Sunteți pe pagina 1din 256

www.asiriyar.

net

GOVERNMENT OF TAMIL NADU

HIGHER SECONDARY SECOND YEAR

BIOLOGY-ZOOLOGY

A publication under Free Textbook Programme of Government of Tamil Nadu

Department of School Education


Untouchability is Inhuman and a Crime

front pages 1.indd 1 25-02-2019 19:53:29


www.asiriyar.net

Government of Tamil Nadu

First Edition - 2019


(Published under New Syllabus)

NOT FOR SALE

Content Creation

The wise
possess all

State Council of Educational Research


and Training
© SCERT 2019

Printing & Publishing

Tamil NaduTextbook and Educational


Services Corporation
www.textbooksonline.tn.nic.in

II

front pages 1.indd 2 25-02-2019 19:53:30


www.asiriyar.net

CONTENTS

BIOLOGY-ZOOLOGY Page No

UNIT I
Chapter 1 Reproduction in Organisms 1
Chapter 2 Human Reproduction 13
Chapter 3 Reproductive Health 34

UNIT II
Chapter 4 Principles of Inheritance and Variation 47
Chapter 5 Molecular Genetics 63
Chapter 6 Evolution 93

UNIT III
Chapter 7 Human Health and Diseases 111
Chapter 8 Microbes in Human Welfare 142

UNIT IV
Chapter 9 Applications of Biotechnology 155

UNIT V
Chapter 10 Organisms and Population 171
Chapter 11 Biodiversity and its Conservation 193
Chapter 12 Environmental Issues 214

Let's use the QR code in the text books ! How ?


• Download the QR code scanner from the Google PlayStore/ Apple App Store into your smartphone.
• Open the QR code scanner application
• Once the scanner button in the application is clicked, camera opens and then bring it closer to the QR code in the text book.
• Once the camera detects the QR code, a URL appears in the screen.Click the URL and go to the content page.

E-book Assessment DIGI links

III

front pages 1.indd 3 25-02-2019 19:53:30


www.asiriyar.net

Conceptual picture with caption relating to


every chapter is given in this text book.

New life for woolly mammoth DNA-researchers can now re-create the
genes of mammoth and study the proteins they encoded

Chapter Outline Presents a complete overview of the chapter

Goals to transform the classroom processes into


Learning Objectives:
learner centric with a list of bench marks

Amazing facts, Rhetorical questions to lead students


to biological inquiry

Directions are provided to students to conduct activities


Activity in order to explore, enrich the concept.

Infographics Visual representation of the lesson to enrich learning .

HOW TO USE Superfluous information about a personality or day to


THE BOOK day life experience relating to the content

To motivate the students to further explore the content


digitally and take them to virtual world

ICT To enhance digital Science skills among students

Conceptual diagram that depicts relationships between


Concept Map concepts to enable students to learn the content schematically

Glossary Explanation of scientific terms

Evaluation Assess students to pause, think and check their understanding

References List of related books for further details of the topic

Web links List of digital resources

IV

front pages 1.indd 4 25-02-2019 19:53:30


www.asiriyar.net

Prospects of Biology-Zoology
National and International Biology Olympiad Exam
Who can participate? : Secondary and Higher Secondary students
Five stages of Exam
stage I : National Standard Examination in Biology
stage II : Indian National Biology Olympiad
stage III : Orientation cum Selection Camp in Biology
stage IV : Pre-departure Training Camp for
International Biology Olympiad
(IBO) (for 4 members)
stage V : Participation in IBO.
Weblink: https://www.entrancei.com

Scholarship for Biology Students


Ministry of Science and Technology offers biology scholarship to 100 students from
schools around the country. Among them 52 (two from each state board) are selected for the
award which carries a cash prize of Rs 20,000, a certificate and a medal. http://www.dbtindia.
nic.in
It also offers INSPIRE programme for science students. www.online.inspire.gov.in
Tamilnadu State council of Science and technology offers Young Scientists Fellowship
Scheme to encourage scientist below 40 years, who are working in educational institutions.
They are given Rs.10000 for 2- 6 months (http://www.tanscst.nic.in/)
Tamilnadu State Council of Science and technology offers Student project
scheme for Science and Technology useful to our society. Student scientists are
awarded with the cash prize of Rs.5000 - 10000 for their best project or model.
(http://www.tanscst.nic.in/)

Institutes
Institutes affiliated
affiliated to Dr. M.G.R.
to Dr. M.G.R. Medical
Medical University,
University, Chennai.
Chennai.
Occupation Therapy Colleges:
• College of Occupational Therapy, Christian Medical College, Vellore
Physiotherapy Colleges:
• Govt. College of Physiotherapy, Trichy
• Govt. Institute of Rehabilitation Medicine, Chennai
• College of Physiotherapy, Christian Medical College, Vellore
• Tamilnadu Paramedical Institutions College of Physiotherapy, Chennai
Siddha Colleges:
• Govt. Siddha Medical College, Chennai
• Govt. Siddha Medical College, Tirunelveli
• National Institute of Siddha, Chennai
V

front pages 1.indd 5 25-02-2019 19:53:30


www.asiriyar.net

Prospects of Biology-Zoology

Pharmacy Colleges:
Homeopathy Colleges:
• Coimbatore Medical College, Coimbatore
• Govt. Homoeopathic Medical College
• College of Pharmacy, Madras Medical
and Hospital, Tirumangalam
College, Chennai
• Tamil Nadu Homoeopathy Medical
• College of Pharmacy, Madurai Medical
College, Salem
College, Madurai
• Thanjavur Medical College, Thanjavur Dental Colleges:
• College of Allied Medical Sciences, • Tamilnadu Govt. Dental College,
Madurai Chennai
• Department of Pharmacy, Annamalai
Ayush Institutions In Tamilnadu
University, Cuddalore
• Ayurveda College, 242-B, Trichy Road,
Nursing Colleges: Sulur, 215 Pathanjalipuri (POST),
• College of Nursing, Madras Medical Coimbatore – 641402
College, Chennai • Venkataramana Ayurveda College, 216
• College of Nursing, Madurai Medical 596,A1&A2,31st St. TNHB Colony,
College, Madurai Periyar Nagar, Korattur, Chennai
Medical Colleges: • Sri Sai Ram Ayurvedic Medical College
• Cancer Institute, College of Oncological & 217 Research Centre, Saileo Nagar,
Sciences, Chennai Poonthandalam Village, Sriperumbudur,
Chennai – 600044
• Chengalpattu Medical College,
Chengalpattu • Dharma Ayurvedic Medical College and
Hosp, 48 218 Grand West Trunk Road,
• Christian Medical College, Vellore
Sriperumbudur, Kanchipuram, 602 105
• Coimbatore Medical College, Coimbatore
• Sri Sankara College of Ayurveda,
• Government Dharamapuri Medical
Sannasipatti, 219 Poolankulathupatti
College, Dharampuri
Post Trichy-620009
• Kanyakumari Govt. Medical College,
Kanyakumari
• Kilpauk Medical College, Chennai
• Madras Medical College and Research List of Tamilnadu Veterinary
Institute, Chennai colleges affiliated to Tamilnadu
• Madurai Medical College, Madurai Veterinary University
• Stanley Medical College, Chennai
• Thanjavur Medical College, Thanjavur • Tamilnadu Veterinary University,
• Theni Government Medical College, Chennai
Theni • Veterinary College and Research
• Thoothukudi Govt. Medical College, Institute, Namakkal
Thoothukudi • Fishery College and Research Institute,
• Tirunelveli Medical College, Tirunelveli Thoothukudi
• Vellore Govt. Medical College, Vellore

VI

front pages 1.indd 6 25-02-2019 19:53:30


www.asiriyar.net

Prospects of Biology-Zoology

List of Tamilnadu Agricultural Salim Ali Centre for Ornithology


colleges affiliated to Tamilnadu and Natural History (SACON)
Agricultural University Coimbatore
in Tamilnadu • National Ornithological Databank
(NOD) Cell
• GIS Laboratory
• Tamilnadu Agricultural University,
• Ecotoxicology Laboratory
Coimbatore.
• Conservation Genetics Laboratory
• Agricultural College and Research
Institute, Kanniyakumari Institute of Basic Medical Science
(IBMS) Tharamani, Chennai
• Agricultural Engineering College and
• Blood transfusion
Research Institute, Coimbatore.
• Chromatography
• Avvaiyar Government College for • Mass spectroscopy
women, Kodaikanal • Clinical Data interpretation
• Horticulture College and Research • Diagnosis of blood courses
Institute, Periyakulam
Centre for Marine Fisheries and
Research Institute (CMFRI)
Institutes conducting
• Marine capture fisheries
Researches in Zoology • Mariculture
Indian institute of science (IISC) • Biodiversity
Bangalore • Marine Biotechnology
• Fishery environment
• Biochemistry (BC)
• Central Animal Facility (CAF) National Environmental
• Centre for Ecological Sciences (CES) Engineering Research Institute
(NEERI)
• Centre for Infectious Disease Research
• Air Pollution control
(CIDR)
• Climate sustainability and skill
• Centre for Neuroscience (CNS)
development
• Microbiology and Cell Biology (MCB) • Cleaner technology and modeling
• Molecular Biophysics Unit (MBU) • Environmental Biotechnology and
Genomic division

IFS Service
IFS (Indian Forest (IndianExamination)
Forest Service)Examination
Examination
• Conducting authority - UPSC
• Educational - B.Sc. in any one degree like Physics, Chemistry, Botany, Zoology,
Qualification: Agriculture, Maths, Geology, or B.E or B.V.Sc.
• Age - Minimum 21, Maximum 32 Yrs.
• Weblink - https://upsconline.nic.in
VII

front pages 1.indd 7 25-02-2019 19:53:30


www.asiriyar.net

VIII

front pages 1.indd 8 25-02-2019 19:53:30


www.asiriyar.net

1
UNIT - I

Reproduction
in Organisms
CHAPTER

Paramecium are capable of both sexual and


Chapter Outline asexual reproduction.

1.1. Modes of reproduction


1.2. Asexual reproduction in continuation of species and introduces
1.3. Sexual reproduction variations in organisms, which are essential
for adaptation and evolution of their
own kind.
Learning Objectives
1.1. Modes of reproduction
➢ Learns the modes of asexual All modes of reproduction have some
reproduction in organisms. basic features such as synthesis of RNA and
proteins, replication of DNA, cell division and
➢ Understands the growth, formation of reproductive units and
significance of asexual their fertilization to form new individuals.
reproduction.
Organisms exhibit two major modes of
➢ Comprehends the reproduction namely asexual and sexual
different modes of reproduction. Reproduction by a single parent
sexual reproduction. without the involvement of gamete formation
is asexual reproduction and the offspring
➢ Realizes the significance and produced are genetically identical. Asexual
advantage of sexual reproduction and reproduction is usually by amitotic or mitotic
its role in evolution. division of the somatic (body) cells, hence
is also known as somatogenic or blastogenic
reproduction. When two parents participate

L iving organisms show a life cycle in the reproductive process involving two
involving birth, growth, development, types of gametes (ova and sperm), it is called
maturation, reproduction and death. sexual reproduction.
Reproduction is the fundamental feature of
all living organisms. It is a biological process 1.2. Asexual reproduction
by which organisms produce their young Asexual reproduction is wide spread
ones. The young ones grow and mature to among different organisms. It is common in
repeat the process. Thus reproduction results members of Protista, Bacteria, Archaea and

TN_GOVT_XII_ Bio Zoology_chapter1.indd 1 25-02-2019 17:54:15


www.asiriyar.net

in multicellular organisms with relatively i) Simple irregular binary fission


simple organisation. The offsprings show ii) Transverse binary fission
“uniparental inheritance” without any genetic iii) Longitudinal binary fission
variation. The different modes of asexual
iv) Oblique binary fission
reproduction seen in animals are fission,
sporulation, budding, gemmule formation, Simple binary fission is seen in Amoeba
fragmentation and regeneration. like irregular shaped organisms (Fig. 1.1),
where the plane of division is hard to observe.
Fission is the division of the parent The contractile vacuoles cease to function
body into two or more identical daughter and disappear. The nucleoli disintegrate and
individuals. Four types of fission are seen in the nucleus divides mitotically. The cell then
animals. They are binary fission, multiple constricts in the middle, so the cytoplasm
fission, sporulation and strobilation. divides and forms two daughter cells.
In binary fission, the parent In transverse binary fission, the plane of
organism divides into two halves and the division runs along the transverse axis of
each half forms a daughter individual. the individual. e.g. Paramecium and Planaria.
The nucleus divides first amitotically or In Paramecium (Fig. 1.2) the macronucleus
mitotically (karyokinesis), followed by the divides by amitosis and the micronucleus
Simple irregular Binary Fission in Amoeba
division of the cytoplasm (cytokinesis). divides by mitosis.
The resultant offsprings are genetically In longitudinal binary fission, the nucleus
Nuclear
identical to the parent. Depending on theContractile
vacuole and the cytoplasm divides in the longitudinal
membrane

plane of fission, binary fission is of the axis of the organism (Fig 1.3). In flagellates, the
Nucleus
following types Hyaline area flagellum is retained usually by one daughter cell.
Chromosomes

Simple irregular Binary Fission in Amoeba Contractile


vacuole

Nuclear
Contractile
membrane
vacuole

Nucleus
Hyaline area
Chromosomes

Contractile
vacuole Daughter amoebae
Fig. 1.1 Irregular simple binary fission in Amoeba
Macronucleus
New oral
groove
forming

Micronucleus Oral groove


disappearing
Daughter
Daughter amoebae paramecia
New
contractile
vacuoles

Macronucleus Micronucleus New


dividing dividing oral groove
amitotically mitotically forming

A B C D E
Fig. 1.2 Transverse binary fission in Paramecium
Reproduction in Organisms 2

TN_GOVT_XII_ Bio Zoology_chapter1.indd 2 25-02-2019 17:54:16


www.asiriyar.net

Longitudinal furrow

Daughter
Euglena
Chromosomes
Nucleus
Nucleoli

Nucleus

Chromatids Nucleolar Nuclear


body constriction

A B C D E

Fig. 1.3 Longitudinal binary fission in Euglena


The basal granule is divided into two and the individuals are called merozoites (Fig. 1.4).
new basal granule forms a flagellum in the other When multiple fission occurs in the oocyte,
daughter individual. e.g. Vorticella and Euglena. it is called sporogony and the daughter
In oblique binary fission the plane of individuals are called sporozoites.
division is oblique. It is seen in dinoflagellates. During unfavorable conditions (increase
e.g. Ceratium or decrease in temperature, scarcity of food)
In multiple fission the parent body Amoeba withdraws its pseudopodia and
divides into many similar daughter cells secretes a three-layered, protective, chitinous
simultaneously. First, the nucleus divides cyst wall around it and becomes inactive
repeatedly without the division of the (Fig. 1.5). This phenomenon is called
cytoplasm, later the cytoplasm divides into as encystment. When conditions become
many parts as that of nuclei. Each cytoplasmic favourable, the encysted Amoeba divides
part encircles one daughter nucleus. This by multiple fission and produces many
results in the formation of many smaller minute amoebae called pseudopodiospore
individuals from a single parent organism. or amoebulae. The cyst wall absorbs
If multiple fission produces four or many water and breaks off liberating the young
daughter individuals by equal cell division pseudopodiospores, each with a fine
and the young ones do not separate until pseudopodia. They feed and grow rapidly to
the process is complete, then this division is lead an independent life.
called repeated fission e.g. Vorticella. In some metazoan animals, a special type
In Plasmodium, multiple fission occurs in of transverse fission called strobilation occurs
the schizont and in the oocyte stages. When (Fig. 1.6). In the process of strobilation, several
multiple fission occurs in the schizont, the transverse fissions occur simultaneously
process is called schizogony and the daughter giving rise to a number of individuals which

Rupturing
Schizont Daughter nuclei schizont wall Merozoites

Fig. 1.4 Multiple Fission in Plasmodium

3 Reproduction in Organisms

TN_GOVT_XII_ Bio Zoology_chapter1.indd 3 25-02-2019 17:54:16


www.asiriyar.net

Pseudopodiospores

Ruptured
Three cyst wall
layered
cyst wall
Nucleus

Cytoplasm
Daughter
nuclei
Daughter nuclei Pseudopodiospores Young
cyst formation formation amoebae
A B C D

Fig. 1.5 Multiple fission in encysted Amoeba

Tentacles

Tentacles
Mouth
Manubrium
Manubrium
Mouth
Ephyrae Early Ephyra
budding (side view)

Inter radial
canal Per radial
canal
Mouth
Stomach Sense
organ
Stalk Manubrium
Stolon Marginal
lappet Bifid arm
Adhesive
disc
Young Adult Early Ephyra
strobila strobila (oral view)
Fig. 1.6 Strobilation in Aurelia
often do not separate immediately from a nuclear membrane, becomes surrounded by
each other e.g. Aurelia. Plasmotomy is the cytoplasm and develops a spore-case around
division of multinucleated parent into many it (Fig. 1.7). When conditions become
multinucleate daughter individuals with the favourable, the parent body disintegrates and
division of nuclei. Nuclear division occurs the spores are liberated, each hatching into a
later to maintain normal number of nuclei. young amoeba.
Plasmotomy occurs in Opalina and Pelomyxa In budding, the parent body produces one
(Giant Amoeba). or more buds and each bud grows into a young
During unfavourable conditions Amoeba one. The buds separate from the parent to lead
multiplies by sporulation without encystment. a normal life. In sponges, the buds constrict
Nucleus breaks into several small fragments and detach from the parent body and the bud
or chromatin blocks. Each fragment develops develops into a new sponge (Fig. 1.8).
Reproduction in Organisms 4

TN_GOVT_XII_ Bio Zoology_chapter1.indd 4 25-02-2019 17:54:17


www.asiriyar.net

Chromatin Nuclear membrane Spores Spore case


blocks disintegrating
Nuclei
Nucleus

D Cytoplasm

Nucleus Spore case


Young
amoeba
Nucleus
Cytoplasm
E Cytoplasm
A B C

Fig. 1.7 Sporulation in Amoeba


Individual
parent Osculum In Noctiluca, hundreds of buds are
formed inside the cytoplasm and many remain
within the body of the parent. This is called
endogenous budding. In freshwater sponges
and in some marine sponges a regular and
peculiar mode of asexual reproduction occurs
Bud Bud Daughter
by internal buds called gemmules is seen
forming growing individual (Fig. 1.10). A completely grown gemmule is a hard
Fig. 1.8 Budding in Leucosolenia (Sponge) ball, consisting of an internal mass of food-laden
archaeocytes. During unfavourable conditions,
the sponge disintegrates but the gemmule can
withstand adverse conditions. When conditions
become favourable, the gemmules begin to hatch.
Micropyle
Monaxon
spicules Outer
Growth Bud develops Bud detaches membrane
Hydra
of bud mouth and from parent and
tentacles leads an Archaeocytes
independent life

Fig. 1.9 Budding in Hydra


Inner
When buds are formed on the outer surface membrane
of the parent body, it is known as exogenous
budding e.g. Hydra. In Hydra when food is
plenty, the ectoderm cells increase and form a
small elevation on the body surface (Fig. 1.9). Fig. 1.10 Gemmule in sponges
Ectoderm and endoderm are pushed out to In fragmentation, the parent body
form the bud. The bud contains an interior breaks into fragments (pieces) and each of
lumen in continuation with parent’s gastro- the fragment has the potential to develop
vascular cavity. The bud enlarges, develops a into a new individual. Fragmentation or
mouth and a circle of tentacles at its free end. pedal laceration occurs in many genera of
When fully grown, the bud constricts at the sea anemones. Lobes are constricted off from
base and finally separates from the parent the pedal disc and each of the lobe grows
body and leads an independent life. mesenteries and tentacles to form a new sea
anemone.

5 Reproduction in Organisms

TN_GOVT_XII_ Bio Zoology_chapter1.indd 5 25-02-2019 17:54:18


www.asiriyar.net

In the tapeworm, Taenia solium the regeneration. In reparative regeneration, only


gravid (ripe) proglottids are the oldest at certain damaged tissue can be regenerated,
the posterior end of the strobila (Fig. 1.11). whereas in restorative regeneration severed
The gravid proglottids are regularly cut off body parts can develop. e.g. star fish, tail of
either singly or in groups from the posterior wall lizard.
end by a process called apolysis. This is very
significant since it helps in transferring the longitudinal incision

developed embryos from the primary host


(man) to find a secondary host (pig).
Scolex
Neck
longitudinal incision

regenerated
regenerated
parts
parts
Immature
proglottids old part
Mature
regenerated
proglottids parts regenerated
longitudinal incision parts

old part

old part

old part
Gravid
proglottids
regenerated
parts Regeneration in Hydra
Fig. 1.12regenerated
parts

old part

Fig. 1.11 Apolysis in Taenia solium


old part

Regen­e ration is regrowth in the injured


region. Regeneration was first studied
in Hydra by Abraham Trembley in 1740.
Regeneration is of two types, morphallaxis
and epimorphosis. In morphallaxis the Fig. 1.13 Reparative regeneration in star fish
whole body grows from a small fragment
e.g. Hydra and Planaria. When Hydra is
accidentally cut into several pieces, each piece POWER OF
can regenerate the lost parts and develop REGENERATION
into a whole new individual (Fig. 1.12).
Sponge when macerated
The parts usually retain their original
and squeezed through
polarity, with oral ends, by developing
fine silk cloth, the cluster of cells pass
tentacles and aboral ends, by producing
through, and these can regenerate new
basal discs. Epimorphosis (Fig. 1.13) is the
sponges. This technique is used for
replacement of lost body parts. It is of two
cultivation of sponges.
types, namely reparative and restorative

Reproduction in Organisms 6

TN_GOVT_XII_ Bio Zoology_chapter1.indd 6 25-02-2019 17:54:18


www.asiriyar.net

1.3. Sexual reproduction Monocystis, whereas the fusion of dissimilar


Sexual reproduction gametes is called anisogamy (Gr. An-without;
involves the fusion of iso-equal; gam-marriage). Anisogamy occurs
male and female gametes in higher animals but it is customary to use
to form a diploid zygote, the term fertilization instead of anisogamy
which develops into a or syngamy. e.g. higher invertebrates and all
new organism. It leads vertebrates.
to genetic variation. The types of sexual Conjugation is the temporary union of the
reproduction seen in animals are syngamy two individuals of the same species. During their
( fertilization) and conjugation. In syngamy, union both individuals, called the conjugants
the fusion of two haploid gametes takes place to exchange certain amount of nuclear material
produce a diploid zygote. Depending upon the (DNA) and then get separated. Conjugation
place where the fertilization takes place, it is of is common among ciliates, e.g. Paramecium,
two types. In external fertilization, the fusion Vorticella and bacteria (Prokaryotes).
of male and female gametes takes place outside Phases of life cycle: Organisms have three
the body of female organisms in the water phases – Juvenile phase, reproductive phase and
medium. e.g. sponges, fishes and amphibians. senescent phase. Juvenile phase/ vegetative
In internal fertilization, the fusion of male phase is the period of growth between the birth
and female gametes takes place within the of the individual upto reproductive maturity.
body of female organisms. e.g. reptiles, aves During reproductive phase/ maturity phase
and mammals. the organisms reproduce and their offsprings
Different kinds of syngamy (fertilization) reach maturity period. On the basis of time,
are prevalent among living organisms. In breeding animals are of two types: seasonal
autogamy, the male and female gametes are breeders and continuous breeders. Seasonal
produced by the same cell or same organism breeders reproduce at particular period of
and both the gametes fuse together to form a the year such as frogs, lizards, most birds,
zygote e.g. Actinosphaerium and Paramecium. deers etc., Continuous breeders continue to
In exogamy, the male and female gametes are breed throughout their sexual maturity e.g.
produced by different parents and they fuse to honey bees, poultry, rabbit etc., Senescent
form a zygote. So it is biparental. e.g. Human – phase begins at the end of reproductive phase
dioecious or unisexual animal. when degeneration sets in the structure and
In lower organisms, sometimes the functioning of the body.
entire mature organisms do not form gametes PARTHENOGENESIS
but they themselves behave as gametes and (Gr. Parthenos – virgin, Genesis-produce)
the fusion of such mature individuals is
known as hologamy e.g. Trichonympha. Development of an egg into a complete
Paedogamy is the sexual union of young individual without fertilization is known as
individuals produced immediately after the parthenogenesis. It was first discovered by
division of the adult parent cell by mitosis. Charles Bonnet in 1745. Parthenogenesis is of
In merogamy, the fusion of small sized two main types namely, Natural Parthenogenesis
and morphologically different gametes and Artificial Parthenogenesis. In certain
(merogametes) takes place. The fusion of animals, parthenogenesis occurs regularly,
morphological and physiological identical constantly and naturally in their life cycle and
gametes (isogametes) is called isogamy. e.g. is known as natural parthenogenesis.

7 Reproduction in Organisms

TN_GOVT_XII_ Bio Zoology_chapter1.indd 7 25-02-2019 17:54:18


www.asiriyar.net

Natural
parthenogenesis are of
different types:

a) Arrhenotoky: In
this type only males are produced by
parthenogenesis. eg: honey bees
b) Thelytoky: In this type of
parthenogenesis only females are
produced by parthenogenesis.eg: Fig. 1.14 Oviparous-Hen with Eggs
Solenobia
c) Amphitoky: In this type
parthenogenetic egg may develop into
individuals of any sex. Eg: Aphis.

Natural parthenogenesis may be of


two types, viz., complete and incomplete.
Complete parthenogenesis is the only form
of reproduction in certain animals and there is
no biparental sexual reproduction. These are
no male organisms and so, such individuals
Fig. 1.15 Viviparous-Cow with calf
are represented by females only. Incomplete
parthenogenesis is found in some animals
in which both sexual reproduction and
parthenogenesis occurs. e.g. In honeybees;
fertilized eggs (zygotes) develop into queen
and workers, whereas unfertilized eggs
develop into drones (male). In paedogenetic
parthenogenesis (paedogenesis) the larvae
produce a new generation of larvae by
parthenogenesis. It occurs in the sporocysts
and Redia larvae of liver fluke. It is also seen
in the larvae of some insects. e.g. Gall fly. In
artificial parthenogenesis, the unfertilized
egg (ovum) is induced to develop into a
Fig. 1.16 Ovoviviparous-Shark and three
complete individual by physical or chemical months embryo
stimuli. e.g., Annelid and seaurchin eggs.
Animals are classified mainly into
three groups namely – Oviparous, Viviparous Ovum-egg-, Parere- to produce) animals (egg
and Ovoviviparous depends on the site of laying animals), the young hatch from eggs
development of embryo and whether they lay laid outside the mother’s body. e.g. reptiles
eggs (unfertilized or fertilized) or give birth and birds (their eggs are covered by hard
to young ones. In Oviparous (Fig 1.14) (L., calcareous shells), invertebrates, fishes and

Reproduction in Organisms 8

TN_GOVT_XII_ Bio Zoology_chapter1.indd 8 25-02-2019 17:54:19


www.asiriyar.net

amphibians (eggs are not covered by hard further divided into binary fission, multiple
calcareous shells but covered by a membrane). fission, sporulation and strobilation.
Viviparous (Fig 1.15) (L., Vivus - alive, Parere According to the plane of fission different
- to produce) animals give rise to young ones. kinds of binary fission have been identified
Viviparity is a type of development in which in different organisms. They are simple
the young ones are born alive after being irregular binary fission, transverse binary
nourished in the uterus through the placenta. fission, longitudinal binary fission and
Majority of mammals including human oblique binary fission. Multiple fission is
beings are viviparous. In Ovoviviparous the division of the parent into many small
animals, the embryo develops inside the egg daughter cells simultaneously. Budding is
and remains in the mother’s body until they another mode of asexual reproduction. The
are ready to hatch (Fig 1.16). This method of parent body produces one or more buds; each
reproduction is similar to viviparity but the bud grows into a young one and may separate
embryos have no placental connection with from the parent to lead a normal life. When
the mother and receive their nourishment many buds are formed on the outer surface of
from the egg yolk. Ovoviviparity is seen in the parent, it is known as exogenous budding.
fishes like shark. Hundreds of buds are formed inside the
cytoplasm and remain within the body of
the parent, this process is called endogenous
budding. Fragmentation is another mode
of asexual reproduction. In fragmentation
the body of the parent breaks into fragments
(pieces). Each fragment has the potential to
develop into a new individual. Regeneration
is the development of the whole body of an
organism from a small fragment. It is of two
types namely restorative regeneration and
reparative regeneration.
Various modes of sexual reproduction
The viviparous lemon shark gives birth is seen in animals. In syngamy the fusion of
to a young one, which is still attached by two haploid gametes takes place to produce
its placental cord. a zygote. The following kinds of syngamy
is prevalent among the living organism.
Summary They are autogamy, exogamy, hologamy,
Reproduction is a process by which the paedogamy, merogamy, isogamy, anisogamy
living beings propagate or duplicate their and conjugation. Parthenogenesis is the
own kind. Reproduction can be broadly special type of sexual reproduction seen
classified into asexual reproduction and in animals. It is of two main types namely
sexual reproduction. In asexual reproduction natural parthenogenesis and artificial
fusion of gametes are not involved, but in parthenogenesis.
sexual reproduction the formation and According to the development of the
fusion of gametes occur. Different modes of embryo, animals may be oviparous, viviparous
asexual reproduction are fission, budding, and ovoviviparous.
fragmentation and regeneration. Fission is

9 Reproduction in Organisms

TN_GOVT_XII_ Bio Zoology_chapter1.indd 9 25-02-2019 17:54:19


www.asiriyar.net

Evaluation Reason: Asexual
 reproduction
1. In which type of involves only mitosis and no meiosis.
parthenogenesis are A  B  C  D
only males produced? III. Assertion: Viviparous animals give
a) Arrhenotoky better protection to their offsprings.
b) Thelytoky R
 eason: They lay their eggs in the
c) Amphitoky d) Both a and b safe places of the environment.
A  B  C  D
2. Animals giving birth to young ones:
a) Oviparous b) Oviviviparous 6. Name an organism where cell division is
c) Viviparous d) Both a and b itself a mode of reproduction.
7. Name the phenomenon where the female
3. The mode of reproduction in bacteria is
gamete directly develops into a new
by
organism with with an avian example.
a) Formation of gametes
b) Endospore formation 8. What is parthenogenesis? Give two
c) Conjugation examples from animals

d) Zoospore formation 9. Which type of reproduction is effective


-Asexual or sexual and why?
4. In which mode of reproduction variations
are seen 10. The unicellular organisms which
a) Asexual b) Parthenogenesis reproduce by binary fission are considered
immortal. Justify.
c) Sexual d) Both a and b
11. Why is the offspring formed by asexual
5. Assertion and reasoning questions: reproduction referred as a clone?
In each of the following questions there
are two statements. One is assertion (A) 12. Why are the offsprings of oviparous
and other is reasoning (R). Mark the animal at a greater risk as compared to
correct answer as offsprings of viviparous organisms?
A. If both A and R are true and R is correct 13. Give reasons for the following:
explanation for A (a) S ome organisms like honey bees are
B If both A and R are true but R is not the called parthenogenetic animals
correct explanation for A (b) A male honey bee has 16 chromosomes
C. If A is true but R is false where as its female has 32 chromosomes.
D. If both A and R are false. 14. Differentiate between the following:
I. Assertion: In bee society, all the (a) Binary fission in amoeba and multiple
members are diploid fission in Plasmodium
except drones. (b) Budding in yeast and budding in Hydra
Reason: Drones are produced by
 (c) Regeneration in lizard and Planaria
parthenogenesis.
15. How is juvenile phase different from
A  B  C  D reproductive phase?
II. Assertion: Offsprings produced by
asexual reproduction are genetically 16. What is the difference between syngamy
identical to the parent. and fertilization?

Reproduction in Organisms 10

TN_GOVT_XII_ Bio Zoology_chapter1.indd 10 25-02-2019 17:54:19


www.asiriyar.net

Concept Map
Simple irregular fission

Transverse fission

Binary fission
Longitudinal fission

Oblique fission

Multiple fission Repeated fission


Fission
Sporulation

Strobilation

Exogenous budding
Budding
Asexual Endogenous budding

Fragmentation

Restorative
Regeneration
Reparative

External fertilization

Syngamy Internal fertilization

Autogamy
Reproduction Sexual Conjugation
Exogamy
Automixis
Hologamy

Paedogamy

Oviparous Merogamy

Ovoviviparous Isogamy

Anisogamy
Viviparous

Natural
Complete parthenogenesis
Parthenogenesis Artificial
Incomplete parthenogenesis
Paedogenesis

11 Reproduction in Organisms

TN_GOVT_XII_ Bio Zoology_chapter1.indd 11 25-02-2019 17:54:19


www.asiriyar.net

ICT CORNER
Reproduction in Organisms

Let us know the DNA


Recombinant Technology

Procedure :
Step -1 Type the URL or scan the QR code to open the activity page
Step -2 Click “Mitosis” and “Meiosis” on the left panel to go through the animations
plays on clicking “START” AND “NEXT”.
Step -3 Click “Work of a Vaccine” to know the process of it.
Step – 4 Click “Recombinant DNA Technology” and click “START VIRTUAL LAB” to go
through the process of it.

Step 1 Step 2 Step 3

Step 4

Reproduction in Organisms URL:


http://www.bch.cuhk.edu.hk/vlab/hpv/index.html
*Pictures are indicative only
*Allow flash player

Reproduction in Organisms 12

TN_GOVT_XII_ Bio Zoology_chapter1.indd 12 25-02-2019 17:54:21


www.asiriyar.net

2
UNIT - I

Human
Reproduction
CHAPTER

In every child who is born, the potentiality of


Chapter Outline the human race is born again
 - James Agee
2.1 Human reproductive system
2.2 Gametogenesis
2.3 Menstrual cycle
2.4 Fertilisation and implantation E very organ system in the human
body works continuously to maintain
homeostasis for the survival of the individual.
2.5 Maintenance of pregnancy and
The human reproductive system is essential for
embryonic development
the survival of the species. An individual may
2.6 Parturition and lactation
live a long healthy life without producing an
offspring, but reproduction is inevitable for the
existence of a species.
The reproductive system has four
Learning Objectives main functions namely,

• to produce the gametes namely


➢ Creates an awareness towards a
sperms and ova
healthy reproductive life in adolescents.
• to transport and sustain these gametes
➢ Understands the structure of the male
and female reproductive systems. • to nurture the developing offspring
➢ Explains the functions of • to produce hormones
the structures associated
The major reproductive events in human
with the male and female
beings are as follows:
reproductive system.
➢ Compares the process • Gametogenesis: Formation of gametes by
of spermatogenesis and spermatogenesis and oogenesis.
oogenesis. • Insemination: Transfer of sperms by the
➢ Discusses the changes in a female body male into the female genital tract.
during and after fertilisation. • Fertilisation: Fusion of male and
➢ Appraises the role of hormones in the female gametes to form zygote, called
process of reproduction. fertilisation.
➢ Understands the events in pregnancy • Cleavage: Rapid mitotic divisions of
and foetal development. the zygote which convert the single celled

13

TN_GOVT_XII_ Bio Zoology_chapter2.indd 13 25-02-2019 19:09:06


www.asiriyar.net

zygote into a multicellular structure 2.1 Human reproductive system


called blastocyst. The male reproductive system comprises
• Implantation: Attachment of blastocyst of a pair of testes, accessory ducts, glands and
to the uterine wall. external genitalia (Fig. 2.1).
• Placentation: Formation of placenta Testes are the primary male sex organs.
which is the intimate connection between They are a pair of ovoid bodies lying in the
foetus and uterine wall of the mother for scrotum. (Fig.2.2 a) The scrotum is a sac of
exchange of nutrients. skin that hangs outside the abdominal cavity.
• Gastrulation: Process by which Since viable sperms cannot be produced
blastocyst is changed into a gastrula with at normal body temperature, the scrotum
three primary germ layers is placed outside the abdominal cavity to
• Organogenesis: Formation of specific provide a temperature 2-3oC lower than the
tissues, organs and organ systems from normal internal body temperature. Thus,
three germ layers. the scrotum acts as a thermoregulator for
spermatogenesis.
• Parturition: Expulsion of the foetus from
the mother’s womb. Each testis is covered by an outermost
fibrous tunica albuginea and is divided
These functions are carried out by the
by septa into about 200 - 250 lobules each
primary and accessory reproductive organs.
containing 2-4 highly coiled testicular
The primary reproductive organs namely
tubules or seminiferous tubules. These highly
the ovary and testis are responsible for
convoluted tubules which form 80 percent of
producing the ova and sperms respectively.
the testicular substance are the sites for sperm
Hormones secreted by the pituitary gland and
production.
the gonads help in the development of the
secondary sexual characteristics, maturation The stratified epithelium of the seminiferous
of the reproductive system and regulation tubule is made of two types of cells namely sertoli
of normal functioning of the reproductive cells or nurse cells and spermatogonic cells
system. The accessory organs help in or male germ cells. Sertoli cells are elongated
transport and to sustain the gametes and to and pyramidal and provide nourishment to
nurture the developing offspring. the sperms till maturation. They also secrete
inhibin, a hormone which
is involved in the negative
feedback control of sperm
production. Spermatogonic
8ULQDU\ 8UHWHU cells divide meiotically and
EODGGHU
5HFWXP differentiate to produce
9DV
GHIHUHQV 6HPLQDOYHVLFOH spermatozoa.
3HQLV (MDFXODWRU\GXFW Interstitial cells or
8UHWKUD 3URVWDWHJODQG Leydig cells are embedded
(SLGLG\PLV $QXV in the soft connective
*ODQVSHQLV %XOERXUHWKUDO tissue surrounding the
7HVWLV JODQG
seminiferous tubules.
6FURWXP These cells are endocrine
in nature and secrete
Fig. 2.1 Male reproductive system

Human Reproduction 14

TN_GOVT_XII_ Bio Zoology_chapter2.indd 14 25-02-2019 19:09:06


www.asiriyar.net

CRYPTORCHISM The failure of one or both testes to descend down into the scrotal sacs is
known as cryptorchism (crypto – hidden + orchis – testicle). It occurs in 1 – 3 percent of new
born males. A surgical correction at a young age can rectify the defect, else these individuals
may become sterile and are unable to produce viable sperms.

androgens namely the testosterone hormone bulbourethral glands also called Cowper’s
which initiates the process of spermatogenesis. gland and a single prostate gland. The seminal
These cells are endocrine in nature and vesicles secrete an alkaline fluid called seminal
are characteristic features of the testes of plasma containing fructose sugar, ascorbic acid,
mammals. Other immunologically competent prostaglandins and a coagulating enzyme called
cells are also present.
The accessory ducts associated Ureter

with the male reproductive system


Urinary bladder
include rete testis, vasa efferentia,
epididymis and vas deferens. (Fig. Seminal vesicle
2.2 b) The seminiferous tubules of
Prostate gland
each lobule converge to form a tubulus Bulbourethral
rectus that conveys the sperms into the gland
rete testis. The rete testis is a tubular Vas deferens
network on the posterior side of the Epididymis
testis. The sperms leave the rete testis Glans penis
and enter the epididymis through Scrotum
the vasa efferentia. The epididymis
Testis
is a single highly coiled tube that
temporarily stores the spermatozoa Fig. 2.2 (a )Diagrammatic view of
the male reproductive system
and they undergo physiological
maturation and acquire increased
motility and fertilizing capacity. The
epididymis leads to the vas deferens
and joins the duct of the seminal
vesicle to form the ejaculatory duct Blood vessels
which passes through the prostate and nerves
and opens into the urethra. The Vas deferens
urethra is the terminal portion of the
Epididymis
male reproductive system and is used
to convey both urine and semen at Rete testis
different times. It originates from the
Tunica albuginea
urinary bladder and extends through Tubulus rectus
the penis by an external opening Seminiferous tubule
called urethral meatus.
The accessory glands of the
male reproductive system include
Fig. 2.2 (b )Testis showing
the paired seminal vesicles and inner details

15 Human Reproduction

TN_GOVT_XII_ Bio Zoology_chapter2.indd 15 25-02-2019 19:09:07


www.asiriyar.net

vesiculase which enhances sperm motility. The region (Fig. 2.3 a). These parts along with the
bulbourethral glands are inferior to the prostate mammary glands are integrated structurally and
and their secretions also help in the lubrication of functionally to support the process of ovulation,
the penis. The prostate encircles the urethra and fertilisation, pregnancy, child birth and child
is just below the urinary bladder and secretes a care.
slightly acidic fluid that contains citrate, several Ovaries are the primary female sex organs
enzymes and prostate specific antigens. Semen that produce the female gamete, ovum. The
or seminal fluid is a milky white fluid which ovaries are located one on each side of the lower
contains sperms and the seminal plasma (secreted abdomen. The ovary is an elliptical structure
from the seminal vesicles, prostate gland and the about 2-4 cm long. Each ovary is covered by a
bulbourethal glands). The seminal fluid acts as a thin cuboidal epithelium called the germinal
transport medium, provides nutrients, contains epithelium which encloses the ovarian stroma.
chemicals that protect and activate the sperms The stroma is differentiated as the outer cortex and
and also facilitate their movement. inner medulla. Below the germinal epithelium is
The penis is the male external genitalia a dense connective tissue, the tunica albuginea.
functioning as a copulatory organ. It is made The cortex appears dense and granular due
of a special tissue that helps in the erection of to the presence of ovarian follicles in various
penis to facilitate insemination. The enlarged stages of development. The medulla is a
end of the penis called glans penis is covered loose connective tissue with abundant blood
by a loose fold of skin called foreskin or vessels, lymphatic vessels and nerve fibres.
prepuce. The ovary remains attached to the pelvic
wall and the uterus by an ovarian ligament
The female reproductive system is far more
called mesovarium.
complex than the male because in addition
to gamete formation, it has to nurture the The fallopian tubes (uterine tubes or
developing foetus. The female reproductive oviducts), uterus and vagina constitute the
system consists of a pair of ovaries along with female accessory organs. (Fig. 2.3 b) Each
a pair of oviducts, uterus, cervix, vagina and fallopian tube extends from the periphery
the external genitalia located in the pelvic of each ovary to the uterus. The proximal
part of the fallopian tube bears a
funnel shaped infundibulum. The
8WHULQH
WXEH edges of the infundibulum have
2YDU\ many finger like projections called
)LPEULDH
fimbriae which help in collection
8WHUXV &HUYL[
of the ovum after ovulation. The
8ULQDU\ 5HFWXP infundibulum leads to a wider
EODGGHU
8UHWKUD 9DJLQD
&OLWRULV Female
/DELXP $QXV
PLQRUD uterus
/DELXP contains
PDMRUD one of the
Fig. 2.3 (a) Female pelvis showing reproductive system strongest muscles of the
human body.

Human Reproduction 16

TN_GOVT_XII_ Bio Zoology_chapter2.indd 16 25-02-2019 19:09:07


www.asiriyar.net

8WHUXV
The Bartholin’s glands
,VWKPXV (also called greater
$PSXOOD )DOORSLDQ vestibular glands) are
WXEH
,QIXQGLEXOXP located posterior to
the left and right of the
)LPEULDH
(QGRPHWULXP 2YDU\
opening of the vagina.
0\RPHWULXP
&HUYL[ They secrete mucus to
3HULPHWULXP
&HUYLFDOFDQDO lubricate the vagina and
9DJLQD are homologous to the
bulbourethral glands of
Fig. 2.3 (b) Diagrammatic view of female reproductive system the male. The Skene’s
glands are located on
central portion called ampulla. The last part the anterior wall of the vagina and around
of the oviduct is the isthmus which is short the lower end of the urethra. They secrete a
and thick walled connecting the ampulla and lubricating fluid and are homologous to the
infundibulum to the uterus. prostate gland of the males.
The uterus or womb is a hollow, thick-walled, The external opening of the vagina is
muscular, highly vascular and inverted pear partially closed by a thin ring of tissue called
shaped structure lying in the pelvic cavity the hymen. The hymen is often torn during
between the urinary bladder and rectum. The the first coitus (physical union). However
major portion of the uterus is the body and the in some women it remains intact. It can be
rounded region superior to it, is the fundus. The stretched or torn due to a sudden fall or jolt
uterus opens into the vagina through a narrow and also during strenuous physical activities
cervix. The cavity of the cervix called the such as cycling, horseback riding, etc., and
cervical canal communicates with the vagina therefore cannot be considered as an indicator
through the external orifice and with the uterus of a woman’s virginity.
through the internal orifice. The cervical canal The mammary glands are modified sweat
along with vagina forms the birth canal. glands present in both sexes. It is rudimentary
The wall of the uterus has three layers of in the males and functional in the females. A
tissues. The outermost thin membranous pair of mammary glands is located in the
serous layer called the perimetrium, thoracic region. It contains glandular tissue
the middle thick muscular layer called and variable quantities of fat with a median
myometrium and the inner glandular layer nipple surrounded by a pigmented area called
called endometrium. The endometrium the areola. Several sebaceous glands called the
undergoes cyclic changes during the areolar glands are found on the surface and
menstrual cycle while myometrium exhibits they reduce cracking of the skin of the nipple.
strong contractions during parturition. Internally each mammary gland consists of
Vagina is a large fibromuscular tube that 2-25 lobes, separated by fat and connective
extends from the cervix to the exterior. It is tissues. (Fig. 2.4) Each lobe is made up of
the female organ of copulation. The female lobules which contain acini or alveoli lined
reproductive structures that lie external to by epithelial cells. Cells of the alveoli secrete
the vagina are called as the external genitalia milk. The alveoli open into mammary
or vulva comprising of labia majora, labia tubules. The tubules of each lobe join to form
minora, hymen and clitoris. a mammary duct. Several mammary ducts

17 Human Reproduction

TN_GOVT_XII_ Bio Zoology_chapter2.indd 17 25-02-2019 19:09:08


www.asiriyar.net

2.2 Gametogenesis
Gametogenesis is the process of formation
of gametes i.e., sperms and ovary from the
6XVSHQVRU\
OLJDPHQW primary sex organs in all sexually reproducing
$GLSRVHWLVVXH organisms. Meiosis plays the most significant
/REH
role in the process of gametogenesis (Fig.2.5).
$UHROD
1LSSOH
Spermatogenesis
/DFWLIHURXVGXFW
0DPPDU\DPSXOOD
Spermatogenesis is the sequence of
0DPPDU\GXFW events in the seminiferous tubules of the
/REXOHFRQWDLQLQJ testes that produce the male gametes, the
DOYHROL
0DPPDU\WXEXOHV sperms. During development, the primordial
germ cells migrate into the testes and become
immature germ cells called sperm mother
Fig. 2.4 Mammary gland cells or spermatogonia in the inner surfaces
of the seminiferous tubules (Fig. 2.6 a). The
join to form a wider mammary ampulla spermatogonia begin to undergo mitotic
which is connected to the lactiferous duct in division at puberty and continue throughout
the nipple. Under the nipple, each lactiferous life.
duct expands to form the lactiferous sinus In the first stage of spermatogenesis, the
which serves as a reservoir of milk. Each spermatogonia migrate among sertoli cells
lactiferous duct opens separately by a minute towards the central lumen of the seminiferous
pore on the surface of the nipple. tubule and become modified and enlarged
Normal development of the breast to form primary spermatocytes which are
begins at puberty and progresses with diploid with 23 pairs i.e., 46 chromosomes.
changes during each
menstrual cycle. 6SHUPDWRJHQHVLV 2RJHQHVLV

In non-pregnant
0XOWLSOLFDWLRQ

6SHUPDWRJRQLD Q )RHWDO Q 2RJRQLD


women, the glandular
3KDVH

OLIH
structure is largely 0LWRWLFGLYLVLRQ 0LWRWLFGLYLVLRQ
underdeveloped and 3ULPDU\ Q 3ULPDU\RRF\WH
the breast size is VSHUPDWRF\WH Q
*URZWK

largely due to amount 0HLRVLV,


3KDVH

0HLRVLV,FRPSOHWHG
of fat deposits. The 6HFRQGDU\ )LUVW
Q
SULRUWRRYXODWLRQ
VSHUPDWRF\WH Q Q SRODU
size of the breast does ERG\
Q 6HFRQGDU\RRF\WH
not have an influence 0HLRVLV,,
$GXOW
XOW
on the efficiency of 6SHUPDWLG Q Q Q Q UHSURGXFWLYH
OLIH
lactation. 6SHUPLRJHQHVLV &RPSOHWLRQ
0DWXUDWLRQ

6HFRQG RIPHLRVLV,,
SRODU
3KDVH

6SHUPDWR]RD Q Q Q Q Q
ERG\
Q 2YXP

Fig. 2.5 Gametogenesis


Human Reproduction 18

TN_GOVT_XII_ Bio Zoology_chapter2.indd 18 25-02-2019 19:09:09


www.asiriyar.net

Spermatid
Spermatogonia

Sertoli cells
Interstitial cell

Fig. 2.6 (a) Cross sectional view of seminiferous


tubule
Some of the primary spermatocytes
undergo first meiotic division to form two
secondary spermatocytes which are haploid
with 23 chromosomes each. The secondary
spermatocytes undergo second meiotic
division to produce four haploid spermatids.
The spermatids are transformed into mature Fig. 2.6 (b) Seminiferous
spermatozoa (sperms) by the process tubules (Enlarged)
called spermiogenesis. Sperms are finally
Structure of human spermatozoan
released into the cavity of seminiferous
The human sperm is a microscopic,
tubules by a process called spermiation.
flagellated and motile gamete (Fig. 2.7).
The whole process of spermatogenesis
The whole body of the sperm is enveloped
takes about 64 days. At any given time,
by plasma membrane and is composed of a
different regions of the seminiferous tubules
head, neck and a tail. The head comprises
contain spermatocytes in different stages
of two parts namely acrosome and nucleus.
of development (Fig. 2.6 b). The sperm
Acrosome is a small cap like pointed
production remains nearly constant at a rate
structure present at the tip of the nucleus
of about 200 million sperms per day.
and is formed mainly from the Golgi body
Spermatogenesis starts at the age of of the spermatid. It contains hyaluronidase,
puberty and is initiated due to the increase a proteolytic enzyme, popularly known as
in the release of Gonadotropin Releasing sperm lysin which helps to penetrate the
Hormone (GnRH) by the hypothalamus. ovum during fertilisation. The nucleus is flat
GnRH acts on the anterior pituitary gland and and oval. The neck is very short and is present
stimulates the secretion of two gonadotropins between the head and the middle piece.
namely Follicle Stimulating Hormone It contains the proximal centriole towards
(FSH) and Lutenizing Hormone (LH). FSH the nucleus which plays a role in the first
stimulates testicular growth and enhances the division of the zygote and the distal centriole
production of Androgen Binding Protein gives rise to the axial filament of the sperm.
(ABP) by the sertoli cells and helps in the The middle piece possesses mitochondria
process of spermiogenesis. LH acts on the spirally twisted around the axial filament
Leydig cells and stimulates the synthesis of called mitochondrial spiral or nebenkern.
testosterone which in turn stimulates the It produces energy in the form of ATP
process of spermatogenesis. molecules for the movement of sperms. The

19 Human Reproduction

TN_GOVT_XII_ Bio Zoology_chapter2.indd 19 25-02-2019 19:09:09


www.asiriyar.net

tail is the longest part


Out of the million eggs
of the sperm and is Acrosome
women possess during
slender and tapering. Head
Nucleus birth, only about 300 to
It is formed of a
400 will ovulate before
central axial filament Neck menopause.
or axoneme and an
outer protoplasmic Mitochondria On the other hand, males produce more
sheath. The lashing
Middle
piece
than 500 billion sperms in their life time.
movements of the
The primary follicle gets surrounded
tail push the sperm
forward. The human by many layers of granulosa cells and a new
Tail
male ejaculates about theca layer to form the secondary follicle. A
200 to 300 million fluid filled space, the antrum develops in the
sperms during coitus. follicle and gets transformed into a tertiary
It is estimated that follicle. The theca layer gets organized into an
around 60 percent inner theca interna and an outer theca externa.
of sperms must At this time, the primary oocyte within the
have normal shape Fig. 2.7 Structure of tertiary follicle grows in size and completes its
of which at least 40 human sperm first meiotic division and forms the secondary
per cent must show oocyte. It is an unequal division resulting in
vigorous motility for normal fertility. the formation of a large haploid secondary
oocyte and a first polar body. The first polar
body disintegrates. During fertilisation, the
The sperm is the smallest
secondary oocyte undergoes second meiotic
human cell and the
division and produces a large cell, the ovum
ovum or egg is the largest
and a second polar body. The second polar body
human cell.
also degenerates. The tertiary follicle eventually
becomes a mature follicle or Graafian follicle.
Oogenesis
If fertilisation does not take place, second
Oogenesis is the process of development
meiotic division is never completed and the
of the female gamete or ovum or egg in the
egg disintegrates. At the end of gametogenesis
ovaries. During foetal development, certain cells
in females, each primary oocyte gives rise to
in the germinal epithelium of the foetal ovary
only one haploid ovum.
divide by mitosis and produce millions of egg
mother  cells or oogonia. No more oogonia Structure of ovum
are formed or added after birth. The oogonial Human ovum is non-cleidoic, alecithal
cells start dividing and enter into Prophase I of and microscopic in nature. (Fig. 2.8 b). Its
meiotic division I to form the primary oocytes cytoplasm called ooplasm contains a large
which are temporarily  arrested at this stage. nucleus called the germinal vesicle. The ovum
The  primary oocytes then get surrounded by is surrounded by three coverings namely an
a single layer of granulosa cells to form the inner thin transparent vitelline membrane,
primordial or primary follicles (Fig. 2.8 a). A middle thick zona pellucida and outer thick
large number of follicles degenerate during the coat of follicular cells called corona radiata.
period from birth to puberty, so at puberty only Between the vitelline membrane and zona
60,000 to 80,000 follicles are left in each ovary. pellucida is a narrow perivitelline space.

Human Reproduction 20

TN_GOVT_XII_ Bio Zoology_chapter2.indd 20 25-02-2019 19:09:09


www.asiriyar.net

7HUWLDU\ 6HFRQGDU\ 3ULPDU\ 3ULPRUGLDO %ORRG


IROOLFOH IROOLFOH IROOLFOH IROOLFOHV YHVVHOV

&RURQDUDGLDWD

=RQD3HOOXFLGD

9LWHOOLQH
PHPEUDQH

&RUSXV 1XFOHXV
DOELFDQV *HUPLQDOYHVLFOH

2RSODVP
&RUSXV
OXWHXP

0DWXUH 6HFRQGDU\
JUDDILDQ RFF\WH
IROOLFOH Fig. 2.8 (b) Diagrammatic view of the
human ovum
Fig. 2.8 (a) Sectional view of the ovary

2.3 Menstural cycle 2. Follicular or proliferative phase


The menstrual or ovarian cycle occurs The follicular phase extends from the 5th
approximately once in every 28/29 days day of the cycle until the time of ovulation.
during the reproductive life of the female from During this phase, the primary follicle in the
menarche (puberty) to menopause except ovary grows to become a fully mature Graafian
during pregnancy. The cycle of events starting follicle and simultaneously, the endometrium
from one menstrual period till the next one is regenerates through proliferation. These changes
called the menstrual cycle during which cyclic in the ovary and the uterus are induced by the
changes occurs in the endometrium every secretion of gonadotropins like FSH and LH,
month. Cyclic menstruation is an indicator of which increase gradually during the follicular
normal reproductive phase (Fig. 2.9). phase. It stimulates follicular development and
Menstrual cycle comprises of the following secretion of oestrogen by the follicle cells.
phases 3. Ovulatory phase
1. Menstrual phase Both LH and FSH attain peak level in
2. Follicular or proliferative phase the middle of the cycle (about the 14th day).
3. Ovulatory phase Maximum secretion of LH during the mid
4. Luteal or secretory phase cycle called LH surge induces the rupture of
the Graafian follicle and the release of the ovum
1. Menstrual phase (secondary oocyte) from the ovary wall into
The cycle starts with the menstrual phase the peritoneal cavity. This process is called
when menstrual flow occurs and lasts for 3-5 as ovulation.
days. Menstrual flow is due to the breakdown of 4. Luteal or secretory phase
endometrial lining of the uterus, and its blood During luteal phase, the remaining part
vessels due to decline in the level of progesterone of the Graafian follicle is transformed into
and oestrogen. Menstruation occurs only if the a transitory endocrine gland called corpus
released ovum is not fertilized. Absence of luteum. The corpus luteum secretes large
menstruation may be an indicator of pregnancy. amount of progesterone which is essential
However it could also be due to stress, hormonal for the maintenance of the endometrium.
disorder and anaemia. If fertilisation takes place, it paves way for

21 Human Reproduction

TN_GOVT_XII_ Bio Zoology_chapter2.indd 21 25-02-2019 19:09:10


www.asiriyar.net

(a) FSH and LH secreted by the anterior pituitary


14th day LH Surge triggers ovulation

Lutenizing hormone(LH)

Follicle stimulating hormone(FSH)

(b) Events in the ovary


Single mature Ovulation Corpus Corpus
follicle luteum albicans
Several follicles start developing

Follicular phase Luteal phase

(c) Ovarian hormones

Progesterone

Oestrogen

(c) Events in the endometrium of the uterus Highly proliferated and vascularized endometrium

Bleeding and sloughing


Thickness of the

(menstruation)
endometrium

Days 1 3 5 7 9 11 13 17 19 21 23 25 27 28

Menstrual phase Follicular phase Luteal phase

Fig. 2.9 Different phases of the menstrual cycle


the implantation of the fertilized ovum. The In the absence of fertilisation, the corpus
uterine wall secretes nutritious fluid in the luteum degenerates completely and leaves a scar
uterus for the foetus. So, this phase is also tissue called corpus albicans. It also initiates
called as secretory phase. During pregnancy the disintegration of the endometrium leading
all events of menstrual cycle stop and there is to menstruation, marking the next cycle.
no menstruation.

POLY CYSTIC OVARY SYNDROME (PCOS)


PCOS is a complex endocrine system disorder that affects women in their reproductive
years. Polycystic means ‘many cysts’. It refers to many partially formed follicles on the ovaries,
which contain an egg each. But they do not grow to maturity or produce eggs that can be
fertilized. Women with PCOS may experience irregular menstrual cycles, increased androgen
levels, excessive facial or body hair growth (hirsutism), acne, obesity, reduced fertility and
increased risk of diabetes. Treatment for PCOS includes a healthy lifestyle, weight loss and
targeted hormone therapy.

Human Reproduction 22

TN_GOVT_XII_ Bio Zoology_chapter2.indd 22 25-02-2019 19:09:10


www.asiriyar.net

Menstrual hygiene The sperms deposited in the female


Menstrual hygiene is vital for good reproductive tract undergo capacitation, which
health, well-being, dignity, empowerment is a biochemical event that enables the sperm
and productivity of women. The impact of to penetrate and fertilise the egg. Fertilisation
poor menstrual hygiene on girls is increased occurs only if the ovum and sperms are
stress levels, fear and embarrassment during transported simultaneously to the ampullary
menstruation. This can keep girls inactive isthmic junction of the fallopian tube.
during such periods leading to absenteeism Before a sperm can enter the egg,
from school. it must penetrate the multiple layers of
Clean and safe absorbable clothing granulosa (follicular) cells which are around
materials, sanitary napkins, pads, tampons the ovum forming the corona radiata (Fig.
and menstrual cups have been identified 2.10). The follicular cells are held together
as materials used to manage menstruation. by an adhesive cementing substance called
Changing sanitary material 4-5 hours as per hyaluronic acid. The acrosomal membrane
the requirement, provides comfort, cleanliness disintegrates releasing the proteolytic enzyme,
and protection from infections. It also helps in hyaluronidase during sperm entry through
enhancing the quality of life of women during the corona radiata and zona pellucida. This is
this period. Used sanitary napkins should be called acrosomal reaction. Once fertilisation
wrapped in paper and disposed. It should not is accomplished, cortical granules from the
be thrown in open areas or drain pipe of toilets. cytoplasm of the ovum form a barrier called
Flushing of sanitary napkins in the drain pipes the fertilisation membrane around the ovum
causes choking of the drainage line leading to preventing further penetration of other sperms.
water pollution. Thus polyspermy is prevented.
The first cleavage produces two identical
Disposal of Napkins cells called blastomeres. These produce 4 cells,
then 8 and so on. After 72 hours of fertilisation,
The ecofriendly way to dispose
a loose collection of cells forms a berry shaped
menstrual waste scientifically and
cluster of 16 or more cells called the morula (Fig.
hygienically is to destroy the sanitary
2.11).
napkins using incinerators. Measures are
being taken to install incinerators and Under the influence of progesterone,
napkin vending machines in washrooms smooth muscles of the fallopian tube relax
of schools , colleges and public facilities. and the dividing embryo takes 4-5 days to
move through the fallopian tube into the
Menopause uterine cavity and finally gets implanted in
Menopause is the phase in a women’s the uterine wall. At this point the embryo
life when ovulation and menstruation stops. consists of a fluid filled hollow ball of about
The average age of menopause is 45-50 years. 100 cells, called the blastocyst. The blastocyst
It indicates the permanent cessation of the is composed of a single layer of large flattened
primary functions of the ovaries. cells called trophoblast and a small cluster
of 20-30 rounded cells called the inner cell
2.4 Fertilisation and implantation mass. The inner cell mass of the blastocyst
Fertilisation occurs when a haploid sperm develops into the embryo and becomes
fuses with a haploid ovum to form a fertilized embedded in the endometrium of the uterus.
egg or diploid zygote.

