Walsh K. Follistatin-like 1 is an Akt-regulated
cardioprotective factor that is secreted by the heart. Circulation. 2008;117(24):3099-3108.
doi:10.1161/CIRCULATIONAHA.108.767673.
141. Shimano M, Ouchi N, Nakamura K, et al. Cardiac myocyte follistatin-like 1 functions to attenuate
hypertrophy following pressure overload. Proc Natl Acad Sci U S A. 2011;108(43):E899-906.
doi:10.1073/pnas.1108559108.
142. Hayakawa S, Ohashi K, Shibata R, et al. Cardiac Myocyte-Derived Follistatin-Like 1 Prevents
Renal Injury in a Subtotal Nephrectomy Model. J Am Soc Nephrol JASN. 2015;26(3):636-646.
doi:10.1681/ASN.2014020210.
143. Wei K, Serpooshan V, Hurtado C, et al. Epicardial FSTL1 reconstitution regenerates the adult
mammalian heart. Nature. 2015;525(7570):479-485. doi:10.1038/nature15372.
144. Miyabe M, Ohashi K, Shibata R, et al. Muscle-derived follistatin-like 1 functions to reduce
neointimal formation after vascular injury. Cardiovasc Res. 2014;103(1):111-120. doi:10.1093/
cvr/cvu105.
145. Görgens SW, Raschke S, Holven KB, Jensen J, Eckardt K, Eckel J. Regulation of follistatin-like
protein 1 expression and secretion in primary human skeletal muscle cells. Arch Physiol Biochem.
2013;119(2):75-80. doi:10.3109/13813455.2013.768270.
146. Wu Y, Zhou S, Smas CM. Downregulated expression of the secreted glycoprotein follistatin-like
1 (Fstl1) is a robust hallmark of preadipocyte to adipocyte conversion. Mech Dev. 2010;127(3-
4):183-202. doi:10.1016/j.mod.2009.12.003.
147. Kim H-J, Kang WY, Seong SJ, Kim S-Y, Lim M-S, Yoon Y-R. Follistatin-like 1 promotes osteoclast
formation via RANKL-mediated NF-κB activation and M-CSF-induced precursor proliferation. Cell
Signal. 2016;28(9):1137-1144. doi:10.1016/j.cellsig.2016.05.018.
148. Ouchi N, Oshima Y, Ohashi K, et al. Follistatin-like 1, a secreted muscle protein, promotes
endothelial cell function and revascularization in ischemic tissue through a nitric-oxide synthase-
26
dependent mechanism. J Biol Chem. 2008;283(47):32802-32811. doi:10.1074/jbc.M803440200.
149. Li K-C, Zhang F-X, Li C-L, et al. Follistatin-like 1 suppresses sensory afferent transmission by
activating Na+,K+-ATPase. Neuron. 2011;69(5):974-987. doi:10.1016/j.neuron.2011.01.022.
150. Mouillet J-F, Mishima T, Paffaro AM do A, et al. The expression and post-transcriptional regulation 1
of FSTL1 transcripts in placental trophoblasts. Placenta. 2015;36(11):1231-1238. doi:10.1016/j.
placenta.2015.09.005.
151. Sylva M, Moorman AFM, van den Hoff MJB. Follistatin-like 1 in vertebrate development. Birth
Defects Res Part C Embryo Today Rev. 2013;99(1):61-69. doi:10.1002/bdrc.21030.
152. Chaly Y, Fu Y, Marinov A, et al. Follistatin-like protein 1 enhances NLRP3 inflammasome-
mediated IL-1β secretion from monocytes and macrophages. Eur J Immunol. 2014;44(5):1467-
1479. doi:10.1002/eji.201344063.
153. Wilson DC, Marinov AD, Blair HC, et al. Follistatin-like protein 1 is a mesenchyme-derived
inflammatory protein and may represent a biomarker for systemic-onset juvenile rheumatoid
arthritis. Arthritis Rheum. 2010;62(8):2510-2516. doi:10.1002/art.27485.
154. Miyamae T, Marinov AD, Sowders D, et al. Follistatin-Like Protein-1 Is a Novel Proinflammatory
Molecule. J Immunol. 2006;177(7):4758-4762. doi:10.4049/jimmunol.177.7.4758.
155. Chaly Y, Marinov AD, Oxburgh L, Bushnell DS, Hirsch R. FSTL1 promotes arthritis in mice by
enhancing inflammatory cytokine/chemokine expression. Arthritis Rheum. 2012;64(4):1082-
1088. doi:10.1002/art.33422.
156. Sundaram GM, Common JEA, Gopal FE, et al. /`See-saw/’ expression of microRNA-198 and
FSTL1 from a single transcript in wound healing. Nature. 2013;495(7439):103-106. doi:10.1038/
nature11890.
157. Shi D-L, Shi G-R, Xie J, Du X-Z, Yang H. MicroRNA-27a Inhibits Cell Migration and Invasion of
Fibroblast-Like Synoviocytes by Targeting Follistatin-Like Protein 1 in Rheumatoid Arthritis. Mol
Cells. 2016;39(8):611-618. doi:10.14348/molcells.2016.0103.
158. Liu M, Liu R, Wu H, et al. Radix puerariae extracts ameliorate paraquat-induced pulmonary
fibrosis by attenuating follistatin-like 1 and nuclear factor erythroid 2p45-related factor-2
signalling pathways through downregulation of miRNA-21 expression. BMC Complement Altern
Med. 2016;16:11. doi:10.1186/s12906-016-0991-6.
159. Rosenberg MI, Georges SA, Asawachaicharn A, Analau E, Tapscott SJ. MyoD inhibits Fstl1 and Utrn
expression by inducing transcription of miR-206. J Cell Biol. 2006;175(1):77-85. doi:10.1083/
jcb.200603039.
160. Geng Y, Dong Y, Yu M, et al. Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP)
4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A.
2011;108(17):7058-7063. doi:10.1073/pnas.1007293108.
161. Sylva M, Li VSW, Buffing AAA, et al. The BMP antagonist follistatin-like 1 is required for skeletal
and lung organogenesis. PloS One. 2011;6(8):e22616. doi:10.1371/journal.pone.0022616.
162. Ouchi N, Asaumi Y, Ohashi K, et al. DIP2A functions as a FSTL1 receptor. J Biol Chem.
2010;285(10):7127-7134. doi:10.1074/jbc.M109.069468.
163. Tanaka M, Murakami K, Ozaki S, et al. DIP2 disco-interacting protein 2 homolog A (Drosophila)
is a candidate receptor for follistatin-related protein/follistatin-like 1--analysis of their binding
with TGF-β superfamily proteins. FEBS J. 2010;277(20):4278-4289. doi:10.1111/j.1742-
4658.2010.07816.x.
164. Liang X, Hu Q, Li B, et al. Follistatin-Like 1 Attenuates Apoptosis via Disco-Interacting
Protein 2 Homolog A/Akt Pathway After Middle Cerebral Artery Occlusion in Rats. Stroke.
2014;45(10):3048-3054. doi:10.1161/STROKEAHA.114.006092.
165. Murakami K, Tanaka M, Usui T, et al. Follistatin-related protein/follistatin-like 1 evokes an
innate immune response via CD14 and toll-like receptor 4. FEBS Lett. 2012;586(4):319-324.
doi:10.1016/j.febslet.2012.01.010.
166. Guo J, Liang W, Li J, Long J. Knockdown of FSTL1 inhibits oxLDL-induced inflammation responses
through the TLR4/MyD88/NF-κB and MAPK pathway. Biochem Biophys Res Commun. August
2016. doi:10.1016/j.bbrc.2016.08.138.
167. Liu R, Yang Y, Shen J, et al. Fstl1 is involved in the regulation of radial glial scaffold development.
Mol Brain. 2015;8:53. doi:10.1186/s13041-015-0144-8.
168. van den Berg G, Somi S, Buffing AAM, Moorman AFM, van den Hoff MJB. Patterns of expression
27
 of the Follistatin and Follistatin-like1 genes during chicken heart development: a potential
role in valvulogenesis and late heart muscle cell formation. Anat Rec Hoboken NJ 2007.
2007;290(7):783-787. doi:10.1002/ar.20559.
169. Towers P, Patel K, Withington S, Isaac A, Cooke J. Flik, a chick follistatin-related gene, functions
in gastrular dorsalisation/neural induction and in subsequent maintenance of midline Sonic
hedgehog signalling. Dev Biol. 1999;214(2):298-317. doi:10.1006/dbio.1999.9421.
170. Ni S, Miao K, Zhou X, et al. The involvement of follistatin-like protein 1 in osteoarthritis by
elevating NF-κB-mediated inflammatory cytokines and enhancing fibroblast like synoviocyte
proliferation. Arthritis Res Ther. 2015;17:91. doi:10.1186/s13075-015-0605-6.
171. Chaly Y, Blair HC, Smith SM, et al. Follistatin-like protein 1 regulates chondrocyte proliferation
and chondrogenic differentiation of mesenchymal stem cells. Ann Rheum Dis. 2015;74(7):1467-
1473. doi:10.1136/annrheumdis-2013-204822.
172. Zhou X, Xiao X, Huang T, et al. Epigenetic inactivation of follistatin-like 1 mediates tumor immune
evasion in nasopharyngeal carcinoma. Oncotarget. 2016;7(13):16433-16444. doi:10.18632/
oncotarget.7654.
173. Maruyama S, Nakamura K, Papanicolaou KN, et al. Follistatin-like 1 promotes cardiac
fibroblast activation and protects the heart from rupture. EMBO Mol Med. 2016;8(8):949-966.
doi:10.15252/emmm.201506151.
174. Chen W, Xia J, Hu P, et al. Follistatin-like 1 protects cardiomyoblasts from injury induced by
sodium nitroprusside through modulating Akt and Smad1/5/9 signaling. Biochem Biophys Res
Commun. 2016;469(3):418-423. doi:10.1016/j.bbrc.2015.12.026.
175. Lara-Pezzi E, Felkin LE, Birks EJ, et al. Expression of follistatin-related genes is altered in heart
failure. Endocrinology. 2008;149(11):5822-5827. doi:10.1210/en.2008-0151.
176. Ogura Y, Ouchi N, Ohashi K, et al. Therapeutic impact of follistatin-like 1 on myocardial
ischemic injury in preclinical models. Circulation. 2012;126(14):1728-1738. doi:10.1161/
CIRCULATIONAHA.112.115089.
177. Alteköester A-K, Harvey RP. Bioengineered FSTL1 Patches Restore Cardiac Function
Following Myocardial Infarction. Trends Mol Med. 2015;21(12):731-733. doi:10.1016/j.
molmed.2015.10.006.
178. Chaly Y, Hostager B, Smith S, Hirsch R. Follistatin-like protein 1 and its role in inflammation and
inflammatory diseases. Immunol Res. 2014;59(1-3):266-272. doi:10.1007/s12026-014-8526-z.
179. Ehara Y, Sakurai D, Tsuchiya N, et al. Follistatin-related protein gene (FRP) is expressed in the
synovial tissues of rheumatoid arthritis, but its polymorphisms are not associated with genetic
susceptibility. Clin Exp Rheumatol. 2004;22(6):707-712.
180. Clutter SD, Wilson DC, Marinov AD, Hirsch R. Follistatin-Like Protein 1 Promotes Arthritis by Up-
Regulating IFN-γ. J Immunol. 2009;182(1):234-239. doi:10.4049/jimmunol.182.1.234.
181. Gorelik M, Fall N, Altaye M, et al. Follistatin-like protein 1 and the ferritin/erythrocyte
sedimentation rate ratio are potential biomarkers for dysregulated gene expression and
macrophage activation syndrome in systemic juvenile idiopathic arthritis. J Rheumatol.
2013;40(7):1191-1199. doi:10.3899/jrheum.121131.
182. Campfield BT, Nolder CL, Marinov A, et al. Follistatin-like protein 1 is a critical mediator of
experimental Lyme arthritis and the humoral response to Borrelia burgdorferi infection. Microb
Pathog. 2014;73:70-79. doi:10.1016/j.micpath.2014.04.005.
183. Fan N, Sun H, Wang Y, et al. Follistatin-Like 1: A Potential Mediator of Inflammation in Obesity.
Mediators Inflamm. 2013;2013:e752519. doi:10.1155/2013/752519.
184. Tanaka M, Ozaki S, Kawabata D, et al. Potential preventive effects of follistatin‐related protein/
TSC‐36 on joint destruction and antagonistic modulation of its autoantibodies in rheumatoid
arthritis. Int Immunol. 2003;15(1):71-77. doi:10.1093/intimm/dxg005.
185. Kawabata D, Tanaka M, Fujii T, et al. Ameliorative effects of follistatin-related protein/TSC-36/
FSTL1 on joint inflammation in a mouse model of arthritis. Arthritis Rheum. 2004;50(2):660-668.
doi:10.1002/art.20023.
186. Le Luduec JB, Condamine T, Louvet C, et al. An Immunomodulatory Role for Follistatin-Like 1
in Heart Allograft Transplantation. Am J Transplant. 2008;8(11):2297-2306. doi:10.1111/j.1600-
6143.2008.02398.x.
187. Adams DC, Karolak MJ, Larman BW, Liaw L, Nolin JD, Oxburgh L. Follistatin-like 1 regulates renal
28
IL-1β expression in cisplatin nephrotoxicity. Am J Physiol - Ren Physiol. 2010;299(6):F1320-F1327.
doi:10.1152/ajprenal.00325.2010.
188. Wang Y, Li D, Xu N, et al. Follistatin-like protein 1: a serum biochemical marker reflecting the
severity of joint damage in patients with osteoarthritis. Arthritis Res Ther. 2011;13(6):R193. 1
doi:10.1186/ar3522.
189. El-Armouche A, Ouchi N, Tanaka K, et al. Follistatin-like 1 in chronic systolic heart failure:
a marker of left ventricular remodeling. Circ Heart Fail. 2011;4(5):621-627. doi:10.1161/
CIRCHEARTFAILURE.110.960625.
190. Widera C, Horn-Wichmann R, Kempf T, et al. Circulating concentrations of follistatin-like
1 in healthy individuals and patients with acute coronary syndrome as assessed by an
immunoluminometric sandwich assay. Clin Chem. 2009;55(10):1794-1800. doi:10.1373/
clinchem.2009.129411.
191. Hayakawa S, Ohashi K, Shibata R, et al. Association of Circulating Follistatin-Like 1 Levels with
Inflammatory and Oxidative Stress Markers in Healthy Men. PloS One. 2016;11(5):e0153619.
doi:10.1371/journal.pone.0153619.
192. Sumitomo K, Kurisaki A, Yamakawa N, et al. Expression of a TGF-beta1 inducible gene, TSC-36,
causes growth inhibition in human lung cancer cell lines. Cancer Lett. 2000;155(1):37-46.
193. Zhao W, Han H-B, Zhang Z-Q. Suppression of lung cancer cell invasion and metastasis by
connexin43 involves the secretion of follistatin-like 1 mediated via histone acetylation. Int J
Biochem Cell Biol. 2011;43(10):1459-1468. doi:10.1016/j.biocel.2011.06.009.
194. Bae K, Park KE, Han J, Kim J, Kim K, Yoon K-A. Mitotic cell death caused by follistatin-like 1
inhibition is associated with up-regulated Bim by inactivated Erk1/2 in human lung cancer cells.
Oncotarget. 2016;7(14):18076-18084. doi:10.18632/oncotarget.6729.
195. Hodgson G, Hager JH, Volik S, et al. Genome scanning with array CGH delineates regional
alterations in mouse islet carcinomas. Nat Genet. 2001;29(4):459-464. doi:10.1038/ng771.
196. Ding T, He X-Z, Xu X-L, Xu H-Y, Zhou C-X, Wang Y-J. [Expression of serum FSTL-1 in bone
metastasis of prostate cancer and its clinical implication]. Zhonghua Nan Ke Xue Natl J Androl.
2014;20(12):1090-1092.
197. Kudo-Saito C, Fuwa T, Murakami K, Kawakami Y. Targeting FSTL1 Prevents Tumor Bone Metastasis
and Consequent Immune Dysfunction. Cancer Res. 2013;73(20):6185-6193. doi:10.1158/0008-
5472.CAN-13-1364.
198. Chan QKY, Ngan HYS, Ip PPC, Liu VWS, Xue WC, Cheung ANY. Tumor suppressor effect of
follistatin-like 1 in ovarian and endometrial carcinogenesis: a differential expression and
functional analysis. Carcinogenesis. 2009;30(1):114-121. doi:10.1093/carcin/bgn215.
199. Ciarmela P, Florio P, Sigurdardottir M, et al. Follistatin-related gene expression, but not follistatin
expression, is decreased in human endometrial adenocarcinoma. Eur J Endocrinol Eur Fed
Endocr Soc. 2004;151(2):251-257.
200. Reddy SP, Britto R, Vinnakota K, et al. Novel glioblastoma markers with diagnostic and prognostic
value identified through transcriptome analysis. Clin Cancer Res Off J Am Assoc Cancer Res.
2008;14(10):2978-2987. doi:10.1158/1078-0432.CCR-07-4821.
201. Trojan L, Schaaf A, Steidler A, et al. Identification of metastasis-associated genes in prostate
cancer by genetic profiling of human prostate cancer cell lines. Anticancer Res. 2005;25(1A):183-
191.
202. Sepporta MV, Tumminello FM, Flandina C, et al. Follistatin as potential therapeutic target in
prostate cancer. Target Oncol. 2013;8(4):215-223. doi:10.1007/s11523-013-0268-7.
203. Kudo-Saito C. FSTL1 promotes bone metastasis by causing immune dysfunction. Oncoimmunology.
2013;2(11). doi:10.4161/onci.26528.
204. Tan X, Zhai Y, Chang W, et al. Global analysis of metastasis-associated gene expression in primary
cultures from clinical specimens of clear-cell renal-cell carcinoma. Int J Cancer. 2008;123(5):1080-
1088. doi:10.1002/ijc.23637.
205. Liu Y, Han X, Yu Y, et al. A genetic polymorphism affects the risk and prognosis of renal cell
carcinoma: association with follistatin-like protein 1 expression. Sci Rep. 2016;6:26689.
doi:10.1038/srep26689.
206. Mashimo J ’ichi, Maniwa R, Sugino H, Nose K. Decrease in the expression of a novel TGF β1-
inducible and ras-recision gene, TSC-36, in human cancer cells. Cancer Lett. 1997;113(1):213-
29
 CHAPTER 2

Endothelial Follistatin-like 1 regulates

the postnatal development of
the pulmonary vasculature
by modulating BMP/Smad signaling

Navessa P. Tania, Harm Maarsingh, I. Sophie T. Bos, Andrea Mattiotti,

Stuti Prakash, Wim Timens, Quinn D. Gunst, Luis J Jimenez-Borreguero,
Martina Schmidt, Maurice J.B. van den Hoff, Reinoud Gosens
Endothelial follistatin-like-1 regulates the postnatal development of the pulmonary
vasculature by modulating BMP/Smad signaling.
Navessa P. Tania1, Harm Maarsingh2, I. Sophie T. Bos1, Andrea Mattiotti3, Stuti
Prakash3, Wim Timens4, Quinn D. Gunst3, Luis J Jimenez-Borreguero5, Martina
Schmidt1, Maurice J.B. van den Hoff3, Reinoud Gosens1
1
University of Groningen, Department of Molecular Pharmacology, Groningen
Research Institute for Asthma and COPD, Groningen, The Netherlands.
2
Palm Beach Atlantic University, Department of Pharmaceutical Sciences, Lloyd L.
Gregory School of Pharmacy, West Palm Beach, Florida, USA.
3
Academic Medical Center, Department of Anatomy, Embryology and Physiology,
Amsterdam,The Netherlands.
4
University of Groningen, University Medical Center Groningen, Department of
Pathology and Medical Biology, Groningen Research Institute for Asthma and COPD,
Groningen, The Netherlands.
5
Centro Nacional de Investigaciones Cardiovasculares & Hospital de La Princesa,
Madrid, Spain.
32
Abstract
BMP signaling regulates vascular smooth muscle maturation, endothelial cell
proliferation and tube formation. The endogenous BMP antagonist Follistatin-like
1 (Fstl1) is highly expressed in pulmonary vascular endothelium of the developing
mouse lung, suggesting a role in pulmonary vascular formation and vascular
homeostasis. The aim of this study was to investigate the role of Fstl1 in the pulmonary
2
vascular endothelium. To this aim, Fstl1 was conditionally deleted from endothelial
and endothelial-derived cells using Tie2-credrivenFstl1-KO mice (Fstl1-eKO mice).
Endothelial-specific Fstl1 deletion was postnatally lethal, as ~70% of Fstl1-eKO mice
died at 3 weeks after birth. Deletion of Fstl1 from endothelium resulted in a reduction
of right ventricular output at 3 weeks after birth compared to controls. This was
associated with pulmonary vascular remodeling, as the percentage of actin positive
small pulmonary vessels was increased at 3 weeks in Fstl1-eKO mice compared to
controls. Endothelial deletion of Fstl1 resulted in activation of Smad1/5/8 signaling
and increased BMP/Smad-regulated gene expression of Jagged1, Endoglin, and
Gata2 at 1 week after birth compared to controls. In addition, potent vasoconstrictor
Endothelin-1, the expression of which is driven by Gata2, was increased in
expression,both on the mRNA and protein level,at 1 week after birth compared to
controls. At 3 weeks, Jagged1 was reduced in the Fstl1-eKO mice whereas Endoglin
and Endothelin-1 were unchanged.In conclusion, loss of endothelial Fstl1 in the
lung is associated with elevated BMP-regulated genes, impaired small pulmonary
vascular remodeling and decreased right ventricular output.
33
Introduction
Pulmonary vascular development and maturation is a tightly controlledprocess
that isorchestrated by multiple signaling pathways, including Bone Morphogenetic
Protein (BMP),which control spatio-temporal gene expression patterns. BMP
signaling is important in embryonicvascular developmentand adult vascular
homeostasis.1,2Dysregulation of BMP signaling has been strongly associated with
the pathogenesis of hereditary vascular diseases, including familial pulmonary
arterial hypertension (PAH), hereditary hemorrhagic telangiectasia, atherosclerosis
and cerebral cavernous malformation.3–11BMP signaling regulates vascular smooth
muscle maturation, endothelial cell proliferation and tube formation.9,12 Tight spatio-
temporal control of BMP signaling and biological availability is therefore crucial for
the normal development of vascular structure and function, including in the lung.
BMP ligands elicittheir activity by binding to typeI BMP receptors (ALK1,
2,3,and 6) and by recruitingtype II BMP receptors (BMPRII, ACVRIIA, and ACVRIIB).
After forming a heterotetrameric complex, the signal propagates to the nucleus
byspecifically phosphorylating the Smad proteinsSmad1/5/8. Phosphorylated
Smad1/5/8 proteins form a complex with Smad4,which results in accumulation of
this complex in the nucleus. This directly and indirectly influences transcription of
target genes, among which Endoglin, Gata2 and Jagged1.13
Follistatin-like 1 (Fstl1) is anendogenous BMP antagonist that is highly expressed
in pulmonary vascular endothelium of thedeveloping mouse lung, suggesting a
role in pulmonary vasculature development.14,15Fstl1 is important for normal lung
development.In fact, multiple organ defects were observed in whole-body knockout
of Fstl1 (Fstl1-KO).15,16Fstl1-KOmice showed increased thickness of alveolar walls and
increased numbers of immature cuboidal alveolar epithelial cells in the lung.15,16
In addition, Fstl1-KOmice exhibited impaired tracheal cartilage formation, alveolar
maturation and lung morphogenesis, resulting in respiratory failure and in postnatal
lethality in mice.15,16Major defects in cardiac and skeletal development were
alsoreported in Fstl1-KOmice.15,16
Given the complex nature of BMP signaling and the predominant endothelial
expression of the BMP antagonist Fstl1 in the developing lung, this study aimed to
explore therole of endothelial Fstl1 signaling in pulmonary vascular development
using Tie2-cremediated endothelial-specific deletion of Fstl1 in vivo. Specifically,
we aimed to investigate the impact of Fstl1 deletion on the morphology of the
pulmonary vasculature, on gene expression associated with BMP signaling, and its
implication on pulmonary function.
34
Materials and Methods
Antibodies and reagents
Polyclonal rabbit anti-Fstl1 (#HPA035251), polyclonal rabbit anti-Jagged1
(#HPA021555),and monoclonal mouse anti-β-actin (#A5441) were purchased
from Sigma Aldrich (St. Louis, MO, USA). Polyclonal rabbit anti-α-smooth muscle
actin(α-SMA,#AB5694) and polyclonal rabbit anti-CD31 (#AB28364)were obtained 2
from Abcam(Cambridge, UK). Polyclonal goat anti-mouse Endoglin (#AF1320) was
procured from R&D Systems (Oxford, UK). Polyclonal rabbit anti-phospho-Smad1/5/8
(#AB3848), monoclonal mouse anti-Troponin I (TnI) (#MAB16910)were obtained
from Millipore (Molsheim, France) andpolyclonal rabbit anti-Smad1(#9743) from
Cell Signaling (Danvers, MA, USA). Horseradish peroxidase (HRP)-conjugated donkey
anti-rabbit IgG (#711-035-152), donkey anti-goat IgG (#705-035-003), and donkey
anti-mouse IgG (#715-035-150) were purchased from Jackson Immunoresearch
(West Grove, PA, USA). Alexa Fluor 647 donkey anti-mouse IgG (#A-31571) was
obtained from Thermo Fisher Scientific (Waltham, MA, USA).All other chemicals
were of analytical grade.
Tie-2cre mediated endothelial-specificdeletion of Fstl1
Conditional deletion of Fstl1 from vascular endothelial and endothelial-derived
cells was achievedby crossing floxed homozygousFstl1fl/flmice with double
heterozygousmice carrying one Fstl1 knockoutallele and the Tie2-cre cassette(Fstl1WT/
KO Tie2-cre
)on a FVB background.15,17Within this cross endothelial specific knockout
mice(Fstl1fl/KO Tie2-cre)and littermate controls(Fstl1fl/WT Tie2-cre, Fstl1fl/KO, and Fstl1fl/WT)
were generated.Fstl1fl/KO Tie2-cre mice are denoted as Fstl1-eKO and their littermate
controls are denoted as controls. The breeding lines were maintained in the animal
facility of the University of Amsterdam. All experimental procedures complied with
institutional and national ethical guidelines regarding animal experimentation.
Mice were sacrificed at 1 and 3 weeks after birth (1 week: n=12 Fstl1-eKO mice
and n=16 controls; 3 weeks: n=11Fstl1-eKO miceand n=30 controls). The lung
tissue was collected. Lung lobes (right superior, middle, and inferior lobes) were
inflated with 50% Tissue-Tek (Sakura Finetek;Alphen-aan-den-Rijn, the Netherlands)
in 0.9% NaCl (Braun; Kronberg, Germany) and fixed with 10% v/v formalin for
paraffin-embedded sections. The non-inflated lobes (left and post caval lobes)
were snap-frozen in liquid nitrogen for mRNA and protein analysis. The pups were
genotyped using PCR with Fstl1 and cre-recombinase primer sets. Fstl1forward
(5’-GCCAGAATCCCACTCCATCG- 3’); Fstl1reverse (5’-TCGGAGCCTGGTGATAAGCG-3’);
cre-recombinase forward (5’-GGTTCGCAAGAACCTGATGGACAT-3’); cre-recombinase
reverse (5’-GCTAGAGCCTGTTTTGCACGTTCA-3’).
In situ hybridization
In situ hybridization was performed as previously described.18In short, lung sections
were deparaffinized and rehydrated in a graded series of alcohol, followed by 15
35
min incubation at 37°C in 10 mg/ml proteinase K dissolved in PBS. The sections were were expressed in arbitrary unitsas ratio ofthe starting concentration (N0) of each
post-fixed for 10 min in 4% paraformaldehyde (PFA) and 0.2% glutaraldehyde in geneofinterest corrected to the geometric mean of the N0value of two reference
PBS, followed by rinsing in PBS. Pre-hybridization was done for at least 1 hr at 70°C genes (B2m and Hprt). Comparing the expression levels of the genes of interest
in hybridization mix (50% formamide, 5xSSC (20xSSC; 3 M NaCl, 0.3 M tri-sodium between the three non-conditional knockout groups (Fstl1fl/WT Tie2-cre, Fstl1KO/fl, or
citrate, pH 4.5)), 1% blocking solution, 5 mM EDTA, 0.1% 3-[(3-Cholamidopropyl) Fstl1WT/fl mice), did not reveal significant differences, allowing pooling of the data
dimethylammonio]-1-propanesulfonate (Sigma Aldrich; St. Louis, MO, USA), 0.5 mg/ and using them as age-matched controls.
ml heparin (BD Biosciences; Erembodegem, Belgium), and 1 mg/ml yeast total RNA
Supplementary Table 1. Primers used for qRT-PCR analysis. 2
(Roche Applied Science; Penzberg, Germany). A digoxigenin (DIG)-labeled probe
(1 ng/ml) was added to the hybridization mix. Probes specific to Fstl1 were used. Gene Primer sequence (5’ 3’) NCBI accession number
After overnight hybridization, the sections were rinsed with 2xSSC, followed by Fstl1 Forward TCGCTGTGTCTGTTCCTGTGGC NM_008047.5
two washings(50% formamide, 2xSSC, pH 4.5) at 65°C, and rinsing with TNT (0.1 M Reverse TTCTGCTGTGCCCTGGTGCTTC
Tris-HCl, pH  7.5, 0.15 M NaCl, 0.05% Tween-20) at room temperature. The sections Eng Forward GCACCTTGTCCCAGGAAGTC NM_001146350.1
Reverse GGAGGCTTGGGATACTCACG
were incubated for 1 hr in MABT-block (100 mM maleic acid, 150 mM NaCl, pH 7.4,
Jag1 Forward CCAGTGTCAGAATGACGCCT NM_013822.5
0.05% Tween-20, 2% blocking solution), followed by 2 hr incubation in MABT-block
Reverse AGTGACCCCCATTCAAGCAG
containing 100 mU/ml alkaline phosphatase-conjugated anti-DIG Fab fragments Gata2 Forward CCCCTATCCCGTGAATCCG NM_008090.5
(Sigma Aldrich; St. Louis, MO, USA). After rinsing in TNT and subsequently in NTM Reverse GGTCCACTACTGTGTCTTGGG
(100 mM Tris, pH 9.0, 100 mM NaCl, 50 mM MgCl2), probe binding was visualized Edn1 Forward GGCCCAAAGTACCATGCAGA NM_010104.3
using nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl-phosphate Reverse GATGGCCTCCAACCTTCGTA
(Roche Applied Science; Penzberg, Germany). The sections were dehydrated in B2m Forward ATGGGAAGCCGAACATACTG NM_009735.3
a graded alcohol series, rinsed in xylene, and embedded in Entellan (Millipore; Reverse CAGTCTCAGTGGGGGTGAAT
Molsheim, France). Images were captured using a Leica DFC320 camera mounted Hprt Forward AGGCCAGACTTTGTTGGATTTGA NM_013556.2
on an AxioPhot microscope (Zeiss; Oberkochen, Germany). Reverse ACTGGCAACATCAACAGGACTC
Abbreviations: Fstl1, Follistatin-like 1; Eng, Endoglin; Jag1, Jagged1; Gata2, GATA
Pulmonary physiological measurement binding protein 2; Edn1, Endothelin-1; B2m,b2-microglobulin; and Hprt, hypoxanthine
Pulmonary physiological functions were measured in miceat 1 week (n=4 Fstl1-eKO guanine phosphoribosyl transferase.
mice and n=14 controls)and 3 weeks (n=8 Fstl1-eKO mice and n=19 controls) after
birth using transthoracic echocardiography as previously described.19
Western blot
RNA isolation and real time quantitative PCR Total protein was extracted from lung tissue (left lobe) using RIPA lysis buffer
Total RNA was extracted from lung tissue (post caval lobe) using the NucleoSpin® RNA (RIPA lysis buffer (65 mM Tris, 155 mM NaCl, 1% Igepal CA-630, 0.25% sodium
isolation kit according to the manufacturer’s instruction (Macherey Nagel;Düren, deoxycholate, 1 mM EDTA, pH 7.4) supplemented with protease inhibitors (1 µg/ml
Germany). The total RNA concentration was determined using theNanoDrop® aprotinin, 1 µg/ml leupeptin, 1 µg/ml pepstatin A, 1 mM Na3VO4, 1 mM NaF, 1 mM
ND1000 spectrophotometer (Thermo Fisher Scientific;Waltham, MA, USA). Equal β-glycerophosphate). Equal amounts of protein lysate were subjected to SDS PAGE
amounts of total RNA were reverse transcribed using the Reverse Transcription electrophoresis and transferred to nitrocellulose or polyvinylidene difluoride (PVDF)
System (Promega; Madison, WI, USA) to generate cDNA. Diluted cDNA was mixed membranes to evaluate the expression level of non-phosphorylated (β-actin, Jagged1,
with FastStart Universal SYBR Green Master Mix (Roche Applied Science; Penzberg, Endoglin, total Smad1) , and phosphorylated (pSmad1/5/8)proteins, respectively.
Germany) and gene of interest primer sets (Biolegio;Nijmegen, the Netherlands). Proteins ofinterest were detected using primary antibodies for overnight at 4°C in in
Primer sequences are listed in Supplementary Table 1. Real-time quantitative PCR TBST (50 mM Tris-HCl, 150 mM NaCl, 0.05% (w/v) Tween-20, pH 7.4). The following
was performed using the Illumina Eco Personal qPCR System (Westburg; Leusden, day, membranes were incubated with HRP-conjugated secondary antibodies for 2 hr
The Netherlands). The qPCR reaction was started by denaturation at 95°C for 15 at room temperature. Protein bands were subsequently visualized using enhanced
minutes followed by 45 cycles of denaturation at 94°C for 30 s, annealing at 59°C chemiluminescence substrate(Perkin Elmer; Groningen, the Netherlands)using the
for 30 s and elongation at 72°C for 30 s. Final elongation was for 5 minutes at 72 °C. G-box gel documentation system (Syngene; Cambridge, UK). Protein band intensities
Real time PCR data was analyzed using LinRegPCR software version 2013.1.20 Data were quantified using Image Studio Lite version 5. Data are presented as ratio of non-

36 37
phosphorylated protein band intensity corrected to b-actinas a reference protein.
For phosphorylated proteins, data are presented as ratio of phosphorylated protein
corrected to total protein.
Immunostaining
Paraffin-embedded lung tissues were sectioned at 5 µm thickness and stained
for α-SMA (Abcam; Cambridge, UK), which was visualized by staining with HRP-
conjugated secondary antibody and diaminobenzidine as a substrate (Sigma
Aldrich; St. Louis, MO, USA). To determine the actin content in large vessels (>50
µm in diameter),21 the α-SMA staining surrounding muscular and elastic vessels
was digitally captured in two lung tissue sections per animal and quantified using
Image J (National Institute of Health, USA) in a blinded fashion. Data are expressed
as ratio of the actin positive area over the square of the length of the tunica intima.
To determine the total number of small vessels (<50 µm in diameter),21CD31 staining
was performed in serial sections to stain for endothelial cells. Data are expressed
as the total number of CD31-positive small vessels corrected to lung surface area
(cm2). Furthermore, the number of actin positive small vessels as well as the total
number of CD31-positive small vessels was quantified in two lung tissue sections
per animal, in a blinded fashion. Data are expressed as the number of actin positive
small vessels corrected to the total number of CD31-positive small vessels. To
evaluate muscularization of the right heart, paraffin-embedded heart tissues were
sectioned at 10 µm and stained using the myocardial marker TnI which was visualized
by staining with Alexa Fluor 647-conjugated secondary antibody. The images were
digitally captured in a blinded manner using a fluorescent microscope (Leica Dm6000;
Wetzlar, Germany). The right ventricular free wall was outlined in each section and
the mean fluorescence intensity of the outlined structure was measured using 3D
Amira software (Version 5.4.3).
Endothelin-1 enzyme-linked immunosorbent assays (ELISA)
The Endothelin-1 protein concentration in lung homogenates was determined using
ELISA according to the manufacturer’s protocol (R&D system;Oxford,UK) in duplicate.
The sample absorbance was determined at 450 nm and at 570 nm to correct for
optical imperfections using Gen5an software using a plate reader (BioTek; Winooski,
VT, USA). The lower and upper detection limits for Endothelin-1 were 0.39 pg/ml
and 25 pg/ml, respectively.
Hematoxylin and eosin staining
Paraffin-embedded lung tissue sections of 5 µm thick were deparaffinized and
rehydrated in a graded series of alcohol, followed by hematoxylin staining. After
washing with flowing water, sections were counterstained with eosin. The sections
were dehydrated in a graded series of alcohol, rinsed in xylene, and embedded
38
in KP-mounting medium (Klinipath BV;Duiven, the Netherlands). Images were
captured using Cell^D imaging software using a light microscope (Olympus BX41;
Zoeterwoude, the Netherlands).
Data analysis
Data are presented as medians per genotype-group except otherwise stated.
To determine the normality of data distribution, a Shapiro-Wilk normality test 2
was performed prior to further statistical analysis. The statistical significance of
differences of normally distributed data was performed using an independent
samples 2-tailedt-test for comparing 2 groups or a two-way ANOVA followed by a
post hocTukey multiple comparisons test for comparing more than 2 groups. For non-
Gaussian distributed data, the statistical significance of differences was determined
usinga non-parametric Mann-Whitney U test for comparing 2 groups or non-
parametric one-way ANOVA with apost hoc Kruskal-Wallis multiple comparisons test
for comparing more than 2 groups. The Bonferroni correction was used to correct for
multiple testing. Differences were considered to be statistically significant at p<0.05.
Results
Loss of Fstl1 from endothelial cells is postnatally lethal in mice.
We and others have previously demonstrated that the homozygote global Fstl1
knockout mice die at birth due to respiratory distress. Here, we generated a mouse
line in which Fstl1 is conditionally impaired in endothelial and endothelial-derived
cells using Tie2-cre targeted gene deletion, which will be referred to as Fstl1-eKO.
Fstl1-eKO knockout pups were born alive at the expected Mendelian ratio (25%).
However, ~70% of Fstl1-eKO mice had died by 3 weeks after birth whereas all their
littermate controls, Fstl1fl/WT Tie2-cre, Fstl1KO/fl, and Fstl1WT/fl mice survived(Figure 1A). In
contrast to Fstl1-KO mice, which display abnormal tracheal cartilage formation and
thickening of alveolar septa, Fstl1-eKO mice had macroscopically normal tracheal
cartilage formation and normal alveolarization (Figure S1). In view of the postnatal
lethality of Fstl1-eKO mice and the marked differences with the globalFstl1-KOmice,
we quantified Fstl1 mRNA and protein in the lungs of these animals. Fstl1 was highly
expressed in the control mice at 1 week after birth and significantly declined 3 weeks
after birth (mRNA p<0.005; protein p<0.05; Figure 1B and 1C), suggesting Fstl1 is
crucial in the early stages of postnatal lung development. The expression of Fstl1
mRNA and protein in lung homogenates of Fstl1-eKO mice were significantly reduced
compared to age-matched controls at 1 week after birth (mRNA p<0.005; protein
p<0.05; Figure 1B and 1C), whereas at 3 weeks after birth the expression of Fstl1
mRNA and protein were not significantly different in Fstl1-eKO mice compared to
age-matched controls (Figure 1B and 1C). In situ hybridization on sections of control
mice showed expression of Fstl1 mRNA both in blood vessels and lung parenchyma
at 1 week. At 3 weeks after birth the pattern of expression was not different, though
39
the staining intensity was markedly less, which is in line with the qPCR findings
(Figure 1D). In the Fstl1-eKO mice, the expression pattern of Fstl1 mRNA was similar
to the control mice, except that Fstl1 mRNA was not or hardly detectable in the
endothelium of the blood vesselsboth at 1 and 3 weeks after birth (Figure 1D).
. normal postnatal development, a significant increase in right ventricular output was
Figure 1. Endothelial deletion of Fstl1 in mice is postnatally lethal. (A) Kaplan Meijer survival
curve of Fstl1-eKO mice compared to controls. ~70% of Fstl1-eKO mice died at 3 weeks after
birth compared to controls. (B) Gene expression analysis of Fstl1 in lung homogenates using
quantitative real time PCR. Horizontal line represents the median of 16-30 mice per group.
(C) Immunoblot analysis of Fstl1 protein in lung homogenates. Data are expressed as means
± SEM of the ratio of Fstl1 protein corrected to β-actin as a reference protein from 4-9 mice
per group. (D) Representative images of Fstl1 in situ hybridization in lung tissue of Fstl1-
eKO mice compared to controls. Red arrowheads point to the absence or presence of Fstl1
probes. AW indicates an airway and V indicates a blood vessel. Each data point represents
an individual animal. *p<0.05; **p<0.01; ***p<0.005 compared to the indicated group; ns
= not significant.
40
Right ventricular output is reduced in Fstl1-eKO mice
To shed light on the cause of neonatal lethality of Fstl1-eKO mice, we determined the
physiological function of the pulmonary vasculature using echocardiography. During
observed at 3 weeks compared to 1 week as shown by the pulmonary valve (PV) and
velocity-time integral (VTI) parameters (p<0.05; Figure 2A). A significant reduction 2
in right ventricular output in Fstl1-eKO mice was observed at 3 weeks compared to
age-matched controls (p<0.05; Figure 2A). Other physiological parameters, including
PV peak gradient, PV mean gradient, PV peak velocity, and PV mean velocity, were
significantly increased at 3 weeks compared to 1 week after birth both in control
and in Fstl1-eKO mice (p<0.05; Figure 2B-2E). No differences between Fstl1-eKOmice
and age-matched controls were observed for these parameters (Figure 2B-2E). A
validated non-invasive method to assess pulmonary vascular resistance22,23 was
performed by measuring pulmonary acceleration time (PAT) corrected for the
pulmonary ejection time (ET). There was no significant difference in pulmonary
vascular resistance during normal postnatal lung development as reflected by the
ratio of PAT/ET in control mice at 3 weeks compared to 1 week after birth (Figure 2F).
A significant change was also not observed between Fstl1-eKO mice compared to
age-matched controls either at 1 week or 3 weeks after birth (Figure 2F). Moreover,
we evaluated the muscularization of the right ventricle using myocardial marker TnI,
as an indicative of right ventricle hypertrophy by measuring the volume of the right
ventricle. There were no changes in the right ventricle volume at 3 weeks compared
to 1 week after birth in the control mice (Figure 2G). At 3 weeks, there was a trend
towards increased RV volume in Fstl1-eKO mice compared to age-matched controls
(Figure 2G). A significant increase in RV volume was observed in Fstl1-eKO mice at 3
weeks compared to 1 week after birth (p=0.005; Figure 2G).
41
 Pulmonary vascular remodeling in Fstl1-eKO mice
In view of these results, we examined the effect of endothelial deletion of Fstl1 on
pulmonary vascular phenotypes and quantified the morphological changes and
actin content in large and small pulmonary vessels. During normal development, the
thickness of the large muscular arteries was unaltered in lung tissue of control mice
at 3 weeks compared to 1 week after birth(Figure 3A), whereas the actin content
was reduced in large elastic (p<0.005) and muscular arteries (p<0.005) in lung tissue 2
of control mice at 3 weeks compared to 1 week after birth (Figure 3B and 3C).In
Fstl1-eKO mice, the thickness and the actin content in large muscular arteries were
unaltered at 3 weeks compared to 1 week after birth (Figure 3A and 3C), whereas the
actin content in large elastic arteries was significantly reduced at 3 weeks compared
to 1 week after birth (p< 0.005; Figure 3B). No significant differences were observed
in the thickness of the large muscular arteries (Figure 3A) and in the actin content in
large elastic and muscular arteries in lung tissue of Fstl1-eKO mice compared to age-
matched controls at either 1 or 3 weeks after birth (Figure 3B and 3C). Reduction in
actin content at 3 weeks after birth seems to be limited to vascular smooth muscle
as there were no temporal changes in the actin content in the airway smooth muscle
bundlesand there was no observed difference between Fstl1-eKO mice compared to
age-matched controls(Figure 3D).
We also explored the number of small blood vessels in lung tissue as these
may contribute to an important extent to changes in pulmonary blood pressure.
In normal development, no significant temporal change in theCD31 positivetotal
number of vessels was observed, whereas the percentage of actin positive vessels
was significantly reduced at 3 weeks compared to 1 week after birth (p<0.01; Figure
3E and 3F). Although the CD31 positive total number of vessels was not significantly
different between Fstl1-eKO mice compared to age-matched controls (Figure 3E),
the percentage of actin positive small pulmonary vessels was significantly higher in
Fstl1-eKO mice at 3 weeks after birth compared to age-matched controls(p<0.05;
Figure 3F).

Figure 2. Right ventricular output is reduced in Fstl1-eKOmice. Pulmonary functions were

measured using echocardiograph. (A) Pulmonary valve (PV)-velocity time integral (VTI) was
significantly decreased in Fstl1-eKO mice compared to age-matched controls.(B) PV peak
gradient, (C) PV mean gradient, (D) PV peak velocity, (E) PV mean velocity, and (F) the ratio
of Pulmonary Acceleration Time (PAT) corrected by the pulmonary ejection time (ET) in
percentage were unaltered in Fstl1-eKO mice compared to age-matched controls. Data are
expressed as the mean ± SEM of 4-19 mice per group. (G) The right ventricle (RV) volume
of Fstl1-eKO mice was unaltered compared to age-matched controls. A significant increase
in RV volume was observed in Fstl1-eKO mice at 3 weeks compared to 1 week after birth.
Data are expressed as the mean ± SEM of 3 mice per group. *p<0.05; **p<0.01; ***p<0.005
compared to the indicated group; ns = not significant.

42 43

Figure 3. Number of actin-positive small pulmonary vessels is increased in the lung tissue
of Fstl1-eKOmice at 3 weeks. (A) The thickness of large muscular arteries in lung tissue was
quantified and expressed as ratio of total area of tunica media over the square of the length
of the tunica intima. Horizontal lines represent the median of n = 9-16 vessels from N= 6-8
mice per group. (B) The α-SMA content in large elastic arteries and (C) in large muscular
arteries in lung tissue was quantified and expressed as ratio of the actin positive area over
the square of the length of tunica intima. Horizontal lines represent the median of n= 9-26
vessels per group from N= 5-12 mice per group. (D) The α-SMA content in airway smooth
muscle bundles surrounding the airway in lung tissue was quantified and expressed as ratio
of the actin positive area over the square of the length of basement membrane. Horizontal
lines represent the median of n=9-34 vessels per group from N= 5-13 mice per group. (E)
Total number of vessels in lung tissue was quantified using CD31 staining and expressed as
ratio of total vessel number/lung surface area (cm2). Horizontal lines represent the median
of the vessel number/cm2 of N= 7-12 mice per group. (F) The percentage of actin positive
small pulmonary vessels in lung tissue was quantified and expressed as percentage of actin
positive small vessel number/total vessel number. Horizontal lines represent the median of
the percentage of actin positive vessels of N= 7-12 mice per group. Representative images
of tissue sections taken at 3 weeks after birth were shown. AW indicates an airway and
V indicates a blood vessel. Scale bars represent 100 µm. Magnification 200x. *p<0.05;
**p<0.01; ***p<0.005 compared to the indicated group.
44
Increased BMP/Smad signaling in the lung of Fstl1-eKO mice
To unravel whether endothelial Fstl1 modulates BMP signaling during postnatal
development, we investigated the activity of BMP/Smad signaling in lung
homogenates using pSmad1/5/8 antibodies. During normal postnatal development,
Smad1/5/8 phosphorylation was higher at 3 weeks compared to 1 week after birth
(p<0.05; Figure 4A). In addition, we found an increased levels ofpSmad1/5/8in lung
homogenates of Fstl1-eKO compared to age-matched controls at 1 week after birth 2
(p<0.05; Figure 4A), whereas,mthe level of pSmad1/5/8at 3 weeks was unaltered in
Fstl1-eKO mice compared to age-matched controls (Figure 4A).
To study the role of BMP signaling further, we selected previously identified
pSmad1/5/8 target genes which relate to vascular remodeling24: Id3, Epas1, Zeb2,
Zfp423, Ephb4, Klf4, Flt1, Jag1, Eng, Gata2, Vegf. Of these, we found that the
expression of Jagged1, Endoglin, and Gata2 was altered in Fstl1-eKO mice compared
to age-matched controls with a nominal p value <0.05, whereas the expression level
of the other genes was not different. Therefore, Jagged1, Endoglin, and Gata2 were
included for further analysis. Consistent with the increased Smad1/5/8 activation,
Jagged1 and Endoglin mRNA and protein were increased in lung tissue of control
mice at 3 weeks compared to 1 week after birth (Jagged1 mRNA p<0.05; protein
p<0.05; Figure 4B and 4D; Endoglin protein p<0.01; Figure 4C and 4E). In line with
increased phosphorylation of Smad1/5/8, the expression of Jagged1 and Endoglin
mRNA and protein was also increased in lung homogenates of 1 week Fstl1-eKO
mice compared to age-matched controls (Jagged1 mRNA p<0.05; protein p<0.05;
Figure 4B and 4D; Endoglin mRNA p<0.05; protein p<0.01; Figure 4C and 4E). At 3
weeks, Jagged1 mRNA (p<0.01) and protein (p<0.05) were reduced in the Fstl1-eKO
mice compared to age-matched controls (Figure 4B and 4D), whereas Endoglin was
not different compared to age-matched controls (Figure 4C and 4E).
The mRNA expression of the transcription factor Gata2 was higher in the lung
homogenates of control mice at 3 weeks compared to 1 week after birth (p<0.01;
Figure 5A). Accordingly, the level of mRNA and protein expression ofthe Gata2 target
gene Endothelin-1, a potent vasoconstrictor, was also increased in lung homogenates
of control mice at 3 weeks compared to 1 week after birth (mRNA p<0.005; protein
p<0.05; Figure 5B and 5C). Gata2 mRNA and Endothelin-1 mRNA and protein levels
were increased in lung homogenates of Fstl1-eKO mice compared to age-matched
controls at 1 week after birth (Endothelin-1 mRNA p< 0.05; protein p<0.01; Figure
5B and 5C). These levels did not further increase at 3 weeks after birth and were no
longer different compared to age-matched controls (Figure 5A-C).
45
 2

Figure 4. Increased activation of Smad1/5/8 and Smad1/5/8-regulated genes in the lung Figure 5. Increased Endothelin-1 in the lung of Fstl1-eKO mice. (A) Pulmonary mRNA
of Fstl1-eKO mice. (A) Immunoblot analysis of pSmad1/5/8 in lung homogenates. Data are expression of Gata2 transcription factor and (B) Endothelin-1 in the lung homogenates. Data
expressed as means ± SEM of the ratios of pSmad1/5/8 corrected to total Smad1 of 4-9 are expressed as starting concentration N0 in arbitrary units corrected toB2m and Hprt as
mice per group. Pulmonary expression of the pSmad1/5/8-regulated genes, Jagged1 (B) reference genes. (C) Endothelin-1 protein concentration in lung homogenates is expressed
and Endoglin (C) in lung homogenates. Data are expressed as starting concentration N0 in as Endothelin-1 concentration in pg/ml per 1 µg protein lysates. Each data points represent
arbitrary units corrected to B2m and Hprt as reference genes. Horizontal lines represent an individual animal. Horizontal line represents the median of Endothelin-1 concentration
medians of 11-30 mice per group. (D) Immunoblot of Jagged1 protein in lung homogenates of 8-12 mice per group. *p<0.05; **p<0.01; ***p<0.005 compared to the indicated group.
and its quantification. Data are expressed as means ± SEM of the ratios of Jagged1 over
the reference protein β-actin of 4-9 mice per group. (D) Immunoblot of Endoglin in lung
homogenates and its quantification. Data are expressed as means ± SEM of the ratios of
Endoglin over the reference protein β-actin of 4-9 mice per group. *p<0.05; **p<0.01;
***p<0.005 compared to the indicated group.

