Accepted Manuscript

Title: SugE belongs to the Small Multidrug Resistance (SMR)

Protein Family involved in Tributyltin (TBT) Biodegradation
and Bioremediation by Alkaliphilic Stenotrophomonas
chelatiphaga HS2

Author: Hamdy A. Hassan

PII: S0141-8130(17)33210-5
DOI: https://doi.org/10.1016/j.ijbiomac.2017.11.025
Reference: BIOMAC 8505

To appear in: International Journal of Biological Macromolecules

Received date: 24-8-2017

Revised date: 4-11-2017
Accepted date: 6-11-2017

Please cite this article as: Hamdy A.Hassan, SugE belongs to the Small Multidrug
Resistance (SMR) Protein Family involved in Tributyltin (TBT) Biodegradation and
Bioremediation by Alkaliphilic Stenotrophomonas chelatiphaga HS2, International
Journal of Biological Macromolecules https://doi.org/10.1016/j.ijbiomac.2017.11.025

This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof
before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that
apply to the journal pertain.
SugE belongs to the Small Multidrug Resistance (SMR) Protein Family involved in

Tributyltin (TBT) Biodegradation and Bioremediation by Alkaliphilic

Stenotrophomonas chelatiphaga HS2

Hamdy A. Hassan

Department of Environmental Biotechnology, Genetic Engineering and Biotechnology Research

Institute, University of Sadat City, Sadat City, Egypt

Current address: Department of Biological Science, Faculty of Science and Humanity Studies at Al-

Quwayiyah, Shaqra University, Al-Quwayiyah 11971, Saudi Arabia

E-mail: hamdy.hassan@gebri.usc.edu.eg

Tel: +2-010-10531994; Fax: +2-048-2601268

1
ABSTRACT

Tributyltin (TBT) used in a variety of industrial processes, subsequent discharge into the

environment, its fate, toxicity and human exposure are topics of current concern. TBT degradation

by alkaliphilic bacteria may be a key factor in the remediation of TBT in high pH contaminated

sites. In this study, Stenotrophomonas chelatiphaga HS2 were isolated and identified from TBT

contaminated site in Mediterranean Sea. S. chelatiphaga HS2 has vigor capability to transform TBT

into dibutyltin and monobutyltin (DBT and MBT) at pH 9 and 7% NaCl (w/v). A gene was

amplified and characterized from strain HS2 as SugE protein belongs to SMR protein family, a

reverse transcription polymerase chain reaction analysis confirmed that SugE protein involved in

the TBT degradation by HS2 strain. TBT bioremediation was investigated in stimulated TBT

contaminated sediment samples (pH 9) using S chelatiphaga HS2 in association with E. coli BL21

(DE3)-pET28a(+)-sugE instead of S chelatiphaga HS2 alone reduced significantly the TBT half-life

from 12d to 5d, although no TBT degradation appeared using E. coli BL21 (DE3)-pET28a(+)-sugE

alone. This finding indicated that SugE gene increased the rate and degraded amount of TBT and is

necessary in enhancing TBT bioremediation.

Keywords: SugE protein; TBT; alkaliphilic bacteria

Introduction

Tributyltin (TBT) has different commercial uses, include wood treatment and preservation,

antifouling of boats (in marine paints), antifungal action in textiles and industrial water systems,

such as cooling tower and refrigeration systems, wood pulp and paper mill systems, and breweries

[1-2].

TBT exposure are generally proposed either directly by ingestion of contaminated seafood

or indirectly by exposure from household items containing butyltin compounds [3]. TBT leads to

the contamination of foodstuff and beverages like drinking water and wine [4]. Several studies

2
either in vivo or in vitro have suggested that potential adverse effects of TBT in humans include

cardiovascular, respiratory and reproductive deficiencies [4] and also suggest that TBT has a role

in the human immune response by affecting on the lymphocytes B and reducing natural killer

cells activity [3].

Generally, TBT is more toxic than dibutyltin (DBT) and monobutyltin (MBT) [5]. Some

countries continued using TBT, although International Maritime Organization has been banned it

[6].

TBT is toxic to most of bacterial strains collected from sediments, where Gram- positive bacteria

were more sensitive to TBT [7-8]. The resistance of bacteria to TBT can be happened by three

methods, firstly: removing of butyl groups from the tin atom, this lead to DBT and MBT formation,

secondly: through a multidrug efflux pump by pumping out TBT [9] thirdly: some bacterial cells

have the capability of TBT bioaccumulation [10]. TBT can be degraded by bacteria either Gram-

negative or Gram-positive bacteria [8,11,12], but still agape which gene/s responsible for TBT

degradation by TBT bacterial degraders [13-15].

Alkaliphiles represent 1-10% from the aerobic organisms and most of alkaliphiles are also

halophiles, because alkaliphiles require some sodium ions to grow [16-17]. Hydrocarbons wastes in

high pH industrial wastewaters can be treated by alkaliphiles [18]. Moderate alkaliphiles and

halophiles can be used in different promising application compared with other extremophiles

[16,19,20].

Small multidrug resistance (SMR) proteins are found in most of the bacterial plasma

membranes [21] that allow resistance to lipophilic cations and antibiotics especially quaternary

ammonium compounds (QAC) [22]. SMR proteins are multidrug transporters family in bacteria

with short length (105-150 amino acids), they have a wide diversity in structure and function [22-

24]. Suppressor of groEL mutations (SUG) is a major protein subclass from the SMR protein family

allowing bacteria to resist quaternary cation compound (QCC) [22, 24]. SugE was discovered in

3
Aeromonas molluscorum Av27, as sugE involved in TBT resistance without indication for its role

in TBT degradation, although Av27 strain is TBT degrader [24].

Bioremediation is considered as a relatively low-cost technology, reduces health and ecological

effects, which usually has a high public acceptance and can often be carried out on site without

changing the environment. [25-26], where bioaugmentation is considered one of the most efficient

method in bioremediation [27]. Bioaugmentation refers to a technique of bioremediation in which

natural or genetically engineered microorganisms capable of catabolizing the contaminant with

unique metabolic profiles are used to treat the contaminated sites [28]. Most experiments dealing

with bioaugmentation were carried out using Gram-negative bacteria as Pseudomonas,

Sphingobium and Achromobacter [29-31] and also with Gram-positive bacteria as Rhodococcus,

Mycobacterium and Bacillus [32-34]. Thus, biological methods using microorganisms or microbial

consortia capable of pollutant degradation have a great appeal in their potential application for

environmental remediation. GMOs and their genetic transfer of catabolic genes using molecular

biology is a possible method for engineering or enhancing remediation genes to the pollutants in

natural environments [35].