23 Human Reproduction

TN_GOVT_XII_ Bio Zoology_chapter2.indd 23 25-02-2019 19:09:10


www.asiriyar.net

 
7KHQXFOHXVDQGRWKHU &RUWLFDOJUDQXOHVIRUPDEDUULHU
FRPSRQHQWVRIWKHVSHUP FDOOHGIHUWLOL]DWLRQPHPEUDQH
HQWHUWKHHJJ ZKLFKQRZIXQFWLRQVDVDEORFN
WRSRO\VSHUP\

%UHDNGRZQRIWKH]RQD
SHOOXFLGDE\WKHVHHQ]\PHV
DOORZVWKHVSHUPWRUHDFK
WKHSODVPDPHPEUDQHRIWKH
HJJ   


7KLVELQGLQJLQGXFHVWKH )ROOLFOHFHOOV
DFURVRPHUHDFWLRQLQZKLFKWKH &RUWLFDO
VSHUPUHOHDVHVK\DOXURQLGDVH  6SHUP JUDQXOH
LQWRWKH]RQDSHOOXFLGD QXFOHXV

 =RQDSHOOXFLGD
7KHVSHUPPLJUDWHVWKURXJK
WKHFRDWRIIROOLFOHFHOOVDQGELQGV (JJSODVPD
WRUHFHSWRUPROHFXOHVLQWKH]RQD 
PHPEUDQH
SHOOXFLGDRIWKHHJJ
$FURVRPH (JJ
F\WRSODVP

Fig. 2.10 Events of fertilisation


This process is called implantation and it
results in pregnancy. Twins are two offsprings produced in the
same pregnancy.
If the fertilised ovum is implanted outside
➢ 
Monozygotic (Identical) twins are
the uterus it results in ectopic pregnancy.
produced when a single fertilised
About 95 percent of ectopic pregnancies
egg splits into two during the first
occur in the fallopian tube. The growth of
cleavage. They are of the same sex,
the embryo may cause internal bleeding,
look alike and share the same genes.
infection and in some cases even death due to
rupture of the fallopian tube. ➢ 
Dizygotic (Fraternal) twins are
produced when two separate eggs
D =\JRWH E FHOOVWDJH F 0RUXOD G (DUO\EODVWRF\VW
are fertilised by two separate sperms.
IHUWLOL]HGHJJ
The twins may be of the same sex or
different sex and are non-identical.
➢ 
Siamese (United) twins are the
)HUWLOL]DWLRQ
conjoined twins who are joined
2RF\WH HJJ
during birth.
H LPSODQWHG
EODVWRF\VW

2.5 Maintenance of pregnancy


and embryonic development
The inner cell mass in the blastula is
Fig. 2.11 From zygote to blastocyst : passage
differentiated into epiblast and hypoblast
of growing embryo through the
fallopian tube immediately after implantation. The hypoblast
is the embryonic endoderm and the epiblast
is the ectoderm. The cells remaining in

Human Reproduction 24

TN_GOVT_XII_ Bio Zoology_chapter2.indd 24 25-02-2019 19:09:12


www.asiriyar.net

between the epiblast and the endoderm form surrounded by sinuses that contain maternal
the mesoderm. Thus the transformation of the blood. The chorionic villi and the uterine
blastocyst into a gastrula with the primary germ tissues form the disc-shaped placenta. Placenta
layers by the movement of the blastomeres is is a temporary endocrine organ formed during
called gastrulation. Each germ layer gives rise pregnancy and it connects the foetus to the
to specific tissues, organs and organ systems uterine wall through the umbilical cord. It is
during organogenesis. the organ by which the nutritive, respiratory
The extra embryonic membranes namely and excretory functions are fulfilled. The
the amnion, yolk sac, allantois and chorion embryo’s heart develops during the fourth week
protect the embryo from dessication, mechanical of pregnancy and circulates blood through the
shock and help in the absorption of nutrients umbilical cord and placenta as well as through
and exchange of gases (Fig. 2.12). The amnion its own tissues.
is a double layered translucent membrane filled The primary germ layers serve as the
with the amniotic fluid. It provides a buoyant primitive tissues from which all body organs
environment to protect the developing embryo develop. The ectoderm gives rise to the central
from injury, regulates the temperature of the nervous system (brain and spinal cord),
foetus and provides a medium in which the peripheral nervous system, epidermis and
foetus can move. The yolk sac forms a part of its derivatives and mammary glands. The
the gut and is the source of the earliest blood connective tissue, cartilage and bone, muscles,
cells and blood vessels. organs of urinogenital system (kidney, ureter
3ODFHQWDO and gonads) arise from the mesoderm. The
YLOOL 3ODFHQWD
endodermal derivatives are epithelium of
gastrointestinal and respiratory tract, liver,
$OODQWRLV
8PELOLFDO pancreas, thyroid and parathyroids.
FRUG
)DOORSLDQ
WXEH Human pregnancy lasts for about 280
)RHWXV 8WHUXV days or 40 weeks and is called the gestation
&KRULRQ
$PQLRWLF period. It can be divided for convenience into
IOXLG $PQLRQ
three trimesters of three months each. The first
trimester is the main period of organogenesis,
the body organs namely the heart, limbs,
lungs, liver and external genital organs are well
Fig. 2.12 Human foetus within the uterus
developed. By the end of the second trimester,
The allantois forms a small out pocketing the face is well formed with features, eyelids and
of embryonic tissue at the caudal end of the yolk eyelashes, eyes blink, body is covered with fine
sac. It is the structural base for the umbilical hair, muscle tissue develops and bones become
cord that links the embryo to the placenta and harder. The foetus is fully developed and is
ultimately it becomes part of the urinary bladder. ready for delivery by the end of nine months
The chorion is the outermost membrane which (third trimester).
encloses the embryo and all other membranes During pregnancy, the placenta acts as
and also helps in the formation of the placenta. a temporary endocrine gland and produces
The trophoblast cells in the blastocyst large quantities of human Chorionic
send out several finger like projections called Gonadotropin (hCG), human Chorionic
chorionic villi carrying foetal blood and are Somatomammotropin (hCS) or human
Placental Lactogen (hPL), oestrogens and

25 Human Reproduction

TN_GOVT_XII_ Bio Zoology_chapter2.indd 25 25-02-2019 19:09:12


www.asiriyar.net

progesterone which are essential for a normal Relaxin is a hormone secreted by the
pregnancy. A hormone called relaxin is also placenta and also found in the corpus luteum.
secreted during the later phase of pregnancy It promotes parturition by relaxing the pelvic
which helps in relaxation of the pelvic ligaments joints and by dilatation of the cervix with
at the time of parturition. It should be noted that continued powerful contractions. The amnion
hCG, hPL and relaxin are produced only during ruptures and the amniotic fluid flows out
pregnancy. In addition, during pregnancy the through the vagina, followed by the foetus. The
level of other hormones like oestrogen and placenta along with the remains of the umbilical
progesterone, cortisol, prolactin, thyroxine, etc., cord called “after birth” is expelled out after
is increased several folds in the maternal blood. delivery.
These hormones are essential for supporting Lactation is the production of milk by
foetal growth. mammary glands. The mammary glands show
changes during every menstrual cycle, during
A female uterus is pregnancy and lactation. Increased level of
normally about 3 inches oestrogens, progesterone and human Placental
Lactogen (hPL) towards the end of pregnancy
long and 2 inches wide
stimulate the hypothalamus towards prolactin
but can expand 20 times
– releasing factors. The anterior pituitary
during pregnancy.
responds by secreting prolactin which plays a
major role in lactogenesis.
2.6 Parturition and lactation Oxytocin causes the “Let-Down” reflex-
Parturition is the completion of pregnancy the actual ejection of milk from the alveoli
and giving birth to the baby. The series of of the mammary glands. During lactation,
events that expels the infant from the uterus oxytocin also stimulates the recently emptied
is collectively called “labour”. Throughout uterus to contract, helping it to return to pre -
pregnancy the uterus undergoes periodic pregnancy size.
episodes of weak and strong contractions.
Colostrum
These contractions called Braxter-Hick’s
contractions lead to false labour. As the Colostrum, a nutrient rich
pregnancy progresses, increase in the oestrogen fluid produced by the human female
concentration promotes uterine contractions. immediately after giving birth, is loaded
These uterine contractions facilitate moulding with immune, growth and tissue repair
of the foetus and downward movement of factors. It acts as a natural antimicrobial
the foetus. The descent of the foetus causes agent to actively stimulate the maturation
dilation of cervix of the uterus and vaginal of the infant’s immune system. No artificial
canal resulting in a neurohumoral reflex called feed can substitute the first milk, with all
Foetal ejection reflex or Ferguson reflex. This its natural benefits and therefore should be
initiates the secretion of oxytocin from the definitely fed to the baby after birth.
neurohypophysis which in turn brings about
the powerful contraction of the uterine muscles The mammary glands secrete a yellowish
and leads to the expulsion of the baby through fluid called colostrum during the initial
the birth canal. This sequence of events is called few days after parturition. It has less lactose
as parturition or childbirth. than milk and almost no fat, but it contains
more proteins, vitamin A and minerals.

Human Reproduction 26

TN_GOVT_XII_ Bio Zoology_chapter2.indd 26 25-02-2019 19:09:13


www.asiriyar.net

STAGES OF
FOETAL DEVELOPMENT

20 Weeks
Length of foetus increases
Hair on the head and
eyebrows. Skin becomes
covered with
16 Weeks sebaceous gland 24 Weeks
Lower limbs reach final Lungs are well developed
development. Rapid eye movements
Movements are seen begin. Foetus starts
gaining weight

12 Weeks 28 Weeks
Eyes and ears are well Immune system starts
defined. Ossification of developing. Central
long bones are seen nervous system
Urine formation begins developed. Retina is
well developed

8 Weeks 32 Weeks
Limbs and digits fully formed. Body weight increases
Movements start taking rapidly. Skin is smooth
place. Neck appears between due to deposition of
head and thorax. External genitalia subcutaneous fat
show sex differences

4 Weeks 36 Weeks
Formation of foregut, midgut and Blood vessels are
hindgut. Heart starts functioning. completely developed.
Forebrain is most prominent. Baby is positioned into
Upper limbs appears as the pelvis in head
paddle-shaped buds down position

40 Weeks
Baby is fully formed.
Ready to be born
any day

27 Human Reproduction

TN_GOVT_XII_ Bio Zoology_chapter2.indd 27 25-02-2019 19:09:14


www.asiriyar.net

CAESAREAN When normal vaginal delivery is not possible due to factors like position of
the baby and nature of the placenta, the baby is delivered through a surgical incision in the
woman’s abdomen and uterus. It is also termed as abdominal delivery or Caesarean Section or
‘C’ Section.

Colostrum is also rich in IgA antibodies. This cervix, vagina and external genitalia. The male
helps to protect the infant’s digestive tract reproductive system consists of a pair of testes,
against bacterial infection. Breast milk is the a pair of duct system, accessory glands and
ideal food for infants as it contains all the external genitalia called penis.
constituents in suitable concentration and is The process of formation of gametes in
easily digestible. It is fully sufficient till about the male is called spermatogenesis and in the
6 months of age and all infants must be breast female is called oogenesis. The reproductive
fed by the mother to ensure the growth of a cycle in females is called menstrual cycle and
healthy baby. it is initiated at puberty. The ovum released
during the menstrual cycle is fertilized by the
Summary sperm and the zygote is formed.
Reproduction is a process which helps in
Zygote undergoes repeated mitotic division
the continuity and maintenance of a species.
and the blastocyst is implanted on the walls of
Human beings are sexually reproducing and
the uterus. It takes about 280 days or 40 weeks
viviparous. The reproductive events include
for the entire development of the human foetus
gametogenesis, insemination, Fertilisation,
and it is delivered out through the process of
cleavage, implantation, placentation,
child birth or parturition. The new born baby is
gastrulation, organogenesis and parturition.
breast fed by the mother.
The female reproductive system consists
of a pair of ovaries, a pair of oviducts, uterus,

World Breast feeding week (WBW)


August 1st week
WBW is organized and promoted world wide by WABA (World Alliance for
Breast feeding Action), WHO (World Health Organization) and UNICEF (United
Nations International Children's Emergency Fund) to stress the importance of
breast feeding during the first six months of baby’s life and a supplemented breast
feeding for two years in order to encourage new mothers for the healthy growth
and development of their children, to guard them from lethal health problems and
diseases including neonatal jaundice, pneumonia, cholera, etc., The Government
of Tamil Nadu has also initiated various projects like Mother’s Milk Bank, Feeding
rooms in bus terminals and also organisizes awareness campaigns during the first
week of August to highlight the importance of breast feeding to infants.

Human Reproduction 28

TN_GOVT_XII_ Bio Zoology_chapter2.indd 28 25-02-2019 19:09:14


www.asiriyar.net

INTERESTING FACTS

1. Males are said to be sterile when they fail to produce viable sperms.
2. Azospermia refers to the failure of spermatogenesis.
3. Enlargement of prostate gland is called prostatitis and can lead to difficulty in urination.
4. Castration or surgical removal of testis is known as orchidectomy
5. Spermarche is the first ejaculation of the semen.

Arunachalam Muruganantham
Inventor And Social Entrepreneur
Arunachalam Muruganantham is the man behind the world’s first low cost sanitary napkin
making machine. His mission was to provide sanitary napkins at minimal cost to poor
women across the country, especially in rural areas. The journey began when he was shocked
by the fact that women in India including his wife often used things such as old rags, leaves
and even ash during menstruation. Approximately 70 percent of all reproductive diseases
in India are caused by poor menstrual hygiene. 23 percent of girls drop out of schools once
they attain puberty. He wished to make a social impact by creating more livelihoods and
improving the menstrual hygiene of rural women.

Arunachalam initiated his research in 1999 and almost after 5 years, successfully created
a low cost machine for the production of sanitary napkins. He presented his prototype
to IIT, Madras for a national innovation competition in 2006 and out of 943 entries, his
machine stood first. Arunachalam made 250 machines in 18 months and set out to states in
Northern India namely Bihar, Madhya Pradesh, Rajasthan and Uttar Pradesh.
Arunachalam Muruganantham was named one of the Time Magazine’s 100 most
influential people in 2014. He was awarded the Padma Shri in 2016.

29 Human Reproduction

TN_GOVT_XII_ Bio Zoology_chapter2.indd 29 25-02-2019 19:09:14


www.asiriyar.net

Evaluation 10. The milk secreted by the mammary glands


1. The mature sperms are soon after child birth is called
stored in the a. Mucous b. Colostrum
a. Seminiferous tubules c. Lactose d. Sucrose
b.Vas deferens 11. Colostrum is rich in
c. Epididymis a. Ig E b. Ig A
d. Seminal vesicle c. Ig D d. Ig M
2. The male sex hormone testosterone is 12. The Androgen Binding Protein (ABP) is
secreted from produced by
a. Sertoli cells b. Leydig cell a. Leydig cells b. Hypothalamus
c. Epididymis d. Prostate gland c. Sertoli cells d. Pituitary gland
3. The glandular accessory organ which 13. Which one of the following menstrual
produces the largest proportion of semen irregularities is correctly matched?
is a. Menorrhagia - excessive
a. Seminal vesicle menstruation
b. Bulbourethral gland b. Amenorrhoea - absence of
c. Prostate gland menstruation
d. Mucous gland c. Dysmenorrhoea - irregularity of
4. The male homologue of the female clitoris is menstruation
a. Scrotum b. Penis d. Oligomenorrhoea - painful
c. Urethra d.Testis menstruation
5. The site of embryo implantation is the 14. Find the wrongly matched pair
a. Uterus b. Peritoneal cavity a. Bleeding phase - fall in oestrogen and
c. Vagina d. Fallopian tube progesterone
6. The foetal membrane that forms the basis b. Follicular phase - rise in oestrogen
of the umbilical cord is c. Luteal phase - rise in FSH level
a. Allantois b. Amnion d. Ovulatory phase - LH surge
c. Chorion d. Yolk sac
7. The most important hormone in intiating Answer the following type of questions
and maintaining lactation after birth is Assertion (A) and Reason (R)
a. Oestrogen b. FSH a. A and R are true, R is the correct
c. Prolactin d. Oxytocin explanation of A
8. Mammalian egg is b. A and R are true, R is not the correct
a. Mesolecithal and non cleidoic explanation of A
b. Microlecithal and non cleidoic c. A is true, R is false
c. Alecithal and non cleidoic d. Both A and R are false
d. Alecithal and cleidoic 15. A – 
In human male, testes are extra
9. The process which the sperm undergoes abdominal and lie in scrotal sacs.
before penetrating the ovum is R – S crotum acts as thermoregulator and
keeps temperature lower by 2oC for
a. Spermiation b. Cortical reaction
normal sperm production .
c. Spermiogenesis d. Capacitation

Human Reproduction 30

TN_GOVT_XII_ Bio Zoology_chapter2.indd 30 25-02-2019 19:09:14


www.asiriyar.net

(a) A and R are true, R is the correct 32.


Explain the various phases of the
explanation of A menstrual cycle.
16. A – O vulation is the release of ovum from 33. Explain the role of oxytocin and relaxin in
the Graafian follicle. parturition and lactation.
R – It occurs during the follicular phase of 34. Identify the given image and label its parts
the menstrual cycle. marked as a, b, c and d
(c) A is true, R is false
d
17. A – 
Head of the sperm consists of
acrosome and mitochondria.
a
R– Acrosome contains spiral rows of
mitochondria. b
(d) Both A and R are false
c
18.
Mention the differences between
spermiogenesis and spermatogenesis.
19. At what stage of development are the
gametes formed in new born male and 35. The following is the illustration of the
female? sequence of ovarian events (a-i) in a
20. Expand the acronyms human female.
a. FSH b. LH c. hCG d. hPL
21. How is polyspermy avoided in humans?
22. What is colostrum? Write its significance.
a) Identify the figure that illustrates ovulation
23. Placenta is an endocrine tissue. Justify.
and mention the stage of oogenesis it
24. Draw a labeled sketch of a spermatozoan. represents.
25. What is inhibin? State its functions. b) Name the ovarian hormone and the
26. Mention the importance of the position of pituitary hormone that have caused the
the testes in humans. above-mentioned events.
27. What is the composition of semen? c) Explain the changes that occurs in the
uterus simultaneously in anticipation.
28. Name the hormones produced from the
placenta during pregnancy. d) Write the difference between C and H.
29. Define gametogenesis.
30. Describe the structure of the human ovum
with a neat labelled diagram.
31.
Give a schematic representation of
spermatogenesis and oogenesis in humans.

31 Human Reproduction

TN_GOVT_XII_ Bio Zoology_chapter2.indd 31 25-02-2019 19:09:15


Human Reproduction
Concept Map

32

TN_GOVT_XII_ Bio Zoology_chapter2.indd 32


+XPDQUHSURGXFWLRQ

0DOHUHSURGXFWLYHV\VWHP )HPDOHUHSURGXFWLYHV\VWHP
*DPHWRJHQHVLV

$FFHVVRU\JODQGV 3ULQFLSDORUJDQV 3ULQFLSDORUJDQV $FFHVVRU\JODQGV 0HQVWUXDOF\FOH

6SHUPDWRJHQHVLV 2RJHQHVLV

6HPLQDO 7HVWLV 6SHUP 2YXP 2YDU\ 0DPPDU\ 0HQVWUXDO


YHVLFOH JODQGV SKDVH

3URVWDWH 6HPLQLIHURXV )DOORSLDQ )ROOLFXODU


6(0(1 )HUWLOLVDWLRQ
JODQG WXEXOHV WXEH SKDVH

=\JRWH
2YXODWRU\
%XOERXUHWKUDO 8WHUXV
9DVGHIHUHQV SKDVH
JODQG ,PSODQWDWLRQ

/XWHDO
)RHWDO 9DJLQD
SKDVH
3HQLV GHYHORSPHQW

3DUWXULWLRQ

/DFWDWLRQ

25-02-2019 19:09:15
www.asiriyar.net
www.asiriyar.net

ICT CORNER
HUMAN REPRODUCTION

Baby’s Journey to the world.

Procedure:
Step 1: Use the URL or scan the QR Code to launch the “Stages of Development before
Birth” activity page.
Step 2: On the right of the window, Click “Video” and view the development of embryo
during that particular stage.
Step 3: Click “Show Features” to know the parts. Click “Heartbeat-Symbol” to hear the
heartbeat of the embryo at that particular stage. Click “Weighing Machine” placed
below to know the weight of the offspring at that stage.
Step 4: Repeat the above steps with the different weeks by clicking the respective week tabs
placed below.

Step 1 Step 2 Step 3

Step 4

HUMAN REPRODUCTION URL:


http://www.glencoe.com/sites/common_assets/science/virtual_labs/
LS26/LS26.html

*Pictures are indicative only


*Allow flash player

33 Human Reproduction

TN_GOVT_XII_ Bio Zoology_chapter2.indd 33 25-02-2019 19:09:16


www.asiriyar.net

3
UNIT - I

Reproductive
Health
CHAPTER
Safe motherhood begins before conception
with healthy lifestyle and proper nutrition.
Chapter outline
3.1. Need for reproductive health Problems
and strategies
3.2. Amniocentesis and its statutory ban
3.3. Social impact of sex ratio,
R eproductive health represents a society with
people having physically and functionally
normal reproductive organs. Healthy people
female foeticide and infanticide have healthier babies and are able to care for
3.4. Population explosion and birth control their family, and contribute more to the society
3.5. Medical termination of pregnancy (MTP) and community. Hence, health is a community
3.6. Sexually transmitted diseases (STD) issue. Reproductive system is a complex system
3.7. Infertility controlled by the neuro-endocrine system,
3.8. Assisted reproductive technologies (ART) hence, it is important to take necessary steps to
3..9. Detection of foetal disorders during early protect it from infectious diseases and injury.
pregnancy
3.1. Need for reproductive health-
Learning objectives Problems and strategies
India is amongst the first few countries
➢ Understands the importance of sex in the world to initiate the ‘Family planning
education and reproductive health. programme’ since 1951 and is periodically
➢ Learns the importance of amniocentesis as assessed every decade. These programmes are
a pre-natal diagnosis. popularly named as ‘Reproductive and Child
➢ Evaluates the effects of Health Care (RCH). Major tasks carried out
maternal and infant under these programmes are:
mortality. • Creating awareness and providing medical
➢ Identifies, compares and assistance to build a healthy society.
explains different types of • Introducing sex education in schools to
contraceptive devices. provide information about adolescence and
➢ Discusses the medical necessity and social adolescence related changes.
consequences of MTP.
• Educating couples and those in the
➢ Explains the reasons of transmission and
marriageable age groups about the
prevention of STDs.
available birth control methods and
➢ Highlights the reasons of infertility.
family planning norms.
➢ Develops a positive and healthy attitude
towards reproductive life.

34

TN_GOVT_XII_ Bio Zoology_chapter3.indd 34 25-02-2019 19:12:21


www.asiriyar.net

the foetus. Once the sex of the foetus is known,


Globally, about 800 women there may be a chance of female foeticide. Hence,
die every day of preventable a statutory ban on amniocentesis is imposed.
causes related to pregnancy
and childbirth; 20 per cent of these 3.3. Social impact of sex ratio,
women are from India. Similarly India's female foeticide and infanticide
infant mortality rate was 44 per 1,000 live. The sex ratio is the ratio of males to the
Although, India has witnessed dramatic females in a population. In India, the child sex
growth over the last two decades, ratio has decreased over the decade from 927
maternal mortality still remains high to 919 female for every 1000 males. To correct
as in comparison to many developing this ratio, steps are needed to change the mind
nations. set and attitudes of people, especially in the
source: http://unicef.in
young adults. Female foeticide and infanticide
is the manifestation of gender discrimination
• Creating awareness about care for pregnant in our society.
women, post-natal care of mother and child
Female foeticide  refers to  ‘aborting the
and the importance of breast feeding.
female in the mother’s womb’; whereas female
• Encouraging and supporting infanticide is ‘killing the female child after her
governmental and non-governmental birth’. These have resulted in imbalance in sex
agencies to identify new methods and/or ratio. In UNDP’s GII 2018 (United nations
to improve upon the existing methods of developmental programmes gender inequality
birth control. index) reflected that India was ranked at 135
out of 187 countries due to availability of
Health care programmes such as very few economic opportunities to women
massive child immunization, supply of as compared to men.
nutritional food to the pregnant women, In order to prevent female foeticide
Janani Suraksha Yojana, Janani Shishu and infanticide, Government of India has
Suraksha Karyakaram, RMNCH+A taken various steps like PCPNDT Act
approach (an integrated approach for (Preconception and Prenatal diagnostic
reproductive, maternal, new born, child technique act-1994)  enacted to ban the
and adolescent health), Pradhan Mantri identification of sex and to prevent the
Surakshit Matritva Abhiyan, etc., are use of prenatal diagnostic techniques for
taken up at the national level by the selective abortion. Various measures are
Government of India. taken by the Government to ensure survival,
provision of better nutrition, education,
protection and empowerment of girls by
3.2. Amniocentesis and its
eliminating the differences in the sex ratio,
statutory ban infant mortality rate and improving their
Due to small family norms and the skewed
nutritional and educational status. POCSO
choice for a  male  child, female  population is
Act (Prevention of children from sexual
decreasing at an alarming rate. Amniocentesis
offences),  Sexual harassment at workplace
is a prenatal technique used to detect any
(Prevention, prohibition and redressal) Act
chromosomal abnormalities in the foetus and it
and the changes in the  Criminal law based
is being often misused to determine the sex of
on the recommendations of Justice Verma

35 Reproductive Health

TN_GOVT_XII_ Bio Zoology_chapter3.indd 35 25-02-2019 19:12:21


www.asiriyar.net

Committee, 2013 aims at creating a safe and a. Periodic abstinence/rhythm method


secure environment for both females and Ovulation occurs at about the 14th day
males. of the menstrual cycle. Ovum survives
for about two days and sperm remains
3.4. Population explosion and alive for about 72 hours in the female
birth control reproductive tract. Coitus is to be avoided
Increased health facilities and better living during this time.
conditions have enhanced longevity. According b. Continuous abstinence is the simplest
to a recent report from the UN, India’s and most reliable way to avoid pregnancy
population has already reached 1.26 billion is not to have coitus for a defined period
and is expected to become the largest country that facilitates conception.
in population size, surpassing China around c. Coitus interruptus is the oldest family
2022. To overcome the problem of population planning method. The male partner
explosion, birth control is the only available withdraws his penis before ejaculation,
solution. People should be motivated to have thereby preventing deposition of semen
smaller families by using various contraceptive into the vagina.
devices. Advertisements by the Government
d. Lactational amenorrhoea Menstrual
in the media as well as posters/bills, etc., with
cycles resume as early as 6 to 8 weeks from
a slogan Naam iruvar namakku iruvar (we two,
parturition. However, the reappearance
ours two) and Naam iruvar namakku oruvar (we
of normal ovarian cycles may be
two, ours one) have also motivated to control
delayed for six months during breast-
population growth in Tamilnadu. Statutory
feeding.  This delay in ovarian cycles is
rising of marriageable age of the female to 18
called lactational amenorrhoea. It serves
years and that of males to 21 years and incentives
as a natural, but an unreliable form of
given to couples with small families are the other
birth control. Suckling by the baby during
measures taken to control population growth in
breast-feeding stimulates the pituitary
our country.
to secrete increased prolactin hormone
Birth control methods in order to increase milk production.
The voluntary use of contraceptive This high prolactin concentration in the
procedures to prevent fertilization or prevent mother’s blood may prevent menstrual
implantation of a fertilized egg in the cycle by suppressing the release of GnRH
uterus is termed as birth control. An ideal (Gonadotropin Releasing Hormone)
contraceptive should be user friendly, easily from hypothalamus and gonadotropin
available, with least side effects and should not secretion from the pituitary.
interfere with sexual drive. The contraceptive 2. Barrier methods In these methods, the
methods are of two types – temporary and ovum and sperm are prevented from meeting
permanent. Natural, chemical, mechanical so that fertilization does not occur.
and hormonal barrier methods are the
a.  Chemical barrier Foaming tablets,
temporary birth control methods.
melting suppositories, jellies and creams
1. Natural method is used to prevent meeting are used as chemical agents that inactivate
of sperm with ovum. i.e., Rhythm method the sperms in the vagina.
(safe period), coitus interruptus, continuous b. Mechanical barrier Condoms  are a
abstinence and lactational amenorrhoea. thin sheath used to cover the penis in
Reproductive Health 36

TN_GOVT_XII_ Bio Zoology_chapter3.indd 36 25-02-2019 19:12:21


www.asiriyar.net

male whereas in female it is used to cover such as Cu T-380 A, Nova T, Cu 7, Cu T 380
vagina and cervix just before coitus so as to Ag, Multiload 375, etc. release free copper
prevent the entry of ejaculated semen into and copper salts into the uterus and suppress
the female reproductive tract. This can sperm motility. They can remain in the uterus
prevent conception. Condoms should be for five to ten years.
discarded after a single use. Condom also
Hormone-releasing IUDs such as
safeguards the user from AIDS and STDs.
Progestasert and   LNG – 20 are often called
Condoms are made of polyurethane, latex
as intrauterine systems (IUS). They increase
and lambskin.
the viscosity of the cervical mucus and thereby
Diaphragms, cervical caps and vaults prevent sperms from entering the cervix.
are made of rubber and are inserted into
the female reproductive tract to cover the Non-medicated IUDs are made of plastic
cervix before coitus in order to prevent or stainless steel. Lippes loop is a double
the sperms from entering the uterus. S-shaped plastic device.
c. Hormonal barrier
3. Permanent birth control methods are
It prevents the ovaries from releasing the adopted by the individuals who do not want
ova and thickens the cervical fluid which to have any more children.
keeps the sperm away from ovum.
Surgical sterilisation methods are the
Oral contraceptives — Pills are used permanent contraception methods advised for
to prevent ovulation by inhibiting the male and female partners to prevent any more
secretion of FSH and LH hormones. A pregnancies. It blocks the transport of the
combined pill is the most commonly gametes and prevents conception. Tubectomy
used birth control pill. It contains is the surgical sterilisation in women. In this
synthetic progesterone and estrogen procedure, a small portion of both fallopian
hormones. Saheli, contraceptive pill tubes are cut and tied up through a small
by Central Drug Research Institute incision in the abdomen or through vagina.
(CDRI) in Lucknow, India contains This prevents fertilization as well as the entry
a non-steroidal preparation called of the egg into the uterus. Vasectomy is the
centchroman. surgical procedure for male sterilisation. In
d. Intrauterine Devices (IUDs) this procedure, both vas deferens are cut and
Intrauterine devices are inserted by tied through a small incision on the scrotum
medical experts in the uterus through to prevent the entry of sperm into the urethra.
the vagina. These devices are available as Vasectomy prevents sperm from heading off
copper releasing IUDs, hormone releasing to penis as the discharge has no sperms in it. ​
IUDs  and non-medicated IUDs. IUDs
increase phagocytosis of sperm within the 3.5. Medical termination of
uterus. IUDs are the ideal contraceptives pregnancy (MTP)
for females who want to delay pregnancy. Medical method of abortion is a
It is one of the popular methods of voluntary or intentional termination of
contraception in India and has a success pregnancy in a non-surgical or non-invasive
rate of 95 to 99%. way. Early medical termination is extremely
Copper releasing IUDs differ from each safe upto 12 weeks (the first trimester) of
other by the amount of copper. Copper IUDs

37 Reproductive Health

TN_GOVT_XII_ Bio Zoology_chapter3.indd 37 25-02-2019 19:12:21


www.asiriyar.net

Approximately half of unintended pregnancies are due to contraceptive


failure, largely owing to inconsistent or incorrect use of contraceptive
methods. The effectiveness of long-acting reversible contraception
(intrauterine devices and contraceptive implants) is superior to that of contraceptive pills,
patch, or ring and is not altered in adolescents and young women. Educating young women
about the usage of intrauterine devices and contraceptive implants would dramatically
reduce the number of unintended pregnancies among women seeking family planning.

pregnancy and generally has no impact on a of infusion needles, surgical instruments,


women’s fertility. Abortion during the second etc with infected people, blood transfusion
trimester is more risky as the foetus becomes or from infected mother to baby. People in
intimately associated with the maternal the age of 15 to 24 years are prone to these
tissue. Government of India legalized MTP infections. The bacterial STI are gonorrhoea,
in 1971 for medical necessity and social syphilis, chancroid, chlamydiasis and
consequences with certain restrictions like sex lymphogranuloma venereum. The viral
discrimination and illegal female foeticides STI are genital herpes, genital warts,
to avoid its misuse. MTP performed illegally Hepatitis-B  and  AIDS. Trichomoniasis is a
by unqualified quacks is unsafe and could be protozoan STI, and candidiasis is a fungal STI.
fatal. MTP of the first conception may have STI caused by bacteria, fungi and protozoa
serious psychological consequences or parasites, can be treated with antibiotics
or other medicines, whereas STI caused by
3.6. Sexually transmitted virus cannot be treated but the symptoms
diseases (STD) can be controlled by antiviral medications.
Sexually transmitted Latex condoms usage greatly reduces the risk,
diseases (STD) or Venereal but does not completely eliminate the risk of
diseases (VD) or Reproductive transmission of STI.
tract infections (RTI) are
called as Sexually transmitted Prevention of STDs
infections (STI). Normally STI are transmitted a. Avoid sex with unknown partner/
from person to person during intimate multiple partners
sexual contact with an infected partner. b. use condoms
Infections like  Hepatitis-B  and  HIV  are
c. In case of doubt, consult a doctor for
transmitted sexually as well as by sharing
diagnosis and get complete treatment.

According to World Health


Organization (WHO), 2017 TNHSP (Tamilnadu health
more than one million people systems project), a unit
of the Health and family
globally acquires a sexually
welfare department of the
transmitted infection every day. India has the Government of Tamilnadu
third largest HIV epidemic in the world, with does free screening for cervical and
2.1 million people living with HIV. breast cancer.

Reproductive Health 38

TN_GOVT_XII_ Bio Zoology_chapter3.indd 38 25-02-2019 19:12:21


www.asiriyar.net

Table 3.1. STD and their symptoms


Name of the Incubation
Causative agent Symptom
Disease period
Bacterial STI
Affects the urethra, rectum and throat
and in females the cervix also get
Gonorrhoea Neisseria gonorrhoeae affected. 2 to 5 days
Pain and pus discharge in the genital tract
and burning sensation during urination.
Primary stage
Formation of painless ulcer on the
external genitalia.
Secondary stage
Skin lesions, rashes, swollen joints and
fever and hair loss.
Syphilis Treponema palladium 10 to 90 days
Tertiary stage
Appearance of chronic ulcers on nose,
lower legs and palate. Loss of movement,
mental disorder, visual impairment, heart
problems, gummas (soft non-cancerous
growths) etc
Trachoma , affects the cells of the
Chlamydiasis Chlamydia trachomatis columnar epithelium in the urinogenital
tract, respiratory tract and conjunctiva. 2 to 3 weeks
Cutaneous or mucosal genital damage, or upto 6
Lymphogranuloma urithritis and endocervicitis. weeks
Chlamydia trachomatis
venereum Locally harmful ulcerations and genital
elephantiasis.
Viral STI
Sores in and around the vulva, vagina,
urethra in female or sores on or around
the penis in male. 2- 21 days
Genital herpes Herpes simplex virus (average 6
Pain during urination, bleeding
days)
between periods.
Swelling in the groin nodes.
Hard outgrowths (Tumour) on
Human papilloma
Genital warts the external genitalia, cervix and 1-8 months
virus (HPV)
perianal region.
Fatigue, jaundice, fever, rash and
stomach pain.
Hepatitis-B Hepatitis B virus (HBV) 30-80 days
Liver cirrhosis and liver failure occur in
the later stage.

Human Enlarged lymph nodes, prolonged fever, 2 to 6 weeks


AIDS immunodeficiency prolonged diarrhoea, weight reduction, even more
virus (HIV) night sweating. than 10 years.

39 Reproductive Health

TN_GOVT_XII_ Bio Zoology_chapter3.indd 39 25-02-2019 19:12:21


www.asiriyar.net

Name of the Incubation


Causative agent Symptom
Disease period
Fungal STI
Attacks mouth, throat, intestinal tract
and vagina.
Candidiasis Candida albicans Vaginal itching or soreness, abnormal _
vaginal discharge and pain during
urination.
Protozoan STI
Vaginitis , greenish yellow vaginal
discharge, itching and burning
Trichomoniasis Trichomonas vaginalis 4-28 days
sensation, urethritis, epididymitis and
prostatitis

Cervical cancer 3.7. Infertility


Cervical cancer is caused by a sexually Inability to conceive or produce children
transmitted virus called Human Papilloma even after unprotected sexual cohabitation
virus (HPV). HPV may cause abnormal is called infertility. That is, the inability of a
growth of cervical cells or cervical dysplasia. man to produce sufficient numbers or quality
The most common symptoms and signs of of sperm to impregnate a woman or inability
cervical cancer are pelvic pain, increased vaginal of a woman to become pregnant or maintain
discharge and abnormal vaginal bleeding. The a pregnancy.
risk factors for cervical cancer include The causes for infertility are tumours
1. Having multiple sexual partners formed in the pituitary or reproductive organs,
2. Prolonged use of contraceptive pills inherited mutations of genes responsible for the
biosynthesis of sex hormones, malformation
Cervical cancer can be diagnosed by a
of the cervix or fallopian tubes and inadequate
Papanicolaou smear (PAP smear) combined with
nutrition before adulthood. Long-term stress
an HPV test. X-Ray, CT scan, MRI and a PET scan
damages many aspects of health especially the
may also be used to determine the stage of cancer.
menstrual cycle. Ingestion of toxins (heavy
The treatment options for cervical cancer include
metal cadmium), heavy use of alcohol, tobacco
radiation therapy, surgery and chemotherapy.
and marijuana, injuries to the gonads and aging
Modern screening techniques can detect also cause infertility.
precancerous changes in the cervix. Therefore
screening is recommended for women above Other causes of infertility
30 years once in a year. Cervical cancer can • Pelvic inflammatory disease (PID), uterine
be prevented with vaccination. Primary fibroids and endometriosis are the most
prevention begins with HPV vaccination of common causes of infertility in women.
girls aged 9 – 13 years, before they become
• Low body fat or anorexia in women. i.e. a
sexually active. Modification in lifestyle can
psychiatric eating disorder characterised
also help in preventing cervical cancer. Healthy
by the fear of gaining weight.
diet, avoiding tobacco usage, preventing early
• Undescended testes and swollen veins
marriages, practicing monogamy and regular
(varicocoele) in scrotum.
exercise minimize the risk of cervical cancer.
Reproductive Health 40

TN_GOVT_XII_ Bio Zoology_chapter3.indd 40 25-02-2019 19:12:21


www.asiriyar.net

• Tight clothing in men may raise the laboratory. One or more fertilized eggs may be
temperature in the scrotum and affect transferred into the woman’s uterus, where they
sperm production. may implant in the uterine lining and develop.
• Under developed ovaries or testes. Excess embryos may be cryopreserved (frozen)
• Female may develop antibodies against for future use. Initially, IVF was used to treat
her partner's sperm. women with blocked, damaged, or absent
fallopian tubes. Today, IVF is used to treat
• Males may develop an autoimmune
many causes of infertility. The basic steps in an
response to their own sperm.
IVF treatment cycle are ovarian stimulation,
egg retrieval, fertilization, embryo culture, and
All women are born with ovaries, but some embryo transfer.
do not have functional uterus. This condition
is called Mayer-Rokitansky syndrome. Egg retrieval is done by minor surgery
under general anesthesia, using ultrasound
guide after 34 to 37 hours of hCG (human
3.8. Assisted reproductive chorionic gonadotropin) injection. The eggs are
technology (ART) prepared and stripped from the surrounding
A collection of procedures, cells. At the same time, sperm preparation is
which includes the handling of done using a special media. After preparing
gametes and/or embryos outside the sperms, the eggs are brought together.
the body to achieve a pregnancy, is 10,000-1,00,000 motile sperms are needed for
known as Assisted Reproductive each egg. Then the zygote is allowed to divide to
Technology. It increases the form 8 celled blastomere and then transferred
chance of pregnancy in infertile couples. ART into the uterus for a successful pregnancy.
includes intra-uterine insemination (IUI), in The transfer of an embryo with more than
vitro fertilization, (IVF) Embryo transfer (ET), 8 blastomeres stage into uterus is called
Zygote intra-fallopian transfer (ZIFT), Gamete Embryo transfer technique.
intrafallopian transfer (GIFT), Intra-cytoplasmic
sperm injection (ICSI), Preimplantation Cryopreservation (or
genetic diagnosis, oocyte and sperm donation freezing) of embryos is
and surrogacy. often used when there
are more embryos than
Intra-uterine insemination (IUI) needed for a single IVF
This is a procedure to treat infertile men
transfer. Embryo cryopreservation can
with low sperm count. The semen is collected
provide an additional opportunity for
either from the husband or from a healthy
pregnancy, through a Frozen embryo
donor and is introduced into the uterus through
transfer (FET), without undergoing
the vagina by a catheter after stimulating the
another ovarian stimulation and retrieval.
ovaries to produce more ova. The sperms swim
towards the fallopian tubes to fertilize the egg,
resulting in normal pregnancy.
Zygote intra-fallopian transfer (ZIFT)
As in IVF, the zygote upto 8 blastomere
In vitro fertilization (IVF) or stage is transferred to the fallopian tube by
Test tube baby laparoscopy. The zygote continues its natural
In this technique, sperm and eggs divisions and migrates towards the uterus
are allowed to unite outside the body in a where it gets implanted.

41 Reproductive Health

TN_GOVT_XII_ Bio Zoology_chapter3.indd 41 25-02-2019 19:12:21


www.asiriyar.net

Intra uterine transfer (IUT) 3.9. Detection of foetal disorders


Embryo with more than 8 blastomeres during early pregnancy
is inserted into uterus to complete its further
development. Ultrasound scanning
Ultrasound has no known risks other
Gamete intra-fallopian transfer (GIFT) than mild discomfort due to pressure from
Transfer of an ovum collected from a the transducer on the abdomen or vagina.
donor into the fallopian tube. In this the eggs No radiation is used during this procedure.
are collected from the ovaries and placed Ultrasonography is usually performed in the
with the sperms in one of the fallopian tubes. first trimester for dating, determination of
The zygote travels toward the uterus and gets the number of foetuses, and for assessment
implanted in the inner lining of the uterus. of early pregnancy complications.

Intra-cytoplasmic sperm injection (ICSI) There are several types of ultrasound


In this method only one sperm is injected imaging techniques. As the most common
into the focal point of the egg to fertilize. The type, the 2-D ultrasound provides a flat
sperm is carefully injected into the cytoplasm picture of one aspect of the baby. The 3-D
of the egg. Fertilization occurs in 75 - 85% image allows the health care provider to see
of eggs injected with the sperms. The zygote the width, height and depth of the images,
is allowed to divide to form an 8 celled which can be helpful during the diagnosis.
blastomere and then transferred to the uterus The latest technology is 4-D ultrasound,
to develop a protective pregnancy. which allows the health care provider to
Surrogacy visualize the unborn baby moving in real
Surrogacy is a method of assisted time with a three-dimensional image.
reproduction or agreement whereby a woman
agrees to carry a pregnancy for another person, Amniocentesis
who will become the newborn child's parent Amniocentesis involves taking a small
after birth. Through in vitro fertilization (IVF), sample of the amniotic fluid that surrounds
embryos are created in a lab and are transferred the foetus to diagnose for chromosomal
into the surrogate mother's uterus. abnormalities (Fig. 3.1).

Male infertility prevention


Azoospermia is defined as the absence of Ultrasound
spermatozoa in the ejaculate semen on at least Transducer

two occasions and is observed approximately Amniotic Fluid


in 1% of the population.
Micro-testicular sperm extraction (TESE) Placenta
Microsurgical sperm retrieval from the testicle
Foetus
involves a small midline incision in the scrotum,
Uterus
through which one or both testicles can be seen.
Under the microscope, the seminiferous tubules
are dilated and small amount of testicular tissue
in areas of active sperm production are removed
and improved for sperm yield compared to
traditional biopsy techniques. Fig. 3.1 Amniocentesis

Reproductive Health 42

TN_GOVT_XII_ Bio Zoology_chapter3.indd 42 25-02-2019 19:12:22


www.asiriyar.net

Amniocentesis is generally performed A hand-held doppler device is often used


in a pregnant woman between the 15th and during prenatal visits to count the foetal heart
20th weeks of pregnancy by inserting a long, rate. During labour, continuous electronic
thin needle through the abdomen into the foetal monitoring is often used.
amniotic sac to withdraw a small sample of
amniotic fluid. The amniotic fluid contains
• Vitamin E is known as anti-sterility
cells shed from the foetus.
vitamin as it helps in the normal
functioning of reproductive structures.
Chorionic villus sampling (CVS)
CVS is a prenatal test that involves taking • Sex hormones were discovered by
a sample of the placental tissue to test for Adolf Butenandt.
chromosomal abnormalities.
• 11th July is observed as World
Foetoscope Population Day.
Foetoscope is used to monitor the foetal
• 1st December is observed as World
heart rate and other functions during late
AIDS Day.
pregnancy and labour. The average foetal heart
rate is between 120 and 160 beats per minute. • NACO (National AIDS Control
An abnormal foetal heart rate or pattern may Organisation) was established in 1992.
mean that the foetus is not getting enough
• Syphilis and gonorrhoea are commonly
oxygen and it indicates other problems.
called as international diseases.

BREAST SELF EXAMINATION AND


EARLY DIAGNOSIS OF CANCER
1. Breast is divided Summary
into 4 quadrants Reproductive health refers to a total well-
and the center 1
5
2 being in all aspects of reproduction. Providing
(Nipple) which medical facilities and care to the problems like
is the 5th menstrual irregularities, pregnancy related
quadrant. 3 4
aspects, medical termination of pregnancy, STI,
2. Each quadrant birth control, infertility, post natal child and
of the breast is
maternal management are the important aspect
felt for lumps using the palm of the
opposite hand. of the Reproductive and Child Health Care
programmes.
3. The examination is done in both
lying down and standing positions, An overall improvement in reproductive
monthly once after the 1st week of health has taken place in our country as indicated
menstrual cycle. by reduced maternal and infant mortality rates,
This way if there are lumps or any assistance to infertile couples, etc. Improved health
deviation of the nipple to one side or any facilities and better living conditions promote an
blood discharge from the nipple we can explosive growth of population. Such a growth
identify cancer at an early stage. necessitated intense propagation of contraceptive
Mammograms are done for women above methods. Various contraceptive options are
the age of 40 years and for young girls
available now such as natural, traditional, barrier,
and women below 40 years. Ultrasound
of the breast aids in early diagnosis. IUDs, pills, injectables, implants and surgical
methods. Though contraceptives are not regular

43 Reproductive Health

TN_GOVT_XII_ Bio Zoology_chapter3.indd 43 25-02-2019 19:12:22


www.asiriyar.net

requirements for reproductive health, one is (d) Syphilis, trichomoniasis and


adviced to use them to avoid pregnancy or to pediculosis
delay or space pregnancy. 3. Identify the correct statements from
Diseases or infections transmitted through the following
coitus are called Sexually transmitted infections
(a)Chlamydiasis is a viral disease.
(STIs). Pelvic inflammatory diseases (PIDs), still
birth, infertility are some of the complications (b) Gonorrhoea is caused by a spirochaete
of STDs. Early detection facilitates better cure of bacterium, Treponema palladium.
these diseases. Avoiding coitus with unknown/ (c) The incubation period for syphilis is
multiple partners, use of condoms during coitus is 2 to 14 days in males and 7 to 21
are some of the simple precautions to avoid days in females.
contracting STIs. (d) B oth syphilis and gonorrhoea are
Inability to conceive or produce children even easily cured with antibiotics.
after unprotected sexual cohabitation is called 4. A contraceptive pill prevents ovulation by
infertility. Various methods are now available to
(a) blocking fallopian tube
help such couples. In vitro fertilization followed by
transfer of embryo into the female genital tract is (b) inhibiting release of FSH and LH
one such method. (c) stimulating release of FSH and LH
(d) causing immediate degeneration of
Evaluation released ovum.
1. Which of the following 5. The approach which does not give the
is correct regarding defined action of contraceptive is
HIV, hepatitis B, (a) Hormonal Prevents entry of sperms,
gonorrhoea and contraceptive prevent ovulation and
fertilization
trichomoniasis?
(b) Vasectomy Prevents spermatogenesis
(a) Gonorrhoea is a STD whereas
others are not. (c) Barrier Prevents fertilization
method
(b) Trichomoniasis is a viral disease (d) Intra uterine Increases phagocytosis of
whereas others are bacterial. device sperms, suppresses sperm
motility and fertilizing capacity
(c) HIV is a pathogen whereas others of sperms
are diseases.
6. Read the given statements and select the
(d) Hepatitis B is eradicated completely correct option.
whereas others are not. Statement 1: Diaphragms, cervical caps
2. Which one of the following groups and vaults are made of rubber and are
includes sexually transmitted diseases inserted into the female reproductive
caused by bacteria only? tract to cover the cervix before coitus.
(a) Syphilis, gonorrhoea and candidiasis Statement 2: They are chemical barriers
(b) Syphilis, chlamydiasis and of conception and are reusable.
gonorrhoea (a) B oth statements 1 and 2 are correct
(c) Syphilis, gonorrhoea and and statement 2 is the correct
trichomoniasis explanation of statement 1.

Reproductive Health 44

TN_GOVT_XII_ Bio Zoology_chapter3.indd 44 25-02-2019 19:12:22


www.asiriyar.net

(b) B oth statements 1 and 2 are correct 11. Correct the following statements
but statement 2 is not the correct a) Transfer of an ovum collected from
explanation of statement 1. donor into the fallopian tube is called
(c) Statement 1 is correct but statement ZIFT.
2 is incorrect.
b) Transfering of an embryo with more
(d) Both statements 1 and 2 are incorrect. than 8 blastomeres into uterus is
7. Match column I with column II and select the called GIFT.
correct option from the codes given below.
c) Multiload 375 is a hormone releasing
Column I Column II IUD.
A. Copper releasing IUD (i) LNG-20
12. Which method do you suggest the couple
B. Hormone releasing (ii) Lippes loop IUD to have a baby, if the male partner fails to
C. Non medicated IUD (iii) Saheli inseminate the female or due to very low
D. Mini pills (iv) Multiload-375 sperm count in the ejaculate?
(a) A-(iv), B-(ii), C-(i), D-(iii) 13. Expand the following
(b) A-(iv), B-(i), C-(iii), D-(ii) a) ZIFT b) ICSI
(c) A-(i), B-(iv), C-(ii), D-(iii) 14. What are the strategies to be
(d) A-(iv), B-(i), C-(ii), D-(iii) implemented in India to attain total
reproductive health?
8. Select the incorrect action of hormonal
contraceptive pills from the following 15. Differentiate foeticide and infanticide.

(a) Inhibition of spermatogenesis. 16. Describe the major STDs and their
symptoms.
(b) Inhibition of ovulation.
17. How are STDs transmitted?
(c) Changes in cervical mucus impairing
its ability to allow passage and 18. Write the preventive measures of STDs.
transport of sperms. 19. The procedure of GIFT involves the
(d) Alteration in uterine endometrium to transfer of female gametes into the
make it unsuitable for implantation. fallopain tube, can gametes be transferred
to the uterus to achieve the same result?
9. What is amniocentesis? Why a statutory Explain.
ban is imposed on this technique?
20. Amnicentesis, the foetal sex determination
10. Select the correct term from the bracket test, is banned in our country, Is it
and complete the given branching tree necessary? comment.
Periodic abstinence
Natural methods B
Coitus interruptus 21. Open Book Assessment
A Condoms, vaults,
Caps etc ‘Healthy reproduction, legally checked
Birth control
methods
Oral contraceptives Pills birth control measures and proper family
Vasectomy planning programmes are essential for
Surgical methods
C
the survival of mankind’ Justify.
IUDs D

(Barriers, Lactational amenorrhoea, CuT,


Tubectomy)

45 Reproductive Health

TN_GOVT_XII_ Bio Zoology_chapter3.indd 45 25-02-2019 19:12:22


Reproductive Health
Concept Map

46

TN_GOVT_XII_ Bio Zoology_chapter3.indd 46


%,57+&21752/0(7+2'6

7HPSRUDU\ 3HUPDQHQW
PHWKRG 0HWKRG

1DWXUDO %DUULHU ,QWUDXWHULQH


PHWKRG PHWKRG 'HYLFHV 6WHULOLVDWLRQ
,PSODQW (VVXUH

9DJLQDO
&KHPLFDO 0HFKDQLFDO 2UDO +RUPRQDO 5LQJ
3HULRGLF EDUULHU EDUULHU FRQWUDFHSWLYHV EDUULHU
DEVWLQHQFH 7XEHFWRP\
UK\WKP 1RQ
PHWKRG 6XEFXWDQHRXV PHGLFDWHG
&RQGRP
)RDPLQJWDEOHWV ,PSODQWV ,8'V
PHOWLQJVXSSRVLWRULHV 0LQLSLOOV
&RQWLQXRXV MHOOLHVDQGFUHDPV 6DKHOL FHQWFKURPDQ
9DVHFWRP\
DEVWLQHQFH 3URJHVWDVHUW +RUPRQDOUHOHDVLQJ
'LDSKUDJP /1* ,8'V

&RLWXV
LQWHUUXSWXV &X7$
1RYD7&X &RSSHU
&X7$J UHOHDVLQJ,8'V
/DFWDWLRQDO 0XOWLORDG
$PHQRUUKRHD

25-02-2019 19:12:23
www.asiriyar.net
www.asiriyar.net

4
UNIT - II

Principles of
Inheritance and
Variation
CHAPTER

Drosophila are ideal for the study of genetics


Chapter outline and development
4.1 Multiple alleles
4.2 Human blood groups
4.3 Genetic control of Rh factor
4.4 Sex determination in human, insects and birds
G enetics is a branch of biology that deals
with the study of heredity and variations. It
describes how characteristics and features pass
4.5 Sex linked inheritance on from the parents to their offsprings in each
4.6. Karyotyping successive generation. The unit of heredity is
4.7. Pedigree analysis known as the gene. Gene is the inherited factor
4.8. Mendelian disorders that determines the biological character of an
4.9. Chromosomal abnormalities organism. A variation is the degree by which
the progeny differs from their parents.
In this chapter, we are going to learn about
multiple alleles with reference to the human
blood groups, sex determination in man, insects
Learning objectives and birds, sex linked inherited traits, genetic
➢ Learns the inheritance of multiple alleles disorders and extra chromosomal inheritance.
with reference to human blood groups. The betterment of human race can be achieved
➢ Understands the mechanism of sex by methods like eugenics, euthenics and
determination in human euphenics.
beings, insects and birds. 4.1 Multiple alleles
➢ Learns about sex linked (X The genetic segregations in Mendelian
and Y) inherited diseases in inheritance reveal that all genes have two
human beings. alternative forms – dominant and recessive
➢ Understands the Mendelian alleles e.g. tall versus dwarf (T and t). The
disorders and diseases associated with former is the normal allele or wild allele and
chromosomal abnormalities. the latter the mutant allele. A gene can mutate
➢ Gains knowledge on extra chromosomal several times producing several alternative
inheritance. forms. When three or more alleles of a gene
➢ Realises the significance of the applications of that control a particular trait occupy the same
genetics in the improvement of human race. locus on the homologous chromosome of an
organism, they are called multiple alleles and
their inheritance is called multiple allelism.
47

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 47 25-02-2019 19:13:07


www.asiriyar.net

4.2 Human Blood Groups determines B antigen and IO allele specifies


Multiple allelism occurs in humans, no antigen. Individuals who possess these
particularly in the inheritance of different types antigens in their fluids such as the saliva
of blood groups. The blood group inheritance are called secretors.
in human can be understood by learning about Each allele (IA and IB) produces a
antigens and antibodies. The composition of transferase enzyme. IA allele produces
blood, different types of blood groups (ABO) the N-acetyl galactose transferase and can add
blood antigens and antibodies were discussed N-acetyl galactosamine (NAG) and IB allele
in chapter 7 of class XI. encodes for the enzyme galactose transferase
that adds galactose to the precursor (i.e.
4.2.1 ABO blood types H substances) In the case of IO/IO allele no
Multiple allele inheritance of ABO blood terminal transferase enzyme is produced and
groups therefore called “null” allele and hence cannot
add NAG or galactose to the precursor.
Blood differs chemically from person
to person. When two different incompatible From the phenotypic combinations it is
blood types are mixed, agglutination evident that the alleles IA and IB are dominant
(clumping together) of erythrocytes to IO, but co-dominant to each other (IA=IB).
(RBC) occurs. The basis of these chemical Their dominance hierarchy can be given
differences is due to the presence of antigens as (IA=IB> IO). A child receives one of three
(surface antigens) on the membrane of alleles from each parent, giving rise to six
RBC and epithelial cells. Karl Landsteiner possible genotypes and four possible blood
discovered two kinds of antigens called types (phenotypes). The genotypes are IAIA, IA
antigen ‘A’ and antigen ‘B’ on the surface IO, IBIB, IB IO, IAIB and IO IO.
of RBC’s of human blood. Based on the
presence or absence of these antigens three • Antigens similar
kinds of blood groups, type ‘A’, type ‘B’, and to those found among
type ‘O’ (universal donor)were recognized. human beings have been
The fourth and the rarest blood group ‘AB’ recognized in the blood
(universal recipient) was discovered in 1902 of other organisms.
by two of Landsteiner’s students Von De A-type antigens have been found in
Castelle and Sturli. chimpanzees and in gibbons, A, B and
Bernstein in 1925 discovered that the AB antigen in orangutans.
inheritance of different blood groups in
• New world monkeys (Platyrrhina) and
human beings is determined by a number
lemurs have a substance similar but not
of multiple allelic series. The three
identical with B antigen in humans.
autosomal alleles located on chromosome 9
are concerned with the determination of • Three blood groups have been
blood group in any person. The gene distinguished in cats with a genetic
controlling blood type has been labeled as system similar to those in humans.
‘L’ (after the name of the discoverer, • The secretors (antigens found in the
Landsteiner) or I (from isoagglutination). body fluids) can be detected in tears,
The I gene exists in three allelic forms, IA, I B saliva, urine, semen, gastric juice and
and IO. IA specifies A antigen. I B allele in the milk of animals.

Principles Of Inheritance And Variation 48

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 48 25-02-2019 19:13:07


www.asiriyar.net

Table 4.1 Genetic basis of the human ABO 4.3 Genetic control of Rh factor
blood groups
Antigens Antibodies
Fisher and Race hypothesis:
ABO blood Rh factor involves three different pairs of
present on present
Genotype group
red blood in blood alleles located on three different closely linked
phenotype
cell plasma loci on the chromosome pair. This system is
more commonly in use today, and uses the 'Cde'
IAIA Type A A Anti -B nomenclature.