46 47
Discussion
Proper formation and maturation of the pulmonary vasculature is essential to
support normal lung development and function.25 BMP signaling is crucial in dynamic
processes of vessel growth and vessel maturation.9,12,26–29 Maturation of immature
vessels proceeds according to the developmental steps: (1) stabilization of the
immature vessels, (2) vessel branching, remodeling, and pruning and (3) vessel
specialization.30 Deregulation of molecules involved in vessel growth and maturation
leads to vascular abnormalities and dysfunction.
In this study, the role of endothelial Fstl1 in postnatal maturation of the
pulmonary vasculature was investigated in vivo using Tie2-cre targeted endothelial-
specific deletion. Conditional deletion of Fstl1 from endothelium was postnatally
lethal, and resulted in small pulmonary vessel changes, pointing to a critical role of
endothelial Fstl1 in postnatal lung development. In line with the idea that Fstl1 is a
BMP antagonist, phosphorylation of BMP/Smad signaling showed the inverse pattern
of Fstl1 expression level during normal postnatal development. In the early stages of
postnatal development, high Fstl1 expression is associated with low phosphorylated
Smad1/5/8 at 1 week after birth whereas at later stages of postnatal development,
decreased in Fstl1 expression is associated with increased phosphorylation of BMP/
Smad signaling in lung tissue of control mice.
We also demonstrate that during early stages of postnatal development, high
Fstl1 expression coincides with high actin content in the large muscular and elastic
arteries and high percentage of actin positive small pulmonary vessels in lung tissue
of control mice. In later stages of postnatal development, low Fstl1 expression
coexists with low actin content in the large muscular and elastic arteries and low
percentage of actin positive small pulmonary vessels in lung tissue of control mice.
Recently, it was reported that Fstl1 mediates TGF-β-induced α-SMA expression by
antagonizing BMP signaling in lung fibroblasts.31 We speculate that Fstl1 antagonizes
BMP signaling to facilitate TGF-β-induced α-SMA expression from vascular smooth
muscle cells in the early stages of normal vascular development. Reduced Fstl1 levels
in later stages of development in turn result in reduction in actin content, suggesting
that Fstl1 possibly mediates endothelial-mural cell communication by modulating
BMP/TGF-β signaling during normal pulmonary vascular development.
During normal postnatal vascular development, transient reduction of actin
content in pulmonary vessels is normal and an indication of maturation of pulmonary
vessels by reducing contractility of pulmonary arteries.32 Our data indicate that loss
of Fstl1 in endothelium prevents this normal reduction of actin in small pulmonary
vessels and as such delays pulmonary vascular maturation.
Mechanistically, Fstl1-eKO mice have increased Smad1/5/8 phosphorylation and
expression of pSmad1/5/8-regulated genes in the lung, including Gata2, Endoglin,
and Jagged1. Previous studies demonstrated the important role of Jagged1 and
Endoglin in vascular specialization and vascular remodeling, respectively, in the later
stages of vessel maturation.10,33,34 In early stages of normal development, high levels
48
of Fstl1 inhibit BMP signaling and its regulated genes, Gata2, Jagged1 and Endoglin,
indicating that modulation of BMP signaling by Fstl1 is important in early stages of
postnatal lung development. On the other hand, low levels of Fstl1 in later stages
of development lead to increased BMP-mediated Smad phosphorylation and its
regulated genes Gata2, Jagged1, and Endoglin. Endoglin is a type III TGF-β receptor
which is predominantly expressed in proliferating endothelial cells and triggers
endothelial cell proliferation and vascular remodeling.34–37 The importance of
2
Endoglin for normal vascular formation and homeostasis is evident in Endoglin null
(Eng-/-) mice, which exhibit vascular deformities.37–40 Increased Endoglin expression
in Fstl1-eKO mice at the early stages of postnatal pulmonary vascular development
might shift the balance towards endothelial cell migration and proliferation instead
of maturation. This supports the contention that Fstl1-eKO mice have delayed
pulmonary vascular maturation.
The Notch ligand Jagged1 is an important regulator of cell fate in embryonic
development41 and vessel fate in pulmonary vascular maturation.10,33 In addition,
it has a significant role in angiogenesis and vascular homeostasis.42,43 Ablation of
Jagged1 in mice is embryonically lethal and leads to vascular abnormalities and
defects in vascular remodeling.33 The aberrant Jagged1 expression during early
stages of postnatal pulmonary vascular development in Fstl1-eKO mice might lead
to deregulation of vascular remodeling and disruption of the vessel specialization
programs.
BMP/Smad increases expression of the transcription factor Gata2, subsequently
promoting the expression of the most potent vasoconstrictor Endothelin-1.44–46
We demonstrate that Endothelin-1 levels are low at the early stages of normal
development and increase at the later stages of normal development. We found
that endothelial deletion of Fstl1 is associated with increased Endothelin-1 mRNA
and protein expression at the early stages of development in the lung. Increased
Endothelin-1 has been reported to promote proliferation and migration of
endothelial cells and contribute to increased pulmonary vascular resistance and
subsequent right ventricle hypertrophy,47,48 suggesting pivotal roles of Endothelin-1
in vessel formation, vascular remodeling, and vascular tone maintenance. Our data
suggest that Endothelin-1 expression is negatively regulated by Fstl1 via inhibiting
Smad1/5/8 and the Gata2 transcription factor, presumably by antagonizing BMP
signaling. These findings are in line with previous studies demonstrating that
Endothelin-1 expression is regulated by BMP via Smad1/5/8 in endothelial cells.44–46
Lower right ventricular output and small vascular remodeling were visible
at 3 weeks after birth, whereas elevation in BMP/Smad phosphorylation and of
its downstream targets Jagged1, Endoglin, Gata2, and Endothelin-1 were more
prominent at 1 week after birth in Fstl1-eKO mice, indicating that molecular changes
are more transient than their physiological and morphological consequences.
As a consequence the functional and morphological differences seen at 3 weeks
after birth were initiated earlier during postnatal development. Alternatively,
the activation of BMP/Smad signaling alone may not be sufficient to affect the
pulmonary vasculature structurally and functionally at early stages of development,
49
but instead becomes evident at a later time point. Despite of higher percentages
of actin positive small pulmonary vessels and notably decreased right ventricular
output, there were minimum morphological defects of large pulmonary vessels,
normal pulmonary vascular resistance as reflected by the ratio of PAT/ET in Fstl1-eKO
mice and a trend towards right ventricle hypertrophy. This may suggest very early
stages of pulmonary vascular dysfunction in Fstl1-eKO mice. This phenotype is also
commonly observed in patients with PAH, in which molecular changes/defects in
2
BMP signaling manifest early in the disease followed by physiological and structural
changes which are observed at later stages of the disease progression.49 In addition,
our data may imply that the molecular and morphological changes in the lung are
possibly a secondary consequence of the right heart dysfunction as reflected by
reduction in RV output. The morphological and physiological functions of the heart
of Fstl1-eKO mice are currently under investigation.
In conclusion, our findings demonstrate that loss of endothelial Fstl1 in the
lung is associated with increased BMP/Smad phosphorylation and elevations in its
downstream targets Jagged1, Endoglin, Gata2 and Endothelin-1. These changes are
associated with impaired small pulmonary vascular remodeling and decreased right
ventricular output. Taken together, our findings suggest a key role of Fstl1 in titrating
the level of BMP signaling for proper postnatal lung development.

Acknowledgements
The authors would like to thank Jan M. Ruijter for expert advice on real time PCR
data analysis and Frank Ensink for technical assistance. This study was financially
supported by a grant from the Netherlands Lung Foundation (grant 3.2.12.083).

Conflict of interest Supplementary Figure 1. Endothelial Fstl1 knockout mice showed normal alveolarization
as shown by hematoxylin and eosin staining. Alveoli surrounding the airways (A) and alveoli
The authors have no conflict of interest. in lung parenchyma (B) of Fstl1­-eKO mice and of age-matched controls show no differences
at 1 week after birth. Scale bars represent 100 µm. Magnification 200x.

50 51
References 21. Hong K-H, Lee YJ, Lee E, et al. Genetic ablation of the BMPR2 gene in pulmonary endothelium is
sufficient to predispose to pulmonary arterial hypertension. Circulation. 2008;118(7):722-730.
1. Lowery JW, de Caestecker MP. BMP signaling in vascular development and disease. Cytokine
doi:10.1161/CIRCULATIONAHA.107.736801.
Growth Factor Rev. 2010;21(4):287-298. doi:10.1016/j.cytogfr.2010.06.001.
22. Thibault HB, Kurtz B, Raher MJ, et al. Noninvasive assessment of murine pulmonary arterial
2. Liu D, Wang J, Kinzel B, et al. Dosage-dependent requirement of BMP type II receptor
pressure: validation and application to models of pulmonary hypertension. Circ Cardiovasc
for maintenance of vascular integrity. Blood. 2007;110(5):1502-1510. doi:10.1182/
Imaging. 2010;3(2):157-163. doi:10.1161/CIRCIMAGING.109.887109.
blood-2006-11-058594.
23. Weyman AE, Dillon JC, Feigenbaum H, Chang S. Echocardiographic Patterns of Pulmonic Valve
3. Machado RD, Aldred MA, James V, et al. Mutations of the TGF-beta type II receptor BMPR2 in
Motion with Pulmonary Hypertension. Circulation. 1974;50(5):905-910. doi:10.1161/01.
pulmonary arterial hypertension. Hum Mutat. 2006;27(2):121-132. doi:10.1002/humu.20285.
4. Harrison RE, Flanagan JA, Sankelo M, et al. Molecular and functional analysis identifies ALK-
CIR.50.5.905. 2
24. Morikawa M, Koinuma D, Tsutsumi S, et al. ChIP-seq reveals cell type-specific binding patterns
1 as the predominant cause of pulmonary hypertension related to hereditary haemorrhagic
of BMP-specific Smads and a novel binding motif. Nucleic Acids Res. 2011;39(20):8712-8727.
telangiectasia. J Med Genet. 2003;40(12):865-871.
doi:10.1093/nar/gkr572.
5. Fujiwara M, Yagi H, Matsuoka R, et al. Implications of mutations of activin receptor-like kinase
25. Kool H, Mous D, Tibboel D, de Klein A, Rottier RJ. Pulmonary vascular development goes awry in
1 gene (ALK1) in addition to bone morphogenetic protein receptor II gene (BMPR2) in children
congenital lung abnormalities. Birth Defects Res Part C Embryo Today Rev. 2014;102(4):343-358.
with pulmonary arterial hypertension. Circ J Off J Jpn Circ Soc. 2008;72(1):127-133.
doi:10.1002/bdrc.21085.
6. Johnson DW, Berg JN, Baldwin MA, et al. Mutations in the activin receptor-like kinase 1 gene in
26. Gangopahyay A, Oran M, Bauer EM, et al. Bone morphogenetic protein receptor II is a novel
hereditary haemorrhagic telangiectasia type 2. Nat Genet. 1996;13(2):189-195.
mediator of endothelial nitric-oxide synthase activation. J Biol Chem. 2011;286(38):33134-
7. McAllister KA, Grogg KM, Johnson DW, et al. Endoglin, a TGF-beta binding protein of endothelial
33140. doi:10.1074/jbc.M111.274100.
cells, is the gene for hereditary haemorrhagic telangiectasia type 1. Nat Genet. 1994;8(4):345-
27. Xu J, Zhu D, Sonoda S, et al. Over-expression of BMP4 inhibits experimental choroidal
351. doi:10.1038/ng1294-345.
neovascularization by modulating VEGF and MMP-9. Angiogenesis. 2012;15(2):213-227.
8. Pi X, Lockyer P, Dyer LA, et al. Bmper inhibits endothelial expression of inflammatory adhesion
doi:10.1007/s10456-012-9254-4.
molecules and protects against atherosclerosis. Arterioscler Thromb Vasc Biol. 2012;32(9):2214-
28. Moreno-Miralles I, Ren R, Moser M, Hartnett ME, Patterson C. Bone morphogenetic protein
2222. doi:10.1161/ATVBAHA.112.252015.
endothelial cell precursor-derived regulator regulates retinal angiogenesis in vivo in a mouse
9. Yao Y, Jumabay M, Wang A, Boström KI. Matrix Gla protein deficiency causes arteriovenous
model of oxygen-induced retinopathy. Arterioscler Thromb Vasc Biol. 2011;31(10):2216-2222.
malformations in mice. J Clin Invest. 2011;121(8):2993-3004. doi:10.1172/JCI57567.
doi:10.1161/ATVBAHA.111.230235.
10. Yao Y, Yao J, Radparvar M, et al. Reducing Jagged 1 and 2 levels prevents cerebral arteriovenous
29. Helbing T, Rothweiler R, Ketterer E, et al. BMP activity controlled by BMPER regulates the
malformations in matrix Gla protein deficiency. Proc Natl Acad Sci U S A. 2013;110(47):19071-
proinflammatory phenotype of endothelium. Blood. 2011;118(18):5040-5049. doi:10.1182/
19076. doi:10.1073/pnas.1310905110.
blood-2011-03-339762.
11. International PPH Consortium, Lane KB, Machado RD, et al. Heterozygous germline mutations
30. Jain RK. Molecular regulation of vessel maturation. Nat Med. 2003;9(6):685-693. doi:10.1038/
in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. Nat
nm0603-685.
Genet. 2000;26(1):81-84. doi:10.1038/79226.
31. Dong Y, Geng Y, Li L, et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary
12. Suzuki Y, Ohga N, Morishita Y, Hida K, Miyazono K, Watabe T. BMP-9 induces proliferation of
fibrosis in mice. J Exp Med. 2015;212(2):235-252. doi:10.1084/jem.20121878.
multiple types of endothelial cells in vitro and in vivo. J Cell Sci. 2010;123(Pt 10):1684-1692.
32. Hall SM, Gorenflo M, Reader J, Lawson D, Haworth SG. Neonatal pulmonary hypertension
13. Wang RN, Green J, Wang Z, et al. Bone Morphogenetic Protein (BMP) signaling in development
prevents reorganisation of the pulmonary arterial smooth muscle cytoskeleton after birth. J
and human diseases. Genes Dis. 2014;1(1):87-105. doi:10.1016/j.gendis.2014.07.005.
Anat. 2000;196(Pt 3):391-403. doi:10.1046/j.1469-7580.2000.19630391.x.
14. Adams D, Larman B, Oxburgh L. Developmental expression of mouse Follistatin-like 1 (Fstl1):
33. Xue Y, Gao X, Lindsell CE, et al. Embryonic Lethality and Vascular Defects in Mice Lacking the
Dynamic regulation during organogenesis of the kidney and lung. Gene Expr Patterns.
Notch Ligand Jagged1. Hum Mol Genet. 1999;8(5):723-730. doi:10.1093/hmg/8.5.723.
2007;7(4):491-500. doi:10.1016/j.modgep.2006.10.009.
34. Chen Y, Hao Q, Kim H, et al. Soluble endoglin modulates aberrant cerebral vascular remodeling.
15. Sylva M, Li VSW, Buffing AAA, et al. The BMP antagonist follistatin-like 1 is required for skeletal
Ann Neurol. 2009;66(1):19-27. doi:10.1002/ana.21710.
and lung organogenesis. PloS One. 2011;6(8):e22616. doi:10.1371/journal.pone.0022616.
35. Lebrin F, Goumans M-J, Jonker L, et al. Endoglin promotes endothelial cell proliferation and TGF-
16. Geng Y, Dong Y, Yu M, et al. Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP)
beta/ALK1 signal transduction. EMBO J. 2004;23(20):4018-4028. doi:10.1038/sj.emboj.7600386.
4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A.
36. Pece-Barbara N, Vera S, Kathirkamathamby K, et al. Endoglin null endothelial cells proliferate
2011;108(17):7058-7063. doi:10.1073/pnas.1007293108.
faster and are more responsive to transforming growth factor beta1 with higher affinity
17. Kisanuki YY, Hammer RE, Miyazaki J, Williams SC, Richardson JA, Yanagisawa M. Tie2-Cre transgenic
receptors and an activated Alk1 pathway. J Biol Chem. 2005;280(30):27800-27808. doi:10.1074/
mice: a new model for endothelial cell-lineage analysis in vivo. Dev Biol. 2001;230(2):230-242.
jbc.M503471200.
doi:10.1006/dbio.2000.0106.
37. Mahmoud M, Allinson KR, Zhai Z, et al. Pathogenesis of arteriovenous malformations in the
18. Somi S, Klein ATJ, Houweling AC, et al. Atrial and ventricular myosin heavy-chain expression in
absence of endoglin. Circ Res. 2010;106(8):1425-1433. doi:10.1161/CIRCRESAHA.109.211037.
the developing chicken heart: strengths and limitations of non-radioactive in situ hybridization.
38. Arthur HM, Ure J, Smith AJ, et al. Endoglin, an ancillary TGFbeta receptor, is required for
J Histochem Cytochem Off J Histochem Soc. 2006;54(6):649-664. doi:10.1369/jhc.5A6846.2006.
extraembryonic angiogenesis and plays a key role in heart development. Dev Biol. 2000;217(1):42-
19. Cruz-Adalia A, Jiménez-Borreguero LJ, Ramírez-Huesca M, et al. CD69 limits the severity
53. doi:10.1006/dbio.1999.9534.
of cardiomyopathy after autoimmune myocarditis. Circulation. 2010;122(14):1396-1404.
39. Li DY, Sorensen LK, Brooke BS, et al. Defective angiogenesis in mice lacking endoglin. Science.
doi:10.1161/CIRCULATIONAHA.110.952820.
1999;284(5419):1534-1537.
20. Ruijter JM, Ramakers C, Hoogaars WMH, et al. Amplification efficiency: linking baseline and bias
40. Bourdeau A, Dumont DJ, Letarte M. A murine model of hereditary hemorrhagic telangiectasia. J
in the analysis of quantitative PCR data. Nucleic Acids Res. 2009;37(6):e45. doi:10.1093/nar/
Clin Invest. 1999;104(10):1343-1351. doi:10.1172/JCI8088.
gkp045.
41. Le TT, Conley KW, Brown NL. Jagged 1 is necessary for normal mouse lens formation. Dev Biol.

52 53
 CHAPTER 3 1

The effect of cigarette smoking

on pulmonary Follistatin-like 1
expression: potential implication in
chronic obstructive pulmonary disease

Navessa P. Tania, Reinoud Gosens, Wim Timens, Maurice J.B. van den
Hoff, Martina Schmidt, Harm Maarsingh

55
The effect of cigarette smoking on pulmonary Follistatin-like 1 expression: Abstract
potential implication in chronic obstructive pulmonary disease
Bone morphogenetic protein (BMP) signaling is pivotal for embryonic lung
morphogenesis and epithelial repair in adult. The endogenous BMP antagonist
Follistatin-like 1 (Fstl1) is increased in several inflammatory diseases, but has not
been explored in chronic obstructive pulmonary disease (COPD) yet. Here, we
Navessa P. Tania1*, Reinoud Gosens1, Wim Timens2, Maurice J.B. van den Hoff3,
report that Fstl1 protein expression is increased in airway epithelium of COPD ex-
Martina Schmidt1, Harm Maarsingh4
smokers compared to non-COPD ex-smokers. Accordingly, phosphorylated Smad1/5,
indicative of active BMP signaling, was found reduced in total lung homogenates.
Taken together, our study provides a novel link between Fstl1 and COPD, provoking
further studies to unravel the Fstl1 functions in the lung and its implication in COPD. 3
1
University of Groningen, Department of Molecular Pharmacology, Groningen
Research Institute for Asthma and COPD, Groningen, The Netherlands.
2
University of Groningen, University Medical Center Groningen, Department of
Pathology and Medical Biology, Groningen Research Institute for Asthma and COPD,
Groningen, The Netherlands.
3
Academic Medical Center, Department of Anatomy, Embryology and Physiology,
Amsterdam, The Netherlands.
4
Palm Beach Atlantic University, Lloyd L. Gregory School of Pharmacy, Department of
Pharmaceutical Sciences, West Palm Beach, Florida, USA.

56 57
Letter to the editor

Chronic obstructive pulmonary disease (COPD) is characterized by persistent

inflammation of the airways and lung parenchyma primarily triggered by tobacco
smoke exposure.1 Bone morphogenetic proteins (BMPs) belong to the TGF-β
superfamily that regulate embryonic lung morphogenesis and adult airway epithelial
homeostasis.2 The endogenous BMP antagonist Follistatin-like 1 (Fstl1) is an
extracellular glycoprotein shown to be crucial during embryonic lung development3,4
and contributes to inflammatory processes, such as in arthritis.5 Despite its’
importance in lung development, little is known about the role of Fstl1 in the adult
lung in health and disease. Here, we determined the expression of Fstl1 in the lung 3
of COPD patients compared to individuals with normal lung function.
Lung tissue and homogenates were obtained from twenty-two ex-smoker COPD
patients of GOLD stage II (n=11) and IV (n=11) and from twenty-nine non-COPD
control individuals without airway obstruction and with different smoking status
(8 never-smokers, 10 current smokers and 11 ex-smokers) for immunostaining and
western blot analysis. COPD stages classification referred to the Global Initiative
for Chronic Obstructive Lung Disease (GOLD) criteria.6 Patient characteristics are
Figure 1. The expression of Fstl1 is increased in COPD lung. (A) Representative immunoblot
of Fstl1 and quantification of Fstl1 protein expression in lung homogenates of COPD stage II
and IV patients compared to non-COPD controls differentiated by smoking status: NS, never-
smoker; CS, current-smoker; ES, ex-smoker. (B) Representative image of Fstl1 staining in lung
tissue. Red arrowhead points to airway epithelium, green arrowhead points to endothelium,
blue arrowhead points to vascular smooth muscle bundles, and purple arrowhead points to
inflammatory cells. AW, airway; V, blood vessel. Scale bar represents 200 µm. Magnification
of 100x. (C) Representative images of Fstl1 staining in the airway epithelium within the
different groups. Semi quantitative analysis of Fstl1 immunostaining in airway epithelium
(D), endothelium of large muscular arteries (E), vascular smooth muscle bundles (F), and
inflammatory cells (G). Each dot represents an individual patient. The horizontal line
represents median of each group (n=5-7 for NS; n=8-10 for CS; n=8-12 for ES; n=11 for ES
COPD II n=11; n=10-11 for ES COPD IV). The number of analyzed compartments in each group
varied due to some patients did not have the cell type of interest in their tissue section.
Scoring of the staining intensity (absent, low, medium, high) was performed by two persons
independently in a blinded manner. Statistical significance of differences was determined
with either a one-way ANOVA followed by a post hoc Tukey multiple comparisons test or a
non-parametric one-way ANOVA with a post hoc Kruskal-Wallis multiple comparisons test
for Gaussian and non-Gaussian distributed data, respectively. The Bonferroni correction was
used to correct for multiple testing. *p<0.05; **p<0.01; ***p<0.005 compared to indicated
groups.

provided in supplementary Table S1 and S2.

We observed that the expression of Fstl1 protein was significantly increased
in total lung homogenates of non-COPD ex-smokers alone (p=0.033) or combined
with non-COPD current smokers (p=0.016) compared to non-COPD never-smokers
(Figure 1A), suggesting that smoking induces a long-lasting increase of pulmonary
Fstl1 protein. In support, in comparison with the non-COPD never smoker group,
the total expression of Fstl1 protein in lung homogenates was significantly increased
in patients with COPD stage II alone (p=0.004) or in combination with COPD stage
IV (p=0.007; Figure 1A), all of which are ex-smokers. Notably, Fstl1 was originally

58 59
identified as a TGF-β target gene and exerts immunomodulatory functions.7,8 The
pulmonary expression of another BMP antagonist Noggin was also studied but
was found unaffected by cigarette smoking or disease state (non-COPD controls
vs COPD patients; supplementary figure 1). This indicates that the increase in BMP
antagonists was selective for Fstl1.
To dissect which cell types express Fstl1 in the lung, immunostaining for Fstl1
was performed. Fstl1 protein was expressed in different cell types in the lung,
including airway epithelium, endothelium, vascular smooth muscle cells, and
inflammatory cells (Figure 1B). The intensity of Fstl1 staining was markedly stronger
in airway epithelium of COPD patients compared to non-COPD controls (Figure 1C).
Semi-quantitative analysis of Fstl1 staining demonstrated that Fstl1 was significantly
increased in the airway epithelium (p=0.002; Figure 1D), endothelium (p=0.002;
3
Figure 1E), vascular smooth muscle (p=0.003; Figure 1F) and inflammatory cells
(p=0.034; Figure 1G) of the combined COPD stage II and IV patients compared to
the combined non-COPD controls. However, we did not observe an ever-smoking
effect for any of the studied compartments in the non-COPD groups. Interestingly,
the expression of Fstl1 protein was significantly increased in airway epithelium of
COPD stage II and IV patients (all ex-smokers) compared to non-COPD ex-smokers
(p=0.004; Figure 1D). This might indicate that increased Fstl1 in airway epithelium is
associated with COPD and is not only associated with smoking. Figure 2. BMP-specific Smad1/5 activation is reduced in the lung homogenates of COPD
patients. Representative immunoblots and quantitative protein expression analysis of (A)
Given that Fstl1 is a BMP antagonist, we examined whether increased Fstl1 phosphorylated Smad1/5 and (B) BMP4 in lung homogenates of COPD stage II and IV patients
was associated with reduced BMP/Smad signaling in the lung by investigating the compared to non-COPD controls differentiated by smoking status. Each dot represents an
expression of phosphorylated, BMP-specific, Smad1/5 in total lung homogenates. individual patient. Horizontal line represents median of each group (n=5 for NS; n=8 for CS;
n=8 for ES; n=11 for ES COPD II; n=10 for ES COPD IV). Data are expressed as ratios of proteins
Indeed, we observed that, when compared to non-COPD never smokers, of interest over the reference protein. Unphosphorylted Smad1 was used as a reference
phosphorylated Smad1/5 was significantly reduced in the lung homogenates of protein for pSmad1/5, and GAPDH for BMP4. *p<0.05; **p<0.01; ***p<0.005 compared to
indicated groups.
non-COPD of current smokers alone (p=0.01), ex-smokers alone (p=0.006) and the
combination of both (p=0.001; Figure 2A). Similarly, the expression of phosphorylated
Smad1/5 was also decreased in both COPD stage II and IV ex-smoker groups In conclusion, cigarette smoking increases the expression of Fstl1 protein and
individually (p=0.002; p=0.003) and combined (p=0.00018; Figure 2A) compared to downregulates phosphorylated Smad1/5 in the lung which persists even after
non-COPD never smokers. These findings show that there is a clear contribution of smoking cessation. Airway epithelium of both COPD stage II and IV patients express
ever smoking to reduced phosphorylated Smad1/5. To exclude that the reduction Fstl1 to a higher degree compared to non-COPD ex-smokers. Increased expression
in phosphorylated Smad1/5 is caused by a reduced pulmonary expression of BMP4 of the BMP-antagonist Fstl1 was accompanied with decreased phosphorylation of
rather than the increased expression of Fstl1, BMP4 protein levels were examined BMP-specific Smad1/5 in the lung, suggesting inhibition of the BMP/Smad signaling
in the total lung homogenates. We did not observe any significant changes in BMP4 pathway by Fstl1. These findings provoke future investigations addressing the
protein among the different groups (Figure 2B). Taken together, our data suggest precise roles of Fstl1 in airway epithelial driven inflammation, epithelial remodeling,
increase expression of Fstl1 and a subsequent decreased phosphorylated Smad1/5 and epithelial repair in non-COPD smokers and its potential contribution to the
levels in the lung are associated with ever smoking effect. development and pathophysiology of COPD.
Previous studies demonstrated that in vitro and in vivo overexpression of
Fstl1 triggers increased production of inflammatory cytokines and chemokines.7,8
Furthermore, a growing body of evidence demonstrates that Fstl1 contributes to
fibrotic processes in pulmonary fibrosis and in the airway wall of severe asthma.9,10
Whether increased expression of Fstl1 is coupled to such functional roles in COPD
requires further investigation.

60 61
 Table S2. Characteristics of COPD patients and non-COPD controls used for
immunoblot.
Characteristics Non-COPD Non-COPD Non-COPD COPD II COPD IV*

Smoking status 5 8 9 11 11
53.3 56.25 59.7 70.9 59.4
Number of subjects (45.0-65.0) (45.0-68.0) (46.0-68.0) (58.0-80.0) (50.0-73.0)
Age (years) 4/1 2/6 3/6 8/3 5/6
43.29 22.3 26.3 28.1
Male/female 0 (14.0-75.0) (1.5-65.0) (0.0 -45.0) (0.0-48.8)
101.8 95.52 100.2 61.4 22.0
Pack years (78.5-130.0) (74.0-107.0) (63.7-121.0) (41.7 -76.0) (13.0-36.0) 3
77.52 78.14 76.3 61.6 37.7
FEV1% predicted (73.0-83.0) (62.4-92.0) (64.0-85.3) (45.7-80.0) (25.0-66.0)
FEV1/FVC% 76.2 79.35 76.3 61.6 37.7
(73.0-83.0) (62.39-92.0) (64.0-86.2) (45.7-80.0) (25.0-66.0)

* FEV1% predicted and FEV1/FVC% were measured post bronchodilators.

Supplementary figure 1. The expression of the other endogenous BMP antagonist Noggin
was unaltered in lung homogenates of patients with COPD compared to non-COPD. (A) A
representative immunoblot and (B) quantitative protein expression analysis of Noggin in the
lung homogenates of COPD compared to non-COPD controls with different smoking status.
Each dot represents an individual patient. Horizontal line represents median of each group
(NS n=5; CS n=8; ES n=8; ES COPD II n=11; ES COPD IV n=10). Data are expressed as ratios
of Noggin over the GAPDH reference protein. The statistical significance of differences was
determined either with a one-way ANOVA followed by a post hoc Tukey multiple comparisons
test or a non-parametric one-way ANOVA with a post hoc Kruskal-Wallis multiple comparisons
test for Gaussian and non-Gaussian distributed data, respectively. The Bonferroni correction
was used to correct for multiple testing.

Table S1. Characteristics of COPD patients and non-COPD controls used for
immunostaining.
Characteristics Non-COPD Non-COPD Non-COPD COPD II COPD IV*

Smoking status NS CS ES ES ES

Number of subjects 8 10 11 11 11

Age (years) 55.1 55.6 62.11 70.9 59.4

(42.0-70.0) (45.0-68.0) (46.0-74.0) (58.0-80.0) (50.0-73.0)
Male/female 5/3 2/8 5/6 8/3 5/6
42.33 25.75 26.3 28.1
Pack years 0 (14.0-75.0) (1.5-65.0) (0.0 -45.0) (0.0-48.8)
FEV1% predicted 102.03 97.07 96.9 61.4 22.0
(78.5-130.0) (74.0-107.0) (63.7 -121.0) (41.7 -76.0) (13.0-36.0)
FEV1/FVC% 76.2 79.35 76.3 61.6 37.7
(73.0-83.0) (62.39-92.0) (64.0-86.2) (45.7-80.0) (25.0-66.0)

* FEV1% predicted and FEV1/FVC% were measured post bronchodilators. NS, never-smoker;
CS, current smoker; ES, ex-smoker.

62 63
Materials and Methods
Fstl1 immunostaining
Human lung tissue sections were stained with primary rabbit anti-human Fstl1
antibody (1:200; ABS616, Merck Milipore, Billerica, MA, USA) overnight at 4°C. The
following day, tissue sections were incubated with HRP-conjugated goat anti-rabbit
antibody for 2 h (1:100, 711-035-152, Jackson Immunoresearch, West Grove, PA,
USA).
Footnotes
Contributors: NPT designed and performed the experiments, interpreted the data
and drafted the first manuscript version. RG, HM, MS, WT designed the experiments,
interpreted the data and contributed to the writing of the manuscript. All authors
approved of the final version of the manuscript.
Funding: This study was financially supported by a grant from the Netherlands
Lung Foundation (grant 3.2.12.083).

Immunoblot Competing interest: none declared.

Equal amounts of lung homogenates were loaded to SDS PAGE electrophoresis and
transferred to PVDF membranes. After incubation with 1x ROTI block (Carl Roth;
Karlsruhe, Germany), membranes were incubated with antibody of interest: rabbit
anti-Fstl1 (1:2000; ABS616, Merck Millipore; Billerica, MA, USA), mouse anti-BMP4
(1:500; MAB757-100; R&D system, Oxford, UK), rabbit anti-pSmad1/5 (1:750; 9516;
Cell Signaling; Danvers, MA, USA), rabbit anti-Smad1 (1:1000; 9743; Cell Signaling,
Danvers, MA, USA), mouse anti-GAPDH (1:2000; sc-47725; Santa Cruz Biotechnology,
Heidelberg, Germany), goat anti-Noggin (1:1000; AF719; R&D system, Oxford, UK).
The following day, horseradish peroxidase (HRP) conjugated antibodies were added,
either donkey anti-rabbit IgG (1:4,000; 711-035-152), anti-goat IgG (1:4,000; 705-
035-003), or anti-mouse IgG (1:4000; 715-035-150 Jackson Immunoresearch, West
Grove, PA, USA). Protein band intensities were quantified using Image Studio Lite
version 5.0.
3
Patient consent: not applicable, see below
Ethics approval: not applicable; Research was conducted according to the Research
Code of the University Medical Center Groningen (http://www.umcg.nl/EN/
Research/Researchers/General/ResearchCode/Paginas/default.aspx) and national
ethical, legal and professional guidelines (“Code of conduct; Dutch federation of
biomedical scientific societies”; https://www.federa.org/).
Acknowledgement
The authors would like to thank Sophie Bos and Marjan Luinge for technical
assistance.

Statistical analysis
Data are presented as individual data points with medians per patient-group unless
stated otherwise. To determine the normality of data distribution, a Shapiro-
Wilk normality test was done prior to further statistical analysis. The statistical
significance of differences of normally distributed data was performed using a
one-way ANOVA followed by a post hoc Tukey multiple comparisons test. For non-
Gaussian distributed data, the statistical significance of differences was determined
using a non-parametric one-way ANOVA with a post hoc Kruskal-Wallis multiple
comparisons test. The Bonferroni correction was used to correct for multiple testing.
Differences were considered to be statistically significant at p<0.05.

64 65
References
1. Garvey C. Recent updates in chronic obstructive pulmonary disease. Postgrad Med.
2016;128(2):231-238. doi:10.1080/00325481.2016.1118352.
2. Sountoulidis A, Stavropoulos A, Giaglis S, et al. Activation of the canonical bone morphogenetic
protein (BMP) pathway during lung morphogenesis and adult lung tissue repair. PloS One.
2012;7(8):e41460. doi:10.1371/journal.pone.0041460.
3. Geng Y, Dong Y, Yu M, et al. Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP)
4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A.
2011;108(17):7058-7063. doi:10.1073/pnas.1007293108.
4. Sylva M, Li VSW, Buffing AAA, et al. The BMP antagonist follistatin-like 1 is required for skeletal
and lung organogenesis. PloS One. 2011;6(8):e22616. doi:10.1371/journal.pone.0022616.
5. Chaly Y, Hostager B, Smith S, Hirsch R. Follistatin-like protein 1 and its role in inflammation and
inflammatory diseases. Immunol Res. 2014;59(1-3):266-272. doi:10.1007/s12026-014-8526-z.
6. Vestbo J, Hurd SS, Agustí AG, et al. Global Strategy for the Diagnosis, Management, and Prevention 3
of Chronic Obstructive Pulmonary Disease. Am J Respir Crit Care Med. 2013;187(4):347-365.
doi:10.1164/rccm.201204-0596PP.
7. Miyamae T, Marinov AD, Sowders D, et al. Follistatin-Like Protein-1 Is a Novel Proinflammatory
Molecule. J Immunol. 2006;177(7):4758-4762. doi:10.4049/jimmunol.177.7.4758.
8. Chaly Y, Marinov AD, Oxburgh L, Bushnell DS, Hirsch R. FSTL1 promotes arthritis in mice by
enhancing inflammatory cytokine/chemokine expression. Arthritis Rheum. 2012;64(4):1082-
1088. doi:10.1002/art.33422.
9. Dong Y, Geng Y, Li L, et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary
fibrosis in mice. J Exp Med. 2015;212(2):235-252. doi:10.1084/jem.20121878.
10. Miller M, Beppu A, Rosenthal P, et al. Fstl1 Promotes Asthmatic Airway Remodeling by Inducing
Oncostatin M. J Immunol Baltim Md 1950. September 2015. doi:10.4049/jimmunol.1501105.

66 67
 CHAPTER 4

Activin-A: active in inflammation in COPD

Navessa P. Tania, Martina Schmidt, Reinoud Gosens

68
Activin-A: active in inflammation in COPD
Navessa P. Tania, Martina Schmidt, Reinoud Gosens
Department of Molecular Pharmacology and GRIAC Research Institute, University of
Groningen, Groningen, The Netherlands.
Chronic obstructive pulmonary disease (COPD) is characterised by irreversible
airflow limitation in which chronic inflammation of the airways plays a major
role. The persistent inflammation is triggered by inhaled toxic substances, such as
cigarette smoke. Accumulating evidence indicates the involvement of developmental
pathways in chronic lung diseases, including COPD.1 Signalling pathways such as
transforming growth factor (TGF)-β, WNT and Sonic hedgehog have all been linked
to COPD, either because of genetic associations or because of differential gene
and protein expression in lung tissue.2–4 Although these pathways were originally
primarily known for their role in development, it is now increasingly clear that
these pathways also play crucial regulatory roles in tissue inflammation and repair,
providing a plausible explanation for the involvement of these pathways in COPD.3
Activin-A, a member of the TGF-β superfamily, is an important regulator of
embryonic development, haematopoiesis and a broad range of tightly regulated
biological processes, including immunity and tissue repair.5 Dysregulation of activin-A
may contribute to the development of disease. Recently, increased expression of
activin-A has been demonstrated in pulmonary hypertension,6 acute lung injury7 4
and asthma.8 Oxidative stress, Toll-like receptor ligands and inflammatory cytokines
stimulate the expression and production of activin-A, which in turn regulates
inflammatory cytokine release, explaining its role in inflammatory responses.7
Accordingly, the endogenous activin-A inhibitor follistatin has attracted great
interest in view of its ability to counteract activin-A activity. Due to its involvement
in inflammatory responses, it is rational to connect activin-A to the pathogenesis of
inflammatory diseases. An imbalance between activin-A and follistatin potentially
leads to excess activin-A-mediated inflammatory responses. However, the roles of
activin-A and follistatin have not yet been established in COPD.
In this issue, Verhamme et al.9 demonstrate for the first time that activin-A is an
important regulator of cigarette smoke-induced inflammation in COPD. They found
that activin-A is elevated and activated in the airway epithelium, airway smooth
muscle and alveolar macrophages of COPD patients. These findings were further
validated in vivo, demonstrating that cigarette smoke induces marked expression
of activin-A in the lungs and bronchoalveolar lavage (BAL) fluid of mice. In vitro,
activin-A expression increased after cigarette smoke exposure of human bronchial
epithelial cells, whereas expression of follistatin was reduced. These data suggest
that cigarette smoke is a major factor involved in activin-A upregulation. Notably,
regardless of airflow limitation, lung tissues of current smokers had a significantly
higher level of activin-A mRNA expression compared with nonsmoker subjects,
whereas the increased activin-A protein expression in airway epithelium was specific
for COPD. Most intriguingly, this study revealed that inhibition of activin-A signalling
by administration of its endogenous inhibitor follistatin, attenuates cigarette smoke-
induced production of interleukin (IL)-6, monocyte chemoattractant protein-1,
tumour necrosis factor (TNF)-α, keratinocyte-derived chemokine and TGF-β1,
and induces the release of the anti-inflammatory cytokine IL-10. Furthermore,
administration of follistatin reduced the number of inflammatory cells, such as
monocytes, macrophages, neutrophils, and CD4+ and CD8+ T-cells, in the BAL fluid

70 71
of cigarette smoke-exposed mice. The authors conclude that activin-A is not an
innocent bystander but plays an active role in cigarette smoke induced pulmonary
inflammation.9
The role of activin-A has been widely studied in inflammatory cells and a dual
role of activin-A in inflammatory responses has been proposed. On one hand,
activin-A promotes alveolar cell death and stimulates the production of pro-
inflammatory cytokines, including IL-6. Furthermore, activin-A is increased following
pulmonary lipopolysaccharide (LPS) exposure and follistatin reduces LPS-induced
pulmonary inflammation in mice.7 On the other hand, follistatin was shown to
augment the production of pro-inflammatory cytokines in concerted action with
TNF-α and IL-13.8 This dual role was also noted in an LPS model of endotoxaemia,
showing that low doses of follistatin augmented IL-6 expression, but reduced
TNF-α and IL-1β concentrations, whereas at higher follistatin concentrations IL-6
expression was normalised.10 Therefore, the role of activin-A in cigarette smoke-
induced inflammation and COPD may be more complex, and studies are warranted
to identify its role in more detail. In particular, its potential anti-inflammatory role
in the regulation of inflammation in COPD needs to be clarified and the therapeutic
potential of activin-A inhibition needs to be explored in more detail.
Several intriguing questions arise from this study require further investigation.
Activin-A regulates expression of its own inhibitor follistatin as a negative feedback
mechanism to control the degree of inflammation.11 Increased expression of
follistatin was not observed in COPD, suggesting that this negative feedback
mechanism might be altered, leading to uncontrolled inflammatory responses.
Therefore, it is important to examine the effect of cigarette smoke on activin-A
and follistatin expression in epithelial and inflammatory cells derived from COPD
patients. Moreover, it is rational to explore the role of activin-A in remodelling as
activin-A shares homology and signalling characteristics with TGF-β1. In this respect,
follistatin inhibits bleomycin-induced pulmonary fibrosis12 and ovalbumin induced
airway remodelling.13 Interestingly, activin-A also promotes alveolar epithelial cell
death.7 Hence, it would be worthwhile to explore the role of activin-A in emphysema.
Furthermore, although administration of exogenous follistatin was able to inhibit
cigarette smoke-induced inflammation, additional study is needed to develop
strategies to restore the endogenous activin-A/follistatin imbalance.
In conclusion, the study of Verhamme et al.9 sheds light on the role of
activin-A and follistatin in COPD, and motivates further investigation. Persistent
and exaggerated production of activin-A might be a key factor provoking persistent
inflammation in COPD. Restoring the activin-A/follistatin imbalance is a therapeutic
strategy worth pursuing in COPD.
72
References
1. Shi W, Chen F, Cardoso WV. Mechanisms of lung development: contribution to adult lung disease
and relevance to chronic obstructive pulmonary disease. Proc Am Thorac Soc. 2009;6(7):558-
563. doi:10.1513/pats.200905-031RM.
2. Baarsma HA, Spanjer AIR, Haitsma G, et al. Activation of WNT / β-Catenin Signaling in Pulmonary
Fibroblasts by TGF-β 1 Is Increased in Chronic Obstructive Pulmonary Disease. PLOS ONE.
2011;6(9):e25450. doi:10.1371/journal.pone.0025450.
3. Rock J, Königshoff M. Endogenous lung regeneration: potential and limitations. Am J Respir Crit
Care Med. 2012;186(12):1213-1219. doi:10.1164/rccm.201207-1151PP.
4. Van Durme YMTA, Eijgelsheim M, Joos GF, et al. Hedgehog-interacting protein is a COPD susceptibility
gene: the Rotterdam Study. Eur Respir J. 2010;36(1):89-95. doi:10.1183/09031936.00129509.
5. Hedger MP, de Kretser DM. The activins and their binding protein, follistatin-Diagnostic
and therapeutic targets in inflammatory disease and fibrosis. Cytokine Growth Factor Rev.
2013;24(3):285-295. doi:10.1016/j.cytogfr.2013.03.003.
6. Yndestad A, Larsen K-O, Oie E, et al. Elevated levels of activin A in clinical and experimental
pulmonary hypertension. J Appl Physiol Bethesda Md 1985. 2009;106(4):1356-1364.
doi:10.1152/japplphysiol.90719.2008.
7. Apostolou E, Stavropoulos A, Sountoulidis A, et al. Activin-A overexpression in the murine lung
causes pathology that simulates acute respiratory distress syndrome. Am J Respir Crit Care Med. 4
2012;185(4):382-391. doi:10.1164/rccm.201105-0784OC.
8. Kariyawasam HH, Pegorier S, Barkans J, et al. Activin and transforming growth factor-beta
signaling pathways are activated after allergen challenge in mild asthma. J Allergy Clin Immunol.
2009;124(3):454-462. doi:10.1016/j.jaci.2009.06.022.
9. Verhamme FM, Bracke KR, Amatngalim GD, et al. Role of activin-A in cigarette smoke-induced
inflammation and COPD. Eur Respir J. 2014;43(4):1028-1041. doi:10.1183/09031936.00082413.
10. Jones KL, Mansell A, Patella S, et al. Activin A is a critical component of the inflammatory
response, and its binding protein, follistatin, reduces mortality in endotoxemia. Proc Natl Acad
Sci U S A. 2007;104(41):16239-16244. doi:10.1073/pnas.0705971104.
11. Bartholin L, Maguer-Satta V, Hayette S, et al. Transcription activation of FLRG and follistatin by
activin A, through Smad proteins, participates in a negative feedback loop to modulate activin A
function. Oncogene. 2002;21(14):2227-2235. doi:10.1038/sj.onc.1205294.
12. Aoki F, Kurabayashi M, Hasegawa Y, Kojima I. Attenuation of bleomycin-induced pulmonary
fibrosis by follistatin. Am J Respir Crit Care Med. 2005;172(6):713-720. doi:10.1164/rccm.200412-
1620OC.
13. Hardy CL, Nguyen H-A, Mohamud R, et al. The activin A antagonist follistatin inhibits asthmatic
airway remodelling. Thorax. 2013;68(1):9-18. doi:10.1136/thoraxjnl-2011-201128.
73
 CHAPTER 5 1

Pro-inflammatory roles of Follistatin-like 1

in coordinating epithelial-mesenchymal
communication in inflammatory cytokine
release in the lung.

Navessa P. Tania, Harm Maarsingh, Maurice J.B. van den Hoff, Vanessa
Niburg, Andrew J. Halayko, Martina Schmidt, Reinoud Gosens

75
Pro-inflammatory roles of Follistatin-like 1 in coordinating epithelial-mesenchymal
communication in inflammatory cytokine release in the lung.
Navessa P. Tania1,2, Harm Maarsingh3, Maurice J.B. van den Hoff4, Vanessa Niburg1,
Andrew J. Halayko5, Martina Schmidt1,2, Reinoud Gosens1,2
University of Groningen, Department of Molecular Pharmacology, Groningen, The
1 transfected with FLAG-tagged Fstl1 or cyan fluorescent protein (control) constructs
Netherlands.
2
University of Groningen, University Medical Center Groningen, Groningen Research
Institute for Asthma and COPD, Groningen, The Netherlands.
3
Palm Beach Atlantic University, Lloyd L. Gregory School of Pharmacy, Department of
Pharmaceutical Sciences, West Palm Beach, FL, USA.
4
Academic Medical Center, Department of Anatomy, Embryology and Physiology,
Amsterdam, The Netherlands.
5
University of Manitoba, Department of Physiology and Pathophysiology, Winnipeg,
Canada.
76
Abstract
The pathogenesis of respiratory diseases such as asthma and chronic obstructive
pulmonary disease (COPD) has been linked to chronic inflammation of the lungs,
potentiated by inhaled toxic particles and infectious agents. The airway epithelium
releases inflammatory mediators with paracrine effects on neighboring cells,
including lung fibroblasts and airway smooth muscle cells. Follistatin-like 1 (Fstl1) is a
secreted glycoprotein expressed by developing lung epithelium, and can contribute
to inflammatory lung pathogenesis if it becomes dysregulated. Here, we aimed to
investigate the functional role of Fstl1 as a determinant of airway epithelial-driven local
inflammation. The human bronchial epithelial cell line (16HBE14o-) was transiently
to generate Fstl1 and CFP conditioned medium (Fstl1 CM and CFP CM, respectively).
The mRNA expression and protein release of IL-6 and IL-8 were determined in cell
lysates and culture supernatants from lung mesenchymal cells. An ARY005 human
cytokine array kit was used to identify epithelial-derived secreted factors present
in CM.Fstl1 CM increased IL-6 and IL-8 mRNA expression and protein release from
human lung mesenchymal cells. However, neither recombinant Fstl1 alone nor
direct overexpression or knockdown of Fstl1 in lung fibroblasts was sufficient to
alter baseline or IL-1β-induced IL-6 and IL-8 protein release. Fstl1 overexpression 5
did induce inflammatory mediator release (GM-CSF, RANTES, IL-6, IL-8) from human
bronchial epithelial cells. In turn, we found that neutralizing antibodies for GM-
CSF, RANTES, IL-6 and IL-8 completely diminished Fstl1 CM-induced release of IL-6
and IL-8 from human lung fibroblasts. Our findings demonstrate that Fstl1 is a pro-
inflammatory factor that can orchestrate the local microenvironment by promoting
airway epithelial cells to release a repertoire of mediators that induce a further
subset of inflammatory mediators from neighboring lung mesenchymal cells. These
data implicate a potential new role for Fstl1 in coordinating and potentiating local
inflammation in chronic lung disorders like asthma and COPD.
77
Introduction
The pulmonary epithelial lining serves as a boundary between the lung and the external
environment. Hence, it acts as the first line of defense against inhaled toxic gases,
particles and infectious agents. Epithelial cells signal changes in the environment to
their neighboring cells, including inflammatory cells and mesenchymal cells such as
sub-epithelial fibroblasts and airway smooth muscle cells.1–3 In turn, a number of
trophic and secretory responses are induced in mesenchymal cells, including the
biosynthesis of a myriad of cytokines and chemokines which eventually result in
leukocyte influx to the lung.2,3
Follistatin-like 1 (Fstl1) is an extracellular glycoprotein belonging to a secreted
protein acidic and rich in cysteine (SPARC) family, which is crucial for normal
lung development.4,5 High levels of Fstl1 have been reported in a number of
inflammatory diseases, such as rheumatoid arthritis, ulcerative colitis, systemic
lupus erythematosus, systemic autoimmune disease, and obesity.6–8 Administration
of Fstl1 aggravates arthritis in mice,9 whereas blocking Fstl1 using a neutralizing
antibody ameliorated collagen-induced arthritis.10 Fstl1 regulates inflammatory
cytokine release from mesenchymal and inflammatory cells, for example the
upregulation of IL-6 and IL-8 from stromal cells, synovial fibroblasts, adipocytes, and
macrophages in vitro7,9,11,12 and IFN-γ from T cells.10 These findings suggest that Fstl1
may sub-serve a previously unrecognized role as a pro-inflammatory cytokine.9,11
Very little is known about the immunomodulatory function of Fstl1 in the lung.
Thus, in the present study we tested the hypothesis that Fstl1 can mediate cytokine
release from pulmonary mesenchymal cells.
78
Material and Methods
Cell culture
The human bronchial epithelial cell line (16HBE14o-) was cultured on collagen-coated
flasks in minimum essential medium (Lonza; Basel, Switzerland) supplemented
with 10% (v/v) heat inactivated fetal bovine serum (FBS), 2 mM L-glutamine, 100
U/ml penicillin, 100 ug/ml streptomycin, 56 ug/ml gentamycin and 1.5 ug/ml
amphotericin B (Thermo Fisher Scientific; Waltham, MA, USA). Human fetal lung
fibroblasts MRC-5 were maintained in Ham’s F12 medium (Lonza; Basel, Switzerland)
supplemented with 10% (v/v) FBS, 2 mM L-glutamine, 100 U/ml penicillin, 100 ug/
ml streptomycin and 1.5 ug/ml amphotericin B (Thermo Fisher Scientific; Waltham,
MA, USA). Human bronchial airway smooth muscle cells, immortalized by stable
ectopic expression of human telomerase reverse transcriptase (hTERT) as described
previously13 were maintained in Dulbecco’s modified Eagle’s medium (DMEM;
Thermo Fisher Scientific; Waltham, MA, USA) supplemented with 10% (v/v) FBS, 100
U/ml penicillin and 100 ug/ml streptomycin and 1.5 amphotericin B (Thermo Fisher
Scientific; Waltham, MA, USA). Cells were maintained in a humidified incubator at
37 °C in air/CO2 (95/5% v/v).
Generation of Fstl1 conditioned medium and stimulation of mesenchymal cells­ 5
16HBE14o- cells were grown to 80% confluence and transfected with either 1 µg/
ml pcDNA3.1 containing FLAG-tagged mouse Fstl1 (Fstl1-FLAG) or cyan fluorescent
protein (CFP) as control for 24 h using transfection reagent SAINT-MIX (SM-1001-01,
Synvolux Therapeutics; Groningen, the Netherlands). The following day, cells were
washed and serum-free media was added. Cell culture supernatants were collected
48 h later. Culture supernatants obtained from 16HBE14o- cells overexpressing
Fstl1-FLAG or CFP were defined as Fstl1 conditioned medium (Fstl1 CM) or CFP CM,
respectively. Fstl1 CM and CFP CM were centrifuged at 4500g for 10 min and filtered
through a membrane of 0.2 µm pore size to remove cells and large cell debris,
respectively. Expression levels of Fstl1-FLAG were verified using Western blot. Fstl1
was detected using a rabbit anti-FLAG antibody (2368S, Cell Signaling; Danvers,
MA, USA) and horseradish peroxidase (HRP)-conjugated donkey anti-rabbit IgG as
secondary antibody (711-035-152, Jackson Immunoresearch; West Grove, PA, USA).
Protein bands were visualized using enhanced chemiluminescence substrate(ECL;
Perkin Elmer; Groningen, the Netherlands) in the G-box gel documentation system
(Syngene; Cambridge, UK).
To test the effects of Fstl1 CM and CFP CM on mesenchymal cells, lung fibroblasts
and airway smooth muscle cells were grown until 90% confluence. After serum
deprivation for 24 h, cultures were treated with different concentrations of Fstl1 CM
(20%, 40% and 50% v/v with 0.5% FBS in Ham’s F12 or in serum-free DMEM or CFP
CM (50% v/v) as controls for 24 h. Cells were lysed and culture supernatants were
collected.
79
Recombinant Fstl1 stimulation, gain- and loss-of function studies Table 1: Primers used for qRT-PCR analysis.
MRC-5 human lung fibroblasts were grown to 90% confluence in 24-wells cluster Gene Forward primer (5’ 3’) Reverse primers (5’ 3’’)
plates and serum-deprived for 24 h prior stimulation with or without 15, 50, 100
FSTL1 ACCACGATGTGGAAACGCTGGC TGCCATTACTGCCACACACAGGC
and 200 ng/ml recombinant human Fstl1 (1694-FN, R&D system; Oxford, UK)
for 24 h. To overexpress Fstl1, MRC-5 cells were transfected with either 1 µg/ml IL6 AGGAGACTTGCCTGGTGAAA TAAAGCTGCGCAGAATGAGA
mouse Fstl1-FLAG or CFP as controls using transfection reagent SAINT-MIX (SM- IL8 TAGCAAAATTGAGGCCAAGGC AAACCAAGGCACAGTGGAAC
1001-01, Synvolux Therapeutics; Groningen, the Netherlands). To silence Fstl1 gene
expression, MRC-5 cells were treated with either 50 pmol FSTL1 siRNA (sc-39815, RANTES TGCTGCTTTGCCTACATTGC TCGGGTGACAAAGACGACTG
Santa Cruz Biotechnology; Heidelberg, Germany) or scrambled siRNA as controls GM-CSF AGTTCTCTGGAGGATGTG GCT CTACTGTTTCATTCATCTCAGCAGC
(SI03650318, Qiagen; Venlo, the Netherlands) using transfection reagent SAINT-RED 18S CGCCGCTAGAGGTGAAATTC TTGGCAAATGCTTTCGCTC
siRNA/RNA (SR-1003-02, Synvolux Therapeutics; Groningen, the Netherlands). Cells
were serum deprived for 24 h prior to stimulation with or without 0.01, 0.1 and 1.0 SDHA GGGAAGACTACAAGGTGCGG CTCCAGTGCTCCTCAAAGGG
ng/ml IL-1β (11457756001, Sigma Aldrich; St. Louis, MO, USA). Culture supernatants HPRT1 AAGCCAGACTTTGTTGGATTTGA ACTGGCGATGTCAATAGGACTC
were collected and cells were lysed 24 h after stimulation.
Abbreviations used: FSTL1, Follistatin-like 1; IL6, interleukin 6; IL8, interleukin 8; RANTES,
regulated on activation, normal T cell expressed and secreted; GM-CSF, granulocyte
RNA isolation and Real time quantitative PCR macrophage-colony stimulating factor; 18S, 18S ribosomal RNA; SDHA, succinate
Total RNA was isolated using TRI Reagent® Solution (AM9738, Thermo Fisher dehydrogenase complex flavoprotein subunit A; and HPRT1, hypoxanthine guanine
Scientific; Waltham, MA, USA) according to the manufacturer’s instruction. The phosphoribosyl transferase 1.
total RNA concentration was determined using the Spectrophotometer NanoDrop®
ND1000 (Thermo Fisher Scientific; Waltham, MA, USA). Equal amounts of total RNA
5
Enzyme-linked immunosorbent assays (ELISA)
were reverse transcribed using Reverse Transcription System (Promega; Madison,
The concentration of IL-6 (M1916) and IL-8 (M1918) in culture supernatants
WI, USA). Diluted cDNA was mixed with FastStart Universal SYBR Green Master
was measured in triplicates using PeliKine compactTM ELISA kit according to the
Mix (Roche Applied Science; Penzberg, Germany) and gene of interest primers
manufacturer’s protocol (Sanquin; Amsterdam, the Netherlands). The concentration
sets (Biolegio; Nijmegen, the Netherlands). Primer sequences are listed in Table 1.
of IL-6 and IL-8 in the culture supernatants of lung fibroblasts and airway smooth
Real-time quantitative PCR was performed using the Illumina Eco Personal qPCR
muscle cells treated with conditioned medium obtained from 16HBE14o- cells was
System (Westburg; Leusden, The Netherlands). The qPCR reaction was started by
measured and corrected by subtracting the concentration of IL-6 and IL-8 already
denaturation at 95°C for 15 minutes followed by 45 cycles of denaturation at 94°C
present in Fstl1 CM and CFP CM controls. The sensitivities for IL-6 and IL-8 were
for 30 s, annealing at 59°C for 30 s and elongation at 72°C for 30 s. Final elongation
0.2 pg/ml and 1.0 pg/ml, respectively. The concentration of human GM-CSF and
was for 5 minutes at 72 °C. Real time PCR data were analyzed using LinRegPCR
RANTES was measured in duplicate in culture medium supernatants using human
software version 2013.1.14 Data were expressed in arbitrary units as ratio of the
GM-CSF (DGM00) and RANTES (DRN00B) quantikine ELISA kits according to the
starting concentration (N0) of each gene of interest corrected to the geometric mean
manufacturer’s protocol (R&D system; Oxford, UK). The optical density was measured
of the N0 value of 3 reference genes (18S, SDHA and HPRT1).
at 450 nm with 570 nm as a wavelength correction using Gen5an software using a
plate reader (BioTek; Winooski, VT, USA). The sensitivities for GM-CSF and RANTES
ELISA were 3 pg/ml and 2 pg/ml, respectively.