To our knowledge, there is no halo or alkaliphilic bacteria from Mediterranean Sea have been

isolated and reported to exhibit resistance or possess a degradation and remediation capability to

TBT. The objective in this study, is to isolate and characterize alkaliphilic bacterium from the

Mediterranean Sea, Abu Qir- coastline, Egypt, that have the capability to degrade TBT into DBT

and MBT and try to find gene/s responsible for the biodegradation and bioremediation of TBT by

the new bacterial strain.

2. Materials and methods

2.1 Isolation and identification of haloalkaliphilic bacteria degrading TBT

4
 TBT contaminated samples were collected from water and sediments in the Mediterranean Sea,

Abu Qir-coastline, Egypt. Samples were placed in sterile bottles. Enrichment cultures were

prepared by adding 1 ml of water sample to 9 ml of mineral medium (MM) [36] with TBT (125

μM), 3% NaCl (w/v) and pH 9, the cultures were incubated at 30°C, and 10% of the culture was

transferred after one month to fresh MM containing pH 7 – 11. MM agar plates supplemented with

TBT were spread with dilutions of the culture and incubated for 7 days. The purified isolate was

selected and identified by 16S rRNA; three primers were used for the amplification of 16S rRNA.

These include: Bact 27f (5’-AGAGTTTGATC(A/C)-TGGCTCAG-3’), Bact 1492r (5’-

TACGG(C/T)-ACCTTGTTACGACTT-3’), and Bact 1098r (5’-AAGGGTTGCGCTCGTTGCG-

3’) [37], full-length sequence (1492bp) of the 16S rRNA was obtained, and aligned using Clustal W

implemented in MEGA software version 3, 1 [38]. The phylogenetic tree was constructed using

Phylogeny.Fr [39].

2.2 TBT and Antibiotic sensitivity

HS2 sample was spread on MM containing 125μM TBT, The isolate was successively

transferred to MM plates containing TBT concentrations (0- 3) mM. The pure isolate was tested to

the antibiotic sensitivity according to the Clinical Laboratory Standard Institute [40].

2.3 Effect of pH and salinity on TBT degrading ability

Bacterial pure culture from HS2 was grown in minimal medium (MM) containing 2 mM of TBT

until growth reached late exponential phase. Cells harvested, and resuspended to an OD600 nm of 5.

The effect of salt and pH on TBT biodegradation was determined at (0–12%) NaCl (w/v) and pH

(7-11) [41-42]. Abiotic loss was monitored in sterile TBT-containing medium.

2.4 Growth curve and TBT analysis

5
 To quantify the growth rate of S. chelatiphaga HS2 and TBT disappearance, HS2 was grown as

described above and the cultures were harvested during the late of exponential growth phase by

centrifugation at 7000 rpm for 10 min. Cells were washed twice with 50mM phosphate buffer (pH

9) and resuspended in liquid MM to give an OD600nm of 0.1. Degradation of TBT was tested in

sterilized glass tubes containing 2ml cell suspension (OD600nm = 0.1) and 2mM of TBT as sole

carbon source. The test tubes were incubated at 150 rpm and 30°C. For the estimation of the colony

forming units (CFU) aliquots were serially diluted, 100μl aliquots were plated on solid LB medium

and the CFUs counted after 2 days incubation at 30°C. Uninoculated tubes and tubes without

substrate served as controls. For TBT analysis the sample vial was purged with nitrogen gas to

achieve an inert atmosphere chamber to exclude oxygen and water. A 90 μl solution of 0.8M n-

hexylmagnesium bromide was added and derivatized for 30min. The reaction was stopped by

adding 1mL of 2M HCl and the solution was set aside for 30 min. The organic phase was separated

by n-hexane and moisture was removed with anhydrous ammonium sulfate, 1 μl was injected to gas

chromatography (Agilent 7890A GC system) with flame ionization detector (FID). The GC

analyses were performed under flow of nitrogen (2 ml/min) on HP-5 column (30 m length, 0.25 mm

I.D., 0.25 μM film thickness). The oven temperature was increased from 80˚C to 320 ˚C by a rate of

3˚C/min. TBT and Dibutyltin dichloride (DBT), purchased from Sigma Aldrish, Germany) were

injected to GC-FID to act as standards according to their retention time and peak area

2.5 Amplification of TBT degrading gene

Genomic DNA was extracted from the strain HS2 grown on MM + Na2CO3 (pH 9) and salinity

(NaCl 7%) in the presence of TBT as a sole carbon source. The isolated DNA was screened for the

presence of TBT gene using specific primers (5’-ATGCCCTGGATATTGCTGCTC-3’ and 5’-

GGGTGAAACCTTGGGTGTATTTG-3’) [24]. The purified DNA was sequenced and the

nucleotide sequences determined in this study were compared with existing sequences in GenBank

by performing a BLASTn and BLASTp search.

6
2.6 Extraction of mRNA, cDNA synthesis, and RT-PCR

To assess constitutive expression, S chelatiphaga HS2 was grown on TBT (2 mM) and was

grown in parallel on Glucose (2 mM) as the sole carbon source, the cultures were harvested during

exponential growth by centrifugation. Total RNA was isolated from 3 ml of TBT- or Glucose-

grown cells. Harvested cells were resuspended in 100 µl water and immediately processed as

previously described [43]. The RNA was subsequently purified using the RNeasy kit (Qiagen), and

2 µl of the eluted RNA (60µl) was separated in 1% agarose gels and stained with ethidium bromide.

cDNA was synthesized from 1 µl of total RNA using a RevertAid First Strand cDNA Synthesis Kit

(Thermo Scientific) from RNA templates. The kit uses RevertAid Reverse Transcriptase (RT), a

recombinant M-MuLV RT which maintains activity at 42-50°C. RiboLock RNase Inhibitor,

supplied with the kit, effectively protects RNA templates from degradation. The reverse

transcription reaction mixtures were serially diluted (3.2-fold) with nuclease-free water (Qiagen),

and 1 µl of each dilution was subjected to amplification by PCR using the primer set TBTRNAF

(5’- GGTGGATATTCCTGCTCGTC -3’) and TBTRNAR (5’- ATGCCTTTCAGACCCAGGAT -

3’) to SugE gene fragment were amplified, purified and sequenced to verify their identity.