IAIo Type A A Anti -B C or c C or c

IBIB Type B B Anti -A


D or d D or d
IBIo Type B B Anti -A

Neither E or e E or e
IAIB Type AB A and B Anti
-A nor
Anti-B Fig. 4.1 Fischer and Race hypothesis – Rh
Blood Type - Homologous Chromosome pair
Anti -A (showing 3 loci and 2 alleles per locus)
Neither
IoIo Type O and anti In the above Fig. 4.1, three pairs of Rh
A nor B
-B alleles (Cc, Dd and Ee) occur at 3 different
loci on homologous chromosome pair-1. The
Rhesus or Rh – Factor possible genotypes will be one C or c, one D or
The Rh factor or Rh antigen is found on d, one E or e from each chromosome. For e.g.
the surface of erythrocytes. It was discovered CDE/cde; CdE/cDe; cde/cde; CDe/CdE etc.,
in 1940 by Karl Landsteiner and Alexander All genotypes carrying a dominant ‘D’ allele
Wiener in the blood of rhesus monkey, will produce Rh+positive phenotype and double
Macaca rhesus and later in human beings. recessive genotype ‘dd’ will give rise to Rh-
The term ‘Rh factor’ refers to “immunogenic negative phenotype.
D antigen of the Rh blood group system. An
individual having D antigen are Rh D positive
Wiener Hypothesis
Wiener proposed the existence of eight
(Rh+) and those without D antigen are Rh D
alleles (R1, R2, R0, Rz, r, r1, r11, r y) at a single Rh
negative (Rh-)”. Rhesus factor in the blood
locus. All genotypes carrying a dominant ‘R
is inherited as a dominant trait. Naturally
allele’ (R1, R2 ,R0 ,Rz) will produce Rh+positive
occurring Anti D antibodies are absent in the
phenotype and double recessive genotypes
plasma of any normal individual. However if
(rr, rr1, rr11, rr y) will give rise to Rh-negative
an Rh- (Rh negative) person is exposed to Rh+
phenotype.
(Rh positive) blood cells (erythrocytes) for
the first time, anti D antibodies are formed
4.3.1 Incompatibility of Rh – Factor –
in the blood of that individual. On the other
Erythroblastosis foetalis
hand, when an Rh positive person receives Rh
Rh incompatability has great significance
negative blood no effect is seen.
in child birth. If a woman is Rh negative and

49 Principles Of Inheritance And Variation

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 49 25-02-2019 19:13:07


www.asiriyar.net

the man is Rh positive, the foetus may be chromosomes determine the sex of the
Rh positive having inherited the factor from individual in dioecious or unisexual
its father. The Rh negative mother becomes organisms. The chromosomes other than the
sensitized by carrying Rh positive foetus within sex chromosomes of an individual are called
her body. Due to damage of blood vessels, autosomes. Sex chromosomes may be similar
during child birth, the mother’s immune (homomorphic) in one sex and dissimilar
system recognizes the Rh antigens and gets (heteromorphic) in the other. Individuals
sensitized. The sensitized mother produces Rh having homomorphic sex chromosomes
antibodies. The antibodies are IgG type which produce only one type of gametes
are small and can cross placenta and enter the (homogametic) whereas heteromorphic
foetal circulation. By the time the mother gets individuals produce two types of gametes
sensitized and produce anti ‘D’ antibodies, the (heterogametic).
child is delivered.
Usually no effects are associated with
Y CHROMOSOME
exposure of the mother to Rh positive antigen
The human Y chromosome
during the first child birth, subsequent Rh
is only 60 Mb in size with
positive children carried by the same mother,
60 functional genes whereas
may be exposed to antibodies produced by
X chromosomes are 165 Mb in size with
the mother against Rh antigen, which are
about 1,000 genes.
carried across the placenta into the foetal
blood circulation. This causes haemolysis of
foetal RBCs resulting in haemolytic jaundice Chromosomal basis of
and anaemia. This condition is known as sex determination
Erythoblastosis foetalis or Haemolytic
disease of the new born (HDN).
Heterogametic Sex
Determination:
Prevention of Eryhroblastosis foetalis In heterogametic sex
If the mother is Rh negative and foetus determination one of the sexes produces
is Rh positive, anti D antibodies should be similar gametes and the other sex produces
administered to the mother at 28th and 34th dissimilar gametes. The sex of the offspring is
week of gestation as a prophylactic measure. determined at the time of fertilization.
If the Rh negative mother delivers Rh
positive child then anti D antibodies should
Heterogametic Males
In this method of sex determination the
be administered to the mother soon after
males are heterogametic producing dissimilar
delivery. This develops passive immunity and
gametes while females are homogametic
prevents the formation of anti D antibodies in
producing similar gametes. It is of two kinds
the mothers blood by destroying the Rh foetal
XX-XO type and XX-XY type.
RBC before the mother’s immune system is
sensitized. This has to be done whenever the
XX-XO Type
woman attains pregnancy.
This method of sex determination is seen
4.4 Sex Determination in bugs, some insects such as cockroaches
Sex determination is the method by and grasshoppers. The female with two X
which the distinction between male and chromosomes are homogametic (XX) while
female is established in a species. Sex the males with only one X chromosome

Principles Of Inheritance And Variation 50

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 50 25-02-2019 19:13:07


www.asiriyar.net

are heterogametic (XO). The presence of Heterogametic Females


an unpaired X chromosomes determines In this method of sex determination,
the male sex. The males with unpaired ‘X’ the homogametic male possesses two ‘X’
chromosome produce two types of sperms, chromosomes as in certain insects and
one half with X chromosome and other certain vertebrates like fishes, reptiles and
half without X chromosome. The sex of birds producing a single type of gamete; while
the offspring depends upon the sperm that females produce dissimilar gametes. The
fertilizes the egg (Fig. 4.2). female sex consists of a single ‘X’ chromosome
or one ‘X’ and one ‘Y’ chromosome. Thus
the females are heterogametic and produce
P1 AAXX AAXO two types of eggs. To avoid confusion
Gametes AX AX AO with the XX-XO and XX-XY types of sex
determination, the alphabets ‘Z’ and ‘W’ are
used here instead of X and Y respectively.
F1 Generation AAXX AAXO Heterogametic females are of two types,
ZO-ZZ type and ZW-ZZ type.
Fig. 4.2 XX-XO Type of sex determination
ZO-ZZ Type
This method of sex determination is seen
XX-XY type (Lygaeus Type) in certain moths, butterflies and domestic
This method of sex determination is chickens. In this type, the female possesses
seen in human beings and in Drosophila. single ‘Z’ chromosome in its body cells and
The females are homogametic with is heterogametic (ZO) producing two kinds
XX chromosome, while the males are of eggs some with ‘Z’ chromosome and
heterogametic with X and Y chromosome. some without ‘Z’ chromosome, while the
Homogametic females produce only one kind male possesses two ‘Z’ chromosomes and is
of egg, each with one X chromosome, while homogametic (ZZ)(Fig.4.4).
the heterogametic males produce two kinds of

sperms some with X chromosome and some
P1 AAZO AAZZ
with Y chromosome. The sex of the embryo
depends on the fertilizing sperm. An egg Gametes AZ AO AZ

fertilized by an ‘X’ bearing sperm produces a


female, if fertilized by a ‘Y’ bearing sperm, a F1 Generation AAZZ AAZO
male is produced (Fig. 4.3)

Fig. 4.4 ZO-ZZ type of sex determination
P1 AAXX AAXY
Gametes AX AX AY ZW-ZZ type
This method of sex determination
occurs in certain insects (gypsy moth) and in
F1 Generation AAXX AAXY vertebrates such as fishes, reptiles and birds.
In this method the female has one ‘Z’ and one
‘W’ chromosome (ZW) producing two types of
Fig. 4.3 XX-XY Type of sex determination eggs, some carrying the Z chromosomes and
some carry the W chromosome. The male sex

51 Principles Of Inheritance And Variation

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 51 25-02-2019 19:13:07


www.asiriyar.net

has two ‘Z’ chromosomes and is homogametic potential genetic function; some genes with
(ZZ) producing a single type of sperm (Fig.4.5). or without homologous counterparts are
seen on the X. Present at both ends of the Y
chromosome are the pseudoautosomal regions
(PARs) that are similar with regions on the X
P1 AAZW AAZZ
chromosome which synapse and recombine
Gametes AZ AW AZ
during meiosis. The remaining 95% of the Y
chromosome is referred as the Non - combining
F1 Generation AAZZ AAZW Region of the Y (NRY). The NRY is divided
equally into functional genes (euchromatic)

and non functional genes (heterochromatic).
Fig. 4.5 ZW-ZZ type of sex determination
Within the euchromatin regions, is a gene
called Sex determining region Y (SRY). In
Sex determintion in human beings
humans, absence of Y chromosome inevitably
Genes determining sex in human beings are
leads to female development and this SRY gene
located on two sex chromosomes, called
is absent in X chromosome. The gene product
allosomes. In mammals, sex determination is
of SRY is the testes determining factor (TDF)
associated with chromosomal differences
present in the adult male testis.
between the two sexes, typically XX females and
XY males. 23 pairs of human chromosomes
include 22 pairs of autosomes (44A) and one pair 4.4.1 Dosage compensation -
of sex chromosomes (XX or XY). Females are Barr body
homogametic producing only one type of In 1949, Barr and Bertram first observed a
gametes (egg), each containing one X condensed body in the nerve cells of female cat
chromosome while the males are heterogametic which was absent in the male. This condensed
producing two types of sperms with X and Y body was called sex chromatin by them and
chromosomes. An independently evolved XX: was later referred as Barr body. In the XY
XY system of sex chromosomes also exist in chromosomal system of sex determination,
Drosophila (Fig.4.6). males have only one X chromosome, whereas
females have two. A question arises: how
Male Famale
(Heterogametic) (Homogametic) does the organism compensate for this dosage
Parents 44A + XY 44A + XX differences between the sexes? In mammals the
Gametes Sperms Ova necessary dosage compensation is accomplished
(22A+X) (22A+Y) (22A+X) (22A+X) by the inactivation of one of the X chromosome
in females so that both males and females have
only one functional X chromosome per cell.
Mary Lyon suggested that Barr bodies
Offsprings/
represented an inactive chromosome, which
Progeny (44A+XX) (44A+XY) (44A+XX) (44A+XY)
Female Male Female Male
in females becomes tightly coiled into a
Fig. 4.6 Sex determination in human beings heterochromatin, a condensed and visible form
of chromatin (Lyon’s hypothesis). The number
of Barr bodies observed in cell was one less than
The Y Chromosome and Male
the number of X-Chromosome. XO females
Development
have no Barr body, whereas XXY males have
Current analysis of Y chromosomes has
one Barr body.
revealed numerous genes and regions with
Principles Of Inheritance And Variation 52

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 52 25-02-2019 19:13:07


www.asiriyar.net

Haplodiploidy in Honeybees express only in the male sex. Sex linked


In hymenopteran insects such as inherited traits are more common in males
honeybees, ants and wasps a mechanism of sex than females because, males are hemizygous
determination called haplodiploidy mechanism and therefore express the trait when they
of sex determination is common. In this system, inherit one mutant allele. The X – linked and Y
the sex of the offspring is determined by the – linked genes in the differential region (non–
number of sets of chromosomes it receives. homologus region) do not undergo pairing or
Fertilized eggs develop into females (Queen crossing over during meiosis. The inheritance
or Worker) and unfertilized eggs develop into of X or Y linked genes is called sex-linked
males (drones) by parthenogenesis. It means that inheritance.
the males have half the number of chromosomes
(haploid) and the females have double the 4.5.1 Inheritance of X - linked genes
number (diploid), hence the name haplodiplody Red-green colour blindness or daltonism,
for this system of sex determination. haemophilia and Duchenne’s muscular dystrophy
are examples of X-linked gene inheritance in
This mode of sex determination facilitates
humans.
the evolution of sociality in which only one
diploid female becomes a queen and lays the
eggs for the colony. All other females which are 1. Haemophilia
diploid having developed from fertilized eggs Haemophilia is commonly known as
help to raise the queen’s eggs and so contribute bleeder’s disease, which is more common in
to the queen’s reproductive success and men than women. This hereditary disease
indirectly to their own, a phenomenon known was first reported by John Cotto in 1803.
as Kin Selection. The queen constructs their Haemophilia is caused by a recessive X-linked
social environment by releasing a hormone that gene. A person with a recessive gene for
suppresses fertility of the workers. haemophilia lacks a normal clotting substance
(thromboplastin) in blood, hence minor
4.5 Sex Linked Inheritance injuries cause continuous bleeding, leading to
The inheritance of a trait that is death. The females are carriers of the disease
determined by a gene located on one of the sex and would transmit the disease to 50% of
chromosomes is called sex linked inheritance. their sons even if the male parent is normal.
Genes present on the differential region of X Haemophilia follows the characteristic criss -
or Y chromosomes are called sex linked genes. cross pattern of inheritance.
The genes present in the differential region
of “X” chromosome are 2. Colour blindness
called X linked genes. In human beings a dominant X – linked
The X–linked genes have gene is necessary for the formation of colour
no corresponding alleles sensitive cells, the cones. The recessive form
in the Y chromosome. of this gene is incapable of producing colour
The genes present in sensitive cone cells. Homozygous recessive
the differential region of Y chromosome are females (XcXc) and hemizygous recessive males
called Y- linked or holandric genes. The Y (XcY) are unable to distinguish red and green
linked genes have no corresponding allele in X colour. The inheritance of colour blindness
chromosome. The Y linked genes inherit along can be studied in the following two types of
with Y chromosome and they phenotypically marriages.

53 Principles Of Inheritance And Variation

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 53 25-02-2019 19:13:07


www.asiriyar.net

(i) M
 arriage between colour blind man a colourblind male will produce normal
and normal visioned woman visioned carrier daughter, colourblind
A marriage between a colour blind man daughter, normal visioned son and a
and a normal visioned woman will produce colourblind son in the F2 generation (Fig.
normal visioned male and female individuals 4.8).
in F1 generation but the females are carriers. ;F;F ; ;<
3DUHQW &RORXUEOLQGIHPDOH 1RUPDOPDOH
The marriage between a F1 normal visioned
carrier woman and a normal visioned male
*DPHWHV ;F ;F ; <
will produce one normal visioned female, one
carrier female, one normal visioned male and
one colour blind male. Colour blind trait is
inherited from the male parent to his grandson
) ;F; ;F<
through carrier daughter, which is an example
1RUPDOEXWFDUULHU &RORXUEOLQGPDOH
of criss-cross pattern of inheritance (Fig. 4.7). IHPDOH ;F<
;F;

*DPHWHV ; ;F ;F <
;; ; ;F<
3DUHQW 1RUPDOIHPDOH &RORXUEOLQGPDOH

*DPHWHV
; ; ;F < ) ;F; ;< ;F;F ;F<
1RUPDOEXW 1RUPDO &RORXUEOLQG &RORXUEOLQG
FDUULHUIHPDOH PDOH IHPDOH PDOH

Fig. 4.8 Marriage between normal visioned


) ;;F ;< man and colour blind woman
1RUPDOEXWFDUULHU 1RUPDOPDOH
IHPDOH
4.5.2 Inheritance of Y- linked genes
;;F ; ;<
Genes in the non-homologous region
*DPHWHV ; ;F ; < of the Y-chromosome are inherited directly
from male to male. In humans, the Y-linked or
holandric genes for hypertrichosis (excessive
;; ;< ;F; ;F< development of hairs on pinna of the ear) are
1RUPDO 1RUPDO 1RUPDOEXW &RORXUEOLQG transmitted directly from father to son, because
IHPDOH PDOH FDUULHUIHPDOH PDOH
males inherit the Y chromosome from the
1RUPDOYLVLRQFDUULHUFRORXUEOLQG
father. Female inherits only X chromosome
Fig. 4.7 Marriage between colour blind from the father and are not affected.
man and normal visioned woman

ii) Marriage between normal visioned man 4.6 Karyotyping


and colour blind woman Karyotyping is a technique through which
a complete set of chromosomes is separated
If a colour blind woman (XcXc) marries from a cell and the chromosomes are arranged
a normal visioned male (X+Y), all F1 sons will in pairs. An idiogram refers to a diagrammatic
be colourblind and daughters will be normal representation of chromosomes.
visioned but are carriers.
Marriage between F1 carrier female with

Principles Of Inheritance And Variation 54

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 54 25-02-2019 19:13:08


www.asiriyar.net

at metaphase stage and the suitable spread of


metaphase chromosomes is photographed.
The individual chromosomes are cut from the
     photograph and are arranged in an orderly
$ %
fashion in homologous pairs. This arrangement
is called a karyotype. Chromosome banding
       permits structural definitions and differentiation
&
of chromosomes.
     
' ( Applications of Karyotyping:
• It helps in gender identification.
    ; <
) * & * • It is used to detect the chromosomal
)LJ+XPDQNDU\RW\SH PDOH aberrations like deletion, duplication,
Fig. 4.9 - Human karyotype (male) translocation, nondisjunction of
chromosomes.
Preparation of Karyotype • It helps to identify the abnormalities of
Tjio and Levan (1960) described a simple
chromosomes like aneuploidy.
method of culturing lymphocytes from the
human blood. Mitosis is induced followed by • It is also used in predicting the evolutionary
addition of colchicine to arrest cell division relationships between species.
• Genetic diseases in human
beings can be detected by this
technique.

Human Karyotype
Depending upon the position of
the centromere and relative length
of two arms, human chromosomes
are of three types: Metacentric, sub
metacentric and acrocentric. The
photograph of chromosomes are
arranged in the order of descending
length in groups from A to G (Fig.
4.9).

4.7 Pedigree Analysis


Pedigree is a “family tree”, drawn
with standard genetic symbols, showing
the inheritance pathway for specific
phenotypic characters (Fig.4.10).
Pedigree analysis is the study of traits
as they have appeared in a given family
Fig. 4.10 Symbols commonly used in pedigree line for several past generations.
charts

55 Principles Of Inheritance And Variation

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 55 25-02-2019 19:13:08


www.asiriyar.net

Genetic Disorders as Cooley’s anaemia. In this disorder the alpha


A genetic disorder is a chain production is increased and damages the
disease or syndrome that is membranes of RBC.
caused by an abnormality
in an individual DNA.
Phenylketonuria
It is an inborn error of Phenylalanine
Abnormalities can range
metabolism caused due to a pair of autosomal
from a small mutation in
recessive genes. It is caused due to mutation
a single gene to the addition or subtraction
in the gene PAH (phenylalanine hydroxylase
of an entire chromosome or even a set of
gene) located on chromosome 12 for the hepatic
chromosomes. Genetic disorders are of two types
enzyme “phenylalanine hydroxylase” This enzyme
namely, Mendelian disorders and chromosomal
is essential for the conversion of phenylalanine to
disorders.
tyrosine. Affected individual lacks this enzyme,
4.8 Mendelian disorders so phenylalanine accumulates and gets converted
Alteration or mutation in a single gene to phenylpyruvic acid and other derivatives. It is
causes Mendelian disorders. These disorders characterized by severe mental retardation, light
are transmitted to the offsprings on the same pigmentation of skin and hair. Phenylpyruvic acid
line as the Mendelian pattern of inheritance. is excreted in the urine.
Some examples for Mendelian disorders are   
phenylalanine  
Thalassemia, albinism, phenylketonuria, sickle hydroxylase
Phenylalanine Tyrosine
cell anaemia, Huntington's chorea, etc., These
disorders may be dominant or recessive and
autosomal or sex linked. Albinism
Albinism is an inborn error of metabolism,
Thalassemia caused due to an autosomal recessive gene.
Thalassemia is an autosomal recessive Melanin pigment is responsible for skin colour.
disorder. It is caused by gene mutation resulting Absence of melanin results in a condition called
in excessive destruction of RBC’s due to the albinism. A person with the recessive allele
formation of abnormal haemoglobin molecules. lacks the tyrosinase enzyme system, which is
Normally haemoglobin is composed of four required for the conversion of dihydroxyphenyl
polypeptide chains, two alpha and two beta alanine (DOPA) into melanin pigment inside
globin chains. Thalassemia patients have defects the melanocytes. In an albino, melanocytes are
in either the alpha or beta globin chain causing present in normal numbers in their skin, hair,
the production of abnormal haemoglobin iris, etc., but lack melanin pigment.
molecules resulting in anaemia.
Thalassemia is classified into alpha and beta 3, 4 dihydroxy   Tyrosinase  
based on which chain of haemoglobin molecule phenylalanine Melanin
is affected. It is controlled by two closely linked (DOPA)
genes HBA1 and HBA2 on chromosome 16.
Mutation or deletion of one or more of the four Huntington’s chorea
alpha gene alleles causes Alpha Thalassemia. It is inherited as an autosomal dominant
In Beta Thalassemia, production of beta globin lethal gene in man. It is characterized by
chain is affected. It is controlled by a single involuntary jerking of the body and progressive
gene (HBB) on chromosome 11. It is the most degeneration of the nervous system,
common type of Thalassemia and is also known

Principles Of Inheritance And Variation 56

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 56 25-02-2019 19:13:08


www.asiriyar.net

accompanied by gradual mental and physical the brain and internal organs are some of the
deterioration. The patients with this disease symptoms of this syndrome.
usually die between the age of 35 and 40.
b. Allosomal abnormalities in human
4.9 Chromosomal Abnormalities
beings
Each human diploid (2n) body cell has
Mitotic or meiotic non-disjunction of sex
46 chromosomes (23 pairs). Chromosomal
chromosomes causes allosomal abnormalities.
disorders are caused by errors in the number
Several sex chromosomal abnormalities have
or structure of chromosomes. Chromosomal
been detected. Eg. Klinefelter’s syndrome and
anomalies usually occur when there is an
Turner’s syndrome.
error in cell division. Failure of chromatids
to segregate during cell division resulting in 1. Klinefelter’s Syndrome (XXY Males)
the gain or loss of one or more chromosomes This genetic disorder is due to the presence
is called aneuploidy. It is caused by non- of an additional copy of the X chromosome
disjunction of chromosomes. Group of resulting in a karyotype of 47,XXY. Persons
signs and symptoms that occur together and with this syndrome have 47 chromosomes
characterize a particular abnormality is called (44AA+XXY). They are usually sterile males,
a syndrome. In humans, Down’s syndrome, tall, obese, with long limbs, high pitched voice,
Turner’s syndrome, Klinefelter’s syndrome, under developed genitalia and have feeble breast
Patau’s syndrome are some of the examples of (gynaecomastia) development.
chromosomal disorders.
2. Turner’s Syndrome (XO Females)

a. Autosomal aneuploidy in human This genetic disorder is due to the loss


beings of a X chromosome resulting in a karyotype
Several autosomal aneuploidies have been of 45,X. Persons with this syndrome have
reported in human being e.g. Down’s syndrome 45 chromosomes (44 autosomes and one X
(21-Trisomy), Patau’s syndrome (13-Trisomy). chromosome) (44AA+XO) and are sterile
females. Low stature, webbed neck, under
1.  Down’s Syndrome/Trisomy – 21 developed breast, rudimentary gonads lack of
Trisomic condition of chromosome - 21 menstrual cycle during puberty, are the main
results in Down’s syndrome. It is characterized by symptoms of this syndrome.
severe mental retardation, defective development
of the central nervous system, increased separation Summary
between the eyes, flattened nose, ears are malformed, Genetics is a branch of biology that deals
mouth is constantly open and the tongue protrudes. with the study of heredity and variation. It
describes how characteristics and features
2.  Patau’s Syndrome/Trisomy-13 pass on from the parents to their offsprings in
successive generations. Variation is the degree by
Trisomic condition of chromosome 13
which progeny differ from their parents. A set of
results in Patau’s syndrome. Meiotic non
three or more alleles of the same gene occupying
disjunction is thought to be the cause for this
the same locus in a given pair of homologous
chromosomal abnormality. It is characterized
chromosomes controlling a particular trait is
by multiple and severe body malformations as
called Multiple allele. ABO blood grouping in
well as profound mental deficiency. Small head
man is a good example for multiple allelism.
with small eyes, cleft palate, malformation of
Apart from A and B antigens, the RBC’s of

57 Principles Of Inheritance And Variation

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 57 25-02-2019 19:13:08


www.asiriyar.net

humans contain a special type of antigen called the condition is XXY. An idiogram refers to a
Rh antigen/Rh factors. Erythroblastosis foetalis, diagrammatic representation of chromosomes.
also called haemolytic disease of the newborn, The cytoplasmic extra nuclear genes have a
in which the red blood cells of a foetus are characteristic pattern of inheritance which does
destroyed due to maternal immune reaction not resemble genes of nuclear chromosomes
resulting from a blood group incompatibility and are known as Extrachromosomal/
between the foetus and the mother. Cytoplasmic inheritance. The betterment of
The mechanism of determination of male human race can be achieved by methods like
and female individuals in a species is called sex Eugenics, Euthenics and Euphenics.
determination. The chromosomes are different
in two sexes and referred to as allosomes; the Evaluation
remaining chromosomes are named autosomes. 1. Haemophilia is more
In human beings a normal female has 22 pairs of common in males
autosomes and a pair of sex chromosomes (44A because it is a
+ XX) and a male has 22 pairs of autosomes and
a) Recessive character
a pair of sex chromosomes (44A + XY). In birds,
carried by
reptiles and some fishes, sex chromosomes are
Y-chromosome
ZZ in males and ZW in females. In moths and
butterflies, sex chromosomes are represented b) 
Dominant character carried by
as ZZ in males and ZO in females. Sex in Y-chromosome
Drosophila is determined polygenically. The sex c) 
Dominant trait carried by
of an individual depends upon the ratio of X X-chromosome
chromosomes to autosome sets. The inheritance
d) 
Recessive trait carried by
of a trait that is determined by a gene located on
X-chromosome
one of the sex chromosomes is called sex linked
inheritance. Haemophilia, colourblindness, 2. ABO blood group in man is controlled by
muscular dystrophy are some examples for X a) Multiple alleles b) Lethal genes
linked inheritance in human beings.
c) Sex linked genes d) Y-linked genes
Pedigree analysis is the study of traits as 3. Three children of a family have blood
they have appeared in a given family line for groups A, AB and B. What could be the
several generations. The genetic disorders are genotypes of their parents?
of two types- Mendelian and chromosomal.
a) IA IB and ii b) IA Io and IBIo
Alternations or mutation in single gene causes
c) IB IB and IA IA d) IA IA and ii
Mendelian disorders like, thalassemia, albinism,
phenylketonuria, and Huntington’s chorea. 4. Which of the following is not correct?
Chromosomal abnormalities arise due to a) Three or more alleles of a trait in the
chromosomal non-disjunction, translocation, population are called multiple alleles.
deletion, duplication and inversion. Downs b) A normal gene undergoes mutations
syndrome, Klinefelter’s syndrome, Turner’s to form many alleles
syndrome and Patau’s syndrome are some of the c) Multiple alleles map at different loci
chromosomal disorders. Downs syndrome is of a chromosome
due to trisomy of chromosome 21. Presence of
d) 
A diploid organism has only two
trisomic condition of chromosome 13 results in
alleles out of many in the population
Patau’s syndrome. In Turner’s syndrome the sex
chromosome is XO and in Klinefelter’s syndrome

Principles Of Inheritance And Variation 58

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 58 25-02-2019 19:13:08


www.asiriyar.net

5. Which of the following phenotypes in the blood group which blood can be safely
progeny are possible from the parental transferred?
combination AxB?
a) ‘O’ and Rh negative
a) A and B only b) ‘O’ and Rh positive
b) A,B and AB only c)’B’ and Rh negative
c) AB only
d) ‘AB’ and Rh positive
d) A,B,AB and O
12. Father of a child is colourblind and
6. Which of the following phenotypes is not
mother is carrier for colourblindness, the
possible in the progeny of the parental
probability of the child being colourblind
genotypic combination IAIO X IAIB?
is
a) AB b) O
a) 25% b) 50%
c) A d) B
c) 100% d) 75%
7. Which of the following is true about
13. A marriage between a colourblind man
Rh factor in the offspring of a parental
and a normal woman produces
combination DdXDd (both Rh positive)?
a) All carrier daughters and normal sons
a) All will be Rh-positive
b) Half will be Rh positive b) 50% carrier daughters, 50% normal
c) About ¾ will be Rh negative daughters
d) About one fourth will be Rh negative c) 50% colourblind sons, 50% normal sons
8. What can be the blood group of offspring d) All carrier offsprings
when both parents have AB blood group?
14. Mangolism is a genetic disorder which
a) AB only b) A, B and AB is caused by the presence of an extra
c) A, B, AB and O d) A and B only chromosome number
9. If the childs blood group is ‘O’ and fathers a) 20 b) 21
blood group is ‘A’ and mother’s blood c) 4 d) 23
group is ‘B’ the genotype of the parents
15. Klinefelters’ syndrome is characterized by
will be
a karyotype of
a) IA IA and IB Io b) IA Io and IB Io
a) XYY b) XO
c) IA Io and IoIo d) IoIo and IB IB
c) XXX d) XXY
10. XO type of sex determination and XY type
16. Females with Turners’ syndrome have
of sex determination are examples of
a) Small uterus
a) Male heterogamety
b) Rudimentary ovaries
b) Female heterogamety
c) Underdeveloped breasts
c) Male homogamety
d) All of these
d) Both (b) and (c)
17. Pataus’ syndrome is also referred to as
11. In an accident there is great loss of
a) 13-Trisomy b) 18-Trisormy
blood and there is no time to analyse the
c) 21-Trisormy d) None of these

59 Principles Of Inheritance And Variation

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 59 25-02-2019 19:13:08


www.asiriyar.net

18. Who is the founder of Modern Eugenics 25. What is haplodiploidy?


movement? 26. Distinguish between heterogametic and
a) Mendel b) Darwin homogametic sex determination systems.
c) Fransis Galton d) Karl pearson 27. What is Lyonisation?
19. Improvement of human race by 28. What is criss-cross inheritance?
encouraging the healthy persons to marry
29. Why are sex linked recessive characters
early and produce large number of children
more common in the male human beings?
is called
a) Positive eugenics 30. What are holandric genes?
b) Negative eugenics 31. Mention the symptoms of Phenylketonuria.
c) Positive euthenics
32. Mention the symptoms of Downs
d) Positive euphenics
syndrome.
20. The _______deals with the control
of several inherited human diseases 33. Differentiate Intersexes from Supersexes
especially inborn errors of metabolism 34. Explain the genetic basis of ABO blood
a) Euphenics b) Eugenics grouping man.
c) Euthenics d) All of these 35. How is sex determined in human beings?
21. “Universal Donor” and “Universal 36. Explain male heterogamety.
Recipients” blood group are _____
and_______respectively 37. Brief about female heterogamety.

a) AB, O b) O, AB 38. Give an account of genetic control of Rh


c) A, B d) B, A factor.
22. ZW-ZZ system of sex determination 39. Explain the mode of sex determination in
occurs in honeybees.
a) Fishes b) Reptiles 40. Discuss the genic balance mechanism
c) Birds d) All of these of sex determination with reference to
23. Co-dominant blood group is Drosophila.
a) A b) AB 41. What are the applications of Karyotyping?
c) B d) O
42. Explain the inheritance of sex linked
24. Which of the following is incorrect characters in human being.
regarding ZW-ZZ type of sex
43. What is extra chromosomal inheritance?
determination?
Explain with an example.
a) It occurs in birds and some reptiles
44. Comment on the methods of Eugenics.
b) Females are homogametic and
males are heterogametic
c) Male produce two types of gametes
d) It occurs in gypsy moth

Principles Of Inheritance And Variation 60

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 60 25-02-2019 19:13:08


www.asiriyar.net

Concept Map
6LPSOH
0XOWLSOHDOOHOHV GRPLQDQFH
(J$%2EORRG
JURXSLQJLQ
KXPDQEHLQJ &RGRPLQDQFH

;OLQNHG(J
+DHPRSKLOLD
&RORXUEOLQGQHVV
6H[OLQNHG
,QKHULWDQFH <OLQNHG(J
+\SHUWULFKRVLV

.DU\RW\SLQJ 3HGLJUHHDQDO\VLV

([WUD
FKURPRVRPDO
&\WRSODVPLF
LQKHULWDQFH
(J.DSSD
SDUWLFOHV
LQSDUDPLFLXP
6KHOOFRLOLQJLQ
VQDLOV
;;)HPDOH;20DOH
3ULQFLSOHVRI (J%XJVFRFNURDFKHV
*UDVVKRSSHUV
LQKHULWDQFH
DQGYDULDWLRQ 0DOH
KHWHURJDPHW\ ;;)HPDOH;<0DOH
(J0DQ %DUUERGLHV;
LQDFWLYDWLRQ 'URVRSKLOD

*HQLFEDODQFHPHFKDQLVP

6H[ =2)HPDOH==0DOH
GHWHUPLQDWLRQ (J0RWKV
%XWWHUIOLHV'RPHVWLFFKLFNHQV
)HPDOH
KHWHURJDPHW\
=:)HPDOH==0DOH
(J%LUGV5HSWLOHV
VRPH)LVKHV

+DSORGLSORLG\

(J+RQH\EHHV

7KDODVVHPLD$OELQLVP
0HQGHOLDQ 3KHQ\ONHWRQXULD
GLVRUGHUV +XQWLQJWRQ
VFKRUHD
*HQHWLF
GLVRUGHUV
'RZQ
VV\QGURPH.OLQHIHWHU
V
&KURPRVRPDO
V\QGURPH7XUQHU
VV\QGURPH
GLVRUGHUV
3DWDX
VV\QGURPH

(XJHQLFV(XSKHQLFV
9DULDWLRQ (XWKHQLFV

61 Principles Of Inheritance And Variation

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 61 25-02-2019 19:13:09


www.asiriyar.net

ICT CORNER
PRINCIPLES OF INHERITANCE AND
VARIATION

Shall we can investigate


on DNA?

Procedure:
Step -1: Type the URL or scan the QR code to open the activity page.
Step -2 :Click “Timeline” to know the history of DNA identification and the work of scientists.
On the right top of the window, find hexagons revealing about other tabs to click.
Step -3 :Click “Genome” to go through “FLYOVER”, “ Chromosome Close Up” and in “
Genome Fishing”, click on the tabs such as “Centromere”, etc., to know the shape. And
Click “Genome Spots” to know the various responsible Spots respective to their activities.
Step – 4 :Find “Launch Gene Body” on the right bottom of the window, and Click it to analyse
and understand about the cloning.
Step -5 :Click on “Applications (Hexagon 4)” to know the uses behind. And click “Chronicle
(Hexagon 5)” to know the documentations.

Step 1 Step 2 Step 3

Step 4

PRINCIPLES OF INHERITANCE AND VARIATION URL:


http://www.dnai.org/

*Pictures are indicative only


*Allow flash player

Principles Of Inheritance And Variation 62

TN_GOVT_XII_ Bio Zoology_chapter 4.indd 62 25-02-2019 19:13:09


www.asiriyar.net

5
UNIT - II

Molecular
Genetics
CHAPTER

New life for Woolly Mammoth DNA-researchers


Chapter Outline can now re-create the genes of mammoth and
study the proteins they encoded
5.1 Gene as the functional unit of inheritance
5.2 In search of the genetic material

M
5.3 DNA is the genetic material endel’s theory dispelled the mystery
5.4 Chemistry of nucleic acids
of why traits seemed to appear and
5.5 RNA world
5.6 Properties of genetic material disappear magically from one generation to
5.7 Packaging of DNA helix the next. Mendel’s work reveals the patterns of
5.8 DNA Replication heredity and reflect the transmission of evolved
5.9 Transcription information from parents to offspring. This
5.10 Genetic code information is located on the chromosomes.
5.11 tRNA – the adapter molecule One of the most advanced realizations of
5.12 Translation
human knowledge was that our unique
5.13 Regulation of Gene expression
5.14 Human Genome Project (HGP) characteristics are encoded within molecules
5.15 DNA finger printing technique of DNA. The discovery that DNA is the genetic
material left several questions unanswered.
How is the information in DNA used? Scientists
Learning Objectives
now know that DNA directs the construction
➢ Identifies DNA as the genetic material. of proteins. Proteins determine the shapes of
➢ Understands the organization of prokaryotic cells and the rate of chemical reactions, such
and eukaryotic genome. as those that occur during metabolism and
➢ Learns to differentiate the nucleotides of DNA photosynthesis. The hereditary nature of every
and RNA. living organism is defined by its genome,
➢ Understands gene expression - which consists of a long sequence of nucleic
Replication, Transcription and
acids that provide the information needed to
Translation.
construct the organism. The genome contains
➢ Learns about codons and the
salient features of genetic code. the complete set of hereditary information for
➢ Understands the gene regulation any organism. The genome may be divided into
through Lac operon model. a number of different nucleic acid molecules.
➢ Realizes the importance of Human Genome Each of the nucleic acid molecule may contain
Project. large number of genes. Each gene is a sequence
➢ Illustrates the applications of DNA finger within the nucleic acid that represents a single
printing technique.
protein. In this chapter we will discuss the

63

TN_GOVT_XII_ Bio Zoology_chapter5.indd 63 25-02-2019 19:13:55


www.asiriyar.net

structure of DNA, its replication, the process


of making RNA from DNA (transcription), the One gene-one enzyme hypothesis
genetic code that determines the sequence of The experiments of George Beadle
amino acid in protein synthesis (translation), and Edward Tatum in the early 1940’s
regulation of gene expression and the essentials on Neurospora crassa (the red bread
of human genome sequencing. mould) led them to propose one ­gene-
one enzyme hypothesis, which states that
5.1 Gene as the functional unit one gene controls the production of one
of inheritance enzyme.
A gene is a basic physical and functional One gene-one polypeptide hypothesis
unit of heredity. The concept of the gene It was observed that an enzyme
was first explained by Gregor Mendel in may be composed of more than one
1860’s. He never used the term ‘gene’. He polypeptide chain and a gene can code
called it ‘factor’. In 1909, the Danish biologist for only one polypeptide chain. Thus one
Wilhelm Johannsen, coined the term ‘gene’, gene-one polypeptide hypothesis states
that was referred to discrete determiners of that one gene controls the production of
inherited characteristics. only one polypeptide chain of an enzyme
molecule.
According to the classical concept of
gene introduced by Sutton in 1902, genes 5.2 In search of the genetic material
have been defined as discrete particles that
As early as 1848, Wilhelm Hofmeister,
follow Mendelian rules of inheritance,
a German botanist, had observed that cell
occupy a definite locus in the chromosome nuclei organize themselves into small,
and are responsible for the expression of rod like bodies during mitosis called
specific phenotypic character. They show the chromosomes. In 1869, Friedrich Miescher,
following properties: a Swiss physician, isolated a substance from
• Number of genes in each organism is the cell nuclei and called it as nuclein. It
more than the number of chromosomes; was renamed as nucleic acid by Altman
hence several genes are located on the (1889), and is now known as DNA. By 1920,
it became clear that chromosomes are made
same chromosome.
up of proteins and DNA. Many experiments
• The genes are arranged in a single linear were carried out to study the actual carriers
order like beads on a string. of genetic information. Griffith's experiment
• Each gene occupies a specific position proved that DNA is the genetic material
which has been dealt in class XI. Bacterial
called locus.
transformation experiments provided the
• Genes may exist in several alternate forms first proof that DNA is the genetic material.
called alleles. However, he could not understand the
• Genes may undergo sudden change cause of bacterial transformation, and the
in positions and composition called biochemical nature of genetic material was
not defined from his experiments.
mutations.
Later, Oswald Avery, Colin Macleod and
• Genes are capable of self-duplication Maclyn McCarty in 1944 repeated Griffith’s
producing their own copies. experiments in an ‘in vitro’ system in order

Molecular Genetics 64

TN_GOVT_XII_ Bio Zoology_chapter5.indd 64 25-02-2019 19:13:55


www.asiriyar.net

+\SRWKHVLV7KHJHQHWLFPDWHULDORIWKHFHOOLVHLWKHUSURWHLQRUQXFOHLFDFLG '1$RU51$

5HPRYHOLSLGVDQG
VXJDUVIURPDVROXWLRQRI
+HDWNLOOHG /LSLGV KHDWNLOOHG6FHOOV
6FHOOV 6XJDUV 3URWHLQV51$DQG'1$
UHPDLQ

$GGSURWHLQDVH $GG51DVH $GG'1DVH 7UHDWVROXWLRQVZLWK


HQ]\PHVWRGHVWUR\
SURWHLQ51$RU'1$
123527(,1 1251$ 12'1$

$GGWRFXOWXUHFRQWDLQLQJ
$GG5FHOOV $GG5FHOOV $GG5FHOOV
OLYLQJ5FHOOV2EVHUYHIRU
WUDQVIRUPDWLRQE\WHVWLQJ
IRUWKHSUHVHQFHRI
YLUXOHQW6FHOOV

6FHOOVDSSHDU 6FHOOVDSSHDU 1R6FHOOV

&RQFOXVLRQ7UDQVIRUPDWLRQUHTXLUHV'1$WKHUHIRUHLWLVWKHJHQHWLFPDWHULDORIWKHFHOO

Fig. 5.1 Transformation experiment of Avery et. al., (1944)

to identify the nature of the transforming (an enzyme which destroys protein) did not
substance responsible for converting a non- affect the transformation. Digestion with
virulent strain into virulent strain. They DNase inhibited transformation suggesting
observed that the DNA, RNA and proteins that the DNA caused the transformation.
isolated from the heat-killed S-strain when These experiments suggested that DNA and
added to R-strain changed their surface not proteins is the genetic material. The
character from rough to smooth and also phenomenon, by which DNA isolated from
made them pathogenic (Fig. 5.1). But one type of cell (R – strain), when introduced
when the extract was treated with DNase into another type (S-strain), is able to retain
(an enzyme which destroys DNA) the some of the properties of the R - strain is
transforming ability was lost. RNase (an referred to as transformation.
enzyme which destroys RNA) and proteases

65 Molecular Genetics

TN_GOVT_XII_ Bio Zoology_chapter5.indd 65 25-02-2019 19:13:56


www.asiriyar.net

Fig. 5.2 The Hershey-Chase (blender) experiment


5.3 DNA is the genetic material phages (virus) are added to bacteria, they
Many biologists despite the earlier adsorb to the outer surface, some material
experiments of Griffith, Avery and others, enters the bacterium, and then later each
still believed that protein, not DNA, was the bacterium lyses to release a large number of
hereditary material in a cell. As eukaryotic progeny phage. Hershey and Chase wanted
chromosomes consist of roughly equal to observe whether it was DNA or protein
amounts of protein and DNA, it was said that entered the bacteria. All nucleic acids
that only a protein had sufficient chemical contain phosphorus, and contain sulphur (in
diversity and complexity to encode the the amino acid cysteine and methionine).
information required for genetic material. Hershey and Chase designed an experiment
In 1952, however, the results of the using radioactive isotopes of Sulphur (35S)
Hershey-Chase experiment finally provided and phosphorus (32P) to keep separate track of
convincing evidence that DNA is the genetic the viral protein and nucleic acids during the
material. infection process. The phages were allowed
5.3.1 Hershey and Chase experiment to infect bacteria in culture medium which
on T2 bacteriophage containing the radioactive isotopes 35S or 32P.
The bacteriophage that grew in the presence of
Alfred Hershey and Martha Chase (1952) 35
S had labelled proteins and bacteriophages
conducted experiments on bacteriophages
grown in the presence of 32P had labelled DNA.
that infect bacteria. Phage T2 is a virus that
infects the bacterium Escherichia coli. When

Molecular Genetics 66

TN_GOVT_XII_ Bio Zoology_chapter5.indd 66 25-02-2019 19:13:56


www.asiriyar.net

The differential labelling thus enabled them to Nitrogenous bases


identify DNA and proteins of the phage. The bases are nitrogen containing
Hershey and Chase mixed the labelled molecules having the chemical properties
phages with unlabeled E. coli and allowed of a base (a substance that accepts H+ ion or
bacteriophages to attack and inject their proton in solution). DNA and RNA both have
genetic material. Soon after infection (before four bases (two purines and two pyrimidines)
lysis of bacteria), the bacterial cells were gently in their nucleotide chain. Two of the bases,
agitated in a blender to loosen the adhering Adenine (A) and Guanine (G) have double
phase particles. It was observed that only 32P carbon–nitrogen ring structures and are
was found associated with bacterial cells and called purines. The bases, Thymine (T),
35
S was in the surrounding medium and not Cytosine (C) and Uracil (U) have single ring
in the bacterial cells. When phage progeny structure and these are called pyrimidines.
was studied for radioactivity, it was found Thymine is unique for DNA, while Uracil is
that it carried only 32P and not 35S (Fig. 5.2). unique for RNA.
These results clearly indicate that only DNA
and not protein coat entered the bacterial The phosphate functional group
cells. Hershey and Chase thus conclusively It is derived from phosphoric acid
proved that it was DNA, not protein, which (H3PO4), has three active OH- groups of which
carries the hereditary information from virus two are involved in strand formation. The
to bacteria. phosphate functional group (PO4) gives DNA
and RNA the property of an acid (a substance
5.4 Chemistry of Nucleic Acids that releases an H+ ion or proton in solution)
Having identified the genetic material as at physiological pH, hence the name nucleic
the nucleic acid DNA (or RNA), we proceed acid. The bonds that are formed from
to examine the chemical structure of these phosphates are esters. The oxygen atom of the
molecules. Generally nucleic acids are a phosphate group is negatively charged after
long chain or polymer of repeating subunits the formation of the phosphodiester bonds.
called nucleotides. Each nucleotide subunit is This negatively charged phosphate ensures
composed of three parts: a nitrogenous base, the retention of nucleic acid within the cell or
a five carbon sugar (pentose) and a phosphate nuclear membrane.
group.
Nucleoside and nucleotide
Pentose sugar The nitrogenous base is chemically
There are two types of nucleic acids linked to one molecule of sugar (at the
depending on the type of pentose sugar. 1-carbon of the sugar) forming a nucleoside.
Those containing deoxyribose sugar are called When a phosphate group is attached to the 5'
Deoxyribo Nucleic Acid (DNA) and those carbon of the same sugar, the nucleoside
with ribose sugar are known as Ribonucleic becomes a nucleotide. The nucleotides are
Acid (RNA). DNA is found in the nucleus joined (polymerized) by condensation
of eukaryotes and nucleoid of prokaryotes. reaction to form a polynucleotide chain. The
The only difference between these two hydroxyl group on the 3' carbon of a sugar of
sugars is that there is one oxygen atom less in one nucleotide forms an ester with the
deoxyribose. phosphate of another nucleotide. The
chemical bonds that link the sugar

67 Molecular Genetics

TN_GOVT_XII_ Bio Zoology_chapter5.indd 67 25-02-2019 19:13:56


www.asiriyar.net

components of adjacent nucleotides are called separated RNA from the protein of TMV
phosphodiester bond (5' 3'), indicating viruses. Three molecular biologists in the early
the polarity of the strand. 1980’s (Leslie Orgel, Francis Brick and Carl
The ends of the DNA or RNA are distinct. Woese) independently proposed the ‘RNA
The two ends are designated by the symbols 5' world’ as the first stage in the evolution of
and 3'. The symbol 5' refers to carbon in the life, a stage when RNA catalysed all molecules
sugar to which a phosphate (PO4) functional necessary for survival and replication. The
group is attached. The symbol 3' refers to term ‘RNA world’ first used by Walter Gilbert
carbon in the sugar to which hydroxyl (OH) in 1986, hypothesizes RNA as the first genetic
functional group is attached. In RNA, every material on earth. There is now enough
nucleotide residue has an additional –OH evidence to suggest that essential life processes
group at 2' position in the ribose. (such as metabolism, translation, splicing etc.,)
Understanding the 5' 3' direction of a evolved around RNA. RNA has the ability to act
nucleic acid is critical for understanding the as both genetic material and catalyst. There are
aspects of replication and transcription. several biochemical reactions in living systems
Based on the X - ray diffraction analysis of that are catalysed by RNA. This catalytic
Maurice Wilkins and Rosalind Franklin, the RNA is known as ribozyme. But, RNA being
double helix model for DNA was proposed by a catalyst was reactive and hence unstable.
James Watson and Francis Crick in 1953. The This led to evolution of a more stable form of
highlight was the base pairing between the DNA, with certain chemical modifications.
two strands of the polynucleotide chain. This Since DNA is a double stranded molecule
proposition was based on the observations having complementary strand, it has resisted
of Erwin Chargaff that Adenine pairs with changes by evolving a process of repair. Some
Thymine (A = T) with two hydrogen bonds RNA molecules function as gene regulators by
and Guanine pairs with Cytosine (G ≡ C) binding to DNA and affect gene expression.
with three hydrogen bonds. The ratios Some viruses use RNA as the genetic material.
between Adenine with Thymine and Guanine Andrew Fire and Craig Mellow (recipients of
with Cytosine are constant and equal. The Nobel Prize in 2006) were of the opinion that
base pairing confers a unique property to RNA is an active ingredient in the chemistry of
the polynucleotide chain. They are said to be life. The types of RNA and their role have been
complementary to each other, that is, if the discussed in class XI.
sequence of bases in one strand (template) is
known, then the sequence in the other strand 5.6 Properties of genetic material
can be predicted. The salient features of DNA (DNA versus RNA)
structure has already been dealt in class XI. The experiment by Hershey and Chase
clearly indicates that it is DNA that acts
5.5 RNA world as a genetic material. However, in some
A typical cell contains about ten times as viruses like Tobacco mosaic virus (TMV),
much RNA as DNA. The high RNA content bacteriophage θB, RNA acts as the genetic
is mainly due to the variety of roles played by material. A molecule that can act as a genetic
RNA in the cell. Fraenkel-Conrat and Singer material should have the following properties:
(1957) first demonstrated that RNA is the
S elf Replication: It should be able to
• 
genetic material in RNA containing viruses
replicate. According to the rule of base
like TMV (Tobacco Mosaic Virus) and they
pairing and complementarity, both nucleic

Molecular Genetics 68

TN_GOVT_XII_ Bio Zoology_chapter5.indd 68 25-02-2019 19:13:56


www.asiriyar.net

acids (DNA and RNA) have the ability to a faster rate. Thus viruses having RNA
direct duplications. Proteins fail to fulfill genome with shorter life span can mutate
this criteria. and evolve faster.
• Stability: It should be stable structurally and The above discussion indicates that both
chemically. The genetic material should be RNA and DNA can function as a genetic
stable enough not to change with different material. DNA is more stable, and is preferred
stages of life cycle, age or with change in for storage of genetic information.
physiology of the organism. Stability as one
of property of genetic material was clearly 5.7 Packaging of DNA helix
evident in Griffith’s transforming principle.
The distance between two consecutive
Heat which killed the bacteria did not
base pairs is 0.34nm (0.34×10-9m) of the
destroy some of the properties of genetic
DNA double helix in a typical mammalian
material. In DNA the two strands being
cell. When the total number of base pairs is
complementary, if separated (denatured) by
multiplied with the distance between two
heating can come together (renaturation)
consecutive base pairs (6.6 × 10-9 × 0.34 ×10-9
when appropriate condition is provided.
m/bp), the length of DNA double helix is
Further 2' OH group present
at every nucleotide in RNA is a
$
reactive group that makes RNA
liable  and easily degradable. RNA
is also known to be catalytic and
reactive. Hence, DNA is chemically
more stable and chemically less 1XFOHRVRPH
reactive when compared to RNA. &RUH'1$

Presence of thymine instead of +$ +% + +

uracil in DNA confers additional /LQNHU'1$


% +
stability to DNA.
• Information storage: It should be
able to express itself in the form $
of ‘Mendelian characters’. RNA $ &
can directly code for protein '

synthesis and can easily express


the characters. DNA, however
depends on RNA for synthesis
of proteins. Both DNA and RNA )

can act as a genetic material, but (

DNA being more stable stores


the genetic information and RNA +
'1$
+$+%+
transfers the genetic information. DQG+ WZR
PROHFXOHVHDFK
+LVWRQHRFWDPHU
+ +LVWRQHSURWHLQ

• Variation through mutation: It


1XFOHRVRPH
should be able to mutate. Both
DNA and RNA are able to mutate. Fig. 5.3 Condensation of DNA - A - DNA, B-Nucleosomes
RNA being unstable, mutates at and  Histones, C- Chromatin fiber, D-  Coiled chromatin
fiber, E- Coiled coil, F- metaphase chromatid

69 Molecular Genetics

TN_GOVT_XII_ Bio Zoology_chapter5.indd 69 25-02-2019 19:13:56


www.asiriyar.net

approximately 2.2 m. (The total length of the makes two complete turns around the histone
double helical DNA = total number of base octameres and the two turns are sealed off by
pairs × distance between two consecutive an H1 molecule. Chromatin lacking H1 has a
base pairs). If the length of E. coli DNA is beads-on-a-string appearance in which DNA
1.36 mm, the number of base pairs in E. coli enters and leaves the nucleosomes at random
is 4 ×106m (1.36 × 103 m/0.34 ×10-9). The places. H1 of one nucleosome can interact
length of the DNA double helix is far greater with H1 of the neighbouring nucleosomes
than the dimension of a typical mammalian resulting in the further folding of the fibre.
nucleus (approximately 10-6 m). How is such The chromatin fiber in interphase nuclei and
a long DNA polymer packaged in a cell? mitotic chromosomes have a diameter that
Chromosomes are carriers of genes which vary between 200-300 nm and represents
are responsible for various characters from inactive chromatin. 30 nm fibre arises from the
generation to generation. Du Praw (1965) folding of nucleosome, chains into a solenoid
proposed a single stranded model (unineme), structure having six nucleosomes per turn. This
as a long coiled molecule which is associated structure is stabilized by interaction between
with histone proteins in eukaryotes. Plants different H1 molecules. DNA is a solenoid and
and animals have more DNA than bacteria packed about 40 folds. The hierarchical nature
and must fold this DNA to fit into the cell of chromosome structure is illustrated in (Fig.
nucleus. In prokaryotes such as E. coli though 5.3). Additional set of proteins are required
they do not have defined nucleus, the DNA for packing of chromatin at higher level and
is not scattered throughout the cell. DNA are referred to as non-histone chromosomal
(being negatively charged) is held with some proteins (NHC). In a typical nucleus, some
proteins (that have positive charges) in a regions of chromatin are loosely packed (lightly
region called the nucleoid. The DNA as a stained) and are referred to as euchromatin.
nucleoid is organized into large loops held The chromatin that is tightly packed (stained
by protein. DNA of prokaryotes is almost darkly) is called heterochromatin. Euchromatin
circular and lacks chromatin organization, is transcriptionally active and heterochromatin
hence termed genophore. is transcriptionally inactive.
In eukaryotes, this organization is much more
complex. Chromatin is formed by a series of 5.8 DNA Replication
repeating units called nucleosomes. Kornberg Replication of DNA takes place during the
proposed a model for the nucleosome, in S phase of cell cycle. During replication, each
which 2 molecules of the four histone proteins DNA molecule gives rise to two DNA strands,
H2A, H2B, H3 and H4 are organized to identical to each other as well as to the parent
form a unit of eight molecules called histone strand. Three hypotheses of DNA replication
octamere. The negatively charged DNA have been proposed. They are conservative
is wrapped around the positively charged replication, dispersive replication, and semi-
histone octamere to form a structure called conservative replication.
nucleosome. A typical nucleosome contains In conservative replication, the original
200 bp of DNA helix. The histone octameres double helix serves as a template. The original
are in close contact and DNA is coiled on molecule is preserved intact and an entirely
the outside of nucleosome. Neighbouring new double stranded molecule is synthesized.
nucleosomes are connected by linker DNA In dispersive replication, the original molecule
(H1) that is exposed to enzymes. The DNA is broken into fragments and each fragment

Molecular Genetics 70

TN_GOVT_XII_ Bio Zoology_chapter5.indd 70 25-02-2019 19:13:56


www.asiriyar.net

3' 5'
Semi-conservative replication was
T A
proposed by Watson and Crick in 1953. This
C G mechanism of replication is based on the
A T
Parent DNA model. They suggested that the two
C G polynucleotide strands of DNA molecule
C G
G C unwind and start separating at one end.
T A
During this process, covalent hydrogen bonds
C G are broken. The separated single strand then
T A
C G acts as template for the synthesis of a new
T A
strand. Subsequently, each daughter double
T A
Parental Parental helix carries one polynucleotide strand from
A T
strand A T strand the parent molecule that acts as a template
C 3' 5' C
C G C G
and the other strand is newly synthesised
G C and complementary to the parent strand
G C TA
T A
C G
(Fig. 5.4).
C G T A
T A
T A
C G C G 5.8.1 Experimental proof of
A T
T A
DNA replication
T A
A T A T The mode of DNA replication was
5'
3'
3'
determined in 1958 by Meselson and Stahl.
5'
They designed an experiment to distinguish
Daughter
strands between semi conservative, conservative and
dispersive replications. In their experiment,
Fig. 5.4 Semiconservative DNA replication they grew two cultures of E.coli for many
serves as a template for the synthesis of generations in separate media. The ‘heavy’
complementary fragments. Finally two new culture was grown in a medium in which
molecules are formed which consist of both the nitrogen source (NH4Cl) contained the
old and new fragments. heavy isotope 15N and the ‘light’ culture was
grown in a medium in which the nitrogen

Generation I Generation II
15 14
N-DNA N-DNA 14
N-DNA
15
N-DNA 15
N-DNA
14
20 min 40 min N-DNA
14
Gravitational force N-DNA

15 15 14 15 14 14 14 15
N N N N N N N N
Heavy Hybrid Light Hybrid

Fig. 5.5 Meselson and Stahl experiment to support semiconservative mode of DNAreplication

71 Molecular Genetics

TN_GOVT_XII_ Bio Zoology_chapter5.indd 71 25-02-2019 19:13:57


www.asiriyar.net

source contained light isotope 14N for many errors are corrected by repair enzymes such
generations. At the end of growth, they as nucleases. Deoxy nucleotide triphosphate
observed that the bacterial DNA in the heavy acts as substrate and also provides energy for
culture contained only 15N and in the light polymerization reaction.
culture only 14N. The heavy DNA could be Replication begins at the initiation site called
distinguished from light DNA (15N from 14N) the site of ‘origin of replication’ (ori). In
with a technique called Cesium Chloride prokaryotes, there is only one origin of
(CsCl) density gradient centrifugation. In replication, whereas in eukaryotes with giant
this process, heavy and light DNA extracted DNA molecules, there can be several origins
from cells in the two cultures settled into two of replication (replicons). Since the two
distinct and separate bands (hybrid DNA) strands of DNA cannot be separated
(Fig. 5.5). throughout at a time (due to large requirement
The heavy culture (15N) was then transferred of energy) the replication occurs within a
into a medium that had only NH4Cl, and took small opening of the DNA helix called as
samples at various definite time intervals (20 replication fork. Unwinding of the DNA
minutes duration). After the first replication, strand is carried out by DNA helicase. Thus, in
they extracted DNA and subjected it to density one strand (template strand with polarity
gradient centrifugation. The DNA settled 3' 5') the replication is continuous and is
into a band that was intermediate in position known as the leading strand while in the
between the previously determined heavy and other strand (coding strand with polarity
light bands. After the second replication (40 5' 3') replication is discontinuous, known
minutes duration), they again extracted DNA as the lagging strand (Fig. 5.6). The
samples, and this time found the DNA settling discontinuously synthesized fragments of the
into two bands, one at the light band position lagging strand (called the Okazaki fragments)
and one at intermediate position. These results are joined by the enzyme DNA ligase.
confirm Watson and Crick’s semi conservative
replication hypothesis.