80 81
Human cytokine arrays
To identify potential inflammatory mediators in Fstl1 CM and CFP CM, a cytokine
array was performed using the Human Cytokine Array Kit (ARY005, R&D system;
Oxford, UK) according to the manufacturer’s instruction. An antibody array that
captures 29 cytokines was spotted in duplicate on nitrocellulose membranes. A
complete list of cytokines is listed in Table 2. Detection antibody/cytokine complexes
bound to immobilized capture antibodies on the membrane were visualized using
ECL (Perkin Elmer, Groningen, the Netherlands) in the G-box gel documentation
system (Syngene; Cambridge, UK).
Results
Fstl1 induces inflammatory cytokine release from mesenchymal cells
Bronchial epithelial cells express and release endogenous Fstl1 protein in vitro to
a higher degree than lung fibroblasts and airway smooth muscle cells, which show
only limited intracellular protein expression (Figure 1A and B) and release (Figure
1C and D). A previous study demonstrated crosstalk between lung epithelial and
mesenchymal cells in driving inflammatory response in the lung.3 To investigate the

Table 2. Human cytokines and chemokines studied in the antibody array.

C5a GM-CSF IL-13 Serpin E1/PAI-1
IL-4 IL-8 CCL4/MIP-1β IL-1ra/IL-1F3
IL-32α CCL2/MCP-1 IFN-γ TNF-α
CD40 ligand/TNFSF5 CXCL1/GRO α IL-16 IL-2
IL-5 IL-10 CCL5/RANTES IL-27
CXCL10/IP-10 MIF IL-1α/IL-1F1 TREM-1
G-CSF CCL1/I-309 IL-17 IL-23
IL-6 IL-12 p70 CXCL12/SDF-1 ICAM-1
CXCL11/I-TAC CCL3/MIP-1α IL-1β/IL-1F2 IL-17E
5
Neutralizing antibody treatment
MRC-5 cells were grown to 90% confluence and serum deprived for 24 h before
experiments. Fstl1 and CFP CM (50% v/v with 0.5% serum Ham’s F12) were
incubated with either neutralizing antibodies against IL-6 (MAB206), IL-8 (MAB208),
GM-CSF (MAB215-100), RANTES (AF-278-NA) or a combination of these neutralizing
antibodies (R&D system, Oxford, UK) 1 h prior to the addition of CM to the cells. IgG
isotype control was used as a control (MAB002, R&D system; Oxford, UK). Cells were
washed and maintained in Ham’s F12 medium containing 0.5% FBS before adding
the neutralizing antibody-treated CM. Culture supernatants were collected and cells
were lysed 24 h after treatment.

Statistical analysis
Data are presented as mean values ± standard error of the mean (SEM). Prior to
further statistical analysis, the normality of data distribution was examined using
a Shapiro-Wilk normality test. The statistical significance of differences of normal
Gaussian distributed data was determined using an independent samples 2-tailed
t-test for comparing 2 groups or two-way ANOVA followed by a post hoc Tukey
multiple comparisons test for comparing more than 2 groups. For non-Gaussian
distributed data, the statistical significance of differences was done using a non-
parametric Mann-Whitney U test for comparing 2 groups or non-parametric one-
way ANOVA with a post hoc Kruskal-Wallis multiple comparisons test for comparing
more than 2 groups. All statistical analysis was performed using IBM SPSS Statistics
22 (Armonk, NY, USA). Differences were considered to be statistically significant at
p<0.05.
Figure 1. Pulmonary bronchial epithelial cells express and release Fstl1. Representative
immunoblots and quantification of intracellular (A, B) and secreted (C, D) Fstl1 in bronchial
epithelial cells, MRC-5 lung fibroblasts and airway smooth muscle cells. Data represent
mean ± SEM of 7-9 independent cell lysates and culture supernatants. (E) The expression
of FSTL1 mRNA in Fstl1-FLAG overexpressing bronchial epithelial cells compared to CFP
controls. (F) A representative immunoblot and quantification of Fstl1 in supernatants of
Fstl1-FLAG overexpressing bronchial epithelial cells compared to CFP controls. Protein bands
were detected using anti-FLAG antibody. Data represent mean ± SEM of 6 independent
experiments. *p<0.05, **p<0.01, ***p<0.001 compared to bronchial epithelial cells or
controls.

82 83
effect of Fstl1 expressed by bronchial epithelial cells and its potential contribution
to inflammatory cytokine release from mesenchymal cells, we overexpressed Fstl1
in bronchial epithelial cells and treated lung fibroblasts and airway smooth muscle
cells with Fstl1 CM derived from bronchial epithelial cells. Overexpression of Fstl1-
FLAG was verified in cell lysates and culture supernatants of bronchial epithelial cells.
Fstl1 mRNA was 4.3-fold increased (p<0.001; Figure 1E) in the Fstl1-overexpressing
bronchial epithelial cells, whereas the amount of secreted Fstl1 protein was 12.1-
fold increased (p<0.001; (Figure 1F).
Interestingly, treatment of lung fibroblasts and airway smooth muscle cells with
Fstl1 CM dose-dependently increased mRNA expression and protein release of IL-6
and IL-8. At 50% concentration, in comparison to control CFP CM, Fstl1 CM induced
IL-6 and IL-8 mRNA by 1.9-fold (p<0.05) and 1.6-fold (p<0.05), respectively, in lung
fibroblasts (Figure 2A and 2B). Similarly 50% Fstl1 CM increased IL-6 and IL-8 mRNA
Figure 2. Fstl1 CM derived from bronchial epithelial cells induces IL-6 and IL-8 mRNA
expression in lung mesenchymal cells. 16HBE14o- cells were grown to confluence and
transfected with either Fstl1-FLAG or CFP (control) to generate Fstl1 CM and CFP CM,
respectively. MRC-5 lung fibroblasts and airway smooth muscle cells were stimulated with
increasing percentages of Fstl1 CM (20; 40; 50% v/v) or CFP CM (50% v/v). The expression of
IL-6 and IL-8 mRNA was measured in cell lysates of lung fibroblasts (A, B) and airway smooth
muscle cells (C,D) using qPCR. Data represent mean ± SEM of 4-8 independent experiments.
*p<0.05, ***p<0.001 compared to CFP CM controls.
84
by 2.0-fold (p<0.001) and 1.7-fold (p<0.001), respectively, in airway smooth muscle
cells (Figure 2C and 2D)­.
We further attempted to decipher whether Fstl1 CM also affected the release
of IL-6 and IL-8 protein from mesenchymal cells, thus we determined IL-6 and IL-8
protein in culture supernatants from lung fibroblasts and airway smooth muscle cells,
but corrected for the levels that were already present in the CM. In this manner we
were able to demonstrate, similar to our measurement of mRNA abundance. Fstl1
CM dose-dependently induced IL-6 and IL-8 protein release by 1.5-fold (57.6 ng/
ml; p<0.05) and 1.7-fold (106.0 ng/ml; p<0.001), respectively, from lung fibroblasts
(Figure 3A and 3B). Release of IL-6 and IL-8, respectively, from airway smooth muscle
cells was also increased by 3.1-fold (39.1 ng/ml; p<0.001) and 1.8-fold (104.1 ng/
ml; p<0.05) after Fstl1 CM exposure (Figure 3C and 3D). Collectively, these data
suggest that Fstl1 is involved in the inflammatory cytokine release from pulmonary
mesenchymal cell.
Figure 3. Fstl1 CM derived from bronchial epithelial cells induces IL-6 and IL-8 release from
mesenchymal cells. 16HBE14o- cells were grown to confluence and transfected with Fstl1-
FLAG or CFP (control) to generate Fstl1 CM and CFP CM, respectively. MRC-5 lung fibroblasts
and airway smooth muscle cells were stimulated with increasing percentages of Fstl1 CM
(20; 40; 50% v/v) or CFP CM (50% v/v). The concentration of IL-6 and IL-8 was measured
using ELISA in culture supernatants of CM-treated lung fibroblasts (A, B) and airway smooth
muscle cells (C, D) and in the Fstl1 CM and CFP CM. Data represent mean ± SEM of 4-8
independent experiments. The concentration of IL-6 and IL-8 in culture supernatants of
mesenchymal cells was corrected for the amount of IL-6 and IL-8 present in the CM. *p<0.05,
**p<0.01, ***p<0.001 compared to CFP CM controls.
85
Recombinant Fstl1 and modulation of Fstl1 expression have no effect on
inflammatory cytokine expression and release from lung fibroblasts
Lung fibroblasts were treated with recombinant human Fstl1, this was, however,
not sufficient to alter mRNA abundance or protein release of IL-6 and IL-8 from
lung fibroblasts (Figure 4A-4D). Since recombinant Fstl1 may not fully represent the
native Fstl1 due to differences in post-translational modifications, we used another
approach to investigate the direct effect of Fstl1 on inflammatory cytokine release by
modulating the endogenous Fstl1 expression using gain- and loss-of-function studies
in lung fibroblasts. Overexpression using a pcDNA3.1 containing Fstl1-FLAG resulted
in a 7.8-fold increase in Fstl1 mRNA (p<0.001; Figure 5A), whereas silencing of Fstl1
using FSTL1 siRNA resulted in a 61% decrease in Fstl1 mRNA (p<0.001; Figure 6A).
Despite significant upregulation or silencing of Fstl1, we observed no effect on basal
or IL-1β-induced IL-6 and IL-8mRNA abundance (Figure 5B-C and 6B-C) or protein
release (Figure 5D-E and 6D-E) from lung fibroblasts.

Figure 6. Silencing of Fstl1 did not affect IL-1β-induced IL-6 and IL-8 mRNA expression
and protein release from lung fibroblasts. MRC-5 were transfected with either FSTL1
siRNA or scrambled siRNA (control) and treated with IL-1β (0.01, 0.1 and 1 ng/ml) for 24
h. (A) Verification of FSTL1 silencing (black bars) in lung fibroblasts compared to scrambled
siRNA controls (white bars). IL-6 and IL-8 mRNA expression in cell lysate (B,C) and protein 5
concentration in culture supernatants (D,E) were measured using qPCR and ELISA, respectively.
Data represent mean ± SEM of 3 independent experiments. *p<0.05, ***p<0.001 compared
to scrambled siRNA non-treated controls; n.s. = non-significant.

Figure 5. Overexpression of Fstl1 did not affect IL-1β-induced IL-6 and IL-8 mRNA
expression or protein release from lung fibroblasts. MRC-5 lung fibroblasts were
transfected with either Fstl1-FLAG or CFP (control) and treated with IL-1β (0.01, 0.1 and 1
ng/ml) for 24 h. (A) Verification of Fstl1-FLAG overexpression (black bars) in lung fibroblasts
compared to CFP controls (white bars). IL-6 and IL-8 mRNA expression in cell lysate (B,C)
and protein concentration in culture supernatants (D,E) were measured using qPCR and
ELISA, respectively. Data represent mean ± SEM of 3 independent experiments. ***p<0.001
compared to CFP non-treated controls; n.s. = non-significant.
Levels of GM-CSF and IL6 are increased in Fstl1 CM derived from bronchial epithelial
cells
Our findings suggest that bronchial epithelium-derived mediators present in the
culture supernatants from Fstl1-overexpressing bronchial epithelial cells, but
not secreted Fstl1 itself, may promote inflammatory cytokine release from lung
mesenchymal cells. We tested whether Fstl1 induces inflammatory mediators from
bronchial epithelial cells which subsequently increase IL-6 and IL-8 release from lung
fibroblasts. To identify inflammatory mediators that are responsible for the Fstl1
CM-induced cytokine release from lung fibroblasts, we screened for factors that are
differentially present in Fstl1 CM compared to CFP CM using a human cytokine array
that screens for 29 cytokines (Table 2). Overexpression of Fstl1 in bronchial epithelial
cells increased levels of RANTES, IL-6, IL-8, and granulocyte-macrophage colony-
stimulating factor (GM-CSF), as evident from their higher intensity compared to CFP
CM array data (Figure 7A). Subsequent studies demonstrated that the mRNA levels
for RANTES, and GM-CSF were indeed selectively increased in bronchial epithelial
cellsthat overexpressFstl1, and released protein levels in culture media was also
increased for IL-6 and GM-CSF (Figure 7B-I).

86 87
Neutralizing antibodies against GM-CSF, RANTES, IL-6 and IL-8 attenuate Fstl1 CM-
induced cytokine release from lung fibroblasts
To elucidate which bronchial epithelial-derived factors mediate Fstl1 CM-induced
cytokine release from lung fibroblasts, we treated CM with neutralizing antibodies
alone or in combination prior to the addition of the CM to lung fibroblasts. IgG
isotype control-treated Fstl1 CM significantly increased IL-6 release (p<0.001) and
IL-8 release (p<0.01) from lung fibroblasts. However, Fstl1 CM-induced IL-6 release
from lung fibroblasts was significantly reduced by neutralizing antibodies against
Figure 7. Inflammatory mediators are increased in culture supernatants of Fstl1
overexpressing bronchial epithelial cells. Fstl1 CM derived from Fstl1 overexpressing
16HBE14o- cells was analyzed using human cytokine arrays compared to CFP CM controls.
(A) Representative membranes show that RANTES, IL-6, IL-8 and GM-CSF were increased in
Fstl1 CM compared to CFP CM. The mRNA expression and protein concentration of RANTES
(B and C), IL-6 (D and E), IL-8 (F and G), GM-CSF (H and I) were in cell lysates and culture
supernatants, respectively, of Fstl1-FLAG overexpressing bronchial epithelial cells (black
bars) compared to CFP controls (white bars). Data represent mean ± SEM of 6 independent
experiments. *p<0.05, ***p<0.001 compared to CFP overexpressing bronchial epithelial cell
controls; n.s. = non-significant.
88
either IL-6 (p<0.01) or IL-8 (p<0.05) (Figure 8A). The combination of GM-CSF, RANTES,
IL-6 and IL-8 neutralizing antibodies completely attenuated Fstl1 CM-induced IL6
release from lung fibroblasts (p<0.001; Figure 8A). Conversely, Fstl1 CM retained
capacity to induce IL-8 release from lung fibroblasts despite pre-treatment with
neutralizing antibodies against IL-6 (p=0.038), IL-8 (p=0.034), or RANTES (p=0.02)
alone (Figure 8B). Importantly, a combination of neutralizing antibodies for GM-CSF,
RANTES, IL-6 and IL-8 did completely dampened the Fstl1 CM-induced IL-8 release
from lung fibroblasts (p<0.05, Figure 8B).
Figure 8.GM-CSF, RANTES, IL-6 and IL-8 neutralizing antibodies attenuate Fstl1 CM-induced
cytokine release from lung fibroblasts.Fstl1 CM (50% v/v, black bars) or CFP CM (50% v/v,
white bars) were pre-incubated with antibodies targeting RANTES, IL-6, IL-8, GM-CSF or a
combination of these neutralizing antibodies 1 h prior to addition to MRC-5 lung fibroblasts.
The protein concentration of IL-6 (A) andIL-8 (B) was measured in culture supernatants from
lung fibroblasts after 24 h stimulation. Data represent mean ± SEM of 6 independent exper-
iments. **p<0.01, ***p<0.001 Fstl1 CM compared to CFP CM controls, #p<0.05, ##p<0.01,
###p<0.001 compared to IgG isotype control-treated Fstl1 CM.
89
Discussion
The pathogenesis of respiratory diseases has been linked to chronic inflammation of
the lungs in response to epithelial injury. The airway epithelium is the first protective
barrier of the internal lung tissue from the external environment. Upon damage,
the epithelium releases inflammatory mediators to communicate with neighboring
cells as part of the defense and repair mechanism.3,15 Fstl1 has been implicated in
the pathogenesis of several inflammatory diseases and has been demonstrated to
modulate inflammatory responses in mouse models of inflammatory diseases.9,10,16
Recent in vitro, in vivo, and proteomic studies demonstrate the involvement of
Fstl1 in the pathological process of respiratory diseases, including lung fibrosis
and asthma.17–20 Fstl1 has previously been identified as a mesenchymal-derived
inflammatory protein in joints.16,21 However, our data indicate that in the respiratory
system, bronchial epithelial cells express and release Fstl1 in much greater amount
than mesenchymal cells. To test the functional relevance of Fstl1 in inflammatory
cytokine release in the lung, we overexpressed Fstl1 in bronchial epithelial cells and
demonstrated that Fstl1 overexpression induces inflammatory cytokine release.
Moreover, Fstl1 CM induces significant cytokine release from lung mesenchymal
cells, likely mediated by GM-CSF, RANTES, IL-6 and IL-8 derived from bronchial
epithelial cells.
Epithelial cells communicate with mesenchymal cells as part of their defense
system and a role for Fstl1 in cell-cell communication has been previously
suggested.9,17 To investigate whether bronchial epithelial-derived Fstl1 affects the
inflammatory response in mesenchymal cells, we treated lung fibroblasts and airway
smooth muscle cells with medium-derived from Fstl1 overexpressing bronchial
epithelial cells (Fstl1 CM). We hypothesized that Fstl1-derived bronchial epithelial is
sufficient to mediate inflammatory cytokine release from mesenchymal cells. Fstl1
CM increased IL-6 and IL-8 mRNA expression and protein release from mesenchymal
cells, suggesting that Fstl1 may regulate pro-inflammatory cytokine release in the
lung. These observations are in line with previous studies demonstrating that Fstl1
promotes IL-6 and IL-8 release from mesenchymal cells.7,9,11,12 However, recombinant
Fstl1 treatment and direct modulation of Fstl1 gene expression in lung fibroblasts
showed no effect on baseline or IL-1β-induced IL-6 and IL-8 protein release, indicating
that there are additional factors involved in the lung fibroblast response to Fstl1 CM.
Our data points to a paradigm in which Fstl1 induces the release of inflammatory
mediators from bronchial epithelial cells that have a strong pro-secretory effect on
nearby mesenchymal cells.
Using cytokine array we identified four potential factors that were increased
upon Fstl1 overexpression in bronchial epithelial cells, namely GM-CSF, RANTES,
IL-6, and IL-8. Our studies using neutralizing antibodies demonstrate that only the
combination of neutralizing antibodies targeting GM-CSF, RANTES, IL6, and IL8
completely blocked Fstl1 CM-induced IL-6 and IL-8 release from lung fibroblasts.
Pre-treatment of Fstl1 CM with neutralizing antibodies against GM-CSF and RANTES
90
alone did not completely inhibit this response. Intriguingly, neutralizing antibodies
selectively targeting IL-6 or IL-8 were able to diminish IL-6 release from lung
fibroblasts induced by Fstl1 CM, suggesting autocrine/paracrine regulation of these
cytokines.
We demonstrate here the first evidence on a direct link between Fstl1 and GM-
CSF or RANTES. Fstl1 overexpression increases GM-CSF gene expression and protein
release from bronchial epithelial cells. Though GM-CSF was originally identified
as a key regulator governing the proliferation and maturation of granulocyte and
macrophage lineages,22 a growing body of evidence indicates that GM-CSF is also an
inflammatory mediator capable of modulating neutrophil migration and survival.22–25
Plasma cytokine levels of GM-CSF is significantly upregulated in patients with COPD,
in particular during chronic bronchitis exacerbations.26–29 Overexpression of GM-CSF
triggers lung inflammation and fibrosis in mice,30,31 whereas a neutralizing antibody
against GM-CSF decreases neutrophil number in the bronchoalveolar lavage fluid
(BALF) of a mouse model of cigarette smoke-induced inflammation.25,32 Moreover, as
overexpression of Fstl1 increases RANTES mRNA levels but does not induce RANTES
release from bronchial epithelial cells, suggesting the effects of Fstl1 CM on RANTES
biosynthesis is complex. RANTES, also known as CC chemokine ligand 5 (CCL5) is a
chemotactic activator of eosinophils,33 that has been associated with asthma,34–36
lung allergic inflammation, and bronchial hyperresponsiveness.33 5
Fstl1 can signal via different signaling pathways, including bone morphogenetic
protein (BMP) receptors,4,5 DIP2 disco-interacting protein 2 homolog A,6,37 toll-like
receptor 4 (TLR4),12 and Na+/K+-ATPase.8 As a collective, our findings and existing
evidence suggest that future studies are needed to delineate the mechanism
underlying differential Fstl1 effects on cytokine release from bronchial epithelial
cells and lung mesenchymal cells.
Although the exact mechanism of Fstl1 action in cytokine expression and release
remains to be elucidated, our study provides the first in vitro demonstration that
Fstl1 induces the transcription and release of inflammatory cytokines, such as GM-
CSF and IL-6, in bronchial epithelial cells, which subsequently induce IL-6 and IL-8
release from mesenchymal cells. We reveal epithelial Fstl1 to be a pro-inflammatory
factor that mediates modulation of mesenchymal cell secretory function, specifically
inflammatory cytokine release. As such, Fstl1 might contribute to the recruitment of
inflammatory cells to the lung. These findings provide a basis for future elucidation
of the role and mechanisms for Fstl1 control of airway biology and pathobiology in
health and disease.
91
Funding
This study was financially supported by a grant from the Netherlands Lung Foundation
(grant 3.2.12.083). NPT is supported by the Netherlands Lung Foundation. AJH is
supported by the Canada Research Chairs Program. The funding agency had no
influence on study design, data analysis and interpretation, or preparation of this
manuscript.

Authors’ contributions
NPT designed and carried out the experiments, analyzed and interpreted the data,
and drafted the manuscript. VN performed part of the experiments and analyzed
the data. MS, HM, RG, and MvdH designed the study and interpreted the data.
AJH kindly provided immortalized airway smooth muscle cells. MvdH generously
provided the Fstl1-FLAG and CFP plasmids. All authors revised the manuscript
critically for important intellectual content and approved the final version.

92 93
References
1. Rusznak C, Mills PR, Devalia JL, Sapsford RJ, Davies RJ, Lozewicz S. Effect of cigarette smoke on
the permeability and IL-1beta and sICAM-1 release from cultured human bronchial epithelial
cells of never-smokers, smokers, and patients with chronic obstructive pulmonary disease. Am J
Respir Cell Mol Biol. 2000;23(4):530-536. doi:10.1165/ajrcmb.23.4.3959.
2. Alkhouri H, Poppinga WJ, Tania NP, Ammit A, Schuliga M. Regulation of pulmonary
inflammation by mesenchymal cells. Pulm Pharmacol Ther. 2014;29(2):156-165. doi:10.1016/j.
pupt.2014.03.001.
3. Osei ET, Brandsma C-A, Noordhoek JA, Timens W, Postma D, Heijink I. Crosstalk between
epithelium and fibroblasts; implications for COPD. Eur Respir J. 2014;44(Suppl 58):P3899.
4. Geng Y, Dong Y, Yu M, et al. Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP)
4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A.
2011;108(17):7058-7063. doi:10.1073/pnas.1007293108.
5. Sylva M, Li VSW, Buffing AAA, et al. The BMP antagonist follistatin-like 1 is required for skeletal
and lung organogenesis. PloS One. 2011;6(8):e22616. doi:10.1371/journal.pone.0022616.
6. Ouchi N, Asaumi Y, Ohashi K, et al. DIP2A functions as a FSTL1 receptor. J Biol Chem.
2010;285(10):7127-7134. doi:10.1074/jbc.M109.069468.
7. Fan N, Sun H, Wang Y, et al. Follistatin-Like 1: A Potential Mediator of Inflammation in Obesity.
Mediators Inflamm. 2013;2013:e752519. doi:10.1155/2013/752519.
8. Li D, Wang Y, Xu N, et al. Follistatin-like protein 1 is elevated in systemic autoimmune diseases
and correlated with disease activity in patients with rheumatoid arthritis. Arthritis Res Ther.
2011;13(1):R17. doi:10.1186/ar3241.
9. Miyamae T, Marinov AD, Sowders D, et al. Follistatin-Like Protein-1 Is a Novel Proinflammatory
Molecule. J Immunol. 2006;177(7):4758-4762. doi:10.4049/jimmunol.177.7.4758.
10. Clutter SD, Wilson DC, Marinov AD, Hirsch R. Follistatin-Like Protein 1 Promotes Arthritis by Up-
Regulating IFN-γ. J Immunol. 2009;182(1):234-239. doi:10.4049/jimmunol.182.1.234.
11. Chaly Y, Marinov AD, Oxburgh L, Bushnell DS, Hirsch R. FSTL1 promotes arthritis in mice by
enhancing inflammatory cytokine/chemokine expression. Arthritis Rheum. 2012;64(4):1082-
1088. doi:10.1002/art.33422.
12. Murakami K, Tanaka M, Usui T, et al. Follistatin-related protein/follistatin-like 1 evokes an
innate immune response via CD14 and toll-like receptor 4. FEBS Lett. 2012;586(4):319-324.
doi:10.1016/j.febslet.2012.01.010.
13. Gosens R, Zaagsma J, Meurs H, Halayko AJ. Muscarinic receptor signaling in the pathophysiology
of asthma and COPD. Respir Res. 2006;7:73. doi:10.1186/1465-9921-7-73.
14. Ruijter JM, Ramakers C, Hoogaars WMH, et al. Amplification efficiency: linking baseline and bias
in the analysis of quantitative PCR data. Nucleic Acids Res. 2009;37(6):e45. doi:10.1093/nar/
gkp045.
15. Knight D. Epithelium–fibroblast interactions in response to airway inflammation. Immunol Cell
Biol. 2001;79(2):160-164. doi:10.1046/j.1440-1711.2001.00988.x.
16. Ouchi N, Oshima Y, Ohashi K, et al. Follistatin-like 1, a secreted muscle protein, promotes
endothelial cell function and revascularization in ischemic tissue through a nitric-oxide synthase-
dependent mechanism. J Biol Chem. 2008;283(47):32802-32811. doi:10.1074/jbc.M803440200.
17. Dong Y, Geng Y, Li L, et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary
fibrosis in mice. J Exp Med. 2015;212(2):235-252. doi:10.1084/jem.20121878.
18. Miller M, Beppu A, Rosenthal P, et al. Fstl1 Promotes Asthmatic Airway Remodeling by Inducing
Oncostatin M. J Immunol Baltim Md 1950. September 2015. doi:10.4049/jimmunol.1501105.
19. Miller M, Esnault S, Kurten RC, et al. Segmental allergen challenge increases levels of airway
follistatin-like 1 in patients with asthma. J Allergy Clin Immunol. 2016;138(2):596-599.e4.
doi:10.1016/j.jaci.2016.01.019.
20. Murphy N, Gaynor KU, Rowan SC, et al. Altered Expression of Bone Morphogenetic Protein
Accessory Proteins in Murine and Human Pulmonary Fibrosis. Am J Pathol. 2016;186(3):600-
615. doi:10.1016/j.ajpath.2015.10.032.
21. Wilson DC, Marinov AD, Blair HC, et al. Follistatin-like protein 1 is a mesenchyme-derived
inflammatory protein and may represent a biomarker for systemic-onset juvenile rheumatoid
arthritis. Arthritis Rheum. 2010;62(8):2510-2516. doi:10.1002/art.27485.
94
22. Hamilton JA. GM-CSF in inflammation and autoimmunity. Trends Immunol. 2002;23(8):403-408.
doi:10.1016/S1471-4906(02)02260-3.
23. Bozinovski S, Jones JE, Vlahos R, Hamilton JA, Anderson GP. Granulocyte/Macrophage-Colony-
stimulating Factor (GM-CSF) Regulates Lung Innate Immunity to Lipopolysaccharide through Akt/
Erk Activation of NFκB and AP-1 in Vivo. J Biol Chem. 2002;277(45):42808-42814. doi:10.1074/
jbc.M207840200.
24. Gomez-Cambronero J, Horn J, Paul CC, Baumann MA. Granulocyte-macrophage colony-
stimulating factor is a chemoattractant cytokine for human neutrophils: involvement of the
ribosomal p70 S6 kinase signaling pathway. J Immunol Baltim Md 1950. 2003;171(12):6846-
6855.
25. Vlahos R, Bozinovski S, Hamilton JA, Anderson GP. Therapeutic potential of
treating chronic obstructive pulmonary disease (COPD) by neutralising granulocyte
macrophage-colony stimulating factor (GM-CSF). Pharmacol Ther. 2006;112(1):106-
115. doi:10.1016/j.pharmthera.2006.03.007.
26. D’Armiento JM, Scharf SM, Roth MD, et al. Eosinophil and T cell markers predict
functional decline in COPD patients. Respir Res. 2009;10:113. doi:10.1186/1465-9921-
10-113.
27. Balbi B, Bason C, Balleari E, et al. Increased bronchoalveolar granulocytes and
granulocyte/macrophage colony-stimulating factor during exacerbations of chronic
bronchitis. Eur Respir J. 1997;10(4):846-850.
28. Stämpfli MR, Wiley RE, Neigh GS, et al. GM-CSF transgene expression in the airway
allows aerosolized ovalbumin to induce allergic sensitization in mice. J Clin Invest.
1998;102(9):1704-1714.
5
29. Saha S, Doe C, Mistry V, et al. Granulocyte-macrophage colony-stimulating factor
expression in induced sputum and bronchial mucosa in asthma and COPD. Thorax.
2009;64(8):671-676. doi:10.1136/thx.2008.108290.
30. Xing Z, Ohkawara Y, Jordana M, Graham F, Gauldie J. Transfer of granulocyte-macrophage
colony-stimulating factor gene to rat lung induces eosinophilia, monocytosis, and
fibrotic reactions. J Clin Invest. 1996;97(4):1102-1110.
31. Lei XF, Ohkawara Y, Stämpfli MR, et al. Compartmentalized transgene expression of
granulocyte-macrophage colony-stimulating factor (GM-CSF) in mouse lung enhances
allergic airways inflammation. Clin Exp Immunol. 1998;113(2):157-165.
32. Vlahos R, Bozinovski S, Chan SPJ, et al. Neutralizing granulocyte/macrophage colony-
stimulating factor inhibits cigarette smoke-induced lung inflammation. Am J Respir Crit
Care Med. 2010;182(1):34-40. doi:10.1164/rccm.200912-1794OC.
33. Conti P, DiGioacchino M. MCP-1 and RANTES are mediators of acute and chronic
inflammation. Allergy Asthma Proc Off J Reg State Allergy Soc. 2001;22(3):133-137.
34. Fryer AA, Spiteri MA, Bianco A, et al. The -403 G-->A promoter polymorphism in the
RANTES gene is associated with atopy and asthma. Genes Immun. 2000;1(8):509-514.
doi:10.1038/sj.gene.6363717.
35. Al-Abdulhadi SA, Helms PJ, Main M, Smith O, Christie G. Preferential transmission and
association of the |[minus]|403 G → A promoter RANTES polymorphism with atopic
asthma. Genes Immun. 2004;6(1):24-30. doi:10.1038/sj.gene.6364151.
36. Hizawa N, Yamaguchi E, Konno S, Tanino Y, Jinushi E, Nishimura M. A Functional
Polymorphism in the RANTES Gene Promoter Is Associated with the Development of
Late-Onset Asthma. Am J Respir Crit Care Med. 2002;166(5):686-690. doi:10.1164/
rccm.200202-090OC.
37. Tanaka M, Murakami K, Ozaki S, et al. DIP2 disco-interacting protein 2 homolog A
(Drosophila) is a candidate receptor for follistatin-related protein/follistatin-like
1--analysis of their binding with TGF-β superfamily proteins. FEBS J. 2010;277(20):4278-
4289. doi:10.1111/j.1742-4658.2010.07816.x.
95
 CHAPTER 6 1

Regulation of pulmonary inflammation by

mesenchymal cells

Hatem Alkhouri, Wilfred J. Poppinga, Navessa P. Tania, Alaina Ammit,

Michael Schuliga

97
Regulation of pulmonary inflammation by mesenchymal cells Abstract

Pulmonary inflammation and tissue remodelling are common elements of chronic

respiratory diseases such as asthma, chronic obstructive pulmonary disease (COPD),
Hatem Alkhouri1, Wilfred J. Poppinga2,3, Navessa P. Tania2,3, Alaina Ammit1 andMi- idiopathic pulmonary fibrosis (IPF), and pulmonary hypertension (PH). In disease,
chael Schuliga4,5 pulmonary mesenchymal cells not only contribute to tissue remodelling, but also
have an important role in pulmonary inflammation. This review will describe the
immunomodulatory functions of pulmonary mesenchymal cells, such as airway
smooth muscle (ASM) cells and lung fibroblasts, in chronic respiratory disease.
An important theme of the review is that pulmonary mesenchymal cells not only
Respiratory Research Group, Faculty of Pharmacy, University of Sydney, Sydney,
1
respond to inflammatory mediators, but produce their own mediators, whether
New South Wales, Australia pro-inflammatory or pro-resolving, which influence the quantity and quality of the
lung immune response. The notion that defective pro-inflammatory or pro-resolving
Department of Molecular Pharmacology, University of Groningen, Groningen, The
2
signalling in these cells potentially contributes to disease progression is also
Netherlands
discussed. Finally, the concept of specifically targeting pulmonary mesenchymal cell
3
Groningen Research Institute of Asthma and COPD (GRIAC), University of Gronin- immunomodulatory function to improve therapeutic control of chronic respiratory
gen, Groningen, University Medical Centre Groningen, The Netherlands disease is considered.

4
Deptartment of Pharmacology and Therapeutics, University of Melbourne,
Parkville, Victoria, Australia
5
Lung Health Research Centre, University of Melbourne, Parkville, Victoria, Austra-
lia
6

98 99
1. Introduction by the synthesis and deposition of collagens I and III and other ECM components
(e.g. fibronectin), expand the volume of the ECM in the sub-epithelial layer of the
Worldwide, more than 250 million people suffer from a debilitating or lethal airway wall, within ASM bundles or in the lung interstitium.15 Aside from important
chronic respiratory disease,1 such as asthma, chronic obstructive pulmonary disease biomechanical contributions in tissue remodelling, pulmonary mesenchymal
(COPD), idiopathic pulmonary fibrosis (IPF) or pulmonary hypertension (PH). cells are also potent producers of an array of inflammatory mediators, including
Asthma, characterized by airway inflammation, remodelling and hyper-reactivity, is cytokines, chemokines and cell adhesion molecules (CAMs).16–19 These inflammatory
one of the most prevalent chronic respiratory diseases, causing ~1/4 of a million mediators, as well as the ECM produced by pulmonary mesenchymal cells, influence
deaths per year globally.1 COPD, comprised of irreversible breakdown of lung tissue the type and quantity of inflammatory cells that infiltrate airway and lung tissue in
(emphysema) and airway wall remodelling, contributes to ~3 million deaths per year, chronic respiratory disease. Furthermore, the potential importance of inflammatory
and is increasing in incidence.1,2 IPF, albeit less common than asthma or COPD, is a responses regulated by pulmonary mesenchymal cells in tissue remodelling is
lethal interstitial lung disease characterised by a relentlessly progressive and invasive becoming increasingly recognised. In this review, the immunomodulatory functions
form of lung parenchymal fibrosis.3 Secondary PH, a comorbidity caused primarily of pulmonary mesenchymal cells and their potential roles in the progression of
by hypoxia in lung disease, features increased pulmonary vascular resistance.4 There chronic respiratory disease will be described.
remains no effective treatment for severeasthma (5-10% of asthmatics), COPD and
IPF.5
The consistent presence of inflammatory cells in the lungs of patients
unequivocally establishes pulmonary inflammation as an important component
of chronic respiratory disease. The lung inflammatory profiles of patients vary
depending on the disease and severity, and change upon exacerbation.6–8 Airway
inflammation in asthma is associated with an increase in mast cells, eosinophils
and CD4+ T-helper-2 (Th2) lymphocytes. However, for asthmatics with fixed airway
obstruction, the inflammation is more neutrophilic with greater CD8+ T-helper-1
(Th1) cell involvement, akin to COPD, which is also characterised by fixed airway
obstruction.7 Whilst IPF has a predominant Th2 cell profile, the ratio of CD8+ to 6
CD4+lymphocytes increases with disease severity.8 Like COPD, neutrophils and
macrophages are also present in lung tissue of patients with IPF. In PH, perivascular
infiltration of dendritic cells, macrophages, mast cells, T-lymphocytes (CD4+ and CD8+)
and B-lymphocytes occurs.9 In chronic respiratory disease, infiltrating inflammatory
cells produce an array of inflammatory mediators which act by autocrine and
paracrine mechanisms to not only regulate inflammatory cell function, but also
pulmonary mesenchymal cells in tissue remodelling.
In chronic respiratory disease, there is an important relationship between
inflammation and tissue remodelling. The latter describes the structural changes in
lung tissue which may contribute to respiratory dysfunction. Pulmonary mesenchymal Figure 1. Immunomodulatory functions of pulmonary mesenchymal cells. The solid
black arrows designate the pro-inflammatory mediators produced directly or indirectly by
cells are structural cells with a well-recognised role in tissue remodelling processes pulmonary mesenchymal cells which contribute to pulmonary inflammation in disease.
in disease. In asthma and COPD, airway smooth muscle (ASM) cell hyperplasia and The black hatched arrows represent sources of pro-inflammatory mediators which regulate
hypertrophy cause ASM enlargement, whereas airway fibroblasts contribute to pulmonary mesenchymal cell function, including the production and expression of pro-
inflammatory mediators. The types and phenotype of the pulmonary mesenchymal and
sub-epithelial fibrosis in the airway wall.10,11 In IPF, lung fibroblasts lung fibroblasts1 inflammatory cells varies for disease and disease severity. Abbreviations are defined in the
have an integral role in the progressive fibrosis which begins in the lung interstitium text.
and invades alveoli spaces.12 In PH, pulmonary vascular smooth muscle cells have a
prominent role in the medial enlargement of blood vessels, which in effect reduces
lumen size, increasing vascular resistance.13 Abnormalities of the extracellular matrix
(ECM) are a key feature of tissue remodelling in lung disease.14 Mesenchymal cells,

100 101
2. Immunomodulatory function of pulmonary mesenchymal cells Table 1. Immunomodulatory proteins expressed by airway smooth muscle (ASM)
This section will provide an overview of the types of immunomodulatory functions cells and lung fibroblasts.
of pulmonary mesenchymal cells, as summarized in Figure 1. Type Protein Pulmonary mesenchymal cell
Cytokines IL-1 ASM23, lung fibroblasts19
2.1. Pro-inflammatory mediators
IL-4 Lung fibroblasts24
Pulmonary mesenchymal cells coordinate inflammatory responses by producing
IL-6 ASM,25 lung fibroblasts24
pro-inflammatory mediators which lead to inflammatory cell recruitment and IL-10 ASM23
activation. The production of pro-inflammatory mediators by ASM cells, particularly IL-11 ASM25
in the context of asthma, has been extensively studied and the subject of many IL-13 Lung fibroblasts26
reviews, including one recent review.20 Table 1 provides an overview of the broad GM-CSF ASM,27 lung fibroblasts19,28
range of cytokines, chemokines and CAMs, which have been shown to be expressed LIF ASM29
by pulmonary mesenchymal cells, primarily in in vitro cell culture studies. The ECM OX40 ligand ASM30
produced by these cells also influences inflammatory cell recruitment. Versican Chemokines CXCL1 (Gro-α) ASM,31 lung fibroblasts32
and hyaluronan for instance are ECM components produced by lung fibroblasts CXCL5 (ENA-78) Lung fibroblasts32
which regulate T-cell trafficking and functioning in inflamed lung tissue.21,22 Pro- CXCL6 (GCP-2) ASM23
inflammatory mediator expression in pulmonary mesenchymal cells is stimulated CXCL8 (IL-8) ASM,33 lung fibroblasts19,26
primarily by cytokines and growth factors produced by inflammatory cells and the CXCL9 (MIG) ASM34
CXCL10 (IP-10) ASM,35 lung fibroblasts36
epithelium.20 The regulation of immunomodulatory function of these cells also
CXCL11(ITAC) ASM34
involves pro-resolving mediators (section 2.2), the innate immune system (section
CXCL12 (SDF-1α) ASM,34 lung fibroblasts19
2.3), the plasminogen activation system (section 2.4) and the coagulation system
CCL2 (MCP-1) ASM,37 lung fibroblasts19
(section 2.5).
CCL3 (MIP-1α) ASM38
CCL5 (RANTES) ASM,39 lung fibroblasts19,26
2.2. Pro-resolving mediators CCL4 (MIP-1β) ASM23
Pulmonary mesenchymal cells may be targets for or produce mediators which CCL7 (MCP-3) ASM,38 lung fibroblasts40
have a role in resolving inflammation. Most pro-resolving mediators with anti- CCL8 (MCP-2) ASM37 6
inflammatory activity, including the resolvins, protectins and lipoxins, are derived CCL11 (Eotaxin) ASM,41 lung fibroblasts42
from dietary omega-3 polyunsaturated fatty acids.53 Administration of pro-resolving CCL16 (MTN-1) ASM23
lipid mediators, including protectin D1, resolvin D1 and resolvin E1, are protective CCL17 (TARC) ASM43
in models of lung injury and disease.54–57 Endogenous protectin D1 is increased CCL19 (MIP-3) ASM44
in the airways in response to allergen challenge, but less so for asthmatics than CCL20 (MIP-3α) ASM45
non-asthmatics.55,58 Such observations suggest that dys-regulated production of CX3CL1 (Fractalkine) ASM46
pro-resolving lipid mediators may contribute to chronic respiratory disease.59 SCF ASM47
CAMs ICAM-1 ASM,48 lung fibroblasts49
Whilst inflammatory cells are a major source of pro-resolving lipid mediators,55,58,59
VCAM-1 ASM,19,48 lung fibroblasts49
pulmonary mesenchymal cells are a target. In cultures of human lung fibroblasts,
CD40 ASM19,50
resolvin D1 inhibits cigarette smoke extract- and IL-1β-induced cytokine release60
CD44 ASM51
and endotoxin-induced COX-2 expression and prostaglandin E2 (PGE2) production.61
CD90 (Thy-1) Lung fibroblasts52
Current knowledge about the release of pro-resolving mediators by pulmonary
mesenchymal cells is limited, aside from the production of annexin A1, an anti- Abbreviations: CD, cluster of differentiation; ENA, epithelial-derived neutrophil activating;
inflammatory protein.24 Annexin A1, like resolvin D1, is a ligand for the lipoxin GM-CSF, granulocyte macrophage-colony stimulating factor; ICAM, intracellular adhesion
molecule; IL, interleukin; LIF, leukaemia inhibitory factor; SCF, Stem cell factor; VCAM,
A4 receptor, ALX/FPR2. Annexin A1 expression and release is increased in lung vascular cell adhesion molecule.
fibroblasts following treatment with glucocorticoids.24 Furthermore, the silencing of
annexin A1 augments TNFα-induced IL-6 release from lung fibroblasts,24 suggesting