2.7 Heterologous expression of sugE gene

The suitable expression in E.coli, sugE was cloned into the expression vector pET28a (+). The sugE

gene was amplified by PCR with the primers pairs which was added a Nde I and Sac I site

(underlined) sugEfe: 5′-ATGCATATGCCTGGATATTGCTGCTC-3′ and sugEre 5′-

GGGTGAGCTCAACCTTGGGTGTATTTG-3′. The constructs were transformed into E.coli BL21

(DE3) for expression. Strain BL21 (DE3)-pET28a(+)-sugE was grown in LB with antibiotic to an

OD600 of 0.6, at which 0.5 mM IPTG was added to induce the protein expression, after one hour it

will be suitable for inoculation in TBT contaminated soil.

7
2.8 Bioremediation of TBT in the sediments

Sediment from Mediterranean Sea, Abu Qir-coastline, Egypt was homogenized and spiked with

TBTCl at 150µg kg-1 to obtain a control sample, 2 kg of spiked sediment was transferred into a 2L

sterilized glass flask. Three enhanced samples each has 2kg of spiked sediment pH 9 in 2L

sterilized glass flask, one was inoculated by 300 mL of a cell culture from E. coli BL21 (DE3)-

pET28a(+)-sugE, prepared previously to obtain approximately 108 cells g-1 of sediment, the second

was inoculated by 300 mL of a cell culture from S. chelatiphaga HS2 to get 108 cells g-1 of

sediment and the third was inoculated with 150ml from E. coli BL21 (DE3)-pET28a(+)-sugE and

150ml from S. chelatiphaga HS2 (1:1) tell 108 cells g-1 of sediment. The samples were aerated and

incubated at 28⁰C to start the degradation. Subsequently, the samples were homogenized and water

was replenished before sediment was collected periodically up to 20 d. Analysis of TBT compounds

were carried out to determine degradation performance as described previously with [44-45]

2.9 Nucleotide sequence accession number

The 16S rRNA sequence for the reported strain in this study S. chelatiphaga HS2, has been

deposited in the GenBank database under accession numbers (KR780649) and SMR gene (sugE

gene) under accession numbers MF447451.

3. Results

3.1 Haloalkaliphilic Bacteria isolation and identification

In this study alkaliphilic bacterial culture capable of growing on TBT as a sole source of carbon and

energy was isolated from alkaline and saline water samples from Port of Abu Qir, Egypt. The

isolate could grow at pH 7.5-10, with optimum growth at pH 9 and could also grow at 1.5-10%

NaCl, with optimum growth at 7% NaCl. The isolate couldn’t grow at lower pH7 or lower

salinity1.5%. 16S rRNA sequence result suggested that the isolates were phylogenetically most

8
closely related to Stenotrophomonas chelatiphaga strain LPM-5 with 98% similarity and was

identified Stenotrophomonas chelatiphaga HS2 designated as HS2.

3.2 TBT sensitively and degradation by S. chelatiphaga HS2

TBT and its degradation products (DBT and MBT) were measured during incubation for 40 hours

in MM containing TBT concentrations (0-3mM) and NaCl (7%) at pH 9, and there is no growth or

TBT degradation on the control (media without inoculation). The results showed that HS2 strain

can grow at high TBT concentrations (up to 3mM) and its best growth was at 2mM TBT

concentration. Moreover, HS2 showed a decrease in TBT percentage and generation of DBT and

MBT as degradation products. This indicated that this bacterial strain has the capability process to

reduce the TBT concentration. There is no degradation appeared by increasing salinity above 10 %

even after increasing the incubation time.

Strain HS2 degraded more than 90 % of the TBT, converting 50% into DBT and 35% into

MBT in the presence of its best conditions for growth ( pH 9, 7% salinity and 30˚C). The

degradation proceeded according to the postulated scheme shown in (Fig. 1). Phylogenetic analysis

of 16S rRNA gene for Stenotrophomonas chelatiphaga HS2 showed 98% similarity with

Stenotrophomonas chelatiphaga LPM-5 and 93 % similarity with Stenotrophomonas maltophilia

KB2. (Fig. 2)

TBT degradation with S. chelatiphaga HS2 in the presence of the best conditions (pH 9, 7%

NaCl and 30˚C) showed a decrease in TBT concentration profile between 10 hours and 30 hours

consistent with the rise of bacterial growth (Fig. 3), whereas the degradation rate declined along

with the available nutrients between 30 hours and 50 hours, achieving more than 95 % of

degradation within 50 hours. The degradation of TBT contrasted with generation of DBT and MBT

as intermediate products. DBT concentration increases during incubation, reaching around 50% of

the original TBT concentration (2mM), MBT was detected with 35% during this period of

9
incubation, the cultured media showed the brown, yellow and white color coincided with the

postulated products that could be inorganic tin in the form of insoluble compounds. S. chelatiphaga

HS2 strain has the capability to use TBT as carbon source in a mineral salt medium with 7% salinity

and pH 9.

S. chelatiphaga HS2 degraded TBT into DBT and MBT as less toxic compounds. TBT

degradation has been determined by using GC-FID [46] and standard TBT and DBT with retention

time (21.020 and 14.226min), the derivatives solution for HS2 bacterial sample showed peaks with

the same retention time for TBT and DBT (Fig. 4), while MBT was predicted from the sample

because it is less polar than DBT and TBT, this results indicated that HS2 has effective debutylation

of TBT according to reported studies [47-48].

3.3 Antibiotic sensitivity of S. chelatiphaga HS2

The results showed HS2 was sensitive to all antibiotics tested except Ampicillin, amoxicillin-

clavulanic acid30 mcg/disc as ß-lactams antibiotics, and this confirm that there is no potential risk

of toxicity for HS2.

3.4 Detection of a gene involved in tributyltin (TBT) resistance in S. chelatiphaga HS2

A gene was amplified using specific primers [24]. The obtained fragment was 315bp, whose

deduced 104 amino acids sequence have high similarity (97%) with Av27-sugE gene from

Aeromonas molluscorum Av27, that is involved in TBT degradation by this strain [24], (91%)

highly homologous with the small multidrug resistance (SMR) family SMR from Aeromonas rivuli

and (83%) to the Aeromonas hydrophila-sugE belonging to the small multidrug resistance (SMR)

family, which includes genes involved in the transport of lipophilic drug, where HS2-sugE in this

study showed ~70% highly similarity with the other reprted sugE protein from the strains

Rhizobium sp. NFR03, Rhizobium sp. 9140, and Methylobacterium sp. 174MFSha1.1 (Fig. 5).