5.8.2 Enzymes and mechanism


of replication
In prokaryotes, replication process requires
three types of DNA polymerases (DNA
polymerase I, II, and III). DNA polymerase
III is the main enzyme involved in DNA
replication. DNA polymerase I (also known
as Kornberg enzyme) and DNA polymerase
II are involved in DNA repair mechanism.
Eukaryotes have five types of DNA
polymerases that catalyses the polymerization
of nucleotides at the 3' OH of the new strand
within a short period of time. E.coli that has
4.6 X 106 bp completes its replication process
within 38 minutes. Replication takes place
faster at the same time accurately. Any error Fig 5.6 Mechanism of replication showing a
will lead to mutation. However replication replication fork

Molecular Genetics 72

TN_GOVT_XII_ Bio Zoology_chapter5.indd 72 25-02-2019 19:13:57


www.asiriyar.net

As they move away in both directions, newly information is reversed. RNA synthesizes DNA
synthesized complementary nucleotides are by reverse transcription, then transcribed into
paired with the existing nucleotides on the mRNA by transcription and then into proteins
parent strand and covalently bonded together by translation.
by DNA polymerase. Formation of new strand For a cell to operate, its genes must be
requires a primer (a short stretch of RNA)for expressed. This means that the gene products,
initiation. The primer produces a 3'-OH end on whether proteins or RNA molecules must be
the sequence of ribonucleotides, to which deoxy made. The RNA that carries genetic information
ribonucleotides are added. The RNA primer is encoding a protein from genes into the cell is
ultimately removed leaving a gap in the newly known as messenger RNA (mRNA). For a gene
synthesized DNA strand. It is removed from to be transcribed, the DNA which is a double
5' end one by one by the exonuclease activity helix must be pulled apart temporarily, and
of DNA polymerase. Finally, when all the RNA is synthesized by RNA polymerase. This
nucleotides are in position, gaps are sealed by enzyme binds to DNA at the start of a gene and
the enzyme DNA ligase. opens the double helix. Finally, RNA molecule
At the point of origin of repliction, the is synthesized. The nucleotide sequence in the
helicases and topoisomerases (DNA gyrase) RNA is complementary to the DNA template
unwind and pull apart the strands, forming a strand from which it is synthesized.
Y-Shaped structure called the replication fork. Both the strands of DNA are not copied during
There are two replication forks at each origin. transcription for two reasons. 1. If both the strands
The two strands of a DNA helix have an act as a template, they would code for RNA with
antiparallel orientation. The enzyme DNA different sequences. This in turn would code for
polymerase can only catalyse the addition of a proteins with different amino acid sequences.
nucleotide to the new strands in the 5' 3' This would result in one segment of DNA coding
direction, as it can only add nucleotides to the for two different proteins, hence complicate the
3' carbon position. genetic information transfer machinery. 2. If two
RNA molecules were produced simultaneously,
5.9 Transcription double stranded RNA complementary to each
Francis Crick proposed the Central dogma other would be formed. This would prevent RNA
in molecular biology which states that genetic from being translated into proteins.
information flows as follows:
5.9.1 Transcription unit and gene
A transcriptional unit in DNA is defined by
three regions, a promoter, the structural gene
and a terminator. The promoter is located
towards the 5' end. It is a DNA sequence that
provides binding site for RNA polymerase. The
presence of promoter in a transcription unit,
The process of copying genetic information
defines the template and coding strands. The
from one strand of DNA into RNA is termed
terminator region located towards the 3' end
transcription. This process takes place in
of the coding strand contains a DNA sequence
presence of DNA dependent RNA polymerase.
that causes the RNA polymerase to stop
In some retroviruses that contain RNA as transcribing. In eukaryotes the promoter has
the genetic material (e.g, HIV), the flow of AT rich regions called TATA box (Goldberg-

73 Molecular Genetics

TN_GOVT_XII_ Bio Zoology_chapter5.indd 73 25-02-2019 19:13:57


www.asiriyar.net

Fig. 5. 7 Schematic structure of a transcription unit


Hogness box) and in prokaryotes this region RNA polymerase opens up the DNA to form the
is called Pribnow box. Besides promoter, transcription bubble. The core enzyme moves
eukaryotes also require an enhancer. ahead, manufacturing RNA leaving the sigma
The two strands of the DNA in the structural subunit behind at the promoter region. The end
gene of a transcription unit have opposite of a gene is marked by a terminator sequence
polarity. DNA dependent RNA polymerase that forms a hair pin structure in the RNA. The
catalyses the polymerization in only one sub-class of terminators require a recognition
direction, the strand that has the polarity protein, known as rho (ρ), to function.
3' 5' acts as a template, and is called the
5.9.2 Process of transcription
template strand. The other strand which has
In prokaryotes, there are three major types
the polarity 5' 3' has a sequence same as
of RNAs: mRNA, tRNA, and rRNA. All three
RNA (except thymine instead of uracil) and is
RNAs are needed to synthesize a protein in a cell.
displaced during transcription. This strand is
The mRNA provides the template, tRNA brings
called coding strand (Fig. 5.7).
amino acids and reads the genetic code, and
The structural gene may be monocistronic
rRNAs play structural and catalytic role during
(eukaryotes) or polycistronic (prokaryotes). In
translation. There is a single DNA-dependent
eukaryotes, each mRNA carries only a single
RNA polymerase that catalyses transcription of all
gene and encodes information for only a single
types of RNA. It binds to the promoter and initiates
protein and is called monocistronic mRNA. In
transcription (Initiation). The polymerase binding
prokaryotes, clusters of related genes, known as
sites are called promoters. It uses nucleoside
operon, often found next to each other on the
triphosphate as substrate and polymerases in
chromosome are transcribed together to give a
a template depended fashion following the
single mRNA and hence are polycistronic.
rule of complementarity. After the initiation
Before starting transcription, RNA polymerase of transcription, the polymerase continues to
binds to the promoter, a recognition sequence in elongate the RNA, adding one nucleotide after
front of the gene. Bacterial (prokaryotic) RNA another to the growing RNA chain. Only a short
polymerase consists of two major components, stretch of RNA remains bound to the enzyme,
the core enzyme and the sigma subunit. The when the polymerase reaches a terminator at the
core enzyme (β1, β, and α) is responsible for end of a gene, the nascent RNA falls off, so also the
RNA synthesis whereas a sigma subunit is RNA polymerase.
responsible for recognition of the promoter.
The question is, how the RNA polymerases
Promoter sequences vary in different organisms.
are able to catalyse the three steps initiation,

Molecular Genetics 74

TN_GOVT_XII_ Bio Zoology_chapter5.indd 74 25-02-2019 19:13:57


www.asiriyar.net

Initiation
5' 5'
3' 3'
Promoter σ RNA polymerase DNA helix
Sigma factor
In
Elongation Eukaryotes, there are at least
three RNA polymerases
5' 5' in the nucleus (in addition
to RNA polymerase found
3' 3'
Terminator in the organelles). There is
RNA σ a clear division of labour.
The RNA polymerase I
Termination
transcribes rRNAs (28S, 18S
5' 5' and 5.8S), whereas the RNA
3' 3' polymerase III is responsible
for transcription of tRNA,
Rho factor ρ 5srRNA and snRNA.
RNA
The RNA polymerase
RNA Polymerase
II transcribes precursor
Fig. 5. 8 Process of transcription in prokaryotes
of mRNA, the hnRNA
(heterogenous nuclear RNA). In eukaryotes, the
elongation and termination? The RNA monocistronic structural genes have interrupted
polymerase is only capable of catalyzing the coding sequences known as exons (expressed
process of elongation. The RNA polymerase sequences) and non- coding sequences called
associates transiently with initiation factor sigma introns (intervening sequences). The introns are
(σ) and termination factor rho (r) to initiate removed by a process called splicing. hnRNA
and terminate the transcription, respectively. undergoes additional processing called as capping
Association of RNA with these factors instructs and tailing. In capping an unusual nucleotide,
the RNA polymerase either to initiate or methyl guanosine triphosphate is added at the 5'
terminate the process of transcription (Fig. 5.8). end, whereas adenylate residues (200-300) (Poly
In bacteria, since the mRNA does not A) are added at the 3' end in tailing (Fig. 5.9).
require any processing to become active Thereafter, this processed hnRNA, now called
and also since transcription and translation mRNA is transported out of the nucleus for
take place simultaneously in the same translation.
compartment (since there is no separation of The split gene feature of eukaryotic genes
cytosol and nucleus in bacteria), many times is almost entirely absent in prokaryotes.
the translation can begin much before the Originally each exon may have coded for
mRNA is fully transcribed. This is because a single polypeptide chain with a specific
the genetic material is not separated from function. Since exon arrangement and intron
other cell organelles by a nuclear membrane removal are flexible, the exon coding for
consequently; transcription and translation these polypeptide subunits act as domains
can be coupled in bacteria. combining in various ways to form new genes.
Single genes can produce different functional
75 Molecular Genetics

TN_GOVT_XII_ Bio Zoology_chapter5.indd 75 25-02-2019 19:13:57


www.asiriyar.net

DNA molecule? Are


5' 5' they written in
coded language on
3' 3' a DNA molecule?
Capping If they occur in the
3' m RNA
Intron language of codes
Cap Exon what is the nature
of genetic code?
m
Gppp Polyadenylation The translation of
5'
RNA splicing proteins follows
3' the triplet rule; a
m
Gppp
5' sequence of three
Poly A tail mRNA base (a
m
Gppp
codon) designates
5' one of the 20
3' different kinds of
Messenger 5'
m
Gppp
amino acids used in
RNA (m RNA)
protein synthesis.
Genetic code is the
Fig. 5.9 Process of transcription in eukaryotes
sequence relationship
proteins by arranging their exons in several
between nucleotide in genes (or mRNA) and
different ways through alternate splicing
the amino acids in the proteins they encode.
patterns, a mechanism known to play an
There are 64 possible triplets, and 61 of them are
important role in generating both protein and
used to represent amino acids. The remaining
functional diversity in animals. Introns would
three triplet codons are termination signals
have arosen before or after the evolution of
for polypeptide chains. Since there are only 20
eukaryotic gene. If introns arose late how did
amino acids involved in protein synthesis, most
they enter eukaryotic gene? Introns are mobile
of them are encoded by more than one triplet.
DNA sequences that can splice themselves out
Two things make this multiple (degenerate)
of, as well as into, specific ‘target sites’ acting
coding possible. First, there is more than one
like mobile transposon-like elements (that
tRNA for most amino acids. Each tRNA has
mediate transfer of genes between organisms
a different anticodon. Second, this pairing is
– Horizontal Gene Transfer - HGT). HGT
highly specific for the first two portions on the
occurs between lineages of prokaryotic
codon, permitting Watson and Crick base pairs
cells, or from prokaryotic to eukaryotic cells
(A – U and G - C) to be formed. But at the third
and between eukaryotic cells. HGT is now
position there is a great deal of flexibility as to
hypothesized to have played a major role in
which base pairs are acceptable. Most part of
the evolution of life on earth.
the genetic code is universal, being the same in
5.10 Genetic Code prokaryotes and eukaryotes.
DNA is the genetic material that carries The order of base pairs along DNA molecule
genetic information in a cell and from controls the kind and order of amino acids
generation to generation. At this stage, an found in the proteins of an organism. This
attempt will be made to determine in what specific order of base pairs is called genetic
manner the genetic information exists in code, the blue print establishing the kinds of

Molecular Genetics 76

TN_GOVT_XII_ Bio Zoology_chapter5.indd 76 25-02-2019 19:13:57


www.asiriyar.net

proteins to be synthesized which makes an chloroplast genomes. However similarities


organism unique. are more common than differences.
Marshall Nirenberg, Severo Ochoa (enzyme • A non-overlapping codon means that the
polynucleotide phosphorylase called Ochoa’s same letter is not used for two different
enzyme), Hargobind Khorana, Francis Crick codons. For instance, the nucleotide
and many others have contributed significantly sequence GUU GUC represents only two
to decipher the genetic code. The order in which codons.
bases are arranged in mRNA decides the order • It is comma less, which means that the
in which amino acids are arranged in proteins. message would be read directly from one
Finally a checker board for genetic code was end to the other i.e., no punctuation are
prepared (table 5.1). needed between two codes.
The salient features of genetic code are as • A degenerate code means that more than
follows: one triplet codon could code for a specific
• The genetic codon is a triplet code and 61 amino acid. For example, codons GUU,
codons code for amino acids and 3 codons GUC, GUA and GUG code for valine.
do not code for any amino acid and • Non-ambiguous code means that one
function as stop codon (Termination). codon will code for one amino acid.
• The genetic code is universal. It means that • The code is always read in a fixed direction
all known living systems use nucleic acids i.e. from 5'→3' direction called polarity.
and the same three base codons (triplet • AUG has dual functions. It acts as a
codon) direct the synthesis of protein initiator codon and also codes for the
from amino acids. For example, the mRNA amino acid methionine.
(UUU) codon codes for phenylalanine in all
• UAA, UAG (tyrosine) and UGA
cells of all organisms. Some exceptions are
(tryptophan) codons are designated as
reported in prokaryotic, mitochondrial and

Table 5.1 Genetic code dictionary


6HFRQG1XFOHRWLGHLQ&RGRQ
8 & $ *
8883KH)3KHQ\ODODQLQH 8&86HU66HULQH 8$87\U<7\URVLQH 8*8&\V&&\VWHLQH 8
88&3KH)3KHQ\ODODQLQH 8&&6HU66HULQH 8$&7\U<7\URVLQH 8*&&\V&&\VWHLQH &
8 8&$6HU66HULQH 8$$7HUPLQDWLRQ 8*$7HUPLQDWLRQ
88$/HX//HXFLQH $
8*&6HU66HULQH 8$*7HUPLQDWLRQ 8**7US:7U\SWRSKDQ
7KLUGQXFOHRWLGHLQFRGRQ ¶HQG

88*/HX//HXFLQH
)LUVWQXFOHRWLGHLQFRGRQ ¶HQG

&88/HX//HXFLQH &&83UR33UROLQH &$8+LV++LVWLGLQH &*8$UJ5$UJLQLQH 8


&$&+LV++LVWLGLQH &*&$UJ5$UJLQLQH
& &8&/HX//HXFLQH &&&3UR33UROLQH &
&8$/HX//HXFLQH &&$3UR33UROLQH &$$*OQ4*OXWDPLQH &*$$UJ5$UJLQLQH $
&8*/HX//HXFLQH &&*3UR33UROLQH &$**OQ4*OXWDPLQH &**$UJ5$UJLQLQH *

$88,OH,,VROHXFLQH $&87KU77KUHRQLQH $$8$VQ1$VSDUDJLQH $*86HU66HULQH 8


$ $8&,OH,,VROHXFLQH $&&7KU77KUHRQLQH $$&$VQ1$VSDUDJLQH $*&6HU66HULQH &
$8$,OH,,VROHXFLQH $&$7KU77KUHRQLQH $$$/\V./\VLQH $*$$UJ5$UJLQLQH $
$8*0HW00HWKLRQLQH $&*7KU77KUHRQLQH $$*/\V./\VLQH $**$UJ5$UJLQLQH *

*889DO99DOLQH *&8$OD$$ODQLQH *$8$VS'$VSDUWLFDFLG **8*O\**O\FLQH 8


* *8&9DO99DOLQH *&&$OD$$ODQLQH *$&$VS'$VSDUWLFDFLG **&*O\**O\FLQH &
*8$9DO99DOLQH *&$$OD$$ODQLQH *$$*OX(*OXWDPLFDFLG **$*O\**O\FLQH $
*8*9DO99DOLQH *&*$OD$$ODQLQH *$**OX(*OXWDPLFDFLG ****O\**O\FLQH *

&RGRQ 7KUHHOHWWHUDQGVLQJOHOHWWHUDEEUHYLDWLRQV

77 Molecular Genetics

TN_GOVT_XII_ Bio Zoology_chapter5.indd 77 25-02-2019 19:13:57


www.asiriyar.net

termination (stop) codons and also are


known as “non-sense” codons. Wobble Hypothesis
It is a hypothesis proposed by Crick
5.10.1 Mutation and genetic code (1966) which states that tRNA anticodon
Comparative studies of mutations (sudden has the ability to wobble at its 5’ end by
change in a gene) and corresponding pairing with even non-complementary
alteration in amino acid sequence of specific base of mRNA codon. According to this
protein have confirmed the validity of the hypothesis, in codon-anticodon pairing
genetic code. The relationship between genes the third base may not be complementary.
and DNA are best understood by mutation The third base of the codon is called
studies. The simplest type of mutation at the wobble base and this position is called
molecular level is a change in nucleotide that wobble position. The actual base pairing
substitutes one base for another. Such changes occurs at first two positions only. The
are known as base substitutions which may importance of Wobbling hypothesis
occur spontaneously or due to the action of is that it reduces the number of tRNAs
mutagens. A well studied example is sickle required for polypeptide synthesis and it
cell anaemia in humans which results from a overcomes the effect of code degeneracy.
point mutation of an allele of β-haemoglobin
gene (βHb). A haemoglobin molecule
consists of four polypeptide chains of two
types, two α chains and two β-chains. Each
chain has a heme group on its surface. The
heme groups are involved in the binding of
oxygen. The human blood disease, sickle cell
anaemia is due to abnormal haemoglobin.
This abnormality in haemoglobin is due to a In the above example though the
single base substitution at the sixth codon of codon and the anti codon do not match
the beta globin gene from GAG to GTG in β perfectly, yet the required amino acid
-chain of haemoglobin. It results in a change is brought perfectly. This enables the
of amino acid glutamic acid to valine at the 6th economy of tRNA, GUU, GUC, GUA and
position of the β -chain. This is the classical GUG code for the amino acid - Valine.
example of point mutation that results in the

DNA sequence 5' 3'


of non-template G T G C A C C T G A C T C C T G A G G A G
(coding) strand

Amino acid Glutamic Glutamic


sequence Valine Histidine Leucine Threonine Proline acid Normal red blood cells
acid

DNA sequence 5' 3'


of non-template G T G C A C C T G A C T C C T G T G G A G
(coding) strand

Amino acid Glutamic


Valine Histidine Leucine Threonine Proline Valine
sequence acid
Mutant Sickled red blood cells

DNA point mutation can lead to a different amino acid sequence Phenotype

Fig. 5. 10 DNA point mutation

Molecular Genetics 78

TN_GOVT_XII_ Bio Zoology_chapter5.indd 78 25-02-2019 19:13:58


www.asiriyar.net

change of amino acid residue glutamic acid to and ribosomal binding loop at their ends.
valine (Fig. 5.10). The mutant haemoglobin In addition it also shows a small lump called
undergoes polymerisation under oxygen variable loop or extra arm. The amino acid
tension causing the change in the shape of is attached to one end (amino acid acceptor
the RBC from biconcave to a sickle shaped end) and the other end consists of three
structure. anticodon nucleotides. The anticodon pairs
with a codon in mRNA ensuring that the
The effect of point mutation can be
correct amino acid is incorporated into the
understood by the following example.
growing polypeptide chain. Four different
ABC DEF GHI JKL regions of double-stranded RNA are formed
during the folding process. Modified bases
If we insert a letter O between DEF are especially common in tRNA. Wobbling
and GHI the arrangement would be between anticodon and codon allows some
ABC DEF OGH IJK L tRNA molecules to read more than one codon.
The process of addition of amino acid
If we insert OQ at the same place the to tRNA is known as aminoacylation or
arrangement would be charging and the resultant product is called
aminoacyl- tRNA (charged tRNA). Without
ABC DEF OQG HIJ KL
aminoacylation tRNA is known as uncharged
The above information shows that insertion tRNA (Fig. 5.12). If two such tRNAs are
or deletion of one or two bases, changes the brought together peptide bond formation is
reading frame from the point of insertions or favoured energetically. Numbers of amino
deletions. Such mutations are referred to as acids are joined by peptide bonds to form a
frame shift insertion or deletion mutations. polypeptide chain. This aminoacylation is
This forms the genetic basis of proof that codon catalyzed by an enzyme aminoacyl – tRNA
is a triplet and is read in a continuous manner.
$PLQRDFLGDWWDFKHGKHUH

5.11. tRNA – the adapter molecule $ 


HQG
&
The transfer RNA, (tRNA) molecule of a &
$ 6WHP
cell acts as a vehicle that picks up the amino 
HQG * *
& *
acids scattered through the cytoplasm and * &
* 8
also reads specific codes of mRNA molecules. $ 8
8 $ 7ORRS 7\&
Hence it is called an adapter molecule. This 'ORRS '+8 8 $ 8
term was postulated by Francis Crick. ' * $ & 8 & * $8 *$ & $& & $
& *
The two dimensional clover leaf model of * & 8* 8* 7 \ &
* ' $ * $ * ** &
8 7K\PLGLQH3VHXGRXULGLQH
tRNA was proposed by Robert Holley. The
'LK\GURXULGLQH & *$ * DQG&\WLGLQH
secondary structure of tRNA depicted in & * * 9DULDEOHORRS
$ 8
Fig. 5.11 looks like a clover leaf. In actual * *
structure, the tRNA is a compact molecule $ \
& $
which looks like an inverted L. The clover 8 < $QWLFRGRQORRS
*$ $
leaf model of tRNA shows the presence of
three arms namely DHU arm, middle arm $QWLFRGRQ
and TΨC arm. These arms have loops such Fig. 5.11 Holley’s two-dimensional clover
as amino acyl binding loop, anticodon loop leaf model of transfer RNA
79 Molecular Genetics

TN_GOVT_XII_ Bio Zoology_chapter5.indd 79 25-02-2019 19:13:58


www.asiriyar.net

synthetase. This is an endothermic reaction Translation refers to the


and is associated with ATP hydrolysis. 20 process of polymerization
different aminoacyl – tRNA synthetases are of amino acids to form poly
known. The power to recognize codon on the peptide chain. The decoding
mRNA lies in the tRNA and not in the attached process is carried out by
amino acid molecule. ribosomes that bind mRNA
and charged tRNA molecules. The mRNA is
The tRNA charged with amino acid serves as
translated, starting at the 5' end. After binding
an adapter molecule to decode the information
to mRNA, the ribosomes move along it, adding
on mRNA. This is achieved by the interaction
new amino acids to the growing polypeptide
of tRNA with mRNA. The tRNA molecule has
chain each time it reads a codon. Each codon
a region that contains complementary bases
is read by an anticodon on the corresponding
(anticodon) to the codon on the mRNA. For
tRNA. Hence the order and sequence of amino
initiation, there is another specific tRNA that
acids are defined by the sequence of bases in the
is referred to as initiator tRNA. There are no
mRNA.
tRNAs for stop codons.
5.12.1 Mechanism of Translation
The cellular factory responsible for
synthesizing protein is the ribosome. The
ribosome consists of structural RNAs and
about 80 different proteins. In inactive state,
it exists as two subunits; large subunit and
small subunit. When the subunit encounters
an mRNA, the process of translation of the
mRNA to protein begins. The prokaryotic
ribosome (70 S) consists of two subunits,
the larger subunit (50 S) and smaller subunit
(30 S). The ribosomes of eukaryotes (80 S)
are larger, consisting of 60 S and 40 S sub
units. ‘S’ denotes the sedimentation efficient
which is expressed as Svedberg unit (S). The
30 S subunit of bacterial ribosome contains
16Sr RNA and 50 S subunit contains 5Sr RNA
molecules and 23 S RNA and 31 ribosomal
proteins. The larger subunit in eukaryotes
consist of a 23 S RNA and 5Sr RNA molecule
and 31 ribosomal proteins. The smaller
Fig. 5.12 Steps involved in charging tRNA. eukaryotic subunit consist of 18Sr RNA
The ‘X’ denotes that for each amino acid component and about 33 proteins.
only the corresponding specific tRNA and
specific aminoacyl tRNA synthetase enzyme One of the alternative ways of dividing
are involved in the charging process. up a sequence of bases in DNA or RNA
into codons is called reading frame. Any
5.12 Translation sequence of DNA or RNA, beginning with
a start codon and which can be translated

Molecular Genetics 80

TN_GOVT_XII_ Bio Zoology_chapter5.indd 80 25-02-2019 19:13:58


www.asiriyar.net

subunits of the ribosomes (30 S and 50 S) are


usually dissociated from each other when not
involved in translation (Fig. 5.13a).
Initiation of translation in E. coli
begins with the formation of an initiation
complex, consisting of the 30S subunits of
the ribosome, a messenger RNA and the
charged N-formyl methionine tRNA (f met – t

Fig. 5.13 a-Translation components

into a protein is known as an Open Reading


Frame (ORF). A translational unit in mRNA
is the sequence of RNA that is flanked by
the start codon (AUG) and the stop codon
and codes for polypeptides. mRNA also
have some additional sequences that are not
translated and are referred to as Untranslated
Regions (UTR). UTRs are present at both 5'
end (before start codon) and at 3' end (after
stop codon). The start codon (AUG) begins
the coding sequence and is read by a special
tRNA that carries methionine (met). The
initiator tRNA charged with methionine
binds to the AUG start codon. In prokaryotes,
N - formyl methionine (f met) is attached to
the initiator tRNA whereas in eukaryotes
unmodified methionine is used. The 5' end
of the mRNA of prokaryotes has a special
sequence which precedes the initial AUG
start codon of mRNA. This ribosome binding
site is called the Shine – Dalgarno sequence
or S-D sequence. This sequences base-pairs
with a region of the 16Sr RNA of the small
ribosomal subunit facilitating initiation. The Fig. 5.13 b- Initiation

81 Molecular Genetics

TN_GOVT_XII_ Bio Zoology_chapter5.indd 81 25-02-2019 19:13:58


www.asiriyar.net

RNA f met), three proteinaceous


initiation factors (IF1, IF2,
IF3), GTP(Guanine Tri
Phosphate) and Mg . 2+

The components that form


the initiation complex interact
in a series of steps. IF3 binds
to the 30S and allows the 30S
subunit to bind to mRNA.
Another initiation protein
(IF2) then enhances the
binding of charged formyl
methionine tRNA to the small
subunit in response to the
AUG triplet. This step ‘sets’
the reading frame so that all
subsequent groups of three
ribonucleotides are translated
accurately.
The assembly of ribosomal
subunits, mRNA and tRNA
represent the initiation
complex. Once initiation
complex has been assembled,
IF3 is released and allows the
initiation complex to combine
with the 50S ribosomal subunit
to form the complete ribosome
(70S). In this process a
molecule of GTP is hydrolyzed
providing the required energy
and the initiation factors (IF2 Fig. 5.13 c- Elongation of the growing polypeptide chain
and IF2 and GDP) are released during translation
(Fig. 5.13 b).
of the ribosome to form hydrogen bonds
Elongation is the second phase of between its anticodon and the second codon
translation. Once both subunits of the on the mRNA (step1). This step requires the
ribosomes are assembled with the mRNA, correct transfer RNA, another GTP and two
binding sites for two charged tRNA molecules proteins called elongation factors (EF-Ts and
are formed. The sites in the ribosome are EF-Tu).
referred to as the aminoacyl site (A site), the
Once the charged tRNA molecule is positioned
peptidyl site (P site) and the exit site (E site).
at the A site, the enzyme peptidyl transferase
The charged initiator tRNA binds to the P
catalyses the formation of peptide bonds that
site. The next step in prokaryotic translation
link the two amino acids together (step 2). At the
is to position the second tRNA at the ‘A’ site

Molecular Genetics 82

TN_GOVT_XII_ Bio Zoology_chapter5.indd 82 25-02-2019 19:13:59


www.asiriyar.net

same time, the covalent bond between the amino Termination is the third phase of translation.
acid and tRNA occupying the P site is hydrolyzed Termination of protein synthesis occurs when
(broken). The product of this reaction is a one of the three stop codons appears in the
dipeptide which is attached to the 3’ end of tRNA ‘A’ site of the ribosome. The terminal codon
still residing in the A site. For elongation to be signals the action of GTP – dependent release
repeated, the tRNA attached to the P site, which factor, which cleaves the polypeptide chain
is now uncharged is released from the large from the terminal tRNA releasing it from
subunit. The uncharged tRNA moves through the translational complex (step 1). The tRNA
the ‘E’ site on the ribosome. is then released from the ribosome, which
The entire mRNA-tRNA-aa1-aa2 complex then dissociates into its subunits (step 2)
shifts in the direction of the ‘P’ site by a distance (Fig. 5.13 d).
of three nucleotides (step 3). This step requires Many antibiotics do not allow pathogenic
several elongation factors (EFs) and the energy bacteria to flourish in animal host because
derived from hydrolysis of GTP. This results in the they inhibit one or the other stage of bacterial
third triplet of mRNA to accept another charged protein synthesis. The antibiotic tetracycline
tRNA into the A site (step 4). The sequence of inhibits binding between aminoacyl
elongation is repeated over and over (step 5 and tRNA and mRNA. Neomycin inhibits the
step 6). An additional amino acid is added to the interaction between tRNA and mRNA.
growing polypeptide, each time mRNA advances Erythromycin inhibits the translocation of
through the ribosome. Once a polypeptide chain mRNA along the ribosome. Streptomycin
is assembled, it emerges out from the base of the inhibits the initiation of translation and
large subunit (Fig. 5.13 c). causes misreading. Chloramphenicol
inhibits peptidyl transferase and formation
of peptide bonds.

5.13 Regulation of gene expression


We have previously established how DNA
is organized into genes, how genes store
genetic information, and how this information
is expressed. We now consider the most
fundamental issues in molecular genetics.
How is genetic expression regulated? Evidence
in support of the idea that genes can be turned
on and off is very convincing. Regulation of
gene expression has been extensively studied
in prokaryotes, especially in E. coli. Gene
expression can be controlled or regulated
at transcriptional or post transcriptional or
translational level. Here, we are going to discuss
regulation of gene expression at transcriptional
level. Usually, small extracellular or intracellular
metabolites trigger initiation or inhibition
Fig. 5.13 d- Termination of
of gene expression. The clusters of gene with
the process of translation
83 Molecular Genetics

TN_GOVT_XII_ Bio Zoology_chapter5.indd 83 25-02-2019 19:13:59


www.asiriyar.net

related functions are called operons. They regulation in E.coli. In lac operon, a polycistronic
usually transcribe single mRNA molecules. structural gene is regulated by a common
In E.coli, nearly 260 genes are grouped into 75 promoter and regulatory gene. When the cell is
different operons. using its normal energy source as glucose, the
Structure of the operon: Each operon is a unit ‘i’ gene transcribes a repressor mRNA and after
of gene expression and regulation and consists its translation, a repressor protein is produced.
of one or more structural genes and an adjacent It binds to the operator region of the operon and
operator gene that controls transcriptional prevents translation, as a result, β-galactosidase is
activity of the structural gene. not produced. In the absence of preferred carbon
source such as glucose, if lactose is available as
i) The structural gene codes for proteins,
an energy source for the bacteria then lactose
rRNA and tRNA required by the cell.
enters the cell as a result of permease enzyme.
ii) Promoters are the signal sequences in
Lactose acts as an inducer and interacts with the
DNA that initiate RNA synthesis. RNA
repressor to inactivate it.
polymerase binds to the promoter prior
The repressor protein binds to the operator
to the initiation of transcription.
of the operon and prevents RNA polymerase
iii) The operators are present between the
from transcribing the operon. In the presence
promoters and structural genes. The
of inducer, such as lactose or allolactose, the
repressor protein binds to the operator
repressor is inactivated by interaction with the
region of the operon.
inducer. This allows RNA polymerase to bind
The Lac (Lactose) operon: The metabolism to the promotor site and transcribe the operon
of lactose in E.coli requires three enzymes to produce lac mRNA which enables formation
– permease, β-galactosidase (β-gal) and of all the required enzymes needed for lactose
transacetylase. The enzyme permease is metabolism (Fig. 5.14). This regulation of
needed for entry of lactose into the cell,
β-galactosidase brings about
51$3RO\PHUDVH
hydrolysis of lactose to XQDEOHWRELQGWR
glucose and galactose, while SURPRWRU
,QDEVHQFH
transacetylase transfers acetyl S L S R ] \ D RILQGXFHU

group from acetyl Co A to


5HSUHVVRUELQGVWRWKHRSHUDWRU
β-galactosidase. 5HSUHVVRUP51$ UHJLRQ R DQGSUHYHQWV51$
SRO\PHUDVHIURPWUDQVFULELQJ
The lac operon consists of one WKHRSHURQ

regulator gene (‘i’ gene refers to


5HSUHVVRU
inhibitor) promoter sites (p),
and operator site (o). Besides 51$3RO\PHUDVHELQGWRSURPRWRU
,QSUHVHQFH
these, it has three structural S L S R ] \ D RILQGXFHU

genes namely lac z,y and lac 7UDQVFULSWLRQ


a. The lac ‘z’ gene codes for
5HSUHVVRUP51$ ODFP51$
β-galactosidase, lac ‘y’ gene
codes for permease and ‘a’ gene ] \ D
,QGXFHU 7UDQVODWLRQ
codes for transacetylase.
Jacob and Monod proposed βJDODFWRVLGDVHSHUPHDVHWUDQVDFHW\ODVH

the classical model of Lac operon ,QDFWLYHUHSUHVVRU

to explain gene expression and Fig. 5.14 Lac Operon model


Molecular Genetics 84

TN_GOVT_XII_ Bio Zoology_chapter5.indd 84 25-02-2019 19:13:59


www.asiriyar.net

lac operon by the repressor is an example of For sequencing, the total DNA from a cell is
negative control of transcription initiation. Lac isolated and converted into random fragments of
operon is also under the control of positive relatively smaller sizes and cloned in suitable hosts
regulation as well. using specialized vectors. This cloning results in
amplification of pieces of DNA fragments so that
5.14 Human Genome it could subsequently be sequenced with ease.
Project (HGP) Bacteria and yeast are two commonly used hosts
The international human genome project and these vectors are called as BAC (Bacterial
was launched in the year 1990. It was a mega Artificial Chromosomes) and YAC (Yeast
project and took 13 years to complete. The Artificial Chromosomes). The fragments are
human genome is about 25 times larger than sequenced using automated DNA sequencers
the genome of any organism sequenced to (developed by Frederick Sanger). The sequences
date and is the first vertebrate genome to be are then arranged based on few overlapping
completed. Human genome is said to have regions, using specialized computer based
approximately 3×109 bp. HGP was closely programs. These sequences were subsequently
associated with the rapid development of a annotated and are assigned to each chromosome.
new area in biology called bioinformatics. The genetic and physical maps on the genome are
assigned using information on polymorphism
5.14.1 Goals and methodologies of of restriction endonuclease recognition sites
Human Genome Project and some repetitive DNA sequences, called
The main goals of Human Genome Project are microsatellites. The latest method of sequencing
as follows even longer fragments is by a method called
Shotgun sequencing using super computers,
• Identify all the genes (approximately which has replaced the traditional sequencing
30000) in human DNA. methods.
• Determine the sequence of the three
billion chemical base pairs that makeup 5.14.2 Salient features of Human
the human DNA. Genome Project:
• To store this information in databases. • Although human genome contains 3 billion
nucleotide bases, the DNA sequences that
• Improve tools for data analysis.
encode proteins make up only about 5% of the
• Transfer related technologies to other genome.
sectors, such as industries. • An average gene consists of 3000 bases, the
• Address the ethical, legal and social issues largest known human gene being dystrophin
(ELSI) that may arise from the project. with 2.4 million bases.
The methodologies of the Human Genome • The function of 50% of the genome is derived
Project involved two major approaches. One from transposable elements such as LINE and
approach was focused on identifying all the genes ALU sequence.
that are expressed as RNA (ETSS – Expressed • Genes are distributed over 24 chromosomes.
Sequence Tags). The other approach was sequence Chromosome 19 has the highest gene density.
annotation. Here, sequencing the whole set of Chromosome 13 and Y chromosome have
genome was taken, that contains all the coding lowest gene densities.
and non-coding sequences and later assigning
different regions in the sequences with functions.

85 Molecular Genetics

TN_GOVT_XII_ Bio Zoology_chapter5.indd 85 25-02-2019 19:13:59


www.asiriyar.net

• The chromosomal organization of human than treating the symptoms will be an important
genes shows diversity. advantage.
• There may be 35000-40000 genes in the • Once genetic sequence becomes easier to
genome and almost 99.9 nucleotide bases are determine, some people may attempt to use
exactly the same in all people. this information for profit or for political
• Functions for over 50 percent of the discovered power.
genes are unknown. • Insurance companies may refuse to insure
• Less than 2 percent of the genome codes for people at ‘genetic risk’ and this would save
proteins. the companies the expense of future medical
bills incurred by ‘less than perfect’ people.
• Repeated sequences make up very large
portion of the human genome. Repetitive • Another fear is that attempts are being made
sequences have no direct coding functions to “breed out” certain genes of people from
but they shed light on chromosome structure, the human population in order to create a
dynamics and evolution (genetic diversity). ‘perfect race’.

• Chromosome 1 has 2968 genes whereas


Pharmacogenomics
chromosome ’Y’ has 231 genes.
is the study of how
• Scientists have identified about 1.4 million genes affect a person’s
locations where single base DNA differences response to drugs.
(SNPs – Single nucleotidepolymorphism
This relatively new field combines
– pronounce as ‘snips’) occur in humans.
pharmacology (the science of drugs)
Identification of ‘SNIPS’ is helpful in finding
and genomics (the study of genes and
chromosomal locations for disease associated
sequences and tracing human history.
their functions) to develop effective,
safe medications and doses that will be
5.14.3 Applications and tailored to a person’s genetic makeup.
future challenges
5.15 DNA fingerprinting technique
The mapping of human chromosomes is
possible to examine a person’s DNA and to The DNA fingerprinting technique was first
identify genetic abnormalities. This is extremely developed by Alec Jeffreys in 1985 (Recipient of
useful in diagnosing diseases and to provide the Royal Society’s Copley Medal in 2014). Each
genetic counselling to those planning to have of us have the same chemical structure of DNA.
children. This kind of information would also But there are millions of differences in the DNA
create possibilities for new gene therapies. sequence of base pairs. This makes the uniqueness
Besides providing clues to understand among us so that each of us except identical twins
human biology, learning about non-human is different from each other genetically. The DNA
organisms, DNA sequences can lead to an of a person and finger prints are unique. There are
understanding of their natural capabilities 23 pairs of human chromosomes with 1.5 million
that can be applied towards solving challenges pairs of genes. It is a well known fact that genes
in healthcare, agriculture, energy production are segments of DNA which differ in the sequence
and environmental remediation. A new era of of their nucleotides. Not all segments of DNA
molecular medicine, characterized by looking code for proteins, some DNA segments have a
into the most fundamental causes of disease regulatory function, while others are intervening
sequences (introns) and still others are repeated
Molecular Genetics 86

TN_GOVT_XII_ Bio Zoology_chapter5.indd 86 25-02-2019 19:13:59


www.asiriyar.net

DNA sequences. In DNA fingerprinting, short DNA finger printing involves identifying
repetitive nucleotide sequences are specific for a differences in some specific regions in DNA
person. These nucleotide sequences are called as sequence called repetitive DNA, because in these
variable number tandem repeats (VNTR).The sequences, a small stretch of DNA is repeated
many times. These repetitive DNA are separated
VNTRs of two persons generally show variations
from bulk genomic DNA as different peaks during
and are useful as genetic markers.
density gradient centrifugation. The bulk DNA
1
forms a major peak and the other small peaks
2 Chromosome 7 Chromosome 7
are referred to as satellite DNA. Depending on
base composition (A : T rich or G : C rich), length
Chromosome 2 Chromosome 2
of segment and number of repetitive units, the
satellite DNA is classified into many sub categories
Chromosome 16 Chromosome 16
such as micro-satellites, mini-satellites, etc., These
1 Paternal Chromosome DNA from individual (A)
sequences do not code for any proteins, but they
2 Maternal Chromosome DNA from individual (B)
f orm a large portion of human genome. These
C A B
0 11 Number of short tandem repeats
sequences show high degree of polymorphism
12
11
and form the basis of DNA fingerprinting (Fig.
Chromosome 7 10
9 5.15). DNA isolated from blood, hair, skin cells,
or other genetic evidences left at the scene of a
8
7
Chromosome 2 6
5
4
crime can be compared through VNTR patterns,
3
2
with the DNA of a criminal suspect to determine
Chromosome 16 1
guilt or innocence. VNTR patterns are also useful
DNA from crime scene (c) Amplified repeats, separated by size on
a gel, give a DNA fingerprint in establishing the identity of a homicide victim,
Fig. 5.15 Schematic representation of either from DNA found as evidence or from the
DNA fingerprinting : Few representative body itself.
chromosomes have been shown to contain The Steps in DNA Fingerprinting technique is
different copy number of VNTR depicted in Fig. 5.16

2 3

DNA is extracted DNA is cut into


from blood cells fragments by a
1
restriction enzyme 4
Blood sample
The DNA fragments
are separated into bands
during electrophoresis
11 in an agarose gel
The X-ray film is developed
to make visible the pattern of
bands which is known as a
DNA fingerprint 6 5
The radioactive The DNA band pattern in
DNA probe the gel is transferred to
is prepared a nylon membrane by
10 a technique known
as southern blotting
X-ray film is placed
next to the membrane
to detect the radioactive
pattern 7
The DNA probe binds
to specific DNA
sequences on the
9 membrane
At this stage, the
8
radioactivity probe is
bound to the DNA pattern Excess DNA probe is
on the membrane washed off

Fig. 5.16 Steps in DNA finger printing


87 Molecular Genetics

TN_GOVT_XII_ Bio Zoology_chapter5.indd 87 25-02-2019 19:14:01


www.asiriyar.net

Application of DNA synthesis. DNA has capacity of replication, while


finger printing the three types of RNA are transcribed on DNA.
Meselson and Stahl (1958) proved experimentally
• Forensic analysis - It can be used in the
the semi-conservative nature of DNA replication
identification of a person involved in
criminal activities, for settling paternity using heavy isotope of nitrogen N15 in E.coli.
or maternity disputes, and in determining In 1958 Crick proposed that DNA determines
relationships for immigration purposes. the sequence of amino acids in a polypeptide
• Pedigree analysis – inheritance pattern (protein) through mRNA, and proposed the
of genes through generations and for central dogma of protein synthesis which
detecting inherited diseases. involves transcription and translation. The
process of copying genetic information from one
• Conservation of wild life – protection of
strand of DNA into RNA is termed transcription.
endangered species. By maintaining DNA
The DNA transcribed RNA molecules serve as a
records for identification of tissues of the
dead endangered organisms. template for the synthesis of polypeptides by a
process termed translation. Each amino acid in
• Anthropological studies–It is useful in
a polypeptide chain is represented by a sequence
determining the origin and migration of
of three nucleotides in the RNA known as the
human populations and genetic diversities.
genetic code. RNA transfers genetic message
from nucleus to the cytoplasm. DNA is always
Summary
present in the nucleus and synthesis is also
In the twentieth century, one of the landmark
confined to the nucleus
discovery in biology was the identification of
Jacob and Monod proposed the classical model
DNA, as genetic material of living organisms.
of Lac operon to explain gene expression and
Gene may be defined as a segment of DNA which
regulation in E. coli. In lac operon a polycistronic
is responsible for inheritance and expression of a
structural gene is regulated by a common
particular character.
promoter and regulator. It is an example of
In 1953, James Watson and Francis Crick
negative control of transcription initiation.
proposed DNA structure based on X-ray
Human genome project, a mega project was
crystallographic studies provided by Maurice
aimed to sequence every gene in the human
Wilkins and Rosalind Franklin. Nucleotides
genome. Polymerase chain reaction is an in vitro
are the structural units of nucleic acids. Each
method of synthesis of nucleic acids wherein,
nucleotide has three components, i) pentose sugar
a specific DNA segment is amplified rapidly
ii) nitrogenous base and iii) phosphate. DNA
without concomitant replication of the rest of
and RNA are polynucleotides. DNA has double
the DNA molecule. DNA fingerprinting is a
stranded helical structure while RNA is a single
technique to identify variations in individuals of
stranded structure. DNA acts as genetic material of
a population at the DNA level. It has immense
almost all the living organism except few viruses.
applications in the field of forensic analysis,
The non genetic RNAs are of three types;
pedigree analysis, anthropological studies, and
m-RNA, r-RNA and t-RNA. They help in protein
conservation of wild life.

Molecular Genetics 88

TN_GOVT_XII_ Bio Zoology_chapter5.indd 88 25-02-2019 19:14:01


www.asiriyar.net

Evaluation 7. Which of the following is the correct


sequence of event with reference to the
1. Hershey and Chase
central dogma?
experiment with
(a) Transcription, Translation, Replication
bacteriophage showed
(b) Transcription, Replication, Translation
that
(c) Duplication, Translation, Transcription
a) Protein gets into the bacterial cells
(d) Replication, Transcription, Translation
b) DNA is the genetic material
8. Which of the following statements about
c) DNA contains radioactive sulphur
DNA replication is not correct?
d) Viruses undergo transformation
(a) Unwinding of DNA molecule occurs
2. DNA and RNA are similar with respect to
as hydrogen bonds break.
a) Thymine as a nitrogen base
(b) Replication occurs as each base is
b) A single-stranded helix shape
paired with another exactly like it.
c) Nucleotide containing sugars, nitrogen
(c) Process is known as semi conservative
bases and phosphates
replication because one old strand is
d) The same sequence of nucleotides for the
conserved in the new molecule.
amino acid phenyl alanine
(d)  C omplementary base pairs are held
3. A mRNA molecule is produced by
together with hydrogen bonds.
a) Replication b) Transcription
9. Which of the following statements is not
c) Duplication d) Translation
true about DNA replication in eukaryotes?
4. The total number of nitrogenous bases in
(a) Replication begins at a single origin of
human genome is estimated to be about
replication.
a) 3.5 million b) 35000
(b)  Replication is bidirectional from the
c) 35 million d) 3.1 billion
origins.
5. E. coli cell grown on 15N medium are
(c) Replication occurs at about 1 million
transferred to 14N medium and allowed to
base pairs per minute.
grow for two generations. DNA extracted
from these cells is ultracentrifuged in a (d) There are numerous different bacterial
cesium chloride density gradient. What chromosomes, with replication
density distribution of DNA would you ocurring in each at the same time.
expect in this experiment? 10. 
The first codon to be deciphered was
(a) One high and one low density band. __________ which codes for ________.
(b) One intermediate density band. (a) AAA, proline (b) GGG, alanine
(c) O  ne high and one intermediate density band. (c) UUU, Phenylalanine (d)TTT, arginine
(d) O  ne low and one intermediate density band. 11. Meselson and Stahl’s experiment proved
6. What is the basis for the difference in the (a)Transduction
synthesis of the leading and lagging strand (b) Transformation
of DNA molecules? (c) DNA is the genetic material
(a) Origin of replication occurs only at the (d)  S emi-conservative nature of DNA
5' end of the molecules. replication
(b) DNA ligase works only in the 3' → 5' direction. 12. Ribosomes are composed of two subunits;
(c) DNA polymerase can join new nucleotides the smaller subunit of a ribosome has a
only to the 3' end of the growing stand. binding site for _________ and the larger
(d)  Helicases and single-strand binding subunit has two binding sites for two
proteins that work at the 5' end. __________.Ans (mRNA, tRNA)

89 Molecular Genetics

TN_GOVT_XII_ Bio Zoology_chapter5.indd 89 25-02-2019 19:14:01


www.asiriyar.net

13. An operon is a: 24. Why the human genome project is called


(a) Protein that suppresses gene expression a mega project?
(b) Protein that accelerates gene expression 25. From their examination of the structure
(c)  C luster of structural genes with of DNA, What did Watson and Crick
related function infer about the probable mechanism of
(d) Gene that switched other genes on or off DNA replication, coding capability and
14. When lactose is present in the culture mutation?
medium: 26. Why tRNA is called an adapter molecule?
(a) Transcription of lac y, lac z, lac a genes 27. What are the three structural differences
occurs. between RNA and DNA?
(b)  Repressor is unable to bind to the 28. Name the anticodon required to recognize
operator. the following codons: AAU, CGA, UAU,
(c)  Repressor is able to bind to the and GCA.
operator. 29. a) Identify the figure given below
(d) Both (a) and (b) are correct. b) Redraw the structure as a replicating
15. Give reasons: Genetic code is ‘universal’. fork and label the parts
16. Name the parts marked ‘A’ and ‘B’ in the 3'
given transcription unit:
5'
3' 3'
A
5'
3'
c)  Write the source of energy for this
B
replication and name the enzyme
17. D
 ifferentiate - Leading stand and lagging strand involved in this process.
18. D
 ifferentiate - Template strand and coding strand. d) Mention the differences in the synthesis
19. Mention any two ways in which single of protein, based on the polarity of the
nucleotide polymorphism (SNPs) two template strands.
identified in human genome can bring 30. If the coding sequence in a transcription
revolutionary change in biological and unit is written as follows:
medical science. 5' TGCATGCATGCATGCATGCATGCATGC 3'
20. State any three goals of the human genome Write down the sequence of mRNA.
project. 31. How is the two stage process of protein
21. In E.coli, three enzymes β- galactosidase, synthesis advantageous?
permease and transacetylase are produced 32.Why did Hershey and Chase use
in the presence of lactose. Explain why radioactively labelled phosphorous
the enzymes are not synthesized in the and sulphur only? Would they have got
absence of lactose. the same result if they use radiolabelled
22. Distinguish between structural gene, carbon and nitrogen?
regulatory gene and operator gene. 33. Explain the formation of a nucleosome.
23. A low level of expression of lac operon 34. It is established that RNA is the first
occurs at all the windows for treatment genetic material. Justify giving reasons.
of various genetic disorders. Justify the
statement.
Molecular Genetics 90

TN_GOVT_XII_ Bio Zoology_chapter5.indd 90 25-02-2019 19:14:01


Concept Map
&RQFOXVLYHO\
'1$LVWKH 'RXEOHKHOL[ 6SOLFLQJ
6LQJOHVWUDQG
JHQHWLFPDWHULDO QXFOHRVLGHV FDSSLQJ
P51$

TN_GOVT_XII_ Bio Zoology_chapter5.indd 91


QXFOHRWLGHV +HOLFDVH WDLOLQJ
W51$U51$
SRODULW\ LVRPHUDVH
%LRORJLVW
QRW SRO\PHUDVH
+HUVKH\
FRQYLQFHG DQG&KDVH
H[SHULPHQW &LVWURQ
([RQ,QWURQ

'1$LVWKH 51$
*ULIILWK¶V
JHQHWLF
H[SHULPHQW
PDWHULDO 7UDQVFULSWLRQ
5HSOLFDWLRQ XQLW3URPRWRU
'1$ 6WUXFWXUDOJHQH
%DFWHULDO 7HUPLQDWRU
WUDQVIRUPDWLRQ
6HDUFKLQJ
IRUJHQHWLF
PDWHULDO 7UDQVFULSWLRQ
FRGRQVVWRS
0ROHFXODU FRGRQV8QDPELJXRXV
'1$)LQJHU *HQHWLFV VSHFLILFGHJHQHUDWH
*HQHWLF XQLYHUVDO$8*
SULQWLQJ
FRGH LQLWLDWRUFRGRQ

+XPDQ
9175DV JHQRPH 7UDQVODWLRQ
SUREH SURMHFW 5HJXODWLRQ
RIJHQH
H[SUHVVLRQ

&KDUJLQJRIW51$
$PLQRDF\ODWLRQ
,QHXNDU\RWHV± RIW51$8QUHODWHG
WUDQVFULSWLRQDOOHYHO UHJLRQVDQG
,GHQWLI\GHWHUPLQHWKH

91
3URFHVVLQJOHYHO 5HOHDVHIDFWRU
VHTXHQFHVWRUHGDWD
DQDO\VLVWUDQVIHUDQG 7UDQVSRUWRIP51$
(/6, DQG7UDQVODWLRQDO
OHYHO

Molecular Genetics

25-02-2019 19:14:02
www.asiriyar.net
www.asiriyar.net

ICT CORNER
Molecular Genetics

Lets us explore the gene


expression

Procedure :
Step 1: Use the URL or scan the QR Code to launch the “Gene Expression Essentials” activity
page.
Step 2: Click “Expression” pick the genetic material from the Biomolecule Toolbox,
understand the changes for the three different genes.
Step 3: Click “mRNA” and slide through the slider in Positive Transcription factors and
Negative Transcription factors such as Concentration, Affinity. Also Slide through
“Affinity” in RNA Polymerase.
Step 4: Click “Multiple Cells” and find the average protein level vs Time in the graph indicated
above.

Step 1 Step 2 Step 3

Step 4

Molecular Genetics URL:


https://phet.colorado.edu/sims/html/gene-expression-essentials/
latest/gene-expression-essentials_en.html

*Pictures are indicative only


*Allow flash player

Molecular Genetics 92

TN_GOVT_XII_ Bio Zoology_chapter5.indd 92 25-02-2019 19:14:04


www.asiriyar.net

6
UNIT - II

Evolution

CHAPTER

"Each has his own tree of ancestors, but at the top


Chapter Outline of all sits probably arboreal"

6.1 Origin of life - Evolution of life forms


6.2 Geological time scale
6.3 Biological evolution
6.4 Evidences for biological evolution
T he term evolution is used to describe
heritable changes in one or more
characteristics of a population of species from
6.5 Theories of biological evolution
one generation to the other. The present state
6.6 Mechanism of evolution
of mankind on earth is the outcome of three
6.7 Hardy Weinberg principle kinds of evolution - chemical, organic and
6.8 Origin and evolution of man social or cultural evolution.
Radiometric dating of meteorites yields
an estimated age for the solar system and for
earth as around 4.5 – 4.6 billion years. The
new born earth remained inhospitable for at
least few hundred millions years. At first it
Learning Objectives was too hot. This is because the collisions of
the planetesimals that coalesced to form earth
➢ Understands the evolution of life on earth. released much heat to melt the entire planet.
➢ Gains knowledge on theories of evolution. Eventually outer surface of the earth cooled
and solidified to form a crust. Water vapour
➢ Interprets evidences
released from the planet’s interior cooled
(anatomical, embryological and and condensed to form oceans. Hence origin
geological) of evolution. of life can be reconstructed using indirect
➢ Learns the principles of evidences. Consequently, biologists have
biological evolution. turned to gather disparate bits of information
and filling them together like pieces of jig saw
➢ Understands the importance of
puzzle. Many theories have been proposed
gene frequencies in a population to explain the origin of life. Few have been
➢ Studies the geological time scale. discussed in this chapter.

93

TN_GOVT_XII_ Bio Zoology_chapter6.indd 93 25-02-2019 19:16:22


www.asiriyar.net

6.1 Origin of life – Evolution of physical forces such as lightning, UV radiations,


life forms volcanic activities, etc., Oparin (1924)
suggested that the organic compounds could
Theory of special creation states that
have undergone a series of reactions leading
life was created by a supernatural power,
to more complex molecules. He proposed that
respectfully referred to as “God”. According
the molecules formed colloidal aggregates or
to Hinduism, Lord Brahma created the Earth.
‘coacervates’ in an aqueous environment. The
Christianity, Islam and most religions believe
coacervates were able to absorb and assimilate
that God created the universe, the plants and
organic compounds from the environment.
the animals.
Haldane (1929) proposed that the primordial
According to the theory of spontaneous
sea served as a vast chemical laboratory
generation or Abiogenesis, living organisms
powered by solar energy. The atmosphere
originated from non-living materials and
was oxygen free and the combination of CO2,
occurred through stepwise chemical and
NH3 and UV radiations gave rise to organic
molecular evolution over millions of years.
compounds. The sea became a ‘hot’ dilute
Thomas Huxley coined the term abiogenesis.
soup containing large populations of organic
Big bang theory explains the origin monomers and polymers. They envisaged that
of universe as a singular huge explosion in groups of monomers and polymers acquired
physical terms. The primitive earth had no lipid membranes and further developed into
proper atmosphere, but consisted of ammonia, the first living cell. Haldane coined the term
methane, hydrogen and water vapour. The prebiotic soup and this became the powerful
climate of the earth was extremely high. UV symbol of the Oparin-Haldane view on the
rays from the sun split up water molecules origin of life (1924-1929).
into hydrogen and oxygen. Gradually the
Oparin and Haldane independently
temperature cooled and the water vapour
suggested that if the primitive atmosphere was
condensed to form rain. Rain water filled
reducing and if there was appropriate supply
all the depressions to form water bodies.
of energy such as lightning or UV light then
Ammonia and methane in the atmosphere
a wide range of organic compounds can be
combined with oxygen to form carbon-
synthesized.
dioxide and other gases.
6.2 Geological time scale
Coacervates (large colloidal particles
The duration of the earth’s history has been
that precipitate out in aqueous medium)
divided into eras that include
are the first pre-cells which gradually
the Paleozoic, Mesozoic, and
transformed into living cells.
Cenozoic. Recent eras are
According to the theory of biogenesis, further divided into periods,
life arose from pre-existing life. The term which are split into epochs.
biogenesis also refers to the biochemical The geological time scale
process of production of living organisms. with the duration of the eras and periods with
This term was coined by Henry Bastian. the dominant forms of life is shown in Table 6.1.
According to the theory of chemical The Paleozoic era is characterized by
evolution, primitive organisms in the abundance of fossils of marine invertebrates.
primordial environment of the earth evolved Towards the later half, other vertebrates (marine
spontaneously from inorganic substances and and terrestrial) except birds and mammals

Evolution 94

TN_GOVT_XII_ Bio Zoology_chapter6.indd 94 25-02-2019 19:16:22


www.asiriyar.net

appeared. The seven periods of Paleozoic era in fishes), Mississippian (earliest amphibians,
order from oldest to the youngest are Cambrian Echinoderms), Pennsylvanian (earliest reptiles),
(Age of invertebrates), Ordovician (fresh Permian (mammal like reptiles).
water fishes, Ostracoderms, various types of Mesozoic era (dominance of reptiles)
Molluscs), Silurian (origin of fishes), Devonian called the Golden age of reptiles, is divided
(Age of fishes, many types of fishes such as into three periods namely Triassic (origin of
lung fishes, lobe finned fishes and ray finned egg laying mammals), Jurassic (Dinosaurs

Table 6.1 Geological Time Scale


YEARS IN
ERA

PERIOD EPOCH FAUNA FLORA


MILLION
Recent Angiosperms
1 Age of Mammals
Quaternary (Holocene) Monocotyledons
6 Pleistocene Age of Human beings
Cenozoic

15 Pliocene Human evolution


Age of
10 Miocene
Angiosperms -
20 Tertiary Oligocene
Mammals and birds Dicotyledons
Eocene
100
Paleocene

Sphenopsides,
125 Cretaceous Ginkgos, Gnetales,
(Dicotyledons)
Mesozoic

(Golden age of Reptiles)


Rise of Dinosaurs Herbaceous
150 Jurassic lycopods, Ferns,
Conifers, Cycads
180 Triassic
Arborescent
205 Permian Mammal like reptiles
lycopods
Earliest Amphibians and Seed ferns and
230 Pennsylvanian
Carboniferous abundant Echinoderms Bryophytes
255 Mississippian Earliest reptiles
Paleozoic

315 Devonian Age of fishes Progymnosperms


Earliest fishes and land
350 Silurian Zosterophyllum
invertebrates
Dominance of Appearance of
430 Ordovician
invertebrates first land plants
510 Cambrian Fossil invertebrates Origin of algae
Upper Multicellular organisms
Precambrian

3000 Middle Appearance of eukaryotes


Planktons
Lower
prokaryotes

95 Evolution

TN_GOVT_XII_ Bio Zoology_chapter6.indd 95 25-02-2019 19:16:22


www.asiriyar.net

were dominant on the earth, fossil bird – viruses. Two major cell types that appeared
Archaeopteryx) and Cretaceous (extinction during this time were significant. One form of the
of toothed birds and dinosaurs, emergence of earliest cell contained clumps of nucleoproteins
modern birds). embedded in the cell substance. Such cells were
Cenozoic era (Age of mammals) similar to the Monera. They are considered as
ancestral to the modern bacteria and blue green
is subdivided into two periods namely
algae. The other form of earliest cells contained
Tertiary and Quaternary. Tertiary period is
nucleoprotein clumps that condensed into a
characterized by abundant mammalian fauna.
central mass surrounded by a thin membrane.
This period is subdivided into five epochs This membrane separated nucleoproteins from
namely, Paleocene (placental mammals, the cell substances. Such cells were referred
Eocene (Monotremes except duck billed to as Protista. When the natural sources of
Platypus and Echidna, hoofed mammals and food in the ocean declined in course of time
carnivores), Oligocene (higher placental the ancestors of Monera and Protista had to
mammals appeared), Miocene (origin of evolve different methods for food procurement.
first man like apes) and Pliocene (origin of These may be summarized as parasitism,
man from man like apes).Quaternary period saprophytism, predator or animalism and
witnessed decline of mammals and beginning chemosynthesis or photosynthesis. When the
of human social life. number of photosynthetic organisms increased
The age of fossils can be determined there was an increase in the free O2 in the sea
and atmosphere.
using two methods namely, relative dating
and absolute dating. Relative dating is used to CH4+2O2 → CO2 +2H2O
determine a fossil by comparing it to similar 4NH3+3O2 → 2N2+6H2O
rocks and fossils of known age. Absolute The atmospheric oxygen combined with
dating is used to determine the precise age methane and ammonia to form CO2 and free
of a fossil by using radiometric dating to nitrogen. The presence of the free O2 brought
measure the decay of isotopes. about the evolution of aerobic respiration
which could yield large amounts of energy
6.3 Biological evolution by oxidation of food stuffs. Thus Prokaryotes
and Eukaryotes evolved.
Formation of protobionts
Abiotically produced molecules can Experimental approach to the origin
spontaneously self assemble into droplets of life
that enclose a watery solution and maintain Urey and Miller (1953), paved way
a chemical environment different from their
for understanding the possible synthesis of
surroundings. Scientists call these spheres
organic compounds that led to the appearance
as ‘protobionts’. Liposomes are lipids in a
of living organisms is depicted in the Fig. 6.1.
solution that can self assemble into a lipid
bilayer. Some of the proteins inside the In their experiment, a mixture of gases was
liposomes acquired the properties of enzymes allowed to circulate over electric discharge
resulting in fast multiplication of molecules. from an tungsten electrode. A small flask was
The coacervates with nucleoprotein and kept boiling and the steam emanating from
nutrients had a limiting surface membrane that it was made to mix with the mixture of gases
had the characters of a virus or free living genes. (ammonia, methane and hydrogen) in the large
Subsequently number of genes united to form chamber that was connected to the boiling
‘proto viruses’ somewhat similar to present day water. The steam condensed to form water

Evolution 96

TN_GOVT_XII_ Bio Zoology_chapter6.indd 96 25-02-2019 19:16:22


www.asiriyar.net

of various geological strata of


Tungsten electrode evolution. Fossilization is the
process by which plant and
Spark discharge animal remains are preserved
Flask
in sedimentary rocks. They fall
under three main categories.
Gaseous mixture
(CH4 + NH3 + H2 + H2O) i) Actual remains – The
Water out original hard parts such as bones,
Condenser teeth or shells are preserved as
Cold water in such in the earth’s atmosphere.
This is the most common method
of fossilization. When marine
animals die, their hard parts such
as bones, shells, etc., are covered
with sediments and are protected
Aqueous medium from further deterioration. They
Boiling water containing organic get preserved as such as they
compounds
are preserved in vast ocean; the
salinity in them prevents decay.
Tap for
withdrawing The sediments become hardened
sample
to form definite layers or strata.
For example, Woolly Mammoth
that lived 22 thousand years ago
were preserved in the frozen
coast of Siberia as such. Several
Fig. 6.1 Diagrammatic representation of Urey-Miller’s human beings and animals living
experiment in the ancient city of Pompeii were
which ran down the ‘U’ tube. Experiment was preserved intact by volcanic ash
conducted continuously for a week and the which gushed out from Mount Vesuvius.
liquid was analysed. Glycine, alanine, beta ii) Petrifaction – When animals die
alanine and aspartic acid were identified. Thus the original portion of their body may be
Miller’s experiments had an insight as to the replaced molecule for molecule by minerals
possibility of abiogenetic synthesis of large and the original substance being lost through
amount of variety of organic compounds in disintegration. This method of fossilization
nature from a mixture of sample gases in which is called petrifaction. The principle minerals
the only source of carbon was methane. Later
involved in this type fossilization are iron
in similar experiments, formation of all types of
pyrites, silica, calcium carbonate and
amino acids, and nitrogen bases were noticed.
bicarbonates of calcium and magnesium.
6.4 Evidences for iii) Natural moulds and casts – Even
biological evolution after disintegration, the body of an animal
might leave indelible impression on the soft
6.4.1 Paleontological evidences mud which later becomes hardened into
Paleontology is the study of prehistoric
stones. Such impressions are called moulds.
life through fossils. Fossils are described as
The cavities of the moulds may get filled up
the true witnesses of evolution or documents
97 Evolution

TN_GOVT_XII_ Bio Zoology_chapter6.indd 97 25-02-2019 19:16:22


www.asiriyar.net

by hard minerals and get fossilized, which are homologous structures that brings about
called casts. Hardened faecal matter termed divergent evolution (Fig 6.2).
as coprolites occur as tiny pellets. Analysis of Similarly the thorn of Bougainvillea and
the coprolites enables us to understand the the tendrils of Curcurbita and Pisum sativum
nature of diet the pre-historic animals thrived represent homology. The thorn in former is
on. used as a defence mechanism from grazing
animals and the tendrils of latter is used as a
Visit any museum nearer to your
support for climbing.
school with your teacher and identify
the bones of different animals including Analogous structures
mammals. The famous Egmore Museum Organisms having different structural
is in Chennai. patterns but similar function are termed as
analogous structures. For example, the wings
6.4.2 Evidences from of birds and insects are different structurally
comparative anatomy but perform the same function of flight that
Similarities in structure between groups brings about convergent evolution (Fig. 6.3).
of organisms are accepted as indicators of
relationship. For example, a comparative study
of the forelimbs of different vertebrates exhibits Ulna
Carpals
a fundamental plan of similarity in structure.
Radius
These relationships can be studied under Humerus
homologous organs, analogous organs, vestigial
organs, connecting links and atavistic organs.
Homologous structures
In vertebrates, comparative anatomical
studies reveal a basic plan in various
structures such as fore limbs and hind limbs.
Fore limbs of vertebrates exhibit anatomical
similarity with each other and is made of
similar bones such as humerus, radius, ulna,
carpals, metacarpals and phalanges. Forewing

Bird Bat

Hindwing
Human

Whale Cat Horse

Humerus Ulna Radius Carpals Phalanges

Fig. 6.2 Forelimbs of terrestrial vertebrates to Fig. 6.3 Comparison of insect and bird wing
show homology to show their analogy
Structures which are similar in origin Other examples of analogous organs
but perform different functions are called include the eyes of the Octopus and of
Evolution 98

TN_GOVT_XII_ Bio Zoology_chapter6.indd 98 25-02-2019 19:16:23


www.asiriyar.net

mammals and the flippers of Penguins include coccyx, wisdom teeth, ear muscles,
and Dolphins. Root modification in sweet body hair, mammae in male, nictitating
potato and stem modification in potato are membrane of the eye, etc.,
considered as analogous organs. Both of these
plants have a common function of storage of
Connecting link
food. The organisms which possess the
characters of two different groups (transitional
Vestigial organs stage) are called connecting links. Example
Peripatus (connecting link between Annelida
Structures that are of no use to the
and Arthropoda), Archeopteryx (connecting
possessor, and are not necessary for their
link between Reptiles and Aves).
existence are called vestigial organs. Vestigial
organs may be considered as remnants of Atavistic organs
structures which were well developed and Sudden appearance of vestigial organs in
functional in the ancestors, but disappeared highly evolved organisms is called atavistic
in course of evolution due to their non- organs. Example, presence of tail in a human
utilization. Human appendix is the remnant baby is an atavistic organ.
of caecum which is functional in the digestive 6.4.3 Embryological evidences
tract of herbivorous animals like rabbit. Embryology deals with the study of the
Cellulose digestion takes place in the caecum development of individual from the egg to the
of these animals. Due to change in the diet adult stage. A detailed study of the embryonic
containing less cellulose, caecum in human development of different forms makes us to
became functionless and is reduced to a think that there is a close resemblance during
vermiform appendix, which is vestigial. Other development.
examples of vestigial organs in human beings The development of heart in all vertebrates
follows the same pattern of development as a
pair of tubular structures
)LVK 6DODPDQGHU 7RUWRLVH &KLFN +XPDQ that later develop into
two chambered heart in
fishes, three chambered in
amphibians and in most
3KDU\QJHDO 3RVWDQDO reptiles and four chambered
SRXFKHV WDLO
in crocodiles, birds and
mammals; indicating a
common ancestry for all the
vertebrates,
Hence scientists in the
19th century concluded that
higher animals during their
embryonic development
pass through stages of lower
animals (ancestors). Ernst
Von Haeckel, propounded
the “biogenetic law or
Fig 6.4 Embryological evidences
99 Evolution

TN_GOVT_XII_ Bio Zoology_chapter6.indd 99 25-02-2019 19:16:25


www.asiriyar.net

theory of recapitulation” which states 6.5 Theories of biological evolution


that the life history of an individual
(ontogeny) briefly repeats or recapitulates the 6.5.1 Lamarck’s theory
evolutionary history of the race (phylogeny). Jean Baptiste de Lamarck, was the first
In other words “Ontogeny recapitulates to postulate the theory of evolution in his
Phylogeny”. The embryonic stages of a famous book ‘Philosophie Zoologique’ in the
higher animal resemble the adult stage of its year 1809. The two principles of Lamarckian
ancestors. Appearance of pharyngeal gill slits, theory are:
yolk sac and the appearance of tail in human i. The theory of use and disuse - Organs
embryos are some of the examples (Fig. 6.4). that are used often will increase in size and
The biogenetic law is not universal and it is those that are not used will degenerate. Neck
now thought that animals do not recapitulate in giraffe is an example of use and absence
the adult stage of any ancestors. The human of limbs in snakes is an example for disuse
embryo recapitulates the embryonic history theory.
and not the adult history of the organisms. ii. The theory of inheritance of
acquired characters - Characters that are
The comparative study of the embryo of
developed during the life time of an organism
different animals shows structural similarities
are called acquired characters and these are
among themselves. The embryos of fish,
then inherited.
salamander, tortoise, chick and human start
life as a single cell, the zygote, and undergo The main objection to Lamarckism
cleavage to produce the blastula, change to Lamarck’s “Theory of Acquired
gastrula and are triploblastic. This indicates characters” was disproved by August
that all the above said animals have evolved Weismann who conducted experiments on
from a common ancestor. mice for twenty generations by cutting their
Molecular evidences tails and breeding them. All mice born were
with tail. Weismann proved that change in the
Molecular evolution is the process
somatoplasm will not be transferred to the
of change in the sequence composition of
next generation but changes in the germplasm
molecules such as DNA, RNA and proteins
will be inherited.
across generations. It uses principles of
evolutionary biology and population genetics Neo-Lamarckism
to explain patterns in the changes of molecules. The followers of Lamarck (Neo-
One of the most useful advancement in the Lamarckists) like Cope, Osborn, Packard and
development of molecular biology is proteins and Spencer tried to explain Lamarck’s theory on
other molecules that control life processes are a more scientific basis. They considered that
conserved among species. A slight change that adaptations are universal. Organisms acquire
occurs over time in these conserved molecules new structures due to their adaptations to
(DNA, RNA and protein) are often called the changed environmental conditions. They
molecular clocks. Molecules that have been used argued that external conditions stimulate the
to study evolution are cytochrome c (respiratory somatic cells to produce certain ‘secretions’
pathway) and rRNA (protein synthesis). which reach the sex cells through the blood
and bring about variations in the offspring.