102 103
that annexin A1 production may be an important immunomodulatory function of
pulmonary mesenchymal cells.
2.3. Toll like receptors (TLRs)
Toll-like receptors (TLRs) activate the innate immune system in response to infection
and tissue injury. TLR ligands are: (i) derived from pathogens, including bacterial
cell-surface lipopolysaccharides (LPS) and the double stranded RNA of viruses; or
(ii) formed endogenously, such as fibrinogen62 and annexin A2.63 The binding of
TLR ligands to their receptors leads to the activation of nuclear factor NF-κB and/or
interferon regulatory transcription factor 3/7, which stimulates the gene expression
of inflammatory mediators. The dysregulation of TLR signalling may contribute to
the development of chronic respiratory disease. The activation of TLR4 by fibrinogen
cleavage products of coagulation proteases possibly contributes to asthma
pathophysiology.62 Pulmonary mesenchymal cells express TLR2,64 TLR3,65 TLR4,66 and
TLR967 and their activation stimulates IL-6, IL-8 and eotaxin production.68,69 ASM cells
release the stress-response protein, annexin A2, which stimulates IL-6 production
in both macrophages70 and ASM cells63 via TLR4. In lung fibroblasts, TLR3 activation
stimulates the production of RANTES, IP-10, IL-8, type 1 IFN, TGF-β, IL-4 and IL-13,26,71
and TLR4 regulates proliferation.72
2.4. The plasminogen activation system
In interstitial lung tissue, the conversion of plasminogen to plasmin (“activation”), a
pro-inflammatory serine protease,73 contributes to disease.74 Plasminogen, a plasma
protein, is relevant in lung pathology as vascular leak leads to its extravasation into
inflamed lung tissue. Both lung fibroblasts and ASM cells activate extracellular
plasminogen with subsequent effects on IL-6 and IL-8 production and cell
proliferation.63,75–77 These effects occur at low µg/mL concentrations of plasminogen,
substantially lower than that detected in plasma. At higher concentrations of
plasminogen, increased PGE2 synthesis and/or apoptosis are observed.63,78 For ASM
cells, plasminogen activation is mediated by the urokinase plasminogen activator
(uPA), in a manner accelerated by the annexin A2 hetero-tetramer (AIIt),63 an
extracellular protein complex comprised of annexin A2 and S100A10 (p11). The
AIIt also serves as a signal transducer for plasmin in mediating its pro-inflammatory
effects on ASM cells77 and macrophages.79 Whilst currently little is known about the
role of annexin A2 in respiratory disease, it is becoming increasingly recognised for
its importance in cancer.80–84 Both uPA and annexin A2 may be novel drug targets in
the treatment of chronic respiratory disease74 (section 5.4).
2.5. The coagulation system
The coagulation system also contributes to pulmonary inflammation in disease.62,85
Like plasminogen, the inactive zymogens of coagulation proteases enter inflamed
lung tissue as a consequence of vascular leak, in a process accompanied by platelet
aggregation and activation of the coagulation cascade.86 Through the actions of
104
thrombin, the main activator of the coagulation system, TLR4-activating fibrinogen
cleavage products are generated. Interestingly, plasmin is also involved in the
formation of fibrinogen cleavage products,87 suggesting that the convergence of both
the coagulation and plasminogen activation systems may play an important role in
pulmonary inflammation in disease. Thrombin and factor Xa (FXa), another coagulant,
also activate PAR receptors, including those on ASM cells and lung fibroblasts,88,89 to
elicit pro-inflammatory and remodelling activities.89–91 The targeting of thrombin or
FXa reduces pulmonary inflammation and tissue remodelling in murine models of
lung injury and disease.89,92,93
3. Pulmonary mesenchymal cells in chronic respiratory disease
3.1. Asthma
In asthma, allergen-induced airway inflammation contributes to airway hyper-
responsiveness (AHR), a process that involves spasmodic ASM contraction.
Inflammation has direct and indirect roles in AHR, causing vascular leakage, mucus
hyper-secretion, epithelial shedding, ASM thickening and sub-epithelial fibrosis.94
Pro-inflammatory mediators produced by ASM cells and airway fibroblasts, including
IL-8, IP-10, MIP-1α, RANTES and eotaxin, contribute to the recruitment of mast cells,
lymphocytes, eosinophils and neutrophils in asthma.34,95–97 ASM abnormalities in
asthmatics may contribute to an increased hyper-secretory phenotype. Cytokine-
induced production of IL-8,98 IP-10,34 ITAC,34 eotaxin99 and MIP-3α100 is greater in
cultures of ASM cells obtained from asthmatic donors than non-asthmatics donors.
Furthermore, ASM cells of asthmatics produce relatively more collagen, fibronectin
and fibulin-1,101–103 ECM proteins which may facilitate inflammatory cell adhesion 6
and activation. Increased calcium handling, caused by abnormal sarco/endoplasmic
reticulum calcium ATPase (SERCA) pump function and expression, increases eotaxin
expression in ASM cells of asthmatics.104,105 Furthermore, JNK signalling and STAT-1
activation is diminished,106,107 whilst p65 NF-κB activation is higher98,107 in ASM cells
of asthmatic than non-asthmatic donors. Additionally, TNF-α induced p38 mitogen-
activated protein kinase (MAPK) signalling is greater in ASM cells of donors with
severe asthma, than other asthma or control groups.108 ASM cells of asthmatics lack
expression of the full length transcription factor CCAAT/enhancer binding protein
(C/EBPα).109 As a consequence, C/EBPβ binding to chemokine promoters increases,
causing cytokine hyper-secretion.98 This may be due to lack of an important anti-
inflammatory protein, MAPK phosphatase 1 (MKP-1), a critical MAPK deactivator
that is explored in greater depth in section 5.3. Reduced expression of MKP-1
was responsible for over-activation of the p38 MAPK pathway and corticosteroid
insensitivity of alveolar macrophages in severe asthma compared with non-severe
asthma.110
Although airway fibroblast secretory function is an area of active research,28 asthma-
associated changes in airway fibroblast inflammatory mediator production is under-
explored. Whilst IL-1b-induced GM-CSF and IL-8 production is increased more in the
airway fibroblasts of asthmatics than non-asthmatics,17 the mechanism behind this
105
differential cytokine production remains unknown. Interestingly, airway fibroblasts
of asthmatics in culture express lower levels of IL-13 Rα2 (a decoy receptor for IL-13
signalling) at baseline than airway fibroblasts of controls,111 possibly augmenting IL-
13-induced inflammation in asthma.112
3.2. COPD
COPD, characterized by shortness of breath, cough and mucus hyper-secretion, is
caused primarily by tobacco exposure. Genetics/epigenetics113,114 and the pulmonary
microbiome115 are also factors that may contribute to COPD. There is an increase in
ASM mass in COPD, albeit, primarily in the small airways.116 Studies investigating the
role of ASM cells in COPD are under-represented when compared to asthma, most
likely due to ASM-related pathology, such as AHR, being far more pronounced in
asthma. In COPD, the number of airway fibroblasts with a more contractile phenotype
(myofibroblasts) is greater,21 likely caused by increases in the expression and activity
of rho-associated coiled-coil protein kinase 1 (ROCK1).117 Such increases will reduce
airway elasticity, as will versican, the production of which is increased in airway
fibroblasts of COPD patients.118,119 Airway fibroblasts of COPD patients also express
higher levels of IL-6 and IL-8 than controls.119 Intriguingly, airway fibroblasts from
COPD patients, and not from control subjects, produce prostacyclins in response
to TGF-β.120 Prostacyclins have anti-inflammatory effects in pulmonary fibrosis and
PH.121
3.3. IPF
Interstitial lung diseases (ILDs) are characterized by an abnormality in the
interstitium, the area in the lung parenchyma between the capillaries and alveolar
spaces. In IPF, a lethal form of ILD, the abnormality is a relentlessly progressive form
of fibrosis that causes irreversible damage of lung structure and function. Whilst an
increased number of inflammatory cells in the lungs of patients with IPF suggests a
role of inflammation,122 an abnormal wound-repair response of epithelial/fibroblast
origin is thought to be an underlying cause.123 Lung fibroblasts have a pivotal
role in IPF, proliferating and differentiating into collagen producing, contractile
myofibroblasts to form fibroblastic foci. The expression of fibroblast growth factor
(FGF9) is increased in IPF fibrotic foci in situ and lung fibroblasts of IPF patients in
vitro in response to TGF-β1.124 By contrast, IFN-inducible expression of STAT1 and
IP-10 is repressed in lung fibroblasts of IPF patients.125 Human lung fibroblasts from
IPF patients show constitutive activation of STAT3,52 which mediates oncostatin M
induced fibroblast chemotaxis.126 Oncostatin M is secreted by inflammatory cells,
such as macrophage and dendritic cells upon bacterial infection.127 Oncostatin M is
a potent mediator of pulmonary inflammation,128 and is involved in the induction of
pulmonary eosinophilia and goblet cell hyperplasia in mice,129,130 being up-regulated
in the lung of IPF patients. Furthermore, in lung fibroblasts, eotaxin expression is
induced by oncostatin M, suggesting that lung fibroblasts play an important role in
oncostatin M-induced inflammation in IPF.42,131
106
3.4. Pulmonary hypertension
PH, whether primary or secondary to an accompanying chronic respiratory disease
is characterized by vasoconstriction, in situ thrombosis and pulmonary vascular
remodelling. Hypoxia, chronic inflammation and shear stress contribute to PH
pathology.132,133 In proximal pulmonary vessels that were previously muscularized,
medial thickening is caused by the hypertrophy, hyperplasia and ECM production of
resident pulmonary vascular smooth muscle cells. In previously non-muscular pre-
capillary arterioles, the pulmonary vascular smooth muscle cells that contribute to
medial thickening are derived from intermediate cells in blood vessels or adventitial
fibroblasts, which differentiate into pulmonary vascular smooth muscle cells. In
PH, the vascular adventitia has an important role in regulating and contributing
to perivascular inflammation.134 Pulmonary adventitial fibroblasts, through the
production and release of pro-inflammatory mediators, induce the infiltration and
activation of monocytes and macrophages. Epigenetic alterations in pulmonary
adventitial fibroblasts from chronically hypoxic hypertensive calves are linked to a
heightened pro-inflammatory phenotype with the expression of IL-1β, IL-6, MCP-1,
CXCL12, RANTES, CCR7, CXCR4, GM-CSF and VCAM-1 being increased.19 In severe
PH, the epigenetic reprogramming of human pulmonary adventitial fibroblasts
to a pro-inflammatory phenotype is associated with the decreased expression of
miR-124, which regulates Notch1/PTEN/FOXO3/p21Cip1 and p27Kip1 signalling.135
Interestingly, aberrant PTEN phosphatase activity may also contribute to the pro-
inflammatory phenotype of pulmonary vascular smooth muscle cells in PH. PTEN,
which inhibits Akt/PI3kinase signalling, regulates a number of cell processes including
inflammation.136 Selective deletion of the PTEN gene in pulmonary vascular smooth 6
muscle cells increases macrophage infiltration and vascular remodelling in a murine
model of PH.137
4. Interactions between pulmonary mesenchymal cells and inflammatory cells
4.1. Mast cell-airway smooth muscle cell interactions
Mast cell-ASM cell interactions have an important role in asthma pathophysiology.138
The number of mast cells within the ASM layer of asthmatics is higher than non-
asthmatics, correlating with disease severity.138–141 In asthma, the mast cells residing
in the ASM layer are predominantly mast cellTC,35 being smaller and less granular30
compared to the mast cells found elsewhere in the airway wall, or within the ASM
layer of non-asthmatics. Mast cell recruitment to the ASM layer requires mast cell
expression of chemokine receptors and ASM cell production of chemokines. Lung
mast cells express a wide range of chemokine receptors, including CCR3, CXCR1,
2, 3 and 4, with CXCR3 being the most highly expressed on mast cells within the
ASM layer in asthma.23,34 Important chemokines produced by ASM cells involved
in mast cell recruitment include: IL-8 (binds CXCR1);142 IP-10 (binds CXCR3);23,34
SDF-1α (binds CXCR4);143 RANTES (binds CCR1, 3 and 5);144 and eotaxin (binds
CCR3).142 These chemokines, in conjunction with SCF and TGF-β, are involved in
the movement of mast cells to the ASM layer.145 ASM cells of asthmatics produce
107
higher levels of IP-10 than ASM cells of non-asthmatics following treatment with Th1
cytokines.34 Under Th2 inflammatory conditions, mast cell chemotaxis involves IL-8
and eotaxin.142 Interestingly, the ASM cells of non-asthmatics release factor(s) that
inhibit mast cell chemotaxis under either Th1 or Th2 inflammatory conditions.142
CXCL1 is an inhibitory factor of mast cell migration, and is produced less in ASM cells
of asthmatics than non-asthmatics.146 Upon ASM-mast cell contact, ASM cells induce
mast cell proliferation and maintain mast cell survival.147 This interaction is mediated
by membrane-bound SCF expressed on ASM cells and soluble IL-6 and CADM1
produced by mast cells.147 In addition, numerous mast cell produced mediators
directly affect ASM cell function, a topic that has been extensively reviewed.148–150
These mediators cause exaggerated bronchoconstriction and also modulate ASM
cell secretory function.146
4.2. Monocyte/macrophage-fibroblast interactions
In chronic respiratory disease, blood circulating monocytes infiltrate lung tissue
to differentiate into macrophages or dendritic cells. The phagocytic and antigen
presenting functions of these cells are important in innate and adaptive immunity
respectively. Fibroblasts are ideally suited to regulate monocyte trafficking,
differentiation and functioning because of their synthetic capacity and sentinel-
like positioning in interstitial spaces. Monocytes stimulate GM-CSF production by
lung fibroblasts in a manner involving physical contact between the two cell types.28
Lung fibroblast production of GM-CSF, which regulates monocyte/macrophage
function, is in turn increased by TNF-α and/or IL-1β, cytokines produced by activated
macrophages. In mouse models of PH, pulmonary adventitial fibroblasts produce
soluble mediators, including GM-CSF, which influence monocyte/macrophage cell
adhesion, infiltration and cytokine production.135 Airway fibroblasts from patients
with COPD express higher levels of the integrin αvβ8, which activates TGF-β, in
turn stimulating CCL2 and CCL20 production in airway fibroblasts by an autocrine
manner.151 In a murine model of COPD, αvβ8-regulated CCL2 and CCL20 production
stimulates dendritic cell migration to boost an adaptive immune response.151
Alternatively activated (M2) macrophages, induced by Th2 cytokines (e.g. IL-4 and
IL-13), are increasingly being recognised for their role in chronic respiratory disease.
M2 activated macrophages are the pre-dominant macrophage phenotype present
in the lungs of IPF patients152 and are detected in higher numbers in the lung of
COPD patients who continue smoking than those who stop.153 The M2 macrophages
have an impaired role in innate immunity, but produce a myriad of pro-inflammatory
and pro-fibrogenic mediators such as TGF-β, IL-13, CCL2, CCL17, CCL18 and CCL22.152
Alveolar macrophages from non-IPF donors produce more CCL18 when either
treated with Th2 cytokines, co-cultured with lung fibroblasts or exposed to native
collagen.154 The latter effect of collagen occurs in a manner mediated by the β2-
integrin.154 As CCL18 stimulates collagen production in lung fibroblasts, an axis
between M2 macrophages and lung fibroblasts, involving a CCL18-driven positive
feedback loop, may perpetuate fibrosis in IPF.154
108
5. Novel strategies to target pulmonary mesenchymal cell immunomodulatory
function
5.1. cAMP elevating agents
There is still a need to find new therapies for chronic respiratory diseases for which,
anti-inflammatory glucocorticoids alone are ineffective.155 Roflumilast, an oral
phosphodiesterase (PDE4) inhibitor, is an anti-inflammatory drug for COPD, but has
side effects including nausea. Interestingly, both PDE4 inhibitors and β2-adrenergic
receptor agonists cause a rise in intracellular second messenger cyclic AMP (cAMP),
but are used pharmacologically for different targets, one inflammation, the other
bronchoconstriction (in asthma and COPD). In cultures of normal human lung
fibroblasts, roflumilast, and the β2-agonist, indacaterol, act synergistically to attenuate
inflammatory cytokine secretion and differentiation into a pro-fibrotic phenotype.156
The levels of PGE2, an endogenous lipid mediator that increases cAMP production,
are higher in lung157 and lung fibroblasts from COPD patients.158,159 However, in COPD,
PGE2 effects on the cAMP pathway are reduced due to an increase in PDE4 activity.157
As increased PDE4 activity also reduces β2-agonist effectiveness, these findings
imply the potential benefit of combining PDE4 inhibitors with cyclic AMP elevating
agonists. Interestingly, the addition of plasmin(ogen) to lung fibroblasts from
IPF patients overcomes a similar PGE2 resistance, by rearranging the intracellular
compartmentalization of the cAMP pathway.160 This rearrangement is mediated
by an increased expression of the A-kinase anchoring protein AKAP9, a scaffolding
protein for protein kinase A (PKA), which amplifies the downstream pathway of
PGE2-cAMP-PKA.160 Thus the anti-inflammatory and anti-fibrotic properties of PGE2
6
on pulmonary mesenchymal cells may potentially be restored in chronic respiratory
diseases by approaches that rearrange cAMP compartmentalization.160
5.2. TGF- β1 pathways
Aberrant TGF-β1 signalling, important in regulating pulmonary mesenchymal cells
function, contributes to pulmonary inflammation and remodelling in disease.151,161,162
Inhibiting specific aspects of TGF-β1 signalling may be an effective strategy to treat
chronic respiratory disease.120 The TGF-β1 superfamily member, activin A, is linked
with the progression of PH, stimulating pulmonary vascular smooth muscle cell
proliferation.163 Administration of follistatin, an endogenous inhibitor of activin A
attenuates inflammation and remodelling in a murine model of pulmonary fibrosis164
and asthma.160 TGF-β1-inducible connective tissue growth factor (CTGF) is implicated
in the pathogenesis of IPF. Inhibition of CTGF reduces collagen promoter activity
and its expression in bleomycin-induced mice lung fibroblasts, suggesting CTGF
neutralization may be an option for the treatment of IPF.165 HS 6-O-sulfotransferases
1 (HS6ST1) is up-regulated in lung fibroblasts of IPF patients,166 and its silencing
reduces TGF-β1 activation and subsequent collagen I and α-smooth muscle actin
expression. Such data suggests that HS6ST1 inhibition could potentially reduce
TGF-β1 -mediated lung fibrosis. Interestingly, the IL-6 antagonist Sant7 attenuates
TGF-β1-induced proliferation of lung fibroblasts obtained from ILD patients,167
109
suggesting that targeting IL-6 may selectively block an important TGF-β1-mediated
fibrotic response. Finally, inhibition of GSK-3, a mediator of TGF-β1-induced
pulmonary mesenchymal cell differentiation, may also be a potential molecular
target for chronic lung diseases.168,169
5.3. MKP-1
In recent years, the important anti-inflammatory role played by the MAPK deactivator
MKP-1 in regulating inflammation in asthma has emerged. Upregulation of MKP-1 is
one of the ways in which common anti-asthma medicines, such as β2-agonists and
glucocorticoids, mediate their anti-inflammatory effects.31,170,171 MKP-1 is a critical
negative feedback controller, limiting the extent and duration of pro-inflammatory
MAPK-driven cellular signalling pathways in pulmonary mesenchymal cells such as
ASM.172,173 Without MKP-1, MAPK-mediated inflammation can continue unchecked
with the clinical consequence in chronic respiratory disease underscored by recent
demonstration of relative corticosteroid insensitivity in cells from people with
severe asthma.108 The concept of enhancing MKP-1 expression and/or activity to
control inflammation is currently under investigation,174 as is the potential use of p38
MAPK inhibitors to improve corticosteroid-mediated therapeutic control of chronic
respiratory disease, especially in severe asthma.108 Further studies are warranted.
5.4. Urokinase & Annexin A2
Urokinase and annexin A2 production by pulmonary mesenchymal cells is potentially
important in chronic respiratory disease (section 2.4). Both uPA and annexin A2 are
becoming increasingly recognised as important pathological mediators, particularly
in cancer, and their targeting by either pharmacological or antibody-based therapies
reduces tumour growth and/or metastasis in a number of pre-clinical cancer
models.80–84 Furthermore, uPA inhibitors are well tolerated in humans and have
provided promising results in recent phase I and II trials for cancer.81 Both uPA
and annexin A2 gene-deletion reduces pulmonary inflammation in various murine
models,77,175,176 and uPA antibodies reduce inflammation and oedema in a mouse
model of acute lung injury.177 However, further pre-clinical characterization of these
inhibitors as therapy for chronic respiratory disease is required.
6. Conclusion
In disease, pulmonary mesenchymal cells not only respond to inflammatory
mediators, but also contribute to inflammation by producing chemokines,
cytokines, CAMs and ECM matrix which recruit and activate inflammatory cells. The
dysregulation of pulmonary mesenchymal cell immunomodulatory function is likely
to contribute to the pathogenesis of lung disease. The specific targeting of aberrant
immunomodulatory functioning in pulmonary mesenchymal cells may be a strategy
to treat lung disorders such as severe asthma, COPD, IPF and PH, for which there are
no current effective therapies.
110
References
1. Bousquet J, Khaltaev N. Global Surveillance, Prevention and Control of Chronic Respiratory
Diseases - WHO - OMS -. WHO Press; 2007. http://apps.who.int/bookorders/anglais/detart1.
jsp?sesslan=1&codlan=1&codcol=15&codcch=708. Accessed March 29, 2017.
2. Decramer M, Janssens W, Miravitlles M. Chronic obstructive pulmonary disease. Lancet Lond
Engl. 2012;379(9823):1341-1351. doi:10.1016/S0140-6736(11)60968-9.
3. Ding Q, Luckhardt T, Hecker L, et al. New insights into the pathogenesis and treatment of
idiopathic pulmonary fibrosis. Drugs. 2011;71(8):981-1001. doi:10.2165/11591490-000000000-
00000.
4. Shlobin OA, Nathan SD. Pulmonary hypertension secondary to interstitial lung disease. Expert
Rev Respir Med. 2011;5(2):179-189. doi:10.1586/ers.11.11.
5. Durham A, Adcock IM, Tliba O. Steroid resistance in severe asthma: current mechanisms and
future treatment. Curr Pharm Des. 2011;17(7):674-684.
6. Tetley TD. Inflammatory cells and chronic obstructive pulmonary disease. Curr Drug Targets
Inflamm Allergy. 2005;4(6):607-618.
7. Tubby C, Harrison T, Todd I, Fairclough L. Immunological basis of reversible and fixed airways
disease. Clin Sci Lond Engl 1979. 2011;121(7):285-296. doi:10.1042/CS20110062.
8. Papiris SA, Kollintza A, Karatza M, et al. CD8+ T lymphocytes in bronchoalveolar lavage in
idiopathic pulmonary fibrosis. J Inflamm Lond Engl. 2007;4:14. doi:10.1186/1476-9255-4-14.
9. Savai R, Pullamsetti SS, Kolbe J, et al. Immune and inflammatory cell involvement in the pathology
of idiopathic pulmonary arterial hypertension. Am J Respir Crit Care Med. 2012;186(9):897-908.
doi:10.1164/rccm.201202-0335OC.
10. Amin K, Lúdvíksdóttir D, Janson C, et al. Inflammation and structural changes in the airways
of patients with atopic and nonatopic asthma. BHR Group. Am J Respir Crit Care Med.
2000;162(6):2295-2301. doi:10.1164/ajrccm.162.6.9912001.
11. Gosselink JV, Hayashi S, Elliott WM, et al. Differential Expression of Tissue Repair Genes in
the Pathogenesis of Chronic Obstructive Pulmonary Disease. Am J Respir Crit Care Med.
2010;181(12):1329-1335. doi:10.1164/rccm.200812-1902OC.
12. Noble PW, Barkauskas CE, Jiang D. Pulmonary fibrosis: patterns and perpetrators. J Clin Invest.
2012;122(8):2756-2762. doi:10.1172/JCI60323. 6
13. Hopkins N, McLoughlin P. The structural basis of pulmonary hypertension in chronic lung
disease: remodelling, rarefaction or angiogenesis? J Anat. 2002;201(4):335-348.
14. Fixman ED, Stewart A, Martin JG. Basic mechanisms of development of airway structural changes
in asthma. Eur Respir J. 2007;29(2):379-389. doi:10.1183/09031936.00053506.
15. Redington AE. Airway fibrosis in asthma: mechanisms, consequences, and potential for
therapeutic intervention. Monaldi Arch Chest Dis Arch Monaldi Mal Torace. 2000;55(4):317-323.
16. Koziol-White CJ, Panettieri RA. Airway smooth muscle and immunomodulation in acute
exacerbations of airway disease. Immunol Rev. 2011;242(1):178-185. doi:10.1111/j.1600-
065X.2011.01022.x.
17. Ward JE, Harris T, Bamford T, et al. Proliferation is not increased in airway myofibroblasts isolated
from asthmatics. Eur Respir J. 2008;32(2):362-371. doi:10.1183/09031936.00119307.
18. Flavell SJ, Hou TZ, Lax S, Filer AD, Salmon M, Buckley CD. Fibroblasts as novel therapeutic
targets in chronic inflammation. Br J Pharmacol. 2008;153(Suppl 1):S241-S246. doi:10.1038/
sj.bjp.0707487.
19. Li M, Riddle SR, Frid MG, et al. Emergence of fibroblasts with a proinflammatory epigenetically
altered phenotype in severe hypoxic pulmonary hypertension. J Immunol Baltim Md 1950.
2011;187(5):2711-2722. doi:10.4049/jimmunol.1100479.
20. Xia YC, Redhu NS, Moir LM, et al. Pro-inflammatory and immunomodulatory functions of airway
smooth muscle: emerging concepts. Pulm Pharmacol Ther. 2013;26(1):64-74. doi:10.1016/j.
pupt.2012.05.006.
21. Evanko SP, Potter-Perigo S, Bollyky PL, Nepom GT, Wight TN. Hyaluronan and versican in the
control of human T-lymphocyte adhesion and migration. Matrix Biol J Int Soc Matrix Biol.
2012;31(2):90-100. doi:10.1016/j.matbio.2011.10.004.
22. Li Y, Jiang D, Liang J, et al. Severe lung fibrosis requires an invasive fibroblast phenotype regulated
by hyaluronan and CD44. J Exp Med. 2011;208(7):1459-1471. doi:10.1084/jem.20102510.
111
23. Alkhouri H, Moir LM, Armour CL, Hughes JM. CXCL1 is a negative regulator of mast cell
chemotaxis to airway smooth muscle cell products in vitro. Clin Exp Allergy J Br Soc Allergy Clin
Immunol. 2014;44(3):381-392. doi:10.1111/cea.12224.
24. Jia Y, Morand EF, Song W, Cheng Q, Stewart A, Yang YH. Regulation of lung fibroblast activation
by annexin A1. J Cell Physiol. 2013;228(2):476-484. doi:10.1002/jcp.24156.
25. Elias JA, Wu Y, Zheng T, Panettieri R. Cytokine- and virus-stimulated airway smooth muscle cells
produce IL-11 and other IL-6-type cytokines. Am J Physiol. 1997;273(3 Pt 1):L648-655.
26. Rudd BD, Burstein E, Duckett CS, Li X, Lukacs NW. Differential role for TLR3 in respiratory syncytial
virus-induced chemokine expression. J Virol. 2005;79(6):3350-3357. doi:10.1128/JVI.79.6.3350-
3357.2005.
27. Saunders MA, Mitchell JA, Seldon PM, et al. Release of granulocyte-macrophage colony stimulating
factor by human cultured airway smooth muscle cells: suppression by dexamethasone. Br J
Pharmacol. 1997;120(4):545-546. doi:10.1038/sj.bjp.0700998.
28. Fitzgerald SM, Chi DS, Hall HK, et al. GM-CSF induction in human lung fibroblasts by IL-1beta,
TNF-alpha, and macrophage contact. J Interferon Cytokine Res Off J Int Soc Interferon Cytokine
Res. 2003;23(2):57-65. doi:10.1089/107999003321455453.
29. Knight DA, Lydell CP, Zhou D, Weir TD, Robert Schellenberg R, Bai TR. Leukemia inhibitory factor
(LIF) and LIF receptor in human lung. Distribution and regulation of LIF release. Am J Respir Cell
Mol Biol. 1999;20(4):834-841. doi:10.1165/ajrcmb.20.4.3429.
30. Burgess JK, Carlin S, Pack RA, et al. Detection and characterization of OX40 ligand expression
in human airway smooth muscle cells: a possible role in asthma? J Allergy Clin Immunol.
2004;113(4):683-689. doi:10.1016/j.jaci.2003.12.311.
31. Issa R, Xie S, Khorasani N, et al. Corticosteroid inhibition of growth-related oncogene protein-
alpha via mitogen-activated kinase phosphatase-1 in airway smooth muscle cells. J Immunol
Baltim Md 1950. 2007;178(11):7366-7375.
32. Brant KA, Fabisiak JP. Nickel and the Microbial Toxin, MALP-2, Stimulate Proangiogenic
Mediators from Human Lung Fibroblasts via a HIF-1α and COX-2–Mediated Pathway. Toxicol Sci.
2009;107(1):227-237. doi:10.1093/toxsci/kfn208.
33. Pang L, Knox AJ. Bradykinin stimulates IL-8 production in cultured human airway smooth muscle
cells: role of cyclooxygenase products. J Immunol Baltim Md 1950. 1998;161(5):2509-2515.
34. Brightling CE, Ammit AJ, Kaur D, et al. The CXCL10/CXCR3 axis mediates human lung mast cell
migration to asthmatic airway smooth muscle. Am J Respir Crit Care Med. 2005;171(10):1103-
1108. doi:10.1164/rccm.200409-1220OC.
35. Hardaker EL, Bacon AM, Carlson K, et al. Regulation of TNF-alpha- and IFN-gamma-induced
CXCL10 expression: participation of the airway smooth muscle in the pulmonary inflammatory
response in chronic obstructive pulmonary disease. FASEB J Off Publ Fed Am Soc Exp Biol.
2004;18(1):191-193. doi:10.1096/fj.03-0170fje.
36. Dong S, Zhang X, He Y, et al. Synergy of IL-27 and TNF-α in regulating CXCL10 expression in lung
fibroblasts. Am J Respir Cell Mol Biol. 2013;48(4):518-530. doi:10.1165/rcmb.2012-0340OC.
37. Wuyts WA, Vanaudenaerde BM, Dupont LJ, Demedts MG, Verleden GM. Modulation by cAMP
of IL-1beta-induced eotaxin and MCP-1 expression and release in human airway smooth muscle
cells. Eur Respir J. 2003;22(2):220-226.
38. Holgate ST, Bodey KS, Janezic A, Frew AJ, Kaplan AP, Teran LM. Release of RANTES, MIP-1 alpha,
and MCP-1 into asthmatic airways following endobronchial allergen challenge. Am J Respir Crit
Care Med. 1997;156(5):1377-1383. doi:10.1164/ajrccm.156.5.9610064.
39. John M, Hirst SJ, Jose PJ, et al. Human airway smooth muscle cells express and release RANTES
in response to T helper 1 cytokines: regulation by T helper 2 cytokines and corticosteroids. J
Immunol Baltim Md 1950. 1997;158(4):1841-1847.
40. Choi ES, Jakubzick C, Carpenter KJ, et al. Enhanced monocyte chemoattractant protein-3/CC
chemokine ligand-7 in usual interstitial pneumonia. Am J Respir Crit Care Med. 2004;170(5):508-
515. doi:10.1164/rccm.200401-002OC.
41. Ghaffar O, Hamid Q, Renzi PM, et al. Constitutive and cytokine-stimulated expression of eotaxin
by human airway smooth muscle cells. Am J Respir Crit Care Med. 1999;159(6):1933-1942.
doi:10.1164/ajrccm.159.6.9805039.
42. Fritz DK, Kerr C, Botelho F, Stampfli M, Richards CD. Oncostatin M (OSM) primes IL-13- and IL-4-
112
induced eotaxin responses in fibroblasts: regulation of the type-II IL-4 receptor chains IL-4Ralpha
and IL-13Ralpha1. Exp Cell Res. 2009;315(20):3486-3499. doi:10.1016/j.yexcr.2009.09.024.
43. Faffe DS, Whitehead T, Moore PE, et al. IL-13 and IL-4 promote TARC release in human airway
smooth muscle cells: role of IL-4 receptor genotype. Am J Physiol Lung Cell Mol Physiol.
2003;285(4):L907-914. doi:10.1152/ajplung.00120.2003.
44. Kaur D, Saunders R, Berger P, et al. Airway smooth muscle and mast cell-derived CC chemokine
ligand 19 mediate airway smooth muscle migration in asthma. Am J Respir Crit Care Med.
2006;174(11):1179-1188. doi:10.1164/rccm.200603-394OC.
45. Jarai G, Sukkar M, Garrett S, et al. Effects of interleukin-1beta, interleukin-13 and transforming
growth factor-beta on gene expression in human airway smooth muscle using gene microarrays.
Eur J Pharmacol. 2004;497(3):255-265. doi:10.1016/j.ejphar.2004.06.055.
46. Sukkar MB, Issa R, Xie S, Oltmanns U, Newton R, Chung KF. Fractalkine/CX3CL1 production by
human airway smooth muscle cells: induction by IFN-gamma and TNF-alpha and regulation
by TGF-beta and corticosteroids. Am J Physiol Lung Cell Mol Physiol. 2004;287(6):L1230-1240.
doi:10.1152/ajplung.00014.2004.
47. Kassel O, Schmidlin F, Duvernelle C, Gasser B, Massard G, Frossard N. Human bronchial smooth
muscle cells in culture produce stem cell factor. Eur Respir J. 1999;13(5):951-954.
48. Panettieri RA, Lazaar AL, Puré E, Albelda SM. Activation of cAMP-dependent pathways in human
airway smooth muscle cells inhibits TNF-alpha-induced ICAM-1 and VCAM-1 expression and T
lymphocyte adhesion. J Immunol Baltim Md 1950. 1995;154(5):2358-2365.
49. Spoelstra FM, Postma DS, Hovenga H, Noordhoek JA, Kauffman HF. Interferon-gamma and
interleukin-4 differentially regulate ICAM-1 and VCAM-1 expression on human lung fibroblasts.
Eur Respir J. 1999;14(4):759-766.
50. Burgess JK, Blake AE, Boustany S, et al. CD40 and OX40 ligand are increased on stimulated
asthmatic airway smooth muscle. J Allergy Clin Immunol. 2005;115(2):302-308. doi:10.1016/j.
jaci.2004.11.004.
51. Lazaar AL, Albelda SM, Pilewski JM, Brennan B, Puré E, Panettieri RA. T lymphocytes adhere
to airway smooth muscle cells via integrins and CD44 and induce smooth muscle cell DNA
synthesis. J Exp Med. 1994;180(3):807-816.
52. Pechkovsky DV, Prêle CM, Wong J, et al. STAT3-mediated signaling dysregulates lung fibroblast- 6
myofibroblast activation and differentiation in UIP/IPF. Am J Pathol. 2012;180(4):1398-1412.
doi:10.1016/j.ajpath.2011.12.022.
53. Weylandt KH, Chiu C-Y, Gomolka B, Waechter SF, Wiedenmann B. Omega-3 fatty acids and their
lipid mediators: towards an understanding of resolvin and protectin formation. Prostaglandins
Other Lipid Mediat. 2012;97(3-4):73-82. doi:10.1016/j.prostaglandins.2012.01.005.
54. Aoki H, Hisada T, Ishizuka T, et al. Protective effect of resolvin E1 on the development of asthmatic
airway inflammation. Biochem Biophys Res Commun. 2010;400(1):128-133. doi:10.1016/j.
bbrc.2010.08.025.
55. Levy BD, Kohli P, Gotlinger K, et al. Protectin D1 is generated in asthma and dampens airway
inflammation and hyperresponsiveness. J Immunol Baltim Md 1950. 2007;178(1):496-502.
56. Wang Y, Li D, Xu N, et al. Follistatin-like protein 1: a serum biochemical marker reflecting the
severity of joint damage in patients with osteoarthritis. Arthritis Res Ther. 2011;13(6):R193.
doi:10.1186/ar3522.
57. Rogerio AP, Haworth O, Croze R, et al. Resolvin D1 and aspirin-triggered resolvin D1 promote
resolution of allergic airways responses. J Immunol Baltim Md 1950. 2012;189(4):1983-1991.
doi:10.4049/jimmunol.1101665.
58. Miyata J, Fukunaga K, Iwamoto R, et al. Dysregulated synthesis of protectin D1 in eosinophils
from patients with severe asthma. J Allergy Clin Immunol. 2013;131(2):353-360-2. doi:10.1016/j.
jaci.2012.07.048.
59. Levy BD. Resolvin D1 and Resolvin E1 Promote the Resolution of Allergic Airway Inflammation
via Shared and Distinct Molecular Counter-Regulatory Pathways. Front Immunol. 2012;3:390.
doi:10.3389/fimmu.2012.00390.
60. Hsiao H-M, Sapinoro RE, Thatcher TH, et al. A novel anti-inflammatory and pro-resolving role for
resolvin D1 in acute cigarette smoke-induced lung inflammation. PloS One. 2013;8(3):e58258.
doi:10.1371/journal.pone.0058258.
113
61. Wu D, Zheng S, Li W, et al. Novel biphasic role of resolvin D1 on expression of cyclooxygenase-2
in lipopolysaccharide-stimulated lung fibroblasts is partly through PI3K/AKT and ERK2 pathways.
Mediators Inflamm. 2013;2013:964012. doi:10.1155/2013/964012.
62. Millien VO, Lu W, Shaw J, et al. Cleavage of fibrinogen by proteinases elicits allergic responses
through Toll-like receptor 4. Science. 2013;341(6147):792-796. doi:10.1126/science.1240342.
63. Stewart AG, Xia YC, Harris T, Royce S, Hamilton JA, Schuliga M. Plasminogen-stimulated airway
smooth muscle cell proliferation is mediated by urokinase and annexin A2, involving plasmin-
activated cell signalling. Br J Pharmacol. 2013;170(7):1421-1435. doi:10.1111/bph.12422.
64. Brant KA, Fabisiak JP. Nickel alterations of TLR2-dependent chemokine profiles in lung fibroblasts
are mediated by COX-2. Am J Respir Cell Mol Biol. 2008;38(5):591-599. doi:10.1165/rcmb.2007-
0314OC.
65. Sugiura H, Ichikawa T, Koarai A, et al. Activation of Toll-like receptor 3 augments myofibroblast
differentiation. Am J Respir Cell Mol Biol. 2009;40(6):654-662. doi:10.1165/rcmb.2008-0371OC.
66. He Z, Zhu Y, Jiang H. Toll-like receptor 4 mediates lipopolysaccharide-induced collagen secretion
by phosphoinositide3-kinase-Akt pathway in fibroblasts during acute lung injury. J Recept Signal
Transduct Res. 2009;29(2):119-125. doi:10.1080/10799890902845690.
67. Meneghin A, Choi ES, Evanoff HL, et al. TLR9 is expressed in idiopathic interstitial pneumonia
and its activation promotes in vitro myofibroblast differentiation. Histochem Cell Biol.
2008;130(5):979-992. doi:10.1007/s00418-008-0466-z.
68. Sukkar MB, Xie S, Khorasani NM, et al. Toll-like receptor 2, 3, and 4 expression and function
in human airway smooth muscle. J Allergy Clin Immunol. 2006;118(3):641-648. doi:10.1016/j.
jaci.2006.05.013.
69. Manetsch M, Seidel P, Heintz U, et al. TLR2 ligand engagement upregulates airway smooth muscle
TNFα-induced cytokine production. Am J Physiol Lung Cell Mol Physiol. 2012;302(9):L838-845.
doi:10.1152/ajplung.00317.2011.
70. Swisher JFA, Burton N, Bacot SM, Vogel SN, Feldman GM. Annexin A2 tetramer activates
human and murine macrophages through TLR4. Blood. 2010;115(3):549-558. doi:10.1182/
blood-2009-06-226944.
71. O’Dwyer DN, Armstrong ME, Trujillo G, et al. The Toll-like receptor 3 L412F polymorphism
and disease progression in idiopathic pulmonary fibrosis. Am J Respir Crit Care Med.
2013;188(12):1442-1450. doi:10.1164/rccm.201304-0760OC.
72. He Z, Gao Y, Deng Y, et al. Lipopolysaccharide induces lung fibroblast proliferation through
Toll-like receptor 4 signaling and the phosphoinositide3-kinase-Akt pathway. PloS One.
2012;7(4):e35926. doi:10.1371/journal.pone.0035926.
73. Syrovets T, Lunov O, Simmet T. Plasmin as a proinflammatory cell activator. J Leukoc Biol.
2012;92(3):509-519. doi:10.1189/jlb.0212056.
74. Schuliga M, Westall G, Xia Y, Stewart AG. The plasminogen activation system: new targets in
lung inflammation and remodeling. Curr Opin Pharmacol. 2013;13(3):386-393. doi:10.1016/j.
coph.2013.05.014.
75. Pendurthi UR, Ngyuen M, Andrade-Gordon P, Petersen LC, Rao LVM. Plasmin induces Cyr61
gene expression in fibroblasts via protease-activated receptor-1 and p44/42 mitogen-activated
protein kinase-dependent signaling pathway. Arterioscler Thromb Vasc Biol. 2002;22(9):1421-
1426.
76. Schuliga M, Harris T, Stewart AG. Plasminogen activation by airway smooth muscle is regulated
by type I collagen. Am J Respir Cell Mol Biol. 2011;44(6):831-839. doi:10.1165/rcmb.2009-
0469OC.
77. Schuliga M, Langenbach S, Xia YC, et al. Plasminogen-stimulated inflammatory cytokine
production by airway smooth muscle cells is regulated by annexin A2. Am J Respir Cell Mol Biol.
2013;49(5):751-758. doi:10.1165/rcmb.2012-0404OC.
78. Bauman KA, Wettlaufer SH, Okunishi K, et al. The antifibrotic effects of plasminogen activation
occur via prostaglandin E2 synthesis in humans and mice. J Clin Invest. 2010;120(6):1950-1960.
doi:10.1172/JCI38369.
79. Li Q, Laumonnier Y, Syrovets T, Simmet T. Plasmin triggers cytokine induction in human monocyte-
derived macrophages. Arterioscler Thromb Vasc Biol. 2007;27(6):1383-1389. doi:10.1161/
ATVBAHA.107.142901.
114
80. Henneke I, Greschus S, Savai R, et al. Inhibition of urokinase activity reduces primary tumor
growth and metastasis formation in a murine lung carcinoma model. Am J Respir Crit Care Med.
2010;181(6):611-619. doi:10.1164/rccm.200903-0342OC.
81. Schmitt M, Harbeck N, Brünner N, et al. Cancer therapy trials employing level-of-evidence-1
disease forecast cancer biomarkers uPA and its inhibitor PAI-1. Expert Rev Mol Diagn.
2011;11(6):617-634. doi:10.1586/erm.11.47.
82. Sharma M, Blackman MR, Sharma MC. Antibody-directed neutralization of annexin II (ANX II)
inhibits neoangiogenesis and human breast tumor growth in a xenograft model. Exp Mol Pathol.
2012;92(1):175-184. doi:10.1016/j.yexmp.2011.10.003.
83. Sharma M, Ownbey RT, Sharma MC. Breast cancer cell surface annexin II induces cell migration
and neoangiogenesis via tPA dependent plasmin generation. Exp Mol Pathol. 2010;88(2):278-
286. doi:10.1016/j.yexmp.2010.01.001.
84. Zheng L, Foley K, Huang L, et al. Tyrosine 23 phosphorylation-dependent cell-surface localization
of annexin A2 is required for invasion and metastases of pancreatic cancer. PloS One.
2011;6(4):e19390. doi:10.1371/journal.pone.0019390.
85. Chambers RC, Scotton CJ. Coagulation cascade proteinases in lung injury and fibrosis. Proc Am
Thorac Soc. 2012;9(3):96-101. doi:10.1513/pats.201201-006AW.
86. Lambrecht BN, Hammad H. Asthma and coagulation. N Engl J Med. 2013;369(20):1964-1966.
doi:10.1056/NEJMcibr1311045.
87. Tchougounova E, Pejler G. Regulation of extravascular coagulation and fibrinolysis by heparin-
dependent mast cell chymase. FASEB J Off Publ Fed Am Soc Exp Biol. 2001;15(14):2763-2765.
doi:10.1096/fj.01-0486fje.
88. Knight DA, Lim S, Scaffidi AK, et al. Protease-activated receptors in human airways: upregulation
of PAR-2 in respiratory epithelium from patients with asthma. J Allergy Clin Immunol.
2001;108(5):797-803. doi:10.1067/mai.2001.119025.
89. Scotton CJ, Krupiczojc MA, Königshoff M, et al. Increased local expression of coagulation
factor X contributes to the fibrotic response in human and murine lung injury. J Clin Invest.
2009;119(9):2550-2563. doi:10.1172/JCI33288.
90. Ortiz-Stern A, Deng X, Smoktunowicz N, Mercer PF, Chambers RC. PAR-1-dependent and PAR-
independent pro-inflammatory signaling in human lung fibroblasts exposed to thrombin. J Cell 6
Physiol. 2012;227(11):3575-3584. doi:10.1002/jcp.24061.
91. Tran T, Stewart AG. Protease-activated receptor (PAR)-independent growth and pro-
inflammatory actions of thrombin on human cultured airway smooth muscle. Br J Pharmacol.
2003;138(5):865-875. doi:10.1038/sj.bjp.0705106.
92. Shinagawa K, Martin JA, Ploplis VA, Castellino FJ. Coagulation factor Xa modulates airway
remodeling in a murine model of asthma. Am J Respir Crit Care Med. 2007;175(2):136-143.
doi:10.1164/rccm.200608-1097OC.
93. Zhu W, Bi M, Liu Y, et al. Thrombin promotes airway remodeling via protease-activated receptor-1
and transforming growth factor-β1 in ovalbumin-allergic rats. Inhal Toxicol. 2013;25(10):577-
586. doi:10.3109/08958378.2013.813995.
94. Bousquet J, Jeffery PK, Busse WW, Johnson M, Vignola AM. Asthma. From bronchoconstriction
to airways inflammation and remodeling. Am J Respir Crit Care Med. 2000;161(5):1720-1745.
doi:10.1164/ajrccm.161.5.9903102.
95. Pilette C, Francis JN, Till SJ, Durham SR. CCR4 ligands are up-regulated in the airways of atopic
asthmatics after segmental allergen challenge. Eur Respir J. 2004;23(6):876-884.
96. Ordoñez CL, Shaughnessy TE, Matthay MA, Fahy JV. Increased neutrophil numbers and IL-8
levels in airway secretions in acute severe asthma: Clinical and biologic significance. Am J Respir
Crit Care Med. 2000;161(4 Pt 1):1185-1190. doi:10.1164/ajrccm.161.4.9812061.
97. Taha RA, Minshall EM, Miotto D, et al. Eotaxin and monocyte chemotactic protein-4 mRNA
expression in small airways of asthmatic and nonasthmatic individuals. J Allergy Clin Immunol.
1999;103(3 Pt 1):476-483.
98. John AE, Zhu YM, Brightling CE, Pang L, Knox AJ. Human airway smooth muscle cells from
asthmatic individuals have CXCL8 hypersecretion due to increased NF-kappa B p65, C/EBP
beta, and RNA polymerase II binding to the CXCL8 promoter. J Immunol Baltim Md 1950.
2009;183(7):4682-4692. doi:10.4049/jimmunol.0803832.
115
99. Chan V, Burgess JK, Ratoff JC, et al. Extracellular matrix regulates enhanced eotaxin expression
in asthmatic airway smooth muscle cells. Am J Respir Crit Care Med. 2006;174(4):379-385.
doi:10.1164/rccm.200509-1420OC.
100. Faiz A, Oliver B, Black JL, Burgess JK. Ccl20 Production By Airway Smooth Muscle Cells Contributes
To Mucus Hyperscretion And Increase Muscle Mass In Asthmatic Airways. Respirology. 2013;18.
https://insights.ovid.com/respirology/respy/2013/04/002/ccl20-production-airway-smooth-
muscle-cells/175/00075270. Accessed March 31, 2017.
101. Araujo BB, Dolhnikoff M, Silva LFF, et al. Extracellular matrix components and regulators in the airway
smooth muscle in asthma. Eur Respir J. 2008;32(1):61-69. doi:10.1183/09031936.00147807.
102. Johnson PRA, Burgess JK, Underwood PA, et al. Extracellular matrix proteins modulate asthmatic
airway smooth muscle cell proliferation via an autocrine mechanism. J Allergy Clin Immunol.
2004;113(4):690-696. doi:10.1016/j.jaci.2003.12.312.
103. Lau JY, Oliver BG, Baraket M, et al. Fibulin-1 is increased in asthma--a novel mediator of airway
remodeling? PloS One. 2010;5(10):e13360. doi:10.1371/journal.pone.0013360.
104. Mahn K, Hirst SJ, Ying S, et al. Diminished sarco/endoplasmic reticulum Ca2+ ATPase (SERCA)
expression contributes to airway remodelling in bronchial asthma. Proc Natl Acad Sci U S A.
2009;106(26):10775-10780. doi:10.1073/pnas.0902295106.
105. Trian T, Benard G, Begueret H, et al. Bronchial smooth muscle remodeling involves calcium-
dependent enhanced mitochondrial biogenesis in asthma. J Exp Med. 2007;204(13):3173-3181.
doi:10.1084/jem.20070956.
106. Alrashdan YA, Alkhouri H, Chen E, et al. Asthmatic airway smooth muscle CXCL10 production:
mitogen-activated protein kinase JNK involvement. Am J Physiol Lung Cell Mol Physiol.
2012;302(10):L1118-1127. doi:10.1152/ajplung.00232.2011.
107. Tan X, Alrashdan YA, Alkhouri H, Oliver BGG, Armour CL, Hughes JM. Airway smooth muscle
CXCR3 ligand production: regulation by JAK-STAT1 and intracellular Ca2+. Am J Physiol - Lung Cell
Mol Physiol. 2013;304(11):L790-L802. doi:10.1152/ajplung.00356.2012.
108. Chang P-J, Bhavsar PK, Michaeloudes C, Khorasani N, Chung KF. Corticosteroid insensitivity of
chemokine expression in airway smooth muscle of patients with severe asthma. J Allergy Clin
Immunol. 2012;130(4):877-885.e5. doi:10.1016/j.jaci.2012.07.017.
109. Roth M, Johnson PRA, Borger P, et al. Dysfunctional interaction of C/EBPalpha and
the glucocorticoid receptor in asthmatic bronchial smooth-muscle cells. N Engl J Med.
2004;351(6):560-574. doi:10.1056/NEJMoa021660.
110. Hew M, Bhavsar P, Torrego A, et al. Relative corticosteroid insensitivity of peripheral blood
mononuclear cells in severe asthma. Am J Respir Crit Care Med. 2006;174(2):134-141.
doi:10.1164/rccm.200512-1930OC.
111. Ingram JL, Huggins MJ, Church TD, et al. Airway fibroblasts in asthma manifest an invasive
phenotype. Am J Respir Crit Care Med. 2011;183(12):1625-1632. doi:10.1164/rccm.201009-
1452OC.
112. Zheng T, Liu W, Oh S-Y, et al. IL-13 receptor alpha2 selectively inhibits IL-13-induced responses in
the murine lung. J Immunol Baltim Md 1950. 2008;180(1):522-529.
113. Han MK, Criner GJ. Update in chronic obstructive pulmonary disease 2012. Am J Respir Crit Care
Med. 2013;188(1):29-34. doi:10.1164/rccm.201302-0319UP.
114. Qiu W, Baccarelli A, Carey VJ, et al. Variable DNA methylation is associated with chronic
obstructive pulmonary disease and lung function. Am J Respir Crit Care Med. 2012;185(4):373-
381. doi:10.1164/rccm.201108-1382OC.
115. Sze MA, Dimitriu PA, Hayashi S, et al. The lung tissue microbiome in chronic obstructive
pulmonary disease. Am J Respir Crit Care Med. 2012;185(10):1073-1080. doi:10.1164/
rccm.201111-2075OC.
116. Jeffery PK. Remodeling and inflammation of bronchi in asthma and chronic obstructive
pulmonary disease. Proc Am Thorac Soc. 2004;1(3):176-183. doi:10.1513/pats.200402-009MS.
117. Hallgren O, Rolandsson S, Andersson-Sjöland A, et al. Enhanced ROCK1 dependent contractility
in fibroblast from chronic obstructive pulmonary disease patients. J Transl Med. 2012;10:171.
doi:10.1186/1479-5876-10-171.
118. Hallgren O, Nihlberg K, Dahlbäck M, et al. Altered fibroblast proteoglycan production in COPD.
Respir Res. 2010;11:55. doi:10.1186/1465-9921-11-55.
116
119. Zhang J, Wu L, Qu J, Bai C, Merrilees MJ, Black PN. Pro-inflammatory phenotype of COPD
fibroblasts not compatible with repair in COPD lung. J Cell Mol Med. 2012;16(7):1522-1532.
doi:10.1111/j.1582-4934.2011.01492.x.
120. Larsson-Callerfelt A-K, Hallgren O, Andersson-Sjöland A, et al. Defective alterations in the collagen
network to prostacyclin in COPD lung fibroblasts. Respir Res. 2013;14:21. doi:10.1186/1465-
9921-14-21.
121. Stitham J, Midgett C, Martin KA, Hwa J. Prostacyclin: an inflammatory paradox. Front Pharmacol.
2011;2:24. doi:10.3389/fphar.2011.00024.
122. Nagai S, Handa T, Ito Y, Takeuchi M, Izumi T. Bronchoalveolar Lavage in Idiopathic Interstitial Lung
Diseases. Semin Respir Crit Care Med. 2007;28(05):496-503. doi:10.1055/s-2007-991522.
123. Nathan N, Thouvenin G, Fauroux B, Corvol H, Clement A. Interstitial lung disease: physiopathology
in the context of lung growth. Paediatr Respir Rev. 2011;12(4):216-222. doi:10.1016/j.
prrv.2011.04.003.
124. Coffey E, Newman DR, Sannes PL. Expression of fibroblast growth factor 9 in normal human lung
and idiopathic pulmonary fibrosis. J Histochem Cytochem Off J Histochem Soc. 2013;61(9):671-
679. doi:10.1369/0022155413497366.
125. Lindahl GE, Stock CJ, Shi-Wen X, et al. Microarray profiling reveals suppressed interferon
stimulated gene program in fibroblasts from scleroderma-associated interstitial lung disease.
Respir Res. 2013;14:80. doi:10.1186/1465-9921-14-80.
126. Nagahama KY, Togo S, Holz O, et al. Oncostatin M modulates fibroblast function via signal
transducers and activators of transcription proteins-3. Am J Respir Cell Mol Biol. 2013;49(4):582-
591. doi:10.1165/rcmb.2012-0460OC.
127. Suda T, Chida K, Todate A, et al. Oncostatin M production by human dendritic cells in response
to bacterial products. Cytokine. 2002;17(6):335-340. doi:10.1006/cyto.2002.1023.
128. Botelho FM, Rangel-Moreno J, Fritz D, Randall TD, Xing Z, Richards CD. Pulmonary expression
of oncostatin M (OSM) promotes inducible BALT formation independently of IL-6, despite a role
for IL-6 in OSM-driven pulmonary inflammation. J Immunol Baltim Md 1950. 2013;191(3):1453-
1464. doi:10.4049/jimmunol.1203318.
129. Fritz DK, Kerr C, Fattouh R, et al. A mouse model of airway disease: oncostatin M-induced
pulmonary eosinophilia, goblet cell hyperplasia, and airway hyperresponsiveness are STAT6 6
dependent, and interstitial pulmonary fibrosis is STAT6 independent. J Immunol Baltim Md
1950. 2011;186(2):1107-1118. doi:10.4049/jimmunol.0903476.
130. Mozaffarian A, Brewer AW, Trueblood ES, et al. Mechanisms of oncostatin M-induced pulmonary
inflammation and fibrosis. J Immunol Baltim Md 1950. 2008;181(10):7243-7253.
131. Smyth DC, Kerr C, Li Y, Tang D, Richards CD. Oncostatin M induction of eotaxin-1 expression
requires the convergence of PI3’K and ERK1/2 MAPK signal transduction pathways. Cell Signal.
2008;20(6):1142-1150. doi:10.1016/j.cellsig.2008.02.001.
132. Pak O, Aldashev A, Welsh D, Peacock A. The effects of hypoxia on the cells of the pulmonary
vasculature. Eur Respir J. 2007;30(2):364-372. doi:10.1183/09031936.00128706.
133. Crosswhite P, Sun Z. Nitric oxide, oxidative stress and inflammation in pulmonary arterial
hypertension. J Hypertens. 2010;28(2):201-212. doi:10.1097/HJH.0b013e328332bcdb.
134. Stenmark KR, Frid MG, Yeager M, et al. Targeting the adventitial microenvironment in pulmonary
hypertension: A potential approach to therapy that considers epigenetic change. Pulm Circ.
2012;2(1):3-14. doi:10.4103/2045-8932.94817.
135. Wang D, Zhang H, Li M, et al. MicroRNA-124 controls the proliferative, migratory, and
inflammatory phenotype of pulmonary vascular fibroblasts. Circ Res. 2014;114(1):67-78.
doi:10.1161/CIRCRESAHA.114.301633.
136. Schabbauer G, Matt U, Günzl P, et al. Myeloid PTEN promotes inflammation but impairs
bactericidal activities during murine pneumococcal pneumonia. J Immunol Baltim Md 1950.
2010;185(1):468-476. doi:10.4049/jimmunol.0902221.
137. Horita H, Furgeson SB, Ostriker A, et al. Selective inactivation of PTEN in smooth muscle
cells synergizes with hypoxia to induce severe pulmonary hypertension. J Am Heart Assoc.
2013;2(3):e000188. doi:10.1161/JAHA.113.000188.
138. Brightling CE, Bradding P, Symon FA, Holgate ST, Wardlaw AJ, Pavord ID. Mast-cell infiltration
of airway smooth muscle in asthma. N Engl J Med. 2002;346(22):1699-1705. doi:10.1056/
117
 NEJMoa012705.
139. Amin K, Janson C, Harvima I, Venge P, Nilsson G. CC chemokine receptors CCR1 and CCR4 are
expressed on airway mast cells in allergic asthma. J Allergy Clin Immunol. 2005;116(6):1383-
1386. doi:10.1016/j.jaci.2005.08.053.
140. Begueret H, Berger P, Vernejoux J, Dubuisson L, Marthan R, Tunon‐de‐Lara JM. Inflammation
of bronchial smooth muscle in allergic asthma. Thorax. 2007;62(1):8-15. doi:10.1136/
thx.2006.062141.
141. Carroll NG, Mutavdzic S, James AL. Increased mast cells and neutrophils in submucosal mucous
glands and mucus plugging in patients with asthma. Thorax. 2002;57(8):677-682.
142. Sutcliffe A, Kaur D, Page S, et al. Mast cell migration to Th2 stimulated airway smooth muscle
from asthmatics. Thorax. 2006;61(8):657-662. doi:10.1136/thx.2005.056770.
143. Juremalm M, Hjertson M, Olsson N, Harvima I, Nilsson K, Nilsson G. The chemokine receptor
CXCR4 is expressed within the mast cell lineage and its ligand stromal cell-derived factor-1alpha
acts as a mast cell chemotaxin. Eur J Immunol. 2000;30(12):3614-3622. doi:10.1002/1521-
4141(200012)30:12&#60;3614::AID-IMMU3614&#62;3.0.CO;2-B.
144. Juremalm M, Olsson N, Nilsson G. Selective CCL5/RANTES-induced mast cell migration through
interactions with chemokine receptors CCR1 and CCR4. Biochem Biophys Res Commun.
2002;297(3):480-485.
145. Berger P, Girodet P-O, Begueret H, et al. Tryptase-stimulated human airway smooth muscle
cells induce cytokine synthesis and mast cell chemotaxis. FASEB J Off Publ Fed Am Soc Exp Biol.
2003;17(14):2139-2141. doi:10.1096/fj.03-0041fje.
146. Alkhouri H, Hollins F, Moir LM, Brightling CE, Armour CL, Hughes JM. Human lung mast cells
modulate the functions of airway smooth muscle cells in asthma. Allergy. 2011;66(9):1231-
1241. doi:10.1111/j.1398-9995.2011.02616.x.
147. Hollins F, Kaur D, Yang W, et al. Human airway smooth muscle promotes human lung mast cell
survival, proliferation, and constitutive activation: cooperative roles for CADM1, stem cell factor,
and IL-6. J Immunol Baltim Md 1950. 2008;181(4):2772-2780.
148. Bradding P. Mast cell regulation of airway smooth muscle function in asthma. Eur Respir J.
2007;29(5):827-830. doi:10.1183/09031936.00017707.
149. John AE, Lukacs NW. Chemokines and Asthma. Sarcoidosis Vasc Diffuse Lung Dis. 2003;20(3):180-
189.
150. Page S, Ammit AJ, Black JL, Armour CL. Human mast cell and airway smooth muscle cell
interactions: implications for asthma. Am J Physiol Lung Cell Mol Physiol. 2001;281(6):L1313-
1323.
151. Kitamura H, Cambier S, Somanath S, et al. Mouse and human lung fibroblasts regulate dendritic
cell trafficking, airway inflammation, and fibrosis through integrin αvβ8-mediated activation of
TGF-β. J Clin Invest. 2011;121(7):2863-2875. doi:10.1172/JCI45589.
152. Pechkovsky DV, Prasse A, Kollert F, et al. Alternatively activated alveolar macrophages in
pulmonary fibrosis-mediator production and intracellular signal transduction. Clin Immunol
Orlando Fla. 2010;137(1):89-101. doi:10.1016/j.clim.2010.06.017.
153. Kunz LIZ, Lapperre TS, Snoeck-Stroband JB, et al. Smoking status and anti-inflammatory
macrophages in bronchoalveolar lavage and induced sputum in COPD. Respir Res. 2011;12:34.
doi:10.1186/1465-9921-12-34.
154. Prasse A, Pechkovsky DV, Toews GB, et al. A vicious circle of alveolar macrophages and fibroblasts
perpetuates pulmonary fibrosis via CCL18. Am J Respir Crit Care Med. 2006;173(7):781-792.
doi:10.1164/rccm.200509-1518OC.
155. Barnes PJ. New anti-inflammatory targets for chronic obstructive pulmonary disease. Nat Rev
Drug Discov. 2013;12(7):543-559. doi:10.1038/nrd4025.
156. Tannheimer SL, Wright CD, Salmon M. Combination of roflumilast with a beta-2 adrenergic
receptor agonist inhibits proinflammatory and profibrotic mediator release from human lung
fibroblasts. Respir Res. 2012;13:28. doi:10.1186/1465-9921-13-28.
157. Michalski J, Kanaji N, Liu X, et al. Attenuation of inhibitory prostaglandin E2 signaling in human
lung fibroblasts is mediated by phosphodiesterase 4. Am J Respir Cell Mol Biol. 2012;47(6):729-
737. doi:10.1165/rcmb.2012-0057OC.
158. Sato T, Liu X, Nelson A, et al. Reduced miR-146a increases prostaglandin E₂in chronic obstructive
118
pulmonary disease fibroblasts. Am J Respir Crit Care Med. 2010;182(8):1020-1029. doi:10.1164/
rccm.201001-0055OC.
159. Togo S, Holz O, Liu X, et al. Lung Fibroblast Repair Functions in Patients with Chronic Obstructive
Pulmonary Disease Are Altered by Multiple Mechanisms. Am J Respir Crit Care Med.
2008;178(3):248-260. doi:10.1164/rccm.200706-929OC.
160. Okunishi K, Sisson TH, Huang SK, Hogaboam CM, Simon RH, Peters-Golden M. Plasmin
overcomes resistance to prostaglandin E2 in fibrotic lung fibroblasts by reorganizing protein
kinase A signaling. J Biol Chem. 2011;286(37):32231-32243. doi:10.1074/jbc.M111.235606.
161. Xie S, Sukkar MB, Issa R, Oltmanns U, Nicholson AG, Chung KF. Regulation of TGF-beta 1-induced
connective tissue growth factor expression in airway smooth muscle cells. Am J Physiol Lung Cell
Mol Physiol. 2005;288(1):L68-76. doi:10.1152/ajplung.00156.2004.
162. Wynn TA. Integrating mechanisms of pulmonary fibrosis. J Exp Med. 2011;208(7):1339-1350.
doi:10.1084/jem.20110551.
163. Yndestad A, Larsen K-O, Oie E, et al. Elevated levels of activin A in clinical and experimental
pulmonary hypertension. J Appl Physiol Bethesda Md 1985. 2009;106(4):1356-1364.
doi:10.1152/japplphysiol.90719.2008.
164. Aoki F, Kurabayashi M, Hasegawa Y, Kojima I. Attenuation of bleomycin-induced pulmonary
fibrosis by follistatin. Am J Respir Crit Care Med. 2005;172(6):713-720. doi:10.1164/rccm.200412-
1620OC.
165. Ponticos M, Holmes AM, Shi-wen X, et al. Pivotal role of connective tissue growth factor in
lung fibrosis: MAPK-dependent transcriptional activation of type I collagen. Arthritis Rheum.
2009;60(7):2142-2155. doi:10.1002/art.24620.
166. Lu J, Auduong L, White ES, Yue X. Up-regulation of heparan sulfate 6-O-sulfation in idiopathic
pulmonary fibrosis. Am J Respir Cell Mol Biol. 2014;50(1):106-114. doi:10.1165/rcmb.2013-
0204OC.
167. Gallelli L, Falcone D, Pelaia G, et al. Interleukin-6 receptor superantagonist Sant7 inhibits
TGF-beta-induced proliferation of human lung fibroblasts. Cell Prolif. 2008;41(3):393-407.
doi:10.1111/j.1365-2184.2008.00538.x.
168. Baarsma HA, Engelbertink LHJM, van Hees LJ, et al. Glycogen synthase kinase-3 (GSK-3) regulates
TGF-β₁-induced differentiation of pulmonary fibroblasts. Br J Pharmacol. 2013;169(3):590-603. 6
doi:10.1111/bph.12098.
169. Baarsma HA, Meurs H, Halayko AJ, et al. Glycogen synthase kinase-3 regulates cigarette smoke
extract- and IL-1β-induced cytokine secretion by airway smooth muscle. Am J Physiol Lung Cell
Mol Physiol. 2011;300(6):L910-919. doi:10.1152/ajplung.00232.2010.
170. Manetsch M, Rahman MM, Patel BS, et al. Long-acting β2-agonists increase fluticasone
propionate-induced mitogen-activated protein kinase phosphatase 1 (MKP-1) in airway smooth
muscle cells. PloS One. 2013;8(3):e59635. doi:10.1371/journal.pone.0059635.
171. Quante T, Ng YC, Ramsay EE, et al. Corticosteroids reduce IL-6 in ASM cells via up-regulation of
MKP-1. Am J Respir Cell Mol Biol. 2008;39(2):208-217. doi:10.1165/rcmb.2007-0014OC.
172. Che W, Manetsch M, Quante T, et al. Sphingosine 1-phosphate induces MKP-1 expression via
p38 MAPK- and CREB-mediated pathways in airway smooth muscle cells. Biochim Biophys Acta.
2012;1823(10):1658-1665. doi:10.1016/j.bbamcr.2012.06.011.
173. Manetsch M, Che W, Seidel P, Chen Y, Ammit AJ. MKP-1: a negative feedback effector that represses
MAPK-mediated pro-inflammatory signaling pathways and cytokine secretion in human airway
smooth muscle cells. Cell Signal. 2012;24(4):907-913. doi:10.1016/j.cellsig.2011.12.013.
174. Doddareddy MR, Rawling T, Ammit AJ. Targeting mitogen-activated protein kinase phosphatase-1
(MKP-1): structure-based design of MKP-1 inhibitors and upregulators. Curr Med Chem.
2012;19(2):163-173.
175. Abraham E, Gyetko MR, Kuhn K, et al. Urokinase-type plasminogen activator potentiates
lipopolysaccharide-induced neutrophil activation. J Immunol Baltim Md 1950. 2003;170(11):5644-
5651.
176. Swaisgood CM, French EL, Noga C, Simon RH, Ploplis VA. The development of bleomycin-induced
pulmonary fibrosis in mice deficient for components of the fibrinolytic system. Am J Pathol.
2000;157(1):177-187. doi:10.1016/S0002-9440(10)64529-4.
177. Wang X-Q, Bdeir K, Yarovoi S, Cines DB, Fang W, Abraham E. Involvement of the urokinase
119
 CHAPTER 7 1