10
3.5 Expression of HS2-sugE gene in S. chelatiphaga HS2

To verify whether HS2-sugE gene expressed in response to TBT, RT-PCR experiments were

performed with total RNA extracted from S chelatiphaga HS2 growing on TBT and Glucose (Fig.

6A) [43, 49]. RT-PCR amplification products of the expected 300-bp size were observed with 3pg

of RNA extracted from the culture grown on TBT (Fig 6B), whereas no product was detected with

RNA extracted from the culture grown on fructose (Fig. 6C), indicating that gene transcripts are

induced at least 107 fold and also specifically induced in the presence of TBT, in addition, no

amplification products were observed in controls devoid of reverse transcriptase. Sequencing of the

approximately 300-bp product confirmed that it was identical to the corresponding sugE gene

fragment from genomic DNA of S chelatiphaga HS2.

3.6 Bioremdiation of TBT by S chelatiphaga HS2.

The degradation of TBT in the sediments by S chelatiphaga HS2 was confirmed by adjusting

sediment condition at pH 9. The obtained results by inoculation S chelatiphaga HS2 in association

with E. coli BL21 (DE3)-pET28a(+)-sugE in the autoclaved sediments spiked with TBT 150µg/ k

g-1 was superior in the enhancement of TBT degradation (Fig 7B) than the inoculation by S

chelatiphaga HS2 only (Fig 7A) and deceases half-life of TBT degradation from 12d to 4d in both

inoculations DBT and MBT were appeared as result of TBT transformation, in other side there is no

any degradation for TBT either in presence of E. coli BL21 (DE3)-pET28a(+)-sugE alone or in the

control.

4. Discussion

Tributyltin (TBT) is considered as recalcitrant compound and has a toxically effect to a large

number of aquatic organisms [50-52]. Some microorganisms were as TBT resistance [53-57],

although the toxicity effect of TBT on the organisms either eukaryotic or prokaryotic [4]. S.
11
chelatiphaga HS2 showed the optimum degradation capability at pH 9 and 7% NaCl, where TBT

degradation by Aeromonas molluscorum Av27 and Aeromonas veronni Av27, which used TBT as

carbon source in a mineral salt medium [8] and showed an optimum growth with salinity 4% and

pH 9 [58-59], by increasing the salinity over 7% or alkalinity over pH 9 effect negatively on the

growth and the TBT degradation capability of HS2 as observed with most extremely halotolerant

hydrocarbon degrading bacteria [60-61].

Understanding alkaliphiles diversity and identifying its microorganisms that play a key role in

TBT degradation are important for defining new strategies for TBT bioremediation. Most of the

studies have been carried out bacterial degradation of TBT at not extreme conditions [9, 24], but

very few reports are known about biodegradation of TBT at extreme environments such as hyper

saline and alkaline conditions using pure bacterial isolates [58-59]. The polluted wastes either from

ships or factories drains in the seas or oceans often have high pH and their bioremediation using

nonalkaliphilic microorganisms is difficult because high pH and salt inhibit their growth and the

degradation of organic compounds [60, 62, 63].

HS2 was most closely related to S. chelatiphaga LPM-5 which is aerobic EDTA degrading

bacterium [64] and S. maltophilia KB2 which is triphenyltin degrading bacterium [65]. HS2 was

sensitive for most of antibiotics indicating that it is non-pathogenic bacterium and could be suitable

for TBT bioremediation [59]. The bacterial resistances to the antibiotics have effect on human

health and may be toxic [66] as a result of horizontal gene transfer through plasmids, transposons

and integrons lead to rapid appearance of antibiotic resistance between environmental bacteria [67-

69].

To clarify, which is involved in TBT resistance the cellular or molecular mechanisms, it is

supposed to be different either among bacterial genera or even the same species or strains [9, 24],

for this reasons molecular studies on TBT degraders received great attention specially genes and its

rolls in the mechanisms of TBT degradation, moreover it is not known whether alkaliphilic bacteria

12
have novel genes and pathways to degrade TBT in comparison with the identified genes by

nonalkaliphiles.

The obtained gene from strain HS2 was very similar to sugE from Aeromonas molluscorum

Av27, which has the capability to degrade TBT into DBT and MBT, and then complete

debutylation happened and free Tin obtained. The results of RT-PCR experiments showed that

SugE gene expressed only in the presence of TBT as direct evidence that S chelatiphaga HS2 is

TBT degrader and considered as a novel haloalkaliphilic TBT degrader and could be effective

candidate bacterium for TBT bioremediation in the halophilic and alkaliphilic TBT contaminated

sites.

Most xenobiotics bioremediation studies by bioaugmentation with single strains inoculation have

been carried out using Gram-negative bacteria [28], where S chelatiphaga HS2 is Gram-negative.

Inoculation natural attenuation sediments spiked by TBT with Enterobacter cloacae resulted in

half-life reduction to 10d at pH 7.5 [45]. S. chelatiphaga HS2 has the capability to degrade TBT in

half-life 12d at pH 9 in autoclaved sediments spiked by TBT without any natural attenuation, the

halfe-life of TBT reduced to only 4d using S chelatiphaga HS2 in association with E. coli BL21

(DE3)-pET28a(+)-sugE, this results confirmed that sugE overexpressed and increased the TBT

degradation resulting in reducing TBT half-life. Many studies dealt with using genetically modified

bacterial strain for hydrocarbon degradation in soil to enhance the ability of new genetically

modified bacterial strains to degrade a wide range of hydrocarbon pollutants and increase the

degradation efficiency in comparison with wild hydrocarbon degrading bacteria [70-72].

Laboratory-constructed strain E. coli D11-inoculated in soil contaminated with 2,4-D has the

capability to degrade 2,4-D more rapidly than the inoculated 2,4-D degrader R. eutropha JMP134

[70]. These results indicated that laboratory-constructed strains could be considered for xenobiotics

bioremediation using bioaugmentation approach. Interestingly, there is no any TBT degradation

using E. coli BL21 (DE3)-pET28a(+)-sugE alone, this indicated that sugE could not start the

13
debutylation of TBT and could be another gene in S chelatiphaga HS2 initiate TBT degradation and

then start TBT debutylation by sugE gene.