Evolution 100

TN_GOVT_XII_ Bio Zoology_chapter6.indd 100 25-02-2019 19:16:25


www.asiriyar.net

6.5.2 Darwin’s theory of Natural found in an organism help them to overcome


Selection struggle and such variations are passed on to the
Charles Darwin explained the theory of next generation.
evolution in his book ‘The Origin of Species by 4. Origin of species by Natural Selection
Natural Selection’. During his journey around According to Darwin, nature is the most
the Earth, he made extensive observations of powerful selective force. He compared origin
plants and animals. He noted a huge variety
of species by natural selection to a small
and remarkable similarities among organisms
isolated group. Darwin believed that the
and their adaptive features to cope up to their
struggle for existence resulted in the survival
environment. He proved that fittest organisms
of the fittest. Such organisms become better
can survive and leave more progenies than the
unfit ones through natural selection. adapted to the changed environment.
Darwin’s theory was based on several facts, Objections to Darwinism
observations and influences. They are:
Some objections raised against Darwinism
1. Over production (or) prodigality of
were –
production
• D
 arwin failed to explain the mechanism
All living organisms increase their
population in larger number. For example, of variation.
Salmon fish produces about 28 million eggs • D
 arwinism explains the survival of the
during breeding season and if all of them hatch, fittest but not the arrival of the fittest.
the seas would be filled with salmon in few • H
 e focused on small fluctuating variations
generations. Elephant, the slowest breeder that that are mostly non-heritable.
can produce six young ones in its life time can
• H
 e did not distinguish between somatic
produce 6 million descendants at the end of 750
and germinal variations.
years in the absence of any check.
2. Struggle for existence • H
 e could not explain the occurrence of
Organisms struggle for food, space and vestigial organs, over specialization of
mate. As these become a limiting factor, some organs like large tusks in extinct
competition exists among the members of mammoths, oversized antlers in the
the population. Darwin denoted struggle for extinct Irish deer, etc.,
existence in three ways –
Neo Darwinism
Intra specific struggle between the same
species for food, space and mate. Neo Darwinism is the interpretation
Inter specific struggle with different species of Darwinian evolution through Natural
for food and space. Selection as it has been modified since it
Struggle with the environment to cope was proposed. New facts and discoveries
with the climatic variations, flood, earthquakes, about evolution have led to modifications
drought, etc., of Darwinism and is supported by Wallace,
3. Universal occurrence of variations Heinrich, Haeckel, Weismann and Mendel.
No two individuals are alike. There are This theory emphasizes the change in the
variations even in identical twins. Even the frequency of genes in population arises due
children born of the same parents differ in colour, to mutation, variation, isolation and Natural
height, behavior, etc., The useful variations selection.

101 Evolution

TN_GOVT_XII_ Bio Zoology_chapter6.indd 101 25-02-2019 19:16:25


www.asiriyar.net

6.5.3 Mutation theory iii. Genetic recombination is due to crossing


Hugo de Vries put forth the Mutation over of genes during meiosis. This brings
theory. Mutations are sudden random changes about genetic variations in the individuals
that occur in an organism that is not heritable. De of the same species and leads to heritable
Vries carried out his experiments in the Evening variations.
Primrose plant (Oenothera lamarckiana) and iv. Natural selection does not produce any
observed variations in them due to mutation. genetic variations but once such variations
According to de Vries, sudden and large occur it favours some genetic changes
variations were responsible for the origin of new while rejecting others (driving force of
species whereas Lamarck and Darwin believed evolution).
in gradual accumulation of all variations as the v. Reproductive isolation helps in
causative factors in the origin of new species. preventing interbreeding between related
organisms.
Salient features of Mutation Theory
• M utations or discontinuous variation are 6.5.5 Evolution by anthropogenic
transmitted to other generations. sources
• In naturally breeding populations, mutations Natural Selection (Industrial melanism)
occur from time to time. Natural selection can be explained
• There are no intermediate forms, as they are clearly through industrial melanism.
fully fledged. Industrial melanism is a classical case of
• They are strictly subjected to natural Natural selection exhibited by the peppered
selection. moth, Biston betularia. These were available
6.5.4 Modern synthetic theory in two colours, white and black. Before
Sewell Wright, Fisher, Mayer, Huxley, industrialization peppered moth both
Dobzhansky, Simpson and Haeckel explained white and black coloured were common in
Natural Selection in the light of Post-Darwinian England. Pre-industrialization witnessed
discoveries. According to this theory gene white coloured background of the wall of
mutations, chromosomal mutations, genetic the buildings hence the white coloured
recombinations, natural selection and moths escaped from their predators. Post
reproductive isolation are the five basic factors industrialization, the tree trunks became
involved in the process of organic evolution. dark due to smoke and soot let out from the
industries. The black moths camouflaged on
i. Gene mutation refers to the changes in the
the dark bark of the trees and the white moths
structure of the gene. It is also called gene/
were easily identified by their predators.
point mutation. It alters the phenotype of
Hence the dark coloured moth population
an organism and produces variations in
was selected and their number increased
their offspring.
when compared to the white moths. Nature
ii. Chromosomal mutation refers to the
offered positive selection pressure to the
changes in the structure of chromosomes
black coloured moths. The above proof shows
due to deletion, addition, duplication,
that in a population, organisms that can adapt
inversion or translocation. This too
will survive and produce more progenies
alters the phenotype of an organism and
resulting in increase in population through
produces variations in their offspring.
natural selection.

Evolution 102

TN_GOVT_XII_ Bio Zoology_chapter6.indd 102 25-02-2019 19:16:25


www.asiriyar.net

Artificial selection is a byproduct of different species to utilize different food


human exploitation of forests, oceans and resources such as insects, seeds, nectar from
fisheries or the use of pesticides, herbicides cactus flowers and blood from iguanas, all
or drugs. For hundreds of years humans have driven by Natural selection. Fig. 6.6 represents
selected various types of dogs, all of which are some of the finches observed by Darwin.
variants of the single species of dog. If human Genetic variation in the ALX1 gene in the
beings can produce new varieties in short DNA of Darwin finches is associated with
period, then “nature” with its vast resources variation in the beak shape. Mild mutation in
and long duration can easily produce new the ALX1 gene leads to phenotypic change in
species by selection. the shape of the beak of the Darwin finches.
6.5.6 Adaptive Radiation Marsupials in Australia and placental
The evolutionary process which produces mammals in North America are two
new species diverged from a single ancestral subclasses of mammals they have adapted
form becomes adapted to newly invaded in similar way to a particular food resource,
habitats is called adaptive radiation. Adaptive locomotory skill or climate. They were
radiations are best exemplified in closely separated from the common ancestor more
related groups that have evolved in relatively than 100 million year ago and each lineage
short time. Darwin’s finches and Australian continued to evolve independently. Despite
marsupials are best examples for adaptive temporal and geographical separation,
radiation. When more than one adaptive marsupials in Australia and placental
radiation occurs in an isolated geographical mammals in North America have produced
area, having the same structural and varieties of species living in similar habitats
functional similarity it is due to convergent with similar ways of life. Their overall
evolution. resemblance in shape, locomotory mode,
feeding and foraging are superimposed
Darwin’s finches upon different modes of reproduction. This
Their common ancestor arrived on the feature reflects their distinctive evolutionary
Galapagos about 2 million years ago. During relationships.
that time, Darwin's finches have evolved into Over 200 species of marsupials live in
14 recognized species differing in body size, Australia along with many fewer species of
beak shape and feeding behavior. Changes in placental mammals. The marsupials have
the size and form of the beak have enabled undergone adaptive radiation to occupy
the diverse habitats in Australia, just as the
placental mammals have radiated across
Warbler finch
(Certhidea olivacea) Cactus ground finch
North America.
(Geospiza scandens)

6.6 Mechanism of evolution


Woodpecker finch
(Cactospiza pallida) Warbler Sharp-beaked ground
finch finch (Geospiza difficilis)
Small insectivorous
tree finch Small ground
Microevolution (evolution on a
bing bills
(Camarhynchus
parvulus) Pro
Gr
ou
finch (Geospiza
fuliginosa) small scale) refers to the changes in allele
eater

C
s

nd hing

frequencies within a population. Allele


he

Large insectivorous
ills

ru
fin
nc

Medium
s
gb

Insect
ch
s

tree finch
e fi

Cactu

ground finch
es
pin

frequencies in a population may change due to


(Camarhynchus eaters
Tre

(Geospiza fortis)
bills
Gras

psittacula) Seed
eaters
Bud eater Large ground four fundamental forces of evolution such as
Vegetarian tree finch (Geospiza
finch (Platyspiza
crassirostris)
Parrot-like bill magnirostris) natural selection, genetic drift, mutation and
gene flow.
Fig 6.5 Darwin’s finches
103 Evolution

TN_GOVT_XII_ Bio Zoology_chapter6.indd 103 25-02-2019 19:16:25


www.asiriyar.net

6.6.1 Natural selection storm clustered around the extremes of the


It occurs when one allele (or combination variation showing stabilizing selection.
of alleles of differences) makes an organism ii. Directional Selection: The environment
more or less fit to survive and reproduce which undergoes gradual change is subjected
in a given environment. If an allele reduces to directional selection (Fig. 6. 7b).
fitness, its frequencies tend to drop from one This type of selection removes the
generation to the next. individuals from one end towards the
The evolutionary path of a given gene other end of phenotypic distribution. For
i.e., how its allele's change in frequency in the example, size differences between male and
population across generation, may result from female sparrows. Both male and female
several evolutionary mechanisms acting at look alike externally but differ in body
once. For example, one gene’s allele frequencies weight. Females show directional selection
might be modified by both gene flow and in relation to body weight.
genetic drift, for another gene, mutation
may produce a new allele, that is favoured by iii. Disruptive Selection (centrifugal selection):
natural selection (Fig. 6.6). When homogenous environment changes
into heterogenous environment this type
Selection
of selection is operational (Fig. 6.7c). The
There are mainly three types of natural organisms of both the extreme phenotypes
selection are selected whereas individuals with
i. Stabilising Selection (centipetal selection): average phenotype are eliminated. This
This type of selection operates in a stable results in splitting of the population into
environment (Fig. 6.7a). The organisms sub population/species. This is a rare form
with average phenotypes survive whereas of selection but leads to formation of two
the extreme individuals from both the ends or more different species. It is also called
are eliminated. There is no speciation but the adaptive radiation. e.g. Darwin's finches-
phenotypic stability is maintained within the beak size in relation to seed size inhabiting
population over generation. For example, Galapagos islands.
measurements of sparrows that survived Group selection and sexual selection are
the storm clustered around the mean, and other types of selection. The two major group
the sparrows that failed to survive the selections are Altrusim and Kin selection.

Dark rock environment Next generation

light grey beetles


are spotted and eaten
Aa by birds more often Aa
AA
AA
than dark ones
Aa AA
aa aa If ‘X’ is eaten by aa AA Aa
aa AA
Aa birds then only
Aa survivors reproduce
aa aa Aa aa Aa

Fig 6.6 Natural selection

Evolution 104

TN_GOVT_XII_ Bio Zoology_chapter6.indd 104 25-02-2019 19:16:26


www.asiriyar.net

Medium-sized

Number of individuals
Phenotypes individuals
are favoured

with phenotype
favoured
by natural
selection

Peak gets higher Peak shifts in


and narrower one direction
Two peaks form

(a) (b) (c)

Fig 6.7 Operation of natural selection on different traits (a) Stabilising (b) Directional and (c) Disruptive

6.6.2 Gene flow (Fig. 6.9). It may result in a loss of some


Movement of genes through gametes or alleles (including beneficial ones) and fixation
movement of individuals in (immigration) and of other alleles. Genetic drift can have major
out (emigration) of a population is referred to as effects, when the population is reduced in size
gene flow. Organisms and gametes that enter the by natural disaster due to bottle neck effect or
population may have new alleles or may bring when a small group of population splits from
in existing alleles but in different proportions the main population to form a new colony due
than those already in the population. Gene flow
to founder’s effect.
can be a strong agent of evolution (Fig 6.8).

AA 'XHWRFKDQFH
HYHQWVRQO\
WKHVHEHHWOHV
$D JLYHVULVHWR 1H[WJHQHUDWLRQ
Migration
$$ RIIVSULQJV
AA AA $D
DD DD
aa DD $D
AA $D
aa
DD DD
aa
AA )UHTXHQF\RI$ 
)UHTXHQF\RI$ 
aa )UHTXHQF\RID  )UHTXHQF\RID 

Fig 6.9 Genetic drift


Fig 6.8 Gene flow
6.6.4 Mutation
6.6.3 Genetic drift / Sewall
Although mutation is the original source
Wright Effect
of all genetic variation, mutation rate for
Genetic drift is a mechanism of evolution in most organisms is low. Hence new mutations
which allele frequencies of a population change on an allele frequencies from one generation
over generation due to chance (sampling error). to the next is usually not large.
Genetic drift occurs in all population sizes,
but its effects are strong in a small population
105 Evolution

TN_GOVT_XII_ Bio Zoology_chapter6.indd 105 25-02-2019 19:16:29


www.asiriyar.net

6.7 Hardy - Weinberg Principle q2= frequency of aa


In nature, populations are usually p = 0.3, q = 0.7 then,
evolving such as the grass in an open meadow, p2 = (0.3)2 = 0.09 = 9 % AA
wolves in a forest and bacteria in a person’s 2pq = 2(0.3) (0.7) = 0.42 = 42 % Aa
body are all natural populations. All of these q2 = (0.7)2 0.49 = 49 % aa
populations are likely to be evolving some Hence the beetle population appears to
of their genes. Evolution does not mean that be in Hardy- Weinberg equilibrium. When
the population is moving towards perfection the beetles in Hardy- Weinberg equilibrium
rather the population is changing its genetic reproduce, the allele and genotype frequency
makeup over generations. For example in a in the next generation would be: Let’s assume
wolf population, there may be a shift in the that the frequency of ‘A’ and ‘a’ allele in the
frequency of a gene variant for black fur than pool of gametes that make the next generation
grey fur. Sometimes, this type of change is would be the same, then there would be
due to natural selection or due to migration no variation in the progeny. The genotype
or due to random events. frequencies of the parent appears in the next
First we will see the set of conditions generation. (i.e. 9% AA, 42% Aa and 49% aa).
required for a population not to evolve. Hardy If we assume that the beetles mate
of UK and Weinberg of Germany stated that randomly (selection of male gamete and
the allele frequencies in a population are female gamete in the pool of gametes), the
stable and are constant from generation to probability of getting the offspring genotype
generation in the absence of gene flow, genetic depends on the genotype of the combining
drift, mutation, recombination and natural parental gametes.
selection. If a population is in a state of Hardy
Hardy Weinberg’s assumptions include
Weinberg equilibrium, the frequencies of
alleles and genotypes or sets of alleles in that No mutation – No new alleles are generated
population will remain same over generations. by mutation nor the genes get duplicated or
Evolution is a change in the allele frequencies deleted.
in a population over time. Hence population Random mating – Every organism gets a
in Hardy Weinberg is not evolving. chance to mate and the mating is random
Suppose we have a large population of with each other with no preferences for a
beetles, (infinitely large) and appear in two particular genotype.
colours dark grey (black) and light grey, and No gene flow - Neither individuals nor
their colour is determined by ‘A’ gene. ‘AA’ their gametes enter (immigration) or exit
and ‘Aa’ beetles are dark grey and ‘aa’ beetles (emigration) the population.
are light grey. In a population let’s say that ‘A’ Very large population size - The population
allele has frequency (p) of 0.3 and ‘a’ allele has should be infinite in size.
a frequency (q ) of 0.7. Then p+q=1. No natural selection- All alleles are fit to
If a population is in Hardy Weinberg survive and reproduce.
equilibrium, the genotype frequency can If any one of these assumptions were not
be estimated by Hardy Weinberg equation. met, the population will not be in Hardy-
(p + q)2 = p2 + 2pq + q2 Weinberg equilibrium. Only if the allele
p2 = frequency of AA frequencies changes from one generation to
2pq= frequency of Aa the other, evolution will take place.

Evolution 106

TN_GOVT_XII_ Bio Zoology_chapter6.indd 106 25-02-2019 19:16:30


www.asiriyar.net

6.8 Origin and Evolution of Man Magnon, France and is considered as the ancestor
of modern Europeans. They were not only adapted
Mammals evolved in the
to various environmental conditions, but were
early Jurassic period, about 210
also known for their cave paintings, figures on
million years ago. Hominid
floors and walls.
evolution occurred in Asia and
Homo sapiens or modern human arose in
Africa. Hominids proved that
Africa some 25,000 years ago and moved to other
human beings are superior to
continents and developed into distinct races. They
other animals and efficient in making tools and
had a brain capacity of 1300 – 1600 cc. They started
culture. The earliest fossils of the prehistoric man
cultivating crops and domesticating animals.
like Ramapithecus and Sivapithecus lived some 14
mya and were derived from ape like Dryopithecus. Summary
Dryopithecus and Ramapithecus were hairy Evolutionary Biology is the study of history
and walked like gorillas and chimpanzees. of life forms on Earth which originated on Earth
Australopithecus lived in East African grasslands millions of years ago. How Earth originated, how
about 5 mya and was called the Australian ape life originated, what is the place of man in the
man. He was about 1.5 meters tall with bipedal universe are all general questions. This chapter
locomotion, omnivorous, semi erect, and lived in deals with several theories to explain the life
caves. Low forehead, brow ridges over the eyes, on Earth. Evidence from the fossil record and
protruding face, lack of chin, low brain capacity many other areas of biology like embryology,
of about 350 – 450 cc, human like dentition, anatomy and molecular biology indicates a
lumbar curve in the vertebral column were common ancestry.
his distinguishing features. Homo habilis lived The theories advanced by Lamarck,
about 2 mya. Their brain capacity was between Darwin, Hugo de Vries explained the intricate
650 – 800cc, and was probably vegetarian. They evolutionary process. Geological time scale
had bipedal locomotion and used tools made of with different eras, periods and epochs gives
chipped stones. an idea about the dominant species in those
Homo erectus the first human like being was days. The mathematical distribution of gene
around 1.7 mya and was much closer to human and genotype frequencies remains constant in
a small population was contributed by Hardy
in looks, skull was flatter and thicker than the
and Weinberg in 1608. Natural Selection and
modern man and had a large brain capacity of
gene pool are the important factors those affect
around 900 cc. Homo erectus probably ate meat.
Hardy Weinberg equilibrium.
Homo ergaster and Homo erectus were
the first to leave Africa. Neanderthal human Human evolution states that humans
was found in Neander Valley, Germany with a developed from primates or ape like ancestors.
brain size of 1400 cc and lived between 34,000 - The emergence of Homo sapiens as a distinct
species from apes and placental mammals in
1,00,000 years ago. They differ from the modern
brain size, eating habit and other behavior
human in having semierect posture, flat cranium,
proves that ‘Ontogeny recapitulates Phylogeny’.
sloping forehead, thin large orbits, heavy brow
ridges, protruding jaws and no chin. They used
animal hides to protect their bodies, knew the
use of fire and buried their dead. They did not
practice agriculture and animal domestication.
Cro-Magnon was one of the most talked forms
of modern human found from the rocks of Cro-

107 Evolution

TN_GOVT_XII_ Bio Zoology_chapter6.indd 107 25-02-2019 19:16:30


www.asiriyar.net

Evaluation 7) Who proposed the Germplasm theory?


1) Th
 e first life on earth a) Darwin
originated b) August Weismann
a) in air c) Lamarck

b) on land d) Alfred Wallace


c) in water 8) The age of fossils can be determined by
d) on mountain a) electron microscope
2) W
 ho published the book “Origin of species b) weighing the fossils
by Natural Selection” in 1859? c) carbon dating
a) Charles Darwin b) Lamarck d) analysis of bones

c) Weismann d) Hugo de Vries 9) Fossils are generally found in


3) W
 hich of the following was the contribution a) igneous rocks b) metamorphic rocks
of Hugo de Vries? c) volcanic rocks d) sedimentary rocks
a) Theory of mutation 10) Evolutionary history of an organism is called
b) Theory of natural Selection a) ancestry b) ontogeny
c
)
Theory of inheritance of acquired c) phylogeny d) paleontology
characters
11) The golden age of reptiles was
d) Germplasm theory
a) Mesozoic era b) Cenozoic era
4) Th
 e wings of birds and butterflies is an c) Paleozoic era d) Proterozoic era
example of
12) Which period was called “Age of fishes”?
a) Adaptive radiation
a) Permian b) Triassic
b) convergent evolution
c) Devonian d) Ordovician
c) divergent evolution
13) Modern man belongs to which period?
d) variation
a) Quaternary b) Cretaceous
5) Th
 e phenomenon of “ Industrial Melanism” c) Silurian d) Cambrian
demonstrates 14) Th
 e Neanderthal man had the brain capacity
a) Natural selection of
b) induced mutation a) 650 – 800cc b) 1200cc
c) reproductive isolation c) 900cc d) 1400cc
d) geographical isolation 15) List out the major gases seems to be found in
6) Darwin’s finches are an excellent example of the primitive earth.
a) connecting links 16) Explain the three major categories in which
fossilization occur?
b) seasonal migration
17) Differentiate between divergent evolution
c) adaptive radiation
and convergent evolution with one example
d) parasitism for each.

Evolution 108

TN_GOVT_XII_ Bio Zoology_chapter6.indd 108 25-02-2019 19:16:30


www.asiriyar.net

18) How does Hardy-Weinberg’s expression  ustrolopithecus → Homo erectus →


A
(p2+2pq+q2=1) explain that genetic Homo sapiens → Ramapithecus → Homo
equilibrium is maintained in a habilis.
population? List any four factors that can 28) Differentiate between the eating habit
disturb the genetic equilibrium. and brain size of Australopithecus and
19) Explain how mutations, natural selection Ramapithecus.
and genetic drift affect Hardy Weinberg 29) How does Neanderthal man differ from
equilibrium. the modern man in appearance?
20) How did Darwin explain fitness of 30) Mention any three similarities found
organisms? common in Neanderthal man and
21) Mention the main objections to Homo sapiens.
Darwinism. 31) According to Darwin, the organic
22) Taking the example of Peppered moth, evolution is due to [AIPMT-2013]3)
explain the action of natural selection. a) Intraspecific competition
What do you call the above phenomenon? b) Interspecific competition
23) Darwin's finches and Australian c) Competition within closely related
marsupials are suitable examples of species.
adaptive radiation – Justify the statement. d) Reduced feeding efficiency in one species
due to the presence of interfering species.
24) Who disproved Lamarck’s Theory of
32) A population will not exist in Hardly-
acquired characters? How?
Weiberg equilibrium if [AIPMT-2015]
25) How does Mutation theory of De Vries a) Individuals mate selectively
differ from Lamarck and Darwin’s view
b) There are no mutations
in the origin of new species.
c) There is no migration
26) Explain stabilizing, directional and d) The population is large
disruptive selection with examples.
27) Rearrange the descent in human
evolution

109 Evolution

TN_GOVT_XII_ Bio Zoology_chapter6.indd 109 25-02-2019 19:16:30


Evolution
Concept Map

110
3DQVSHUPLD 0XWDWLRQ
6SRQWDQHRXV
JHQHUDWLRQ

TN_GOVT_XII_ Bio Zoology_chapter6.indd 110


6WDELOLVLQJ

6SHFLDWLRQ
6SHFLDO
FUHDWLRQ 1DWXUDOVHOHFWLRQ 'LVUXSWLYH
2ULJLQRIOLIH

'LUHFWLRQDO
$ELRJHQHVLV
(92/87,21 $FTXLUHG
FKDUDFWHUV

+XPDQHYROXWLRQ 3RSXODWLRQ
(PEU\RORJLFDO

'U\RSLWKHFXV +DUG\:HLQEHUJ
HTXLOLEULXP
(YLGHQFHV
5DPDSLWKHFXV
)DFWRUVDIIHFWLQJ
0RUSKRORJLFDO *HQHIORZ +DUG\:HLQEHUJ 5HFRPELQDWLRQ
DQG$QDWRPLFDO HTXLOLEULXP
$XVWUDORSLWKHFXV %LRFKHPLFDO
0XWDWLRQ

+RPRKDELOLV *HQHWLFGULIW
'LYHUJHQW 1DWXUDOVHOHFWLRQ
HYROXWLRQ
+RPRORJ\
+RPRHUHFWXV 3DOHRQWRORJLFDO
&RQYHUJHQW
HYROXWLRQ
+RPRVDSLHQV $QDORJ\

25-02-2019 19:16:30
www.asiriyar.net
www.asiriyar.net

7
UNIT - III

Human Health
and Diseases
CHAPTER

Sneezing spreads diseases through the droplets


Chapter outline of mucus
7.1 Common diseases in human beings:
Infectious and non infectious

T
7.2 Maintenance of personal and public
he World Health Organization [WHO]
hygiene
defines health as ‘a state of complete
7.3 Basic concepts of immunology
physical, mental and social wellbeing and not
7.4 Immunodeficency diseases
merely absence of diseases’. We can also say
7.5 Autoimmune diseases
“HEALTH IS WEALTH”, when people are
7.6 Adolescence – Drug and alcohol abuse
healthy they are more efficient at work. Health
7.7 Mental health – Depression
increases longevity of people and reduces
infant and adult mortality. Personal hygiene,
Learning Objectives regular exercise and balanced diet are very
important to maintain good health.
➢ Learns about various bacterial,viral,
fungal, protozoan and helminth diseases. 7.1 Common diseases in
➢ Understands the life cycle of human beings
malarial parasite. Disease can be defined as a disorder or
➢ Understands the basic concepts of
malfunction of the mind or body. It involves
immunology.
morphological, physiological and psychological
➢ Differentiates between innate immunity
disturbances which may be due to environmental
and acquired immunity,
primary immune response factors or pathogens or genetic anomalies or life
and scondary immune style changes. Diseases can be broadly grouped
response, active and passive into infectious and non infectious types.
immunity. Diseases which are transmitted from one
➢ Realiazes the importance of person to another are called infectious diseases
immunization. or communicable diseases. Such disease
➢ Explains the concept of hypersensitivity. causing organisms are called pathogens
➢ Learns the ill effects of drugs and alcohol. and are transmitted through air, water, food,
➢ Realizes the responsibility for their physical contact and vectors. The disease
behaviour and health care.
causing pathogen may be virus, bacteria, fungi,
➢ Understands the importance of mental
protozoan parasites, helminthic parasites, etc.,
health and to be followed for their well
Infectious diseases are common and everyone
being.

111

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 111 25-02-2019 19:18:29


www.asiriyar.net

Common human diseases

Bacterial diseases Viral diseases Fungal diseases Protozoan Helminthic


• Dysentery • Common cold • Candidiasis diseases diseases
• Plague • Mumps • Athlete’s foot • Malaria • Ascariasis
• Diphtheria • Measles • Amoebiasis • Filariasis
• Cholera • Viral hepatitis • African
• Typhoid • Dengue fever sleeping
• Pneumonia • Chikungunya sickness
• Chicken pox • Kala-azar
• Poliomyelitis

suffers from such diseases at some time or the


Bacterial resistance
other. Most of the bacterial diseases are curable
If an antibiotic is used too often to
but all viral diseases are not. Some infectious
fight a specific bacterial infection, the
disease like AIDS may be fatal.
bacteria may become resistant to the
Non-infectious diseases are not
specific antibiotic. Hence the specific
transmitted from an infected person to
antibiotic can no longer be used to
a healthy person. In origin they may be
treat the bacterial infection. Some
genetic (cystic fibrosis), nutritional (vitamin
deficiency diseases) and degenerative bacteria have developed resistance to
(arthritis, heart attack, stroke). Among non - many antibiotics. Therefore, infections
infectious diseases, cancer is one of the major caused by these bacteria are difficult to
causes of death. be cured.
Risk of bacterial resistance can be
7.1.1 Bacterial and viral diseases reduced by observing the following steps
Bacterial diseases
• Avoid using antibiotics to treat minor
Though the number of bacterial
infections that can be taken care by our
species is very high, only a few bacteria are
immune system.
associated with human diseases and are called
pathogenic bacteria. Such pathogens may • Do not use an antibiotic to treat viral
emit toxins and affected the body. Common infections such as common cold or flu.
pathogenic bacteria and the bacterial diseases • Always follow the prescription.
are given in table 7.1. Skipping doses or failing to complete
Bacteria spread through air, water or the prescription may allow antibiotic
by inhaling the droplets/aerosols or even resistance to develop.
by sharing utensils, dresses with an infected
person. Typhoid fever can be confirmed by living cells. Outside the living cells they
Widal test. cannot carry out the characteristics of a
living organism. Viruses invade living cells,
Viral diseases forcing the cells to create new viruses. The
Viruses are the smallest intracellular new viruses break out of the cell, killing it
obligate parasites, which multiply within and invade other cells in the body, causing
Human Health and Diseases 112

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 112 25-02-2019 19:18:29


www.asiriyar.net

Table 7.1. Bacterial diseases in human beings


S. Diseases Causative agent Site of Mode of Symptoms
No infection transmission
1 Shigellosis Shigella sp. Intestine Food and water Abdominal pain,
(Bacillary contaminated dehydration, blood
dysentery) by faeces / and mucus in the
faecal oral route stools

2 Bubonic Yersinia pestis Lymph Rat flea vector- Fever, headache,


plague nodes Xenopsylla and swollen lymph
( Black death) cheopis nodes
3 Diphtheria Corynebacterium Larynx, Droplet Fever, sore throat,
diphtheriae skin, nasal infection hoarseness and
and genital difficulty in
passage breathing
4 Cholera Vibrio cholerae Intestine Contaminated Severe diarrhoea
food and water/ and dehydration
faecal oral route
5 Tetanus Clostridium Spasm of Through wound Rigidity of jaw
( Lock jaw) tetani muscles infection muscle, increased
heart beat rate
and spasm of the
muscles of the jaw
and face
6 Typhoid Salmonella typhi Intestine Through Headache,
( Enteric fever) contaminated abdominal
food and water discomfort, fever
and diarrhoea
7 Pneumonia Streptococcus Lungs Droplet Fever, cough,
pneumoniae infection painful breathing
and brown sputum
8 Tuberculosis Mycobacterium Lungs Droplet Thick
tuberculosis infection mucopurulant
nasal discharge

diseases in human beings. Rhino viruses cause i. Pneumotropic diseases (respiratory


one of the most infectious human ailment tract infected by influenza)
called the “Common cold”. ii. Dermotropic diseases (skin and
Viral diseases are generally grouped subcutaneous tissues affected by chicken pox
into four types on the basis of the symptoms and measles)
produced in the body organs.

113 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 113 25-02-2019 19:18:29


www.asiriyar.net

Table: 7.2 Viral diseases in human beings


S. Diseases Causative Site of Mode of Symptoms
No agent infection transmission
1 Common cold Rhino viruses Respiratory Droplet Nasal congestion
tract infection and discharge, sore
throat, cough and
headache
2 Mumps Mumps virus Salivary glands Saliva and Enlargement of the
(RNA virus) droplet parotid glands
Paramyxo infection
virus
3 Measles Rubella virus Skin and Droplet Sore throat,
(RNA virus), respiratory infection running nose,
Paramyxo tract cough and fever.
virus reddish rashes on
the skin, neck and
ears
4 Viral hepatitis Hepatitis - B Liver Parenteral Liver damage,
virus route, blood jaundice, nausea,
transfusion yellowish eyes,
fever and pain in
the abdomen
5 Chicken pox Varicella Respiratory Droplet Mild fever with
-Zoster virus tract, skin and infection and itchy skin, rash and
(DNA Virus ) nervous system direct contact blisters
6 Poliomyelitis Polio virus Intestine, Droplet Fever, muscular
(RNA virus) brain, spinal infection stiffness and
cord through weakness, paralysis
faecal oral and respiratory
route failure
7 Dengue fever Dengue virus Skin and blood Mosquito Severe flu like
(Break bone or Flavi virus vector illness with a
fever) (DENV 1-4 Aedes aegypti sudden onset of
virus) fever and painful
headache, muscle
and joint pain
8 Chikungunya Alpha virus Nervous Mosquito Fever and joint
(Toga virus) system vector Aedes pain, headache and
aegypti joint swelling

Human Health and Diseases 114

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 114 25-02-2019 19:18:29


www.asiriyar.net

the walls of the host intestine (colon) and


Nipah virus is a zoonotic virus
secretes histolytic enzymes causing ulceration,
(transmitted from animals to humans) and
bleeding, abdominal pain and stools with
also transmitted through contaminated
excess mucus. Symptoms of amoebiasis can
food. In infected people, it causes a range
range from diarrhoea to dysentery with blood
of illness from asymptomatic infection and mucus in the stool. House flies (Musca
to acute respiratory illness and fatal domestica) acts as a carrier for transmitting the
encephalitis. parasite from contaminated faeces and water.
Endosome Food vacuole

Plasmalemma

Ectoplasm

Endoplasm

iii. Viscerotropic diseases (blood and


visceral organs affected by yellow fever and Nucleus

dengue fever) Fig. 7.1 Entamoeba histolytica


iv. Neurotropic diseases (central
nervous system affected by rabies and polio). African sleeping sickness is caused
Some common viral diseases of human beings by Trypanosoma species. Trypanosoma is
are given in table 7.2. generally transmitted by the blood sucking
Tsetse flies. Three species of Trypanosoma
Swine flu was first cause sleeping sickness in man.
recognised in the 1919 Free flagellum
pandemic and still circulates
as a seasonal flu virus. Swine Attached
flu is caused by the H1N1 flagellum

virus strain. Symptoms include fever, cough,


sore throat, chills, weakness and body aches. Undulating
membrane
Children, pregnant women and the elderly
are at risk from severe infection. Pellicle

7.1.2 Protozoan diseases


Nucleus
About 15 genera of protozoans live as
parasites within the human body and cause Reserve
food
diseases. granules

Amoebiasis also called amoebic dysentery


or amoebic colitis is caused by Entamoeba
histolytica, which lives in the human large Basal granule
intestine and feeds on food particles and Kinetoplast

bacteria (Fig. 7.1). Infective stage of this


Fig. 7.2. Trypanosoma
parasite is the trophozoite, which penetrates gambiense
115 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 115 25-02-2019 19:18:30


www.asiriyar.net

1. T. gambiense is transmitted by Glossina being released from liver cells, the merozoites
palpalis (Tsetse fly) and causes Gambian or penetrate the RBC’s.
Central African sleeping sickness (Fig. 7.2). Inside the RBC, the merozoite begins
2. T. rhodesiense is transmitted by Glossina to develop as unicellular trophozoites. The
morsitans causing Rhodesian or East trophozoite grows in size and a central vacuole
African sleeping sickness. develops pushing them to one side of cytoplasm
and becomes the signet ring stage. The
3. T. cruzi is transmitted by a bug called
trophozoite nucleus then divides asexually to
Triatoma megista and causes Chagas disease
produce the schizont. The large schizont shows
or American trypanosomiasis.
yellowish - brown pigmented granules called
Kala – azar or visceral leishmaniasis Schuffners granules. The schizont divides
is caused by Leishmania donovani, which is and produces mononucleated merozoites.
transmitted by the vector Phlebotomus (sand Eventually the erythrocyte lyses, releasing the
fly). Infection may occur in the endothelial cells, merozoites and haemozoin toxin into the blood
bone marrow, liver, lymph glands and blood stream to infect other erythrocytes. Lysis of red
vessels of the spleen. Symptoms of Kala azar blood cells results in cycles of fever and other
are weight loss, anaemia, fever, enlargement of symptoms. This erythrocytic stage is cyclic
spleen and liver. and repeats itself approximately every 48 to
Malaria is caused by different types of 72 hours or longer depending on the species
Plasmodium species such as P. vivax, P. ovale, of Plasmodium involved. The sudden release
P. malariae and P. falciparum (Table 7.3). of merozoites triggers an attack on the RBCs.
Plasmodium lives in the RBC of human in its Occasionally, merozoites differentiate into
mature condition it is called as trophozoite. It is macrogametocytes and microgametocytes.
transmited from one person to another by the When these are ingested by a mosquito,
bite of the infected female Anopheles mosquito. they develop into male and female gametes
respectively.
Life cycle of Plasmodium In the mosquito's gut, the infected
Plasmodium vivax is
erythrocytes lyse and male and female
a digenic parasite, involving
gametes fertilize to form a diploid zygote
two hosts, man as the
called ookinete. The ookinete migrates to the
secondary host and female
mosquito's gut wall and develop into an oocyte.
Anopheles mosquito as the
The oocyte undergoes meiosis by a process
primary host. The life cycle
called sporogony to form sporozoites. These
of Plasmodium involves three phases namely
sporozoites migrate to the salivary glands of
schizogony, gamogony and sporogony (Fig. 7.3).
the mosquito. The cycle is now completed and
The parasite first enters the human blood when the mosquito bites another human host,
stream through the bite of an infected female the sporozoites are injected and the cycle begins
Anopheles mosquito. As it feeds, the mosquito a new.
injects the saliva containing the sporozoites. The
The pathological changes caused by
sporozoite within the blood stream immediately
malaria, affects not only the erythrocytes
enters the hepatic cells of the liver. Further in
but also the spleen and other visceral organs.
the liver they undergo multiple asexual fission
Incubation period of malaria is about 12 days.
(schizogony) and produce merozoites. After
The early symptoms of malaria are headache,
nausea and muscular pain. The classic

Human Health and Diseases 116

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 116 25-02-2019 19:18:30


www.asiriyar.net

,QPRVTXLWRJXW ,QKXPDQ

6SRUR]RLWHV 6SRUR]RLWHV

6DOLYDU\
JODQGV

/LYHU
2RF\VW 0HUR]RLWHV

6FKL]RQW
IRUPV
'1$UHSOLFDWLRQIROORZHG 0HUR]RLWHV
E\VSRURJRQ\ UXSWXUHIURP
5%&
2RNLQHWH 5%&V
0LGWURSKR]RLWH
'1$UHSOLFDWLRQDQG0HLRVLV 6SKDVHEHJLQV 1XFOHXV

=\JRWH +HPR]RLQ

(DUO\WURSKR]RLWH 6LJQHWULQJ
IRUPV IRUPV
0DFURJDPHWH
0DFURJDPHWRF\WH
0LFURJDPHWH

0LFURJDPHWRF\WH

([IODJHOODWLRQ *DPHWRF\WHV3ODVPRGLXP

Fig. 7.3  Life cycle of Plasmodium


symptoms first develop with the synchronized Prevention
release of merozoites, haemozoin toxin and It is possible to break the transmission
erythrocyte debris into the blood stream cycle by killing the insect vector. Mosquito's
resulting in malarial paroxysms – shivering lay their eggs in water. Larvae hatch and
chills, high fever followed by sweating. Fever develop in water but breathe air by moving to
and chills are caused partly by malarial toxins the surface. Oil can be sprayed over the water
that induce macrophages to release tumour surface, to make it impossible for mosquito
necrosis factor (TNF-α) and interleukin. larvae and pupae to breathe.
Table 7.3 Types of malaria

Sl Types of Malaria Causative agent Duration of


No Erythrocytic cycle
1 Tertian, benign tertian or vivax P. vivax 48 hours
malaria
2 Quartan malaria P. malariae 72 hours
3 Mild tertian malaria P. ovale 48 hours
4 Malignant tertian or quotidian P. falciparum 36 – 48 hours
malaria

117 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 117 25-02-2019 19:18:30


www.asiriyar.net

Ponds, drainage ditches and other to grow and makes them to thrive in skin
permanent bodies of water can be stocked folds such as those in the groin or between
with fishes such as Gambusia which feed on the toes. Ringworms of the feet is known as
mosquito larvae. Preparations containing Athlete’s foot caused by Tinea pedis (Fig.
Bacillus thuringiensis can be sprayed to kill 7.5). Ringworms are generally acquired from
the mosquito larvae since it is not toxic to soil or by using clothes, towels and comb used
other forms of life. The best protection against by infected persons.
malaria is to avoid being bitten by mosquito.
People are advised to use mosquito nets, wire
gauging of windows and doors to prevent
mosquito bites.
In the 1950’s the World Health
Organisation (WHO) introduced the Malaria
eradication programme. This programme
was not successful due to the resistance of
Plasmodium to the drugs used to treat it and
resistance of mosquito's to DDT and other
insecticides. Fig. 7.4 Symptoms of Ringworm

Malaria vaccine is used


to prevent  malaria.
The only approved
vaccine as of 2015 is
RTS,S(Mosquirix). It
requires four injections and has
relatively low efficacy (26–50%). Due
to this low efficacy,  WHO  does not
Fig. 7.5 Symptoms of Athlete’s foot
recommend the use of RTS,S vaccine
in babies between 6 and 12 weeks
of age. 7.1.4 Helminthic diseases
Helminthes are mostly endoparasitic
in the gut and blood of human beings and
7.1.3 Fungal diseases cause diseases called helminthiasis. The
Fungi was recognized as a causative two most prevalent helminthic diseases are
agent of human diseases much earlier than Ascariasis and Filariasis.
bacteria. Dermatomycosis is a cutaneous
Ascaris is a monogenic parasite and exhibits
infection caused by fungi belonging to the
sexual dimorphism. Ascariasis is a disease
genera Trichophyton, Microsporum and
caused by the intestinal endoparasite Ascaris
Epidermophyton.
lumbricoides commonly called the round worms
Ringworm is one of the most common (Fig. 7.6). It is transmitted through ingestion of
fungal disease in humans (Fig. 7.4). embryonated eggs through contaminated food
Appearance of dry, scaly lesions on the skin, and water. Children playing in contaminated
nails and scalp are the main symptoms of the soils are also prone to have a chance of transfer
disease. Heat and moisture help these fungi of eggs from hand to mouth. The symptoms

Human Health and Diseases 118

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 118 25-02-2019 19:18:30


www.asiriyar.net

Triradiate mouth
with lips
of the disease are In some cases, the obstruction of lymph vessels
Excretory
pore abdominal pain, causes elephantiasis or filariasis of the limbs,
Lateral line vomiting, headache, scrotum and mammary glands (Fig. 7.8).
anaemia, irritability
and diarrhoea. A heavy 7.2 Maintenance of personal and
infection can cause public hygiene
Cloacal aperture
nutritional deficiency Hygiene is a set of practices performed
Penial setae

and severe abdominal to conserve good health. According to the World


pain and causes stunted Health Organization (WHO), hygiene refers to
Ventrally
curved tail
growth in children. “conditions and practices that help to maintain
Fig. 7.6 health and prevent the spread of diseases."
Ascaris It may also cause
male and Anus
enteritis, hepatitis and Personal hygiene refers to maintaining
female worm bronchitis. one’s body clean by bathing, washing hands,
trimming fingernails, wearing clean clothes
Filariasis is caused by Wuchereria
and also includes attention to keeping surfaces
bancrofti, commonly called filarial worm.
in the home and workplace, including toilets,
It is found in the lymph vessels and lymph
bathroom facilities, clean and pathogen-free.
nodes of man (Fig. 7.7). Wuchereria bancrofti
is sexually dimorphic, viviparous and digenic. Our public places teem with infection,
The life cycle is completed in two hosts, man contamination and germs. It seems that every
and the female Culex mosquito. The female surface we touch and the air we breathe are with
filarial worm gives rise to juveniles called pollutants and microbes. It’s not just the public
microfilariae larvae. In the lymph glands, the places that are unclean, but we might be amazed
juveniles develop into adults. The accumulation at the number of people who do not wash their
of the worms block the lymphatic system hands before taking food, after visiting the
resulting in inflammation of the lymph nodes. restroom, or who sneeze without covering their
faces. Many infectious diseases such as typhoid,
amoebiasis and ascariasis are transmitted
through contaminated food and water.
Advancement in science and technology
provide effective controlling measures for many
infectious and non-infectious diseases. The use of
vaccines and adopted immunization programmes
have helped to eradicate small pox in India.
Moreover a large number of infectious diseases
like polio, diphtheria, pneumonia and tetanus
have been controlled by the use of vaccines and
by creating awareness among the people.

7.3 Basic concepts of


Immunology
Immunology is the study of immune
system. This system protects an indvidual
Fig. 7.7 Wuchereria Fig. 7.8 Chronic
bancrofti from various infective agents. It refers to
inflammation of the
all the mechanisms used by the body for
lower limbs
119 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 119 25-02-2019 19:18:31


www.asiriyar.net

protection from environmental agents that that are foreign to the host and not to those of
are foreign to the body. host itself. This ability to distinguish foreign
molecules from self is another fundamental
When the immune system does not
feature of the immune system. However,
function efficiently in an individual, it leads to
occasionally, it fails to make its distinction
infection causing disease. The overall ability
and reacts destructively against the host's
of body to fight against the disease causing
own molecules; such autoimmune diseases
pathogen is called immunity. It is also called
can be fatal to the organism.
disease resistance and the lack of immunity is
known as susceptibility. Immunity is highly Almost all the macromolecules e.g.
specific. proteins, polysaccharides, nucleic acids,
etc., as long as they are foreign to recipient
Normally many of the responses of the
organism can induce immune response.
immune system initiate the destruction and
Any substance capable of eliciting immune
elimination of invading organisms and any
response is called an ANTIGEN (ANTIbody
toxic molecules produced by them. These
GENerator). There are two broad classes of
immune reactions are destructive in nature
immunity responses namely, innate immunity
and are made in response only to molecules
and acquired immunity (Fig. 7.9).

Table 7.4 Innate immunity- types and mechanisms

Type of innate immunity Mechanism


1. Anatomical barriers
Prevents the entry of microbes.
Skin
Its acidic environment (pH 3-5) retards the growth of microbes.

Mucus entraps foreign microorganisms and competes with microbes


Mucus membrane
for attachment.

2. Physiological barriers

Normal body temperature inhibits the growth of pathogens.


Temperature
Fever also inhibits the growth of pathogens.

Low pH Acidity of gastric secretions (HCl) kills most ingested microbes.

Lysozyme acts as antibacterial agent and cleaves the bacterial cell wall.
Interferons induce antiviral state in the uninfected cells.
Chemical mediators
Complementary substances produced from leucocytes lyse the
pathogenic microbes or facilitate phagocytosis.

Specialized cells (Monocytes, neutrophils, tissue macrophages)


3. Phagocytic barriers
phagocytose, and digest whole microorganisms.

Tissue damage and infection induce leakage of vascular fluid,


containing chemotactic signals like serotonin, histamine and
4. Inflammatory barriers
prostaglandins. They influx the phagocytic cells into the affected area.
This phenomenon is called diapedesis.

Human Health and Diseases 120

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 120 25-02-2019 19:18:31


www.asiriyar.net

Immunity 7.3.2 Acquired immunity


The immunity that an individual acquires
Innate Adaptive
after birth is known as acquired immunity. It
Immunity Immunity is the body's resistance to a specific pathogen.

The unique features of acquired immunity


Artificial
Natural are antigenic specificity, diversity, recognition of
self and non-self and immunological memory.
Active Passive Active Passive
(infection) (maternal) (immunization) (antobody
transfer)
Components of acquired
Fig. 7.9 Immune system immunity
Acquired immunity has two components –
cell mediated immunity (CMI) and antibody
7.3.1 Innate immunity mediated immunity or humoral immunity.
Innate immunity is the natural
phenomenon of resistance to infection which 1. Cell mediated immunity
an individual possesses right from the birth. When pathogens are destroyed by cells
The innate defense mechanisms are non-specific without producing antibodies, then it is known
in the sense that they are effective against a as cell mediated immune response or cell
wide range of potentially infectious agents. It is mediated immunity. This is brought about by T
otherwise known as non-specific immunity or cells, macrophages and natural killer cells.
natural immunity. 2. Antibody mediated immunity or humoral
immunity
Lysozyme in tears When pathogens are destroyed by the
Removal of airbrone
particles production of antibodies, then it is known
Bronchi as antibody mediated or humoral immunity.
mucus,cilia
This is brought about by B cells with the help
Gut of antigen presenting cells and T helper cells.
acid
Antibody production is the characteristic
Skin feature of vertebrates only.
Physical barrier

Rapid pH change Types of acquired immunity


Acquired immunity may be active
Flushing of
urinary tract immunity or passive immunity (Table 7.5).

Low pH The immunological resistance developed


of vagina
by the organisms through the production
Fig. 7.10 Various anatomical and of antibodies in their body is called active
physiological barriers to microbial attack immunity. Active immunity is acquired through
the use of a person’s immune responses, which
A number of innate defense mechanisms are lead to the development of memory cells.
operative non-specifically against a large number Active immunity results from an infection or an
of microorganisms as shown in the Table 7.4 and immunization.
Fig. 7.10.

121 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 121 25-02-2019 19:18:32


www.asiriyar.net

Table 7.5 Differences between active and passive immunity

Sl.No Active Immunity Passive Immunity


Active immunity is produced actively by Passive immunity is received passively and
1
host’s immune system. there is no active host participation.
It is produced due to contact with pathogen It is produced due to antibodies obtained
2
or by its antigen. from outside.
3 It is durable and effective in protection. It is transient and less effective.
4 Immunological memory is present. No memory.
Booster effect on subsequent dose is
5 Subsequent dose is less effective.
possible.
Immunity is effective only after a short
6 Immunity develops immediately.
period.

Passive immunity does not require the Primary immune response


body to produce antibodies to antigens. The The primary immune response occurs
antibodies are introduced from outside into the when a pathogen comes in contact with the
organism. Thus, passive immunity is acquired immune system for the first time. During
without the activation of a person’s immune this, the immune system has to learn to
response, and therefore there is no memory. recognize the antigen, produce antibody
against it and eventually produce memory
The process of production lymphocytes. The primary immune response
of blood cells in the is slow and short-lived.
bone marrow is called
haematopoiesis. Secondary immune response
The secondary immune response occurs
7.3.3 Immune responses when a person is exposed to the same antigen
The immune responses may be primary again. During this time, immunological memory
or secondary (Table 7.6). has been established and the immune system

Table 7.6 Differences between primary and secondary immune responses


Sl.No Primary Immune Response Secondary Immune Response
It occurs as a result of second and
It occurs as a result of primary contact
1 subsequent contacts with the same
with an antigen.
antigen.
Antibody level reaches peak in 7 to 10 Antibody level reaches peak in 3 to 5
2
days. days.
Prolonged period is required to establish
3 It establishes immunity in a short time.
immunity.
Antibody level remains high for longer
4 There is rapid decline in antibody level.
period.
It appears mainly in the lymph nodes It appears mainly in the bone marrow,
5
and spleen. followed by the spleen and lymph nodes.

Human Health and Diseases 122

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 122 25-02-2019 19:18:32


www.asiriyar.net

can start producing antibodies immediately.


Within hours after recognition of the antigen, a
new army of plasma cells are generated. Within
2 to 3 days, the antibody concentration in the
blood rises steeply to reach much higher level
than primary response. This is also called as
“booster response”.

7.3.4 Lymphoid organs


Immune system of an organism consists of
several structurally and functionally different
organs and tissues that are widely dispersed Bursa of Fabricius is a primary lymphoid organ
in the body. The organs involved in the origin, of birds. It is attached to the dorsal side of the
maturation and proliferation of lymphocytes cloaca. B lymphocytes mature in the bursa and
are called lymphoid organs (Fig. 7.11). bring about humoral immunity.

Primary lymphoid organs


Bursa of Fabricius of birds, bone marrow
and thymus gland of mammals constitute
the primary lymphoid organs involved
in the production and early selection of
lymphocytes. These lymphocytes become
dedicated to a particular antigenic specificity.
Only when the lymphocytes mature in the
primary lymphoidal organs, they become
immunocompetent cells. In mammals, B cell
maturation occurs in the bone marrow and
T cells maturation occurs in the thymus.

Thymus
The thymus is a flat and bilobed organ
located behind the sternun, above the heart.
Each lobe of the thymus contains numerous
lobules, separated from each other by
Fig. 7.11 Lymphoid organs in human body connective tissue called septa. Each lobule
is differentiated into two compartments,
Based on their functions, they are classified
the outer compartment or outer cortex, is
into primary or central lymphoid organs and
densely packed with immature T cells called
secondary or peripheral lymphoid organs. The
thymocytes, whereas the inner compartment
primary lymphoid organs provide appropriate
or medulla is sparsely populated with
environment for lymphocytic maturation. The
thymocytes. One of its main secretions is the
secondary lymphoid organs trap antigens and
hormone thymosin. It stimulates the T cell to
make it available for mature lymphocytes, which
become mature and immunocompetent. By
can effectively fight against these antigens.

123 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 123 25-02-2019 19:18:32


www.asiriyar.net

the early teens, the thymus begins to atrophy


and is replaced by adipose tissue (Fig. 7.12). Peyer’s patches are oval-shaped areas
Thus thymus is most active during the of thickened tissue that are embedded in
neonatal and pre-adolescent periods. the mucus-secreting lining of the small
intestine of humans and other vertebrate
7K\URLG
animals. Peyer’s patches contain a variety
JODQG
7UDFKHD
of immune cells, including macrophages,
5LJKWOREH dendritic cells, T cells, and B cells.
7K\PXV
/HIWOREH
The tonsils (palatine tonsils) are a pair
6HSWDH of soft tissue masses located at the back of
/REXOH the throat (pharynx). The tonsils are part
of the lymphatic system, which help to
fight infections. They stop invading germs
$ %
/XQJV including bacteria and viruses.
+HDUW
Spleen is a secondary lymphoid organ
Fig. 7.12 Primary lymphoid organ - Thymus located in the upper part of the abdominal
A) Location B) Structure cavity close to the diaphragm. Spleen
Bone marrow contains B and T cells. It brings humoral
Bone marrow is a lymphoid tissue found and cell mediated immunity.
within the spongy portion of the bone.
Bone marrow contains stem cells known as The adenoids are glands
haematopoietic cells. These cells have the located in the roof of
potential to multiply through cell division the mouth, behind the
and either remain as stem cells or differentiate soft palate where the
and mature into different kinds of blood cells. nose connects to the
throat. The adenoids produce antibodies
Secondary or peripheral lymphoid that help to fight infections. Typically,
organs the  adenoids  shrink during adolescence
In secondary or peripheral lymphoid and may disappear by adulthood.
organs, antigen is localized so that it can be
effectively exposed to mature lymphocytes.
Lymph nodes filter and trap substances that
The best examples are lymph nodes,
travel through the lymphatic fluid. They are
appendix, Peyer’s patches of gastrointestinal
packed tightly with white blood cells, namely
tract, tonsils, adenoids, spleen, MALT
lymphocytes and macrophages. There are
(Mucosal-Associated Lymphoid Tissue),
hundreds of lymph nodes found throughout
GALT (Gut-Associated Lymphoid Tissue),
the body. They are connected to one another
BALT (Bronchial / Tracheal-Associated
by lymph vessels. Lymph is a clear, transparent,
Lymphoid Tissue).
colourless, mobile and extracellular fluid
Lymph node connective tissue. As the lymph percolates
through the lymph node, the particulate
Lymph node is a small bean-shaped
antigen brought in by the lymph will be
structure and is part of the body’s immune
trapped by the phagocytic cells, follicular and
system. It is the first one to encounter
interdigitating dendritic cells.
the antigen that enters the tissue spaces.