Variant club cell differentiation is

driven by bone morphogenetic
protein 4 in adult human airway
epithelium:
Implications for goblet cell metaplasia
and basal cell hyperplasia in COPD

Navessa P. Tania, Harm Maarsingh, Frank Ensink, John-Poul Ng-Blichfeldt,

Pieter S. Hiemstra, Maurice J.B. van den Hoff, Martina Schmidt,
Reinoud Gosens

121
Variant club cell differentiation is driven by bone morphogenetic protein 4 in adult
human airway epithelium: Implications for goblet cell metaplasia and basal cell
hyperplasia in COPD
Navessa P. Tania1,2, Harm Maarsingh3, Frank Ensink1, John-Poul Ng-Blichfeldt1,2, Pieter
S. Hiemstra4, Maurice J.B. van den Hoff5, Martina Schmidt1,2, Reinoud Gosens1,2
University of Groningen, Department of Molecular Pharmacology, Groningen, The
1
Netherlands.
2
University of Groningen, University Medical Center Groningen, Groningen Research
Institute for Asthma and COPD, Groningen, The Netherlands.
3
Palm Beach Atlantic University, Lloyd L. Gregory School of Pharmacy, Department of
Pharmaceutical Sciences, West Palm Beach, Florida, USA.
4
Dept. of Pulmonology, Leiden University Medical Centre, Leiden, The Netherlands.
5
Academic Medical Center, Department of Anatomy, Embryology and Physiology,
Amsterdam, The Netherlands.
122
Abstract
Activation of BMP signaling in adult airway epithelium is required for appropriate
regeneration after epithelial injury and plays key roles in proximal-to-distal
patterning of airway epithelial differentiation with highest expression in the distal
airways. COPD is associated with epithelial remodeling characterized by loss of
functional club cells, increased goblet cell metaplasia and basal cell hyperplasia.
Here, we studied the effects of BMP4 on adult airway epithelial differentiation,
hypothesizing that BMP4 would regulate club cell differentiation, whilst suppressing
goblet cell differentiation. An in vitro air-liquid interface (ALI) culture system was
used to grow adult primary tracheobronchial epithelial cells (PTECs). After 14 days
of air-exposure in the presence or absence of BMP4, distinct morphological changes
were observed in BMP4-treated PTECs. BMP4 reduced gene expression for markers
of ciliated (Tektin-1), goblet (MUC5AC), and basal (TP63) cells. Interestingly, BMP4
increased marker gene expression for distal variant club cells (UPK3A, SCGB3A,
SFTPA), but not for common club cells (CYP2F1, SCGB1A1). Moreover, BMP4 induced
gene expression of lung progenitor markers (NKX2.1, ITGA6). Mechanistically, BMP4
increased target genes downstream of Notch signaling (HEY1, HEY3) and TGF-β1
signaling (ID-1, SERPINE1). In conclusion, BMP4 promotes distal variant club cell
differentiation and suppresses proximal differentiation of goblet and ciliated cells.
Our findings provide a plausible connection between the loss of (variant) club cells
and increased goblet cell metaplasia and basal cell hyperplasia on one hand and
the observed reduction of BMP signaling in patients with COPD on the other hand.
Reactivation of BMP signaling in distal airway epithelium may be a strategy worth
pursuing to trigger differentiation and maintenance of distal variant club progenitor
cells capable of airway epithelial repair.
123
Introduction
In fetal and neonatal lung development, BMP signaling is crucial in governing
proximal-to-distal epithelial cell fate.1–3 Loss of BMP signaling in the developing
mouse lung leads to severe loss of distal epithelial cell types, whilst promoting the
presence of proximal epithelial cell types - even in the most distal airway regions.3 In
adult lung, it has been proposed that BMP signaling is involved in tissue repair and
that inappropriate BMP activation might contribute to adult respiratory diseases,
including asthma and COPD.2–4 Activation of BMP signaling in adult airway epithelium
after epithelial injury regenerates normal epithelial architecture in a similar pattern
as early lung development.5,6
The healthy epithelial lining of adult airways consists of a mixed population of
mucus-producing (MUC5AC+) goblet cells, (TEKT1+) ciliated cells, (TP63+) basal cells,
(SCGB1A1+/CYP2F+) club cells, and (SCGB3A2+/UPK3A+/SFTPA+) variant club cells.7,8
Goblet cells are normally expressed in the proximal airway epithelium, whereas
(variant) club cells are predominantly expressed in the distal airway epithelium. In
COPD, airway epithelial cell differentiation programs are inappropriately activated
with loss of functional club cells, increased goblet cell metaplasia, and basal cell
hyperplasia as key pathological features of airway epithelium in the disease.9–12 Low
levels of secretoglobin family 1A member 1 (SCGB1A1, also known as a club (formerly
clara) cell secretory protein CC10 or CC16) in serum and bronchoalveolar lavage have
been associated with the prevalence, severity and acceleration of a decline in forced
expiratory volume in one second (FEV1) in COPD in several studies.10,13–17 Goblet cell
metaplasia is characterized by increased numbers of goblet cells in the proximal
airways of COPD patients and by the appearance of goblet cells in more distal
airway regions that normally do not express these cells.9 Importantly, our previous
studies demonstrate that functional BMP4 signaling (Smad1/5/8 phosphorylation)
is reduced in COPD (Chapter 3), which could explain the change in proximal-to-distal
differentiation pattern.
The air-liquid interface (ALI) culture system provides a valuable tool to study
airway epithelial differentiation in vitro mimicking a polarized pseudostratified
epithelium.18,19 In ALI culture, the expression of the BMP4 gene is markedly increased
during mucociliary differentiation of adult airway epithelial cells.20 A recent study
demonstrates that BMP signaling is a negative regulator of basal progenitor cell
proliferation in mouse tracheal epithelium6 and BMP4 drives specification of adult
bronchoalveolar stem cells in mice,21 yet little is known about the role of BMP4 in
human airway epithelial cell differentiation. In addition, the underlying mechanisms
by which BMP exerts its effect in airway epithelial cell fate is still unclear.
In this study, we present evidence that BMP4 alters primary tracheobronchial
epithelial cells (PTECs) morphology and induces variant club cell marker gene
expression that is associated with high expression of distal epithelial and progenitor
markers. In parallel, BMP4 suppresses ciliated, goblet, and basal cell marker gene
expression. Our findings provide a plausible connection between the loss of (variant)
124
club cells and increased goblet cell metaplasia and basal cell hyperplasia on one
hand and the observed reduction of BMP signaling in patients with COPD on the
other. Restoring normal BMP signaling in distal airway epithelium may be a strategy
worth pursuing to trigger differentiation and maintenance of distal variant club
progenitor cells capable of airway epithelial repair.
Materials and methods
Air-liquid interface cultured primary tracheobronchial epithelial cells (ALI-PTEC)-
human PTECs were isolated from anonymous healthy lung transplant donors. Lung
transplant donors were selected according to Eurotransplant guidelines, including
absence of tumor and primary chronic lung diseases, such as asthma and COPD,
and with <20 pack years of smoking history. PTECs were expanded in submerged
culture using keratinocyte serum free medium (17005-075, Invitrogen, CA, USA)
supplemented with 25 µg/ml bovine pituitary extract and 0.2 ng/ml epidermal growth
factor (37000-015, Invitrogen, CA, USA). Generation of mucociliary differentiated
PTEC cultures was conducted using air-liquid interface (ALI) system as previously
described.22,23 Prior to cell seeding in the ALI culture system, transwell semipermeable
inserts were coated for 2 h at 37 °C with a mixture of 30 µg/ml PureCol (Advanced
BioMatrix, San Diego, CA, USA), 10 µg/ml human fibronectin, and 10 µg/ml BSA
(Sigma Aldrich, St. Louis, MO, USA) dissolved in PBS. Passage 1-2 of PTECs were
seeded on coated Transwell 12 mm in diameter inserts at a density of 75,000 cells
(Corning, New York, USA) and cultured in submerged condition using B/D medium
composed of 1:1 DMEM (41966-029, Invitrogen, CA, USA) and BEBM supplemented
with BEGM BulletKit singlequots excluding gentamicin (CC-3170, Lonza, Verviers,
Belgium) plus freshly added retinoic acid (50 nM) (R-2625, Sigma Aldrich; St. Louis,
MO, USA). For time course studies, fully confluent PTECs (~4 days) were air-exposed
in the absence or presence of 100 ng/ml recombinant human BMP4 (314-BP, R&D 7
system, Oxford, UK) in basal medium. RNA was extracted for real time quantitative
PCR (RT-qPCR) and cells were fixed and sectioned for immunocytochemistry at day
0, 4, 9, and 14. For concentration response studies, cells were air-exposed in the
absence or presence of 1, 10, 100 ng/ml recombinant human BMP4 (R&D system,
Oxford, UK) in basal medium for 14 days. For all experiments, the apical surface
was washed twice with PBS and freshly prepared BMP4-containing B/D medium was
added every 48 h. At day 14, RNA was extracted for RT-qPCR and cells were fixed for
immunocytochemistry (Figure 1A).
RNA isolation and RT-qPCR
Total RNA was extracted from ALI cultured cells using the NucleoSpin® RNA isolation
kit according to manufacturer’s instruction (Macherey Nagel; Düren, Germany).
The total RNA concentration was determined using the NanoDrop® ND1000
spectrophotometer (Thermo Scientific, Wilmington, MA). Equal amounts of total
RNA were reverse transcribed using the Reverse Transcription System (Promega;
125
Madison, WI, USA) to generate cDNA. Diluted cDNA was mixed with FastStart Immunocytochemistry
Universal SYBR Green Master Mix (Roche Applied Science; Penzberg, Germany) Cells were fixed on transwell inserts with 10% formalin and then paraffin-embedded
and gene-of-interest primer sets (Biolegio; Nijmegen, the Netherlands). Primer according to the ‘Costar® Transwell® Inserts for Histology preparation’ manufacturer’s
sequences are listed in Supplementary Table 1. Real-time quantitative PCR was procedure(Corning, New York, USA). Paraffin blocks were transversely cross-
performed using the Illumina Eco Personal qPCR System (Westburg; Leusden, The sectioned in 5 µm thick sections, which were fixed to glass slides for Hematoxylin
Netherlands). The qPCR reaction was started by denaturation at 95 °C for 15 minutes and eosinstaining (Sigma Aldrich; St. Louis, MO, USA). Sections were analysed using
followed by 45 cycles of denaturation at 94 °C for 30 s, annealing at 59 °C for 30 s a light microscope (Olympus BX41; Zoeterwoude, the Netherlands) using Cell^D
and elongation at 72 °C for 30 s. Final elongation was for 5 minutes at 72 °C. Real imaging software. Antibodies used were: SCGB3A (orb186085, Biorbyt, Cambridge,
time PCR data was analyzed using LinRegPCR software version 2013.1.24 Data were UK), UPK3A (HPA018415, Atlas antibody; Stockholm, Sweden), SFTPA (AB3420-I
expressed in arbitrary units as ratio of the starting concentration (N0) of each gene Millipore, Amsterdam-Zuidoost, the Netherlands).
of interest corrected to the geometric mean of the N0 value of 3 reference genes
(B2M, HPRT1, SDHA). Statistical analysis
Data are presented as mean ± standard error of the mean (SEM) of cultures
derived from 6 different donors. To determine the normality of data distribution, a
Supplementary Table 1: Primers used for RT-qPCR analysis Shapiro-Wilk normality test was performed prior to further statistical analysis. The
statistical significance of differences of normally distributed data was performed
Gene Forward primer (5’ 3’) Reverse primers (5’ 3’)
using an independent samples 2-tailed t-test for comparisons of 2 groups or a two-
TEKT1 GGCCAAGGTCATGGAAGAGAT ATCACGACACAGCTCCACG way ANOVA followed by a post hoc Tukey multiple comparisons test for comparing
MUC5AC CTGCCAGTCCTGCCTTTGTA GACCCTCCTCTCAATGGTGC more than 2 groups. For non-normally distributed data, statistical significance
TP63 CCTTACATCCAGCGTTTCGTAG TTTGTCTGTGTGCTCTGGGA
was determined using a non-parametric Mann-Whitney U test for comparing 2
groups or non-parametric one-way ANOVA with a post hoc Kruskal-Wallis multiple
UPK3A CGGTTCGGCTCGGCTG ATTCCTGGAAATGGCTGAGTCG
comparisons test for comparing more than 2 groups. Differences were considered to
SCGB3A2 TTACTCTGCTACTGCCTTCCTC CCTCCACAAGGTGCTCAACA be statistically significant at p<0.05.
SFTPA TGTGTGGGTCGCTGATTTCT GGGATACCAGGGCTTCCAAC
BMP4 AAGCGTAGCCCTAAGCATCA TGGTTGAGTTGAGGTGGTCA
Results
FSTL1 ACCACGATGTGGAAACGCTGGC TGCCATTACTGCCACACACAGGC
NOG TTCATGGCCACCTCGCCCCC ACTCTAGCCCTTTGATCTCG BMP4 negatively regulates pseudostratified epithelial differentiation in adult
SCGB1A1 CGTGTCATCGAAACCCTCCT GCTTTCTCTGGGCTTTTGGG human PTECs 7
CYP2F1 ACCCTCCTTAACACCGTCCA ATGGCGGTGAGGTACAGAAAG In comparison to untreated controls, BMP treated PTECs were characterized by
NKX2.1 CGCTCATTTGTTGGCGACTG CACTGAGAACGGAGTCGTGT
enlarged cell cytoplasm following 14-days of differentiation as evident by light mi-
croscopy (Figure 1B). Higher concentrations of BMP4 were associated with more
ITGA6 GCCAAAGATACTAGTGCCAAAGC CTTGAGGATCACCTACATAGAGCG
expanded cell cytoplasm compared to controls at day 14 (Figure 1C). A bilayer of
HEY1 GTAGTTAACTCCTCCCTGCCC GGGGACATGGAACCTAGAGC cells was observed in a cross-section of the submerged cultures of PTEC-controls at
HEY3 CTGCGTTCGCCATGAAGC GTTTCTCTATGATCCCTCTGCGT day 0. After 14 days of air exposure, cells formed polarized pseudostratified layers
HPRT1 AAGCCAGACTTTGTTGGATTTGA ACTGGCGATGTCAATAGGACTC with the luminal part covered with cells with a ciliated-like phenotype starting from
SDHA GGGAAGACTACAAGGTGCGG CTCCAGTGCTCCTCAAAGGG day 9 onwards in PTEC-controls. Strikingly, pseudostratified epithelium with ciliated
cells at the luminal side was not observed in BMP4 treated PTECs. Instead, a thin
B2M AAGCAGCATCATGGAGGTTTG AAGCAAGCAAGCAGAATTTGGA
single epithelial cell layer was observed at day 14 (Figure 1D). BMP4 treatment was
Abbreviations used: TEKT1, tektin-1; MUC5AC, mucin 5AC;TP63, tumor protein 63; UPK3A, associated with flattening of cuboidal epithelial cells (Figure 1E). These observations
uroplakin 3A; SCGB3A2, secretoglobin family 3A member 2; SFTPA, surfactant protein A; indicate that BMP4 inhibits normal pseudostratified epithelial differentiation and in-
BMP4, bone morphogenetic protein 4; FSTL1, follistatin-like 1; NOG, noggin; SCGB1A1, stead induces differentiation of a single layered epithelium with enlarged cytoplasm
secretoglobin family 1A member 1; CYP2F1, cytochrome P450 family 2 subfamily F member
1; NKX2.1,NK2 homeobox 1; ITGA6, integrin α6; HEY, hes-related family BHLH transcription in adult human PTECs.
factor with YRPW motif; HPRT1, hypoxanthine guanine phosphoribosyl transferase 1; SDHA,
succinate dehydrogenase complex flavoprotein subunit A; and B2M, β2-microglobulin.

126 127
 BMP4 negatively regulates gene expression of ciliated, goblet, and basal cell
markers in adult human PTECs
To characterize the phenotype of the BMP4 induced cells in more detail, expression
of mRNA for markers of epithelial cell types, including ciliated, goblet, and basal
cells, was examined at days 0, 4, 9 and 14 of ALI culture. In PTEC-controls, the ciliated
cell marker Tektin-1 (p<0.05; Figure 2A,D) and the goblet cell marker MUC5AC
(p<0.05; Figure 2B,E) were significantly increased over time, whereas the basal cell

D. Cross sectioned view E.

Control BMP4 BMP4

Day 0 0 ng/ml
100 µm
100 µm
7
Day 4 1 ng/ml
100 µm 100 µm
100 µm

Day 9 10 ng/ml
100 µm
100 µm
100 µm

Day 14 100 ng/ml

100 µm 100 µm

100 µm

Figure 1. BMP4 inhibits pseudostratified epithelial differentiation in adult human PTECs.

(A) A schematic diagram of air-liquid-interface (ALI) culture model. (B) Representative top
view images of 100 ng/ml BMP4-treated PTECs morphology overtime and (C) in responses to
different concentrations of BMP4 (1; 10; 100 ng/ml) at 14 days compared to PTEC-controls.
Magnification 100x. Scale bars represent 500 µm. (D) Representative cross sectional images
of H&E staining of 100 ng/ml BMP4-treated PTECs morphology overtime and (E) in responses
to different concentrations of BMP4 (1, 10 and 100 ng/ml) at 14 days compared to PTEC-
controls. Magnification 200x. Scale bars represent 100 µm. Images were taken using a light
microscope in each well of 6 independent experiments from 6 different donors.
Figure 2. BMP4 inhibits gene expression of ciliated, goblet, and basal cell markers in adult
human PTECs. Time-response effects of vehicle or BMP4 (100 ng/ml) on mRNA expression
of theciliated cell marker Tektin-1 (A), the goblet cell marker MUC5AC (B), and the basal
cell marker TP63 (C) in PTECs. Concentration response effects of BMP4 (1,10 and 100 ng/
ml) on mRNA expression of Tektin-1 (D), MUC5AC (E), and TP63 (F) in PTECs at Day 14. Data
represent mean ± SEM in arbitrary units of 6 independent experiments from 6 different
donors. *p<0.05 and **p<0.01 compared to time-matched PTEC-controls; #p<0.05 and
##
p<0.01 compared to Day 0 PTEC-controls; $p<0.05 and $$p<0.01 compared to day 14 PTEC-
controls; ns = not significant.

128 129
marker TP63 was significantly reduced (p<0.01; Figure 2C,F). Expression of mRNA
for markersof ciliated (Tektin-1), goblet (MUC5AC), and basal (TP63) cells was
reduced in BMP4-treated PTECs compared to controls at corresponding time points
(Figure 2A-C) and in response to different concentrations of BMP4 (Figure 2D-F).
These observations demonstrate that BMP4 represses goblet, ciliated, and basal cell
marker gene expression.

BMP4 induces variant club cell marker gene expression in adult human PTECs
Next, we studied the effects of BMP4 on club cells by determining the gene expression
of common (SCGB1A1, CYP2F1) and distal variant club cell markers (UPK3A, SCGB3A2,
SFTPA). In PTEC-controls, the mRNA expression of SCGB1A1, UPK3A (uroplakin
A), SCGB3A2 (secretoglobin 3A2), and SFTPA (surfactant protein A) was unaltered
(Figure 3A, C-E) whereas a time-dependent increase of CYP2F1 (p<0.01; Figure 3B)
was observed. In PTECs treated with BMP4, the mRNA expression of SCGB1A1 was
unaffected (Figure 3A), whereas CYP2F1 was significantly suppressed (p<0.01; Figure
3B). Intriguingly, the mRNA expression of variant club cell markers, including uroplakin
3A (p<0.05; Figure 3C), secretoglobin 3A2 (p<0.05; Figure 3D), and surfactant protein
A (p<0.01; Figure 3E) was markedly upregulatedby BMP4 during the 14 day period.
To confirm these findings, increasing concentrations of BMP4 were used to treat
PTECs for 14 days. As observed before, BMP4 did not alter SCGB1A1 (Figure 3F)
but significantly suppressed CYP2F1 (p<0.001; Figure 3G) mRNA expression in PTECs
treated with increasing concentrations of BMP4. Likewise, mRNA expression for the
distal variant club cell marker uroplakin 3A (p<0.001; Figure 3H), secretoglobin 3A2
(p<0.05; Figure 3I) and surfactant protein A (p<0.01; Figure 3J) were concentration-
dependently induced by BMP4 in PTECs. Taken together, these results demonstrate
that BMP4 suppresses marker gene expression for common club cells and promotes
markers for distal variant club cells in adult human PTECs.
7

Figure 3. BMP4 promotes variant club cell marker gene expression in adult human PTECs.
Time-response effects of vehicle or BMP4 (100 ng/ml) on mRNA expression of the common
club cell markers SCGB1A1 (A) and CYP2F1 (B), and the variant club cell markers uroplakin
3A (UPK3A; C), secretoglobin 3A2 (SGB3A2; D) and surfactant protein A (SFTPA; E) in PTECs.
Concentration response effects of BMP4 (1, 10 and 100 ng/ml) on mRNA expression of
SCGB1A1 (F), CYP2F1 (G), uroplakin 3A (H), secretoglobin 3A2 (I) and surfactant protein
A (J) in PTECs at Day 14. Data represent mean ± SEM in arbitrary units of 6 independent
experiments from 6 different donors. *p<0.05 and **p<0.01 compared to time-matched
PTEC-controls; ##p<0.01 compared to Day 0 PTEC-controls; $p<0.05 and $$p<0.01 compared
to Day 14 PTEC-controls; ns = not significant.

130 131
BMP4 induces time- and concentration-dependent increased of its own antagonist
Fstl1 during epithelial differentiation
To investigate the underlying mechanism of BMP4 in adult epithelial differentiation,
we explored the expression of BMP4 and its endogenous antagonists, FSTL1 and
Noggin. A previous study showed upregulation of BMP4 expression during epithelial
differentiation in ALI culture.20 In line with this, we observed that the mRNA
expression of BMP4 was upregulated in a time-dependent manner (p<0.01; Figure
4A) in PTEC-controls. Interestingly, BMP4 treatment significantly inhibited its own
gene transcription as evident by lower BMP4 mRNA levels (p<0.05; Figure 4A and
4D). The mRNA expression of FSTL1 was significantly reduced (P<0.05; Figure 4B)
whereas Noggin was unaltered (Figure 4C) after 14 days of air exposure. BMP4
concentration dependently increased mRNA expression of FSTL1 (P<0.01; Figure
4E), but not of Noggin (Figure 4F) at day 14.

BMP4 may regulate dedifferentiation of adult lung epithelial cells by modulating
expression of progenitor markers
At early stages of embryonic lung development, active BMP signaling is evident in
lung buds, which predominantly consist of lung-specific progenitor cells. Involvement
of BMP signaling in differentiation of lung progenitor cells from stem cells has been
reported.2 To address the question whether the expression of lung progenitor
markers in adult human PTECs is affected by BMP4, we determined the mRNA
expression of the lung progenitor markers NKX2.1 and ITGA6. In PTEC-controls,the
mRNA expression of NKX2.1 (p<0.01; Figure 5A) and ITGA6 (p<0.001; Figure 5B)
was significantly reduced over time, which was prevented by BMP4 (p<0.01 and
p<0.001; Figure 5A,B) in a concentration-dependent manner (Figure 5C,D). These
observations suggest that BMP4 modulates gene expression of lung progenitor
markers in adult human PTECs.
7
BMP4 induces Notch target gene expression during epithelial cell differentiation
To shed light on a possible mechanisms involved in BMP4-regulated distal variant
club cell differentiation, we examined the expression of Notch target genes (HEY1
and HEY3) and TGF-β1 target genes (ID-1 and SERPINE1) as previous studies sug-
gest that these genes are downstream target of active BMP signaling in pulmonary Figure 4. BMP4 induces gene expression of its antagonist Fstl1 in adult human PTECs
time and concentration dependently. Time-response effects of vehicle or BMP4 (100 ng/
cells.25,26 In PTEC-controls, a significant increase in mRNA expression of HEY1 (p<0.05; ml) on mRNA expression of BMP4 (A), FSTL1 (B), and Noggin (C) in PTECs. Concentration
Figure 6A) and ID-1 (p<0.05; Figure 6C), was observed, whereas HEY3 was unaltered response effects of BMP4 (1, 10 and 100 ng/ml) on mRNA expression of BMP4 (D), FSTL1
(Figure 6B) and SERPINE1 decreased (p<0.01; Figure 6D) over the course of 14 days (E), and Noggin (F) in PTECs at Day 14. Data represent mean ± SEM in arbitrary units of 6
independent experiments from 6 different donors. *p<0.05 and **p<0.01 compared to time-
of differentiation. BMP4 significantly induced mRNA expression of HEY1, HEY3, ID- matched PTEC-controls; #p<0.05 and ##p<0.01 compared to Day 0 PTEC-controls; $p<0.05
1, and SERPINE1 (p<0.01 all; Figure 6A-D) in a concentration-dependently manner and $$p<0.01 compared to Day 14 PTEC-controls.
(p<0.001; Figure 6G-H). These data suggest that both Notch and TGF-β signaling are
downstream of BMP4.

132 133
Figure 5. BMP4 induces gene expression of lung progenitor cell markers in adult human
PTECs. Time-response effects of vehicle or BMP4 (100 ng/ml) on mRNA expression ofNKX2.1
transcription factor(A) and integrin subunit α6 (B) in PTECs. Concentration response effects of
BMP4 (1; 10; 100 ng/ml) on mRNA expression of NKX2.1 transcription factor(C) and integrin
subunit α6 (D) in PTECs. Data represent mean ± SEM in arbitrary units of 6 independent 7
experiments from 6 different donors. *p<0.05, **p<0.01 and ***p<0.001 compared to time-
matched non-treated controls. #p<0.05, ##p<0.01 and ###p<0.001 compared to Day 0 PTEC-
controls; $p<0.05 and $$p<0.01 compared to Day 14 PTEC-controls.

Figure 6. BMP increases Notch and TGF target gene expression in adult human PTECs.
Time-response effects of vehicle or BMP4 (100 ng/ml) on mRNA expression of Notch targets
HEY1 (A) and HEY3 (B) and of TGF-β1 targets ID-1 (C) and SERPINE1 (D) in PTECs. Concentra-
tion response effects of BMP4 (1, 10 and 100 ng/ml) on mRNA expression of HEY1 (E), HEY3
(F), ID-1 (G) and SERPINE1 (H) in PTECs at Day 14. Data represent mean ± SEM in arbitrary
units of 6 independent experiments from 6 different donors. **p<0.01 and ***p<0.001 com-
pared to time-matched PTEC-controls; #p<0.05, ##p<0.01 compared to Day 0 PTEC-controls;
$p<0.05, $$p<0.01 and $$$p<0.001compared to Day 14 PTEC-controls.

134 135
 Table 1. Summary
BMP4 induces distal variant club cell differentiation in adult human airway Characteristics Control BMP4
epithelium Pseudostratified Widened, flatten
To confirm that BMP4 inhibits goblet cell differentiation and promotes variant Morphology
columnar cells
club cell differentiation, periodic acid schiff (PAS) staining and immunostaining for TEKT1 + - Ciliated cell marker
distal variant club cell markers (SCGB3A/SFTPA) were performed, respectively. PAS MUC5AC + - Goblet cell marker
staining on cross-sections of PTEC-controls showed more intense staining intensity TP63 - - Basal cell marker
compared to BMP4 treated cells at day 14 (Figure 7A). In contrast, the expression of SCGB1A1 - -
distal variant club cell markers was more apparent in BMP4 treated cells compared CYP2F1 + -
Common club cell markers
Gene
to PTEC-controls at 14 days (Figure 7B). Taken together, these findings indicate that expression UPK3A - +
BMP4 may drive epithelial differentiation toward distal variant club cells in adult
SCGB3A - + Variant club cell markers
human PTECs. The observed mRNA expression profile of PTECs treated for 14 days
SFTPA - +
with or without BMP4 is summarized in Table 1.
NKX2.1 - +
Progenitor cell markers
ITGA6 - +
Abbreviations used: TEKT1, tektin-1; MUC5AC, mucin 5AC;TP63, tumor protein 63; SCGB1A1,
secretoglobin family 1A member 1; CYP2F1, cytochrome P450 family 2 subfamily F member
1; UPK3A, uroplakin 3A; SCGB3A2, secretoglobin family 3A member 2; SFTPA, surfactant
protein A; NKX2.1,NK2 homeobox 1; and ITGA6, integrin α6.

Acknowledgements
This study was financially supported by a grant from the Netherlands Lung Foundation
(grant 3.2.12.083).

Conflict of interests
The authors declare no financial conflict of interests.

Author contributions 7
NPT and RG conceived the study and designed the experiments. NPT carried out the
experiments, analyzed the data, and drafted the manuscript. FE performed some
experiments and analyzed the data. All co-authors approved the final version of the
manuscript.
Figure 7. BMP4 inhibits goblet cells and promotes distal variant club cell differentiation
in adult human PTECs. Representative images of PTEC-BMP4 compared to PTEC-controls
stained using periodic acid-schiff (PAS, A) or the variant club cell markers secretoglobin 3A2
or surfactant protein A (B) at Day 14. Magnification 200x. Scale bars represent 100 µm.

136 137
References
1. Bellusci S, Henderson R, Winnier G, Oikawa T, Hogan BL. Evidence from normal expression
and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse
embryonic lung morphogenesis. Dev Camb Engl. 1996;122(6):1693-1702.
2. Sountoulidis A, Stavropoulos A, Giaglis S, et al. Activation of the canonical bone morphogenetic
protein (BMP) pathway during lung morphogenesis and adult lung tissue repair. PloS One.
2012;7(8):e41460. doi:10.1371/journal.pone.0041460.
3. Weaver M, Yingling JM, Dunn NR, Bellusci S, Hogan BL. Bmp signaling regulates proximal-distal
differentiation of endoderm in mouse lung development. Dev Camb Engl. 1999;126(18):4005-
4015.
4. Warburton D, Bellusci S. The molecular genetics of lung morphogenesis and injury repair.
Paediatr Respir Rev. 2004;5 Suppl A:S283-287.
5. Shi W, Chen F, Cardoso WV. Mechanisms of lung development: contribution to adult lung disease
and relevance to chronic obstructive pulmonary disease. Proc Am Thorac Soc. 2009;6(7):558-
563. doi:10.1513/pats.200905-031RM.
6. Tadokoro T, Gao X, Hong CC, Hotten D, Hogan BLM. BMP signaling and cellular dynamics during
regeneration of airway epithelium from basal progenitors. Dev Camb Engl. 2016;143(5):764-773.
doi:10.1242/dev.126656.
7. Kotton DN, Morrisey EE. Lung regeneration: mechanisms, applications and emerging stem cell
populations. Nat Med. 2014;20(8):822-832. doi:10.1038/nm.3642.
8. Li F, He J, Wei J, Cho WC, Liu X. Diversity of Epithelial Stem Cell Types in Adult Lung. Stem Cells
Int. 2015;2015:e728307. doi:10.1155/2015/728307.
9. Saetta M, Turato G, Baraldo S, et al. Goblet cell hyperplasia and epithelial inflammation
in peripheral airways of smokers with both symptoms of chronic bronchitis and chronic
airflow limitation. Am J Respir Crit Care Med. 2000;161(3 Pt 1):1016-1021. doi:10.1164/
ajrccm.161.3.9907080.
10. Pilette C, Godding V, Kiss R, et al. Reduced epithelial expression of secretory component in small
airways correlates with airflow obstruction in chronic obstructive pulmonary disease. Am J
Respir Crit Care Med. 2001;163(1):185-194. doi:10.1164/ajrccm.163.1.9912137.
11. Gamez AS, Gras D, Petit A, et al. Supplementing defect in club cell secretory protein attenuates
airway inflammation in COPD. Chest. 2015;147(6):1467-1476. doi:10.1378/chest.14-1174.
12. Shaykhiev R, Crystal RG. Early events in the pathogenesis of chronic obstructive pulmonary
disease. Smoking-induced reprogramming of airway epithelial basal progenitor cells. Ann Am
Thorac Soc. 2014;11 Suppl 5:S252-258. doi:10.1513/AnnalsATS.201402-049AW.
13. Bernard A, Marchandise FX, Depelchin S, Lauwerys R, Sibille Y. Clara cell protein in serum and
bronchoalveolar lavage. Eur Respir J. 1992;5(10):1231-1238.
14. Vestbo J, Edwards LD, Scanlon PD, et al. Changes in Forced Expiratory Volume in 1 Second over
Time in COPD. N Engl J Med. 2011;365(13):1184-1192. doi:10.1056/NEJMoa1105482.
15. Park HY, Churg A, Wright JL, et al. Club cell protein 16 and disease progression in chronic
obstructive pulmonary disease. Am J Respir Crit Care Med. 2013;188(12):1413-1419.
doi:10.1164/rccm.201305-0892OC.
16. Lomas DA, Silverman EK, Edwards LD, et al. Evaluation of serum CC-16 as a biomarker for COPD
in the ECLIPSE cohort. Thorax. 2008;63(12):1058-1063. doi:10.1136/thx.2008.102574.
17. Guerra S, Halonen M, Vasquez MM, et al. The relation of circulating CC16 to lung function growth,
decline, and development of COPD across the lifespan. Lancet Respir Med. 2015;3(8):613-620.
doi:10.1016/S2213-2600(15)00196-4.
18. Kaartinen L, Nettesheim P, Adler KB, Randell SH. Rat tracheal epithelial cell differentiation in
vitro. In Vitro Cell Dev Biol Anim. 1993;29A(6):481-492.
19. Whitcutt MJ, Adler KB, Wu R. A biphasic chamber system for maintaining polarity of
differentiation of cultured respiratory tract epithelial cells. Vitro Cell Dev Biol J Tissue Cult Assoc.
1988;24(5):420-428.
20. Ross AJ, Dailey LA, Brighton LE, Devlin RB. Transcriptional profiling of mucociliary differentiation
in human airway epithelial cells. Am J Respir Cell Mol Biol. 2007;37(2):169-185. doi:10.1165/
rcmb.2006-0466OC.
21. Lee J-H, Bhang DH, Beede A, et al. Lung stem cell differentiation in mice directed by endothelial
138
cells via a BMP4-NFATc1-thrombospondin-1 axis. Cell. 2014;156(3):440-455. doi:10.1016/j.
cell.2013.12.039.
22. Mertens TCJ, Hiemstra PS, Taube C. Azithromycin differentially affects the IL-13-induced
expression profile in human bronchial epithelial cells. Pulm Pharmacol Ther. 2016;39:14-20.
doi:10.1016/j.pupt.2016.05.005.
23. Amatngalim GD, van Wijck Y, de Mooij-Eijk Y, et al. Basal cells contribute to innate immunity
of the airway epithelium through production of the antimicrobial protein RNase 7. J Immunol
Baltim Md 1950. 2015;194(7):3340-3350. doi:10.4049/jimmunol.1402169.
24. Ruijter JM, Ramakers C, Hoogaars WMH, et al. Amplification efficiency: linking baseline and bias
in the analysis of quantitative PCR data. Nucleic Acids Res. 2009;37(6):e45. doi:10.1093/nar/
gkp045.
25. Rock JR, Gao X, Xue Y, Randell SH, Kong Y-Y, Hogan BLM. Notch-Dependent Differentiation of Adult
Airway Basal Stem Cells. Cell Stem Cell. 2011;8(6):639-648. doi:10.1016/j.stem.2011.04.003.
26. Cibois M, Luxardi G, Chevalier B, et al. BMP signalling controls the construction of vertebrate
mucociliary epithelia. Development. 2015;142(13):2352-2363. doi:10.1242/dev.118679.
27. Rackley CR, Stripp BR. Building and maintaining the epithelium of the lung. J Clin Invest.
2012;122(8):2724-2730. doi:10.1172/JCI60519.
28. Wells JM, Melton DA. Early mouse endoderm is patterned by soluble factors from adjacent germ
layers. Dev Camb Engl. 2000;127(8):1563-1572.
29. Mou H, Vinarsky V, Tata PR, et al. Dual SMAD Signaling Inhibition Enables Long-Term
Expansion of Diverse Epithelial Basal Cells. Cell Stem Cell. 2016;19(2):217-231. doi:10.1016/j.
stem.2016.05.012.
30. Reynolds SD, Giangreco A, Power JH, Stripp BR. Neuroepithelial bodies of pulmonary airways
serve as a reservoir of progenitor cells capable of epithelial regeneration. Am J Pathol.
2000;156(1):269-278. doi:10.1016/S0002-9440(10)64727-X.
31. Barnes PJ. CLub cells, their secretory protein, and copd. Chest. 2015;147(6):1447-1448.
doi:10.1378/chest.14-3171.
32. Shijubo N, Itoh Y, Yamaguchi T, et al. Clara cell protein-positive epithelial cells are reduced in
small airways of asthmatics. Am J Respir Crit Care Med. 1999;160(3):930-933. doi:10.1164/
ajrccm.160.3.9803113.
33. Rokicki W, Rokicki M, Wojtacha J, Dżeljijli A. The role and importance of club cells (Clara cells) in
the pathogenesis of some respiratory diseases. Kardiochirurgia Torakochirurgia Pol Pol J Cardio-
Thorac Surg. 2016;13(1):26-30. doi:10.5114/kitp.2016.58961.
34. Myllärniemi M, Lindholm P, Ryynänen MJ, et al. Gremlin-mediated decrease in bone
morphogenetic protein signaling promotes pulmonary fibrosis. Am J Respir Crit Care Med.
2008;177(3):321-329. doi:10.1164/rccm.200706-945OC.
7
35. De Langhe E, Cailotto F, De Vooght V, et al. Enhanced endogenous bone morphogenetic protein
signaling protects against bleomycin induced pulmonary fibrosis. Respir Res. 2015;16:38.
doi:10.1186/s12931-015-0202-x.
36. Dong Y, Geng Y, Li L, et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary
fibrosis in mice. J Exp Med. 2015;212(2):235-252. doi:10.1084/jem.20121878.
37. Miller M, Beppu A, Rosenthal P, et al. Fstl1 Promotes Asthmatic Airway Remodeling by
Inducing Oncostatin M. J Immunol Baltim Md 1950. 2015;195(8):3546-3556. doi:10.4049/
jimmunol.1501105.
38. Murphy N, Gaynor KU, Rowan SC, et al. Altered Expression of Bone Morphogenetic Protein
Accessory Proteins in Murine and Human Pulmonary Fibrosis. Am J Pathol. 2016;186(3):600-
615. doi:10.1016/j.ajpath.2015.10.032.
39. Miller M, Esnault S, Kurten RC, et al. Segmental allergen challenge increases levels of airway
follistatin-like 1 in patients with asthma. J Allergy Clin Immunol. 2016;138(2):596-599.e4.
doi:10.1016/j.jaci.2016.01.019.
40. Liu M, Liu R, Wu H, et al. Radix puerariae extracts ameliorate paraquat-induced pulmonary
fibrosis by attenuating follistatin-like 1 and nuclear factor erythroid 2p45-related factor-2
signalling pathways through downregulation of miRNA-21 expression. BMC Complement Altern
Med. 2016;16:11. doi:10.1186/s12906-016-0991-6.
41. Sylva M, Li VSW, Buffing AAA, et al. The BMP antagonist follistatin-like 1 is required for skeletal
139
 and lung organogenesis. PloS One. 2011;6(8):e22616. doi:10.1371/journal.pone.0022616.
42. Geng Y, Dong Y, Yu M, et al. Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP)
4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A.
2011;108(17):7058-7063. doi:10.1073/pnas.1007293108.
43. Maeda Y, Chen G, Xu Y, et al. Airway epithelial transcription factor NK2 homeobox 1 inhibits
mucous cell metaplasia and Th2 inflammation. Am J Respir Crit Care Med. 2011;184(4):421-429.
doi:10.1164/rccm.201101-0106OC.
44. Chapman HA, Li X, Alexander JP, et al. Integrin α6β4 identifies an adult distal lung epithelial
population with regenerative potential in mice. J Clin Invest. 2011;121(7):2855-2862.
doi:10.1172/JCI57673.
45. Guha A, Vasconcelos M, Cai Y, et al. Neuroepithelial body microenvironment is a niche
for a distinct subset of Clara-like precursors in the developing airways. Proc Natl Acad Sci.
2012;109(31):12592-12597. doi:10.1073/pnas.1204710109.
46. Paul MK, Bisht B, Darmawan DO, et al. Dynamic changes in intracellular ROS levels regulate
airway basal stem cell homeostasis through Nrf2-dependent Notch signaling. Cell Stem Cell.
2014;15(2):199-214. doi:10.1016/j.stem.2014.05.009.
47. Lafkas D, Shelton A, Chiu C, et al. Therapeutic antibodies reveal Notch control of transdifferentiation
in the adult lung. Nature. 2015;528(7580):127-131. doi:10.1038/nature15715.

140 141
 CHAPTER 8 1

GENERAL DISCUSSION AND

SUMMARY

143
Preface
Chronic obstructive pulmonary disease (COPD) is characterized by progressive
irreversible airflow obstruction in which excessive and persistent inflammation
of the airways plays an important role. As outlined in the general introduction
(Chapter 1), the proper balance between bone morphogenetic protein-4 (BMP4)
and its endogenous inhibitor Follistatin-like 1 (Fstl1) is crucial for normal embryonic
lung morphogenesis1,2 and in adult steady-state conditions for proper biological
functions.3–5 The immunomodulatory functions of Fstl1 has been studied in various
inflammatory diseases.6–8 However, the functional role of Fstl1 in postnatal lung
development and COPD lungs has not been previously explored. Recently, several
studies demonstrated the involvement of Fstl1 in pulmonary fibrosis and severe
allergic asthma.9–13 Our studies described in this thesis reveal that Fstl1 is required for
pulmonary vascular development postnatally (Chapter 2). In addition, we show that
Fstl1 protein expression is increased in airway epithelium of COPD patients (Chapter
3). Addressing the potential implications of increased Fstl1 expression in airway
epithelium, we found Fstl1 to be a pro-inflammatory mediator of airway epithelial-
driven inflammation (Chapter 5). Furthermore, we found that BMP4 signaling
regulates variant club cell differentiation in adult airway epithelium (Chapter 7).
1. The role of Fstl1 in lung development
The development of the lung is orchestrated by tight temporal and spatial control
of multiple signaling pathways to form functional airway and vascular systems.
BMP signaling is essential in dynamic processes of vessel growth and maturation,
by governing vascular smooth muscle and endothelial cell proliferation and
migration.14–19 Highly coordinated regulation of BMP signaling is essential for proper
airway and vascular tree branching during lung development to enable proper lung
functioning.20 Several genetic vascular diseases have been linked with aberrant BMP
signaling, including familial pulmonary arterial hypertension (PAH).18,21–28 In line
with such a central role for BMP signaling, whole body Fstl1 knockout (Fstl1-KO)
mice display a smaller lung morphology and thickening of the alveolar septa. Fstl1-
KO mice suffer from respiratory distress and died shortly after birth,1,2 indicating
that Fstl1 is required for lung morphogenesis and alveolarization. Intriguingly, we
found that mice with endothelial-specific Fstl1 deletion (Fstl1-eKO) also suffered
from respiratory distress and died 3 weeks after birth (Chapter 2). Postnatal lethality
of the Fstl1-eKO mice suggests a significant role of endothelial Fstl1 in postnatal
pulmonary vasculature development to support proper neonatal development,
including the lung. Fstl1-eKO mice died at postnatal day 21 which is around the
alveolar stage of lung development at postnatal days of 5-30, which is critical for
alveolar and vascular network formation and maturation.20,29 Branching of the
airway and vascular network must be coordinated to optimize exposure of blood
to oxygen.20 The formation of the distal small pulmonary vascular network may be
disrupted in Fstl1-eKO mice and result in respiratory distress (Chapter 2).
144
Although minimal pulmonary vascular remodeling was observed in large
muscular and elastic arteries in Fstl1-eKO mice, we found increased percentages
of actin positive small pulmonary vessels at the later stages of development at
postnatal day 21 (Chapter 2). In addition, we found that the right ventricular
output was decreased in Fstl1-eKO mice at later stages of pulmonary development,
as determined by an echocardiography (Chapter 2). Furthermore, analysis of the
underlying mechanisms leading to the lethality of Fstl1-eKO mice reveals that
phosphorylated Smad1/5/8 - an indicator of active BMP signaling - and BMP-
regulated proteins (Jagged1, endoglin, and endothelin-1) are increased at the
early stages of development at postnatal day 7 (Chapter 2). A dynamic regulation
of vasoconstriction is synergistically controlled by molecular changes, including an
increase in endothelin-1 release30,31 and/or morphological changes in smooth muscle
tissues, including an increase in α-smooth muscle actin and increased proliferation
of vascular smooth muscle cells.32,33
In wildtype mice, a transition between a molecular to a morphological regulation
of vasoconstriction was observed (Chapter 2). Increased protein expression of
endothelin-1 simultaneously occurred with decreased percentages of actin positive
small vessels at postnatal day 14 compared to day 7. This transition was normal
and non-lethal (Chapter 2). However in the Fstl1-eKO mice, the protein expression
of endothelin-1 was already high at postnatal day 7 and remained high at day 21
whereas the percentages of actin positive vessels did not decrease by postnatal
day 21 (Chapter 2). The combination of a high endothelin-1 expression and a high
percentage of actin positive small pulmonary vessels may lead to an increase in
pulmonary vascular resistance due to vasoconstriction (Chapter 2). However,
no difference was observed in the pulmonary vascular resistance as reflected by
the ratio of pulmonary acceleration time over ejection time (PAT/ET) in Fstl1-eKO
mice compared to age-matched controls either at postnatal day 7 or 21 (Chapter
2). The pulmonary vascular resistance was measured in pulmonary valves of the
large pulmonary arteries where there was no pulmonary stenosis observed during
echocardiography measurement in Fstl1-eKO mice. This may reflect very early stages
of pulmonary vascular dysfunction in Fstl1-eKO mice. Interestingly, such phenotype
is commonly observed in patients with PAH, where physiological and structural
8
changes are initiated by molecular changes in BMP signaling followed by vascular
dysfunction and remodeling at later stages of the disease.34 It is likely that an increase
of the vascular resistance occurs at the site of actin remodeling in small pulmonary
vessels, due to resistance being a function of 1/r4 (according to Hagen-Poiseuille
law), where “r” is the diameter of the vessel lumen.35
In Fstl1-eKO mice, increased pulmonary levels of endothelin-1 at postnatal day
7 may transiently increase pulmonary vascular resistance. Since pulmonary arteries
are connected to the heart, this initial increase in pulmonary vascular resistanceleads
to a decrease in right ventricular output to the lung at postnatal day 21 (Chapter
2). Consequently, morphological changes were observed in the heart and lungs of
Fstl1-eKO mice at postnatal day 21 such as right ventricle hypertrophy and small
pulmonary vascular remodeling, respectively (Chapter 2). The progressive and
145
irreversible defects in cardiopulmonary structures in Fstl1-eKO mice may contribute
to the respiratory distress, presumably because the remodeled small pulmonary
vessels are unable to adequately carry blood to the lungs. These may lead to a lack of
oxygen delivery to the brain and ultimately death. Therefore, it would be interesting
to examine the levels of oxygen and carbon dioxide in the blood in addition to
determine the radius and the actin content of small pulmonary vessels in the follow
up studies. Altogether, it is tempting to speculate that molecular changes in Fstl1-
eKO mice are transient and initiated earlier during postnatal development whereas
physiological functions and morphological consequences may manifest at later stages
of postnatal development. An alternative explanation could be that dysregulation of
BMP signaling by itself may not be adequate to affect structure and functions of
large pulmonary vasculature at early stages of development, but instead is more
pronounced at later stages of development. It is also possible that the molecular and
morphological changes in the lungs are a secondary consequence of the right heart
dysfunction due to thickening/muscularization of the right ventricle. The thickened
right ventricle could be associated with reduced right ventricular output that leads
to lung hypoxia. As consequences, the percentages of actin positive small vessels did
not decrease whilst the expression of endothelin-1 was high in the lungs at postnatal
day 21 to push the blood flow through the pulmonary capillaries to meet the oxygen
demand. It would be worthwhile in future studies to dissect cardiovascular structure
and functions in Fstl1-eKO mice to confirm the main cause of death of Fstl1-eKO mice
in addition to revealing what the function of Fstl1 is in cardiovascular system. The
developmental role of endothelial Fstl1 in modulating BMP/Smad signaling during
postnatal development of pulmonary vasculature is illustrated in Figure 1.