5. Conclusions

The finding from this study is to isolate and characterize alkaliphilic bacterium that has the

capability to degrade TBT into DBT and MBT. S. chelatiphaga HS2 was obtained, and could use

TBT as a carbon source in minimal media with 7% salinity and pH 9. S. chelatiphaga HS2 was the

most effective TBT degrader, non-pathogenic and transform most of TBT into DBT and MBT.

Molecular studies have been done to clarify that system in the TBT resistant of S. chelatiphaga

HS2, new gene was amplified and identified as sugE gene, a reverse transcription polymerase chain

reaction analysis in HS2 strain confirmed that sugE protein was contributed in the TBT degredation.

The study suggests that, to get more effectiveness bioremediation in sediments spiked with TBT, it

could be by inoculation the sediments by S. chelatiphaga HS2 together with E. coli BL21 (DE3)-

pET28a(+)-sugE. This study also mentioned for the first time that, it could be another gene initiate

the TBT degradation and then sugE gene make the TBT debutylation. S. chelatiphaga is novel

alkaliphilic strain and its TBT degradation capability has never been reported previously. Moreover,

HS2 strain is an effective candidate bacterium for TBT bioremediation in the halophilic and

alkaliphilic TBT contaminated sites.

Acknowledgements

The authors thank Somya E. Dawah for excellent technical assistance.

14
References

[1] J.J. Cooney, Organotin compounds and aquatic bacteria: a review. Helgol. Mar. Res.

49(1995) 663-677.

[2] K. Fent, Organotin compounds in municipal wastewater and sewage sludge: contamination,

a fate in treatment process and ecotoxicological consequences. Sci. Total. Environ. 185

(1996) 151-159.

[3] M. Azenha, M.T. Vasconcelos, Butyltin compounds in Portuguese wines. J. Agric. Food

Chem. 50 (2002) 2713-2716.

[4] B. Antizar-Ladislao, Environmental levels, toxicity and human exposure to tributyltin

(TBT)- contaminated marine environment. A review. Environ. Int. 34 (2008) 292-308.

[5] M. Ferreira, L. Blanco, A. Garrido, J.M. Vieites, A.G. Cabado, In Vitro Approaches To

Evaluate Toxicity Induced by Organotin Compounds Tributyltin (TBT), Dibutyltin (DBT),

and Monobutyltin (MBT) in Neuroblastoma Cells. J. Agric. Food. Chem. 61(2013) 4195-

4203.

[6] IMO, International convention on the control of harmful anti-fouling systems on ships

AFS/CONF/26. London: IMO (2001) pp1-28.

[7] S.A. Mendo, P.R. Nogueira, S.C.N. Ferreira, R.G. Silva, Tributyltin and triphenyltin toxicity

on benthic estuarine bacteria. Fresenius Environmental Bulletin 12 (2003) 1361-1367.

[8] A. Cruz, T. Caetano, S. Suzuki, S. Mendo, Aeromonas veronii, a tributyltin (TBT)-

degrading bacterium isolated from an estuarine environment, Ria de Aveiro in Portugal.

Mar. Environ. Res. 64 (2007) 639-650.

[9] F. Jude, C. Arpin, C. Brachet-Castang, M. Capdepuy, P. Caumette, C. Quentin, TbtABM, a

multidrug efflux pump associated with tributyltin resistance in Pseudomonas stutzeri.

FEMS Microbiol. Lett, 232 (2004) 7-14.

15
[10] T. Fukagawa, S. Konno, K. Takama, S. Suzuki, Occurrence of tributyltin (TBT) and methyl

mercury tolerant bacteria in natural seawater to which TBT was added. J. Mar. Biotechnol. 1

(1994) 211-214.

[11] F. Jude, J.F. Lascourreges, M. Capdepuy, C. Quentin, P. Caumette, Evaluation of tributyltin

resistance in marine sediment bacteria, Can. J. Microbiol. 42 (1996) 525-532.

[12] S.K. Dubey, U. Roy, Biodegradation of tributyltins (organotins) by marine bacteria, Appl.

Organomet. Chem. 17 (2003) 3-8.

[13] S. Kawai, Y. Kurokaw, H. Harino, M. Fukushima, Degradation of tributyltin by a bacterial

strain isolated from polluted river water, Environ. Pollut. 102 (1998) 259-263.

[14] H. Harino, M. Kitano, Y. Mori, K. Mochida, A. Kakuno, S. Arima, Degradation of

antifouling booster biocides in water, J. Mar. Biol. Assoc UK 85 1(2005) 33-38.

[15] A.S. Stasinakis, N.S. Thomaidis, A.Nikolaou, A . Kantifes, Aerobic biodegradation of

organotin compounds in activated sludge batch reactors, Environ. Pollut. 134 (2005) 431-

438.

[16] H.A. Hassan, N.M. Rizk, M.A. Hefnawy, A.M. Awad, Isolation and characterization of

halophilic aromatic and chloroaromatic degrader from Wadi El-Natrun Soda lakes, Life. Sci.

J. 9 (2012)1565-1570.

[17] H.A. Hassan, A.B.A.Z. Eldein, N.M. Rizk, Cloning and Kinetic Properties of Catechol 2, 3-

dioxygenase from Novel Alkaliphilic BTEX-degrading Pseudomonas sp. HB01, Life. Sci.

J. 11(2014a) 376-384.

[18] R. Margesin, F. Schinner, Biodegradation and bioremediation of hydrocarbons in extreme

environments, Appl. Microbiol. Biotechnol. 56 (2001) 650-663

[19] S. Ramesh, M. Rajesh, N. Mathivanan, Characterization of a thermostable alkaline protease

produced by marine Streptomyces fungicidicus MMLY,614. Bioprocess Biosyst. Eng. 32

(2009) 791- 800.

16
[20] M. Manikandan, V. Kannan, L. Pasic, Diversity of microorganisms in solar salterns of

Tamil Nadu, India, World J. Microbiol. Biotechnol. 25 (2009) 1007-1017.

[21] D.C. Bay, R.J. Turner, Diversity and evolution of the small multidrug resistance protein

family, BMC Evol. Biol. 9 (2009)140.