Human Health and Diseases 124

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 124 25-02-2019 19:18:32


www.asiriyar.net

Afferent lymphatic vessel Mucosa-associated lymphoid tissue


(MALT) is a diffuse system of small
concentrations of lymphoid tissue in the
alimentary, respiratory and urino-genital
tracts. MALT is populated by lymphocytes
Sinuses
Mantle zone such as T and B cells, as well as plasma
Follicle cells and macrophages, each of which is
Cortex well situated to encounter antigens passing
Paracortex through the mucosal epithelium.
Medullary
Efferent lymphatic vessel
cords Gut-associated lymphoid tissue
(GALT) is a component of the mucosa-
Fig. 7.13 Secondary lymphoid organ – associated lymphoid tissue (MALT) which
Structure of lymph node works in the immune system to protect the
Lymph node has three zones (Fig. 7.13). body from invasion in the gut.
They are the cortex, paracortex and medulla. Bronchus Associated Lymphoid Tissues
The outer most layer of the lymph node is (BALT) also a component of MALT is made
called cortex, which consists of B-lymphocytes, of lymphoid tissue (tonsils, lymph nodes,
macrophages, and follicular dendritic cells. The lymph follicles) is found in the respiratory
paracortex zone is beneath the cortex, which mucosae from the nasal cavities to the lungs.
is richly populated by T lymphocytes and microbial infections and the growth of tumour
interdigitating dendritic cells. The inner most cells. The cellular composition of adult human
zone is called the medulla which is sparsely blood is given in Table 7.7.
populated by lymphocytes, but many of them
Table 7.7 The cellular composition of adult
are plasma cells, which actively secrete antibody human blood
molecules. As the lymph enters, it slowly
percolates through the cortex, paracortex Number of Approximate
Cell type
cells per µl percentage
and medulla, giving sufficient chance for the
phagocytic cells and dendritic cells to trap the 4200,000 -
Red blood cells -
antigen brought by the lymph. The lymph leaving 6500,000
a node carries enriched antibodies secreted by
White blood cells
the medullary plasma cells against the antigens
that enter the lymph node. Sometimes visible Agranulocytes
swelling of lymph nodes occurs due to active Lymphocytes 1500-4000 20-30
immune response and increased concentration
of lymphocytes. Thus swollen lymph nodes may Monocytes 200-950 2-7
signal an infection. There are several groups Granulocytes
of lymph nodes. The most frequently enlarged
Neutrophils 2000-7000 50-70
lymph nodes are found in the neck, under the
chin, in the armpits and in the groin. Basophils 50-100 <1

Cells of the immune system Eosinophils 40-500 2-5

The immune system is composed of many 150,000-


Platelets -
500,000
interdependent cells that protect the body from

125 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 125 25-02-2019 19:18:32


www.asiriyar.net

All these cells are derived from pluripotent activated and divides rapidly to produce plasma
haematopoetic stem cells. Each stem cell has the cells. The plasma cells produce antibodies. Some
capacity to produce RBC, WBC and platelets. B cells do not produce antibodies but become
The only cells capable of specifically recognising memory cells. These cells are responsible for
and producing an immune response are the secondary immune response. T lymphocytes
lymphocytes. The other types of white blood do not produce antibodies. They recognize
cells play an important role in non specific antigen-presenting cells and destroy them. The
immune response, antigen presentation and two important types of T cells are Helper T
cytokine production. cells and Killer T cells. Helper T cells release a
Lymphocytes: About 20-30% of the white chemical called cytokine which activates B cells.
blood cells are lymphocytes. They have a large Killer cells move around the body and destroy
nucleus filling most of the cell, surrounded cells which are damaged or infected (Fig. 7.14).
by a little cytoplasm. The two main types of Apart from these cells neutrophils and
lymphocytes are B and T lymphocytes. Both monocytes destroy foreign cells by phagocytosis.
these are produced in the bone marrow. B Monocytes when they mature into large cells,
lymphocytes (B cells) stay in the bone marrow they are called macrophages which perform
until they are mature. Then they circulate phagocytosis on any foreign organism.
around the body. Some remain in the blood,
while others accumulate in the lymph nodes and Dendritic cells are called so because
spleen. T lymphocytes leave the bone marrow its covered with long, thin membrane
and mature in the thymus gland. Once mature, extensions that resemble dendrites of nerve
T cells also accumulate in the same areas of the cells. These cells present the antigen to
body as B cells. Lymphocytes have receptor T-helper cells. Four types of dendritic cells
proteins on their surface. When receptors on a are known. They are langerhans, interstitial
B cell bind with an antigen, the B cell becomes cells, myeloid and lymphoid cells

Fig. 7.14 Cells of the immune system


Human Health and Diseases 126

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 126 25-02-2019 19:18:32


www.asiriyar.net

7.3.5 Antigens 7.3.6 Antibodies


The term antigen (Ag) is used in two Antibodies are immunoglobulin (Ig)
senses, the first to describe a molecule which protein molecules synthesized on exposure to
generates an immune response and the second, antigen that can combine specifically with the
a molecule which reacts with antibodies. In antigen. Whenever pathogens enter our body,
general antigens are large, complex molecular the B-lymphocytes produce an army of proteins
substances that can induce a detectable immune called antibodies to fight with them. Thus,
response. Thus an antigen is a substance that is they are secreted in response to an antigen
specific to an antibody or a T-cell receptor and (Ag) by the effect of B cells called plasma cells.
is often used as a synonym for immunogen. The antibodies are classified into five major
categories, based on their physiological and
The histocompatibility biochemical properties. They are IgG (gamma),
antigens are cell surface IgM (mu), IgA (alpha), IgD (delta) and IgE
antigens that induce an (epsilon).
immune response leading
In the 1950s, experiments by Porter and
to rejection of allografts.
Edelman revealed the basic structure of the
An immunogen is a substance capable of immunoglobulin. An antibody molecule
initiating an immune response. Haptens are is Y shaped structure that comprises of
substance that are non-immunogenic but can react four polypeptide chains, two identical light
with the products of a specific immune response. chains (L) of molecular weight 25,000 Da
Substances that can enhance the immune (approximately 214 amino acids) and two
response to an antigen are called adjuvants. identical heavy chains (H) of molecular weight
Epitope is an antigenic determinant and is the 50,000 Da (approximately 450 amino acids).
active part of an antigen. A paratope is the antigen The polypeptide chains are linked together
– binding site and is a part of an antibody which by di-sulphide (S-S) bonds. One light chain is
recognizes and binds to an antigen. attached to each heavy chain and two heavy
chains are attached to each other to form a Y
Antigenicity is the property shaped (Fig.7.15) structure. Hence, an antibody
of a substance (antigen) is represented by H2 L2. The heavy chains have
that allows it to react with a flexible hinge region at their approximate
the products of the specific middles.
Antigen binding
immune response. site

Types of antigens Variable


region
On the basis of origin, antigens are classified Light chain
into exogenous antigens and endogenous antigens. Disulphide
bond
The antigens which enter the host from the
Heavy chain
outside in the form of microorganisms, pollens,
Constant
drugs, or pollutants are called exogenous antigens. region
The antigens which are formed within the individual
are endogenous antigens. The best examples are Fig. 7.15 Structure of
blood group antigens. immunoglobulin

127 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 127 25-02-2019 19:18:33


www.asiriyar.net

Each chain (L and H) has two terminals. They are When antigen and antibody are closely
C - terminal (Carboxyl) and amino or N-terminal. fitted, the strength of binding is great. When
Each chain (L and H) has two regions. They have they are apart binding strength is low. The
variable (V) region at one end and a much larger bonds that hold the antigen to the antibody
constant (C) region at the other end. Antibodies combining site are all non-covalent in nature.
responding to different antigens have very different These include hydrogen bonds, electrostatic
(V) regions but their (C) regions are the same bonds, Van der Waals forces and hydrophobic
in all antibodies. In each arm of the monomer bonds. Antibody affinity is the strength of the
antibody, the (V) regions of the heavy and light reaction between a single antigenic determinant
chains combines to form an antigen – binding site and a single combining site on the antibody.
shaped to ‘fit’ a specific antigenic determinant.
The chief application of antigen - antibody
Consequently each antibody monomer has two
reactions are to determine blood groups for
such antigen – binding regions. The (C) regions
transfusion, to study serological ascertainment
that forms the stem of the antibody monomer
of exposure to infectious agents, to develop
determine the antibody class and serve common
immunoassays for the quantification of various
functions in all antibodies.
substances, to detect the presence or absence
The functions of immunoglobulin are of protein in serum and to determine the
agglutination, precipitation, opsonisation, characteristics of certain immunodeficiency
neutralization etc. diseases.

7.3.7 Antigen and


Different types of antigen and
antibody interaction
The reaction between
antibody reactions
an antigen and antibody The reaction between soluble antigen
is the basis for humoral and antibody leads to visible precipitate
immunity or antibody formation, which is called precipitin reaction.
mediated immunity. The Antibodies that bring about precipitate
reaction between antigen formation on reacting with antigens are called
and antibody occurs in as precipitins.
three stages. During the first stage, the reaction Whenever a particulate antigen interacts
involves the formation of antigen - antibody with its antibody, it would result in clumping or
complex. The next stage leads to visible events agglutination of the particulate antigen, which
like precipitation, agglutination, etc. The final is called agglutination reaction. The antibody
stage includes destruction of antigen or its involved in bringing about agglutination
neutralization (Fig. 7.16). reaction is called agglutinin.
Opsonisation or enhanced attachment
Binding force of antigen - antibody is the process by which a pathogen is marked
reaction of ingestion and destruction by a phagocyte.
The binding force between antigen and Opsonisation involves the binding of an
antibody is due to three factors. They are opsonin i.e., antibody, to a receptor on the
closeness between antigen and antibody, non- pathogen’s cell membrane. After opsonin
covalent bonds or intermolecular forces and binds to the membrane, phagocytes are
affinity of antibody. attracted to the pathogen. So, opsonisation is

Human Health and Diseases 128

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 128 25-02-2019 19:18:33


www.asiriyar.net

Antigen and Antibody interactions

Neutralisation Agglutination Precipitation


Complement system
(Exotoxin, toxoid) (Particulate antigen) (Soluble antigen)

Bacteria Complement
Virus molecule

Antigen
Bacterium molecules
Foreign cell Hole

Leads to
Enhances

Phagocytosis Inflammation Cell lysis


Inflammation
Injury

Macrophage

Fig. 7.16 Antigen and antibody reaction

a process in which pathogens are coated with the microbes, their toxins, or one of its surface
a substance called an opsonin, marking the proteins. Vaccines “teach” our body how to
pathogen out for destruction by the immune defend itself when viruses or bacteria, invade
system. This results in a much more efficient it. Vaccines deliver only very little amounts of
phagocytosis. inactivated or weakened viruses or bacteria, or
The neutralization reactions are the parts of them. This allows the immune system
reactions of antigen-antibody that involve the to recognize the organism without actually
elimination of harmful effects of bacterial experiencing the disease. Some vaccines need
exotoxins or a virus by specific antibodies. to be given more than once (i.e., a ‘booster’
These neutralizing substances i.e. antibodies vaccination) to make sure the immune system
are known as antitoxins. This specific can overcome a real infection in the future.
antibody is produced by a host cell in response Vaccine initiates the immunization
to a bacterial exotoxin or corresponding process. The vaccines are classified as first,
toxoid (inactivated toxin). second and third generation vaccines.

7.3.8 Vaccines First generation vaccine is further


subdivided into live attenuated vaccine, killed
A vaccine is a biological preparation
vaccine and toxoids (Fig. 7.17). Live attenuated
that provides active acquired immunity to
a particular disease and resembles a disease- vaccines  use the weakened (attenuated),
causing microorganism and is often made aged, less virulent form of the virus. E.g.
from weakened or attenuated or killed forms of Measles, mumps and rubella (MMR) vaccine

129 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 129 25-02-2019 19:18:33


www.asiriyar.net

Attenuated
(weakening)
Live Attenuated
pathogen non-pathogenic
form (vaccine)

Natural live vaccine Live attenuated vaccine

Chemical
Inactivation
Modification
Live
pathogen Killed pathogens Toxin Toxoid
(vaccine) (vaccine)
Fig.7.17 Types of vaccines
and the Varicella (chickenpox) vaccine, Killed 7.3.9 Vaccination and
(inactivated) vaccines are killed or inactivated
immunization
by heat and other methods. E.g. Salk’s polio
“Vaccination is the process of
vaccine. Toxoid vaccines  contain a toxin or
administrating a vaccine into the body or the act
chemical secreted by the bacteria or virus.
of introducing a vaccine into the body to produce
They make us immune to the harmful effects of
immunity to a specific disease.” Immunization
the infection, instead of to the infection itself. is the process of the body building up immunity
E.g. DPT vaccine (Diphtheria, Pertussis and to a particular disease. Immunization describes
Tetanus). the actual changes in the body after receiving a
Second generation vaccine contains the vaccine. Vaccines work by fighting the pathogen
pure surface antigen of the pathogen. E.g. and then recording it in their memory system
Hepatitis-B vaccine. Third generation vaccine to ensure that the next time this pathogen enters
contains the purest and the highest potency the body, it is eliminated far quickly. Once, the
vaccines which are synthetic in generation. The body is able to fight against the disease, it is
latest revolution in vaccine is DNA vaccine or believed to have built the immunity for it, also
recombinant vaccine (Refer Chapter- 10 for known as the body being immunized against
details). the disease.

Vaccino therapy is the


7.3.10 Hypersentivity –
method of use of vaccine
for treatment of disease. Overactive Immune Response
Dr. Edward Jenner prepared Some of the individuals are very sensitive
first vaccine for small pox to some particles present in the environment.
in 1796. Polio vaccine was developed by Dr. The exaggerated response of the immune system
Jonas Salk (vaccine consists of inactivated to certain antigens present in the environment
microorganism) and Dr. Albert Sabin (live is called allergy (allo-altered, erg-reaction).
attenuated oral polio vaccine). Louis Pasteur The substances to which such an immune
(1885) discovered vaccine against rabies, response is produced are called allergens. An
anthrax and cholera. BCG vaccine was allergen is an antigen that causes an allergic
developed by Calmette and Guerin against reaction. Allergic reactions begin within few
tuberculosis in France in the year 1908. seconds after the contact with the allergen and

Human Health and Diseases 130

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 130 25-02-2019 19:18:33


www.asiriyar.net

last about half an hour. The common examples observed under the electron microscope,
of allergens are mites in dust, pollens and some HIV is seen as a spherical virus, 100-120
proteins in insect venom. Hay fever and asthma nm in diameter, containing a dense core
are some common examples of allergy. Symptoms surrounded by a lipoprotein envelope.
of allergic reactions include sneezing, watery eyes, The envelope has glycoprotein (gp)
running nose and difficulty in breathing. Allergy is spikes termed gp 41 and gp 120. At the
a form of over active immune response mediated core, there are two large single stranded
by IgE and mast cells. It can also be due to the RNA. Attached to the RNA are molecules
release of chemicals like histamine and serotonin of reverse transcriptase. It also contains
from the mast cells. enzymes like protease and ribonuclease.
Anaphylaxis is the classical immediate The core is covered by a capsid made
hypersensitivity reaction. It is a sudden, systematic, of proteins. This is followed by another
severe and immediate hypersensitivity reaction layer of matrix proteins as shown in the
occurring as a result of rapid generalized mast-cell Fig 7.18.
degranulation. gp41
gp120

7.4 Immunodeficiency disease Lipid bilayer

–Ineffective immune response Matrix protein

– AIDS Capsid protein

Immunodeficiency results from the failure Reverse


transcriptase

of one or more components of the immune


system. Primary immune deficiencies are Two single-stranded
RNAs
caused by genetic developmental defects.
Secondary immune deficiencies arise due to
various reasons like radiation, use of cytolytic
and immunosuppressive drugs and infections. Fig. 7.18 Structure of HIV
AIDS is an acronym for Acquired Immuno
Deficiency Syndrome. It is the deficiency of HIV Transmission
immune system, acquired during the life time The HIV is often located within the
of an individual indicating that it is not a cells especially in macrophages. HIV can
congenital disease. AIDS is caused by Human survive for 1.5 days inside a cell but only
Immuno Deficiency Virus (HIV). It selectively about 6 hours outside a cell. Routes of HIV
infects helper T cells. The infected helper T transmission include unsafe sexual contact,
cells will not stimulate antibody production blood-contaminated needles, organ
by B-cells resulting in loss of natural defence transplants, blood transfusion and vertical
against viral infection. On the basis of genetic transmission from HIV infected mother to
characteristics and differences in the viral child. HIV is not transmitted by insects or
antigens, HIV is classified into the types 1 and 2 by casual contact.
(HIV-1, HIV-2).
After getting into the body of the person,
the virus enters into macrophages where RNA
Structure of HIV
genome of the virus replicates to form viral DNA
The human immunodeficiency virus
with the help of the enzyme reverse transcriptase.
belongs to the genus Lentivirus. When
This viral DNA gets incorporated into the DNA

131 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 131 25-02-2019 19:18:34


www.asiriyar.net

of host cells and directs the infected cells to cytotoxic T cells that destroy our own tissues.
produce viral particles. The macrophages If a disease-state results, it is referred to as
continue to produce virus and in this way acts auto-immune disease. Thus, autoimmunity is a
like a HIV factory. Simultaneously, HIV enters misdirected immune response. Autoimmunity
into helper T-lymphocytes, replicates and is evidenced by the presence of auto antibodies
produces progeny viruses. The progeny viruses and T cells that are reactive with host antigens.
released in the blood attack other helper When the cells act as antigens in the same body,
T-lymphocytes. This is repeated, leading to a they are called autoantigens.
progressive decrease in the number of helper
Autoimmune diseases in human can be
T lymphocytes in the body of the infected
divided into two broad categories, namely
person. During this period, the person suffers
organ-specific and non-organ-specific
from bouts of fever, diarrhoea and weight loss.
(systemic) autoimmune diseases. In organ-
Due to decrease in the number of helper T
specific disease, the autoimmune process
lymphocytes, the person starts suffering from
is directed mostly against one organ. The
infections and becomes immune deficient and
autoantibodies may block the functions
unable to protect against any infection.
performed by the organs. Examples include
A simple blood test is available that Hashimoto’s thyroiditis, Graves’ disease
can determine whether the person has been (thyroid gland) and Addison’s disease (adrenal
infected with HIV. The ELISA test (Enzyme glands).
Linked ImmunoSorbent Assay) detects the
In non-organ specific (systemic) disorders,
presence of HIV antibodies. It is a preliminary
autoimmune activity is widely spread
test. Western blot test is more reliable and
throughout the body. Rheumatoid arthritis
a confirmatory test. It detects the viral core
and multiple sclerosis are example for systemic
proteins. If both tests detect the presence of
disorder.
the antibodies, the person is considered to be
HIV positive.
7.5.1 Tumour immunology
AIDS has no cure. Prevention of AIDS
A tumour or neoplasm is a group of cells
is the best option. Advocating safe sex and
whose growth has gone unchecked. When a
promoting regular check-up, safe blood for
transfusion, use of disposable needles, use of tumour continues to grow and invades healthy
condoms during sexual contact, prevention of tissue, it is called cancer. They spread to other
drug abuse, AIDS awareness programme by parts of the body from the tumour and give rise to
NACO (National AIDS Control Organisation), secondary tumour. This is known as metastasis.
NGOs (Non-Governmental Organisations) Tumour may be benign or malignant depending
and WHO are to prevent the spreading of on its characteristics. Benign or non-cancerous
AIDS. tissues are capable of indefinite growth and do
not invade other body parts. In the malignant
7.5Autoimmune diseases tumour, the cells grow indefinitely, detach and
Autoimmunity is due to an abnormal migrate into healthy surrounding tissues.
immune response in which the immune system In normal cells, cell growth and differentiation
fails to properly distinguish between self and
is highly controlled and regulated. But in cancer
non-self and attacks its own body. Our body
cells, there is breakdown of this regulatory
produces antibodies (auto antibodies) and

Human Health and Diseases 132

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 132 25-02-2019 19:18:34


www.asiriyar.net

mechanism. Normal cells show a property called Immunotherapy of cancer


contact inhibition, which inhibits uncontrolled
Immunotherapy also called biological
growth. Cancer cells do not have this property. As
therapy uses substances made by the body
a result, cancerous cells divide continuously giving
or in a laboratory (monoclonal antibodies)
rise to mass of tissues called tumours (Table 7.8).
to improve or to resist the immune system
When a cell undergoes malignant function. Different approaches have been
transformation, it acquires new surface antigen attempted in the immunotherapy of cancer.
and may also lose some normal antigens. Immunotherapy appears to be important in
These antigens are present on the membranes getting rid of the residual malignant cells after
of malignant cells and they induce an immune the gross tumour has been removed. The best
response. Both humoral and cellular responses results in the treatment of cancer is to follow
can be observed in malignancy. Cancer cells can an integrated approach to therapy, combining
avoid immune detection as they are not foreign surgery, radiotherapy, chemotherapy and
bodies but are abnormally functioning body immunotherapy.
cells. This makes them difficult to treat.
Scope of Immunology
The concept of immunological surveillance
The younger graduates in this field can
postulates that the primary function of the find number of employment opportunities in
immune system is to “seek and destroy” Government as well as private hospitals. The
malignant cells that arise by somatic mutation. scope of the immunology is immunotherapy,
The efficiency of the surveillance mechanism microbial immunology, clinical immunology,
reduces either as a result of ageing or due to cellularimmunology,allergyandimmunology,
congenital or acquired immunodeficiencies, translational immunology, transplantation
leads to increased incidence of cancer. Thus, if immunology, neuro-inflammatory disorders,
immunological surveillance is effective, cancer tumour immunology, vaccine immunology,
should not occur. The development of tumour inflammatory disorders, ocular immunology
represents a lapse in surveillance. and inflammation.

Table 7.8 Differences between normal cell and cancer cell

133 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 133 25-02-2019 19:18:34


www.asiriyar.net

7.6 Adolescence – drug and The drugs which are commonly abused
alcohol abuse include opioids, cannabinoids, coca-alkaloids,
Adolescence begins with a period of barbiturates, amphetamines and LSD.
rapid physical and sexual development called Opioids are drugs which bind to specific
puberty to maturity from 12 to 19 years of age. opioid receptors present in the central
Adolescence is also a highly dynamic period of nervous system and intestinal tract. Heroin
psychological and social changes in individuals. (smack) is chemically diacetyl morphine,
Adolescents are vulnerable to group (peer) which is white, odourless and bitter crystalline
pressure and many youngsters are pushed into compound. It is obtained by acetylation of
experimenting with drugs and alcohol. Proper morphine, which is extracted from flowers of
education and guidance would enable youth the poppy plant (Fig. 7.19). Morphine is one
to say no to drugs and alcohol and to follow a of the strongest pain killer and is used during
healthy life style. surgery. It is the most widely abused narcotic
drug which acts as a depressant and slows
Alcohol is a psychoactive drug, which
down body functions.
acts on the brain, affecting a person’s mind and
Cannobinoids are a group of chemicals
behaviour. It is a depressant, which slows down
obtained from Cannabis sativa, the Indian hemp
the activity of the nervous system. The intake
plant (Fig. 7.20). Natural cannabinoids are
of certain drugs for a purpose other than their the main source of marijuana, ganja, hashish
normal clinical use in an amount and frequency and charas. It interferes in the transport of the
that impair one’s physical, physiological and neurotransmitter, dopamine and has a potent
psychological functions is called drug abuse. stimulating action on the CNS, producing
increased energy and a sense of euphoria.

Fig. 7.19 Opium plant (poppy plant) Fig. 7.20 Cannabis sativa (Hemp plant)
Table 7.9 classification of drugs
Group Drugs Effects
Amphetamines, cocaine,
Stimulants Accelerates the activity of the brain
nicotine and tobacco
Alcohol, Barbiturates,
Depressants Slows down the activity of the brain
Tranquilizers
Narcotic/ Act as depressants on the Central
Opium, Morphine
Analgesics Nervous System
Cannabis Bhang (Marijuana), Ganja, Charas Affects the cardiovascular system.
Lysergic acid diethylamide Distorts the way one sees, hears and
Hallucinogens
(LSD), Phencyclidine feels

Human Health and Diseases 134

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 134 25-02-2019 19:18:34


www.asiriyar.net

Cocaine is a white powder that is obtained only their jobs, homes and money, but also
from the leaves of the coca plant, Erythroxylum friendship, family relationships and contact
coca. It is commonly called coke or crack. Cocaine with the normal world. Addiction to drugs
causes serious physical and psychological and alcohol can lead to a psychological
problems including hallucinations and attachment to certain effects such as euphoria
paranoia. The other plants with hallucinogenic and temporary feeling of well being.
properties are Atropa belladonna and Datura Repeated use of drugs and alcohol may
(Fig. 7.21 and Fig. 7.22). affect the tolerance level of the receptors
present in the body. These receptors then
respond only to highest doses of drugs and
alcohol leading to greater intake and addiction.
Excessive use of drug and alcohol leads to
physical and psychological dependence.
When psychological dependence develops,
the drug user gets mentally ‘hooked on’ to
the drug. The drug user constantly thinks
only about the drug and has continuous
Fig. 7.21 Atropa Fig. 7.22Datura
belladonna uncontrollable craving for it. This state called
“euphoria” is characterized by mental and
Drugs like methamphetamine, emotional preoccupation with the drug.
amphetamines, barbiturates, tranquilizers, Physical dependence is a state in which
Lysergic acid diethylamide (LSD) are the user’s body requires a continuous presence
normally used as medicine to treat patients of the drug. If the intake of the drug or alcohol
with mental illness like depression and is abruptly stopped, he or she would develop
insomnia and are often abused. withdrawal symptoms. In a sense, the body
Tobacco is smoked, chewed and becomes confused and protests against the
used as snuff. It increases the carbon absence of the drug. The withdrawal symptoms
monoxide content of blood and reduces may range from mild tremors to convulsions,
the concentration of haem bound oxygen, severe agitation and fits, depressed mood, anxiety,
thus causing oxygen deficiency in the body. nervousness, restlessness, irritability, insomnia,
Tobacco contains nicotine, carbon monoxide dryness of throat, etc, depending on the type of
and tars, which cause problems in the heart, drug abuse.
lung and nervous system. Adrenal glands are
stimulated by nicotine to release adrenaline
and nor adrenaline which increases blood
pressure and heart beat. Alcoholism is the inability to control
drinking due to physical and emotional
7.6.1 Addiction and dependence dependence on alcohol. Treatment involves
Addiction is a physical or psychological counseling by a healthcare professional.
need to do or take or use certain substance Detoxification programme in a hospital or
such as alcohol, to the point where it could medical facility is an option for those who
be harmful to the individual. This addictive need additional assistance. Medications
behaviour can be personally destructive to are available to reduce the desire to drink
a person. Overtime addicts start to lose not and smoke.

135 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 135 25-02-2019 19:18:34


www.asiriyar.net

7.6.2 Effects of drugs and alcohol 1.  Effectively dealing with peer pressure
Short-term effect appears only for a few The biggest reason for teens to start
minutes after the intake of drugs and alcohol. on drugs is due to their friends / peer groups
The abuser feels a false sense of well being and imposing pressure on them. Hence, it is
a pleasant drowsiness. Some short term effects important to have a better group of friends to
are euphoria, pain, dullness of senses, alteration avoid such harmful drugs and alcohol.
in behaviour, blood pressure, narcosis (deep
sleep), nausea and vomiting. 2.  Seeking help from parents and peers
Help from parents and peer group
Drugs and alcohol have long-term effect
should be sought immediately so that they can
that lead to serious damages, because of the
be guided appropriately. Help may even be
constant and excessive use. The physical and
sought from close and trusted friends. Getting
mental disturbance makes the life of the user
proper advice to sort out their problems would
unbearable and torturous. For example heavy
help the young to vent their feelings of anxiety
drinking permanently damages the liver
and guilt.
and brain.
The use of alcohol during adolescence may 3.  Education and counselling
have long-term effects. Alcohol interferes with Education and counselling create
the ability of the liver to break down fat. Over positive attitude to deal with many problems
time fat accumulation and high levels of alcohol and to accept disappointments in life.
destroy the liver cells and a scar tissue grows in
the place of dead cells. This scarring of the liver
4.  Looking for danger signs
Teachers and parents need to look
is called “Liver cirrhosis”. Alcohol irritates the
for sign that indicate tendency to go in for
stomach lining due to the production of excess
acid leading to ulcers. Excessive alcohol use addiction.
weakens the heart muscle, causing scar tissue 5.  Seeking professional and
to build up in the cardiac muscle fibers. As a medical assistance
result, heavy drinkers have an increased risk Assistance is available in the form of
of high blood pressure, stroke, coronary artery highly qualified psychologists, psychiatrists and
disease and heart attack. Korsakoff syndrome, de-addiction and rehabilitation programmes to
a chronic memory disorder is most commonly help individuals to overcome their problems.
caused by alcohol misuse.
7.7 Mental health – Depression
7.6.3 Prevention and control
Mental health is a state of well being of
It is practically possible to prevent some
the mind, with self esteem. Self esteem means
one from using drugs and alcohol. Here  are
liking yourself and being able to stand up for what
some ways that help to prevent drug and
you believe is right. Positive mental health is an
alcohol abuse.

Alcoholic Anonymous
Alcoholic anonymous was started in 1935 by a businessman and a doctor who had been a
“hopeless drunk” for many years. After the men helped each other to stop drinking and to stay
sober, they then founded the alcoholic anonymous to help other alcoholics. Since that time
alcoholic anonymous has spread throughout the world.

Human Health and Diseases 136

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 136 25-02-2019 19:18:34


www.asiriyar.net

important part of wellness. A mentally healthy Entamoeba, Plasmodium and Leishmania


person reflects a good personality. Activities of cause diseases such as amoebic dysentery,
mentally healthy people are always appreciated malaria and kala-azar respectively. Personal
and rewarded by the society as these persons cleanliness and hygiene, proper disposal of
are creative as well as cooperative with others. waste, safe drinking water and immunization
Mental health improves the quality of life. are very useful in preventing diseases. Drug
Depression is a common mental disorder and alcohol abuse of young and adolescent
that causes people to experience depressed is another cause of concern. Addiction
mood, loss of interest or pleasure, feelings of to drugs and alcohol is happening due to
guilt or low self-worth, disturbed sleep poor peer pressure, examination–related and
appetite, low energy and poor concentration. competition–related stresses. The addicted
person should receive proper counselling,
Signs and symptoms of mental
education and professional medical help to
depression
liberate themselves from all forms of addiction.
Loss of self confidence and self esteem
yy
Anxiety
yy Immunology deals with a study of the
immune system. The immune system
Not being able to enjoy things that are
yy
recognises and eliminates the invaders, and the
usually pleasurable or interesting.
ability of the body to overcome the pathogen
Lifestyle changes like exercise, is called immunity. Immune response is the
meditation, yoga and healthy food habits can body’s response to pathogens and it may be
help to be relieved from depression. Exercise primary or secondary. The organs involved
stimulates the body to produce serotonin and in the origin, maturation and proliferation
endorphins, which are neurotransmitters that of lymphocytes are called lymphoid organs.
suppress depression. Practicing exercise in Thymus, bone marrow are primary lymphoid
daily life creates a positive attitude .
Participating in an exercise programme can: Activities
yy Increase self-esteem
yy Boost self-confidence Activity 1: Students examine the impact
yy Create a sense of empowerment of microorganisms in our daily life and
Enhance
yy social connections and
consider their applied potential. They
relationships can also conduct independent research
and communicate their findings.
Brain is one of the most metabolically active
Activity 2: Students prepare wet mounts
part of the body and needs a steady stream
of nutrients to function. A poor diet may to observe the microbes found in curd.
not provide the nutrients for a healthy body Activity 3: The leader will blow bubbles
and may provoke symptoms of anxiety and at the group of students to demonstrate
depression. how some diseases can be air borne?
Activity 4: Which parasite acts as a
Summary transporter host for other parasites? Discuss
Health is a state of complete physical Activity 5: Your friends call you a “sissy
and psychological well being. Many other boy” because you do not smoke or chew
extended factors like microbes may cause
tobacco. What answer will you give? How
illness to human body. Protozoans like
will you prove your strength?

137 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 137 25-02-2019 19:18:34


www.asiriyar.net

organs. The secondary lymphoid organs are a) CNS stimulant b) both a and b
lymph node, MALT, GALT and BALT. c) hallucinogenic d) CNS depressants
An antigen is a substance that is 5. Choose the correctly match pair.
specific to an antibody. An immunogen is a
a) Amphetamines - Stimulant
substance capable of initiating an immune
response. Haptens are substance that are b) LSD - Narcotic
non-immunogenic but can react with the c) Heroin - Psychotropic
product of a specific immune response. d) Benzodiazepine - Pain killer
Substances that can enhance the immune
response to an antigen are called adjuvants. 6. The Athlete’s foot disease in human is
Precipitation, agglutination, neutralization, caused by-------
opsonisation etc. are the different types of a) Bacteria b) Fungi
antigen and antibody reaction. A vaccine is c) Virus d) Protozoan
biological preparation that provides active 7. Cirrhosis of liver is caused by chronic
acquired immunity. The malfunctioning of intake of ------
immune system leads to hypersensitivity,
a) Opium b) Alcohol
immunodeficiency or autoimmune diseases.
A tumour or neoplasm is a group of cells c) Tobacco d) Cocaine
whose growth has gone unchecked. 8. The sporozoite of the malarial parasite is
Evaluation present in ----

1. A 30 year old woman has bleedy a) saliva of infected female Anopheles


diarrhoea for the past 14 hours, which mosquito.
one of the following organisms is likely b) RBC of human suffering from
to cause this illness? malaria.
a) Streptococcus c) Spleen of infected humans.
pyogens d) Gut of female Anopheles mosquito.
b) Clostridium
difficile 9. Where do the following events in the life
cycle of Plasmodium takes place?
c) Shigella dysenteriae
d) Salmonella enteritidis a) Fertilization - _________
2. Exo-erythrocytic schizogony of b) Development of gametocytes - ____
Plasmodium takes place in -------
c) Release of sporozoites - ________
a) RBC b) Leucocytes
d) Schizogony - _________
c) Stomach d) Liver
3. The sporozoites of Plasmodium vivax are 10. Paratope is an
formed from ------------ a) Antibody binding site on variable regions
a) Gametocytes b) Sporoblasts b) Antibody binding site on heavy regions
c) Oocysts d) Spores c) Antigen binding site on variable regions
4. Amphetamines are stimulants of the d) Antigen binding site on heavy regions
CNS, whereas barbiturates are ----

Human Health and Diseases 138

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 138 25-02-2019 19:18:34


www.asiriyar.net

11. Allergy involves 19. Explain the process of replication of


a) IgE b) IgG retrovirus after it gains entry into the
human body.
c) lgA d) IgM
20. Explain the structure of immunoglobulin
12. Spread of cancerous cells to distant sites with suitable diagram.
is termed as
21. What are the cells involved innate
a) Metastasis
immune system?
b) Oncogenes
c) Proto-oncogenes 22. What is vaccine? What are its types?
d) Malignant neoplasm 23. A person is infected by HIV. How will you
13. AIDS virus has diagnose for AIDS?
a) Single stranded RNA 24. Autoimmunity is a misdirected immune
b) Double stranded RNA response. Justify.
c) Single stranded DNA
d) Double stranded DNA 25. List the causative agent, mode of
transmission and symptoms for
14. B cells that produce and release large Diphtheria and Typhoid.
amounts of antibody are called
26. A patient was hospitalized with fever and
a) Memory cells b) Basophils
chills. Merozoites were observed in her
c) Plasma cells d) killer cells
blood. What is your diagnosis?
15. Given below are some human organs.
27. (i) Write the scientific name of the
Identify one primary and one secondary
filarial worm that causes filariasis.
lymphoid organ. Explain its role.
Liver, thymus, stomach, thyroid, tonsils (ii) Write the symptoms of filariasis.
(iii)How is this disease transmitted?
16. Name and explain the type of barriers
which involve macrophages. 28. List the common withdrawal symptoms
17. What are interferons? Mention their role. of drugs and alcohol abuse.
18. List out chemical alarm signals produced 29. Why do you think it is not possible to
during inflammation. produce vaccine against 'common cold'?

INTERESTING FACTS
1. Freezing does not kill bacteria; it only 5. Iceland and the Faroe islands are the only
arrests their growth. countries in the world, where there are
2. Antibiotics not only kill harmful bacteria, “No mosquitos” (Mosquito free countries)
but also kill beneficial bacteria of our body. 6. Sterile insect technique (SIT) - The screw-
3. UTI- Urinary Tract Infection is one of worm fly was the first pest successfully
the most common bacterial infections eliminated from an area through the
affecting 150 million people each year sterile insect technique, by the use of an
worldwide. integrated area-wide approach.

4. World malaria day is on 25th April 7. Zika virus could become a surgical weapon
against brain cancer.

139 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 139 25-02-2019 19:18:34


/\PSKRLG
'LSKWKHULD RUJDQV
,PPXQH $QWLJHQ
3QHXPRQLD &KROHUD UHVSRQVHV DQWLERG\

3ODJXH 7\SKRLG $FTXLUHG 9DFFLQDWLRQ


LPPXQLW\
%DVLF
%DFWHULDO 'UXJVDQG

Human Health and Diseases 140


7HWDQXV %DFLOODU\ ,QQDWH FRQFHSWRI
GLVHDVHV $OFRKRO +\SHUVHQVLWLYLW\
G\VHQWHU\ LPPXQLW\ LPPXQRORJ\
$PRHELDVLV

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 140


0DODULD
3URWR]RDQ 7XPRU
.DOD$]DU GLVHDVHV LPPXQRORJ\

6OHHSLQJ
VLFNQHVV
+DVKLPRWR¶V
WK\URLGLWLV

)LODULDVLV
+HOPLQWKLF +HDOWKDQG
+XPDQ $XWRLPPXQH *UDYH¶V
KHDOWKDQG ,PPXQRORJ\ GLVHDVHV
GLVHDVHV GLVHDVHV GLVHDVHV
$VFDULDVLV
GLVHDVHV

$GGLVRQ¶V
GLVHDVHV

&DQGLGLDVLV

)XQJDO 6FRSHRI
$WKOHWH¶V
IRRW
GLVHDVHV LPPXQRORJ\
9LUDO
KHSDWLWLV
8ULQDU\WUDFW 0HQWDO ,PPXQH
LQIHFWLRQ &RPPRQ 9LUDO
FROG &KLNXQJXQ\D KHDOWK GHILFLHQF\
GLVHDVHV GHSUHVVLRQ GLVHDVH
0XPSV 3ROLRP\HOLWLV

0HDVOHV 'HQJXH $,'6


&KLFNHQ IHYHU
SR[

Concept Map

25-02-2019 19:18:34
www.asiriyar.net
www.asiriyar.net

ICT CORNER
Human Health and Diseases

Let us do examine to know the


chronic disease - systemic lupus
erythematosus (SLE)

Procedure :
Step -1 : Type the URL or scan the QR code to open the activity page. Click “To enter the lab” to
start the test.
Step -2 : Follow the interactive steps guided by the virtual lab starting from centrifugation and to
ELISA.
Step -3 : On the right, Find the different headers such as “Diagnosis, Background, Notebook,
Glossary and Help” and click to know the virtual procedure happening aside on the left.
Step – 4 : Find “Launch Gene Body” on the right bottom of the window, and Click it to analyse
and understand about the cloning.
Step -5: Complete this ELISA to know a patient acquired the disease or not.

Step 1 Step 2 Step 3

Step 4

IMMUNOLOGY URL:
http://media.hhmi.org/biointeractive/vlabs/immunology/index.html?_
ga=2.219254809.1253796128.1545143882-264360672.1545143882

*Pictures are indicative only


*Allow flash player

141 Human Health and Diseases

TN_GOVT_XII_ Bio Zoology_chapter7 combined.indd 141 25-02-2019 19:18:37


www.asiriyar.net

8
UNIT - III

Microbes in
Human Welfare
CHAPTER

Saccharomyces cerevisiae, a species of yeast


used in baking and brewing industry.
Chapter outline
8.1 Microbes in household products Microbes such as bacteria, fungi,
8.2 Microbes in industrial products protozoa, certain algae, viruses, viroids and
8.3 Microbes in sewage treatment and prions are some of the major components
energy generation of the biological system on Earth. Several
microorganisms are beneficial and contribute
8.4 Microbes in the production of biogas
to human welfare. Microbes are present
8.5 Microbes as bio-control agents and
everywhere – in soil, water, air and within
bio-fertilisers
bodies of animals and plants. Microbes like
8.6 Bioremediation bacteria and fungi can be grown on nutritive
media to form colonies which can be visibly
seen. Some of the microbes useful to human
welfare are discussed here.
Learning objectives
8.1  Microbes in household
➢➢ Differentiates probiotics from products
pathogens. In every day life, microbes and their
➢➢ Understands the use of microbes in products are used in the preparation of idli,
household products. dosa, cheese, curd, yogurt, dough, bread,
➢➢ Learns about antibiotic vinegar, etc., Bacteria like Lactobacillus
production and fermented acidophilus, L. lactis and Streptococcus lactis
beverages. commonly called lactic acid bacteria (LAB)
➢➢ Realizes the importance are probiotics which check the growth of
of microbes in sewage pathogenic microbes in the stomach and
treatment and energy other parts of the digestive tract.
generation. The LAB bacteria grows in milk and
➢➢ Learns the role of bio-fertilisers convert it into curd, thereby digesting the milk
in farming. protein casein. A small amount of curd added
➢➢ Realizes the applications of microbes in to fresh milk as a starter or inoculum contains
bio-remediation. millions of Lactobacilli, which under suitable

142

TN_GOVT_XII_ Bio Zoology_chapter 8.indd 142 25-02-2019 19:20:01


www.asiriyar.net

o
temperature (≤40 C) multiply and convert di-oxide, which is responsible for leavening of
milk into curd. Curd is more nutritious than dough. When leavened dough is baked, both
milk as it contains a number of organic acids carbon-di-oxide and ethyl alcohol evaporate
and vitamins. making the bread porous and soft.

Prebiotics are compounds Single cell protein (SCP)


in food (fibers) that induce Single cell protein refers to edible
the growth or activity of unicellular microorganisms like Spirulina.
beneficial microorganisms. Protein extracts from pure or mixed cultures
Probiotics are live of algae, yeasts, fungi or bacteria may be used
microorganisms intended to provide health as ingredient or as a substitute for protein rich
benefits when consumed, generally by foods and is suitable for human consumption
improving or restoring the gut flora. or as animal feed.

Yogurt is produced by bacterial 8.2  Microbes in industrial


fermentation of milk, and lactic acid is products
produced as a byproduct. Microorganisms Microbes are used to synthesize a number
such as Streptococcus thermophilus and of products valuable to human beings. Products
Lactobacillus bulgaricus coagulate the milk like beverages, antibiotics, organic acids, amino
protein and convert the lactose in the milk acids, vitamins, biofuels, single cell protein,
to lactic acid. The flavour in yogurt is due to enzymes, steroids, vaccines, pharmaceutical
acetaldehyde. drugs, etc., are produced in industries.
Cheese is a dairy product produced in a Production on a large scale requires growing
wide range of flavours, textures and is formed microbes in very large vessels called fermentors.
by coagulation of the milk protein, casein. A fermentor (bioreactor) is a closed vessel with
During cheese production, milk is usually adequate arrangement for aeration, agitation,
acidified and the enzyme rennet is added to temperature, pH control and drain or overflow
cause coagulation. The solids are separated and vent to remove the waste biomass of cultured
pressed to form cheese. Most cheese are made microorganisms along-with their products.
with a starter bacteria, Lactococcus, Lactobacillus
or Streptococcus. 8.2.1 Antibiotic production
Paneer (cottage cheese) is fresh cheese Antibiotics are chemical substances
common in South Asia, especially in India. produced by microorganisms which can kill
It is made by curdling milk with lemon juice, or retard the growth of other disease causing
vinegar and other edible acids. Large holes in microbes even in low concentration. Antibiotic
Swiss cheese is due to the production of large means “against life”. Antibiotics are used to treat
amount of carbon-di-oxide by the bacterium diseases such as plague, meningitis, diphtheria,
Propionibacterium shermanii. syphilis, leprosy, tuberculosis etc., Selman
The dough used in the preparation of idlis and Waksman discovered Streptomycin and was the
dosas are fermented by the bacteria Leuconostoc first to use the term “antibiotic” in 1943.
mesenteroides whereas the dough used in While working on Staphylococci bacteria,
bread making is fermented by Saccharomyces Alexander Fleming observed a green mould
cerevisiae (Baker’s Yeast). Fermentation of growing in one of his unwashed culture plates
glucose mainly forms ethyl alcohol and carbon- around which Staphylococci could not grow. He

143 Microbes in Human Welfare

TN_GOVT_XII_ Bio Zoology_chapter 8.indd 143 25-02-2019 19:20:01


www.asiriyar.net

found that it was due to a chemical produced


by the mould and he named it as penicillin, Hypersensitivity reaction
which was the first antibiotic discovered by is a major problem with
Alexander Fleming in 1926 (Fig.8.1). Penicillin the use of penicillin,
is produced by the fungi Penicillium notatum resulting in nausea,
and Penicillium chrysogenum. It is bactericidal vomiting, wheezing and
(antibiotics that kill bacteria) in action and ultimately cardiovascular collapse. To check
inhibits the synthesis of the bacterial cell wall. the sensitivity reaction, doctors use a needle
to prick the forearm of the patients to give a
Penicillin is also referred as the “queen
weak dose of penicillin. An itchy red region in
of drugs” and its full potential as an effective
the forearm is an indication that the patient
antibiotic was established much later by
is allergic to penicillin. This test is important
Earnest Chain and Howard Florey when they
before administration of penicillin to a patient.
treated the wounded soldiers in World War II
with penicillin. Fleming, Chain and Florey Tetracycline is a broad spectrum
were awarded the Nobel prize in 1945 for the bacteriostatic antibiotic (antibiotics that limit the
discovery of penicillin. growth of bacteria) that inhibits microbial protein
synthesis. Chlortetracycline is the first antibiotic
Antibiosis is the property of antibiotics to
of this group, isolated from the cultures  of
kill microorganisms.
Streptomyces aureofaciens. Streptomycin is
Broad-spectrum antibiotics act against a
a broad spectrum antibiotic isolated from
wide range of disease-causing bacteria.
the actinomycetes, Streptomyces griseus. It is
Narrow-spectrum antibiotics are active
bactericidal against both gram positive and
against a selected group of bacterial types.
gram negative bacteria, especially against
Mycobacterium tuberculosis. Antibiotics, such
ng

as erythromycin, chloromycetin, griseofulvin,


Alexander Flemin

neomycin, kenamycin, bacitracin, etc., are also


isolated as microbial products.

Antibiotic resistance
Antibiotic resistance occurs when bacteria
develop the ability to defeat the drug designed
to kill or inhibit their growth. It is one of the
most acute threat to public health. Antibiotic
resistance is accelerated by the misuse and
over use of antibiotics, as well as poor infection
prevention control. Antibiotics should be used
H only when prescribed by a certified health
Penicillium N S
chrysogenum professional. When the bacteria become
O
O
N resistant, antibiotics cannot fight against them
OH and the bacteria multiply. Narrow spectrum
O
antibiotics are preferred over broad spectrum
antibiotics. They effectively and accurately target
Stap
Staphylococcus aureus
specific pathogenic organisms and are less likely
Fig. 8.1 Discovery of penicillin to cause resistance. "Superbug" is a term used to

Microbes in Human Welfare 144

TN_GOVT_XII_ Bio Zoology_chapter 8.indd 144 25-02-2019 19:20:02


www.asiriyar.net

describe strains of bacteria that are resistant to


Alcohol content in various beverages
the majority of antibiotics commonly used today.
• Beer contains 3 to 5 percent of alcohol.
8.2.2 Fermented beverages • Wine contains 9 to 14 percent alcohol.
Microbes especially yeast is being used Wine coolers are made of wine mixed
from time immemorial for the production with carbonated water and flavourings.
of beverages like wine, beer, whisky, brandy Wine coolers have about 4 to 6 percent
and rum. Wine is among the oldest alcoholic alcohol.
beverages known and is produced by • Distilled spirits such as whiskey, gin,
fermentation of fruit juice by yeast. Zymology scotch and vodka usually contain 35
is an applied science which deals with the to 50 percent alcohol.
biochemical process of fermentation and its
practical uses. In some parts of South India, a traditional
Saccharomyces cerevisiae commonly drink called pathaneer is obtained from
called brewer’s yeast is used for fermenting fermenting sap of palms and coconut trees. A
malted cereals and fruit juices to produce common source is tapping of unopened spadices
various alcoholic beverages. Wine and beer of coconut. It is a refreshing drink, which on
are produced without distillation, whereas boiling produces jaggery or palm sugar. When
whisky, brandy and rum are obtained by pathaneer is left undisturbed for few hours it
fermentation and distillation. gets fermented to form toddy with the help of
naturally occurring yeast, to form a beverage
The Pasteur effect is the that contains 4 percent alcohol. After 24 hours
inhibiting effect of oxygen toddy becomes unpalatable and is used for the
on the fermentation production of vinegar.
process. Saccharomyces cerevisiae is the major
producer of ethanol (C2H5OH). It is used for
Oenology is the science and study of industrial, laboratory and fuel purposes. So
wine and wine making. Wine is made from ethanol is referred to as industrial alcohol.
the fermentation of grape juice. Grape juice is Bacteria such as Zymomonas mobilis and Sarcina
fermented by various strains of Saccharomyces ventriculi are also involved in ethanol production.
cerevisiae into alcohol. Grape wine is of two types, The principal substrates for the commercial
red wine and white wine. For red wine, black production of industrial alcohol include molasses
grapes are used including skins and sometimes or corn, potatoes and wood wastes. The process
the stems also are used. In contrast white wine is of ethanol production starts by milling a feed
produced only from the juice of either white or stock followed by the addition of dilute or fungal
red grapes without their skin and stems. amylase (enzyme) from Aspergillus to break
down the starch into fermentable sugars. Yeast
Beer is produced from germinated barley
is then added to convert the sugars to ethanol
malt grain by Saccharomyces carlsbergensis which is then distilled off to obtain ethanol which
or Saccharomyces cerevisiae. Rum is made is upto 96 percent in concentration. The two
from fermented sugarcane or molasses or most common type of biofuels in use today are
directly from sugarcane juice by Saccharomyces ethanol and biodiesel, both of them represent the
cerevisiae. Whisky is a type of distilled alcoholic first generation of biofuel technology. Ethanol is
beverage made from fermented grain mash by often used as a fuel, mainly as a biofuel additive
Saccharomyces cerevisiae. for gasoline.

145 Microbes in Human Welfare

TN_GOVT_XII_ Bio Zoology_chapter 8.indd 145 25-02-2019 19:20:02


www.asiriyar.net

Biodiesel is a fuel made from vegetable oils, fats or greases. Biodiesel fuel can be used in diesel
engines without altering the engine. Pure biodiesel is non-toxic, biodegradable and produces
lower level of air pollutants than petroleum-based diesel fuel. The Government of India
approved the National Policy on Biofuels in December 2009 and identified Jatropha curcas as
the most suitable oilseed for biodiesel production. Pongamia species is also a suitable choice
for production of biodiesel.

removing clots from the blood vessels of


C6H12O6 Yeast 2C2H5OH + 2CO2↑ patients who have undergone myocardial
(Glucose) Fermentation (Ethanol)
infarction.
Cyclosporin A, an immunosuppressant
World biofuel day is used in organ transplantation is produced
observed every year on from the fungus Trichoderma polysporum.
10th  August to create It is also used for its anti-inflammatory,
awareness about the anti-fungal and anti-parasitic properties.
importance of renewable Statins produced by the yeast Monascus
bio-fuels as an alternative to conventional purpureus have been used to lower blood
non-renewable fossil fuels. This day also cholesterol levels. It acts by competitively
highlights the various efforts taken by the inhibiting the enzyme responsible for the
Government in the biofuel sector. synthesis of cholesterol. Recombinant human
insulin has been produced predominantly
8.2.3  Chemicals, enzymes and other using  E. coli  and  Saccharomyces cerevisiae  for
bioactive molecules therapeutic use in human.
Microbes are not only used for commercial
and industrial production of alcohol, but also 8.3  Microbes in sewage treatment
used for production of chemicals like organic and energy generation
acids and enzymes. Examples of organic acid Sewage is the waste generated every day in
producers are Aspergillus niger for citric acid, cities and towns containing human excreta. It
Acetobacter aceti for acetic acid, Rhizopus contains large amounts of organic matter and
oryzae for fumaric acid, Clostridium microbes, which are pathogenic to humans and
butyricum for butyric acid and Lactobacillus are bio-degradable pollutants. Domestic waste
for lactic acid. consists of approximately 99 percent water,
Yeast (Saccharomyces cerevisiae) and suspended solids and other soluble organic and
bacteria are used for commercial production inorganic substances. Sewage should not be
of enzymes. Lipases are used in detergent discharged directly into natural water bodies like
formulations and are used for removing oily rivers and streams. Before disposal, sewage should
stains from the laundry. Bottled juices are be treated in sewage treatment plants to make it
clarified by the use of pectinase, protease and less polluting (Fig. 8.2).
cellulase. Rennet can also be used to separate
milk into solid curds for cheese making. 8.3.1 Wastewater treatment
Streptokinase produced by the bacterium The main objective of a wastewater treatment
Streptococcus and genetically engineered process is to reduce organic and inorganic
Streptococci are used as “clot buster” for components in wastewater to a level that it no

Microbes in Human Welfare 146

TN_GOVT_XII_ Bio Zoology_chapter 8.indd 146 25-02-2019 19:20:02


www.asiriyar.net

Preliminary Primary Secondary or biological Tertiary


treatment treatment treatment treatment

Primary Secondary Treated


Aeration zone Disinfection
Pretreatment settling tank settling tank sewage
(air + liquid water) zone
Waste for
water from dispose/reuse
cities and towns Remove
coarse solids Air 80-90% Organic
sand and grit solids

Recirculated to aeration tank

Primary Secondary
sludge Anaerobic sludge
sludge digester

Production of biogas

Fig. 8.2 Sewage treatment process


longer supports microbial growth and to eliminate major part of the organic matter in the effluent.
other potentially toxic materials. Microorganisms This significantly reduces the BOD (Biochemical
mainly bacteria and some protozoa play an oxygen demand or Biological oxygen demand).
essential part in the treatment of sewage to make BOD refers to the amount of the oxygen that
it harmless. Sewage contains pathogenic bacteria. would be consumed, if all the organic matter in
These bacteria must be destroyed in order to one litre of water were oxidized by bacteria. The
prevent the spread of diseases. Sewage treatment sewage water is treated till the BOD is reduced.
is usually performed in the following three stages. The greater the BOD of the waste water more is its
polluting potential.
Primary treatment Once the BOD of sewage water is reduced
Primary treatment involves the physical significantly, the effluent is then passed into
removal of solid and particulate organic and a settling tank where the bacterial “flocs” are
inorganic materials from the sewage through allowed to sediment. This sediment is called
filtration and sedimentation. Floating debris activated sludge. A small part of activated sludge
is removed by sequential filtration. Then the is pumped back into the aeration tank to serve as
grit (soil and small pebbles) are removed by the inoculum. The remaining major part of the
sedimentation. All solids that settle form the sludge is pumped into large tanks called anaerobic
primary sludge and the supernatant forms the sludge digesters. Here, the bacteria which grow
effluent. The effluent from the primary settling anaerobically, digest the bacteria and the fungi in
tank is taken for secondary treatment. the sludge. During this digestion, bacteria produce
a mixture of gases such as methane, hydrogen
Secondary treatment or sulphide and CO2. These gases form biogas and
biological treatment can be used as a source of energy.
The primary effluent is passed into large
aeration tanks where it is constantly agitated Tertiary treatment
mechanically and air is pumped into it. This Tertiary treatment is the final process
allows vigorous growth of useful aerobic microbes that improves the quality of the waste water
into floc (masses of bacteria associated with before it is reused, recycled or released into
fungal filaments to form mesh like structures). natural water bodies. This treatment removes
While growing, these microbes consume the the remaining inorganic compounds and

147 Microbes in Human Welfare

TN_GOVT_XII_ Bio Zoology_chapter 8.indd 147 25-02-2019 19:20:02


www.asiriyar.net

substances, such as nitrogen and phosphorus. bacteria and mimicking bacterial interaction
UV is an ideal disinfectant for wastewater since found in nature (Fig. 8.3). Microbial fuel cells
it does not alter the water quality – except for work by allowing bacteria to oxidize and reduce
inactivating microorganisms. UV is a chemical- organic molecules. Bacterial respiration is basically
free process that can completely replace one big redox reaction in which electrons are
the existing chlorination system and also being moved around. A MFC consists of an anode
inactivates chlorine-resistant microorganisms and a cathode separated by a proton exchange
like Cryptosporidium and Giardia. membrane. Microbes at the anode oxidize the
organic fuel generating protons which pass
Act enforced by Government to through the membrane to the cathode and the
conserve water bodies electrons pass through the anode to the external
National river conservation plan (NRCP) circuit to generate current.
was enacted in 1995 to improve the water
quality of the rivers, which are the major
e-
fresh water resources in our country. This
e-
important assignment taken up under the
NRCP includes, Substrate C
A a O2 + 4H+
• To capture the raw sewage flowing into the n t
river through open drains and divert them o h
for treatment. d o
Re e 2H2O
• Setting up sewage treatment plants for d
OX e
treating the diverted sewage.
CO2 H+ H+
• Construction of low cost sanitation toilets to
prevent open defecation on river banks.
Proton exchange membrane
The ministry for environment, forest and
climate change has initiated the Ganga action Fig. 8.3 Microbial fuel cell
plan and the Yamuna action plan to save the 8.4 Microbes in the production of
major rivers of the country.
biogas (Gobar gas)
The Ganga action plan was launched on Biogas is a mixture of different gases
14th January 1986. The main objective of the produced by the breakdown of organic matter in
programme is to improve the water quality of the absence of oxygen. Biogas can be produced
River Ganges by interception, diversion and from raw materials such as agricultural wastes,
treatment of domestic sewage and to identify manure, municipal wastes, plant material,
grossly polluting units to prevent pollution. sewage, food waste, etc., Biogas is produced
The Yamuna Action Plan is a bilateral under anaerobic condition, when the organic
project between the Government of India and materials are converted through microbiological
Japan. It was formally launched in April 1993. It reactions into gas and organic fertilizer. Biogas
was proposed to build large number of sewage primarily consists of methane (63 percent), along
treatment plants to discharge treated wastewater with CO2 and hydrogen. Methane producing
into the rivers. bacteria are called methanogens and one such
common bacterium is Methanobacterium.
8.3.2 Microbial fuel cell(MFC)
Biogas is devoid of smell and burns with a blue
A microbial fuel cell is a bio-electrochemical
flame without smoke. The Methanogens are also
system that drives an electric current by using
present in anaerobic sludge and rumen of cattle.