2. The role of Fstl1 in airway inflammation in COPD

One of the hallmarks of COPD pathogenesis is the exaggerated activation of the
innate immune system and abnormal tissue repair in response to long term
exposure to pneumotoxic inhaled pollutants, such as cigarette smoke. In turn, this
leads to airway epithelial remodeling and physiological changes which consequently
contribute to the not fully reversible airflow limitation.36,37 As a first barrier to the
external milieu, airway epithelium secretes inflammatory mediators with paracrine
effects on neighboring mesenchymal cells, including lung fibroblasts and airway
smooth muscle cells. Interestingly, a role for Fstl1 in cell-cell communication has
been previously reported.6,9 A growing body of evidence indicates pro-inflammatory
roles of Fstl1 in mediating secretion of inflammatory cytokine in the pathogenesis of
several inflammatory diseases and in worsening the symptoms of these diseases.6,7,38
However, the link between Fstl1 and COPD pathogenesis has not been explored
previously.
Our studies on the expression of Fstl1 in COPD demonstrated that Fstl1 expression
was markedly increased in lung homogenates of non-COPD smokers and both stage II
and IV COPD patients compared to individuals without airflow obstruction (Chapter
3). Further examination on lung tissue of COPD patients revealed that Fstl1 protein
Figure 1. The developmental role of endothelial Follistatin-like 1 in modulating BMP/
Smad signaling during postnatal development of pulmonary vasculature. In the presence
of endothelial Fstl1 in the wildtype mice, BMP-induced phosphorylation of Smad1/5 and
subsequent downstream target genes are maintained for normal endothelial function
and vascular homeostasis. Deletion of endothelial Fstl1 in Fstl1-eKO mice is associated 8
with overactivation of BMP-induced phosphorylated Smad1/5 and its downstream target
genes, including Endoglin, Jag1, Gata2. In turn, increased Gata2 presumably increases the
expression of the most potent vasoconstrictor endothelin-1 which could contribute to
vascular remodeling and vasoconstriction.
was expressed in different parts of the lung tissue, including airway epithelium,
endothelium, vascular smooth muscle cells, and inflammatory cells (Chapter 3).
The intensity of Fstl1 staining, used as an indicator of Fstl1 protein abundance, was
higher in airway epithelium, endothelium, vascular smooth muscle bundles, and
inflammatory cells of both COPD stage II and IV patients (all ex-smokers) compared to
individuals without airflow obstruction (Chapter 3). This might indicate that increased
Fstl1 expression associates with COPD. This thesis aims to address the potential
implications of increased Fstl1 expression related to COPD pathogenesis (Chapter

146 147
5 and 7). Intriguingly, the expression of Fstl1 protein in lung homogenates of non-
COPD current smokers and ex-smokers was also higher compared to non-COPD non-
smokers, indicating an effect of ever smoking, presumably through smoke-induced
inflammation (Chapter 3). It could be that acute induction of inflammatory mediator
release and subsequent local inflammation involving recruitment of inflammatory
cells to the lung promoted by cigarette smoke persist after smoking cessation. Given
that Fstl1 is a TGF-β1 inducible factor and TGF-β1 release is increased from bronchial
epithelial cells after cigarette smoke treatment,39 this suggests that TGF-β1 could
mediate the observed upregulation of Fstl1 in response to cigarette smoke.
We next explored the potential roles of Fstl1 in pulmonary cells in regulating
local inflammation in the lung (Chapter 5). We examined the expression of Fstl1 and
BMP4 in pulmonary cells lines and found that in the respiratory system, bronchial
epithelial cells express and secrete Fstl1 the most compared to lung mesenchymal
cells, such as lung fibroblasts and airway smooth muscle cells (Chapter 5). This is in
line with our observation in lung tissue of individuals with normal lung function, in
which we demonstrated that Fstl1 is predominantly expressed by airway epithelial
cells, particularly in the apical part of ciliated cells and to a lesser extent in airway
smooth muscle cells (Chapter 3). Other studies have suggested that Fstl1 is a
mesenchymal-derived factor in the heart and joint.38,40 Given that Fstl1 is known
as an endogenous antagonist of BMP signaling in the lung,1,2 we examined the
phosphorylation of BMP-specific Smad1/5 in lung homogenates of COPD patients
(all ex-smokers) compared to non-COPD with different smoking status. We observed
that phosphorylated Smad1/5 was significantly reduced in the lung homogenates
of non-COPD current smokers, non-COPD ex-smokers, and COPD stage II and stage
IV patients compared to non-COPD never-smokers (Chapter 3). Reduced levels of
phosphorylated Smad1/5 could be explained by increased expression of Fstl1 but
may also be explained by reduced pulmonary BMP4 expression. We found that there
was no significant difference in BMP4 protein levels in the lung homogenates among
groups (Chapter 3). In pulmonary cell lines, BMP4 is predominantly expressed by
mesenchymal cells, such as lung fibroblasts and airway smooth muscle cells (data
not shown) and human bronchial epithelial cells expressed and secreted the lowest
levels of BMP4. BMP4 expression is localized in the distal bud of the developing
lung at the pseudoglandular stage (E11-E16.5), coordinating the proximal-distal
axis of endoderm by controlling the differentiation of distal bud epithelial cells.41
Accordingly, phosphorylation of Smad1/5 in pulmonary cell lines followed the
pattern of BMP ligand levels, showing higher degree of canonical BMP signaling in
airway smooth muscle cells and lung fibroblasts compared to bronchial epithelial
cells. Differential cellular source of ligands and their inhibitors in the lung suggest
potential crosstalk between epithelial and mesenchymal cells in governing biological
functions, including regulation of inflammatory cytokine release. These findings
provoked our study to understand the precise roles of Fstl1 in airway inflammation
in healthy subjects and to discuss the potential contribution to the development of
COPD (Chapter 5).
148
To mimic the observed upregulation of Fstl1 in airway epithelium of patients
with COPD and study its impact on inflammatory cytokine release from pulmonary
mesenchymal cells, Fstl1 was overexpressed in epithelial cells. Overexpression of
Fstl1 in bronchial epithelial cells increased the release of IL-6 and GM-CSF protein,
indicating a pro-inflammatory role (Chapter 5). Fstl1 conditioned medium (Fstl1
CM) derived from Fstl1 overexpressing bronchial epithelial cells was used to treat
pulmonary mesenchymal cells. Interestingly, we found that Fstl1 CM increased IL-6
and IL-8 transcription and protein release from mesenchymal cells, suggesting that
Fstl1 may regulate pro-inflammatory cytokine release in the lung. Overexpression
of Fstl1 in bronchial epithelial cells triggers inflammatory cytokine release from
these cells and CM derived from these Fstl1-overexpressing bronchial epithelial cells
induces cytokine release from pulmonary mesenchymal cells (Chapter 5). Although
previous studies reported that Fstl1 promotes direct release of IL-6 and IL-8 from
mesenchymal cells.6,8,42,43, our data using recombinant Fstl1 treatment as well as gain-
and-loss of Fstl1 functions in lung fibroblasts showed no effect at all on baseline or
IL-1β-induced IL-6 and IL-8 protein release, suggesting that Fstl1 alone is insufficient
to induce pro-inflammatory cytokine release from mesenchymal cells. Therefore,
we speculate that Fstl1 may induce the release of inflammatory mediators from
bronchial epithelial cells which in turn regulate the inflammatory cytokine release
from mesenchymal cells. We identified several secreted factors as candidates for the
effect of Fstl1 CM on IL-6 and IL-8 release from lung fibroblasts, namely IL-6, IL-8,
GM-CSF and RANTES and confirmed their functional contribution using neutralizing
antibody experiments. Collectively, our study provides the first in vitro demonstration
that Fstl1 induces the transcription and release of inflammatory cytokines, such as
GM-CSF and IL-6, in bronchial epithelial cells, which subsequently are able to induce
the release of IL-6 and IL-8 from mesenchymal cells. In summary, we provide evidence
that Fstl1 is a pro-inflammatory factor that mediates epithelial-mesenchymal
communication in regulating inflammatory cytokine release. Therefore, Fstl1 might
contribute to the recruitment of inflammatory cells to the lung. In line with our
findings, recent in vitro, in vivo, and proteomic studies demonstrate the involvement
of Fstl1 in the pathological process of respiratory diseases, including lung fibrosis
and asthma.9,11–13 Collectively, these findings may provide a basis for targeting
8
Fstl1 as therapeutic approach for epithelial-driven airway inflammation. The pro-
inflammatory role of Fstl1 in coordinating epithelial-mesenchymal communication
in inflammatory cytokine release in the lung is depicted in Figure 2.
3. Implications of Fstl1 in goblet cell metaplasia and basal cell hyperplasia in
COPD: The role of BMP4 in adult epithelial differentiation
BMP signaling is pivotal in governing proximal-to-distal axis patterning of airway
epithelium in fetal and neonatal lung development. In adult lungs, active BMP
signaling airway is required for epithelial regeneration following injury.44–49 BMP4 is
a secreted mesenchymal derived factor that determines epithelial cell fate during
lung development41. In addition, BMP4 is required for epithelial cell differentiation in
149
air-liquid interface (ALI) cultures, as its expression is time-dependently upregulated
in an transcriptional profiling study.50
The airway epithelium is the first protective physical and functional barrier of the
airways and lung against the external environment. The pseudostratified epithelium
lining of adult airways is composed of a mixed balance of goblet cells, ciliated cells,
basal cells and club cells (formerly known as clara cells) that are properly distributed
along the tracheobronchial tree.51,52 Mucus secreting goblet cells are predominantly
expressed in the proximal epithelium, along with basal cells, club cells, and ciliated
cells.53,54 In distal small bronchioles, secretory club cells, ciliated cells, and pulmonary
neuroendocrine cells are abundant. Respiratory alveoli are covered with a thin
single layer of flat type I and cuboidal type II alveolar epithelial cells.55–57
Cigarette smoke alters the composition of airway epithelium and contributes
to airway epithelial remodeling in COPD.58 Airway epithelial remodeling in COPD
is characterized by goblet cell metaplasia, basal cell hyperplasia as well as loss of
functional club cells in peripheral and central airways.59–61 Variant club cells are
secretory cells that reside primarily in distal lungs with protective roles by secreting
uteroglobin, secretoglobin, and surfactant protein-like protein which have anti-
inflammatory functions and are important for epithelial regeneration.62 Variant
club cells possess stem cell-like properties and are capable of self-renewal and
differentiation into ciliated and goblet cells.57,63 Variant club cells have a distinct
epithelial cells
Fstl1
GM-CSF
RANTES
IL-6
IL-8
mesenchymal cells
IL-6
IL-8
Figure 2. The pro-inflammatory roles of Follistatin-like 1 in coordinating epithelial-
mesenchymal communication in inflammatory cytokine release in the lung. Overexpression
of Fstl1 in airway epithelium increases expression and release of inflammatory mediators,
including GM-CSF, RANTES, IL-6, and IL-8. In turn, these factors increases release of IL-6 and
IL-8 from pulmonary fibroblasts. For further details, see text.
150
flattened morphology and are characterized by lack of secretoglobin 1A member
1 (SCGB1A1, also known as a club cell 10 kDa secretory protein CC10 or CC16) and
cytochrome p450 Cyp2f expression. In contrast, common club cells show typical
cuboidal epithelial phenotype with high expression of SCGB1A1 and cytochrome
p450 Cyp2f making them sensitive to naphthalene injury.62,64,65 Loss of (variant) club
cells has been observed in COPD.60,61,66,67 Low serum levels of SCGB1A1 are not only
associated with COPD prevalence and severity, but also with lung function decline
in COPD as determined by an accelerated forced expiratory volume in one second
(FEV1).68–72
During normal mucociliary differentiation, basal cells directly or indirectly
(through intermediate club cells) give rise to goblet and ciliated cells. Intriguingly,
our study reveals that BMP4 drives basal cell differentiation towards variant club
cells and suppresses further differentiation towards goblet and ciliated cells in adult
primary human bronchial epithelial cells (Chapter 7). Although a previous study
has demonstrated a role of BMP4 in proximal-distal epithelial differentiation in the
developing lung, 45 we are the first to show that BMP4 promotes variant club cell
differentiation in adult human airway epithelial cells in ALI cultures.
In line with previous studies,73,74 we also found that functional BMP4 signaling
(Smad1/5/8 phosphorylation) is reduced whereas Fstl1 expression is increased in
COPD lungs (Chapter 3). Increased Fstl1 in COPD airway epithelium might drive
epithelial differentiation towards goblet cell metaplasia, basal cell hyperplasia, and
loss of club cells which are typical features of remodeled distal COPD epithelium,
by inhibiting the negative regulation of the BMP pathway on goblet cell and basal
cell differentiation. Our study provides a plausible connection between the loss of
club cells, and goblet cell and basal cell metaplasia on one hand and the observed
reduction in BMP/Smad signaling in COPD patients on the other hand.73,74
Moreover, we observed that BMP4 induces expression of its own endogenous
antagonist Fstl1 during airway epithelial differentiation in a time- and concentration-
dependent manner (Chapter 7), implying that Fstl1 may be involved in BMP functions
during epithelial differentiation. Future studies using Fstl1 CM or Fstl1 neutralizing
antibody ββ and retraction of BMP4 treatment after 14 days of treatment in BMP4-
treated cells may answer whether the effect of BMP4 is reversible and whether
8
the switch towards the variant club cell differentiation program can be re-directed
towards a ciliated cell differentiation program. It has been shown previously that
BMP antagonists can function as a positive regulator of basal cell proliferation by
antagonizing BMP functions to block basal cell proliferation.75,76 Likewise, inhibition
BMP/TGF-β/Smad signaling promotes basal cell hyperplasia in primary human
epithelial cells.77 A persistent increase of the BMP antagonist Fstl1 in COPD could
thus trigger basal cell proliferation and basal cell hyperplasia which is commonly
observed in airway epithelial remodeling in COPD.
151
 In the developing lung, Fstl1 is expressed by goblet cells78 whereas in the healthy
adult lung, it are predominantly the ciliated cells that express Fstl1 (Chapter 3 and
5). In contrast, BMP4 is predominantly expressed by pulmonary mesenchymal cells,
such as lung fibroblasts and airway smooth muscle cells. Therefore it is tempting
to speculate that epithelial-mesenchymal communication via BMP signaling is an
important regulator of ciliated and goblet cell differentiation.79
Furthermore, we found that BMP-treated cells have increased expression of
notch-regulated genes, indicative of active notch signaling in adult human epithelial
differentiation (Chapter 3). Notch signaling determines the ultimate epithelial cell
fate in the airways. Therefore understanding the crosstalk between BMP and notch
in adult lung repair is important to explain the aberrant regeneration of remodeled
epithelium in COPD. In COPD, notch signaling components, e.g. Hey1 and Hey2,
are downregulated.70 Notch signaling promotes club cell fate at the expense of
ciliated cells as observed using conditional deletion of an enzyme responsible for
notch ligand-receptor binding, O-fucosyltransferase1 (Pofut1), or the transcriptional Figure 3. Variant club cell differentiation is driven by bone morphogenetic protein 4 in
effector of notch RBPjk or HES1 in mice.80–82 Guha and colleagues demonstrated that adult human airway epithelium: Implications for goblet cell metaplasia in COPD. Upon 14
the expression of the club cell marker secretoglobin 3A2 is driven by notch 1 activation days of air exposure, a cultured basal cell in air-liquid interface (ALI) system differentiates
into a pseudostratified epithelium composing of ciliated and mucus-producing goblet cells,
in vivo. They further proposed secretoglobin 3A2 expression and activation of notch which presumably derived from an intermediate club cell. Addition of BMP4 to the basal
signaling as early markers of the club cell differentiation program.62 In addition, it medium of ALI system every 48 hr suppresses the differentiation of goblet and ciliated cells,
was shown that Notch directly repressed MUC5AC transcription in lung epithelial whilst promotes the differentiation of variant club cells.
cells.81 Conversely, constitutive epithelial expression of notch 1 intracellular domain
(N1ICD) in developing mouse lung and notch activation in adult human airway
4. Future perspectives
epithelium triggers goblet cell metaplasia at the expense of ciliated cells.79
The data presented in this thesis shed light on previously unexplored roles for Fstl1/
Crosstalk between BMP and notch signaling is also observed during postnatal
BMP signaling in COPD and discuss the potential implications of increased expression
lung development. Endothelial deletion of Fstl1 in Fstl1-eKO mice was associated
of Fstl1 protein in airway inflammation and epithelial remodeling.
with increased BMP-regulated Jagged1 during postnatal lung development (Chapter
PAH is a common comorbidity in COPD.83,84 Our study provides in vivo evidence
2). In addition, notch downstream target genes, Hey1 and Hey3, were increased by
of a key role for endothelial Fstl1 in titrating the levels of BMP/Smad signaling during
BMP4 in the ALI cultured primary human bronchial epithelial cells. These observations
proper postnatal lung development (Chapter 2). However, the direct link and the
suggest that similar mechanisms of cell fate determination involving functional
precise functions of endothelial Fstl1 in pulmonary arterial smooth muscle cell
interactions between BMP and notch signaling is involved in adult lung cells and in
proliferation and in the regulation of actin remodeling in pulmonary arterial smooth
lung development. It would be interesting to characterize the composition of airway
muscle cells of lung neonates and COPD lungs remain to be elucidated. Uncontrolled
epithelium of Fstl1-eKO mice to examine whether variant club cell predominate Fstl1
proliferation of pulmonary arterial smooth muscle cells and impaired actin 8
deficient mouse epithelium. Additionally, future studies are necessary to address
remodeling contribute to vasoconstriction in PAH. Ex vivo studies using precision cut
whether inhibition of notch signaling using neutralizing antibodies can inhibit BMP-
lung slices may reveal the functional contribution of endothelial Fstl1 in pulmonary
induced variant club cell differentiation in the ALI culture system.
vascular contraction by comparing the vascular contractility of Fstl1-eKO with that of
To conclude, our studies demonstrate that BMP4 inhibits differentiation of
littermate controls. In addition, it is tempting to test the hypothesis that endothelial-
goblet cells whilst promoting differentiation of variant club cells in adult human
derived Fstl1 is a mediator of endothelial-mural cell communication in vascular tone
epithelium. Restoration of this imbalance in the lung of COPD patients may provide
regulation in the lung. An in vitro experiment using a co-culture system of human
a novel strategy to restore the observed decreased BMP-regulated Smad1/5 in the
lung microvascular endothelial cells and vascular smooth muscle cells could address
COPD lung and to reverse the loss of club cells whilst reducing goblet cell metaplasia
this question and could dissect the underlying mechanism by which Fstl1 regulates
and basal cell hyperplasia. Our study provokes future studies to address such a
actin expression in pulmonary vascular smooth muscle cells.
strategy in models of airway epithelial injury-repair in vitro and in vivo. The role of
BMP4 in adult human airway epithelial differentiation is illustrated in Figure 3.

152 153
 In pulmonary vessels of COPD patients, we observed an increase in Fstl1 protein
expression in endothelial cells as well as vascular smooth muscle cells compared to
individuals with normal lung function (Chapter 3). Although cell-specific expression
of phosphorylated BMP-regulated Smad was not explored, we found that the
BMP-regulated Smad activation was reduced in whole lung homogenates of COPD
patients compared to non-COPD controls (Chapter 3). Activation of BMP signaling
is reduced in idiopathic PAH patients,85–87 however, the contribution of Fstl1 to this
reduction was not studied. Previous studies demonstrated that another endogenous
BMP inhibitor, gremlin, was increased in endothelial cells of idiopathic and hypoxic-
induced PAH.88 Moreover, haploinsufficiency of gremlin 1 reduced pulmonary
vascular resistance by attenuating vascular remodeling,88 suggesting that BMP
inhibition promotes vascular structural changes and leads to vasoconstriction.88 A
recent study shows that Fstl1 can antagonize BMP/Smad signaling whilst facilitating
TGF-β-induced α-smooth muscle actin expression from lung fibroblasts thereby
contributing to extracellular matrix remodeling and airway fibrosis.89 It could
probably be that Fstl1 increases α-smooth muscle actin production from vascular
smooth muscle and promotes structural vascular changes and ultimately contributes
to increased vascular resistance and PAH. A future study evaluating the link between
Fstl1 expression and pulmonary vascular function in patients with PAH secondary to
COPD would be valuable to perform.
This thesis also explored the potential implications of increased Fstl1 in COPD,
particularly in airway epithelium. A pro-inflammatory role of Fstl1, which mediates
epithelial-mesenchymal communication in inflammatory cytokine release (Chapter
4), may contribute to the innate immune response of the lung following environmental
insults, e.g cigarette smoke. To provide insight into the potential pathways involved
in Fstl1-driven local airway inflammation in the lung, further studies are required to
identify the receptor(s) by which Fstl1 exerts its function in airway epithelial cells as
well as in pulmonary mesenchymal cells.
Moreover, we demonstrate that BMP4 simultaneously inhibits differentiation of
goblet cells while promoting differentiation of variant club cells (Chapter 5). Follow
up studies using mouse models of COPD are required to investigate the functional
effect of increased Fstl1 in airway epithelium to assess whether it antagonizes BMP
signaling and contributes to goblet cell metaplasia, basal cell hyperplasia and loss of
variant club cells in in vitro and in vivo. Experiments using functional recombinant
Fstl1 and Fstl1 neutralizing antibodies would be valuable to examine the implication
of targeting Fstl1 in COPD. Given the postnatal lethality of Fstl1-eKO mice (Chapter
2) that hinders further study in cigarette smoke-induced COPD mouse models,
follow up in vivo studies using doxycycline-induced epithelial-specific Fstl1-KO are
worth pursuing to evaluate the involvement of epithelial-derived Fstl1 in COPD
development, including airway inflammation and epithelial cell differentiation.
Furthermore, it may be of interest to evaluate Fstl1 expression as well as BMP-
regulated Smad phosphorylation in different parts of the tracheobronchial tree,
154
including proximal conducting airways and distal respiratory airways, to examine
whether there is an association between the relative expression (ratio) of BMP/Fstl1
and the epithelial cell composition in COPD airways.
To conclude, impaired activation of developmental Fstl1/BMP signaling following
epithelial and vascular injury has been implicated in COPD thus it is important to
understand the functional role of Fstl1/BMP axis during lung development. This will
lead to identify the abnormal tissue repair process in response to chronic lung injury
that can lead to the development of COPD.
5. Clinical and therapeutic relevance
COPD is characterized by an irreversible obstruction of the airways and is associated
with a progressive decline in lung function.90 Dysregulation of lung tissue repair as a
result of impaired activation of regenerative pathways following chronic lung injury
has been implicated in the development of COPD.91,92 A growing body of research
efforts has been focused on searching for a new drug target to improve current
COPD treatment by targeting lung repair pathways. Thus, a better understanding
of the developmental BMP/Fstl1 pathway in airway inflammation and epithelial
remodeling as parts of lung repair mechanisms will offer a novel molecular target
for COPD therapy.
Persistent activation of innate immune responses through airway epithelium-
driven inflammation may contribute to chronic inflammation and contribute to
airway structural changes in COPD. Cigarette smoking increases the expression of
Fstl1 protein even in the lung of non-COPD patients, which persists after smoking
cessation (Chapter 3). Increased Fstl1 in airway epithelium of COPD stage II and IV
patients is associated with COPD and is not only associated with smoking (Chapter
3). Given the pro-inflammatory role of Fstl1 in respiratory innate immunity (Chapter
5), targeting Fstl1 may offer a potential therapeutic value for COPD therapy. Blocking
Fstl1 in the lung may repress GM-CSF and IL-6 release and limit airway-driven
inflammation and subsequent influx of neutrophils and macrophages to the lung of
COPD patients.
(Variant) club cells have anti-inflammatory and epithelial repair functions in the
lung.57,63 Loss of (variant) club cells has been linked to increased airway inflammation 8
and COPD development.60,61,66,67 Restoration of club cell functions in COPD attenuates
airway inflammation.60 The study presented in this thesis shows that BMP4 is able
to promote variant club cell differentiation and suppress goblet cell and ciliated cell
differentiation (Chapter 7). Thereby, the loss of club cells in COPD epithelium60,61,66,67
is likely to link with reduced BMP signaling in patients with COPD,73,74 presumably
by elevated expression of Fstl1 (Chapter 3). Reactivation of BMP signaling in
airway epithelium may be a strategy worth pursuing to trigger differentiation and
maintenance of variant club cells capable of airway epithelial repair as well as
suppressing the inflammatory response in the lung, whilst repressing goblet cell
metaplasia and basal cell hyperplasia in COPD.
155
6. Summary
The hypothetical model derived from this thesis is illustrated in Figure 4, depicting
BMP4
the potential implications of increased pulmonary expression of Fstl1 protein in
COPD airway epithelium. Collectively, our studies have revealed these following Chapter 7 goblet cell metaplasia loss of club cells
findings:
1. Endothelial Fstl1 is required for normal postnatal development of pulmonary
vasculature by modulating BMP/Smad signaling (Chapter 2).
2. Loss of endothelial Fstl1 is associated with an early expression of Endoglin, Chapter 3
Jagged1, Gata2 and the most potent vasoconstrictor endothelin-1, as well Fstl1

as with pulmonary small vessel remodeling, right ventricle hypertrophy and

right heart dysfunction. These abnormalities could cumulatively contribute Fstl1
to the observed respiratory distress in Fstl1-eKO mice (Chapter 2).
Chapter 5
3. The expression of Fstl1 protein is increased in the airway epithelium of COPD
GM-CSF
stage II and IV patients and is accompanied by decreased BMP-signaling RANTES
(Chapter 3). IL-6
IL-8
4. In comparison to the non-COPD never smoking group, ever smoking induces mesenchymal cells
a long lasting increase in the pulmonary expression of Fstl1 protein whilst
decreasing the pulmonary expression of BMP-regulated Smad1/5. This effect
IL-6
of ever smoking is present in non-COPD (ex-smokers and current smokers) IL-8
as well as in COPD stage II IV (all ex-smokers; Chapter 3).
5. Fstl1 promotes pro-inflammatory cytokine release (GM-CSF, RANTES, IL-6,
IL-8) from bronchial epithelial cells and coordinates epithelial-mesenchymal
communication, leading to subsequent pro-inflammatory cytokine release
(IL-6 and IL-8) from mesenchymal cells (Chapter 5).
6. BMP4 negatively regulates differentiation of goblet cells whilst promoting neutrophils macrophages
differentiation of variant club cells in adult bronchial epithelium. This
implies that the observed loss of club cells, goblet cell metaplasia and basal
cell hyperplasia in COPD could result from inhibition of BMP signaling due to
Airway inflammation
elevated levels of Fstl1 (Chapter 7).
Figure 4. The pathological implications of increased Fstl1 in airway epithelium of COPD
patients. The expression of Fstl1 protein is increased in the airway epithelium of both COPD
stage II and IV patients (Chapter 3). Given the importance role of Fstl1 in postnatal lung 8
development (Chapter 2) and increased Fstl1 protein expression in ever smoker non-COPD
and ex-smoker COPD lungs (Chapter 3), it could be that the Fstl1 protein is reactivated as part
of adult lung repair mechanism following epithelial injury, including cigarette smoking. Fstl1
is a pro-inflammatory cytokine mediating epithelial-mesenchymal communication in IL-6 and
IL-8 release (Chapter 5). Therefore, Fstl1 may contribute to the recruitment of neutrophils
and macrophages to the lungs. BMP4 inhibits differentiation of goblet cells whilst promoting
differentiation of variant club cells in adult human airway epithelium (Chapter 7). Increased
Fstl1 in COPD airway epithelium might drive epithelial differentiation towards goblet cell
hyperplasia and loss of club cells, which are the common hallmarks of remodeled COPD
airway epithelium. Fstl1 may inhibit the negative regulation of the BMP signaling in goblet
cells. Our findings provide a plausible connection between the loss of (variant) club cells and
goblet cell metaplasia (Chapter 7) with the observed reduction of BMP signaling in patients
with COPD stage II and IV (Chapter 3).

156 157
References
1. Sylva M, Li VSW, Buffing AAA, et al. The BMP antagonist follistatin-like 1 is required for skeletal
and lung organogenesis. PloS One. 2011;6(8):e22616. doi:10.1371/journal.pone.0022616.
2. Geng Y, Dong Y, Yu M, et al. Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP)
4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A.
2011;108(17):7058-7063. doi:10.1073/pnas.1007293108.
3. Umezu T, Yamanouchi H, Iida Y, Miura M, Tomooka Y. Follistatin-like-1, a diffusible mesenchymal
factor determines the fate of epithelium. Proc Natl Acad Sci U S A. 2010;107(10):4601-4606.
doi:10.1073/pnas.0909501107.
4. Hayakawa S, Ohashi K, Shibata R, et al. Cardiac Myocyte-Derived Follistatin-Like 1 Prevents
Renal Injury in a Subtotal Nephrectomy Model. J Am Soc Nephrol JASN. 2015;26(3):636-646.
doi:10.1681/ASN.2014020210.
5. Zhou X, Xiao X, Huang T, et al. Epigenetic inactivation of follistatin-like 1 mediates tumor immune
evasion in nasopharyngeal carcinoma. Oncotarget. 2016;7(13):16433-16444. doi:10.18632/
oncotarget.7654.
6. Miyamae T, Marinov AD, Sowders D, et al. Follistatin-Like Protein-1 Is a Novel Proinflammatory
Molecule. J Immunol. 2006;177(7):4758-4762. doi:10.4049/jimmunol.177.7.4758.
7. Clutter SD, Wilson DC, Marinov AD, Hirsch R. Follistatin-Like Protein 1 Promotes Arthritis by Up-
Regulating IFN-γ. J Immunol. 2009;182(1):234-239. doi:10.4049/jimmunol.182.1.234.
8. Chaly Y, Marinov AD, Oxburgh L, Bushnell DS, Hirsch R. FSTL1 promotes arthritis in mice by
enhancing inflammatory cytokine/chemokine expression. Arthritis Rheum. 2012;64(4):1082-
1088. doi:10.1002/art.33422.
9. Dong Y, Geng Y, Li L, et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary
fibrosis in mice. J Exp Med. 2015;212(2):235-252. doi:10.1084/jem.20121878.
10. Liu M, Liu R, Wu H, et al. Radix puerariae extracts ameliorate paraquat-induced pulmonary
fibrosis by attenuating follistatin-like 1 and nuclear factor erythroid 2p45-related factor-2
signalling pathways through downregulation of miRNA-21 expression. BMC Complement Altern
Med. 2016;16:11. doi:10.1186/s12906-016-0991-6.
11. Murphy N, Gaynor KU, Rowan SC, et al. Altered Expression of Bone Morphogenetic Protein
Accessory Proteins in Murine and Human Pulmonary Fibrosis. Am J Pathol. 2016;186(3):600-
615. doi:10.1016/j.ajpath.2015.10.032.
12. Miller M, Beppu A, Rosenthal P, et al. Fstl1 Promotes Asthmatic Airway Remodeling by Inducing
Oncostatin M. J Immunol Baltim Md 1950. September 2015. doi:10.4049/jimmunol.1501105.
13. Miller M, Esnault S, Kurten RC, et al. Segmental allergen challenge increases levels of airway
follistatin-like 1 in patients with asthma. J Allergy Clin Immunol. 2016;138(2):596-599.e4.
doi:10.1016/j.jaci.2016.01.019.
14. Gangopahyay A, Oran M, Bauer EM, et al. Bone morphogenetic protein receptor II is a novel
mediator of endothelial nitric-oxide synthase activation. J Biol Chem. 2011;286(38):33134-
33140. doi:10.1074/jbc.M111.274100.
15. Xu J, Zhu D, Sonoda S, et al. Over-expression of BMP4 inhibits experimental choroidal
neovascularization by modulating VEGF and MMP-9. Angiogenesis. 2012;15(2):213-227.
doi:10.1007/s10456-012-9254-4.
16. Moreno-Miralles I, Ren R, Moser M, Hartnett ME, Patterson C. Bone morphogenetic protein
endothelial cell precursor-derived regulator regulates retinal angiogenesis in vivo in a mouse
model of oxygen-induced retinopathy. Arterioscler Thromb Vasc Biol. 2011;31(10):2216-2222.
doi:10.1161/ATVBAHA.111.230235.
17. Helbing T, Rothweiler R, Ketterer E, et al. BMP activity controlled by BMPER regulates the
proinflammatory phenotype of endothelium. Blood. 2011;118(18):5040-5049. doi:10.1182/
blood-2011-03-339762.
18. Yao Y, Jumabay M, Wang A, Boström KI. Matrix Gla protein deficiency causes arteriovenous
malformations in mice. J Clin Invest. 2011;121(8):2993-3004. doi:10.1172/JCI57567.
19. Suzuki Y, Ohga N, Morishita Y, Hida K, Miyazono K, Watabe T. BMP-9 induces proliferation of
multiple types of endothelial cells in vitro and in vivo. J Cell Sci. 2010;123(Pt 10):1684-1692.
doi:10.1242/jcs.061556.
20. Kool H, Mous D, Tibboel D, de Klein A, Rottier RJ. Pulmonary vascular development goes awry in
158
congenital lung abnormalities. Birth Defects Res Part C Embryo Today Rev. 2014;102(4):343-358.
doi:10.1002/bdrc.21085.
21. International PPH Consortium, Lane KB, Machado RD, et al. Heterozygous germline mutations
in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. Nat
Genet. 2000;26(1):81-84. doi:10.1038/79226.
22. Machado RD, Aldred MA, James V, et al. Mutations of the TGF-beta type II receptor BMPR2 in
pulmonary arterial hypertension. Hum Mutat. 2006;27(2):121-132. doi:10.1002/humu.20285.
23. Harrison RE, Flanagan JA, Sankelo M, et al. Molecular and functional analysis identifies ALK-
1 as the predominant cause of pulmonary hypertension related to hereditary haemorrhagic
telangiectasia. J Med Genet. 2003;40(12):865-871.
24. Fujiwara M, Yagi H, Matsuoka R, et al. Implications of mutations of activin receptor-like kinase
1 gene (ALK1) in addition to bone morphogenetic protein receptor II gene (BMPR2) in children
with pulmonary arterial hypertension. Circ J Off J Jpn Circ Soc. 2008;72(1):127-133.
25. Johnson DW, Berg JN, Baldwin MA, et al. Mutations in the activin receptor-like kinase 1 gene in
hereditary haemorrhagic telangiectasia type 2. Nat Genet. 1996;13(2):189-195. doi:10.1038/
ng0696-189.
26. McAllister KA, Grogg KM, Johnson DW, et al. Endoglin, a TGF-beta binding protein of endothelial
cells, is the gene for hereditary haemorrhagic telangiectasia type 1. Nat Genet. 1994;8(4):345-
351. doi:10.1038/ng1294-345.
27. Pi X, Lockyer P, Dyer LA, et al. Bmper inhibits endothelial expression of inflammatory adhesion
molecules and protects against atherosclerosis. Arterioscler Thromb Vasc Biol. 2012;32(9):2214-
2222. doi:10.1161/ATVBAHA.112.252015.
28. Yao Y, Yao J, Radparvar M, et al. Reducing Jagged 1 and 2 levels prevents cerebral arteriovenous
malformations in matrix Gla protein deficiency. Proc Natl Acad Sci U S A. 2013;110(47):19071-
19076. doi:10.1073/pnas.1310905110.
29. Jain RK. Molecular regulation of vessel maturation. Nat Med. 2003;9(6):685-693. doi:10.1038/
nm0603-685.
30. Schiffrin EL. Endothelin and endothelin antagonists in hypertension. J Hypertens. 1998;16(12 Pt
2):1891-1895.
31. Lee SH, Channick RN. Endothelin antagonism in pulmonary arterial hypertension. Semin Respir
Crit Care Med. 2005;26(4):402-408. doi:10.1055/s-2005-916155.
32. Brozovich FV, Nicholson CJ, Degen CV, Gao YZ, Aggarwal M, Morgan KG. Mechanisms of Vascular
Smooth Muscle Contraction and the Basis for Pharmacologic Treatment of Smooth Muscle
Disorders. Pharmacol Rev. 2016;68(2):476-532. doi:10.1124/pr.115.010652.
33. Wilson JL, Yu J, Taylor L, Polgar P. Hyperplastic Growth of Pulmonary Artery Smooth Muscle Cells
from Subjects with Pulmonary Arterial Hypertension Is Activated through JNK and p38 MAPK.
PLoS ONE. 2015;10(4). doi:10.1371/journal.pone.0123662.
34. Noordegraaf AV, Galiè N. The role of the right ventricle in pulmonary arterial hypertension. Eur
Respir Rev. 2011;20(122):243-253. doi:10.1183/09059180.00006511.
35. NAEIJE R, CHESLER N. PULMONARY CIRCULATION AT EXERCISE. Compr Physiol. 2012;2(1):711-
741. doi:10.1002/cphy.c100091. 8
36. Knight D. Epithelium–fibroblast interactions in response to airway inflammation. Immunol Cell
Biol. 2001;79(2):160-164. doi:10.1046/j.1440-1711.2001.00988.x.
37. Osei ET, Brandsma C-A, Noordhoek JA, Timens W, Postma D, Heijink I. Crosstalk between
epithelium and fibroblasts; implications for COPD. Eur Respir J. 2014;44(Suppl 58):P3899.
38. Ouchi N, Oshima Y, Ohashi K, et al. Follistatin-like 1, a secreted muscle protein, promotes
endothelial cell function and revascularization in ischemic tissue through a nitric-oxide synthase-
dependent mechanism. J Biol Chem. 2008;283(47):32802-32811. doi:10.1074/jbc.M803440200.
39. Shibanuma M, Mashimo J, Mita A, Kuroki T, Nose K. Cloning from a mouse osteoblastic cell line
of a set of transforming-growth-factor-beta 1-regulated genes, one of which seems to encode a
follistatin-related polypeptide. Eur J Biochem FEBS. 1993;217(1):13-19.
40. Wilson DC, Marinov AD, Blair HC, et al. Follistatin-like protein 1 is a mesenchyme-derived
inflammatory protein and may represent a biomarker for systemic-onset juvenile rheumatoid
arthritis. Arthritis Rheum. 2010;62(8):2510-2516. doi:10.1002/art.27485.
41. Morrisey EE, Hogan BLM. Preparing for the first breath: genetic and cellular mechanisms in lung
159
 development. Dev Cell. 2010;18(1):8-23. doi:10.1016/j.devcel.2009.12.010.
42. Murakami K, Tanaka M, Usui T, et al. Follistatin-related protein/follistatin-like 1 evokes an
innate immune response via CD14 and toll-like receptor 4. FEBS Lett. 2012;586(4):319-324.
doi:10.1016/j.febslet.2012.01.010.
43. Fan N, Sun H, Wang Y, et al. Follistatin-Like 1: A Potential Mediator of Inflammation in Obesity.
Mediators Inflamm. 2013;2013:e752519. doi:10.1155/2013/752519.
44. Bellusci S, Henderson R, Winnier G, Oikawa T, Hogan BL. Evidence from normal expression
and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse
embryonic lung morphogenesis. Dev Camb Engl. 1996;122(6):1693-1702.
45. Weaver M, Yingling JM, Dunn NR, Bellusci S, Hogan BL. Bmp signaling regulates proximal-distal
differentiation of endoderm in mouse lung development. Dev Camb Engl. 1999;126(18):4005-
4015.
46. Sountoulidis A, Stavropoulos A, Giaglis S, et al. Activation of the canonical bone morphogenetic
protein (BMP) pathway during lung morphogenesis and adult lung tissue repair. PloS One.
2012;7(8):e41460. doi:10.1371/journal.pone.0041460.
47. Ninomiya N, Michiue T, Asashima M, Kurisaki A. BMP signaling regulates the differentiation
of mouse embryonic stem cells into lung epithelial cell lineages. In Vitro Cell Dev Biol Anim.
2013;49(3):230-237. doi:10.1007/s11626-013-9589-1.
48. Huang SXL, Islam MN, O’Neill J, et al. Highly efficient generation of airway and lung epithelial cells
from human pluripotent stem cells. Nat Biotechnol. 2014;32(1):84-91. doi:10.1038/nbt.2754.
49. Huang SXL, Green MD, de Carvalho AT, et al. The in vitro generation of lung and airway progenitor
cells from human pluripotent stem cells. Nat Protoc. 2015;10(3):413-425. doi:10.1038/
nprot.2015.023.
50. Ross AJ, Dailey LA, Brighton LE, Devlin RB. Transcriptional profiling of mucociliary differentiation
in human airway epithelial cells. Am J Respir Cell Mol Biol. 2007;37(2):169-185. doi:10.1165/
rcmb.2006-0466OC.
51. Fahy JV, Dickey BF. Airway Mucus Function and Dysfunction. N Engl J Med. 2010;363(23):2233-
2247. doi:10.1056/NEJMra0910061.
52. Li F, He J, Wei J, Cho WC, Liu X. Diversity of Epithelial Stem Cell Types in Adult Lung. Stem Cells
Int. 2015;2015:e728307. doi:10.1155/2015/728307.
53. Hong KU, Reynolds SD, Watkins S, Fuchs E, Stripp BR. Basal cells are a multipotent progenitor
capable of renewing the bronchial epithelium. Am J Pathol. 2004;164(2):577-588. doi:10.1016/
S0002-9440(10)63147-1.
54. Rock JR, Onaitis MW, Rawlins EL, et al. Basal cells as stem cells of the mouse trachea and
human airway epithelium. Proc Natl Acad Sci U S A. 2009;106(31):12771-12775. doi:10.1073/
pnas.0906850106.
55. Kimura J, Deutsch GH. Key mechanisms of early lung development. Pediatr Dev Pathol Off J Soc
Pediatr Pathol Paediatr Pathol Soc. 2007;10(5):335-347. doi:10.2350/07-06-0290.1.
56. Rawlins EL, Hogan BLM. Epithelial stem cells of the lung: privileged few or opportunities for
many? Dev Camb Engl. 2006;133(13):2455-2465. doi:10.1242/dev.02407.
57. Kotton DN, Morrisey EE. Lung regeneration: mechanisms, applications and emerging stem cell
populations. Nat Med. 2014;20(8):822-832. doi:10.1038/nm.3642.
58. Schamberger AC, Staab-Weijnitz CA, Mise-Racek N, Eickelberg O. Cigarette smoke alters primary
human bronchial epithelial cell differentiation at the air-liquid interface. Sci Rep. 2015;5.
doi:10.1038/srep08163.
59. Saetta M, Turato G, Baraldo S, et al. Goblet cell hyperplasia and epithelial inflammation
in peripheral airways of smokers with both symptoms of chronic bronchitis and chronic
airflow limitation. Am J Respir Crit Care Med. 2000;161(3 Pt 1):1016-1021. doi:10.1164/
ajrccm.161.3.9907080.
60. Gamez AS, Gras D, Petit A, et al. Supplementing defect in club cell secretory protein attenuates
airway inflammation in COPD. Chest. 2015;147(6):1467-1476. doi:10.1378/chest.14-1174.
61. Pilette C, Godding V, Kiss R, et al. Reduced epithelial expression of secretory component in small
airways correlates with airflow obstruction in chronic obstructive pulmonary disease. Am J
Respir Crit Care Med. 2001;163(1):185-194. doi:10.1164/ajrccm.163.1.9912137.
62. Guha A, Vasconcelos M, Cai Y, et al. Neuroepithelial body microenvironment is a niche
160
for a distinct subset of Clara-like precursors in the developing airways. Proc Natl Acad Sci.
2012;109(31):12592-12597. doi:10.1073/pnas.1204710109.
63. Barnes PJ. CLub cells, their secretory protein, and copd. Chest. 2015;147(6):1447-1448.
doi:10.1378/chest.14-3171.
64. Hung KS. Development of neuroepithelial bodies in pre- and postnatal mouse lungs: scanning
electron microscopic study. Anat Rec. 1982;203(2):285-291. doi:10.1002/ar.1092030210.
65. Reynolds SD, Giangreco A, Power JH, Stripp BR. Neuroepithelial bodies of pulmonary airways
serve as a reservoir of progenitor cells capable of epithelial regeneration. Am J Pathol.
2000;156(1):269-278. doi:10.1016/S0002-9440(10)64727-X.
66. Shijubo N, Itoh Y, Yamaguchi T, et al. Clara cell protein-positive epithelial cells are reduced in
small airways of asthmatics. Am J Respir Crit Care Med. 1999;160(3):930-933. doi:10.1164/
ajrccm.160.3.9803113.
67. Rokicki W, Rokicki M, Wojtacha J, Dżeljijli A. The role and importance of club cells (Clara cells) in
the pathogenesis of some respiratory diseases. Kardiochirurgia Torakochirurgia Pol Pol J Cardio-
Thorac Surg. 2016;13(1):26-30. doi:10.5114/kitp.2016.58961.
68. Bernard A, Marchandise FX, Depelchin S, Lauwerys R, Sibille Y. Clara cell protein in serum and
bronchoalveolar lavage. Eur Respir J. 1992;5(10):1231-1238.
69. Vestbo J, Edwards LD, Scanlon PD, et al. Changes in Forced Expiratory Volume in 1 Second over
Time in COPD. N Engl J Med. 2011;365(13):1184-1192. doi:10.1056/NEJMoa1105482.
70. Park HY, Churg A, Wright JL, et al. Club cell protein 16 and disease progression in chronic
obstructive pulmonary disease. Am J Respir Crit Care Med. 2013;188(12):1413-1419.
doi:10.1164/rccm.201305-0892OC.
71. Lomas DA, Silverman EK, Edwards LD, et al. Evaluation of serum CC-16 as a biomarker for COPD
in the ECLIPSE cohort. Thorax. 2008;63(12):1058-1063. doi:10.1136/thx.2008.102574.
72. Guerra S, Halonen M, Vasquez MM, et al. The relation of circulating CC16 to lung function growth,
decline, and development of COPD across the lifespan. Lancet Respir Med. 2015;3(8):613-620.
doi:10.1016/S2213-2600(15)00196-4.
73. Myllärniemi M, Lindholm P, Ryynänen MJ, et al. Gremlin-mediated decrease in bone
morphogenetic protein signaling promotes pulmonary fibrosis. Am J Respir Crit Care Med.
2008;177(3):321-329. doi:10.1164/rccm.200706-945OC.
74. De Langhe E, Cailotto F, De Vooght V, et al. Enhanced endogenous bone morphogenetic protein
signaling protects against bleomycin induced pulmonary fibrosis. Respir Res. 2015;16:38.
doi:10.1186/s12931-015-0202-x.
75. Cibois M, Luxardi G, Chevalier B, et al. BMP signalling controls the construction of vertebrate
mucociliary epithelia. Development. 2015;142(13):2352-2363. doi:10.1242/dev.118679.
76. Tadokoro T, Gao X, Hong CC, Hotten D, Hogan BLM. BMP signaling and cellular dynamics during
regeneration of airway epithelium from basal progenitors. Dev Camb Engl. 2016;143(5):764-
773. doi:10.1242/dev.126656.
77. Mou H, Vinarsky V, Tata PR, et al. Dual SMAD Signaling Inhibition Enables Long-Term
Expansion of Diverse Epithelial Basal Cells. Cell Stem Cell. 2016;19(2):217-231. doi:10.1016/j.
stem.2016.05.012. 8
78. Adams D, Larman B, Oxburgh L. Developmental expression of mouse Follistatin-like 1 (Fstl1):
Dynamic regulation during organogenesis of the kidney and lung. Gene Expr Patterns.
2007;7(4):491-500. doi:10.1016/j.modgep.2006.10.009.
79. Guseh JS, Bores SA, Stanger BZ, et al. Notch signaling promotes airway mucous metaplasia
and inhibits alveolar development. Development. 2009;136(10):1751-1759. doi:10.1242/
dev.029249.
80. Lafkas D, Shelton A, Chiu C, et al. Therapeutic antibodies reveal Notch control of transdifferentiation
in the adult lung. Nature. 2015;528(7580):127-131. doi:10.1038/nature15715.
81. Tsao P-N, Wei S-C, Wu M-F, et al. Notch signaling prevents mucous metaplasia in mouse
conducting airways during postnatal development. Development. 2011;138(16):3533-3543.
doi:10.1242/dev.063727.
82. Ito T, Udaka N, Yazawa T, et al. Basic helix-loop-helix transcription factors regulate the
neuroendocrine differentiation of fetal mouse pulmonary epithelium. Development.
2000;127(18):3913-3921.
161
83. Siafakas NM, Antoniou KM, Tzortzaki EG. Role of angiogenesis and vascular remodeling in
chronic obstructive pulmonary disease. Int J Chron Obstruct Pulmon Dis. 2007;2(4):453-462.
84. Hashimoto M, Tanaka H, Abe S. Quantitative analysis of bronchial wall vascularity in the medium
and small airways of patients with asthma and COPD. Chest. 2005;127(3):965-972. doi:10.1378/
chest.127.3.965.
85. Morty RE, Nejman B, Kwapiszewska G, et al. Dysregulated bone morphogenetic protein signaling
in monocrotaline-induced pulmonary arterial hypertension. Arterioscler Thromb Vasc Biol.
2007;27(5):1072-1078. doi:10.1161/ATVBAHA.107.141200.
86. Takahashi K, Kogaki S, Matsushita T, Nasuno S, Kurotobi S, Ozono K. Hypoxia induces alteration
of bone morphogenetic protein receptor signaling in pulmonary artery endothelial cell. Pediatr
Res. 2007;61(4):392-397. doi:10.1203/pdr.0b013e3180332cba.
87. Long L, Crosby A, Yang X, et al. Altered Bone Morphogenetic Protein and Transforming Growth
Factor-β Signaling in Rat Models of Pulmonary Hypertension. Circulation. 2009;119(4):566-576.
doi:10.1161/CIRCULATIONAHA.108.821504.
88. Cahill E, Rowan SC, Sands M, et al. The pathophysiological basis of chronic hypoxic pulmonary
hypertension in the mouse: vasoconstrictor and structural mechanisms contribute equally. Exp
Physiol. 2012;97(6):796-806. doi:10.1113/expphysiol.2012.065474.
89. Dong Y, Geng Y, Li L, et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary
fibrosis in mice. J Exp Med. 2015;212(2):235-252. doi:10.1084/jem.20121878.
90. Vestbo J, Hurd SS, Agustí AG, et al. Global Strategy for the Diagnosis, Management, and Prevention
of Chronic Obstructive Pulmonary Disease. Am J Respir Crit Care Med. 2013;187(4):347-365.
doi:10.1164/rccm.201204-0596PP.
91. Shi W, Chen F, Cardoso WV. Mechanisms of lung development: contribution to adult lung disease
and relevance to chronic obstructive pulmonary disease. Proc Am Thorac Soc. 2009;6(7):558-
563. doi:10.1513/pats.200905-031RM.
92. Boucherat O, Morissette MC, Provencher S, Bonnet S, Maltais F. Bridging Lung Development
with Chronic Obstructive Pulmonary Disease. Relevance of Developmental Pathways in Chronic
Obstructive Pulmonary Disease Pathogenesis. Am J Respir Crit Care Med. 2015;193(4):362-375.
doi:10.1164/rccm.201508-1518PP.

162 163
CHAPTER 9 1

DUTCH SUMMARY/
NEDERLANDSE
SAMENVATTING

165
Voorwoord

Chronisch obstructief longlijden (chronic obstructive pulmonary disease, COPD)

wordt gekenmerkt door een progressieve en irreversibele luchtwegobstructie waarin
buitensporige en hardnekkige ontsteking van de longen een belangrijke rol speelt.
Zoals aangegeven in de algemene inleiding (Hoofdstuk 1), is een juiste balans tussen
het zogenaamde Bone morphogenetic protein (BMP4) en zijn endogene remme
Follistatin-like 1 (Fstl1) van cruciaal belang voor goede biologische functies tijdens
normale embryonale long-morfogenese1,2 en in de volwassen long in rusttoestand.3–5
Daarnaast is een immuunmodulerende functie van Fstl1 aangetoond in verschillende
ontstekingsziekten.6–8 De functionele rol van Fstl1 in de postnatale ontwikkeling van
de longen en in de longen van COPD patiënten is echter nog niet eerder onderzocht.
Onlangs heeft een aantal studies de betrokkenheid van Fstl1 bij longfibrose en
ernstig allergisch astma aangetoond.9–13 De studies beschreven in dit proefschrift
laten zien dat Fstl1 vereist is voor de pulmonale vasculaire ontwikkeling na de
geboorte (Hoofdstuk 2). Bovendien tonen wij aan dat Fstl1 eiwitexpressie verhoogd
is in het epitheel van de luchtwegen van COPD patiënten (Hoofdstuk 3). We vonden
tevens dat Fstl1 een ontstekingsbevorderende factor in de luchtwegen is (Hoofdstuk
5). Verder vonden we dat BMP4 signalering de distale variant-clubceldifferentiatie
van het epitheel in de luchtwegen reguleert (Hoofdstuk 7). In zijn geheel laten
onze bevindingen aannemen dat Fstl1 een cruciale rol speelt in de ontwikkeling en
achteruitgang van COPD.