[22] D.C. Bay, K.L. Rommens, R.J. Turner, Small multidrug resistance proteins: A multidrug

transporter family that continues to grow, Biochim. Biophys. Acta, Biomembr. 1778

(2008)1814-1838.

[23] D.C. Bay, R.J. Turner, Spectroscopic analysis of the intrinsic chromophores within small

multidrug resistance protein SugE. Biochim. Biophys. Acta. 1808 (2011) 2233-2244.

[24] A. Cruz, N. Micaelo, V. F´elix, J. Song, S. Kitamura, S. Suzuki, S. Mendo, sugE: a gene

involved in tributyltin (TBT) resistance of Aeromonas molluscorum Av27. J. Gen. Appl.

Microbiol. 59 (2013) 39-47.

[25] R.N.Z. Abd Rahman, F.M. Ghazali, A.B. Salleh, M., Basri, Biodegradation of hydrocarbon

contamination by immobilized bacterial cells. J. Microbiol. 44 (2006) 354-359.

[26] D. Sarkar, M. Ferguson, R. Datta, S. Birnbaum, Bioremediation of petroleum hydrocarbons

in contaminated soils: Comparison of biosolids addition, carbon supplementation, and

monitored natural attenuation. Environ. Pollut. 136 (2005) 187-195.

[27] S. Liu, J.M. Suflita, Ecology and evolution of microbial populations for bioremediation.

Trends Biotechnol. 11 (1993) 344-352.

[28] A. Mrozik, Z. Piotrowska-Seget, Bioaugmentation as a strategy for cleaning up of soils

contaminated with aromatic compounds. Microbiol. Res. 165 (2010) 363-375.

[29] E. Heinaru, M. Merimaa, S. Viggor, M. Lehiste, I. Leito, J. Truu, A. Heinaru,

Biodegradation efficiency of functionally important populations selected for

bioaugmentation in phenol- and oil-polluted area. FEMS Microbiol. Ecol. 51 (2005) 363–

73.

17
[30] R.I. Dams, G. Paton, K. Killham, Bioaugmentation of pentachlorophenol in soil and

hydroponic system. Int. Biodeterior. Biodegrad. 60 (2007) 171–177.

[31] Z. Ronen, L. Vasiluk, A. Abeliovih, A. Nejidat, Activity and survival of tribromophenol-

degrading bacteria in a contaminated desert soil. Soil Biol. Biochem. 32 (2000) 1643-1650.

[32] M. Briglia, E.L. Nurmiaho-Lassila, G. Vallini, M.S. Salkinoja-Salonen, The survival of

pentachlorophenol-degrading Rhodococcus chlorophenolicus PCP-1 and Flavobacterium sp.

in natural soil. Biodegradation. 1(1990) 273–281.

[33] R.J.S. Jacques, B.C. Okeke, F.M. Bento, A.S. Teixeira, M.C.R. Peralba, F.A.O. Comargo,

Microbial consortium bioaugmentation of a polycyclic aromatic hydrocarbons contaminated

soil. Bioresour. Technol. 99 (2008) 2637–2643.

[34] I.S. Silva, E.C. dos Santos, C.R. de Menezes, A.F. de Faria, E. Franciscon, M. Grossman,

Bioremediation of a polyaromatic hydrocarbon contaminated soil by native soil microbiota

and bioaugmentation with isolated microbial consortia. Bioresour. Technol. 100 (2009)

4669-4675.

[35] J.R. Lipthay, T. Barkay, S.J. Sørensen, Enhanced degradation of phenoxyacetic acid in soil

by transfer of the tfdA gene encoding a 2,4-dichlorophenoxyacetic acid dioxygenase. FEMS

Microbiol. Ecol. 35 (2001) 75–84.

[36] E. Dorn, M. Hellwig, W. Reineke, H.J. Knackmuss, Isolation and characterization of a 3-

chlorobenzoate degrading pseudomonad, Arch. Microbiol. 99 (1974) 61-70.

[37] Y.J. Chang, J.R. Stephen, A.P. Richter, A.D. Venosa, J. Bruggemann, S.J. Macnaughton,

G.A. Kowalchuk, J.R. Haines, E. Kline, D.C. White, Phylogenetic analysis of aerobic

freshwater and marine enrichment cultures efficient in hydrocarbon degradation: effect of

profiling method, J. Microbiol. Methods. 40 (2000) 19-31.

[38] S. Kumar, K. Tamura, M. Nei, MEGA3: Integrated Software for Molecular Evolutionary

Genetics Analysis and Sequence Alignment, Brief. Bioinform. 5(2004)150-163.

18
[39] A. Dereeper, V. Guignon, G. Blanc, S. Audic, S. Buffet, F. Chevenet, J.F. Dufayard, S.

Guindon, V. Lefort, M. Lescot, J.M. Claverie, O. Gascuel, Phylogeny.fr: robust

phylogenetic analysis for the non-specialist Nucleic Acids Research. Jul 1; 36 (Web Server

Issue) (2008) W465-9. Epub Apr 19.

[40] Clinical and Laboratory Standards Institute (CLSI), Performance standards for antimicrobial

susceptibility testing; 19th informational supplement M100-S19. Wayne, PA: Clinical and

Laboratory Standards Institute 29 (2009) 52-59.

[41] H.A. Hassan, A.A. Aly, M.E. Ebeid, Cloning and Expression of Gene encoding meta-

Cleavage Enzyme of BTEX Degradation Pathway from Haloalkaliphilic Pseudomonas sp.

HA10, Life Sci. J. 11(2014b) 403-411.

[42] H.A. Hassan, A.A. Aly, Isolation and characterization of three novel catechol 2,3-

dioxygenase from three novel haloalkaliphilic BTEX-degrading Pseudomonas strains, Int.

J. Biol. Macromol. https://doi.org/10.1016/j.ijbiomac.2017.08.113.

[43] R. Witzig, H. A.H. Aly, C. Strömpl, V. Wray, H. Junca, D.H. Pieper, Molecular detection

and diversity of novel diterpenoid dioxygenase DitA1 genes from proteobacterial strains and

soil samples, Environ. Microbiol. 9 (2007) 1202-1212.

[44] S. Bangkedphol, H.E. Keenan, C. Davidson, A. Sakultantimetha, A. Songsasen,

Development of a low-cost method of analysis for the qualitative and quantitative analysis

of butyltins in environmental samples. J. Environ. Sci. Heal. A 43 (2008) 1744-1751.