Microbes in Human Welfare 148

TN_GOVT_XII_ Bio Zoology_chapter 8.indd 148 25-02-2019 19:20:03


www.asiriyar.net

such as fungi, bacteria, viruses


Gas storage
tank
Gas Control valve
(outlet for Biogas)
or by naturally occurring
substances derived from plants
and animals. The use of a
microbes or other biological
Mixing
tank Overflow agents to control a specific
tank
pest is called a biopesticide.
Inlet pipe
Outlet pipe
Biopesticides are used to
Inlet tank control insect pests. The lady
Partition
Digester
wall bird beetle and dragonflies
tank
are useful to control aphids and
mosquito larvae respectively.
Fig. 8.4 Biogas unit
Bacillus thuringiensis is a
In rumen, these bacteria help in the breakdown soil dwelling bacterium which is commonly used
of cellulose. The excreta of cattle called dung is as a biopesticide and contains a toxin called cry
commonly called “Gobar”. Gobar gas is generated toxin (Fig. 8.5). Scientists have introduced this
by the anaerobic decomposition of cattle dung. It toxin producing genes into plants and have raised
consists of methane, CO2 with some hydrogen, genetically engineered insect resistant plants. e.g.
nitrogen and other gases in trace amounts. Bt-cotton.
In a biogas plant, anaerobic digestion is During sporulation Bacillus thuringiensis
carried out in an air tight cylindrical tank known produces crystal proteins called Delta-endotoxin
as digester (Fig. 8.4). It is made up of concrete which is encoded by cry genes. Delta-endotoxins
bricks and cement or steel. Bio-wastes are collected have specific activities against the insects of the
and slurry of dung is fed into this digester. It orders Lepidoptera, Diptera, Coleoptera and
has a side opening into which organic materials Hymenoptera. When the insects ingest the toxin
for digestion are incorporated for microbial crystals their alkaline digestive tract denatures
activity. Anaerobic digestion is accomplished the insoluble crystals making them soluble.
in three stages: solubilisation, acidogenesis and The cry toxin then gets inserted into the gut cell
methanogenisis. The outlet is connected to a pipe membrance and paralyzes the digestive tract. The
to supply biogas. The slurry is drained through insect then stops eating and starves to death.
another outlet and is used as fertilizer. Biogas is Weedicides are substances, which
used for cooking and lighting. The technology of destroy weeds without harming the useful
biogas production was developed in India mainly plants. Bioweedicides are compounds
due to the efforts of Indian Agricultural Research and secondary metabolites derived from
Institute (IARI) and Khadi and Village Industries microbes such as fungi, bacteria or protozoa.
Commission (KVIC). The first bioherbicide developed in 1981 was
a Mycoheribicide derived from the fungus
8.5 Microbes as bio control agents Phytophthora palmivora. It controls the
and biofertilisers growth of strangler vine in citrus crops.
Large scale application of chemical Trichoderma species are free living fungi
insecticides and pesticides have a deleterious that are very common in the root ecosystem. They
effect on the health of human beings and are effective biocontrol agents for several plant
pollute our environment. Biocontrol is a pathogens. Buculoviruses are pathogens that
method of controlling pest by use of microbes

149 Microbes in Human Welfare

TN_GOVT_XII_ Bio Zoology_chapter 8.indd 149 25-02-2019 19:20:03


www.asiriyar.net

form mycorrhiza. Cyanobacteria


(or) blue  green algae (BGA) are
prokaryotic free-living organisms
which can fix nitrogen. Oscillatoria,
Nostoc, Anabaena, Tolypothrix are well
known nitrogen fixing cyanobacteria.
Their importance is realized in the
water logged paddy fields where
Cyanobacteria multiply and fix
molecular nitrogen. Cyanobacteria
secrete growth promoting substances
like indole-3-acetic acid, indole-3-
butyric acid, naphthalene acetic acid,
Fig. 8.5 Actions of cry toxin amino acids, proteins, vitamins which
promotes plant growth and production.
attack insects and other arthropods. The genus Biofertilisers are commonly used in
Nucleopolyhedrovirus is used as a biocontrol organic farming methods. Organic farming is a
agent. These viruses are species specific and have technique, which involves cultivation of plants
narrow spectrum insecticidal applications. and rearing of animals in natural ways. This
8.5.1 Biofertilisers process involves the use of biological materials,
avoiding synthetic substances to maintain
Biofertilisers are formulation of living
soil fertility and ecological balance thereby
microorganisms that enrich the nutrient quality
minimizing pollution and wastage.
of the soil. They increase physico – chemical
properties of soils such as soil structure, Key features of organic farming
texture, water holding capacity, cation exchange • Protecting soil quality using organic materials
capacity and pH by providing several nutrients and encouraging biological activity.
and sufficient organic matter. The main • Indirect provision of crop nutrients using
sources of biofertilisers are bacteria, fungi and soil microorganisms.
cyanobacteria. Rhizobium is a classical example • Nitrogen fixation in soils using legumes.
for symbiotic nitrogen fixing bacteria. This • Weed and pest control based on methods
bacterium infects the root nodules of leguminous like crop rotation, biological diversity,
plants and fixes atmospheric nitrogen into natural predators, organic manures and
organic forms. Azospirillum and Azotobacter are suitable chemical, thermal and biological
free living bacteria that fix atmospheric nitrogen interventions.
and enrich the nitrogen content of soil.
A symbiotic association between a fungus 8.6 Bioremediation
and the roots of the plants is called mycorrhiza. The use of
The fungal symbiont in these associations naturally occurring or
absorbs the phosphorus from soil and transfers genetically engineered
to the plant. Plants having such association microorganisms to reduce or degrade
show other benefits such as resistance to root- pollutants is called bioremediation.
borne pathogens, tolerance to salinity, drought, Bioremediation is less expensive and more
enhances plant growth and developments. For sustainable than other remediations available.
example, many members of the genus Glomus It is grouped into in situ bioremediation

Microbes in Human Welfare 150

TN_GOVT_XII_ Bio Zoology_chapter 8.indd 150 25-02-2019 19:20:04


www.asiriyar.net

chrysosporium an anaerobic
fungus exhibits strong
potential for bioremediation
Microorganism of pesticides, polyaromatic
O
hydrocarbons, dyes,

O
+ H2

2
+H
CO 2
oil

2
CO
oil CO 2
O
+ H2 trinitrotoluene, cyanides,
carbon tetrachloride, etc.,
Microorganisms Microorganisms digest Microorganisms Dehalococcoides species are
eat oil or other oil and convert it to give off
organic contaminants carbon dioxide (CO ) CO and H O
responsible for anaerobic
2 2 2
and water (H O)
2 bioremediation of toxic
trichloroethene to non-
toxic ethane. Pestalotiopsis
Fig. 8.6 The process of bioremediation microspora is a species of
endophytic fungus capable
(treatment of contaminated soil or water in the
of breaking down and digesting polyurethane.
site) and ex situ bioremediation (treatment of
This makes the fungus a potential candidate
contaminated soil or water that is removed
for bioremediation projects involving large
from the site and treated) .
quantities of plastics.
8.6.1 Microorganisms involved
in bioremediation Breaks down
PET into
Ideonella sakaiensis
adhere to
Aerobic microbes degrade the terephthalic acid
& ethylene glycol
PET film

pollutants in the presence of oxygen. They


mainly degrade pesticides and hydrocarbons.
Pseudomonas putida is a genetically
engineered microorganism (GEM). Ananda
Mohan Chakrabarty obtained patent for Eats the
terephthalic
this recombinant bacterial strain. It is multi- acid & ethylene PET Bottle
glycol
plasmid hydrocarbon-degrading bacterium
which can digest the hydrocarbons in the oil
spills (Fig.8.6). Fig. 8.7 Actions of Ideonella sakaiensis
Nitrosomonas europaea is also capable of
degrading benzene and a variety of halogenated Summary
organic compounds including trichloroethylene All microbes are not pathogenic, many of them are
and vinyl chloride. Ideonella sakaiensis is beneficial to human beings. We use microbes and
currently tried for recycling of PET plastics their derived products almost every day. Lactic acid
(Fig. 8.7). These bacteria use PETase and bacteria convert milk into curd. Saccharomyces
MHETase enzymes to breakdown PET plastic cerevisiae (yeast) is used in bread making. Idly
into terephthalic acid and ethylene glycol. and dosa are made from dough fermented by
microbes. Bacteria and fungi are used in cheese
Anaerobic microbes degrade the
making. Industrial products like lactic acid, acetic
pollutants  in the absence of oxygen.
acid and alcohol are produced by microbes.
Dechloromonas aromatica has the ability
Antibiotics are produced from useful microbes
to degrade benzene anaerobically and to
to kill the disease causing harmful microbes. For
oxidize toluene and xylene. Phanerochaete
more than a hundred years, microbes are being

151 Microbes in Human Welfare

TN_GOVT_XII_ Bio Zoology_chapter 8.indd 151 25-02-2019 19:20:04


www.asiriyar.net

used to treat sewage by the process of activated a) Bacillus thurigiensis


sludge formation. Bio-gas produced by microbes is b) Bacillus subtilis
used as a source of energy in rural areas. Microbes c) Lactobacillus acidophilus
are also used as bio-control agents to avoid the use d) Streptococcus lactis
of toxic pesticides. Now a days chemical fertilisers 7. Which of the following is not involved in
are gradually replaced by bio-fertilisers. In bio- nitrogen fixation?
remediation naturally occurring or genetically
a) Pseudomonas b) Azotobacter
engineered microorganisms are used to reduce or
c) Anabaena d) Nostac
degrade pollutants.
8. CO2 is not released during
a) Alcoholic fermentation
Evaluation
b) Lactate fermentation
1. 
Which of the following c) Aerobic respiration in animals
microorganism is used for d) Aerobic respiration in plants
production of citric acid in
industries? 9. The purpose of biological treatment of waste
water is to _______
a) Lactobacillus bulgaris
a) Reduce BOD b) Increase BOD
b) Penicillium citrinum
c) Reduce sedimentation
c) Aspergillus niger d) Rhizopus nigricans
d) Increase sedimentation
2. W
 hich of the following pair is correctly 10. The gases produced in anaerobic sludge
matched for the product produced by them? digesters are
a) Acetobacter aceti - Antibiotics a) Methane, oxygen and hydrogen sulphide.
b) Methanobacterium - Lactic acid b) Hydrogen sulphide, methane and sulphur
c) Penicilium notatum - Acetic acid dioxide.
d) Saccharomyces cerevisiae - Ethanol c) Hydrogen sulphide, nitrogen and methane.
3. 
The most common substrate used in d) Methane, hydrogen sulphide and CO2.
distilleries for the production of ethanol 11. How is milk converted into curd? Explain
is_________ the process of curd formation.
12. Give any two bioactive molecules produced
a) Soyameal b) Groundgram
by microbes and state their uses.
c) Molasses d) Corn meal
13. What is biological oxygen demand?
Cry toxins obtained from Bacillus
4.  14. Explain the role of cry-genes in genetically
thuringiensis are effective against for______ modified crops.
a) Mosquitoes b) Flies 15. Write the key features of organic farming.
c) Nematodes d) Bollworms 16. Justify the role of microbes as a bio-fertilizer.
5. Cyclosporin – A is an immunosuppressive 17. Write short notes on the following.
drug produced from _______ a) Brewer's yeast b) Ideonella sakaiensis
c) Microbial fuel cells
a) Aspergillus niger
b) Manascus purpureus 18. List the advantages of biogas plants in rural
c) Penicillium notatum areas.
d) Trichoderma polysporum 19. When does antibiotic resistance develop?
20. What is the key difference between primary
6. 
Which of the following bacteria is used
and secondary sewage treatment?
extensively as a bio-pesticide?
Microbes in Human Welfare 152

TN_GOVT_XII_ Bio Zoology_chapter 8.indd 152 25-02-2019 19:20:04


Concept Map

TN_GOVT_XII_ Bio Zoology_chapter 8.indd 153


0LFUREHVLQ
KXPDQZHOIDUH

6HZDJH %LRFRQWURO +RXVHKROG (QHUJ\


,QGXVWULHV %LRIHUWLOLVHU %LRJDV
WUHDWPHQW DJHQWV SURGXFWV SURGXFWLRQ

3URGXFWLRQRI
IHUPHQWHGEHYHUDJHV 3ULPDU\ 1RVWRF$QDEDHQD 0HWKDQRJHQV &XUG 0LFURELDOIXHO
$]RVSLULOOXP 2UJDQLFIDUPLQJ %LRZHHGLFLGHV %LRSHVWLFLGH
WUHDWPHQW JURZ FHOOV
5KL]RELXP DQDHURELFDOO\RQ
0\FRUUKL]DDQG FHOOXORVLFPDWHULDO
3URGXFWLRQRIDQWLELRWLFV &\DQREDFWHULD <RJXUW
DQGSURGXFH
FDUERQGLR[LGH
0\FRKHUELFLGH DQGK\GURJHQ
DORQJZLWK &KHHVH
&KHPLFDOVOLNHFLWULFDFLG 6HFRQGDU\ %WKXULQJLHQVLV
DFHWLFDFLGODFWLFDFLG WUHDWPHQW PHWKDQH
EXW\ULFDFLGHWF
%UHDG

3URGXFWLRQRI
%LRDFWLYHPROHFXOHV &U\JHQHSURGXFH
GHOWDHQGRWR[LQ
7HUWLDU\ DQGNLOOLQJHVWLQJ
WUHDWPHQW LQVHFWV

153 Microbes in Human Welfare

25-02-2019 19:20:04
www.asiriyar.net
www.asiriyar.net

ICT CORNER
MICROBES IN HUMAN WELFARE

How the fermentation takes place?


Lets us experiment it virtually

Procedure :
Step -1: Type the URL or scan the QR code to open the activity page and click “START” to
begin the fermentation experiment.
Step -2: Click “next” for all the flasks combination.
Step -3: When the “Matching Game” starts to know the result, “Drag and place” the
combination perfectly to their respective flasks.
Step – 4 :Go on through the other tests, explanations and the principle involved in the
fermentation process.

Step 1 Step 2 Step 3

Step 4

MICROBES IN HUMAN WELFARE URL:


http://www.bch.cuhk.edu.hk/vlab2/animation/fermentation/

*Pictures are indicative only


*Allow flash player

Microbes in Human Welfare 154

TN_GOVT_XII_ Bio Zoology_chapter 8.indd 154 25-02-2019 19:20:06


www.asiriyar.net

9
UNIT - IV

Applications of
biotechnology
CHAPTER
"Our world is built on biology"

Chapter outline
9.1 Applications in Medicine
B efore we start this chapter, it will be helpful
if you revise the structure of DNA, Protein
synthesis and genetic engineering. Genetic
9.2 Gene therapy engineering involves the manipulation of DNA
9.3 Stem Cell Therapy and naturally occurring processes such as protein
9.4 Molecular Diagnosis synthesis for a wide range of applications including
9.5 Transgenic Animals the production of therapeutically important
9.6 Biological products and proteins. This also involves extracting a gene from
their uses one organism and transferring it to the DNA of
9.7 Animal cloning another organism, of the same or another species.
The DNA produced in this way is referred to as
9.8 Ethical issues
recombinant DNA (rDNA) and this technique as
recombinant DNA technology. All these are part of
the broad field biotechnology which can be defined
as the applications of scientific and engineering
principles to the processing of material by biological
Learning objectives
agents to provide goods and services.

➢➢ Understand the applications of rDNA Biotechnology is an umbrella term that covers


technology in the field of medicine. various techniques for using the properties of
living things to make products or provide services.
➢➢ Analyse the role of diagnostic tools in
The term biotechnology was first used before
Molecular diagnosis.
20th century for such traditional activities as
➢➢ Learn animal cloning making idli, dosa, dairy products, bread or
and its applications. wine, but none of these would be considered
biotechnology in the modern sense.
➢➢ Create awareness on the
ethical issues involved in In this chapter we will study the applications
biotechnology. of bio-technology in various fields including
the field of Medicine. Recombinant DNA
➢➢ Realise the need for biosafety guidelines
technology has led to the large scale
and regulations in Biotechnology.
production of various hormones and proteins
of therapeutic use.

155

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 155 25-02-2019 19:21:15


www.asiriyar.net

9.1 Applications in Medicine the animal insulin as compared to human


insulin, it resulted in the occurrence of
9.1.1 Recombinant Human Insulin allergic reactions in some diabetic patients.
The Human insulin is synthesized by the β Production of insulin by recombinant DNA
cells of Islets of Langerhans in the pancreas. It technology started in the late 1970s. This
is formed of 51 aminoacids which are arranged technique involved the insertion of human
in two polypeptide chains, A and B. The insulin gene on the plasmids of E.coli. The
polypeptide chain A has 21 amino acids while polypeptide chains are synthesized as a
the polypeptide chain B has 30 amino acids. precursor called pre-pro insulin, which
Both A and B chains are attached together by contains A and B segments linked by a third
disulphide bonds. Insulin controls the levels chain (C) and preceded by a leader sequence.
of glucose in blood. It facilitates the cellular The leader sequence is removed after
uptake and utilization of glucose for the translation and the C chain is excised, leaving
release of energy. Deficiency of insulin leads the A and B polypeptide chains (Fig. 9.1).
to diabetes mellitus which is characterized by Insulin was the first ever pharmaceutical
increased blood glucose concentration and product of recombinant DNA technology
a complex of symptoms which may lead to administered to humans. The approval to use
death, if untreated. A continuous program of recombinant insulin for diabetes mellitus was
insulin dependence is required to treat this given in 1982. In 1986 human insulin was
deficiency. marketed under the trade name Humulin.
In the early years, insulin isolated and
purified from the pancreas of pigs and cows Best and Banting in 1921, isolated insulin from
was used to treat diabetic patients. Due the pancreatic islets of a dog and demonstrated
to minor differences in the structure of its effectiveness against diabetes.

Extraction &
DNA Introduction of purification of
recombinant human insulin
DNA into a C chain
bacterial cell Recombinant A chain
Bacterium COOH

Human H2N
pancreas cell Signal B chain

Human Recombinant
peptide
Pre pro insulin
insulin-producing bacteria
gene multiplying C chain

Recombinant and producing A chain

human insulin in COOH Human insulin


DNA S S
fermentation tank S S
H 2N
Bacterial Plasmid DNA B chain

DNA cut with restriction Pro insulin


Fermentation
enzymes
Tank A chain
S S
H 2N COOH

Plasmid S
S
S
S
DNA H 2N COOH
B chain
Bacterium
Human insulin Insulin

Fig. 9.1 Human Insulin Production

Applications of biotechnology 156

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 156 25-02-2019 19:21:16


www.asiriyar.net

Somatic cell nuclear transfer is a could be treated by injecting hGH extracted from
technique for creating a viable embryo from the human pituitary glands.
a body cell and an egg cell. This technique is Using recombinant DNA technology hGH
discussed later in animal cloning. can be produced (Fig.9.2). The gene for hGH is
isolated from the human pituitary gland cells.
The isolated gene is inserted into a plasmid
In 1997, Rosie, the first
vector and then is transferred into E. coli. The
transgenic cow produced
recombinant E. coli then starts producing human
human protein enriched
growth hormone.The recombinant E. coli are
milk, which contained the
isolated from the culture and mass production of
human alpha lactalbumin. The protein
hGH is carried out by fermentation technology.
rich milk (2.4 gm/litre) was a nutritionally
balanced food for new born babies than A recombinant form of human growth
the normal milk produced by the cows. hormone called somatropin is used as a drug to
treat growth disorders in children.
9.1.2 Human Growth Hormone (hGH)
9.1.3 Human Blood-Clotting
At about the same time when recombinant
Factor VIII
insulin was first made in E. coli, other research
You would have studied in your earlier
groups worked on human growth hormones
class that many factors are required for normal
somatostatin and somatotropin. These are
blood clotting process and the factor VIII is
peptide hormones secreted by the pituitary
one of them. The genes for the formation of
gland that helps in the growth and development
factor VIII is located in the X chromosome. A
by increasing the uptake of amino acids and
genetic defect in the synthesis of factor VIII
promoting protein synthesis. Deficiency of
results in Haemophilia A, a sex-linked disease
human growth hormone causes dwarfism, which

EcoRI

Gene for human


Recombinant growth hormone
Gene for human DNA
growth hormone

DNA
recombination
Sticky
ends
Human Cell

DNA
Bacterial Cell insertion

Bacterial
chromosome
EcoRI

Bacterial cell for


containing gene for
Plasmid human growth hormone

Fig. 9.2 Production of human growth hormone


157 Applications of biotechnology

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 157 25-02-2019 19:21:16


www.asiriyar.net

characterized by prolonged clotting time and be overcome by this approach.


internal bleeding (Refer Chapter 4). Clotting The recombinant vaccines are generally of
factor VIII isolated from blood of normal uniform quality and produce less side effects as
human being was used in the treatment of compared to the vaccines produced by conventional
Haemophilia A. Requirement of large quantities methods. Different types of recombinant vaccines
of blood for this purpose and the risk of include subunit recombinant vaccines, attenuated
transmission of infectious diseases like AIDS is recombinant vaccines and DNA vaccines.
a disadvantage. Recombinant DNA technology Subunit recombinant vaccines
was used to produce Recombinant Factor VIII Vaccines that use components of a pathogenic
in the Chinese Hamster ovary and in the baby organism rather than the whole organism are called
Hamster kidney cells. More recently a cell line subunit vaccines; recombinant DNA technology
of human origin has been used for the first time is very suited for developing new subunit vaccines.
to produce human blood clotting factor VIII. It includes components like proteins, peptides and
DNAs of pathogenic organisms. The advantages of
9.1.4 Interferons
these vaccines include their purity in preparation,
Interferons are proteinaceous, antiviral, stability and safe use.
species specific substances produced by Attenuated recombinant vaccines
mammalian cells when infected with viruses.
This includes genetically modified
Interferons were discovered by Alick Isaacs
pathogenic organisms (bacteria or viruses)
and Jean Lindemann in 1957. Based on the
that are made nonpathogenic and are used
structure of interferons they are classified
as vaccines. It is now possible to genetically
as α, β and γ interferons. They stimulate the
engineer the organisms (bacteria or viruses) and
cellular DNA to produce antiviral enzymes
use them as live vaccines and such vaccines are
which inhibit viral replication and protect the
referred to as attenuated recombinant vaccines.
cells. Similar to factor VIII , interferons could
be isolated from blood, but the amount of
blood required for isolation of interferons is Edible vaccines are prepared by molecular
enormous and not practical. To overcome this pharming using the science of genetic
issue interferons could be produced by rDNA engineering. Selected genes are introduced
technology. The yeast Saccharomyces cerevisiae into plants and the transgenic plants are
is more suitable for production of recombinant induced to manufacture the encoded protein.
interferons than E.coli, since E.coli does not Edible vaccines are mucosal targeted vaccines
possess the machinery for glycosylation of which cause stimulation of both systemic and
proteins. Interferons are used for the treatment mucosal immune response. At present edible
of various diseases like cancer, AIDS, multiple vaccines are produced for human and animal
sclerosis, hepatitis C and herpes zoster. In spite diseases like measles, cholera, foot and mouth
of the therapeutic applications interferons are disease and hepatitis.
not within the reach of the common man due to
high cost for its production. DNA Vaccines
Genetic immunisation by using DNA
9.1.5 Recombinant Vaccines
vaccines is a novel approach that came into being
Recombinant DNA technology has been
in 1990. The immune response of the body is
used to produce new generation vaccines.The
stimulated by a DNA molecule. A DNA vaccine
limitations of traditional vaccine production could
consists of a gene encoding an antigenic protein,

Applications of biotechnology 158

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 158 25-02-2019 19:21:16


www.asiriyar.net

inserted onto a plasmid, and then incorporated 9.2 Gene Therapy


into the cells in a target animal. DNA instructs If a person is born with a hereditary
the cells to make antigenic molecules which are disease, can a corrective therapy be given for
displayed on its surfaces. This would evoke an such disease? Yes, this can be done by a process
antibody response to the free floating antigen known as gene therapy. This process involves
secreted by the cells. The DNA vaccine cannot the transfer of a normal gene into a person’s
cause the disease as it contains only copies of cells that carries one or more mutant alleles.
a few of its genes. DNA vaccines are relatively Expression of normal gene in the person results
easy and inexpensive to design and produce. in a functional gene product whose action
Vaccines produced by these new techniques produces a normal phenotype. Delivery of the
have definite advantages like producing target normal gene is accomplished by using a vector.
proteins, long lasting immunity and trigger The main thrust of gene therapy has been
immune response only against specific directed at correcting single gene mutations as
pathogens with less toxic effects. in cystic fibrosis and haemophilia. At present
Recombinant hepatitis B vaccine as a most genetic diseases have no effective treatment
subunit vaccine is produced by cloning and so gene therapy could offer hope for many
hepatitis B surface antigen (HbsAg) gene in people. There are two strategies involved in
gene therapy namely; Gene augmentation
the yeast, Saccharomyces cerevisiae (Fig. 9.3).

The recombinant vaccine for hepatitis B (HbsAg) was the first synthetic vaccine launched in 1997
which was marketed by trade names Recombivax and Engerix-B. India is the fourth country in
the world after USA, France and Belgium to develop an indigenous hepatitis B vaccine.

DNA

HB
Recombinant vaccine
Bacterium
Extraction &
Hepatitis B purification of
Virus HB antigen HB vaccine
producing
gene Recombinant yeast
Recombinant cell multiplying and
DNA producing HB antigen
in fermentation tank
Bacterial Plasmid DNA
DNA cut with restriction
enzymes Fermentation
Tank
Plasmid
DNA
Bacterium HB antigen

Fig. 9.3 Production of recombinant HB Vaccine


159 Applications of biotechnology

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 159 25-02-2019 19:21:16


www.asiriyar.net

Bacterium carrying
plasmid with cloned normal Genetically disabled
human ADA gene retrovirus

Cloned ADA gene is


T cells
incorporated into virus
with disabled ADA gene
isolated from SCID patient Genetically altered
cells are reimplanted to
produce ADA

Retrovirus infects
T cells, transfer
ADA gene to cells
Cells are grown
in culture to
ensure ADA gene
is active

Fig. 9.4 Process of gene therapy


Table 9.1 Diffentiation between somatic cell gene therapy and germ line gene therapy

SOMATIC CELL GENE THERAPY GERM LINE GENE THERAPY


Therapeutic genes transferred into the somatic cells. Therapeutic genes transferred into the germ cells.
Introduction of genes into bone marrow cells,
Genes introduced into eggs and sperms.
blood cells, skin cells etc.,
Will not be inherited in later generations. Heritable and passed on to later generations.

The first clinical gene therapy was given in 1990 by French Anderson to a four year old
girl with adenosine deaminase (ADA) deficiency. ADA deficiency or SCID (Severe combined
immunodeficiency) is an autosomal recessive metabolic disorder. It is caused by the deletion or
dysfunction of the gene coding for ADA enzyme. In these patients the nonfunctioning T-Lymphocytes
cannot elicit immune responses against invading pathogens.The right approach for SCID treatment
would be to give the patient a functioning ADA which breaks down toxic biological products.
In some children ADA deficiency could be cured by bone marrow transplantation, where
defective immune cells could be replaced with healthy immune cells from a donor. In some patients it
can be treated by enzyme replacement therapy, in which functional ADA is injected into the patient.
During gene therapy the lymphocytes from the blood of the patient are removed and grown in a
nutrient culture medium. A healthy and functional human gene, ADA cDNA encoding this enzyme
is introduced into the lymphocytes using a retrovirus. The genetically engineered lymphocytes are
subsequently returned to the patient. Since these cells are not immortal, the patient requires periodic
infusion of such genetically engineered lymphocytes. The disease could be cured permanently if the
gene for ADA isolated from bone marrow cells are introduced into the cells of the early embryonic
stages.

Applications of biotechnology 160

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 160 25-02-2019 19:21:17


www.asiriyar.net

therapy which involves insertion of DNA into body. ES cells are immortal i.e., they can proliferate
the genome to replace the missing gene product in a sterile culture medium and maintain their
and Gene inhibition therapy which involves undifferentiated state.
insertion of the anti sense gene which inhibits
the expression of the dominant gene (Fig. 9. 4). More
Stem cell
Stem cell
The two approaches to achieve gene therapy
are somatic cell and germ line gene therapy.
Somatic cell therapy involves the insertion of
a fully functional and expressible gene into a
target somatic cell to correct a genetic disease
Muscle cell Neuron
permanently whereas Germline gene therapy
involves the introduction of DNA into germ cells
which is passed on to the successive generations.
Red blood corpuscles
Gene therapy involves isolation of a specific
gene and making its copies and inserting them Fig. 9.5 Embryonic stem cells
into target cells to make the desired proteins.
It is absolutely essential for gene therapists to Adult stem cells are found in various tissues
ensure that the gene is harmless to the patient of children as well as adults. An adult stem cell or
and it is appropriately expressed and that the somatic stem cell can divide and create another
body’s immune system does not react to the cell similar to it. Most of the adult stem cells are
foreign proteins produced by the new genes. multipotent and can act as a repair system of the
body, replenishing adult tissues.The red bone
9.3 Stem Cell Therapy marrow is a rich source of adult stem cells.
Stem cells are undifferentiated cells found The most important and potential application
in most of the multi cellular animals. These cells of human stem cells is the generation of cells and
maintain their undifferentiated state even after tissues that could be used for cell based therapies.
undergoing numerous mitotic divisions. Human stem cells could be used to test new drugs.
Stem cell research has the potential to
revolutionize the future of medicine with the ability Totipotency (Toti-total) is the ability
of a single cell to divide and produce all of the
to regenerate damaged and diseased organs. Stem differentiated cells in an organism.
cells are capable of self renewal and exhibit ‘cellular Pluripotency (Pluri-several) refers to a
potency’. Stem cells can differentiate into all types stem cell that has the potential to differentiate
of cells that are derived from any of the three germ into any of the three germ layers-ectoderm,
layers ectoderm, endoderm and mesoderm. endoderm and mesoderm.
Multipotency (multi-Many) refers to the
In mammals there are two main types of stem cells that can differentiate into various
stem cells – embryonic stem cells (ES cells) and types of cells that are related. For example blood
adult stem cells. ES cells are pluripotent and can stem cells can differentiate into lymphocytes,
produce the three primary germ layers ectoderm, monocytes , neutrophils etc.,
mesoderm and endoderm. Embryonic stem cells Oligopotency (Oligo-Few) refers to stem
cells that can differentiate into few cell types.
are multipotent stem cells that can differentiate
For example lymphoid or myeloid stem cells
into a number of types of cells (Fig. 9.5). ES cells can differentiate into B and T cells but not RBC.
are isolated from the epiblast tissue of the inner Unipotency ( Uni- Single) refers to the
cell mass of a blastocyst. When stimulated ES can ability of the stem cells to differentiate into only
develop into more than 200 cells types of the adult one cell type.

161 Applications of biotechnology

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 161 25-02-2019 19:21:17


www.asiriyar.net

Stem Cell Banks produces symptoms in the patient. By the time


Stem cell banking is the extraction, the symptoms appear concentration of pathogen
processing and storage of stem cells, so that becomes very high in the body.However very low
they may be used for treatment in the future, concentration of a bacteria or a virus, even when
when required. Amniotic cell bank is a facility the symptoms of the disease does not appear, can
that stores stem cells derived from amniotic be detected by amplification of their nucleic acid.
fluid for future use. Stem cells are stored in ELISA [Enzyme Linked Immunosorbent Assay]
banks specifically for use by the individual
from whom such cells have been collected Coating
Antigen is adsorbed onto the wells in
and the banking costs are paid. Cord Blood ELISA plate in coating buffer
Banking is the extraction of stem cells from
the umbilical cord during childbirth. While Remove buffer and wash plate
the umbilical cord and cord blood are the most Blocking
popular sources of stem cells, the placenta, A buffer containing unrelated protein is
used to block free sites in the wells
amniotic sac and amniotic fluid are also rich
sources in terms of both quantity and quality.
Remove buffer and wash plate

9.4 Molelcular Diagnostics Detection


Enzyme conjugated detection antibody
Early diagnosis of infectious diseases or binds antigen
inherent genetic defects is essential for appropriate
treatment. Early detection of the disease is not Remove buffer and wash plate
possible using conventional diagnostic methods
Readout
like microscopic examinations, serum analysis Substrate is catalyzed by the enzyme to
and urine analysis.These laboratory techniques generate colored readout

are indirect and not always specific. Scientists


are continuously searching for specific, sensitive
and simple diagnostic techniques for diagnosis
of diseases. Recombinant DNA technology,
Polymerase Chain Reactions (PCR) and Enzyme
Linked Immunosorbent Assay (ELISA) are some
of the techniques that are reliable and help in
early diagnosis. Presence of pathogens like virus,
bacteria, etc., is detected only when the pathogen

Enzyme-linked Substrate Product


Detection Antibody

Target
Antigen
Capture
Antibody

Fig. 9.6 Enzyme Linked ImmunoSorbent Assay


Applications of biotechnology 162

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 162 25-02-2019 19:21:18


www.asiriyar.net

ELISA is a biochemical procedure and specific method used for diagnosis. ELISA
discovered by Eva Engvall and Peter Perlmanin possesses the added advantages of not requiring
(1971) to detect the presence of specific radioisotopes or a radiation counting apparatus.
antibodies or antigens in a sample of serum, PCR (Polymerase Chain Reaction)
urine, etc., It is a very important diagnostic The polymerase chain reaction (PCR) is
tool to determine if a person is HIV positive an invitro amplification technique used for
or negative. ELISA is a tool for determining synthesising multiple identical copies (billions)
serum antibody concentrations (such as the of DNA of interest. The technique was developed
antibodies produced in a person infected by by Kary Mullis (Nobel laureate, 1993) in the
pathogens such as HIV) and also for detecting year 1983.
the presence of specific antigens and hormones
Denaturation, renaturation or primer
such as human chorionic gonadotropins.
annealing and synthesis or primer extension,
During diagnosis the sample suspected are the three steps involved in PCR (Fig.  9.7).
to contain the antigen is immobilized on The double stranded DNA of interest is denatured
the surface of an ELISA plate (Fig. 9.6). The to separate into two individual strands by high
antibody specific to this antigen is added and temperature . This is called denaturation. Each
allowed to react with the immobilized antigen. strand is allowed to hybridize with a primer
The anti-antibody is linked to an appropriate (renaturation or primer annealing). The primer
enzyme like peroxidase. The unreacted anti- template is used to synthesize DNA by using Taq –
antbody is washed away and the substrate of the DNA polymerase.
enzyme (hydrogen peroxidase) is added with
During denaturation the reaction mixture is
certain reagents such as 4-chloronaphthol. The
heated to 950 C for a short time to denature the
activity of the enzyme yields a coloured product
target DNA into single strands that will act as a
indicating the presence of the antigen. The
template for DNA synthesis. Annealing is done by
intensity of the colour is directly proportional
rapid cooling of the mixture, allowing the primers
to the amount of the antigen. ELISA is highly
to bind to the sequences on each of the two strands
sensitive and can detect antigens in the range of
flanking the target DNA. During primer extension
a nanogram.
or synthesis the temperature of the mixture is
There are four kinds of ELISA namely, increased to 750C for a sufficient period of time to
Direct ELISA, Indirect ELISA, sandwich ELISA allow Taq DNA polymerase to extend each primer
and competitive ELISA. It is a highly sensitive by copying the single stranded template. At the
5’ 3’
3’ 5’
5’ 3’
Nucleotide
5’ 3’

5’ 3’ Denaturation Annealing Extension


3’ 5’

3’ 5’

DNA primer 3’ 5’
Original
DNA
5’ 3’
3’ 5’
Fig. 9.7 Steps involved in PCR
163 Applications of biotechnology

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 163 25-02-2019 19:21:18


www.asiriyar.net

end of incubation both single template strands be present. Its DNA has unique sequences that
will be made partially double stranded. The new can be detected by PCR, often using the clinical
strand of each double stranded DNA extends to specimen (for example, blood, stool, spinal fluid,
a variable distance downstream. These steps are or sputum) in the PCR mixture. PCR is also
repeated again and again to generate multiple employed in the prenatal diagnosis of inherited
forms of the desired DNA. This process is also diseases by using chorionic villi samples or cells
called DNA amplification (Fig. 9.8). from amniocentesis. Diseases like sickle cell
anemia, β-thalassemia and phenylketonuria
Targeted sequence
5’
can be detected by PCR in these samples.
3’
5’ 3’ cDNA from PCR is a valuable tool for diagnosis
Heat, cool, add and monitoring retroviral infections – eg.
primers to get
ssDNA that Tuberculosis by Mycobacterium tuberculosis.
primers anneal to
Several virally induced cancers, like
5’ 3’ 3’ 5’
cervical cancer caused by Papilloma virus
Primer Primer
can be detected by PCR. Sex of human beings
Add Taq polymerase,
and live stocks, embryos fertilized invitro can
dGTP, dCTP, dATP, dTTP be determined by PCR by using primers and
to synthesize
complimentary strand DNA probes specific for sex chromosomes.
3’ 5’ 3’ 5’ PCR technique is also used to detect sex-
5’ 3’ 5’ 3’ linked disorders in fertilized embryos.
Repeat cycle
25 to 75 times
Applications of PCR
The differences in the genomes of two
Fig. 9.8 Polymerase chain reaction
different organisms can be studied by PCR. PCR
The PCR technique can also be used for
is very important in the study of evolutions,
amplifications of RNA in which case it is referred
more specifically phylogenetics. As a technique
to as reverse transcription PCR (RT-PCR). In this
which can amplify even minute quantities of
process the RNA molecules (mRNA) must be
DNA from any source, like hair, mummified
converted to complementary DNA by the enzyme
tissues, bones or any fossilized materials.
reverse transcriptase. The cDNA then serves as
the template for PCR. PCR technique can also be used in the
PCR In Clinical Diagnosis field of forensic medicine . A single molecule
of DNA from blood stains, hair, semen of an
The specificity and sensitivity of PCR is
individual is adequate for amplification by PCR.
useful for the diagnosis of inherited disorders
The amplified DNA is used to develop DNA
(genetic diseases), viral diseases, bacterial
fingerprint which is used as an important tool
diseases, etc., The diagnosis and treatment of
in forensic science.Thus, PCR is very useful for
a particular disease often requires identifying
identification of criminals. PCR is also used in
a particular pathogen. Traditional methods of
amplification of specific DNA segment to be
identification involve culturing these organisms
used in gene therapy.
from clinical specimens and performing
metabolic and other tests to identify them.
The concept behind PCR based diagnosis of
9.5 Transgenic Animals
In early days selective breeding
infectious diseases is simple – if the pathogen
methods were carried out to improve the
is present in a clinical specimen its DNA will
genetic characteristics of live stock and

Applications of biotechnology 164

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 164 25-02-2019 19:21:18


www.asiriyar.net

other domestic animals. With the advent of • 


Transgenic mice are used for testing the
modern biotechnology it is possible to carry safety of vaccines.
out manipulations at the genetic level to get • 
Transgenic animals are used for testing
the desired traits in animals. Transgenesis is toxicity in animals that carry genes which
the process of introduction of extra (foreign/ make them sensitive to toxic substances than
exogenous) DNA into the genome of the non-transgenic animals exposed to toxic
animals to create and maintain stable heritable substances and their effects are studied.
characters. The foreign DNA that is introduced • Transgenesis is important for improving the
is called the transgene and the animals that quality and quantity of milk, meat, eggs and
are produced by DNA manipulations are wool production in addition to testing drug
called transgenic animals or the genetically resistance
engineered or genetically modified organisms.
The various steps involved in the production 9.6 Biological products and their
of transgenic organisms are uses
• Identification and separation of desired A biological product is a substance
gene. derived from a living organism and used for
• S election of a vector (generally a virus) or the prevention or treatment of disease. These
direct transmission. products include antitoxins, bacterial and
• Combining the desired gene with the vector. viral vaccines, blood products and hormone
extracts. These products may be produced
• I ntroduction of transferred vector into cells,
through biotechnology in a living system, such
tissues, embryo or mature individual.
as a microorganism, plant cell or animal cell,
• D
 emonstration of integration and and are often more difficult to characterize than
expression of foreign gene in transgenic small molecule drugs. Through recombinant
tissue or animals. Transgenic animals such DNA technology it is possible to produce these
as mice, rat, rabbit, pig, cow, goat, sheep biological products on demand. There are
and fish have been produced (Fig 9.9). many types of biological products approved
Uses Of Transgenesis for use -they are, therapeutic proteins,
• Transgenesis is a powerful tool to study gene monoclonal antibodies and vaccines. Health
expression and developmental processes in care and pharmaceutical industries have been
higher organisms. revolutionised by biotechnological proteins.
• Transgenesis helps in the improvement of Hormones and antibodies are produced
genetic characters in animals.Transgenic commercially, primarily for the medical
animals serve as good models for industry. Recombinant hormones like Insulin,
understanding human diseases which help Human growth hormone, Recombinant
in the investigation of new treatments for vaccines and recombinant proteins like human
diseases.Transgenic models exist for many alpha lactalbumin are available today.
human diseases such as cancer, Alzheimer’s, Animals are used as bioreactors to produce
cystic fibrosis, rheumatoid arthritis and desirable proteins. Antibodies are substances
sickle cell anemia. that react against the disease causing antigens
• 
Transgenic animals are used to produce and these can be produced using transgenic
proteins which are important for medical animals as bioreactors. Monoclonal antibodies,
and pharmaceutical applications. which are used to treat cancer, heart disease

165 Applications of biotechnology

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 165 25-02-2019 19:21:18


www.asiriyar.net

and transplant rejection are produced by this


technology. Natural protein adhesives are
non toxic, biodegradable and rarely trigger
an immune response, hence could be used Udder cell Egg from B
to reattach tendons and tissues, fill cavities in from A

teeth, and repair broken bones.


Nucleus
Nucleus
Remove
nucleus from
Fuse cells egg

Human
gene E
Egg
donor

Egg Culture in
oviduct tissue
Micro injection of
human gene
Implant 6 day old
embryo in surrogate

Blastocyst

Development
within a host goat

Dolly
Transgenic
goat
Fig. 9. 10 Cloning of dolly
Milk from
transgenic goat developed by the nuclear transfer technique
and the phenomenon of totipotency.
Fig.9. 9 Production of transgenic Totipotency refers to the potential of a cell
animals to develop different cells, tissues, organs and
9.7 Animal Cloning finally an organism.
Cloning is the process of producing The mammary gland udder cells (somatic
genetically identical individuals of an organism cells) from a donor sheep (ewe) were isolated
either naturally or artificially. In nature many and subjected to starvation for 5 days. The
organisms produce clones through asexual udder cells could not undergo normal growth
reproduction. cycle, entered a dormant stage and became
Cloning in biotechnology refers to the totipotent. An ovum (egg cell) was taken
process of creating copies of organisms or copies from another sheep (ewe) and its nucleus was
of cells or DNA fragments (molecular cloning). removed to form an enucleated ovum. The
dormant mammary gland cell/udder cell and
Dolly was the first mammal (Sheep)
the enucleated ovum were fused. The outer
clone developed by Ian Wilmut and Campbell
membrane of the mammary cell was ruptured
in 1997. Dolly, the transgenic clone was
allowing the ovum to envelope the nucleus.

Applications of biotechnology 166

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 166 25-02-2019 19:21:19


www.asiriyar.net

The fused cell was implanted into another


ewe which served as a surrogate mother. Five A gene ‘knock out’ is a genetically
months later dolly was born. Dolly was the engineered organism that carries one or
first animal to be cloned from a differentiated more genes in its chromosomes that have
somatic cell taken from an adult animal without been made inoperative
the process of fertilization (Fig. 9.10).
9.8 Ethical Issues
Advantages and Disadvantages Of Cloning
Biotechnology has given to the society cheap
Animals
drugs, better friuts and vegetables, pest resistant
• Offers benefits for clinical trials and medical crops, indigenious cure to diseases and lot of
research. It can help in the production of controversy. This is mainly because the major
proteins and drugs in the field of medicine. part of the modern biotechnology deals with
• Aids stem cell research. genetic manipulations. People fear that these
• Animal cloning could help to save endangered genetic manipulations may lead to unknown
species. consequences. The major apprehension
• Animal and human activists see it as a threat of recombinant DNA technology is that
to biodiversity saying that this alters evolution unique microorganisms either inadvertently
which will have an impact on populations and or deliberately for the purpose of war may
the ecosystem. be developed that could cause epidemics or
• The process is tedious and very expensive. environmental catastrophies. Although many
• It can cause animals to suffer. are concerned about the possible risk of genetic
• Reports show that animal surrogates were engineering, the risks are in fact slight and the
manifesting adverse outcomes and cloned potential benefits are substantial.
animals were affected with disease and have
high mortality rate. Summary
• It might compromise human health through Biotechnology is defined as “any
consumption of cloned animal meat. technological application that uses biological
• Cloned animals age faster than normal systems, living organisms or derivatives thereof,
animals and are less healthy than the parent to make or modify products or processes for
organism as discovered in Dolly specific use”. In 1919, Hungarian agricultural
engineer Karl Ereky coined the term
• Cloning can lead to occurrence of genetic
Biotechnology. Biotechnology includes two
disorders in animals.
major technologies, Genetic engineering and
• More than 90% of cloning attempts fail to
Chemical engineering.
produce a viable offspring.
Biotechnology has application in four
Ian Wilmut and Campbell major industrial areas, including health
removed 277 cells from the care (medical) agriculture, industrial and
udder of an adult sheep and environment.Biotechnology techniques are
fused those cells with 277
used in the field of medicine for diagnosis,
unfertilised egg cells from
which the nuclear material was removed. prevention and treatment of different diseases.
After culturing the resulting embryos for 6 Production of recombinant hormones,
days , they implanted 29 embryos into the recombinant clotting factor VIII and
surrogate mother's womb and only one Dolly recombinant interferons have helped in the
was produced. treatment of diseases. Recombinant vaccines

167 Applications of biotechnology

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 167 25-02-2019 19:21:20


www.asiriyar.net

have been used to prevent various diseases. Evaluation


The recombinant vaccines are of three types-
1. T
 he first clinical gene
subunit recombinant vaccines, attenuated
therapy was done for the
recombinant vaccines and gene recombinant
treatment of
vaccines.
a) AIDS
Genetic defects could be corrected by a process b) Cancer
called Gene therapy. It is of two types somatic cell c) Cystic fibrosis d) SCID
gene therapy and germline gene therapy 2. Dolly, the sheep was obtained by a technique
Stem cells are undifferentiated cells found known as
in multicellular organisms. These cells are of a) Cloning by gene transfer
two types -Embryonic stem cells and adult stem b) Cloning without the help of gametes
cells. Stem cells have the ability to regenerate c) Cloning by tissue culture of somatic cells
damaged and diseased organs. Recombinant
d) Cloning by nuclear transfer.
DNA technology, Polymerase chain reaction
3. The genetic defect adenosine deaminase
and Enzyme Linked Immunosorbent Assay
deficiency may be cured permanently by
are techniques that are reliable and help in early
a) Enzyme replacement therapy
diagnosis.
b) periodic infusion of genetically engineered
Transgenesis is the process of introduction lymphocytes having ADA cDNA
of a foreign gene into the genome of animals to c)  administering adenosine deaminase
create and maintain stable heritable characters. activators
A biological product is a substance derived d) introducing bone marrow cells producing
from a living organism and used for the ADA into embryo at an early stage of
prevention or treatment of diseases. development.
4. H
 ow many amino acids are arranged in the
Cloning is the process of producing two chains of Insulin?
genetically identical individuals of an organism
a) Chain A has 12 and Chain B has 13
either naturally or artificially
b) Chain A has 21 and Chain B has 30
Advances in Biotechnology and their amino acids
applications are most frequently associated c) Chain A has 20 and chain B has 30 amino
with controversies, ethical issues and concerns. acids
Statutory bodies are constituted to monitor d) Chain A has 12 and chain B has 20 amino
and approve the biotechnological processes acids.
and products. 5. P
 CR proceeds in three distinct steps governed
by temperature, they are in order of
Genetically modified organisms can play
a) Denaturation, Annealing, Synthesis
a positive role in sustainable agriculture,
b) Synthesis, Annealing, Denaturation
forestry, aquaculture, bioremediation and
c) Annealing, Synthesis, Denaturation
environmental management in developed and
d) Denaturation, Synthesis, Annealing
developing countries. Biosafety guidelines
6. Which one of the following statements is true
have been formulated by many countries for
regarding DNA polymerase used in PCR?
DNA recombinant manipulations.
a) It is used to ligate introduced DNA in
recipient cells
b) It serves as a selectable marker

Applications of biotechnology 168

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 168 25-02-2019 19:21:20


www.asiriyar.net

c) It is isolated from a Virus 17. Gene therapy is an attempt to correct a


d) It remains active at a high temperature. Genetic defect by providing a normal gene
7. ELISA is mainly used for into the individual. By this the function
a) Detection of mutations can be restored. An alternate method
b) Detection of pathogens would be to provide gene product known
c) Selecting animals having desired traits as enzyme replacement therapy, which
d) Selecting plants having desired traits would also restore the function. Which
8. Transgenic animals are those which have in your opinion is a better option? Give
reasons for your answer.
a) Foreign DNA in some of their cells
18. W
 hat are transgenic animals? Give examples.
b) Foreign DNA in all their cells
c) Foreign RNA in some of their cells 19. If a person thinks he is infected with HIV,
d) Foreign RNA in all their cells due to unprotected sex, and goes for a blood
test. Do you think a test such as ELISA will
9. Recombinant Factor VIII is produced in
help? If so why? If not, why?
the ------- cells of the Chinese Hamster
20. Explain how ADA deficiency can be corrected?
a) Liver cells b) blood cells
21. What are DNA vaccines?
c) ovarian cells d) brain cells. 22. Differentiate between Somatic cell gene
10. Vaccines that use components of a therapy and germline gene therapy.
pathogenic organism rather than the whole 23. What are stem cells? Explain its role in the
organism are called field of medicine.
a) Subunit recombinant vaccines 24. One of the applications of biotechnology is
b) attenuated recombinant vaccines ‘gene therapy” to treat a person born with a
c) DNA vaccines hereditary disease
d) conventional vaccines. i) What does “gene therapy” mean?
11. Mention the number of primers required in ii) Name the hereditary disease for which
each cycle of PCR. Write the role of primers the first clinical gene therapy was used.
and DNA polymerase in PCR. Name the
iii) 
Mention the steps involved in gene
source organism of the DNA polymerase
therapy to treat this disease.
used in PCR.
25. PCR is a useful tool for early diagnosis of an
12. How is the amplification of a gene sample of Infectious disease. Elaborate.
interest carried out using PCR?
26. What are recombinant vaccines?. Explain
13. W
 hat is genetically engineered Insulin? the types.
14. Explain how “Rosie” is different from a 27. Explain why cloning of Dolly, the sheep
normal cow. was such a major scientific breakthrough?
15. How was Insulin obtained before the 28. Mention the advantages and disadvantages
advent of rDNA technology? What were the of cloning.
problems encountered?
29. Explain how recombinant Insulin can be
16. ELISA is a technique based on the produced.
principles of antigen-antibody reactions.
30. Explain the steps involved in the production
Can this technique be used in the molecular
of recombinant hGH.
diagnosis of a genetic disorder such as
Phenylketonuria?

169 Applications of biotechnology

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 169 25-02-2019 19:21:20


www.asiriyar.net

ICT CORNER
Applications of biotechnology Science for a
better life

A Transgenic fly. Come let us create


and use

Procedure :
Step -1: Type the URL or scan the QR code to open the activity page and click “Click to enter
the lab” to begin.
Step -2: Click wherever the cursor symbol becomes as “Hand” symbol as that would lead for
the next step.
Step -3 Follow the instructions for all the six steps “Prepare DNA to Examine Light Output”.
Step – 4 : Explore the “Use Transgenic flies” a dialog box option found below the lab area to
know uses.

Step 1 Step 2 Step 3

Step 4

Applications of biotechnology Science for a better life URL:


http://media.hhmi.org/biointeractive/vlabs/transgenic_fly/index.html?_
ga=2.234689054.1812412497.1546851037-264360672.1545143882

*Pictures are indicative only


*Allow flash player

Applications of biotechnology 170

TN_GOVT_XII_ Bio Zoology_chapter 9.indd 170 25-02-2019 19:21:22


www.asiriyar.net

10
UNIT - V

Organisms and
Population
CHAPTER

Save nature – save our future


Chapter Outline
10.1. Organism and its Environment
10.2. Habitat
10.3. Major Abiotic Components or Factors
10.4. Concept of Biome and Distribution
10.5. Responses to abiotic factors
T he word ‘ecology’ is derived from the
Greek term ‘oikos’, meaning ‘house’
and logos, meaning ‘study’. Thus, the study
10.6. Adaptations of the environmental ‘house’ includes all
10.7. Populations the organisms in it and all the functional
10.8. Population attributes processes that make the house habitable.
10.9. Population age distribution
The study of ecology encompasses
10.10. Growth models / Curves
different levels-organism, population,
10.11. Population regulation
10.12. Population interactions community, ecosystem, etc., In ecology, the
term population, originally coined to denote
a group of people is broadened to include
Learning Objectives
groups of individuals of any one kind of
To gain knowledge / insight about: organism. Community in the ecological sense
➢➢ The local and geographical distribution (designated as ‘biotic community’) includes
- abundance of organisms.
all the populations occupying a given area.
➢➢ Temporal changes in the occurrence,
abundance and activities. The community (Biotic) and the non-living
➢➢ Interrelationship between environment (Abiotic) function together as
organism in population an ecological system (or) ecosystem. Biome
and communities. is a term in wide use for a large regional or
➢➢ Structural adaptation and sub continental system characterized by a
functional adjustment
major vegetation type. The largest and most
of organisms to their physical
environment. nearly self-sufficient biological system is
➢➢ The evolutionary development of all often designated as the Ecosphere, which
these interrelations. includes all the living organisms of the Earth,
➢➢ Population growth, models, regulation. interacting with the physical environment
➢➢ Animal associations – intraspecific, to regulate their distribution, abundance,
interspecific. production and evolution.

171

TN_GOVT_XII_ Bio Zoology_chapter10.indd 171 25-02-2019 19:22:06


www.asiriyar.net

10. Organism and its environment (respiration), air sacs (floatation) and kidneys
Every living organism has its own (excretion).
specific surrounding, medium or environment Niche (or) Ecological Niche
with which it continuously interacts and As every organism has its unique habitat,
develops suitable adaptations for survival so also it has an ecological niche which includes
there. Environment is a collective term which the physical space occupied by an organism
includes the different conditions in which an and its functional role in the community.
organism lives or is present. The common and The ecological niche of an organism not only
influencing factors in any environment are light, depends on where it lives but also includes the
temperature, pressure, water, salinity. These are sum total of its environmental requirements.
collectively referred to as Abiotic components. Charles Elton (1927) was the first to
Environments are variable and dynamic, in use the term ‘niche’ as the functional status
which temperature changes and light changes of an organism in its community. Groups
are diurnal and seasonal. These influence the of species with comparable role and niche
organisms inhabiting them. An organism’s dimensions within a community are termed
growth, distribution, number, behavior and ‘guilds’. Species that occupy the same niche
reproduction is determined by the different in different geographical regions, are termed
factors present in the environment. ‘ecological equivalents’.
Many animals share the same general
10.2 Habitat habitat. But their niches are well defined. The
A habitat can be considered as the ‘address’ life style of an individual population in the
of the organism. The collection of all the habitat habitat is known as its niche. For example,
areas of a species constitutes its geographical crickets and grasshoppers are closely related
range. Organisms in a habitat interact with each insects that live in the same habitat, yet
other and can be part of trophic levels to form they occupy different ecological niches. The
food chains and food webs. grasshopper is very active during daylight. It
Examples: In a xerophytic habitat, the can usually be found on a plant, feeding on the
camel is able to use water efficiently and plant parts. Although the cricket lives in the
effectively for evaporative cooling through their same field, it is quite different. During the day,
skin and respiratory system. They excrete highly the cricket hides under leaves or plant debris
concentrated urine and can also withstand and is usually inactive. It is active at night time
dehydration upto 25% of the body weight. The (nocturnal). The cricket and the grasshopper
hoofs and hump are also suitable adaptations do not interfere with each other’s activities in
for survival in this dry sandy environment. the same habitat. Thus, niche of an organism
In an aquatic media, maintaining can be defined as the total position and
homeostasis and osmotic balance is a challenge. function of an individual in its environment.
So, marine animals have appropriate adaptations In a pond ecosystem, where Catla, Rohu
to prevent cell shrinkage. While freshwater and Mrigal are present, the ecological niche of
organisms have suitable adaptations to withstand the Catla is a surface feeder, Rohu is a column
bursting of their cells. Apart from this, organisms feeder and Mrigal is a bottom feeder. Their
such as fish have a wide range of adaptations mouths are designed to suit their niche and
like fins (locomotion), streamlined body hence have different positions and functions in
(aerodynamic), lateral line system (sensory), gills their habitat. (Fig.10.1)

Organisms and populations 172

TN_GOVT_XII_ Bio Zoology_chapter10.indd 172 25-02-2019 19:22:06


www.asiriyar.net

6RODU The metabolism of organisms is regulated


UDGLDWLRQ
by enzymes which are temperature sensitive. In
many organisms, determination of sex and sex
3KRWRV\QWKHVLV
ratio, maturation of gonads, gametogenesis and
6XUIDFH
IHHGHU reproduction is influenced by temperature. In
&DWOD
LV

certain environments, the size and colouration

VLV
RUDXWRO\V

QGRUDXWRO\
3K\WRSODQNWRQ 0DFURSK\WHV
of animals are influenced by temperature. Birds
1XWULHQWV ([FUHWLRQDQG

([FUHWLRQD
and mammals attain greater body size in colder
&ROXPQ
IHHGHU 5RKX
=RRSODQNWRQ

regions than warmer regions (Bergmann’s rule).


Warm blooded animals, living in colder climates,

1XWULHQWV
%HQWKRV
%RWWRP
IHHGHU 0ULJDO
tend to have shorter limbs, ears and other
0LFURELDOGHFRPSRVLWLRQ
appendages when compared to the members of
Fig.10.1 Types of feeders (niche) in pond ecosystem the same species in warmer climates (Allen’s
rule). In some aquatic environments, an inverse
relationship between water temperature and
10.3 Major Abiotic Components fish meristic characters is observed - lower the
or Factors temperature, more the vertebrae (Jordon’s rule).
The abiotic factors include the chemical
Bergman's rule
and physical factors which influence or affect Bergman's rule is an eco geographic principle
organisms and their functioning in their that states that within broadly distributed
taxoncmic clade, populations and
environment. The common abiotic factors are: species of larger size are found in
colder and of smaller
Temperature size are in warmer
regions.
Temperature or degree of hotness and
coldness is an essential and variable factor in
any environment. It influences all forms of life
by affecting many vital activities of organisms
like metabolism, behaviour, reproduction,
7KH$OOHQ5XOH
development and even death in the Biosphere. ‡)URPWKHQRUWKHUQDUFWLFKDUH /DUFWLFXV WKURXJKWKHPRUH
The minimum and maximum temperature of an VRXWKHUO\GHVHUWMDFNUDEELW /DOOHQL KDUHVVKRZSURJUHVVLYHO\
ORQJHUH[WUHPLWLHV OHJV HDUV DQGOHDQHUERGLHV
environment regulates the survival of a cell.

van’t Hoff ’s rule


van’t Hoff proposed that, with the
D /HSXV E /DPHULFDQXV F /FDOLIRPLFXV G /DOOHQL
increase of every 10ºC, the rate of metabolic DUFWLFXV

activity doubles or the reaction rate is


Temperature influences the distribution
halved with the decrease of 10ºC. This rule
of organisms. The tropics have higher diversity
is referred as the van’t Hoff ’s rule. The effect
and density of populations, when compared to
of temperature on the rate of reaction is
expressed in terms of temperature coefficient temperate and polar regions.
or Q10 value. The Q10 values are estimated
taking the ratio between the rate of reaction Adaptations to temperature
at XºC and rate of reaction at (X-10ºC). In Adaptation to temperature is essential
the living system the Q10 value is about 2.0. for the survival of the species/organisms.
If the Q10 value is 2.0, it means 10ºC increase Organisms which can survive a wide range of
and the rate of metabolism doubles. temperature are referred to as Eurytherms

173 Organisms and populations

TN_GOVT_XII_ Bio Zoology_chapter10.indd 173 25-02-2019 19:22:07


www.asiriyar.net

(cat, dog, tiger, human). Eurythermy can be calories) and duration (length of day) of light
an evolutionary advantage: adaptations to cold are considered significant for organisms.
temperatures (cold-eurythemy) are seen as Light influences growth, pigmentation,
essential for the survival of species during  ice migration and reproduction. The
ages.  In addition, the ability to survive in a
intensity and frequency of light influences
wide range of temperatures increases a species'
metabolic activity, induce gene mutations
ability to inhabit other areas, an advantage
(UV, X- rays). Light is essential for vision. This
for natural selection. Eurythermy is an aspect of
thermoregulation in organisms. is proved by the poorly developed or absence
of eyes in cave dwelling organisms. Diapause is
Those organisms which can tolerate only a
also influenced by light in animals. Gonads of
narrow range of temperature are Stenotherms
(Fish, Frogs, Lizards and Snakes). birds become more active with increasing light
Over the course of time, by evolution,
animals of different ecological habitats have Phototaxis: The movement of
developed different variations and adaptations organism in response to light, either towards
to temperature changes. It enabled them to the source of light as in Moths (positive
survive in different habitats and develop niches. phototaxis) or away from light (Euglena,
In case of extreme temperatures, organisms have Volvox, earthworm (negative phototaxis).
adapted by forming heat resistant spores, cysts Phototropism: The growth or
(Entamoeba), antifreeze proteins (Arctic fishes). orientation of an organism in response
Hibernation (winter sleep) and Aestivation to light, either towards the source of light
(Summer sleep) are useful adaptations to
(positive phototropism) as seen in Sunflower,
overcome extreme winters and summers. In
or a way from light (negative phototropism)
certain conditions, migration is an appropriate
as in case of the root of plants.
adaptation to overcome extreme temperatures
and resultant water and food scarcity (Fig 10.2). Photokinesis: A change in the speed
of locomotion (or frequency of turning)
Light in a motile organism or cell which is made
It is an important and essential abiotic in response to a change in light intensity is
factor. Ecologically, the quality (wavelength or called Photokinesis. It involves undirected
colour), the intensity (actual energy in gram random movement in response to light.