1. De rol van Fstl1 in luchtwegontsteking bij COPD patiënten

De ontwikkeling van de long wordt nauwkeurig aangestuurd door meerdere
signaaltransductieroutes, die de vorming van luchtwegen en vasculatuur reguleren.
BMP signalering is essentieel in het dynamische proces van vaatgroei en rijping,
door het reguleren van de proliferatie en migratie van vasculaire gladde spieren en
endotheelcellen.14–19 Sterk gecoördineerde regulatie van BMP signalering is essentieel
voor een goede longontwikkeling.20 Verscheidene genetische vaatziekten zijn in
verband gebracht met afwijkende BMP signalering, waaronder familiaire pulmonale
arteriële hypertensie (PAH).18,21–28 Deze centrale rol voor BMP signalering wordt
ondersteund door de bevinding dat muizen waarbij het Fstl1 gen is uitgeschakeld
(Fstl1-KO muizen) kleinere longen met verdikte alveolaire septa hebben. Deze muizen
hebben last van ademnood en sterven vrijwel direct na de geboorte,1,2 wat aangeeft
dat Fstl1 nodig is voor longontwikkeling en alveolarisatie. Opvallend genoeg vonden
we dat muizen met endotheel-specifieke Fstl1 deletie (Fstl1-eKO) ook last hadden
van ademnood en 3 weken na de geboorte stierven (Hoofdstuk 2). De postnatale
sterfte van de Fstl1-eKO muizen suggereert een belangrijke rol voor endotheliaal
Fstl1 in postnatale ontwikkeling van de pulmonaire vasculatuur. Fstl1-eKO muizen
stierven gemiddeld 21 dagen na de geboorte, wat in het alveolaire stadium van
de longontwikkeling is dat van cruciaal belang is voor de alveolaire en vasculaire
netwerkvorming en rijping.20,29 Vertakking van de luchtwegen en het vasculaire
Figuur 1. De rol van endotheliaal Follistatin-like 1 bij het moduleren van BMP/Smad
signalering tijdens de postnatale ontwikkeling van de longvaten. In aanwezigheid van
endotheliaal Fstl1 worden de BMP-geïnduceerde fosforylering van Smad1/5 en daarop
volgende downstream targetgenen geremd. Deletie van endotheliaal Fstl1 in Fstl1-eKO
muizen is geassocieerd met over-activatie van door BMP gefosforyleerde Smad1/5 en de
targetgenen endogline, JAG1 en GATA2.
netwerk moet worden gecoördineerd om de blootstelling van bloed aan zuurstof te
optimaliseren.20 De vorming van het pulmonaire vasculaire netwerk bleek dan ook
verstoord in Fstl1-eKO muizen, leidend tot ademnood (Hoofdstuk 2).
Hoewel minieme pulmonaire vasculaire remodeling in de grote en elastische
arteriën in Fstl1-eKO muizen werd waargenomen, vonden we met name verhoogde
percentages van actine bevattende kleine longvaten 21 dagen na de geboorte in 9
deze muizen (Hoofdstuk 2). Bovendien vonden we dat de cardiale output van het
rechterventrikel was verlaagd in Fstl1-eKO muizen (Hoofdstuk 2). Verder onderzoek
naar de onderliggende mechanismen toonde aan dat gefosforyleerd Smad1/8/5
- een aanwijzing voor actieve BMP signalering - en BMP-gereguleerde eiwitten
(Jagged1, endogline, en endotheline-1) verhoogd waren tijdens het vroege stadium
van longontwikkeling (7 dagen na de geboorte) (Hoofdstuk 2). De remodeling van de
longvaatjes in de Fstl1-eKO muizen ging gepaard met een verhoogde eiwitexpressie

166 167
van endotheline-1, hetgeen een sterke vaatvernauwende werking heeft, na zowel 7
en 21 dagen na de geboorte. (Hoofdstuk 2). De combinatie van een hoge endotheline-
1-expressie en een hoog percentage van actine bevattende kleine longvaten zou
kunnen leiden tot een verhoging van de pulmonale vasculaire weerstand (Hoofdstuk
2). De progressieve en onomkeerbare defecten in longvatstructuur en-functie in
Fstl1-eKO muizen zouden de ademnood kunnen verklaren, omdat de niet adequaat
gevormde kleine longvaten niet in staat zijn om in de juiste mate bloed naar de
longen te brengen. Dit zou kunnen leiden tot een gebrek aan zuurstoftoevoer naar
de vitale organen en uiteindelijk tot de dood. Het zou dan ook interessant zijn om de
zuurstof- en kooldioxideniveaus in het bloed te onderzoeken, en daarnaast ook de
diameter van de kleine longvaten en hoeveelheid spiermassa in de kleine longvaten
te bepalen in follow-up studies.
Samengevat lijkt het dat Fstl1-eKO muizen gekenmerkt worden door tijdelijke
moleculaire veranderingen in BMP signalering, die vroeg beginnen tijdens de
postnatale ontwikkeling (7 dagen na de geboorte), terwijl de fysiologische functies
en morfologische gevolgen hiervan zich in latere stadia van postnatale ontwikkeling
(21 dagen na de geboorte) manifesteren. Het is echter ook mogelijk dat de
moleculaire en morfologische veranderingen in de longen een gevolg zijn van een
slecht functionerend rechter ventrikel. Als gevolg van hypoxie die aldus ontstaat
kan remodeling van de longvaten en een toegenomen endotheline-1-expressie
optreden. Toekomstige studies zouden de cardiovasculaire structuur en functies in
Fstl1-eKO muizen kunnen bestuderen om te onderzoeken wat de functie is van Fstl1
in het cardiovasculaire systeem. De rol van Fstl1 bij het moduleren van BMP/Smad
signalering tijdens de postnatale ontwikkeling van de longvaten wordt weergegeven
in Figuur 1.
2. De rol van Fstl1 in ontsteking van de luchtwegen bij COPD patiënten
Eén van de kenmerken van COPD is een inadequate activering van het aangeboren
immuunsysteem en abnormaal weefselherstel in reactie op langdurige blootstelling
aan pneumotoxische, geïnhaleerde stoffen, zoals sigarettenrook. Op zijn beurt leidt
dit tot epitheliale remodeling en fysiologische veranderingen die bijdragen aan
de niet volledig reversibele luchtwegvernauwing.30,31 Als eerste barrière tegen het
externe milieu scheidt luchtwegepitheel ontstekingsmediatoren uit met paracriene
effecten op naburige mesenchymale cellen, waaronder longfibroblasten en gladde
spiercellen van de luchtwegen. Interessant is dat een rol voor Fstl1 in cel-cel
communicatie al eerder is gerapporteerd.6,9 Een groeiende hoeveelheid bewijs geeft
aan dat Fstl1 een pro-inflammatoire rol heeft in het reguleren van de inflammatoire
cytokine secretie in de pathogenese van verschillende ontstekingsziekten en in de
verergering van de symptomen van deze ziekten.6,7,32 Het verband tussen Fstl1 en
COPD pathogenese is echter nog niet eerder onderzocht.
Onze studies naar de expressie van Fstl1 in COPD hebben aangetoond dat Fstl1
sterk verhoogd is in longhomogenaten van rokers zonder COPD en van stadium II
als IV COPD-patiënten in vergelijking met personen zonder luchtwegobstructie
168
(Hoofdstuk 3). Nader onderzoek aan longweefsel van COPD-patiënten toonde
aan dat het Fstl1 eiwit tot expressie werd gebracht in verschillende delen van het
longweefsel, waaronder luchtwegepitheel, endotheel, vasculaire gladde spiercellen,
en ontstekingscellen (Hoofdstuk 3). De intensiteit van Fstl1 kleuring, gebruikt
als indicator voor de mate van aanwezigheid van het Fstl1 eiwit, was hoger in
luchtwegepitheel, endotheel, vasculaire gladde spierbundels en ontstekingscellen
van zowel patienten met stadium II en IV COPD (allen ex-rokers) in vergelijking
met personen zonder luchtwegobstructie (Hoofdstuk 3). Dit kan erop wijzen dat
verhoogde Fstl1 expressie geassocieerd is met COPD. Dit proefschrift is gericht op
de mogelijke gevolgen van deze toegenomen Fstl1 expressie en de rol hiervan in de
pathogenese van COPD (Hoofdstuk 5 en 7). Intrigerend is dat de expressie van Fstl1
in longhomogenaten van rokers zonder COPD en ex-rokers ook hoger is in vergelijking
met niet-rokers zonder COPD, hetgeen wijst op een effect van het ooit-hebben-
gerookt, waarschijnlijk door rook-geïnduceerde ontsteking (Hoofdstuk 3). Het zou
kunnen dat acute vrijzetting van ontstekingsmediatoren en de daaropvolgende
lokale ontsteking waarbij ontstekingscellen worden gerekruteerd in de longen
wordt bevorderd door sigarettenrook, wat blijft bestaan ​​na het stoppen met roken.
Aangezien Fstl1 een TGF-β1 induceerbare factor is en TGF-β1 afgifte door bronchiale
epitheelcellen wordt verhoogd na sigarettenrook behandeling,33 suggereert dit
dat TGF-β1 de waargenomen up-regulatie van Fstl1 kan reguleren als reactie op
sigarettenrook.
Vervolgens hebben we de mogelijke rol van Fstl1 in longcellen onderzocht in het
reguleren van de lokale ontsteking (Hoofdstuk 5). Middels studies in verschillende
cellijnen bleek dat bronchiale epitheelcellen het meeste Fstl1 tot expressie brengen
en uitscheiden in vergelijking met mesenchymale cellen, zoals longfibroblasten en
luchtweggladde spiercellen (Hoofdstuk 5). Dit komt overeen met onze waarneming
in longweefsel van personen met een normale longfunctie dat Fstl1voornamelijk
tot expressie wordt gebracht in epitheelcellen, met name in het apicale deel
van trilhaarcellen en in mindere mate in gladde spiercellen in de luchtwegen
(Hoofdstuk 3). Andere studies in het hart en de gewrichten suggereren dat Fstl1 een
mesenchymaal uitgescheiden factor is.32,34
Gezien het feit dat Fstl1 bekend staat als een endogene antagonist van BMP
signalering in de longen,1,2 hebben wij de fosforylering van BMP-specifieke Smad1/5
onderzocht in longhomogenaten van COPD-patiënten (allen ex-rokers) in vergelijking
met personen zonder COPD met verschillend rookgedrag. Gefosforyleerd Smad1/5
bleek aanzienlijk verminderd in longhomogenaten van rokers zonder COPD, ex-
rokers zonder COPD en COPD stadium II en stadium IV patiënte (allen ex-rokers) 9
in vergelijking met mensen zonder COPD die nooit gerookt hebben (Hoofdstuk
3). Deze verminderde Smad1/5 fosforylering kan verklaard worden door de
verhoogde expressie van Fstl1, maar ook door verminderde pulmonaire BMP4
expressie. We vonden in de longhomogenaten echter geen significante verschillen
in BMP4 eiwitgehalten tussen de groepen (Hoofdstuk 3). In cellijnen wordt BMP4
hoofdzakelijk tot expressie gebracht in mesenchymale cellen, zoals longfibroblasten
en luchtweggladde spiercellen, terwijl humane bronchiale epitheelcellen de laagste
169
expressie en uitscheiding van BMP4 hebben. De fosforylering van Smad1/5 in de
cellijnen volgde dit patroon van BMP ligand expressie. De verschillende cellulaire
bronnen van liganden en hun remmers in de longen wijzen op een mogelijke
crosstalk tussen epitheliale en mesenchymale cellen in het aansturen van biologische
functies, met inbegrip van de regulering van inflammatoire cytokine afgifte. Door
deze bevindingen hebben we besloten om te onderzoeken wat de precieze rol
van Fstl1 in luchtwegontsteking in het algemeen, en de mogelijke bijdrage aan de
ontwikkeling van COPD in het bijzonder (Hoofdstuk 5).
De waargenomen toegenomen Fstl1 expressie in het luchtwegepitheel
patiënten met COPD werd nagebootst door Fstl1 tot overexpressie te brengen
in epitheelcellen, en het effect hiervan op pro-inflammatoire cytokine afgifte
van pulmonale mesenchymale cellen te bestuderen. Overexpressie van Fstl1 in
bronchiale epitheelcellen vergrootte de afgrifte van de ontstekingsfactoren IL-6
en GM-CSF wat duidt op een pro-inflammatoire functie (Hoofdstuk 5). Celmedium
verkregen van bronchiale epitheelcellen waarin Fstl1 tot overexpressie was gebracht
(Fstl1-CM) werd gebruikt om mesenchymale cellen mee te behandelen. Interessant
genoeg ontdekten we dat dit Fstl1-CM de IL-6 en IL-8-transcriptie en eiwit afgifte
door mesenchymale cellen verhoogde, wat suggereert dat Fstl1 pro-inflammatoire
cytokine afgifte in de longen zou kunnen reguleren. (Hoofdstuk 5). Hoewel eerdere
studies meldden dat Fstl1 de directe afgifte van IL-6 en IL-8 uit mesenchymale
cellen bevordert,6,8,35,36 vertonen onze gegevens met behulp van recombinante Fstl1
behandeling en overexpressie en knockdown van Fstl1 in longfibroblasten geen
enkel effect op het basale niveau van IL-1β geïnduceerde IL-6 en IL-8-eiwit afgifte,
wat suggereert dat Fstl1 op zichzelf onvoldoende is om cytokine afgifte te induceren
uit mesenchymale cellen. Derhalve hypothetiseren wij dat Fstl1 de afgifte van
ontstekingsmediatoren uit bronchiale epitheelcellen zou kunnen induceren, welke
op hun beurt de cytokineafgifte uit mesenchymale cellen reguleren. We hebben
verschillende uitgescheiden factoren geïdentificeerd als kandidaten voor het effect
van Fstl1-CM op IL-6 en IL-8 afgifte uit de longfibroblasten, namelijk IL-6, IL-8, GM-
CSF en RANTES, en hebben hun functionele bijdrage met behulp van experimenten
met neutraliserende antilichamen bevestigd. Onze studie geeft het eerste in vitro
bewijs dat Fstl1 de transcriptie en afgifte van inflammatoire cytokinen, zoals GM-CSF
en IL-6, induceert in bronchiale epitheelcellen, die vervolgens de afgifte van IL-6 en
IL-8 uit mesenchymale cellen kunnen stimuleren.
1. Fstl1 en metaplasie van slijmbekercellen in COPD: de rol van BMP4 in
volwassen epitheliale differentiatie
BMP signalering is cruciaal in het aansturen van de proximaal-naar-distale
patroonvorming van luchtwegepitheel in foetale en neonatale longontwikkeling.
In volwassen longen is actieve BMP signalering vereist voor epitheliale regeneratie
na letsel.37–42 BMP4 is een uitgescheiden mesenchymale factor die het lot van
epitheelcellen tijdens longontwikkeling bepaalt.43 Daarnaast is BMP4 vereist voor
epitheliale celdifferentiatie, omdat werd aangetoond dat de BMP4 expressie
170
tijdsafhankelijk was upgereguleerd in een transcriptieprofielbepaling.44
Het luchtwegepitheel is de eerste beschermende fysische en functionele
barrière van de luchtwegen en longen tegen de externe omgeving. Het epitheel van
luchtwegen in volwassen bestaat uit een gemengd evenwicht van slijmbekercellen,
trilhaarcellen, basale cellen en clubcellen die zijn verdeeld over de tracheobronchiale
boom.45 Slijmuitscheidende slijmbekercellen worden voornamelijk tot expressie
gebracht in het proximale epithelium, samen met de basale cellen, club cellen
en trilhaarcellen.46,47 In de distale, kleine bronchioli zijn er secretoire club cellen,
trilhaarcellen, en pulmonale neuro-endocriene cellen. Respiratoire longblaasjes zijn
bedekt met een dunne, enkele laag van platte type I en type II kubische alveolaire
epitheelcellen.48–50
Sigarettenrook verandert de samenstelling van luchtwegepitheel en draagt ​​bij
aan epitheliale remodeling bij COPD.51 Luchtwegepitheelremodeling bij COPD wordt
gekenmerkt door metaplasie van slijmbekercellen en basale cellen, en door verlies van
functionele clubcellen in de perifere en centrale luchtwegen.52–54 Variant clubcellen
(voorheen claracellen genoemd) zijn secretoire cellen die zich voornamelijk bevinden
in de distale luchtwegen en een beschermende rol hebben door het afscheiden van
uteroglobine, secretoglobine en surfactant, welke ontstekingsremmende functies
hebben en belangrijk zijn voor epitheliale regeneratie.55 Variant clubcellen hebben
stamcelachtige eigenschappen en zijn in staat tot zelfvernieuwing en differentiatie
tot trilhaarcellen en slijmbekercellen.50,56 Variant clubcellen hebben een duidelijke
afgeplatte morfologie en worden gekenmerkt door een afwezigheid van CC10 en
cytochroom p450 Cyp2f. Normale clubcellen vertonen een typisch kubusvormig
epitheliaal fenotype met hoge expressie van CC10 en cytochroom P450 Cyp2f,
waardoor ze gevoelig zijn voor naftaleen.55,57,58 Verlies van (variant) clubcellen is
waargenomen bij COPD.53,54,59,60 Lage serum niveaus van club cell secretory protein
(CC10, ook bekend als CC16 of SCGB1A1) worden niet alleen geassocieerd met de
ernst en prevalentie van COPD, maar ook met een daling van de longfunctie bij
COPD.61–65
Tijdens normale mucociliaire differentiatie ontstaan uit basale cellen direct of
indirect (via intermediaire clubcellen) slijmbekercellen en trilhaarcellen. Intrigerend
genoeg blijkt uit onze studie dat BMP4 basale celdifferentiatie in de richting van
variant clubcellen drijft en verdere differentiatie in de richting van slijmbekercellen
en trilharencellen onderdrukt (Hoofdstuk 7). Hoewel een eerdere studie een
rol voor BMP4 heeft aangetoond in proximale-distale epitheliale differentiatie
in de ontwikkelende longen,38 tonen wij als eerste aan dat BMP4 de variant
clubceldifferentiatie in volwassen humane epitheelcellen in ALI (air-liquid interface) 9
kweken bevordert.
Overeenkomstig met eerdere studies in COPD en longfibrose63,66,67 vonden
we dat de functionele BMP4 signalering (Smad1/5/8 fosforylering) is verminderd
in COPD, terwijl Fstl1 expressie is verhoogd (Hoofdstuk 3). Door het remmen van
de negatieve regulatie van de BMP signaaltransductieroute op differentiatie van
slijmbekercellen en basale cellen zou het Toegenomen Fstl1 in luchtwegepitheel
bij COPD kunnen bijdragen aan de epitheliale differentiatie in de richting van
171
slijmbekercelhyperplasie, basale celmetaplasie, en verlies van clubcellen. Dit zijn behandeling na 14 dagen in BMP4 behandelde cellen, zouden kunnen beantwoorden
typische kenmerken zijn van ge-remodeled distaal epitheel bij COPD. Onze studie of het effect van BMP4 omkeerbaar is, en of de schakeling naar het distale
toont een plausibel verband aan tussen het verlies van clubcellen en slijmbekercel- variant clubceldifferentiatieprogramma kan worden omgeleid naar een proximaal
en basale celmetaplasie enerzijds en de waargenomen vermindering van de BMP/ trilhaarceldifferentiatieprogramma. Eerder is aangetoond dat BMP-antagonisten
Smad signalering bij COPD-patiënten anderzijds.66,67 kunnen functioneren als een positieve regulator van basale celproliferatie.68,69 Een
Bovendien hebben we waargenomen dat BMP4 de expressie van zijn eigen aanhoudende toename van de BMP antagonist Fstl1 in COPD kan dus leiden tot
endogene antagonist Fstl1 induceert tijdens luchtwegepitheeldifferentiatie in een basale celproliferatie en basale celhyperplasie, wat gewoonlijk wordt waargenomen
tijds- en concentratieafhankelijke manier (Hoofdstuk 7). Dit impliceert dat Fstl1 in luchtwegepitheelremodeling bij COPD.
betrokken zou kunnen zijn bij BMP functies in epitheeldifferentiatie. Toekomstige Tijdens de longontwikkeling wordt Fstl1 tot expressie gebracht door
studies met Fstl1-CM of Fstl1 neutraliserend antilichaam, en het staken van BMP4 slijmbekercellen,70 terwijl het in de gezonde volwassen longen voornamelijk de
trilhaarcellen zijn die Fstl1 tot expressie brengen (Hoofdstuk 3 en 5). Daarentegen
wordt BMP4 voornamelijk tot expressie gebracht door mesenchymale cellen, zoals
BMP4 longfibroblasten en luchtweggladde spiercellen. Daarom vermoed ik dat epitheliale-
mesenchymale communicatie via BMP-signalering een belangrijke regulator van
Hoofdstuk 7 slijmbekercelmetaplasie verlies van clubcellen
trilhaarcel en slijmbekercel differentiatie is.77
Daarnaast vonden we dat BMP-behandelde cellen verhoogde expressie van
zognaamde Notch-gereguleerde genen hebben (Hoofdstuk 3). Notch bepaalt het
Hoofdstuk 3
uiteindelijke lot van epitheelcellen in de luchtwegen. Daarom is het belangrijk de
Fstl1
crosstalk tussen BMP en Notch bij longherstel van de volwassen longen te begrijpen
om de afwijkende regeneratie van geremodeled epitheel bij COPD te verklaren. In
Fstl1
COPD zijn Notch signaleringscomponenten, zoals Hey1 en Hey2, gedownreguleerd.63
Hoofdstuk 5 Crosstalk tussen BMP en Notch signalering wordt ook waargenomen tijdens de
GM-CSF postnatale ontwikkeling van de longen, waar endotheliale deletie van Fstl1 in Fstl1-
RANTES
IL-6
eKO muizen was geassocieerd met verhoogde BMP-gereguleerd Jagged1 (Hoofdstuk
IL-8 2). Daarnaast werden de Notch targetgenen Hey1 en Hey3 verhoogd tot expressie
mesenchymale cellen
gebracht in primaire humane bronchiale epitheelcellen na stimulatie met BMP4.
Deze waarnemingen suggereren dat soortgelijke mechanismen een rol spelen in
IL-6
IL-8 volwassen longcellen en in de ontwikkeling van de longen. Het zou interessant zijn
om de samenstelling van het epitheel van de luchtwegen van Fstl1-eKO muizen
te karakteriseren om te onderzoeken of variant clubcellen overheersen in het
epitheel van Fstl1 deficiënte muizen. Daarnaast zijn toekomstige studies nodig om
te onderzoeken of de remming van Notch signalering door middel van het gebruik
neutrofielen macrofagen
van neutraliserende antilichamen, BMP-geïnduceerde variant club cel differentiatie
in het ALI kweeksysteem kan remmen.
Samengevat tonen onze studies aan dat BMP4 de differentiatie van
slijmbekercellen remt, terwijl het de differentiatie van variant club-cellen bevordert.
Luchtwegontsteking
Herstel van deze onbalans in de longen van COPD patiënten zou een nieuwe strategie 9
Figuur 2. De pathologische gevolgen van het toegenomen Fstl1 niveau in het epitheel kunnen zijn om het herstel van de waargenomen verminderde BMP-gereguleerde
van de luchtwegen van COPD-patiënten. De expressie van het Fstl1 eiwit is toegenomen Smad1/5 in COPD longen te verbeteren, alsmede om het verlies van clubcellen tegen
in het luchtwegepitheel van COPD patiënten. Fstl1 is een pro-inflammatoir cytokine dat
de epitheliale-mesenchymale communicatie bij IL-6 en IL-8 afgifte medieert. Zo kan Fstl1 te gaan en de metaplasie van slijmbekercellen te verminderen. Onze studie spoort
bijdragen aan de rekrutering van neutrofielen en macrofagen naar de longen. BMP4 remt toekomstige studies aan om een ​​dergelijke strategie te onderzoeken in modellen
de differentiatie van slijmbekercellen, terwijl het de differentiatie van variant clubcellen in voor luchtwegepitheel schade en herstel in vitro en in vivo. De pathologische
het epitheel van de luchtwegen van de volwassen mens bevordert. Toegenomenase Fstl1 in
het epitheel van de luchtwegen bij COPD kan zo slijmbekercel hyperplasie bevorderen en het gevolgen van het toegenomen Fstl1 niveau in het epitheel van de luchtwegen van
verlies van clubcellen in de hand werken. COPD-patiënten is weergegeven in Figuur 2.

172 173
2. Toekomstperspectieven
De in dit proefschrift gepresenteerde gegevens belichten de tot nu toe onbekende
rol van Fstl1/BMP signalering in COPD en bespreken de mogelijke gevolgen van
verhoogde expressie van het Fstl1 eiwit bij luchtwegontsteking en epitheliale
remodeling.
PAH is een veel voorkomende comorbiditeit bij COPD.71,72 Onze studie biedt in
vivo bewijs voor een belangrijke rol voor endotheliaal Fstl1 in het titreren van de
niveaus van BMP/Smad signalering tijdens de postnatale ontwikkeling van de longen
(Hoofdstuk 2). Echter, de rechtstreekse link en de specifieke functies van endotheliaal
Fstl1 in pulmonale arteriële celproliferatie van gladde spiercellen en bij de regulatie
van actine remodeling in pulmonale arteriële gladde spiercellen in de longen van
pasgeborenen en in COPD longen moet nog worden opgehelderd. Ongecontroleerde
proliferatie van pulmonale arteriële gladde spiercellen en verminderde actine
remodeling dragen bij aan vaatvernauwing in PAH. Ex vivo studies met precision-cut
lung slices zouden meer duidelijkheid kunnen scheppen over de functionele bijdrage
van endotheliaal Fstl1 aan vernauwing van de longvaten. Een in vitro experiment
met een co-kweeksysteem van humane long microvasculaire endotheelcellen en
vasculaire gladde spiercellen zou de vraag kunnen beantwoorden hoe communicatie
tussen deze celtypen de remodeling en vaatvernauwing reguleert.
In longvaten van COPD-patiënten zagen we een toename van Fstl1 eiwitexpressie
in endotheelcellen en vasculaire gladde spiercellen in vergelijking met personen
met een normale longfunctie (Hoofdstuk 3). Hoewel celspecifieke expressie van
door BMP gefosforyleerde Smad signalering niet werd onderzocht, bleek dat de
BMP-Smad gereguleerde activatie in longhomogenaten van COPD patiënten was
verminderd vergeleken met controles zonder COPD (Hoofdstuk 3). Activering van
BMP signalering is verminderd bij patiënten met idiopathische PAH.73–75 Echter, de
bijdrage van Fstl1 aan deze verlaging werd niet onderzocht. Eerdere studies toonden
aan dat een endogene BMP-remmer, Gremlin, was verhoogd in endotheelcellen van
idiopathische PAH en van PAH veroorzaakt door zuurstofgebrek.76 Bovendien was bij
haploinsufficiëntie van Gremlin 1 de pulmonale vasculaire weerstand verminderd
door het verzwakken van vasculaire remodeling,76 wat suggereert dat remming
van BMP leidt tot vasculaire structurele veranderingen en tot vaatvernauwing.86
Uit recent onderzoek blijkt dat Fstl1 de BMP/Smad signalering kan remmen, terwijl
het de TGF-β-geïnduceerde α-smooth muscle actin expressie door longfibroblasten
vergemakkelijkt, waardoor wordt bijgedragen aan extracellulaire matrix remodeling
en luchtwegfibrose.9 Het zou zo kunnen zijn dat Fstl1 de α-smooth muscle actin-
productie door vasculaire gladde spieren verhoogt en structurele vasculaire
veranderingen bevordert, waarmee het uiteindelijk bijdraagt ​​aan toegenomen
vaatweerstand en PAH. Een toekomstige studie ter evaluatie van het verband tussen
Fstl1 expressie en pulmonale vaatfunctie bij patiënten met PAH secundair aan COPD
zou waardevol zijn om uit te voeren.
Dit proefschrift onderzocht ook de mogelijke gevolgen van de toegenomen
Fstl1 expressie bij COPD, met name in het epitheel van de luchtwegen. Een pro-
inflammatoire rol voor Fstl1, welke epitheliale-mesenchymale communicatie
174
medieert bij de afgifte van cytokinen (Hoofdstuk 4), zou kunnen bijdragen aan de
aangeboren immuunrespons van de long die volgt op blootstelling aan bijvoorbeeld
sigarettenrook. Om inzicht te verkrijgen in de mogelijke signaaltransductieroutes
die betrokken zijn bij Fstl1-aangedreven lokale luchtwegontsteking in de longen
zijn verdere studies nodig om de receptor(en) waarmee Fstl1 zijn werking in
epitheelcellen en in pulmonaire mesenchymale cellen uitoefent te identificeren.
Verder tonen we aan dat BMP4 de differentiatie van slijmbekercellen remt,
terwijl het de differentiatie van variant clubcellen bevordert (Hoofdstuk 5). Follow-up
studies met behulp van muismodellen van COPD zijn nodig om het functionele effect
van de toegenomen Fstl1 in het luchtwegepitheel te onderzoeken, om te beoordelen
of dit de BMP signalering remt en aldus ​​bijdraagt aan de slijmbekercelmetaplasie en
het verlies van variant clubcellen. Experimenten met behulp van neutraliserende
antilichamen tegen Fstl1 zouden waardevol zijn om deze implicaties te onderzoeken.
Gezien de postnatale sterfte van Fstl1-eKO muizen (Hoofdstuk 2) wat verdere studies
in sigarettenrook-geïnduceerde COPD muismodellen belemmert, zijn follow-up in
vivo studies met behulp van doxycycline geïnduceerde epitheel-specifieke Fstl1-
KO de moeite waard om de betrokkenheid van epitheliaal-uitgescheiden Fstl1 in
de ontwikkeling van COPD te bestuderen. Verder kan het van belang zijn om Fstl1
expressie en BMP-gereguleerde Smad-fosforylering in de proximale geleidende
luchtwegen en de distale luchtwegen te onderzoeken om te bepalen of er een verband
is tussen de relatieve expressie (ratio) van BMP/Fstl1 en de epitheelcelsamenstelling
in de luchtwegen bij COPD.
Samengevat speelt een verstoorde activering van Fstl1/BMP
signaaltransductie na epitheel- en vasculaire schade een rol bij COPD. Het is tevens
belangrijk om de functionele rol van de Fstl1/BMP as tijdens longontwikkeling te
begrijpen. Dit zal leiden tot beter begrip van het abnormale weefselherstelproces
bij COPD.
9
175
References
1. Sylva M, Li VSW, Buffing AAA, et al. The BMP antagonist follistatin-like 1 is required for skeletal
and lung organogenesis. PloS One. 2011;6(8):e22616. doi:10.1371/journal.pone.0022616.
2. Geng Y, Dong Y, Yu M, et al. Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP)
4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A.
2011;108(17):7058-7063. doi:10.1073/pnas.1007293108.
3. Umezu T, Yamanouchi H, Iida Y, Miura M, Tomooka Y. Follistatin-like-1, a diffusible mesenchymal
factor determines the fate of epithelium. Proc Natl Acad Sci U S A. 2010;107(10):4601-4606.
doi:10.1073/pnas.0909501107.
4. Hayakawa S, Ohashi K, Shibata R, et al. Cardiac Myocyte-Derived Follistatin-Like 1 Prevents
Renal Injury in a Subtotal Nephrectomy Model. J Am Soc Nephrol JASN. 2015;26(3):636-646.
doi:10.1681/ASN.2014020210.
5. Zhou X, Xiao X, Huang T, et al. Epigenetic inactivation of follistatin-like 1 mediates tumor immune
evasion in nasopharyngeal carcinoma. Oncotarget. 2016;7(13):16433-16444. doi:10.18632/
oncotarget.7654.
6. Miyamae T, Marinov AD, Sowders D, et al. Follistatin-Like Protein-1 Is a Novel Proinflammatory
Molecule. J Immunol. 2006;177(7):4758-4762. doi:10.4049/jimmunol.177.7.4758.
7. Clutter SD, Wilson DC, Marinov AD, Hirsch R. Follistatin-Like Protein 1 Promotes Arthritis by Up-
Regulating IFN-γ. J Immunol. 2009;182(1):234-239. doi:10.4049/jimmunol.182.1.234.
8. Chaly Y, Marinov AD, Oxburgh L, Bushnell DS, Hirsch R. FSTL1 promotes arthritis in mice by
enhancing inflammatory cytokine/chemokine expression. Arthritis Rheum. 2012;64(4):1082-
1088. doi:10.1002/art.33422.
9. Dong Y, Geng Y, Li L, et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary
fibrosis in mice. J Exp Med. 2015;212(2):235-252. doi:10.1084/jem.20121878.
10. Liu R, Yang Y, Shen J, et al. Fstl1 is involved in the regulation of radial glial scaffold development.
Mol Brain. 2015;8:53. doi:10.1186/s13041-015-0144-8.
11. Murphy N, Gaynor KU, Rowan SC, et al. Altered Expression of Bone Morphogenetic Protein
Accessory Proteins in Murine and Human Pulmonary Fibrosis. Am J Pathol. 2016;186(3):600-
615. doi:10.1016/j.ajpath.2015.10.032.
12. Miller M, Beppu A, Rosenthal P, et al. Fstl1 Promotes Asthmatic Airway Remodeling by
Inducing Oncostatin M. J Immunol Baltim Md 1950. 2015;195(8):3546-3556. doi:10.4049/
jimmunol.1501105.
13. Miller M, Esnault S, Kurten RC, et al. Segmental allergen challenge increases levels of airway
follistatin-like 1 in patients with asthma. J Allergy Clin Immunol. 2016;138(2):596-599.e4.
doi:10.1016/j.jaci.2016.01.019.
14. Gangopahyay A, Oran M, Bauer EM, et al. Bone morphogenetic protein receptor II is a novel
mediator of endothelial nitric-oxide synthase activation. J Biol Chem. 2011;286(38):33134-
33140. doi:10.1074/jbc.M111.274100.
15. Xu J, Zhu D, Sonoda S, et al. Over-expression of BMP4 inhibits experimental choroidal
neovascularization by modulating VEGF and MMP-9. Angiogenesis. 2012;15(2):213-227.
doi:10.1007/s10456-012-9254-4.
16. Moreno-Miralles I, Ren R, Moser M, Hartnett ME, Patterson C. Bone morphogenetic protein
endothelial cell precursor-derived regulator regulates retinal angiogenesis in vivo in a mouse
model of oxygen-induced retinopathy. Arterioscler Thromb Vasc Biol. 2011;31(10):2216-2222.
doi:10.1161/ATVBAHA.111.230235.
17. Helbing T, Rothweiler R, Ketterer E, et al. BMP activity controlled by BMPER regulates the
proinflammatory phenotype of endothelium. Blood. 2011;118(18):5040-5049. doi:10.1182/
blood-2011-03-339762.
18. Yao Y, Jumabay M, Wang A, Boström KI. Matrix Gla protein deficiency causes arteriovenous
malformations in mice. J Clin Invest. 2011;121(8):2993-3004. doi:10.1172/JCI57567.
19. Suzuki Y, Ohga N, Morishita Y, Hida K, Miyazono K, Watabe T. BMP-9 induces proliferation of
multiple types of endothelial cells in vitro and in vivo. J Cell Sci. 2010;123(Pt 10):1684-1692.
doi:10.1242/jcs.061556.
20. Kool H, Mous D, Tibboel D, de Klein A, Rottier RJ. Pulmonary vascular development goes awry in
congenital lung abnormalities. Birth Defects Res Part C Embryo Today Rev. 2014;102(4):343-358.
176
doi:10.1002/bdrc.21085.
21. International PPH Consortium, Lane KB, Machado RD, et al. Heterozygous germline mutations
in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. Nat
Genet. 2000;26(1):81-84. doi:10.1038/79226.
22. Machado RD, Aldred MA, James V, et al. Mutations of the TGF-beta type II receptor BMPR2 in
pulmonary arterial hypertension. Hum Mutat. 2006;27(2):121-132. doi:10.1002/humu.20285.
23. Harrison RE, Flanagan JA, Sankelo M, et al. Molecular and functional analysis identifies ALK-
1 as the predominant cause of pulmonary hypertension related to hereditary haemorrhagic
telangiectasia. J Med Genet. 2003;40(12):865-871.
24. Fujiwara M, Yagi H, Matsuoka R, et al. Implications of mutations of activin receptor-like kinase
1 gene (ALK1) in addition to bone morphogenetic protein receptor II gene (BMPR2) in children
with pulmonary arterial hypertension. Circ J Off J Jpn Circ Soc. 2008;72(1):127-133.
25. Johnson DW, Berg JN, Baldwin MA, et al. Mutations in the activin receptor-like kinase 1 gene in
hereditary haemorrhagic telangiectasia type 2. Nat Genet. 1996;13(2):189-195. doi:10.1038/
ng0696-189.
26. McAllister KA, Grogg KM, Johnson DW, et al. Endoglin, a TGF-beta binding protein of endothelial
cells, is the gene for hereditary haemorrhagic telangiectasia type 1. Nat Genet. 1994;8(4):345-
351. doi:10.1038/ng1294-345.
27. Pi X, Lockyer P, Dyer LA, et al. Bmper inhibits endothelial expression of inflammatory adhesion
molecules and protects against atherosclerosis. Arterioscler Thromb Vasc Biol. 2012;32(9):2214-
2222. doi:10.1161/ATVBAHA.112.252015.
28. Yao Y, Yao J, Radparvar M, et al. Reducing Jagged 1 and 2 levels prevents cerebral arteriovenous
malformations in matrix Gla protein deficiency. Proc Natl Acad Sci U S A. 2013;110(47):19071-
19076. doi:10.1073/pnas.1310905110.
29. Jain RK. Molecular regulation of vessel maturation. Nat Med. 2003;9(6):685-693. doi:10.1038/
nm0603-685.
30. Knight D. Epithelium–fibroblast interactions in response to airway inflammation. Immunol Cell
Biol. 2001;79(2):160-164. doi:10.1046/j.1440-1711.2001.00988.x.
31. Osei ET, Brandsma C-A, Noordhoek JA, Timens W, Postma D, Heijink I. Crosstalk between
epithelium and fibroblasts; implications for COPD. Eur Respir J. 2014;44(Suppl 58):P3899.
32. Ouchi N, Oshima Y, Ohashi K, et al. Follistatin-like 1, a secreted muscle protein, promotes
endothelial cell function and revascularization in ischemic tissue through a nitric-oxide synthase-
dependent mechanism. J Biol Chem. 2008;283(47):32802-32811. doi:10.1074/jbc.M803440200.
33. Shibanuma M, Mashimo J, Mita A, Kuroki T, Nose K. Cloning from a mouse osteoblastic cell line
of a set of transforming-growth-factor-beta 1-regulated genes, one of which seems to encode a
follistatin-related polypeptide. Eur J Biochem FEBS. 1993;217(1):13-19.
34. Wilson DC, Marinov AD, Blair HC, et al. Follistatin-like protein 1 is a mesenchyme-derived
inflammatory protein and may represent a biomarker for systemic-onset juvenile rheumatoid
arthritis. Arthritis Rheum. 2010;62(8):2510-2516. doi:10.1002/art.27485.
35. Murakami K, Tanaka M, Usui T, et al. Follistatin-related protein/follistatin-like 1 evokes an
innate immune response via CD14 and toll-like receptor 4. FEBS Lett. 2012;586(4):319-324.
doi:10.1016/j.febslet.2012.01.010.
36. Fan N, Sun H, Wang Y, et al. Follistatin-Like 1: A Potential Mediator of Inflammation in Obesity.
Mediators Inflamm. 2013;2013:e752519. doi:10.1155/2013/752519.
37. Bellusci S, Henderson R, Winnier G, Oikawa T, Hogan BL. Evidence from normal expression
and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse 9
embryonic lung morphogenesis. Dev Camb Engl. 1996;122(6):1693-1702.
38. Weaver M, Yingling JM, Dunn NR, Bellusci S, Hogan BL. Bmp signaling regulates proximal-distal
differentiation of endoderm in mouse lung development. Dev Camb Engl. 1999;126(18):4005-
4015.
39. Sountoulidis A, Stavropoulos A, Giaglis S, et al. Activation of the canonical bone morphogenetic
protein (BMP) pathway during lung morphogenesis and adult lung tissue repair. PloS One.
2012;7(8):e41460. doi:10.1371/journal.pone.0041460.
40. Ninomiya N, Michiue T, Asashima M, Kurisaki A. BMP signaling regulates the differentiation
of mouse embryonic stem cells into lung epithelial cell lineages. In Vitro Cell Dev Biol Anim.
177
 2013;49(3):230-237. doi:10.1007/s11626-013-9589-1.
41. Huang SXL, Islam MN, O’Neill J, et al. Highly efficient generation of airway and lung epithelial cells
from human pluripotent stem cells. Nat Biotechnol. 2014;32(1):84-91. doi:10.1038/nbt.2754.
42. Huang SXL, Green MD, de Carvalho AT, et al. The in vitro generation of lung and airway progenitor
cells from human pluripotent stem cells. Nat Protoc. 2015;10(3):413-425. doi:10.1038/
nprot.2015.023.
43. Morrisey EE, Hogan BLM. Preparing for the first breath: genetic and cellular mechanisms in lung
development. Dev Cell. 2010;18(1):8-23. doi:10.1016/j.devcel.2009.12.010.
44. Ross AJ, Dailey LA, Brighton LE, Devlin RB. Transcriptional profiling of mucociliary differentiation
in human airway epithelial cells. Am J Respir Cell Mol Biol. 2007;37(2):169-185. doi:10.1165/
rcmb.2006-0466OC.
45. Fahy JV, Dickey BF. Airway Mucus Function and Dysfunction. N Engl J Med. 2010;363(23):2233-
2247. doi:10.1056/NEJMra0910061.
46. Hong KU, Reynolds SD, Watkins S, Fuchs E, Stripp BR. Basal cells are a multipotent progenitor
capable of renewing the bronchial epithelium. Am J Pathol. 2004;164(2):577-588. doi:10.1016/
S0002-9440(10)63147-1.
47. Rock JR, Onaitis MW, Rawlins EL, et al. Basal cells as stem cells of the mouse trachea and
human airway epithelium. Proc Natl Acad Sci U S A. 2009;106(31):12771-12775. doi:10.1073/
pnas.0906850106.
48. Kimura J, Deutsch GH. Key mechanisms of early lung development. Pediatr Dev Pathol Off J Soc
Pediatr Pathol Paediatr Pathol Soc. 2007;10(5):335-347. doi:10.2350/07-06-0290.1.
49. Rawlins EL, Hogan BLM. Epithelial stem cells of the lung: privileged few or opportunities for
many? Dev Camb Engl. 2006;133(13):2455-2465. doi:10.1242/dev.02407.
50. Kotton DN, Morrisey EE. Lung regeneration: mechanisms, applications and emerging stem cell
populations. Nat Med. 2014;20(8):822-832. doi:10.1038/nm.3642.
51. Schamberger AC, Staab-Weijnitz CA, Mise-Racek N, Eickelberg O. Cigarette smoke alters primary
human bronchial epithelial cell differentiation at the air-liquid interface. Sci Rep. 2015;5.
doi:10.1038/srep08163.
52. Saetta M, Turato G, Baraldo S, et al. Goblet cell hyperplasia and epithelial inflammation
in peripheral airways of smokers with both symptoms of chronic bronchitis and chronic
airflow limitation. Am J Respir Crit Care Med. 2000;161(3 Pt 1):1016-1021. doi:10.1164/
ajrccm.161.3.9907080.
53. Gamez AS, Gras D, Petit A, et al. Supplementing defect in club cell secretory protein attenuates
airway inflammation in COPD. Chest. 2015;147(6):1467-1476. doi:10.1378/chest.14-1174.
54. Pilette C, Godding V, Kiss R, et al. Reduced epithelial expression of secretory component in small
airways correlates with airflow obstruction in chronic obstructive pulmonary disease. Am J
Respir Crit Care Med. 2001;163(1):185-194. doi:10.1164/ajrccm.163.1.9912137.
55. Guha A, Vasconcelos M, Cai Y, et al. Neuroepithelial body microenvironment is a niche
for a distinct subset of Clara-like precursors in the developing airways. Proc Natl Acad Sci.
2012;109(31):12592-12597. doi:10.1073/pnas.1204710109.
56. Barnes PJ. CLub cells, their secretory protein, and copd. Chest. 2015;147(6):1447-1448.
doi:10.1378/chest.14-3171.
57. Hung KS. Development of neuroepithelial bodies in pre- and postnatal mouse lungs: scanning
electron microscopic study. Anat Rec. 1982;203(2):285-291. doi:10.1002/ar.1092030210.
58. Reynolds SD, Giangreco A, Power JH, Stripp BR. Neuroepithelial bodies of pulmonary airways
serve as a reservoir of progenitor cells capable of epithelial regeneration. Am J Pathol.
2000;156(1):269-278. doi:10.1016/S0002-9440(10)64727-X.
59. Shijubo N, Itoh Y, Yamaguchi T, et al. Clara cell protein-positive epithelial cells are reduced in
small airways of asthmatics. Am J Respir Crit Care Med. 1999;160(3):930-933. doi:10.1164/
ajrccm.160.3.9803113.
60. Rokicki W, Rokicki M, Wojtacha J, Dżeljijli A. The role and importance of club cells (Clara cells) in
the pathogenesis of some respiratory diseases. Kardiochirurgia Torakochirurgia Pol Pol J Cardio-
Thorac Surg. 2016;13(1):26-30. doi:10.5114/kitp.2016.58961.
61. Bernard A, Marchandise FX, Depelchin S, Lauwerys R, Sibille Y. Clara cell protein in serum and
bronchoalveolar lavage. Eur Respir J. 1992;5(10):1231-1238.
178
62. Vestbo J, Edwards LD, Scanlon PD, et al. Changes in Forced Expiratory Volume in 1 Second over
Time in COPD. N Engl J Med. 2011;365(13):1184-1192. doi:10.1056/NEJMoa1105482.
63. Park HY, Churg A, Wright JL, et al. Club cell protein 16 and disease progression in chronic
obstructive pulmonary disease. Am J Respir Crit Care Med. 2013;188(12):1413-1419.
doi:10.1164/rccm.201305-0892OC.
64. Lomas DA, Silverman EK, Edwards LD, et al. Evaluation of serum CC-16 as a biomarker for COPD
in the ECLIPSE cohort. Thorax. 2008;63(12):1058-1063. doi:10.1136/thx.2008.102574.
65. Guerra S, Halonen M, Vasquez MM, et al. The relation of circulating CC16 to lung function growth,
decline, and development of COPD across the lifespan. Lancet Respir Med. 2015;3(8):613-620.
doi:10.1016/S2213-2600(15)00196-4.
66. Myllärniemi M, Lindholm P, Ryynänen MJ, et al. Gremlin-mediated decrease in bone
morphogenetic protein signaling promotes pulmonary fibrosis. Am J Respir Crit Care
Med. 2008;177(3):321-329. doi:10.1164/rccm.200706-945OC.
67. De Langhe E, Cailotto F, De Vooght V, et al. Enhanced endogenous bone morphogenetic
protein signaling protects against bleomycin induced pulmonary fibrosis. Respir Res.
2015;16:38. doi:10.1186/s12931-015-0202-x.
68. Cibois M, Luxardi G, Chevalier B, et al. BMP signalling controls the construction of
vertebrate mucociliary epithelia. Development. 2015;142(13):2352-2363. doi:10.1242/
dev.118679.
69. Tadokoro T, Gao X, Hong CC, Hotten D, Hogan BLM. BMP signaling and cellular
dynamics during regeneration of airway epithelium from basal progenitors. Dev Camb
Engl. 2016;143(5):764-773. doi:10.1242/dev.126656.
70. Adams D, Larman B, Oxburgh L. Developmental expression of mouse Follistatin-like 1
(Fstl1): Dynamic regulation during organogenesis of the kidney and lung. Gene Expr
Patterns. 2007;7(4):491-500. doi:10.1016/j.modgep.2006.10.009.
71. Siafakas NM, Antoniou KM, Tzortzaki EG. Role of angiogenesis and vascular
remodeling in chronic obstructive pulmonary disease. Int J Chron Obstruct Pulmon Dis.
2007;2(4):453-462.
72. Hashimoto M, Tanaka H, Abe S. Quantitative analysis of bronchial wall vascularity in the
medium and small airways of patients with asthma and COPD. Chest. 2005;127(3):965-
972. doi:10.1378/chest.127.3.965.
73. Morty RE, Nejman B, Kwapiszewska G, et al. Dysregulated bone morphogenetic protein
signaling in monocrotaline-induced pulmonary arterial hypertension. Arterioscler
Thromb Vasc Biol. 2007;27(5):1072-1078. doi:10.1161/ATVBAHA.107.141200.
74. Takahashi K, Kogaki S, Matsushita T, Nasuno S, Kurotobi S, Ozono K. Hypoxia induces alteration
of bone morphogenetic protein receptor signaling in pulmonary artery endothelial cell. Pediatr
Res. 2007;61(4):392-397. doi:10.1203/pdr.0b013e3180332cba.
75. Long L, Crosby A, Yang X, et al. Altered Bone Morphogenetic Protein and Transforming
Growth Factor-β Signaling in Rat Models of Pulmonary Hypertension. Circulation.
2009;119(4):566-576. doi:10.1161/CIRCULATIONAHA.108.821504.
76. Cahill E, Rowan SC, Sands M, et al. The pathophysiological basis of chronic
hypoxic pulmonary hypertension in the mouse: vasoconstrictor and structural
mechanisms contribute equally. Exp Physiol. 2012;97(6):796-806. doi:10.1113/ 9
expphysiol.2012.065474.
179
 CHAPTER 10 1

INDONESIAN SUMMARY/
RANGKUMAN DALAM
BAHASA INDONESIA

181
Pendahuluan
Penyakit paru obstruktif kronik (PPOK) merupakan penyakit yang ditandai dengan
penyumbatan aliran udara yang bersifat irreversible dan memburuk seiring
waktu disertai dengan peradangan saluran pernapasan yang berlebihan. Seperti
yang dijelaskan pada bab pengantar (Bab 1), keseimbangan antara protein bone
morfogenetik protein 4 (BMP4) dan inhibitor alaminya, Follistatin-like 1 (Fstl1) sangat
penting dalam pertumbuhan paru-paru embrio normal1,2 dan dalam menjalankan
fungsi biologis normal pada paru-paru dewasa.3–5 Beberapa penelitian sebelumnya
menunjukkan bahwa Fstl1 berfungsi sebagai regulator sistem imun pada berbagai
penyakit inflamasi.6–8 Namun, fungsi dari Fstl1 dalam perkembangan paru-paru
setelah kelahiran dan paru-paru penderita PPOK belum pernah diteliti sebelumnya.
Baru-baru ini, beberapa hasil penelitian menunjukkan fungsi penting dari Fstl1 dalam
perkembangan fibrosis paru-paru dan alergi asma.9–13 Penelitian yang dipaparkan
dalam tesis ini menunjukkan bahwa Fstl1 diperlukan untuk perkembangan pembuluh
paru-paru setelah kelahiran pada hewan model mencit (Bab 2). Selain itu, penelitian
ini juga menunjukkan peningkatan ekspresi protein Fstl1 pada sel epitel saluran
pernapasan pasien penderita PPOK (Bab 3). Implikasi dari meningkatnya ekspresi
protein Fstl1 pada sel epitel saluran pernapasan juga didiskusikan pada tesis ini. Hasil
penelitian ini menunjukkan bahwa Fstl1 yang dihasilkan oleh sel-sel epitel saluran
pernapasan berperan sebagai mediator peradangan pada paru-paru (Bab 5). Lebih
lanjut, hasil penelitian ini juga menunjukkan bahwa BMP4 mengatur diferensiasi sel
epitel saluran pernapasan menjadi sel klub varian (Bab 7).
1. Fungsi Fstl1 dalam perkembangan paru-paru
Perkembangan saluran pernapasan dan sistem pembuluh paru-paru yang fungsional
diatur secara ketat oleh berbagai jalur pensinyalan molekuler dalam sel. Pensinyalan
molekuler oleh BMP sangat penting dalam proses pertumbuhan dan perkembangan
paru-paru, dengan mengatur proliferasi dan migrasi sel-sel otot polos and sel-
sel endotel pembuluh,14–18 serta dalam proses percabangan saluran pernapasan
dan pembuluh paru-paru.19 Salah satu penyakit genetik pembuluh darah yang
disebabkan pensinyalan molekuler BMP yang tidak terkoordinasi baik adalah
hipertensi arteri pulmonari (PAH).20–28 Sejalan dengan peran utama pensinyalan
molekuler BMP, mencit yang tidak mengekspresikan gen Fstl1 (Fstl1-knockout [KO])
mempunyai ukuran paru-paru yang lebih kecil dan memiliki alveolar septa yang
lebih tebal dibandingkan mencit wildtype. Mencit Fstl1-KO juga menderita sesak
napas dan meninggal sesaat setelah lahir.1,2 Penelitian ini menunjukkan bahwa Fstl1
berfungsi untuk morfogenesis dan alveolarisasi paru-paru selama perkembangan
embrio. Hasil penelitian yang dipaparkan pada tesis ini menunjukkan bahwa mencit
dengan delesi gen Fstl1 spesifik pada sel-sel endotelium (Fstl1-eKO) juga menderita
sesak napas dan hanya bertahan hidup selama 21 hari setelah dilahirkan (Bab 2).
Kematian setelah kelahiran pada mencit Fstl1-eKO menunjukkan fungsi penting dari
182
Fstl1 pada sel-sel endotelium dalam perkembangan pembuluh paru-paru setelah
kelahiran. Pada mencit, hari ke-5 hingga ke-30 setelah kelahiran adalah tahap yang
penting untuk pembentukan, perkembangan, dan maturasi alveoli serta pembuluh
darah paru-paru.19,29 Pembentukan dan percabangan jaringan saluran pernapasan
dan pembuluh darah harus terkoordinasi dengan baik sehingga paparan darah
terhadap oksigen optimal.19 Pembentukan jaringan pembuluh kecil paru-paru pada
mencit Fstl1-eKO mungkin terganggu sehingga menyebabkan gangguan pernapasan
(Bab 2).
Meskipun perubahan struktur pembuluh besar arteri otot dan elastis pada
mencit Fstl1-eKO minimal, persentase pembuluh kecil paru-paru yang positif
mengekspresikan protein aktin meningkat pada hari ke-21 setelah kelahiran (Bab
2). Selain itu, output darah dari ventrikel kanan (right ventricular output) menurun
pada mencit Fstl1-eKO pada hari ke-21 setelah kelahiran (Bab 2). Molekuler analisis
pada mencit Fstl1-eKO menunjukkan bahwa Smad1/5/8 terfosforilasi - indikator
aktifnya pensinyalan molekuler BMP - dan ekspresi protein-protein yang diatur oleh
BMP (Jagged1, endoglin, dan endothelin-1) meningkat pada pada hari ke-7 setelah
kelahiran (Bab 2).
Regulasi vasokonstriksi yang dinamis diatur oleh perubahan molekuler,
termasuk peningkatan endothelin-130,31 dan/atau perubahan morfologi pada
jaringan otot polos, termasuk meningkatnya proliferasi sel otot polos pembuluh
darah dan jumlah ekspresi protein aktin pada pembuluh paru-paru.32,33 Pada mencit
wildtype transisi regulasi vasokonstriksi dari molekuler ke perubahan morfologi
dapat diobservasi (Bab 2). Peningkatan ekspresi protein endothelin-1 terjadi
secara bersamaan dengan menurunnya persentase pembuluh kecil paru-paru
yang aktin pada hari ke-14 dibandingkan pada hari ke-7 setelah kelahiran. Transisi
ini normal dan tidak mematikan (Bab 2).Namun pada mencit Fstl1-eKO, ekspresi
protein endothelin-1 sudah tinggi pada hari ke-7 dan tetap tinggi pada hari ke-21
setelah kelahiran, sedangkan persentase pembuluh kecil paru-paru yang positif
aktin tidak menurun pada hari ke-21 setelah kelahiran (Bab 2). Kombinasi ekspresi
endothelin-1 yang tinggi dan persentase pembuluh kecil paru-paru yang positif
aktin yang tinggi menyebabkan peningkatan resistensi pembuluh darah paru-paru
dan menyebabkan vasokonstriksi (Bab 2). Namun, berdasarkan rasio pulmonary
acceleration time terhadap ejection time (PAT/ET), tidak ada perbedaan yang
signifikan pada resistensi pembuluh paru-paru pada mencit Fstl1-eKO dibandingkan
dengan mencit kontrol baik pada hari ke-7 maupun ke-21 setelah kelahiran (Bab
2). Resistensi pembuluh paru-paru yang diukur pada katup arteri besar pulmonalis
tidak menunjukkan adanya stenosis pulmonari. Observasi ini mencerminkan tahap
awal dari disfungsi pembuluh paru-paru pada mencit Fstl1-eKO. Hal yang sama juga
biasa diamati pada pasien penderita PAH, di mana perubahan fisiologi dan struktur
diawali oleh perubahan pensinyalan molekuler BMP yang diikuti oleh disfungsi dan
10
perubahan struktur pembuluh paru-paru pada stadium lanjut.34 Kemungkinan besar
peningkatan resistensi pembuluh paru-paru terjadi pada pembuluh kecil, karena
resistansi menjadi fungsi 1/r4 (menurut hukum Hagen-Poiseuille), di mana “r” adalah
183
diameter lumen.35
Pada mencit Fstl1-eKO, peningkatan kadar endothelin-1 secara transien pada
hari ke-7 setelah kelahiran dapat meningkatkan resistensi pembuluh paru-paru.
Karena arteri pulmonalis terhubung ke jantung, peningkatan resistansi pembuluh
pulmonalis ini menyebabkan penurunan output dari ventrikel kanan ke paru-paru
pada hari ke-21 setelah kelahiran (Bab 2). Akibatnya, perubahan morfologi terjadi
pada jantung dan paru-paru pada mencit Fstl1-eKO pada hari ke-21 setelah kelahiran,
seperti hipertrofi ventrikel kanan dan perubahan struktur pembuluh kecil paru-paru
(Bab 2). Perubahan yang progresif dan ireversibel pada struktur kardiopulmoner pada
mencit Fstl1-eKO dapat menyebabkan gangguan pernapasan di mana pembuluh
kecil paru-paru tidak mampu membawa darah ke paru-paru secara memadai.Hal ini
dapat menyebabkan kurangnya pengiriman oksigen ke otak dan akhirnya kematian.
Oleh karena itu, penelitian selanjutnya diperlukan untuk memeriksa kadar oksigen
dan karbon dioksida dalam darah selain menentukan radius dan kandungan aktin
pada pembuluh kecil paru-paru. Secara keseluruhan, perubahan molekuler pada
mencit Fstl1-eKO bersifat sementara dan dimulai sejak dini dalam perkembangan
paru-paru setelah kelahiran, sedangkan fungsi fisiologi dan konsekuensi morfologi
terjadi pada tahap selanjutnya. Disregulasi pensinyalan molekuler BMP saja mungkin
tidak memadai untuk menyebabkan perubahan struktur dan fungsi pembuluh paru-
paru besar pada tahap awal perkembangan, namun dapat diobservasi pada tahap
perkembangan paru-paru selanjutnya. Adapula kemungkinan bahwa perubahan
molekuler dan morfologi di paru-paru merupakan konsekuensi sekunder dari
disfungsi jantung kanan karena penebalan dinding ventrikel kanan. Ventrikel kanan
yang menebal dapat menyebabkan penurunan output dari ventrikel kanan yang Gambar 1. Fungsi Follistatin-like 1 dalam memodulasi pensinyalan molekuler BMP/Smad
kemudian menyebabkan hipoksia paru-paru. Sebagai konsekuensinya, persentase selama perkembangan pembuluh paru-paru setelah melahirkan. Pada mencit kontrol, BMP
menginduksi fosforilasi protein Smad1/5 dan gen targetnya untuk mempertahankan fungsi
pembuluh kecil paru-paru yang positif aktin tidak menurun sementara ekspresi normal dan homeostasis pembuluh paru-paru. Delesi Fstl1 dari endotelium pada mencit
endothelin-1 meningkat di paru-paru pada hari ke-21 setelah kelahiran untuk Fstl1-eKO menyebabkan aktivasi yang berlebihan dari protein Smad1/5 dan gen targetnya,
mendorong aliran darah melalui kapiler paru-paru. Penelitian selanjutnya diperlukan termasuk Endoglin, Jag1, Gata2. Peningkatan ekspresi Gata2 meningkatkan ekspresi
vasokonstriktor endotelin-1 yang dapat menyebabkan perubahan struktur pembuluh paru-
untuk mempelajari struktur dan fungsi kardiovaskular pada mencit Fstl1-eKO untuk paru dan vasokonstriksi.
mengkonfirmasi penyebab utama kematian mencit Fstl1-eKO. Fungsi Fstl1 pada
endotelium dalam mengatur sinyal BMP/Smad pada perkembangan pembuluh
paru-paru setelah kelahiran diilustrasikan pada Gambar 1.
2. Fungsi Fstl1 dalam inflamasi saluran pernapasan pada COPD
Salah satu patogenesis PPOK adalah aktivasi sistem kekebalan tubuh yang
berlebihan dan perbaikan jaringan yang abnormal sebagai respon terhadap polutan
udara, seperti asap rokok, dalam jangka waktu yang panjang. Hal ini menyebabkan
perubahan struktur epitelium dan perubahan fisiologis dari saluran pernapasan
yang berkontribusi terhadap keterbatasan aliran udara pada saluran pernapasan
PPOK.36,37 Sebagai barir pertama dari lingkungan eksternal, sel epitel saluran
pernapasan memproduksi mediator inflamasi untuk berkomunikasi dengan sel
10
mesenkim, termasuk fibroblas paru-paru dan sel otot polos saluran pernapasan.
Fungsi Fstl1 dalam komunikasi antar sel telah dilaporkan sebelumnya.6,9 Hasil
penelitian ini mengindikasikan fungsi Fstl1 dalam mengatur sekresi sitokin inflamasi