[45] A. Sakultantimetha, H.E. Keenan, T.K. Beattie, S. Bangkedphol, O. Cavoura,

Bioremediation of tributyltin contaminated sediment: Degradation enhancement and

improvement of bioavailability topromote treatment processes. Chemosphere. 83 (2011)

680-686.

[46] Association of Official Analytical Chemists (AOAC), Method 988.05. In: Helrich, K., Ed.,

Official Methods of Analysis, (1990), 15th Edition, AOAC, Arlington, VA, 70.

19
[47] J.E. Landmeyer, T.L. Tanner, B.E. Watt, Biotransformation of tributyltin to tin in freshwater

river-bed sediments contaminated by an organotin release, Environ. Sci. Technol. 38 (2004)

4106-4112.

[48] G. Escalante, V.L. Campos, C. Valenzuela, J. Yan˜ez, C. Zaror, M.A. Mondaca, Arsenic

resistant bacteria isolated from arsenic contaminated river in the Atacama Desert (Chile),

Bull. Environ.Contam.Toxicol. 83 (2009) 657–661.

[49] H.A.H. Aly, N.B. Huu, V. Wray, H. Junca, D.H. Pieper, Two angular dioxygenases

contribute to the metabolic versatility of dibenzofuran-degrading Rhodococcus sp. strain

HA01, Appl. Environ. Microbiol. 74 (2008) 3812-3822.

[50] D.M. Yebra, S. Kiil, K. Dam-Johansen, Antifouling technology - past, present and future

steps towards efficient and environmentally friendly antifouling coatings, Progress in

Organic Coatings. 50 (2004) 75-104.

[51] L. Jr. Guillette, T. Iguchi, Life in a contaminated world. Science. 337 (2012) 1614-1615.

[52] R.W. Chapman, L.J. Guillette, Contaminants and impoSEX: transcriptomics of

contaminant-induced sex change, Mol. Ecol. 22 (2013) 1485-1487

[53] G.M. Gadd, Microbial interactions with tributyltin compounds: detoxification,

accumulation, and environmental fate, Sci. Total Environ. 258 (2000) 119-127.

[54] N.F.Y. Tam, A.M.Y. Chong, Y.S. Wong, Removal of tributyltin (TBT) by live and dead

microalgal cells, Mar. Pollut. Bull. 45 (2002) 362-371.

[55] M. Hernould, S. Gagn´e, M. Fournier, C. Quentin, C. Arpin, Role of the AheABC efflux

pump in Aeromonas hydrophila intrinsic multidrug resistance, Antimicrob. Agents

Chemother. 52 (2008) 1559-1563.

[56] P. Bernat, R. Szewczyk, M. Krupinski, J. Dlugonski, Butyltins degradation by

Cunninghamella elegans and Cochliobolus lunatus co-culture, J. Hazard. Mater. 246-247

(2013) 277-282.

20
[57] J. Yáñez, P. Riffo, P. Santander, H.D. Mansilla, M.A. Mondaca, V. Campos, D.

Amarasiriwardena, Biodegradation of Tributyltin (TBT) by Extremophile Bacteria from

Atacama Desert and Speciation of Tin By-products, Bull. Environ. Contam. Toxicol. 95

(2015) 126-130

[58] D. Miñana-Galbis, M. Farfán, M.C. Fusté, J.G. Lorén, Aeromonas molluscorum sp. nov.,

isolated from bivalve molluscs, Int. J. Syst. Evol. Microbiol. 54 (2004) 2073-2078.

[59] A. Cruz, Tributyltin (TBT) resistance in Aeromonas molluscorum Av27 biology. Aveiro

(2012) University of Aveiro.

[60] H. Li, Y.H. Liu, N. Luo, X.Y. Zhang, T.G. Luan, J.M. Hu, Z.Y. Wang, P.C. Wu, M.J.

Chen, J.Q. Lu, Biodegradation of benzene and its derivatives by a psychrotolerant and

moderately haloalkaliphilic Planococcus sp. strain ZD22, Res. in microbiol. 157 (2006)

629-636.

[61] D. Sonal, A. Sei, A.P. Marianna, F.A. Deniz, Z.F. Babu Proteogenomic elucidation of

initial steps in benzene degradation pathway in a novel Halophile, Arhodomonas sp. strain

Rozel isolated from a hypersaline environment, Appl. Environ. Microbiol. 78 (2012) 7309-

7316.

[62] C.A. Nicholson, B.Z. Fathepure, Biodegradation of benzene by halophilic and halotolerant

bacteria under aerobic conditions, Appl. Environ. Microbiol. 70 (2004) 1222-1225.

[63] S. Dalvia, A. Sei, A.P. Marianna, F.A. Deniz, B.Z. Fathepurea, Proteogenomic elucidation

of the initial steps in the benzene degradation pathway of a novel halophile, Arhodomonas

sp. strain rozel, isolated from a hypersaline environment, Appl. Environ. Microbiol. 78

(2012) 7309-7316.

[64] E. Kaparullina, N. Doronina, T. Chistyakova, Y. Trotsenko, Stenotrophomonas

chelatiphaga sp. nov., a new aerobic EDTA-degrading bacterium, Syst. Appl. Microbiol. 32

(2009) 157-162.

21
[65] J. Gao, J.S. Ye, J.W. Ma, L.T. Tang, J. Huang, Biosorption and biodegradation of

triphenyltin by Stenotrophomonas maltophilia and their influence on cellular metabolism, J.

Hazard. Mater. 276 (2014) 112-119.

[66] G.L. French, Clinical impact and relevance of antibiotic resistance, Adv. Drug. Deliv. Rev.

57 (2005) 1514-1527.

[67] F. De La Cruz, J. Davies, Horizontal gene transfer and the origin of species: lessons from

bacteria, Trends Microbiol. 8 (2000) 128-133.

[68] A.O. Summers, Genetic linkage and horizontal gene transfer, the roots of the antibiotic

multiresistance problem, Anim. Biotechnol. 17 (2006) 125-135.

[69] E. Harrison, M.A. Brockhurst, Plasmid-mediated horizontal gene transfer is a

coevolutionary process, Trends in Microbiol. 20 (2012) 262-267.

[70] D.T. Newby, T.J. Gentry, I.L. Pepper, Comparison of 2,4-dichlorophenoxyacetic acid

degradation and plasmid transfer in soil resulting from bioaugmentation with two different

pJP4 donors. Appl. Environ. Microbiol. 66 (2000) 3399-3407.

[71] J.L.M. Rodrigues, A. Kachel, M.R. Aiello, J.F. Quensen, O.V. Maltseva, T.V. Tsoi,

Degradation of Aloclor1242 dechlorination products in sediments by Burkholderia

xenovorans LB400(ohb) and Rhodococcus sp strain RHA1(fcb). Appl. Environ. Microbiol.

72 (2006) 2476-2482.

[72] V. Massa, A. Infantino, F. Radice, V. Orlandi, F. Tavecchio, R. Giudiuci, Efficiency of

natural and engineered bacterial strains in the degradation of 4-chlorobenzoic acid in soil

slurry. Int. Biodeterior. Biodegrad. 63 (2009) 112-25.

22
Figures Captions

Fig. 1 Proposed TBT debutylation pathway[46- 56]

Fig. 2 Phylogenetic tree based on 16S rRNA gene sequences showing the relationship

Stenotrophomonas chelatiphaga. HS2 strain (Accession number KR780649) to other reported

Stenotrophomonas strains. The strain followed by the accession numbers and degraded substrate“.

Petroleum H” Petroleum hydrocarbon, “BTEX” Benzene, toluene, ethylbenzene and xylenes,

“TPT” Triphenyltin, “EDTA” Ethylenediaminetetra acetic acid, and “TBT” Tributyltin degrader.

Fig. 3. Growth of S chelatiphaga HS2 on 2mM TBT as a carbon source. Growth was monitored by

following colony-forming units (CFU), TBT depletion and formation of DBT and MBT were

assessed by GC.

Fig. 4 Identification by GC-FID of DBT, and MBT as metabolites produced from TBT by S.

chelatiphaga HS2 panel (C). panel (A) and (B) are authentic standard for TBT and DBT with

retention time (21.02min) and (14.25min) respectively.

Fig. 5 Phylogenetic tree shows the relatedness HS2-SugE protein. The dendrogram was calculated

using Phylogeny.fr based on protein sequence alignments. HS2-SugE from S. chelatiphaga HS2 is

shown by arrow.

Fig. 6 RNA extraction from S. chelatiphaga HS2 on TBT (panel A lanes 1, 2 respectively) and

Fructose (panel A lanes 3, 4). RT-PCR amplification of SugE gene from S. chelatiphaga grown on

TBT (Panel B) or Fructose (Panel C) M, molecular weight marker Hyperladder 1 (Bioline). cDNA

generated from template RNA was serially diluted (3.2-fold) with nuclease-free water and 1 µl of

23
each dilution was subjected to amplification by PCR Panel B (Lanes 1 - 8), Panel C (lanes 1- 6).

Negative controls panel B (lanes 9-11), included RT and PCR reactions devoid of reverse

transcriptase and template cDNA respectively.

Fig. 7 Degradation and transformation of TBT into DBT and MBT in autoclaved sediment spiked

with TBT at pH 9 and salinity 7% during 20 d of incubation at 28 ⁰C (A) inoculation with S.

chelatiphaga HS2 and (B) inoculation with S. chelatiphaga HS2 and E. coli BL21 (DE3)-

pET28a(+)-sugE .

24
Fig. 1 Proposed TBT debutylation pathway [46- 56]
 S. maltophilia TPH-6 KM386988 (Petroleum H)

S. maltophilia A1w2 AY512625 (BTEX)

S. maltophilia KB2 DQ230920 (TPT)

S. chelatiphaga LPM-5 NR_116366 (EDTA)

S. sp. HS2 (TBT)

S. sp. R-41388 FR682931(Pesticide)

S. sp. VA-15a DQ984206 (Naphthalene)

0.001

Fig. 2 Phylogenetic tree based on 16S rRNA gene sequences showing the relationship

Stenotrophomonas chelatiphaga. HS2 strain (Accession number KR780649) to other reported

Stenotrophomonas strains. The strain followed by the accession numbers and degraded

substrate“. Petroleum H” Petroleum hydrocarbon, “BTEX” Benzene, toluene, ethylbenzene and

xylenes, “TPT” Triphenyltin, “EDTA” Ethylenediaminetetra acetic acid, and “TBT” Tributyltin

degrader.
 TBT
DBT
S. chelatiphaga HS2 (cfu) MBT
10 2,5

TBT, DBT and MBT (mM)

2

8
log cfu/ml

1,5

1
6

0,5
5

4 0
0 10 20 30 40 50
Incubation time (h)

Fig. 3. Growth of S chelatiphaga HS2 on 2mM TBT as a carbon source. Growth was monitored

by following colony-forming units (CFU), TBT depletion and formation of DBT and MBT were

assessed by GC.
 A B C

Fig. 4 Identification by GC-FID of DBT, and MBT as metabolites produced from TBT by S.
chelatiphaga HS2 panel (C). panel (A) and (B) are authentic standard for TBT and DBT with
retention time (21.02min) and (14.25min) respectively.
Fig. 5 Phylogenetic tree shows the relatedness HS2-SugE protein. The dendrogram was

calculated using Phylogeny.fr based on protein sequence alignments. HS2-SugE from S.

chelatiphaga HS2 is shown by arrow.

Fig. 6 RNA extraction from S. chelatiphaga HS2 on TBT (panel A lanes 1, 2 respectively) and

Fructose (panel A lanes 3, 4). RT-PCR amplification of SugE gene from S. chelatiphaga grown

on TBT (Panel B) or Fructose (Panel C) M, molecular weight marker Hyperladder 1 (Bioline).

cDNA generated from template RNA was serially diluted (3.2-fold) with nuclease-free water

and 1 µl of each dilution was subjected to amplification by PCR Panel B (Lanes 1 - 8), Panel C

(lanes 1- 6). Negative controls panel B (lanes 9-11), included RT and PCR reactions devoid of

reverse transcriptase and template cDNA respectively.

 A B

Fig. 7 Degradation and transformation of TBT into DBT and MBT in autoclaved sediment

spiked with TBT at pH 9 and salinity 7% during 20 d of incubation at 28 ⁰C (A) inoculation

with S. chelatiphaga HS2 and (B) inoculation with S. chelatiphaga HS2 and E. coli BL21

(DE3)-pET28a(+)-sugE .