184 185
dalam beberapa penyakit inflamasi.6,7,38 Namun, keterlibatan Fstl1 dalam patogenesis
PPOK belum pernah diteliti sebelumnya.
Penelitian ini menunjukkan bahwa ekspresi protein Fstl1 meningkat secara
signifikan pada paru-paru perokok yang tidak menderita PPOK dan pada pasien PPOK
stadium II dan IV dibandingkan dengan pasien yang tidak menderita PPOK (Bab 3).
Analisis lebih lanjut menunjukkan bahwa protein Fstl1 lebih tinggi ekspresinya pada
sel epitel saluran pernapasan, endotelium, sel otot polos pembuluh paru-paru, dan
sel imun pada jaringan paru-paru pasien PPOK stadium II dan IV (semua pernah
menjadi perokok) dibandingkan jaringan paru-paru pasien yang tidak menderita PPOK
(Bab 3). Observasi ini mengindikasikan bahwa peningkatan ekspresi protein Fstl1
berhubungan dengan perkembangan PPOK. Tesis ini bertujuan untuk mengevaluasi
potensi implikasi dari meningkatnya ekspresi protein Fstl1 berkaitan dengan
patogenesis PPOK (Bab 5 dan 7). Ekspresi protein Fstl1 pada paru-paru perokok dan
mantan perokok yang tidak menderita PPOK juga lebih tinggi dibandingkan pasien
yang tidak pernah merokok dan tidak menderita PPOK. Hal ini mengindikasikan
bahwa adanya efek jangka panjang yang berkaitan dengan pernah merokok pada
ekspresi protein Fstl1 di paru-paru (Bab 3). Asap rokok menstimulasi produksi
mediator inflamasi yang berkontribusi dalam perekrutan sel-sel imun ke paru-
paru, dimana efek asap rokok tersebut tetap ada setelah berhenti merokok. Fstl1
adalah protein yang diregulasi oleh TGF-β1 dan asap rokok menyebabkan expresi
protein TGF-β1 meningkat pada sel epitel bronkus.39 Hal tersebut menunjukkan
bahwa TGF-β1 dapat memediasi peningkatan ekspresi protein Fstl1 sebagai respons
terhadap asap rokok.
Sel epitel bronkus mengekspresikan dan mensekresikan protein Fstl1 yang
paling banyak dibandingkan dengan sel mesenkim paru-paru, seperti fibroblas
paru-paru dan sel otot polos saluran pernapasan (Bab 5). Sama halnya dengan
sel-sel epitel saluran pernapasan pada jaringan paru-paru pasien non-PPOK juga
mengekspresikan protein Fstl1 paling banyak (Bab 3). Mengingat bahwa Fstl1 adalah
inhibitor alami dari BMP4 di paru-paru,1,2 tingkat fosforilasi protein Smad1/5 lebih
rendah pada paru-paru perokok, mantan perokok non-PPOK, dan pada pasien PPOK
stadium II dan IV dibandingkan dengan pasien yang tidak pernah merokok dan tidak
menderita PPOK (Bab 3). Rendahnya tingkat fosforilasi protein Smad1/5 kemungkinan
disebabkan oleh peningkatan ekspresi protein Fstl1 di paru-paru (Bab 3).BMP4 pada
umumnya diekspresikan oleh sel mesenkim, seperti fibroblas paru-paru dan sel
otot polos saluran pernapasan sedangkan sel epitel bronkus mengekspresikan dan
melepaskan protein BMP4 dengan konsentrasi yang rendah. Ekspresi protein BMP4
pada distal bud paru-paru yang sedang berkembang pada tahap pseudoglandular
(E11-E16.5), mengkoordinasikan aksis proksimal-distal endoderm dengan mengatur
diferensiasi sel epitel.40 Perbedaan sumber seluler ligan dan inhibitornya pada paru-
paru mengindikasikan adanya komunikasi antara sel epitel dan sel mesenkim dalam
mengatur fungsi biologis, termasuk regulasi sitokin inflamasi di paru-paru. Tesis ini
menganalisis fungsi dari protein Fstl1 dalam inflamasi saluran pernapasan pada
individu yang sehat dan fungsinya dalam perkembangan PPOK (Bab 5).
Ekspresi protein Fstl1 yang berlebihan pada sel epitel bronkus meningkatkan
186
produksi protein IL-6 dan GM-CSF, mengindikasikan fungsi Fstl1 sebagai regulator
sitokin inflamasi (Bab 5). Medium yang mengandung Fstl1 (Fstl1 CM) yang berasal
dari sel epitel yang mengekspresikan protein Fstl1 secara berlebihan menyebabkan
meningkatnya produksi protein IL-6 dan IL-8 dari sel mesenkim paru-paru. Kandidat
mediator yang disekresikan oleh sel epitel yang menyebabkan meningkatnya
produksi protein IL-6 and IL-8 dari fibroblas paru-paru adalah IL-6, IL-8, GM-CSF dan
RANTES. Penelitian ini secara keseluruhan menunjukkan bahwa Fstl1 menginduksi
transkripsi dan produksi sitokin inflamasi, seperti GM-CSF dan IL-6, dari sel epitel
bronkus, yang kemudian dapat menginduksi produksi IL-6 dan IL -8 dari sel mesenkim
paru-paru (Bab 5). Fstl1 adalah mediator inflamasi yang mengkoordinasi komunikasi
sel epitel dan sel mesenkim dalam mengatur produksi sitokin inflamasi.Oleh karena
itu, Fstl1 dapat berperan dalam merekrut sel imun ke paru-paru. Sejalan dengan
itu, beberapa penelitian sebelumnya menunjukkan keterlibatan Fstl1 dalam proses
patologis penyakit pernapasan, termasuk fibrosis paru-paru dan asma.9,11–13 Tesis
ini mengindikasikan bahwa protein Fstl1 dapat dijadikan target molekuler yang
potensial untuk menghambat inflamasi pada saluran pernapasan pada paru-paru
PPOK.
3. Implikasi dari protein Fstl1 pada sel goblet dan sel basal pada PPOK: Fungsi
dari BMP4 pada diferensiasi sel epitel saluran pernapasan dewasa
Pensinyalan molekuler BMP sangat penting dalam mengatur proksimal-distal axis
saluran pernapasan dalam perkembangan paru-paru embrio dan bayi. Pada paru-
paru dewasa, aktivasi pensinyalan molekuler BMP diperlukan untuk regenerasi
jaringan epitel paru-paru.41–46 BMP4 adalah faktor yang disekresikan oleh jaringan
mesenkim yang mampu menentukan nasib sel epitel selama perkembangan paru-
paru.40 Selain itu, BMP4 diperlukan untuk diferensiasi sel epitel saluran pernapasan
dalam kultur in vitroair-liquid interface (ALI).47
Sel epitel saluran pernapasan berfungsi sebagai pelindung pertama dari
lingkungan luar. Lapisan sel epitel saluran pernapasan pada orang dewasa terdiri dari
sel goblet, sel bersilia, sel basal dan sel klub (sebelumnya dikenal sebagai sel clara).48
Sel goblet yang mensekresikan mukus sebagain besar berada pada bagian proksimal
dari saluran pernapasan, begitu pula sel basal, sel klub, dan sel bersilia.49,50 Jumlah
sel klub sekretori, sel bersilia, dan sel neuroendokrin berlimpah pada bronkiolus.
Alveoli pernapasan dilapisi dengan lapisan tipis sel alveolar tipe I dan sel alveolar
kuboidal tipe II.51–53
Asap rokok mengubah komposisi sel epitel saluran pernapasan dan berkontribusi
terhadap perubahan struktur sel epitel pada saluran pernapasan pada pasien
PPOK.54 Perubahan struktur jaringan epitel pada saluran pernapasan pada pasien
PPOK ditandai dengan metaplasia sel goblet, hiperplasia sel basal, serta hilangnya
sel klub yang fungsional. Sel klub varian adalah sel sekretori yang berfungsi sebagai
10
pelindung jaringan paru-paru dengan mengeluarkan uteroglobin, sekretoglobin, dan
protein seperti surfaktan yang memiliki fungsi sebagai anti-inflamasi serta penting
untuk regenerasi jaringan epitel saluran pernapasan.55 Sel klub varian memiliki
187
karakteristik seperti sel punca dan mampu melakukan pembaharuan diri dan
berdiferensiasi menjadi sel bersilia atau sel goblet.53,56 Tingkat serum SCGB1A1 yang
rendah tidak hanya berkaitan dengan prevalensi dan tingkat keparahan PPOK, tetapi
juga dengan penurunan fungsi paru-paru pada pasien PPOK.57–61
Pada diferensiasi jaringan epitel saluran pernapasan yang normal, sel basal
secara langsung atau tidak langsung (melalui perantara sel klub) berdiferensiasi
menjadi sel goblet atau sel bersilia. Tesis ini menunjukkan bahwa BMP4 menstimulasi
diferensiasi sel basal ke sel klub varian namun menekan diferensiasi terhadap sel
goblet dan sel bersilia pada sel epitel bronkus dewasa (Bab 7). Meskipun penelitian
sebelumnya menunjukkan bahwa BMP4 berfungsi dalam diferensiasi jaringan epitel
pada paru-paru yang sedang berkembang,42 hasil penelitian yang dipaparkan dalam
tesis ini menunjukkan bahwa BMP4 menstimulasi diferensiasi sel klub varian pada
sel epitel saluran pernapasan.
Sejalan dengan penelitian sebelumnya,59,62,63 tesis ini juga menunjukkan bahwa
dibandingkan pasien non-PPOK.59
Interaksi antara pensinyalan molekuler BMP dan Notch juga diamati selama
perkembangan paru-paru setelah kelahiran pada hewan model mencit.Delesi Fstl1
pada sel endotel mencit Fstl1-eKO berkaitan dengan peningkatan Jagged1 pada
perkembangan paru-paru setelah kelahiran kelahiran (Bab 2). Selain itu, Hey1 dan
Hey3, meningkat di sel epitel bronkus manusia.
Kesimpulannya, tesis ini menunjukkan bahwa BMP4 menghambat diferensiasi
sel goblet sementara menstimulasi diferensiasi sel klub varian pada sel epitel saluran
pernapasan dewasa.Mengembalikan keseimbangan antara BMP4 dan inhibitornya
di paru-paru pasien PPOK merupakan strategi untuk memperbaiki hilangnya sel klub
BMP4

aktivasi pensinyalan molekuler BMP4 (fosforilasi Smad1/5/8) berkurang sedangkan Bab 7 jumlah sel goblet bertambah

ekspresi Fstl1 meningkat pada paru-paru pasien PPOK (Bab 3). Peningkatan Fstl1
pada sel epitel saluran pernapasan paru-paru PPOK dapat menstimulasi diferensiasi
sel epitel menjadi metaplasia sel goblet, hiperplasia sel basal, dan hilangnya sel klub jumlah sel klub berkurang
Bab 3
yang merupakan ciri khas dari jaringan epitel saluran pernapasan PPOK. Tesis ini Fstl1

menunjukkan adanya hubungan antara hilangnya sel klub, metaplasia sel goblet,
dan hiperplasia sel basal dengan rendahnya aktivasi pensinyalan molekular BMP/ Fstl1

Smad pada paru-paru pasien PPOK.62,63 Bab 5

Studi selanjutnya dengan menggunakan Fstl1 CM atau antibodi penetralisir GM-CSF

RANTES
Fstl1 dan retraksi BMP4 pada sel epitel dewasa setelah 14 hari pada kultur ALI dapat IL-6
IL-8
mengungkapkan apakah efek BMP4 reversible dan apakah proses diferensiasi sel klub mesenchymal cells

varian dapat dialihkan ke diferensiasi sel bersilia. Studi sebelumnya menunjukkan

bahwa inhibitor BMP dapat berfungsi sebagai regulator proliferasi sel basal dengan IL-6
IL-8
menghambat fungsi BMP.64,65 Tingginya protein Fstl1 pada saluran pernapasan pasien
PPOK dapat menstimulasi proliferasi sel basal yang berkontribusi pada hiperplasia
jaringan epitel saluran pernapasan paru-paru PPOK.
Pada paru-paru yang sedang berkembang, Fstl1 diekspresikan oleh sel goblet66
sedangkan pada paru-paru orang dewasa yang sehat, Fstl1 diekspresikan sebagian sel-sel neutrofil sel-sel makrofaga

besar oleh sel bersilia (Bab 3 dan 5). Sebaliknya, sebagian besar BMP4 diekspresikan
oleh sel mesenkim paru-paru, seperti fibroblas paru-paru dan sel otot polos saluran
pernapasan.Oleh karena itu, komunikasi sel epitel dan sel mesenkim melalui inflamasi saluran pernapasan

pensinyalan molekuler BMP penting dalam memodulasi diferensiasi sel bersilia dan
sel goblet.
BMP4 menginduksi tingginya ekspresi gen-gen yang dikontrol oleh pensinyalan
molekuler Notch selama diferensiasi sel epitel saluran pernapasan dewasa (Bab 3).
Pensinyalan molekuler Notch menentukan nasib sel epitel di saluran pernapasan.
Oleh karena itu, memahami interaksi antara pensinyalan molekuler BMP dan Notch
sangat penting untuk memperbaikidan regenerasi jaringan epitel saluran pernapasan
yang terganggu pada pasien PPOK. Jumlah komponen pensinyalan molekuler
Notch, seperti Hey1 dan Hey2 lebih rendah tingkatnya pada pasien penderita PPOK
Gambar 2. Implikasi patologi peningkatan protein Fstl1 pada sel epitel saluran pernapasan
pada pasien PPOK. Ekspresi protein Fstl1 meningkat pada sel epitel saluran pernapasan pada
pasien PPOK stadium II dan IV. Protein Fstl1 kemungkinan diproduksi pada paru-paru dewasa
sebagai mekanisme perbaikan jaringan paru-paru akibat paparan kronis terhadap asap rokok.
Fstl1 adalah sitokin inflamasi yang memediasi komunikasi antara sel epitel dan sel mesenkim
dalam produksi IL-6 dan IL-8. Oleh karena itu, Fstl1 dapat berkontribusi dalam perekrutan
neutrofil dan makrofag ke paru-paru dan menyebabkan inflamasi paru-paru kronis. BMP4 10
menghambat diferensiasi sel goblet dan menstimulasi diferensiasi sel klub varian pada sel
epitel saluran pernapasan. Peningkatan Fstl1 pada sel epitel saluran pernapasan pada paru-
paru PPOK dapat menginduksi diferensiasi sel epitel menjadi sel goblet sementara jumlah
sel klub berkurang.

188 189
sementara mengurangi metaplasia sel goblet dan hiperplasia sel basal. Gambar 2 BMP dan apakah Fstl1 berkontribusi langsung terhadap metaplasia sel goblet,
mengillustrasikan implikasi potensial dari meningkatnya protein Fstl1 pada sel-sel hiperplasia sel basal, dan hilangnya sel klub varian. Studi berikutnya menggunakan
epitel saluran pernapasan penderita COPD. antibodi penetralisir Fstl1 dan Fstl1 rekombinan protein akan bermanfaat untuk
mengevaluasi implikasi dari Fstl1 di paru-paru pasien penderita PPOK.
4. Perspektif masa depan Kesimpulannya, deregulasi pensinyalan molekuler Fstl1/BMP sebagai respon
Data yang dipaparkan dalam tesis ini menunjukkan fungsi dari Fstl1 pada paru- terhadap kerusakan kronis jaringan epitel saluran pernapasan dan pembuluh paru-
paru yang belum pernah diteliti sebelumnya.Tesis ini menganalisis fungsi dari paru dapat berkontribusi dalam perkembangan PPOK. Oleh karena itu, pemahaman
pensinyalan molekuler BMP/Fstl1 dan mengeksplorasi potensi implikasi dari yang baik mengenai mekanisme regulasi Fstl1/BMP dalam perkembangan paru-paru
meningkatnya ekspresi protein Fstl1 pada peradangan saluran pernapasan serta setelah kelahiran sangat penting untuk mengidentifikasi proses perbaikan jaringan
perubahan struktur lapisan epitel pada saluran pernapasan pasien PPOK. PAH paru-paru yang abnormal.
adalah komorbiditas yang umum pada pasien PPOK.67,68 Studi kami menunjukkan
salah satu fungsi dari Fstl1 pada sel endotel pembuluh paru-paru, yaitu mengatur
tingkat aktivasi BMP/Smad pada perkembangan paru-paru setelah kelahiran (Bab 2).
Proliferasi sel otot polos pembuluh paru-paru yang tidak terkontrol dan perubahan
struktur aktin menyebabkan vasokonstriksi pada pasien PAH. Studi ex vivo dengan
menggunakan precision cut lung slices dapat mengungkapkan kontribusi fungsional
dari Fstl1 endotel pada kontraksi pembuluh dengan membandingkan kontraktilitas
pembuluh paru-paru antara mencit Fstl1-eKO dengan kontrol. Eksperimen dengan
menggunakan sistem ko-kultur sel endotel mikrovaskuler dan sel otot polos
pembuluh paru-paru dapat mengungkapkan mekanisme Fstl1 dalam mengatur
ekspresi aktin pada sel otot polos pembuluh paru-paru.
Pada pembuluh paru-paru pasien PPOK, peningkatan ekspresi protein Fstl1 pada
sel endotel serta sel otot polos pembuluh paru-paru ditemukan pada pasien penderita
PPOK (Bab 3). Tesis ini juga menunjukkan bahwa tingkat aktivasi pensinyalan BMP/
Smad berkurang pada paru-paru pasien PPOK dibandingkan dengan pasien non-
PPOK (Bab 3). Aktivasi pensinyalan molekuler BMP juga berkurang pada pasien PAH
idiopatik,69–71 namun kontribusi Fstl1 terhadap berkurangnya aktivasi pensinyalan
molekuler BMP belum diteliti. Penelitian sebelumnya menunjukkan bahwa inhibitor
BMP lainnya, seperti gremlin, meningkat pada sel endotel dari pasien PAH idiopatik
maupun hipoksia.72
Studi selanjutnya untuk mengevaluasi hubungan antara ekspresi Fstl1 dan
fungsi pembuluh paru-paru pada pasien PPOK dengan komorbiditas PAH akan
sangat bermanfaat untuk dilakukan. Tesis ini juga mengeksplorasi implikasi potensial
peningkatan Fstl1 pada pasien PPOK, terutama pada sel epitel saluran pernapasan.
Fstl1 berperan sebagai pro-inflamasi karena dapat memediasi komunikasi antara
sel epitel dan sel mesenkim dalam mengatur produksi sitokin inflamasi (Bab 4).
Penelitian lebih lanjut diperlukan untuk mengidentifikasi reseptor Fstl1 yang terlibat
di sel epitel maupun sel mesenkim saluran pernapasan.
BMP4 menghambat diferensiasi sel goblet sementara menstimulasi diferensiasi
sel klub varian (Bab 5). Penelitian selanjutnya menggunakan mencit model PPOK
diperlukan untuk mengkonfirmasi efek fungsional dari meningkatnya ekspresi protein
10
Fstl1 pada jaringan epitel saluran pernapasan. Di samping itu, perlu dilakukan studi
selanjutnya untuk mengevaluasi apakah Fstl1 menghambat pensinyalan molekuler

190 191
References
1. Sylva M, Li VSW, Buffing AAA, et al. The BMP antagonist follistatin-like 1 is required for skeletal
and lung organogenesis. PloS One. 2011;6(8):e22616. doi:10.1371/journal.pone.0022616.
2. Geng Y, Dong Y, Yu M, et al. Follistatin-like 1 (Fstl1) is a bone morphogenetic protein (BMP)
4 signaling antagonist in controlling mouse lung development. Proc Natl Acad Sci U S A.
2011;108(17):7058-7063. doi:10.1073/pnas.1007293108.
3. Umezu T, Yamanouchi H, Iida Y, Miura M, Tomooka Y. Follistatin-like-1, a diffusible mesenchymal
factor determines the fate of epithelium. Proc Natl Acad Sci U S A. 2010;107(10):4601-4606.
doi:10.1073/pnas.0909501107.
4. Hayakawa S, Ohashi K, Shibata R, et al. Cardiac Myocyte-Derived Follistatin-Like 1 Prevents
Renal Injury in a Subtotal Nephrectomy Model. J Am Soc Nephrol JASN. 2015;26(3):636-646.
doi:10.1681/ASN.2014020210.
5. Zhou X, Xiao X, Huang T, et al. Epigenetic inactivation of follistatin-like 1 mediates tumor immune
evasion in nasopharyngeal carcinoma. Oncotarget. 2016;7(13):16433-16444. doi:10.18632/
oncotarget.7654.
6. Miyamae T, Marinov AD, Sowders D, et al. Follistatin-Like Protein-1 Is a Novel Proinflammatory
Molecule. J Immunol. 2006;177(7):4758-4762. doi:10.4049/jimmunol.177.7.4758.
7. Clutter SD, Wilson DC, Marinov AD, Hirsch R. Follistatin-Like Protein 1 Promotes Arthritis by Up-
Regulating IFN-γ. J Immunol. 2009;182(1):234-239. doi:10.4049/jimmunol.182.1.234.
8. Chaly Y, Marinov AD, Oxburgh L, Bushnell DS, Hirsch R. FSTL1 promotes arthritis in mice by
enhancing inflammatory cytokine/chemokine expression. Arthritis Rheum. 2012;64(4):1082-
1088. doi:10.1002/art.33422.
9. Dong Y, Geng Y, Li L, et al. Blocking follistatin-like 1 attenuates bleomycin-induced pulmonary
fibrosis in mice. J Exp Med. 2015;212(2):235-252. doi:10.1084/jem.20121878.
10. Liu R, Yang Y, Shen J, et al. Fstl1 is involved in the regulation of radial glial scaffold development.
Mol Brain. 2015;8:53. doi:10.1186/s13041-015-0144-8.
11. Murphy N, Gaynor KU, Rowan SC, et al. Altered Expression of Bone Morphogenetic Protein
Accessory Proteins in Murine and Human Pulmonary Fibrosis. Am J Pathol. 2016;186(3):600-
615. doi:10.1016/j.ajpath.2015.10.032.
12. Miller M, Beppu A, Rosenthal P, et al. Fstl1 Promotes Asthmatic Airway Remodeling by
Inducing Oncostatin M. J Immunol Baltim Md 1950. 2015;195(8):3546-3556. doi:10.4049/
jimmunol.1501105.
13. Miller M, Esnault S, Kurten RC, et al. Segmental allergen challenge increases levels of airway
follistatin-like 1 in patients with asthma. J Allergy Clin Immunol. 2016;138(2):596-599.e4.
doi:10.1016/j.jaci.2016.01.019.
14. Gangopahyay A, Oran M, Bauer EM, et al. Bone morphogenetic protein receptor II is a novel
mediator of endothelial nitric-oxide synthase activation. J Biol Chem. 2011;286(38):33134-
33140. doi:10.1074/jbc.M111.274100.
15. Xu J, Zhu D, Sonoda S, et al. Over-expression of BMP4 inhibits experimental choroidal
neovascularization by modulating VEGF and MMP-9. Angiogenesis. 2012;15(2):213-227.
doi:10.1007/s10456-012-9254-4.
16. Moreno-Miralles I, Ren R, Moser M, Hartnett ME, Patterson C. Bone morphogenetic protein
endothelial cell precursor-derived regulator regulates retinal angiogenesis in vivo in a mouse
model of oxygen-induced retinopathy. Arterioscler Thromb Vasc Biol. 2011;31(10):2216-2222.
doi:10.1161/ATVBAHA.111.230235.
17. Helbing T, Rothweiler R, Ketterer E, et al. BMP activity controlled by BMPER regulates the
proinflammatory phenotype of endothelium. Blood. 2011;118(18):5040-5049. doi:10.1182/
blood-2011-03-339762.
18. Suzuki Y, Ohga N, Morishita Y, Hida K, Miyazono K, Watabe T. BMP-9 induces proliferation of
multiple types of endothelial cells in vitro and in vivo. J Cell Sci. 2010;123(Pt 10):1684-1692.
doi:10.1242/jcs.061556.
19. Kool H, Mous D, Tibboel D, de Klein A, Rottier RJ. Pulmonary vascular development goes awry in
congenital lung abnormalities. Birth Defects Res Part C Embryo Today Rev. 2014;102(4):343-358.
doi:10.1002/bdrc.21085.
20. International PPH Consortium, Lane KB, Machado RD, et al. Heterozygous germline mutations
192
in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. Nat
Genet. 2000;26(1):81-84. doi:10.1038/79226.
21. Machado RD, Aldred MA, James V, et al. Mutations of the TGF-beta type II receptor BMPR2 in
pulmonary arterial hypertension. Hum Mutat. 2006;27(2):121-132. doi:10.1002/humu.20285.
22. Harrison RE, Flanagan JA, Sankelo M, et al. Molecular and functional analysis identifies ALK-
1 as the predominant cause of pulmonary hypertension related to hereditary haemorrhagic
telangiectasia. J Med Genet. 2003;40(12):865-871.
23. Fujiwara M, Yagi H, Matsuoka R, et al. Implications of mutations of activin receptor-like kinase
1 gene (ALK1) in addition to bone morphogenetic protein receptor II gene (BMPR2) in children
with pulmonary arterial hypertension. Circ J Off J Jpn Circ Soc. 2008;72(1):127-133.
24. Johnson DW, Berg JN, Baldwin MA, et al. Mutations in the activin receptor-like kinase 1 gene in
hereditary haemorrhagic telangiectasia type 2. Nat Genet. 1996;13(2):189-195. doi:10.1038/
ng0696-189.
25. McAllister KA, Grogg KM, Johnson DW, et al. Endoglin, a TGF-beta binding protein of endothelial
cells, is the gene for hereditary haemorrhagic telangiectasia type 1. Nat Genet. 1994;8(4):345-
351. doi:10.1038/ng1294-345.
26. Pi X, Schmitt CE, Xie L, et al. LRP1-dependent endocytic mechanism governs the signaling output
of the bmp system in endothelial cells and in angiogenesis. Circ Res. 2012;111(5):564-574.
doi:10.1161/CIRCRESAHA.112.274597.
27. Yao Y, Jumabay M, Wang A, Boström KI. Matrix Gla protein deficiency causes arteriovenous
malformations in mice. J Clin Invest. 2011;121(8):2993-3004. doi:10.1172/JCI57567.
28. Yao Y, Yao J, Radparvar M, et al. Reducing Jagged 1 and 2 levels prevents cerebral arteriovenous
malformations in matrix Gla protein deficiency. Proc Natl Acad Sci U S A. 2013;110(47):19071-
19076. doi:10.1073/pnas.1310905110.
29. Jain RK. Molecular regulation of vessel maturation. Nat Med. 2003;9(6):685-693. doi:10.1038/
nm0603-685.
30. Schiffrin EL. Endothelin and endothelin antagonists in hypertension. J Hypertens. 1998;16(12 Pt
2):1891-1895.
31. Lee SH, Channick RN. Endothelin antagonism in pulmonary arterial hypertension. Semin Respir
Crit Care Med. 2005;26(4):402-408. doi:10.1055/s-2005-916155.
32. Brozovich FV, Nicholson CJ, Degen CV, Gao YZ, Aggarwal M, Morgan KG. Mechanisms of Vascular
Smooth Muscle Contraction and the Basis for Pharmacologic Treatment of Smooth Muscle
Disorders. Pharmacol Rev. 2016;68(2):476-532. doi:10.1124/pr.115.010652.
33. Wilson JL, Yu J, Taylor L, Polgar P. Hyperplastic Growth of Pulmonary Artery Smooth Muscle Cells
from Subjects with Pulmonary Arterial Hypertension Is Activated through JNK and p38 MAPK.
PLoS ONE. 2015;10(4). doi:10.1371/journal.pone.0123662.
34. Noordegraaf AV, Galiè N. The role of the right ventricle in pulmonary arterial hypertension. Eur
Respir Rev. 2011;20(122):243-253. doi:10.1183/09059180.00006511.
35. NAEIJE R, CHESLER N. PULMONARY CIRCULATION AT EXERCISE. Compr Physiol. 2012;2(1):711-
741. doi:10.1002/cphy.c100091.
36. Knight D. Epithelium–fibroblast interactions in response to airway inflammation. Immunol Cell
Biol. 2001;79(2):160-164. doi:10.1046/j.1440-1711.2001.00988.x.
37. Osei ET, Brandsma C-A, Noordhoek JA, Timens W, Postma D, Heijink I. Crosstalk between
epithelium and fibroblasts; implications for COPD. Eur Respir J. 2014;44(Suppl 58):P3899.
38. Ouchi N, Oshima Y, Ohashi K, et al. Follistatin-like 1, a secreted muscle protein, promotes
endothelial cell function and revascularization in ischemic tissue through a nitric-oxide synthase-
dependent mechanism. J Biol Chem. 2008;283(47):32802-32811. doi:10.1074/jbc.M803440200.
39. Shibanuma M, Mashimo J, Mita A, Kuroki T, Nose K. Cloning from a mouse osteoblastic cell line
of a set of transforming-growth-factor-beta 1-regulated genes, one of which seems to encode a
follistatin-related polypeptide. Eur J Biochem FEBS. 1993;217(1):13-19.
40. Morrisey EE, Hogan BLM. Preparing for the first breath: genetic and cellular mechanisms in lung 10
development. Dev Cell. 2010;18(1):8-23. doi:10.1016/j.devcel.2009.12.010.
41. Bellusci S, Henderson R, Winnier G, Oikawa T, Hogan BL. Evidence from normal expression
and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse
embryonic lung morphogenesis. Dev Camb Engl. 1996;122(6):1693-1702.
193
42. Weaver M, Yingling JM, Dunn NR, Bellusci S, Hogan BL. Bmp signaling regulates proximal-distal signaling protects against bleomycin induced pulmonary fibrosis. Respir Res. 2015;16:38.
differentiation of endoderm in mouse lung development. Dev Camb Engl. 1999;126(18):4005- doi:10.1186/s12931-015-0202-x.
4015. 64. Cibois M, Luxardi G, Chevalier B, et al. BMP signalling controls the construction of vertebrate
43. Sountoulidis A, Stavropoulos A, Giaglis S, et al. Activation of the canonical bone morphogenetic mucociliary epithelia. Development. 2015;142(13):2352-2363. doi:10.1242/dev.118679.
protein (BMP) pathway during lung morphogenesis and adult lung tissue repair. PloS One. 65. Tadokoro T, Gao X, Hong CC, Hotten D, Hogan BLM. BMP signaling and cellular dynamics during
2012;7(8):e41460. doi:10.1371/journal.pone.0041460. regeneration of airway epithelium from basal progenitors. Dev Camb Engl. 2016;143(5):764-
44. Ninomiya N, Michiue T, Asashima M, Kurisaki A. BMP signaling regulates the differentiation 773. doi:10.1242/dev.126656.
of mouse embryonic stem cells into lung epithelial cell lineages. In Vitro Cell Dev Biol Anim. 66. Adams D, Larman B, Oxburgh L. Developmental expression of mouse Follistatin-like 1 (Fstl1):
2013;49(3):230-237. doi:10.1007/s11626-013-9589-1. Dynamic regulation during organogenesis of the kidney and lung. Gene Expr Patterns.
45. Huang SXL, Islam MN, O’Neill J, et al. Highly efficient generation of airway and lung epithelial cells 2007;7(4):491-500. doi:10.1016/j.modgep.2006.10.009.
from human pluripotent stem cells. Nat Biotechnol. 2014;32(1):84-91. doi:10.1038/nbt.2754. 67. Siafakas NM, Antoniou KM, Tzortzaki EG. Role of angiogenesis and vascular remodeling in
46. Huang SXL, Green MD, de Carvalho AT, et al. The in vitro generation of lung and airway progenitor chronic obstructive pulmonary disease. Int J Chron Obstruct Pulmon Dis. 2007;2(4):453-462.
cells from human pluripotent stem cells. Nat Protoc. 2015;10(3):413-425. doi:10.1038/ 68. Hashimoto M, Tanaka H, Abe S. Quantitative analysis of bronchial wall vascularity in the medium
nprot.2015.023. and small airways of patients with asthma and COPD. Chest. 2005;127(3):965-972. doi:10.1378/
47. Ross AJ, Dailey LA, Brighton LE, Devlin RB. Transcriptional profiling of mucociliary differentiation chest.127.3.965.
in human airway epithelial cells. Am J Respir Cell Mol Biol. 2007;37(2):169-185. doi:10.1165/ 69. Morty RE, Nejman B, Kwapiszewska G, et al. Dysregulated bone morphogenetic protein signaling
rcmb.2006-0466OC. in monocrotaline-induced pulmonary arterial hypertension. Arterioscler Thromb Vasc Biol.
48. Fahy JV, Dickey BF. Airway Mucus Function and Dysfunction. N Engl J Med. 2010;363(23):2233- 2007;27(5):1072-1078. doi:10.1161/ATVBAHA.107.141200.
2247. doi:10.1056/NEJMra0910061. 70. Takahashi K, Kogaki S, Matsushita T, Nasuno S, Kurotobi S, Ozono K. Hypoxia induces alteration
49. Hong KU, Reynolds SD, Watkins S, Fuchs E, Stripp BR. Basal cells are a multipotent progenitor of bone morphogenetic protein receptor signaling in pulmonary artery endothelial cell. Pediatr
capable of renewing the bronchial epithelium. Am J Pathol. 2004;164(2):577-588. doi:10.1016/ Res. 2007;61(4):392-397. doi:10.1203/pdr.0b013e3180332cba.
S0002-9440(10)63147-1. 71. Long L, Crosby A, Yang X, et al. Altered Bone Morphogenetic Protein and Transforming Growth
50. Rock JR, Onaitis MW, Rawlins EL, et al. Basal cells as stem cells of the mouse trachea and Factor-β Signaling in Rat Models of Pulmonary Hypertension. Circulation. 2009;119(4):566-576.
human airway epithelium. Proc Natl Acad Sci U S A. 2009;106(31):12771-12775. doi:10.1073/ doi:10.1161/CIRCULATIONAHA.108.821504.
pnas.0906850106. 72. Cahill E, Rowan SC, Sands M, et al. The pathophysiological basis of chronic hypoxic pulmonary
51. Kimura J, Deutsch GH. Key mechanisms of early lung development. Pediatr Dev Pathol Off J Soc hypertension in the mouse: vasoconstrictor and structural mechanisms contribute equally. Exp
Pediatr Pathol Paediatr Pathol Soc. 2007;10(5):335-347. doi:10.2350/07-06-0290.1. Physiol. 2012;97(6):796-806. doi:10.1113/expphysiol.2012.065474.
52. Rawlins EL, Hogan BLM. Epithelial stem cells of the lung: privileged few or opportunities for
many? Dev Camb Engl. 2006;133(13):2455-2465. doi:10.1242/dev.02407.
53. Kotton DN, Morrisey EE. Lung regeneration: mechanisms, applications and emerging stem cell
populations. Nat Med. 2014;20(8):822-832. doi:10.1038/nm.3642.
54. Schamberger AC, Staab-Weijnitz CA, Mise-Racek N, Eickelberg O. Cigarette smoke alters primary
human bronchial epithelial cell differentiation at the air-liquid interface. Sci Rep. 2015;5.
doi:10.1038/srep08163.
55. Guha A, Vasconcelos M, Cai Y, et al. Neuroepithelial body microenvironment is a niche
for a distinct subset of Clara-like precursors in the developing airways. Proc Natl Acad Sci.
2012;109(31):12592-12597. doi:10.1073/pnas.1204710109.
56. Barnes PJ. CLub cells, their secretory protein, and copd. Chest. 2015;147(6):1447-1448.
doi:10.1378/chest.14-3171.
57. Bernard A, Marchandise FX, Depelchin S, Lauwerys R, Sibille Y. Clara cell protein in serum and
bronchoalveolar lavage. Eur Respir J. 1992;5(10):1231-1238.
58. Vestbo J, Edwards LD, Scanlon PD, et al. Changes in Forced Expiratory Volume in 1 Second over
Time in COPD. N Engl J Med. 2011;365(13):1184-1192. doi:10.1056/NEJMoa1105482.
59. Park HY, Churg A, Wright JL, et al. Club cell protein 16 and disease progression in chronic
obstructive pulmonary disease. Am J Respir Crit Care Med. 2013;188(12):1413-1419.
doi:10.1164/rccm.201305-0892OC.
60. Lomas DA, Silverman EK, Edwards LD, et al. Evaluation of serum CC-16 as a biomarker for COPD
in the ECLIPSE cohort. Thorax. 2008;63(12):1058-1063. doi:10.1136/thx.2008.102574.
61. Guerra S, Halonen M, Vasquez MM, et al. The relation of circulating CC16 to lung function growth,
decline, and development of COPD across the lifespan. Lancet Respir Med. 2015;3(8):613-620.
doi:10.1016/S2213-2600(15)00196-4. 10
62. Myllärniemi M, Lindholm P, Ryynänen MJ, et al. Gremlin-mediated decrease in bone
morphogenetic protein signaling promotes pulmonary fibrosis. Am J Respir Crit Care Med.
2008;177(3):321-329. doi:10.1164/rccm.200706-945OC.
63. De Langhe E, Cailotto F, De Vooght V, et al. Enhanced endogenous bone morphogenetic protein

194 195
ACKNOWLEDGEMENT
Acknowledgement
First of all, I would like to sincerely thank everyone who has made any contributions
to the Fstl1 project and supported me through the process of starting up, during,
and finishing this long unforgettable journey. These collective supports have made
the completion of my thesis possible. As it is rather impossible to mention everyone
individually, I apologize if I did not mention your name. For the following persons, I
would like to specifically address my great appreciation.
Most of all I am fully indebted to my primary promotor, Reinoud Gosens, for your
constructive feedback on the study design, experimental planning, manuscripts
and thesis finalization by giving me the necessary freedom to grow and develop
scientifically and personally. You taught me by example on how to be a good future
leader. Thank you for your continuous supports and advice throughout my PhD. I am
glad and very grateful to work with you. Also, thank you for your quick response in
finalizing the manuscripts and this thesis. Thank you so much, Reinoud!
I am grateful for the full support of my promotor Martina Schmidt in the last four
years, especially in pursuing pharmacological education in England. Thank you for
giving me the opportunity to work on the Fstl1 project and for being very supportive
in finalizing this thesis by providing me with feedback and suggestions.
I would also like to express my gratitude to my co-promoter in Florida, USA, Harm
Maarsingh for the opportunity to work on the Fstl1 project. Thank you for your
insightful advice in study design and thorough feedback in data analysis, data
interpretation, and critically reviewing this thesis as well as abstracts and posters
for conferences. Without your support, finalizing this thesis would not be feasible.
I really appreciate your time and efforts to maintain good communication through
Skype meetings in the past four years.
To the Fstl1 expert in the heart, Maurice van den Hoff, I am extremely grateful
for your guidance and suggestions throughout my project, especially in the study
design and experimental plan of the Fstl1 knockout animal study. Thank you for
your constructive feedback on the manuscripts and for giving me the opportunity
to learn PCR data analysis directly from the expert, the LinReg software developer,
Jan Ruijter. I thank Jan for the opportunity to participate in the intensive workshop
on advanced real time PCR data analysis and for your guidance on selecting proper
reference genes.
Besides my promotors, I would like to thank the assessment committee, Frank Kruyt,
Gert Folkerts, and Colin Bingle for critically reviewing and evaluating my thesis.
I wish to acknowledge the support provided by Wim Timens. I learned a lot from
you about ‘’reading’’ the human lung pathology and vessel structure. Thank you
198
for your insightful input in study design, critical feedback on the manuscripts,
and also kindly providing COPD patient materials that were very valuable to my
study. Andrew Halayko provided me with very valuable feedback on epithelial-
mesenchymal communication manuscript. Pieter Hiemstra, thank you for critically
reading and providing constructive feedback on the epithelial cell differentiation
manuscript. Thank you Luis Jesus Jimenez-Borreguero for your insightful knowledge
on cardiopulmonary physiological functions which was very valuable for the Fstl1
knockout manuscript. I am so grateful to have such experts to exchange ideas and
discuss the data with.
Thank you Sophie Bos for traveling with me all the way to Amsterdam to isolate the
lungs of newborn mouse pups and generating human COPD lung slices, in addition
to teaching me how to paraffin-embed and slice the lung tissue. I wish to thank
Marjan Luinge for your assistance in using the pressure cooker at the pathology lab.
Thank you Herman Meurs for your hospitality every time I joined your car to go to
conferences or a lab outing. You are extremely humble and your diverse interests
beyond science are so inspiring. You even traveled around Indonesia more than I have
done. I enjoyed talking to you about your experience in different parts of Indonesia
and even successfully convinced me that Indonesia has a distinct smell. Thank you
Amalia Dolga for several nice discussions we had about exciting experimental design
and some great advice on future career development.
My gratitude also extends to Marc Sylva for sharing your extensive knowledge and
experience in studying Fstl1, Andrea Mattiotti for your support in managing the Fstl1
knockout breeding line and fruitful discussions on how to analyze and interpret the
data, to Stuti Prakash for collecting functional data in Madrid that are essential for
the publication and to Quinn Gunst for technical support in in situ hybridization
which were very valuable for the revision of the Fstl1 knockout manuscript. The
annual Groningen-Amsterdam Fstl1 meeting would not be successful without all of
your active participation and contributions. Thank you!
Many thanks to the master students who have been working with me on this
Fstl1 project. Ken Ho Hua, you impressed me with your final report and great
understanding on Fstl1 pathways in different systems, Jorinke Koops, thank you for
all your hard work in optimizing the immunostaining before you went New castle,
Australia. You were a quick learner and able to be independent quite quickly. This
was great when I could not be physically present for a couple of weeks as I had to
recover from surgery. Vanessa Niburg, thank you for your continuous enthusiasm
and your persistence in finishing the ELISA experiments. You were a very well
organized person and fun to be around. Furthermore, thank you to Frank Ensink,
a humorous and motivated student, for your hard work in running lots of western
blots. I always appreciate your honesty and enjoy exchanging new ideas and creative
experiments with you. Also, to the bachelor students Sefike Vardar, Rukiye Çiçek,
199
Barzo Sulaiman, Rosa Kortekaas, and Nuhoda Aldarij, thank you for all your hard
work and dedication to the project. I hope all of you had a great time and learn a lot
during your internship.
I would like to thank the following (ex)-colleagues for their kindly support, help, and
for all the fun we have had in the last four years. A special thanks to my roommate,
Tim Koopmans, Timmy, thank you for being around, and for being you. You saw me
laugh crazily or cry quietly. Thanks for all your support and being my ‘’living stress
ball’’. I will never forget when we had tapas with Pablo Munoz, encouraging me to
keep going while I was down. And of course to our many, many fun times throughout
my PhD. Without you guys, I would not be writing this acknowledgment. Thanks a
bunch! I wish both of you good luck with your career and I look forward to reading
your publications in Science, Cell or Nature! Haoxiao Zuo, I secretly wished you would
not need to go to Germany every now and then, just stay in our office in Groningen
to add more woman power ;) Thanks to you and Bing Han for cooking local Chinese
food every now and then, which really reminds me of my grandparents’ cooking.
Also thanks Bing for helping me translate a Chinese abstract about Fstl1. I thank
John-Poul Ng-Blichfeldt for the inspiring discussions about epithelial differentiation.
If only you came back to Groningen earlier, I would probably have more time to do
some follow-up experiments.
Pavan Prabhala, thank you for many fun times, which included walking around
Groningen to catch Pokémon. We caught more than 50 Pokémon in a day! Thanks
to Anita Spanjer and Loes Kistemaker for teaching me how to isolate primary
human epithelial cells as well as perform ALI cultures, and to Eline van Dijk, thanks
for sharing primary human fibroblasts. Although it was rather short, I had shared
several nice memories with Mariska van den Berg, Inge Krabbendam and Xin Hui
Wu, especially during intensive preparation for Herman’s farewell party where the
three of you practiced your music talents in my office. Thank you for all the sweet
moments we shared and I wish all of you to enjoy and get the most out of your PhD
experience. I thank Annet Zuidhof for the technical assistance in showing me how to
do immunohistochemistry for the first time. Thanks Carolina Elzinga for empowering
discussions that had given me a new perspective. Without it, I would not be able to
finish my thesis. Thanks Sepp Jansen for inspiring advice on writing and finishing a
thesis abroad, which I kept in mind while writing this thesis in Seattle.
Thank you Janneke Fekkes-Koolman, for your kindly help in sending the hard copy
of my thesis to the reading committee member in England, in extending my RuG
email that enables me to submit my thesis, and in arranging the reimbursement of
travel expenses for the conferences and courses in the past four years. I would like
to also thank you in advance for being very helpful in supporting my paranymphs
to distribute the thesis. I would be lost without your help. Jacques Hille, you were
always caring about my wellbeing and progress in my thesis writing. I have greatly
appreciated this, thank you so much for your concerns.
200
Tijtske Oenema, Hana Cernecka, and Kuldeep Kumawat, thank you for your interest
to get taste of Indonesian cultures by coming to watch my stage performance at the
Indonesian day! And together with David Wright, we explored the Dutch island,
cycling around Terschelling during the very rare Dutch summer. That was my first
time swimming with jellyfish in Dutch water! Thank you Mark Menzen for all the fun
you brought every day, making lab life less serious. Since you left, the lab was never
the same.
Thanks to my friends for making my life worth living, more colorful, and never letting
me give up. Christel Seegers and Thea van den Bosch, I am glad to have you as
my friends and so grateful to have you as my paranymphs. Thank you for helping
me with the Dutch summary for this thesis. Together with Maureen Xu, we always
made time for girls night out, thank you for all the fun times we shared, for coming
to my house often and willing to try my experimental cooking without any doubt.
Maybe because I did not tell you they were experimental dishes ;) I could not expect
to have better friends than you all. It was so difficult to say good-bye when I moved
to Seattle but who knows, I might come back to the Netherlands one day. In the
meantime, we will stay in touch.
Thank you to my topmaster fellows, Vijay Anand and Neeraj Kumar for our many
great times together. We have known each other for as long as I moved to Groningen
and we have been through many ups and downs, as foreigners in Groningen,
experiencing all the new stuff for the first time. Tomas Kloosterman, you are very
talented not only in science but also in music. Thank you for inviting me to your
piano concerts, sharing your creative homemade salad recipes, and not to mention
for fixing my bike. I am so glad that you found the love of your life, Angelique
Kloosterman that also shares the same interest in science and music. Thanks Johana
Isaza Correa for visiting me in Groningen, I hope everything goes well with your PhD
as well as personal life in Ireland. I missed our great time together with Karolina
Szczrba during summer in Groningen. I hope we can meet again one day either in
Europe or in the US. Sunil Lee and Smitha Chandran, thank you for your hospitality
and introducing me to authentic Indian foods. I would never forget the day that you
had to fly to India in the early morning, when Katarzyna Butler and I had to catch
the train carrying all your big suitcases at the very last minute. It was crazy but fun!
Thank you Valentine Kheng for making the world seems so small by keeping in touch
no matter where we are by visiting each other in different parts of the world. Thank
you for visiting me in the Netherlands and I was so glad to visit you in New York. I
am so grateful to have such amazing friends like you and Rama “Radut” Dhenni!
Thanks for your continuous support. Dut, I really appreciate your time and effort for
critically reading and reviewing my Indonesian summary for this thesis.
Robert Woudstra, thank you for kidnapping Wilfred for diving weekends, allowing
me to have peaceful ME time. Also thank you for traveling to my hometown, Bandung
201
to be present at our wedding in Indonesia and to be the first person to visit us in
Seattle! I hope you had great time in the US!
To the (former) members of Indonesian student association in Groningen (PPI
Groningen), thank you for organizing many events where I could speak Indonesian
and contribute to promote Indonesian cultures. Through this organization also I
met many PhD fellows from diverse backgrounds. I apologize I could not mention
everyone but I would like to thank all for all your support during my stay in
Groningen. A special thanks to Awalia Febriana and Astri Ferdiana, for being such
inspiring role models, to Surahyo Sumarsono for reviewing and providing feedback
for the Indonesian summary of this thesis. Thanks a bunch Daniel, words fall too
short to describe my gratitude for your kindly help and support in my first two years
in Groningen. Glad to hear that you also finishing your PhD. I am convinced that
you will get a postdoctoral position soon. Rieza Aprianto, we have known each
other since we were at ITB, you probably know me as ‘’mahasiswa nyasar’’ as I was
the only person from Microbiology that took Pharmacy courses. And later, to our
surprise, we ended up together again in Groningen. I wish you success to finalize
your thesis and good luck for your future career in the Netherlands! MacKenzie
Hadi, ‘who does not know Kenzi’, that was the first comment I heard from others
before I met you. After I met you, I know why. Thank you for being very entertaining.
Groningen has never been the same since you moved to Leiden. Amirah A. Alkaff,
Putri D. Utari, and Doti Parameswari, thank you for all the fun we shared together
during the preparation of the Indonesian day every year as well as for your kindly
support in the past four years.
Thank you the Marmalade gang, for all your mental support throughout my PhD and
being my friends in the last 13 years, no matter where you are in the world. Thank
you Mega Arfindari, Amalia Muntiyara, and Dessy Dwiyanti for always making time
to meet up every time I visit Indonesia. To Ikha Mansoora and Maya Fitriyanti, we
finally live in the same country again. We definitely will catch up more often. I hope
to visit you in South Korea soon, Anggita Karleshya.
I would like to thank my cousin, Joe Wimpi Manikam, who helped me out since
my final bachelor project at the Pharmaceutical Biotechnology laboratory at ITB.
Without your help as a medical doctor, I would not be able to perform the functional
assay to test the enzyme activity I worked on in 2008. For my PhD, you were again
very helpful for inspiring discussions on the plausible cause of death of the Fstl1
knockout mice. You are very talented and knowledgeable and I know I can always
come to you when I need clinical advice and medical doctor support.
A special thanks to Putri A. Wulandari, there are not enough words to thank you
enough. We have known each other for 18 years, you are like a sister to me. You
have been my living witness of my long journey in pursuing my ambition. Thank you
for visiting me when I just moved to Groningen and again when I was finishing up my
202
PhD and about to move to Seattle. I am glad that you will come to my defense. Thank
you for countless empowering discussions we had and for designing my beautiful
artsy cover that turned out to be better than my imagination!
My parents, mama and papa, thank you for raising me and providing me with loving
and caring environment, which allowed me to take a risky and difficult path that
no one in our family had yet pursued, from a bachelor in science to a master study
abroad, until my PhD. You never doubted my choices, instead encouraging me to
keep going, which eventually resulted in this thesis. Time difference and distance
have never been a problem to maintain our good communication, thank you for
your continuous support! Your support has helped me to persevere and go through
many difficult circumstances. Thanks my brother, Herren Calida for visiting me in
Groningen, soon you will graduate and apply your business skills in to practice. Best
of luck! Thanks to my brother, Hanel Topada and his lovely wife, my sister-in-law
Sylvia T. Gunawan for taking good care of our parents while I am so far, far away.
Thanks Nel for introducing me to the world of investment and for being my personal
financial advisor.
My parents-in-law, my mem, Janke Huitema, thank you for teaching me how to be
creative in sewing and knitting. I am so grateful to have you because I know I can
always be myself and come to you for support in the Netherlands. Thank you my
heit, Marten Poppinga for accompanying me to get my surgery in Assen as well as
for helping me moving in and out of 3 different houses, until we finally moved to
Seattle. With heit and mem, I had lots of memorable time in Germany, Belgium and
all around the Netherlands. I would also like to extend a thank you to Alexander
and Anje Poppinga for your hospitality and giving me my first adorable nephews in
the Netherlands, Jurryt and Thymen. Thank you Avelien Huitema, for visiting me
in Groningen multiple times. Congratulations on finishing your studies and taking
a bold move to look for your dream job! Marijke Huitema and Nicola Williams, it
felt like yesterday that I came to your wedding in Belgium, instead it has been four
years. Time goes so fast! Thank you for visiting me whenever you came back to the
Netherlands. I am so glad to hear that both of you have settled down now in Ghent.
Last but not least, thanks to Wilfred J. Poppinga for being such a sweet and loving
husband, for your non-stop support and faith in me. Thank you for always taking
good care of me, being an antidote of my stress, giving me all the freedom I wish
for, and much more. No wonder I married you 3 times! We have been through many
challenges together in the past 5 years, including living on different continents twice.
I hope we will never do it again. I am very happy to share my life with you. Words
could never be enough to express my gratitude to have you as my life partner.
Navessa P. Tania
Seattle, WA
June 2017
203
 1

BIOGRAPHY
AND
LIST OF PUBLICATIONS

205
About the author
Navessa Padma Tania was born in Bandung, Indonesia on April 12nd in 1986. After
finishing her final project at the Department of Pharmaceutical Biotechnology,
she obtained her bachelor degree in Microbiology at the Bandung Institute of
Technology, Indonesia in 2008. Upon graduation, she worked as a research assistant
at the Mochtar Riady Institute for Nanotechnology.
In 2010, she was awarded with a talent grant from the Groningen Biomolecular
Sciences and Biotechnology Institute, to participate in a 2-year Topmaster program in
Biomolecular Sciences at the University of Groningen, The Netherlands. During her
master studies, she developed her scientific skills at the Department of Molecular
Genetics, and she participated in the 2011 international Genetically Engineered
Machine (iGEM) competition in synthetic biology at the Massachusetts Institute of
Technology, USA. As a final master project, she performed a collaborative project
at the University Medical Center Groningen between the Department of Medical
Oncology and the Department of Molecular Pharmacology.
Upon completion of her master degree, she started her PhD studies at the
Department of Molecular Pharmacology, at the University of Groningen in close
collaboration with the Academic Medical Center, Amsterdam. In 2015, she won an
abstract award from American Thoracic Society in Denver, USA. Her research focused
on the roles of Follistatin-like 1 in the lung is presented in this thesis.
206
Published articles
N.P. Tania, H. Maarsingh, I. S. T. Bos, A. Mattiotti, S. Prakash, W. Timens, Q. D. Gunst, L.
J. Jimenez-Borreguero, M. Schmidt, M. J.B. van den Hoff, R. Gosens. Endothelial follistatin-
like-1 regulates the postnatal development of the pulmonary vasculature by modulating
BMP/Smad signaling. Pulm Circ. 2017;7(1) 219–231.
N.P. Tania, M. Schmidt, R. Gosens. Activin-A: active in inflammation in COPD. Eur Respir J.
2014 Apr;43(4):954-5.
H. Alkhouri, W.J. Poppinga, N.P. Tania, A. Ammit, M. Schuliga. Regulation of pulmonary
inflammation by mesenchymal cells.Pulm Pharmacol Ther. 2014;29(2):156-65.
W.W. Wang, S.F. Ang, R. Kumar, C. Heah, A. Utama, N.P. Tania, H. Li, S.H. Tan, D. Poo, S.P.
Choo, H.C. Toh. Identification of Serum Monocyte Chemoattractant Protein-1 and Prolactin
as Potential Tumor Markers in Hepatocellular Carcinoma. PLoS One. 2013, 8(7): e68904.
A. Utama, N.P. Tania, R. Dhenni, R.A. Gani, I. Hasan, A. Sanityoso, S.A. Lelosutan, R.
Martamala, L.A. Lesmana, A. Sulaiman, S. Tai. Genotype diversity of hepatitis C virus (HCV) in
HCV-associated liver disease patients in Indonesia. Liver Int. 2010, 30(8):1152-60.
Published abstracts
N.P. Tania, R. Gosens, S. T. Bos, W. Timens, M. Schmidt, M. van den Hoff, H. Maarsingh.
Endothelial Follistatin-like 1 regulates the maturation of the pulmonary vasculature by
modulating BMP/Smad signaling. The FASEB Journal, 2016, 30 (1): 300.1.
N.P. Tania, R. Gosens, I.S.T. Bos, A. Mattiotti, S. Prakash, W. Timens, Q.D. Gunst, L.J. Jimenez-
Borreguero, M. Schmidt, M.J.B. van den Hoff, H. Maarsingh. Endothelial Follistatin-like-1 is
crucial for normal development of the pulmonary vasculature in mice. Am J Respir Crit Care
Med. 2015, 191: A5960.
N.P. Tania, R. Gosens, W. Timens, M. Schmidt, M. van den Hoff, H. Maarsingh. Follistatin-like
1 regulates inflammatory cytokine release from lung fibroblasts and airway smooth muscle
cells. Am J Respir Crit Care Med. 2014; 189:A5314.
207