6WHQRWKHUPDO 6WHQRWKHUPDO
ROLJRWKHUPDO (XU\WKHUPDO SRO\WKHUPDO

2SWLPXP
$FWLYLW\

2SWLPXP 2SWLPXP

0LQLPXP 0D[LPXP 0LQLPXP 0D[LPXP

7HPSHUDWXUH
Fig. 10.2 Types of Organisms based on temperature tolerance
Organisms and populations 174

TN_GOVT_XII_ Bio Zoology_chapter10.indd 174 25-02-2019 19:22:07


www.asiriyar.net

in summer. Light influences the locomotion freeze, while below the surface, water will be
and movement of lower animals. in liquid form, sustaining life(Fig. 10.3).
Û&
WATER
Û&
Life on earth began in the seas and water ,&(

is essential for the survival of all forms of life. Û&


Û&
About three-fourth of the earth’s surface is Û&
:DWHU

covered with water (hydrosphere). Water is Û&


Û&
found in three states: gaseous, liquid, and solid.
There are two types of water on Earth.
They are the Fresh water (rivers, lakes, ponds) Fig. 10.3 Thermal zones in cold water bodies
and the Salt water (seas and oceans). Based on • Water is considered as the Universal solvent.
the dissolved salts, water can be hard water It is the main medium by which chemical
(sulphates/nitrates of Calcium/Magnesium) constituents are transported from abiotic
or soft water. If hardness can be removed by components to the living components of an
boiling, it is temporary hard water, and if boiling ecosystem.
does not help, it is permanent hard water.
• Water has high surface tension. This allows
Essential properties of water pollen, dust, and even water striders to
•• Water is one of the main agents in remain at the surface of a water body even
Pedogenesis (soil formation). though they are denser than the water.

•• It is the medium for several different


Soil
ecosystems.
It is a mixture of organic matter, minerals,
•• It is present as moisture in the atmosphere gases, liquids and organisms that together
and the outer layers of the lithosphere and is support life. The soil zone is known as
uneven in distribution on the earth. Pedosphere. Soil is formed from rocks which
•• Water is heavier than air and imparts greater are the parent materials of soil, by weathering
buoyancy to the aquatic medium. This and is called embryonic soil (Pedogenesis).
enables organism to float at variable levels. It has four major functions-
•• Water has high heat capacity and latent heat, •• medium for plant growth
due to which it can withhold large amounts •• means for water storage and purification
of heat. Thus, oceans and lakes tend to
•• modifier of earth’s atmosphere
maintain a relatively constant temperature,
•• habitat for many organisms, which in turn
and the biosphere is relatively thermostable.
modify the soil
•• Water is physically unique because it is less
Soil is formed of many horizontal layers called
dense as a solid (ice) than as a liquid.
as Soil Profile.
•• When water freezes (0⁰C), it contracts. The
maximum density of liquid water occurs at Properties of Soil
4ºC. Below that, it expands markedly. This 1. Texture of soil – The texture of soil is
enables ice to float on the top of water bodies. determined by the size of the soil particles.
Hence, only the surface of water bodies will The types of soil include sand, silt and clay
on the basis of their size differences.

175 Organisms and populations

TN_GOVT_XII_ Bio Zoology_chapter10.indd 175 25-02-2019 19:22:07


www.asiriyar.net

2. Porosity – The space present between soil Relative humidity is the amount of water
particles in a given volume of soil are called vapour present in air and is expressed as a
pore spaces. The percentage of soil volume percentage of the amount needed for saturation
occupied by pore space or by the interstitial at the same temperature Relative humidity is
spaces is called porosity of the soil. expressed as a percentage; a high percentage
3. Permeability of soil-The characteristic means that the air-water mixture is more
of soil that determines the movement of humid  at a given temperature. Humidity is
water through pore spaces is known as soil measured with a Hygrometer.
permeability. Soil permeability is directly
dependent on the pore size. Water holding Altitude
capacity of the soil is inversely dependent This factor is mainly the elevation or gradient
on soil porosity. and it affects temperature and precipitation in
an ecosystem or biome. As altitude increases,
4. Soil Temperature-Soil gets its heat energy
temperature and density of oxygen decreases.
from solar radiation, decomposing organic
Higher altitudes usually receive snow instead of
matter, and heat from the interior of earth.
rain because of low temperature.
Soil temperature effects the germination
of seeds, growth of roots and biological Animals are known to modify their
activity of soil-inhabiting micro-and macro- response to environmental changes (stress) in
organisms. reasonably short time spans. This is known as
Acclimatization. This is observed when people
5. Soil water- In soil, water is not only important
who have moved from the plains to higher
as a solvent and transporting agent, but also
altitudes show enhanced RBC count within a
maintains soil texture, arrangement and
few days of settling in their new habitat. This
compactness of soil particles, making soil
helps them cope with lower atmospheric oxygen
habitable for plants and animals.
and higher oxygen demand.
Wind
Wind is the natural movement of air of any 10.4 Concept of biome and their
velocity from a particular direction. The two distribution
main causes are differential heating between Biomes are large regions of earth that
the equator and the poles and the rotation have similar or common vegetation and
of the planet (Coriolis effect).  Wind helps to climatic conditions. They play a crucial role
transport pollen grains, seeds, and even flight in sustaining life on Earth. They are defined
by their soil, climate, flora and fauna. Biomes
of birds. While it is the source of wind energy,
have distinct biological communities that
it also causes erosion. Wind speed is measured
have been formed in response to a shared
with an Anemometer.
physio-chemical climate. Biomes are seen to
even spread across continents. Thus, it can be
Humidity observed that a biome is a broader term than
Moisture in the form of invisible vapor habitat. Any biome can comprise a variety of
in the atmosphere is called humidity. which habitats. Factors such as temperature, light,
is generally expressed in terms of absolute water availability determine what type of
humidity, relative humidity or specific humidity. organisms and adaptations are observed in a
Absolute humidity is the total mass of water biome (Fig. 10.4).
vapour present in a given volume or mass of air.
It does not take temperature into consideration.

Organisms and populations 176

TN_GOVT_XII_ Bio Zoology_chapter10.indd 176 25-02-2019 19:22:07


www.asiriyar.net

Tropical Rain Forest


Temperate Forest
Desert
Tundra
Taiga (Boreal forest)
Grassland
Savana / Tropical Grassland
Freshwater
Marine
Ice

Fig. 10.4 Biomes and their geographical distribution

Aquatic Biomes: They occupy about 71% of the


biosphere. The aquatic biome is home to millions of
$UFWLF
aquatic organisms like fishes. The climate of coastal
OG
&R

7XQGUD
zones are influenced by aquatic bodies (Fig. 10.6).
H

Aquatic biomes of earth


WXU

6XEDUFWLF
HUD
PS

7DLJD 1. Freshwater   (Lakes, ponds, rivers)


WH
LQJ

2. Brackish water   (Estuaries / Wetlands)


DV

7HPSHUDWH
FUH

7HPSHUDWH 7HPSHUDWH
3. Marine  (Coral reefs, pelagic zones and
'H

IRUHVW JUDVVODQG 'HVHUW


abyssal zones)
7URSLFDO
Terrestrial biomes
W
+R

5DLQIRUHVW 6DYDQQD 'HVHUW These are large communities of plants and


:HW
'HFUHDVLQJPRLVWXUH
'U\
animals that occupy a distinct region.  They
include grassland, tundra, desert, tropical
Fig. 10.5 Biomes can be broadly classified
rainforest, and deciduous and coniferous
as Aquatic biomes and Terrestrial biomes
forests. Terrestrial biomes are distinguished
Characters of a biome primarily by their predominant vegetation,
•• Location, Geographical position (Latitude, and are mainly determined by climate, which
Longitude) in turn, determines the organisms inhabiting
•• Climate and physiochemical environment them. These include the keystone species and
•• Predominant plant and animal life indicator species which are unique to their
•• Boundaries between biomes are not always respective biomes. The terrestrial biomes are a
sharply defined. Transition or transient source of food, O2 and act as CO2 sink, apart
zones are seen as in case of grassland and from the climate regulatory role (Fig. 10.7).
forest biomes (Fig. 10.5).

177 Organisms and populations

TN_GOVT_XII_ Bio Zoology_chapter10.indd 177 25-02-2019 19:22:08


www.asiriyar.net

Ocean Coral reefs Rivers Mangroves Lakes


Fig. 10.6 Aquatic Biomes

30◦N
Tropic of
Cancer
Equator
Tropic of
Capricom
30◦S

Tropical forest Savana Desert Chaparral Temperate grassland Tundra


Temperate broadleaf forest Northen conifores forest High mountains Polar ice
Fig. 10.7 The distribution of major terrestrial biomes
Major Biomes of the Earth •• Dwarf willows, birches, mosses, grasses,
Tundra biome, Taiga biome, Grassland sedges are the flora here.
biome, Alpine biome, Forest biome and Desert •• Reindeer, arctic hare, musk ox, lemmings
biome. are important Tundra herbivores. Some
important carnivores are the arctic fox,
TUNDRA BIOME arctic wolf, bobcat and snowy owl. Polar
•• This is the almost treeless plain in the bears live along coastal areas.
northern parts of Asia, Europe and North
America. •• Because of the severe winters, many of the
animals are migratory. For example, the many
•• Winters are long with little daylight,
shore birds and waterfowl such as ducks and
Summers are short, with long daylight
geese, nest in the Tundra during the summer
hours.
and migrate south for the winter.
•• Precipitation is less than 250 mm per year.
It is a zone of permafrost.

Organisms and populations 178

TN_GOVT_XII_ Bio Zoology_chapter10.indd 178 25-02-2019 19:22:08


www.asiriyar.net

hare and predatory pine martens. Important


Historically biomes are predators include the timber wolf, grizzly bear,
known to move as climate black bear, bobcat and wolverines (Fig. 10.8).
changes. A classic example
is the Sahara Desert, which
years ago was supposed to
be a lush landscape with river flowing
through it. Accordingly, appropriate
fauna like Hippos, Giraffes, Crocodiles
lived amid abundant trees. Over course
of time the climate dried out. It has now
become the planets largest desert. The Fig. 10.8 Taiga biome
animals have migrated out to adjacent GRASSLAND BIOME
regions with more favourable conditions. •• Grasslands occur in temperate and in the
 (Source: National Geography) tropical regions.
•• They have hot summers, cold winters, and
Characteristics of Tundra: irregular rainfall.
••Extremely cold climate •• Often they are characterized by high winds.
••Low biotic diversity •• The low irregular rainfall is the factor which
makes the difference between a temperate
••Simple vegetation structure
deciduous forest and a temperate grassland.
••Limitation of drainage
•• Herbivores like antelope, bison, wild horse,
••Short season of growth and reproduction jack rabbit, ground squirrel and prairie dogs
••Energy and nutrients in the form of dead are abundant.
organic material •• Predators include coyotes, foxes, hawks and
snakes.
••Large population oscillations
•• In India, fauna of grasslands includes
TAIGA BIOME Elephant, Gaur, Rhino, Antelope.
•• The Taiga is 1300-1450 km wide zone south •• Flora of grasslands include purple needle
of the Tundra. grass, wild oats, foxtail, ryegrass and buffalo
•• This area has long and cold winters. grass (Fig. 10.9).
•• Summer temperature ranges from 10⁰ C to 21⁰ C.
•• Precipitation ranges about 380-1000 mm
annually.
•• The Taiga is a forest of coniferous trees such
as spruce, fir and pine. This is a major source
for the logging industry.
•• Important migratory herbivores include
moose, elk, deer and reindeer. Moose and
reindeer migrate to the Taiga for winter and to
the Tundra for summers. The common smaller Fig. 10.9 Grassland biome
mammals are herbivorous squirrels, snowshoe

179 Organisms and populations

TN_GOVT_XII_ Bio Zoology_chapter10.indd 179 25-02-2019 19:22:09


www.asiriyar.net

Alpine biome •• Precipitation is evenly distributed


•• The alpine zone (zone between timber line throughout the year with annual rainfall
and snow zone) includes in the descending exceeding 2000 mm.
order, a sub-snow zone immediately below •• Soil is nutrient-poor and acidic.
the snow zone, a meadow zone in the centre Decomposition is rapid and soils are subject
and a shrub zone which gradually merges to heavy leaching.
into the timber zone.
•• Tree canopy is multilayered and continuous,
•• The snow zone of Himalayas lies over allowing little light penetration.
5100m above mean sea level and alpine
zone exists at a height of 3600m. From an •• Flora is highly diverse: one square kilometer
ecological view point, the zone above the may contain as many as 100 different tree
limits of tree growth (timber line) exhibits species. Trees are 25-35 m tall, with buttressed
extreme environmental conditions which trunks and shallow roots, mostly evergreen,
greatly influence the biota of this region. with large dark green leaves. Common
vegetation are orchids, bromeliads, vines
•• Alpine zone of Himalayas is characterized
(lianas), ferns, mosses, and palms.
by sparseness of animal groups. Many
invertebrates of alpine zone are predatory •• They are characterized by the greatest
and occur in lakes, streams and ponds. diversity of fauna which includes birds, bats,
Among fishes, amphibians and vertebrates small mammals, and insects.
are totally lacking and reptilian fauna is Based on the seasonal distribution of rainfall,
greatly impoverished. the types of tropical forests are
•• Flora of alpines includes alpine phacelia,
•• Evergreen rainforest: no dry season.
bear grass, bristlecone pine, moss campion,
polylepis forest, pygmy bitterroot, and •• Seasonal rainforest: short dry period in a
wild potato. very wet tropical region.
•• Semi evergreen forest: longer dry season
Forest biomes (the upper tree storey consists of deciduous
Forest is a broad term used to describe trees, while the lower storey is still evergreen).
areas where there are a large number of trees
•• Moist/dry deciduous forest (monsoon): the
(Fig. 10.10). The forest biomes include a
length of the dry season increases further as
complex assemblage of different kinds of biotic
rainfall decreases (all trees are deciduous).
communities. The major forest biomes are the
Tropical forests and the Temperate forests. More than half of earth’s tropical forests
have already been destroyed.
Tropical forest
•• They occur near the equator (between
latitudes 23.5⁰ at north and 23.5⁰ at south).
•• The major characteristic of tropical forests is
their distinct seasons. Only two seasons are
present (rainy and dry). Winter is absent.
The length of daylight is about 12 hours and
varies little.
•• The average annual temperature ranges
between 20° C and 25° C. Fig. 10.10 Forest biome
Organisms and populations 180

TN_GOVT_XII_ Bio Zoology_chapter10.indd 180 25-02-2019 19:22:09


www.asiriyar.net

Temperate forest
Only scattered remnants of original
•• These forests occur in eastern North temperate forests remain today.
America, northeastern Asia and western
and central Europe. Desert biomes
•• Have well-defined seasons with a distinct •• Deserts cover about one fifth of the earth's
winter. Moderate climate and a growing surface and occur where rainfall is >500
season of 140-200 days during 4-6 frost- mm/year.
free months distinguish temperate forests. •• Rainfall is usually very low and/or
•• Annual temperature varies from -30° C to concentrated in short bursts between
30° C. long rainless periods. Evaporation rates
•• Precipitation (750-1500 mm) is distributed regularly exceed rainfall rates.
evenly throughout the year. •• Soils are course-textured, shallow, rocky
•• Soil is fertile, enriched with decaying litter. or gravely with good drainage and have no
subsurface water. The finer dust and sand
•• Canopy is moderately dense and
particles are blown elsewhere, leaving
allows light to penetrate, resulting in
heavier pieces behind. Sand dunes are
well-developed and richly diversified
common.
understorey vegetation and stratification
of animals. •• Mean annual temperatures range from
20-25° C. The extreme maximum ranges
•• Flora is characterized by 3-4 tree species
from 43.5 - 49° C. Minimum temperatures
per km2. Trees have broad leaves that are
sometimes drop to -18° C. Based on the
lost annually such as oak, hickory, beech,
temperature range, deserts can be Hot
hemlock, maple, basswood, cottonwood,
deserts and Cold deserts.
elm, willow, and spring-flowering herbs.
•• Hot deserts such as the Sahara of North
•• Fauna consists of squirrels, rabbits, skunks, Africa and the deserts of the southwestern
birds, deer, mountain lion, bobcat, timber U.S., Mexico, Australia and India (Thar
wolf, fox, and black bear. desert) occur at low latitudes.
Based on seasonal distribution of rainfall, the •• Hot deserts have a considerable amount
types of temperate forests are of specialized vegetation (xerophytes),
•• Moist conifer and evergreen broad-leaved aloe, agave, Opuntia species, Euphorbia
forests: wet winters and dry summers. royleana as well as specialized vertebrate
•• Dry conifer forests: dominate higher and invertebrate animals.
elevation zones; low precipitation. •• Soils often have abundant nutrients
because they need only water to become
•• Mediterranean forests: precipitation is
very productive and have little or no
concentrated in winter (<1000 mm /year).
organic matter.
•• Temperate coniferous forests: mild
•• Only animals which can tap available water
winters, high annual precipitation (> 2000
or capable of storing sufficient water and
mm /year).
withstand the heat can survive in the desert.
•• Temperate broad-leaved rainforests: The animals include small nocturnal (active
mild, frost-free winters, high precipitation at night) carnivores. The dominant animals
(> 1500 mm/year), evenly distributed
throughout the year.

181 Organisms and populations

TN_GOVT_XII_ Bio Zoology_chapter10.indd 181 25-02-2019 19:22:09


www.asiriyar.net

are burrowers and have cursorial, fossorial is between -2° C and 4° C and the mean
and saltatorial adaptations. summer temperature is between 21° C and
•• The animals stay inactive in protected 26° C.
hideaways during the hot day and come •• Winters receive quite a bit of snow. The
out to forage at dusk, dawn or at night, mean annual precipitation ranges from 150-
when the desert is cooler. 250 mm.
•• The dominant animals of warm deserts are •• The soil is heavy, silty and salty.
reptiles and small mammals. The Indian
Spiny-tailed lizard, the  blackbuck, the •• Widely distributed animals are jack rabbits,
white-footed  fox are the common fauna kangaroo rats, kangaroo mice, pocket mice,
of the Thar deserts. There are also insects, grasshopper mice, antelope and ground
arachnids and birds (Fig. 10.11). squirrels.

10.5 Responses To Abiotic Factors


Every living organism responds to
its environment. There are various ways
by which organisms respond to abiotic
conditions. Some organisms can maintain
constant physiological and morphological
conditions or undertake steps to overcome
Fig. 10.11 Desert biome the environmental condition, which in itself
is a response (Fig. 10.12).
Rainfall is lowest in
the Atacama Desert of &RQIRUPHUV
Chile, where it averages 5HJXODWRUV
3DUWLDOUHJXODWRUV
less than 15 mm. Some
,QWHUQDOOHYHO

years are even rainless.


Inland Sahara also receives less than
15 mm rainfall a year. Rainfall in
American deserts is higher — almost
280 mm a year.

•• Cold deserts are characterized by cold ([WHUQDOOHYHO


winters with snowfall and high overall Fig. 10.12 Organisms’ response to
rainfall throughout the winter and environmental stressors
occasionally over the summer. The types of responses observed are
•• They occur in the Antarctic, Greenland •• Regulate: Some organisms are able to
and the Nearctic realm, parts of USA and maintain homeostasis by physiological
in parts of western Asia and the Ladakh means which ensures constant body
region in India. temperature, ionic / osmotic balance.
•• They have short, moist, and moderately Birds, mammals and a few lower vertebrate
warm summers with fairly long, cold and invertebrate species are capable of such
winters. The mean winter temperature regulation.

Organisms and populations 182

TN_GOVT_XII_ Bio Zoology_chapter10.indd 182 25-02-2019 19:22:09


www.asiriyar.net

•• Conform: Most animals cannot maintain to survive freezing climates. Some of the
a constant internal environment. Their most attractive adaptations in nature occur
body temperature changes with the for reasons of crypsis (e.g. camouflage) and
ambient temperature. In aquatic animals mimicry. Cryptic animals are those which
like fishes, the osmotic concentration of camouflage perfectly with their environment
the body fluids changes with that of the and are almost impossible to detect. Certain
ambient water osmotic concentration. Such reptiles and insects such as chameleons and
animals are called Conformers. In case of stick insects show this type of adaptation,
extreme condition, the inhabitants relocate which helps in prey capture or to evade from
themselves as in migration. predators. Likewise, horse legs are suitable
•• Migrate: Organisms tend to move away for fast running and adapted for grasslands
temporarily from a stressful habitat to a and similar terrestrial environments.
new, hospitable area and return when the
stressful period is over. Birds migrate from b) Behavioural adaptations
Siberia to Vedanthangal in Tamilnadu to Action and behaviour of animals are
escape from the severe winter periods. instinctive or learned. Animals develop certain
behavioural traits or adaptations for survival.
•• Suspend: In certain conditions, if the
Fleeing from a predator, hiding during sleep,
organisms is unable to migrate, it may avoid
seeking refuge from climate change or moving
the stress by becoming inactive. This is seen
to find different food sources are all behavioral
commonly in bears going into hibernation
adaptations. The two most characteristic forms
during winter. Some snails and fish go
of behavioral adaptations are migration and
into aestivation to avoid summer related
courtship. Migration allows the animals to find
problems like heat and desiccation. Some
better resources or evade threat. Courtship is
lower animals suspend a certain phase of their
a set of behavioral patterns to find a mate to
life cycle, which is referred to as diapause.
reproduce. Most nocturnal animals remain
underground or inactive during daytime. This
10.6 Adaptations
is a modification of their feeding and activity
In biology, adaptation is a
pattern or habit or behaviour.
dynamic evolutionary process
that fits  organisms  to their
environment and enhancing Ethology is the scientific study of animal
their  evolutionary fitness. behaviour, under natural conditions.
Adaptations can be a  phenotypic  or  adaptive
trait with a functional role in each individual c) Physiological adaptations
organism that is maintained and has These are adaptations of organisms
been evolved by natural selection. The adaptive that help them to live and survive in their
traits may be structural adaptation, behavioural environment with unique niches. Example:
adaptation and physiological adaptation. Lions have sharp canines to hunt and tear
meat and a digestive system suitable for
a) Structural adaptations
digesting raw meat. The two most well-known
The external and internal structures of
physiological adaptations are hibernation and
animals can help them to adapt better to their
aestivation. These are two different types of
environment. Some of the most common
examples are mammals growing thicker fur inactivity where the metabolic rate slows down

183 Organisms and populations

TN_GOVT_XII_ Bio Zoology_chapter10.indd 183 25-02-2019 19:22:09


www.asiriyar.net

so much that the animal can survive without 4. Some animals obtain their water
eating or drinking. Aquatic medium and requirement from food as partial
terrestrial habitats have their own respective replacement of water lost through
environmental conditions. Hence organisms excretion.
have to evolve appropriate adaptations to select 5. Birds make nests and breed before the
suitable habitats and niches. rainy season as there is availability of
abundant food. But during drought
Adaptations of aquatic animals birds rarely reproduce.
1. The pectoral fins and dorsal fins act as 6. Camels are able to regulate water
stabilizers or balancers and the caudal effectively for evaporative cooling
fin helps in changing the direction as a through the skin and respiratory system
rudder. and excrete highly concentrated urine,
2. Arrangement of body muscles in the and can also withstand dehydration up
form of bundles (myotomes) help in to 25% of their body weight.
locomotion. 10.7 Populations
3. Stream lined structure helps in the swift Population is defined
movement of the animals in water. as any group of organisms
4. Respiration by gills making use of gases of the same species which
dissolved in water. can interbreed among
5. Presence of air-bladders filled with air themselves, and occupy a particular space
for buoyancy. and function as part of a biotic community.
6. Presence of lateral-line system. They A population has various properties like
function as rheoreceptors which is population density, natality (birth rate),
helpful in echolocating objects in water. mortality (death rate), age distribution, biotic
7. Integuments rich in mucous glands are potential, dispersion and ‘r’, ‘K’ selected
protected by scales. growth forms. A population possesses genetic
8. Maintain water and ionic balance in its characteristics that are directly related to
body with excretory structures. their adaptiveness, reproductive success, and
persistence in their habitats over time. Life
Adaptations of terrestrial animals history of an organism is an important part
1. Earthworms, land Planarians secrete a of this attribute. The population has a definite
mucus coating to maintain a moist situation structure and function that can be described
for burrowing, coiling, respiration, etc., with reference to time.
2. Arthropods have an external covering
over the respiratory surfaces and well- 10.8 Population Attributes
developed tracheal systems.
Population density
3. In vertebrate skin, there are many
cellular layers besides the well protected The density of a population refers to
respiratory surfaces that help in its size in relation to unit of space and time.
preventing loss of water. Population density is the total number of that
species within a natural habitat. The size of

Organisms and populations 184

TN_GOVT_XII_ Bio Zoology_chapter10.indd 184 25-02-2019 19:22:09


www.asiriyar.net

the population can be measured in several Birth rate (b) = number of birth per unit time
ways, including abundance (absolute number average population
in population), numerical density (number Mortality
of individuals per unit area (or) volume) and Mortality is the population decline
biomass density (biomass per unit area (or) factor and is oppposite to natality. Mortality
volume). The population density of a species can be expressed as a loss of individuals in
can also be expressed with reference to the unit time or death rate. Generally, mortality
is expressed as specific mortality, that is, the
actual area of habitat available to the species
number of members of an original population
(ecological density - Table 10.1). When the size
dying after the lapse of a given time. The crude
of individuals in the population is relatively death rate of a population can be calculated
uniform then density is expressed in terms of by the equation.
number of individuals (numerical density).
Death rate (d)= number of deaths per unit time
average population
Natality
Populations increase because of The rate of mortality (death) is determined
natality. Natality is equivalent to birth rate by density. Mortality is high at high density
because of the hazards of overcrowding,
and is an expression of the production of new
increased predation and spread of disease.
individuals in the population by birth, hatching,
Mortality rates vary among species and
germination (or) fission. The two main aspects of
are correlated and influenced by a number
reproduction, namely fertility and fecundity play
of factors such as destruction of nests, eggs
a significant role in a population. Natality rate
or young by storms, wind, floods, predators,
may be expressed in crude birth rate number of
accidents and desertion by parents.
organisms born per female per unit time.

Table 10.1 Indices of density

S.No. Indices of Density Keys

It is usually expressed as the number of individuals per unit


1 Population density
area or volume. Eg.100 trees per acre

It is the size of a population in relation to the numbers per unit


2 Crude density
of total space. Eg.1000 fish in a pond.
It is the size of a population in relation to the numbers per
unit of habitat space. (Available area or volume that can be
3 Ecological density
colonized by a population). Eg. 1000 fish in the volume of
water in the pond.
These are time relative indices which can show the changes in
number (increase and decrease) with respect to time. Number
4 Relative abundance
of birds of a species spotted per hour in an unit area over a
specified time.

185 Organisms and populations

TN_GOVT_XII_ Bio Zoology_chapter10.indd 185 25-02-2019 19:22:09


www.asiriyar.net

$JH'LVWULEXWLRQ
$JHVWUXFWXUH

3RVWUHSURGXFWLYHDJH

5HSURGXFWLYHDJH

3UHUHSURGXFWLYHDJH

,QFUHDVLQJSRSXODWLRQ 6WDEOHSRSXODWLRQ 'HFUHDVLQJSRSXODWLRQ

Fig. 10.13 Age distribution pyramids

Population Dispersion Both emigration and immigration are


Populations have a tendency to disperse initiated or triggered by weather and other
or spread out in all directions, until some abiotic and biotic factors.
barriers are reached. This is observed by the
migration of individuals into (Immigration)
10.9 Population Age Distribution
or out (Emigration) of the population area. The proportion of the age groups
(pre- reproductive, reproductive and post
Migration reproductive) in a population is its age distribution
Migration is a peculiar and unique kind of attribute. This determines the reproductive status
mass population movement from one place to of the population at the given time and is an
another and back. To avoid the severe winter indicator of the future population size.
cold, Siberian cranes migrate from Siberia
to Vedanthangal in Tamil Nadu and return Usually a rapidly growing population will
back in spring. Some fishes are known to have larger proportion of young individuals. A
migrate from sea to fresh water (anadromous stable population will have an even distribution
migration, Salmon) and some from fresh of various age classes. A declining population
water to sea (catadromous migration, Eel). tends to have a larger proportion of older
individuals (Fig. 10.13).
Emigration
Under natural conditions, emigration 10.10 Growth Models / Curves
usually occurs when there is overcrowding. This Populations show characteristic growth
is regarded as an adaptive behavior that regulates patterns or forms. These patterns can be plotted
the population in a particular site and prevents and termed as J-shaped growth form and
over exploitation of the habitat. Further, it leads S-shaped growth form (Sigmoid form).
to occupation of new areas elsewhere.
J shaped growth form:
Immigration When a population increases rapidly in an
It leads to a rise in population levels. If exponential fashion and then stops abruptly due
the population increases beyond the carrying to environmental resistance or due to sudden
capacity, it can result in increased mortality appearance of a limiting factor, they are said
among the immigrants or decreased to exhibit J-shaped growth form. Many insects
reproductive capacity of the individuals. show explosive increase in number during the

Organisms and populations 186

TN_GOVT_XII_ Bio Zoology_chapter10.indd 186 25-02-2019 19:22:09


www.asiriyar.net

rainy season followed by their disappearance at Table 10.2 Differences between r- selected
the end of the season (Fig. 10.14). and K selected species
Biotic Environmental Carrying r selected species K selected species
potential resistance capacity
Smaller sized Larger sized
organisms organisms
Population

Produce many Produce few


offspring offspring
J curve S curve
Late maturity with
Mature early extended parental
care
0
Time Short life
Long life expectancy
Fig. 10.14 J shaped and S shaped expectancy
growth curves
Each individual Can reproduce
reproduces only more than once in
Biotic potential once or few times in lifetime
It is the maximum reproductive their life time
capacity of an organism under optimum Most individuals
environmental conditions. Only few reach
reach maximum life
Carrying capacity adulthood
span
The maximum number of organism that
a region can support without environmental Unstable
Stable environment,
degradation is called carrying capacity. environment,
density dependent
Environmental resistance density independent
Is the sum total of the environmental
limiting factors, both biotic and abiotic, 10.11 Population Regulation
which together act to prevent the biotic
The inherent tendency of all animal
potential of an organism from being realized.
populations is to increase in number. But it does
not increase indefinitely. Once the carrying
capacity of the environment is reached,
S-Shaped growth form (sigmoid population numbers remain static or fluctuate
growth) depending on environmental conditions. This is
Some populations, as in a population of regulated by many factors which are
small mammals, increase slowly at first then 1. Density independent – Extrinsic factors
more rapidly and gradually slow down as 2. Density dependent - Intrinsic factors
environmental resistance increases whereby
Extrinsic factors include availability of space,
equilibrium is reached and maintained. Their shelter, weather, food, etc. Intrinsic factors
growth is represented by S shaped growth include competition, predation, emigration,
curve. immigration and diseases.

187 Organisms and populations

TN_GOVT_XII_ Bio Zoology_chapter10.indd 187 25-02-2019 19:22:09


www.asiriyar.net

Table 10.3 Analysis of two species population interactions


SN. TYPES OF SPECIES SPECIES GENERAL NATUE OF EXAMPLES
NO. INTERATION 1 2 INTERACTION
1 Amensalism -- 0 The most powerful animal or Cat and Rat
large organisms inhibits the
growth of other lower organisms
2 Mutualism + + Interaction favorable to both Between
and obligatory crocodile and
bird
3 Commensalism + 0 Population 1, the commensal Sucker fish on
benefits, while 2 the host is not shark
affected
4 Competition -- -- Direct inhibition of each species Birds compete
by the other with squirrels
for nuts and
seeds.
5 Parasitism + -- Population 1, the parasite, Ascaris and
generally smaller than 2, the host tapeworm
in human
digestive tract.
6 Predation + -- Population 1, the predator, Lion predatory
generally larger than 2, the prey on deer
10.12 Population Interaction Summary
Organisms belonging to different
Ecology is the study of the relationships
populations interact for food, shelter, mating
of living organisms with the abiotic and
or for other necessities. Interaction may be
biotic components of their environment.
intra specific (interaction within the members
Temperature, Light, Water, Soil, Humidity,
of same species) or inter specific (among
Wind and Topographic factors are the important
organisms of different species).
physical components of the environment to
Intra specific association is observed for all which the organisms are adapted in various
livelihood processes like feeding, territoriality, ways. Maintenance of a constant internal
breeding and protection. environment by the organisms contributes to
Interspecific associations or interactions optimal performance, but only some organisms
can be: (regulators) are capable of homeostasis in the
Neutral: where different species live together fact of changing external environment. Others
but do not affect each other. simply conform. Many species have evolved
Positive: it is a symbiotic relationship in which adaptations to avoid unfavourable conditions in
no organism in association is harmed and either space or in time.
one or both may be benefitted. It is of two types Population ecology is an important area of
– Mutualism and Commensalism. ecology. A population is a group of individuals
Negative: One or both of the interacting of a given special sharing or competing for
organisms will be affected as in case of similar resources in a defined geographical
competition, predation, parasitism. area. Populations have attributes that individual
organisms do not, such as natality and bortality,
sex ratio and age distribution. The proportion

Organisms and populations 188

TN_GOVT_XII_ Bio Zoology_chapter10.indd 188 25-02-2019 19:22:09


www.asiriyar.net

of different age groups of males and females 5. Competition between species leads to
in a population is often presented graphically a) Extinction b) Mutation
as age pyramid, its shape indicated whether a c) Amensalism d) Symbiosis
population is stationary, growing or declining.
6. Which of the following is an r-species
Ecological effects of any factors on a
a) Human b) Insects
population are generally reflected in population
density. Population grow through births and c) Rhinoceros d) Whale
immigration and decline through deaths and 7. Match the following and choose the correct
emigration. When resources are unlimited, combination from the options given below.
the growth is usually exponential but when
Column I Column II
resources become progressively limiting the
A. Mutalism 1. Lion and deer
growth pattern turns logistic. In either case,
growth is ultimately limited by the carrying B. Commensalism 2. Round worm and man
capacity of the environment. The intrinsic rate C. Parasitism 3. Birds compete with
of natural increase is a measure of the inherent squirrels for nuts
potential of a population to grow. D. Competition 4. Sea anemone on hermit
crab
Population of the same or different species
in a habitat do not live in isolation but interact E. Predation 5. Bernacles attached to
in many ways. These interactions may be intra Whales.
specific or interspecific. They may be positive, Dispersal
negative or neutral in nature. a) A- 4, B-5, C-2, D –3, E-1
b) A- 3, B-1, C-4, D – 2, E-5
Evaluation: c) A- 2, B-3, C-1, D – 5, E-4
1. All populations in a d) A- 5, B-4, C-2, D – 3, E-1
given physical area are 8. The figure given below is a diagrammatic
defined as representation of response of organisms
a) Biome b) Ecosystem to abiotic factors. What do A, B and C
c) Territory d) Biotic factors represent respectively.

2. Organisms which can survive a wide range


of temperatuer are called
$
a) Ectotherms b) Eurytherms
,QWHUQDOOHYHO

c) Endotherms d) Stenotherms %
3. The interaction in nature, where one gets &
benefit on the expense of other is...
a) Predation b) Mutualism
c) Amensalism d) Commensalism
([WHUQDOOHYHO
4. Predation and parasitism are which type of
interactions?
a) (+,+) b) (+, O)
c) (--, --) d) (+, --)

189 Organisms and populations

TN_GOVT_XII_ Bio Zoology_chapter10.indd 189 25-02-2019 19:22:10


www.asiriyar.net

S. A B C a) Conform b) Regulate
No. c) Migrate d) Suspend.
a. Conformer Regulator Partial 14. What is a Habitat?
Regulator 15. Define ecological niche.
b. Regulator Partial Conformer 16. What is Acclimatisation?
Regulator 17. What is Pedogenesis?
18. What is Zero Stress?
c. Partial Regulator Conformer
Regulator 19. What is soil permeability?
20. Differentiate between Eurytherms and
d. Regulator Conformer Partial Stenotherms.
Regulator
21. Explain hibernation and aestivation with
examples.
9. The relationship between sucker fish and
22. Give the diagnostic characters features of
shark is...........
a Biome?
a) Competition b) Commensalism
23. Classify the aquatic biomes of Earth.
c) Predation d) Parasitism.
24. What are the ways by which organisms
10. What type of human population is respond to abiotic factors?
represented by the following age pyramid? 25. Classify the adaptive traits found in
organisms.
$JH'LVWULEXWLRQ
$JHVWUXFWXUH

26. Differentiate Natality and Mortality.


3RVWUHSURGXFWLYHDJH

27. Differentiate J and S shaped curve.


5HSURGXFWLYHDJH

3UHUHSURGXFWLYHDJH 28. Give an account of population regulation.


,QFUHDVLQJSRSXODWLRQ 6WDEOHSRSXODWLRQ 'HFUHDVLQJSRSXODWLRQ

29. What is ecological density, crude density


a) Vanishing population
and population density?
b) Stable population
30. Give an account of the properties of soil.
c) Declining population
31. Differentiate between Tundra and Taiga
d) Expanding population Biomes.
11. Which of the following is correct for 32. List the adaptations seen in terrestrial
r-selected species animals.
a) L arge number of progeny with small size 33. Describe Population Age Distribution.
b) large number of progeny with large size 34. Describe Growth Models/Curves.
c) small number of progeny with small size
d) small number of progeny with large size
12. Animals that can move from fresh water
to sea called as.....
a) Stenothermal b) Eurythermal
c) Catadromous d) Anadromous
13. Some organisms are able to maintain
homeostasis by physical means ...

Organisms and populations 190

TN_GOVT_XII_ Bio Zoology_chapter10.indd 190 25-02-2019 19:22:10


2UJDQLVPDQG
3RSXODWLRQ

TN_GOVT_XII_ Bio Zoology_chapter10.indd 191


2UJDQLVP 3RSXODWLRQ

+DELWDWDQG 5HVSRQVHWR 3RSXODWLRQ 3RSXODWLRQ 3RSXODWLRQ 3RSXODWLRQ


$ELRWLFIDFWRUV %LRPH $GDSWDWLRQ
QLFKH DELRWLFIDFWRUV DWWULEXWHV JURZWKFXUYHV UHJXODWLRQ LQWHJUDWLRQ

- 'HQVLW\
7HPSHUDWXUH 7XQGUD &RQIRUP 0RUSKRORJLFDO 'HQVLW\ 0XWXDOLVP
JURZWKFXUYHV GHSHQGHQW

6 'HQVLW\
/LJKW 7DLJD 5HJXODWH 3K\VLRORJLFDO 1DWDOLW\ JURZWKFXUYHV &RPPHQVDOLVP
LQGHSHQGHQW

6RLO *UDVVODQG 0LJUDWH %HKDYLRXU 0RUWDOLW\ &RPSHWLWLRQ

:DWHU )RUHVW 6XVSHQG (PLJUDWLRQ 3DUDVLWLVP

$WPRVSKHULF
'HVHUW ,PPLJUDWLRQ 3UHGDWLRQ
KXPLGLW\

7RSRJUDSKLF
0LJUDWLRQ
IDFWRU

191 Organisms and populations

25-02-2019 19:22:10
www.asiriyar.net
www.asiriyar.net

ICT CORNER
Organisms and Population

How the fermentation takes place?


Lets us experiment it virtually

Procedure :
Step:-1: Type the URL or scan the QR code to open the activity page.
Step: -2 Click “Background Information” to know the general on “Population Genetics”.
Step:-3 Click “Tutorial” to learn the steps that aligned with the “experiment”.
Step – 4: Click “Run Experiments” on home page to test the experiment by altering the
variables under various parameters.

Step 1 Step 2 Step 3

Step 4

Organisms and Population URL:


http://virtualbiologylab.org/ModelsHTML5/PopGenFishbowl/
PopGenFishbowl.html

*Pictures are indicative only


*Allow flash player

Organisms and populations 192

TN_GOVT_XII_ Bio Zoology_chapter10.indd 192 25-02-2019 19:22:12


www.asiriyar.net

11
UNIT - V

Biodiversity and
its conservation
CHAPTER
Nilgiri tahr is an endangered species in the
IUCN Red List of Threatened Species
due to hunting and poaching
Chapter outline

A
11.1 Biodiversity
wide variety of living organisms including
11.2 Importance of biodiversity – Global plants, animals and micro-organisms with
and India whom we share this planet earth makes the world
11.3 Biogeographical regions of India a beautiful place to live in. Living organisms exist
almost everywhere from mountain peaks to the
11.4 Threats to biodiversity
ocean depths; from deserts to the rainforests.
11.5. Causes of Biodiversity Loss They vary in their habit and behaviour, shape,
11.6 IUCN size and colour. The remarkable diversity of
living organisms forms an inseparable and
11.7 Biodiversity and its conservation significant part of our planet, however, the ever
increasing human population is posing serious
threats to bio-diversity. In this chapter, we shall
discuss biodiversity – concepts, levels, magnitude
Learning objectives
and patterns, importance of biodiversity,
biogeographical regions of India, threats to
➢➢ Acquire knowledge about concept, biodiversity, causes of biodiversity loss, extinction,
level and patterns of biodiversity. and biodiversity conservation.
➢➢ Appreciate the magnitude
of India’s biodiversity. 11.1 Biodiversity
➢➢ Understand The 1992 UN Earth Summit defined
biogeographical regions Biodiversity as the variability among living
and resources of India. organisms from all sources, including
terrestrial, marine and other aquatic ecosystems
➢➢ Gain insight into the
and the ecological complexes of which they are
threats to biodiversity.
a part. This includes diversity within species,
➢➢ Understand the reasons/causes and between species and ecosystems of a region.
effects of extinction. It reflects the number of different organisms
and their relative frequencies in an ecological
system and constitutes the most important
functional component of a natural ecosystem.

193

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 193 25-02-2019 19:23:01


www.asiriyar.net

It helps to maintain ecological processes, Genetic diversity

create soil, recycle nutrients, influence climate,


degrade waste and control diseases. It provides
an index of health of an ecosystem.The survival
of human race depends on the existence and
wellbeing of all life forms (plants and animals) Genetic diversity in a whole population
in the biosphere.
Species diversity

11.1.1 Concept of biodiversity


The term biodiversity was introduced
by Walter Rosen (1986). Biodiversity is the
assemblage of different life forms. Each species
is adapted to live in its specific environments. Species diversity in a
coastal redwood ecosystem
The changes in climatic conditions are
reflected in the distribution and pattern of Ecosystem diversity
biodiversity on our planet. The number of
species per unit area declines as we move
from tropics towards the poles. The Tundra
and Taiga of northern Canada, Alaska,
northern Europe and Russia possess less than
12 species of trees. The temperate forests of Community and
the United states have 20-35 species of trees, ecosystem diversity
across the landscape
while the tropical forests of Panama have over of an entire region

110 species of trees in a relatively small area. Fig. 11.1 Three levels of biodiversity
formation of different races, varieties and
11.1.2 Levels of biodiversity subspecies. Rouwolfia vomitaria, a medicinal
Edward Wilson popularized the term plant growing in different ranges of the
‘Biodiversity’ to describe diversity at all levels Himalayas shows differences in the potency
of biological organization from populations to and concentration of the active ingredient
biomes. There are three levels of biodiversity reserpine due to genetic diversity. Genetic
– Genetic diversity, Species diversity and diversity helps in developing adaptations to
Community/Ecosystem diversity (Fig. 11.1). changing environmental conditions.
Genetic diversity refers to the differences Species diversity refers to the variety
in genetic make-up (number and types of genes) in number and richness of the species in any
between distinct species and to the genetic habitat. The number of species per unit area at
variation within a single species; also covers a specific time is called species richness, which
genetic variation between distinct populations denotes the measure of species diversity. The
of the same species. Genetic diversity can Western Ghats have greater amphibian species
be measured using a variety of molecular diversity than the Eastern Ghats. The more the
techniques. India has more than 50,000 genetic number of species in an area the more is the
variants of Paddy and 1000 variants of Mango. species richness (Fig. 11.1a).The three indices
Variation of genes of a species increases with of diversity are - Alpha, Beta and Gamma
diversity in size and habitat. It results in the diversity

Biodiversity and its conservation 194

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 194 25-02-2019 19:23:01


www.asiriyar.net

i. Alpha diversity: It is measured by counting described. Each year about 10-15 thousand
the number of taxa (usually species) within new species are identified and published
a particular area, community or ecosystem. worldwide, of which 75% are invertebrates. The
ii. 
B eta diversity: It is species diversity number of undescribed species is undoubtedly
between two adjacent ecosystems and is much higher.
obtaining by comparing the number of India is very rich in terms of biological
species unique to each of the ecosystem. diversity due to its unique bio-geographical
iii. Gamma diversity refers to the diversity location, diversified climatic conditions and
of the habitats over the total landscape or enormous eco-diversity and geo-diversity.
geographical area. According to world biogeographic classification,
iii. Gamma diversity: It refers to the diversity India represents two of the major realms
of the habitats over the total landscape or (The Palearctic and Indo-Malayan) and three
geographical area. biomes (Tropical humid forests, Tropical Dry/
Deciduous forests and Warm Deserts/Semi
deserts). With only about 2.4% of the world’s
total land surface, India is known to have over
8 % of the species of animals that the world
holds and this percentage accounts for about
92,000 known species.
India is the seventh largest country in the
world in terms of area. India has a variety of
ecosystems, biomes with its varied habitats
like, hills, valleys, plateaus, sea shores,
Fig. 11.1a Species biodiversity
mangroves, estuaries, glaciers, grasslands
Community/Ecosystem diversity is the and river basins. It also reflects different
variety of habitats, biotic communities, and kinds of climates, precipitation, temperature
ecological processes in the biosphere. It is the distribution, river flow and soil. India is one
diversity at ecosystem level due to diversity of of the 17 mega biodiversity countries of the
niches, trophic levels and ecological processes world and has ten biogeographic zones with
like nutrient cycles, food webs, energy flow characteristic habitat and biota.
and several biotic interactions. India with its
alpine meadows, rain forests, mangroves,
"The world is currently undergoing a very
coral reefs, grass lands and deserts has one of
rapid loss of biodiversity comparable
the greatest ecosystem diversity on earth.
with the great mass extinction events
11.1.3 Magnitude of biodiversity that have previously occurred only
Biodiversity is often quantified as the five or six times in the earth's history."
number of species in a region at a given time. - World Wildlife Fund
The current estimate of different species on
earth is around 8-9 million. However, we really 11.1.4 Patterns of biodiversity
don’t know the exact magnitude of our natural distribution
wealth. This is called the ‘The Taxonomic The distribution of plants and animals
impediment’. So far about 1.5 million species of is not uniform around the world. Organisms
microorganisms, animals and plants have been require different sets of conditions for their

195 Biodiversity and its conservation

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 195 25-02-2019 19:23:01


www.asiriyar.net

optimum metabolism and growth. Within


this optimal range (habitat) a large number
and type of organisms are likely to occur,
grow and multiply. The habitat conditions are
determined by their latitudes and altitudes.
MSL.171.91m

Latitudinal and altitudinal gradients:


Temperature, precipitation, distance from the
equator (latitudinal gradient), altitude from sea
level (altitudinal gradient) are some of the factors
that determine biodiversity distribution patterns.
The most important pattern of biodiversity is Mean Sea Level (MSL) is an average
latitudinal gradient in diversity. This means level of the surface of one or more of Earth’s
that there is an increasing diversity from the oceans (or seas) from which heights such
poles to equator. Diversity increases as one as elevations may be measured.
moves towards the temperate zones and reaches As we travel by train we notice names
the maximum at the tropics. Thus, tropics
of stations on big yellow signboards
harbour more biodiversity than temperate or
on which is usually written how much
polar regions, especially between the latitudes
elevated that place is compared to MSL.
of 23.5⁰N and 23.5⁰S (Tropic of Cancer to the
For example, Erode junction is about 171
Tropic of Capricorn). Harsh conditions exist in
temperate areas during the cold seasons while meters above MSL.
very harsh conditions prevail for most of the year
in polar regions. • The temperatures vary between 25⁰C to
35⁰C, a range in which most metabolic
Columbia located near the equator (0⁰) has
activities of living organisms occur with
nearly 1400 species of birds while New York at
ease and efficiency.
41⁰N has 105 species and Greenland at 71⁰N
has 56 species. India, with much of its land area • The average rainfall is often more than 200
in the tropical latitudes, is home for more than mm per year.
1200 species of birds. Thus it is evident that the • Climate, seasons, temperature, humidity,
latitude increases the species diversity. photoperiods are more or less stable and
Decrease in species diversity occurs as encourage both variety and numbers.
one ascends a high mountain due to drop in • Rich resource and nutrient availability.
temperature (temperature decreases @ 6.5⁰ C
per Km above mean sea level) Species - Area relationships
The reasons for the richness of biodiversity German Naturalist and Geographer
in the Tropics are: Alexander von Humboldt explored the
• Warm tropical regions between the tropic wilderness of south American jungles and
of Cancer and Capricorn on either side of found that within a region the species richness
equator possess congenial habitats for living increased with increasing area but upto a
organisms. certain limit. The relationship between species
• Environmental conditions of the tropics are richness and area for a wide variety of taxa
favourable not only for speciation but also (angiosperm plants, birds, bats, freshwater
for supporting both variety and number of fishes) turned out to be the rectangular
organisms.
Biodiversity and its conservation 196

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 196 25-02-2019 19:23:01


www.asiriyar.net

hyperbola. On a logarithmic scale, the Tundra and the Polar ice caps. This variety
relationship is a straight line described by the (Biodiversity) is essential for the wellbeing of
equation. our planet and sustenance of life as a whole. The
log S = log C + Z log A importance of biodiversity can be viewed and
measured as
where
a) Ecosystem services b) Biological
S = Species richness
resources c) Social benefits of biodiversity
A = Area
Z = Slope of the line (regression The organization and functioning of
coefficient) ecosystems world over is effected and dependent
C = Y-intercept on biodiversity and its richness. The major
functional attributes are:
• continuity of nutrient cycles or
S=CAz
biogeochemical cycles (N2, C, H2O, P, S
cycles)
• soil formation, conditioning or maintenance
(S) Species richness

e
al of soil health (fertility) by soil microbial
sc
g diversity along with the different trophic
g -lo log S = log C + Z log A
lo members
• increases ecosystem productivity and
provide food resources
(A) Area (S) • act as water traps, filters, water flow
Fig. 11.2 Species - Area relationship on regulators and water purifiers (forest cover
log scale and vegetation)
Regression coefficient Z generally has • climate stability (forests are essential for
a value of 0.1-0.2 regardless of taxonomic rainfall, temperature regulation, CO2
group or region. However, in case of the absorption, which in turn regulate the
species – area relationship in very large areas density and type of vegetation)
like entire continents, the slope of the line • forest resource management and sustainable
appears to be much steeper (Z-value in the development
range of 0.6-1.2). For example, in case of the • maintaining balance between biotic
fruit eating (frugivorous) birds and mammals components
in the tropical forests of different continents,
• cleaning up of pollutants – microbes are the
the slope is found to be a steeper line of 1.15
biggest degraders of molecules including
(Fig 11.2).
many anthropogenic ones which are present
11.2 Importance of biodiversity – in effluents, sewage, garbage and agro-
chemicals
Global and India
Biodiversity is the variety of life on earth. • ecological stability – the varieties and richness
That is, it is the number of different species of species contribute to ecological stability
of flora and fauna including microorganisms. and survival of species. Biodiverse regions
These organisms can inhabit different are reservoirs of biological resources like
ecosystems with varying conditions like the food resources, gene pool, genetic resource,
Rainforests, Coral reefs, Grasslands, Deserts, medicinal resources, bio-prospecting

197 Biodiversity and its conservation

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 197 25-02-2019 19:23:01


www.asiriyar.net

• to provide unique aesthetic value and hot of biotic provinces and biomes and covers
spots for Ecotourism. Along with forest 7.2% of the country’s landmass. The
resources and wildlife it has commercial common fauna of the Himalayan ranges,
significance are the wild sheep, mountain goats, shrew,
• an indicator of the health of the ecosystem. snow leopard and panda, many of which
Endemism is a crucial indicator of are endangered.
richness. 3. Indian Desert: The extremely arid area
west of the Aravalli hill range, comprising
The interrelationship both the salty desert of Gujarat and the
and interdependence of sand desert of Rajasthan. It comprises
all living components 6.9% of the country’s land-mass. Wild
in a system can be seen ass is endemic to this region. It is also
from the example of the the habitat for the Indian Bustard, camel,
fruit bats of Guam (South East Asia). The foxes and snakes, many of which are
fruit bats are a delicacy here, and hence endangered.
their population has dwindled which is 4. Semi – Arid Zones: This zone is between
not surprising. What is surprising is that the desert and the Deccan plateau,
local fruit production has got affected including the Aravalli hill range covering
as it was identified that the bats served 15.6% of the country’s landmass. Fauna
as pollinators. Hence there is a need for found here are nilghai, blackbuck, four
conservation of diversity as that could horned antelopes, sambar, chital and
avert such situations. spotted deer which are herbivores along
with predators like Asiatic lion, tiger,
leopard and jackal.
11.3 Biogeographical regions of
5. Western Ghats: Western Ghats, are
India
mountain ranges along the west coast of
As per the international ‘biome’ type
India, extending over almost 1,500km
of classification based upon climate, fauna
from Sat Pena in south Gujarat to the
and flora and the soil conditions, India can
southernmost tip of Kerala. The annual
be divided into ten different biogeographic
rainfall is about 2000 mm. This zone has
zones, (Fig.11.3)namely:
large populations of Nilgiri tahr (State
1. Trans Himalayan Region: An extension animal of Tamil Nadu), Nilgiri Langur,
of the Tibetan plateau, high-altitude cold tiger, leopard, and Indian elephant.The
desert in Ladakh (J&K) and Lauhala Spiti grizzled squirrel and lion tailed macaque
(H.P) comprising 5.7% of the country’s are endemic to this region.
landmass. The mountains of this region
6. Deccan Peninsula: This covers much
have the richest wild sheep and goat
of the southern and south-central
community in the world, renowned for its
plateau with a predominantly deciduous
quality wool and wool products. Other
vegetation and 4.3% of the country’s
fauna include Chiru and Black-rocked
landmass. It is known for deciduous
Crane.
forests, thorn forests and pockets of semi
2. Himalayas: The entire mountain chain ever green forests. Fauna found here are
running from north-western to north- Chital, Sambhar, Nilghai, elephant, sloth
eastern India, comprising a diverse range

Biodiversity and its conservation 198

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 198 25-02-2019 19:23:01


www.asiriyar.net

Trans-Himalaya

Himalaya
Semi arid

Gangetic plains
Desert
North east

Deccan peninsula
Coastal

Western ghats

Island

Fig. 11.3 Biogeographical regions of India


bear, black buck and barking deer. It is the India are home to a wide variety of
catchment area of major Indian rivers like vegetation. With 5.2% of the country’s
Godavari, Tapti, Narmada and Mahanadi. landmass, this region represents the
7. Gangetic Plains: These plains are transition zone between the Indian,
relatively homogenously defined by the Indo-Malayan and Indo-Chinese bio-
Ganges river system and occupy about geographical regions and is the meeting
11% of the country’s landmass. This point of the Himalayan Mountains and
region is very fertile and extends up to peninsular India. The North-East is
the Himalayan foothills. Fauna includes thus the biogeographical ‘Gateway’ for
rhinoceros, elephant, buffalo, swamp much of India’s fauna and flora and also
deer, hog-deer. biodiversity hotspot (Eastern Himalaya),
which includes the Indian rhinoceros,
8. North-East India: The plains and non-
leopard and golden langur.
Himalayan hill ranges of north eastern

199 Biodiversity and its conservation

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 199 25-02-2019 19:23:02


www.asiriyar.net

9. Coastal Region: Coastal region of India larger areas to obtain the necessities of
with sandy beaches, mud flats, coral reefs, life - food, cover, mates than do smaller
mangroves constitutes 2.5% of the total mammals. Individual home range of Lion
geographical area. The coastline from can be about 100 square Km. Mammals have
Gujarat to Sundarbans is estimated to be specialized dietary needs such as carnivores,
5423km long. Apart from this a total of 25 frugivores and the need to forage over much
islets constitute the Lakshadweep, which larger areas than general dietary herbivores
are of coral origin and have a typical reef and omnivores. Mammals also have low
lagoon system, rich in biodiversity. The reproductive output other than small rodents.
fauna includes native crabs, turtles and
tunas 11.5 Causes of biodiversity loss
10. Andaman and Nicobar Islands:The The major causes for biodiversity decline are:
Andaman and Nicobar Islands in the
• Habitat loss, fragmentation and
Bay of Bengal have highly diverse set of
destruction (affects about 73% of all
biomes, constituting 0.3% of the total
species)
geographical area. They are centers of high
endemism and contain some of India’s • Pollution and pollutants (smog, pesticides,
finest evergreen forests and support a herbicides, oil slicks, GHGs)
wide diversity of corals. Fauna includes • Climate change
Narcondam hornbills of the Andamans • Introduction of alien/exotic species
and the South Andaman Krait. • Over exploitation of resources (poaching,
indiscriminate cutting of trees, over
11.4 Threats to biodiversity fishing, hunting, mining)
Even though India is one of the 17 identified • Intensive agriculture and aquacultural
mega diverse countries of the world, it faces lots practices
of threats to its biodiversity. • Hybridization between native and non-
Apart from natural causes, human native species and loss of native species
activities, both directly and indirectly are today’s • Natural disasters (Tsunami, forest fire,
main reason for habitat loss and biodiversity earth quake, volcanoes)
loss. Fragmentation and degradation due to • Industrialization, Urbanization,
agricultural practices, extraction (mining, infrastructure development, Transport –
fishing, logging, harvesting) and development Road and Shipping activity, communication
(settlements, industrial and associated towers, dam construction, unregulated
infrastructures) leads to habitat loss and tourism and monoculture are common area
fragmentation leads to formation of isolated, of specific threats
small and scattered populations and as • Co-extinction
endangered species.
Habitat Loss
Some of the other threats include
specialised diet, specialized habitat Development of human society is
requirement, large size, small population inevitable. Natural habitats are destroyed for
size, limited geographic distribution and the purpose of settlement, agriculture, mining,
high economic or commercial value. Large industries and construction of highways.
mammals by virtue of their size require As a result species are forced to adapt to the

Biodiversity and its conservation 200

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 200 25-02-2019 19:23:02


www.asiriyar.net

changes in the environment or move to other and decreased biodiversity in the habitat
places. If not, they become victim to predation, fragments. Animals requiring large territories
starvation, disease and eventually die or results such as mammals and birds are severely
in human animal conflict. affected. The elephant corridors and migratory
routes are highly vulnerable. The dwindling
Over population, urbanization,
of many well-known birds (sparrows) and
industrialization and agricultural advancements animals can be attributed to this.
require additional land, water and raw materials
every year. This is made possible only through
fragmentation or destruction of natural habitats Where are the Sparrows?
by filling wetlands, ploughing grasslands, Common Sparrows are going extinct
cutting down trees, forest, desilting rivers, because of mindless urbanization. They are
constructing transport ways, caving mountains, losing not just their natural habitats but also
extracting, ores, changing the course of rivers the essential human touch they need and
and filling of seashore. thrive upon. The population of sparrows
is dwindling due to the use of packed
The most dramatic example of habitat food, insecticides in farming and changing
loss comes from the tropical rainforests 14% of lifestyles, and match box-styled architecture
the earth’s land surface once covered by these resulting in an inadequate availability
tropical forests, is not more than 6% now. The of food and shelter for the birds. Unlike
Amazon rainforest, a vast area, harbouring pigeons that can make nests on ledges,
millions of species, also called “Lungs of the sparrows need cavities to build their nests.
planet”is destroyed and being replaced for
agriculture and human settlements. 90% of New
Over exploitation:
Zealand’s wetlands have been destroyed and
cleared for cultivating soya beans and raising We depend on nature for our basic needs
such as food and shelter. However, when
grass for beef cattle. Kodaikanal and Nilgiri
the need becomes greed, it leads to over
hills of Tamil Nadu have been destroyed rapidly
exploitation of natural resources. Excessive
for human occupancy. Loss of habitat results
exploitation of a species, reduces the size of
in annihilation of plants, microorganisms and
its population to such a level that it becomes
forcing out animals from their habitats. vulnerable to extinction. Dodo, passenger
pigeon and Steller’s sea cow have become
Habitat fragmentation
extinct in the last 200-300 years due to over
Habitat fragmentation is the process
exploitation by humans. Overfishing due to
where a large, continuous area of habitat is
population pressure leads to many marine fish
both, reduced in area and divided into two or
(populations) declining around the world.
more fragments. Fragmentation of habitats
like forest land into crop lands, orchard lands, Exotic species invasion:
plantations, urban areas, industrial estates, Exotic species (non-native; alien) are
transport and transit systems has resulted in the organisms often introduced unintentionally
destruction of complex interactions amongst or deliberately for commercial purpose, as
species, (food chain and webs) destruction of biological control agents and other uses. They
species in the cleared regions, annihilation of often become invasive and drive away the local
species restricted to these habitats (endemic) species and is considered as the second major

201 Biodiversity and its conservation

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 201 25-02-2019 19:23:02


www.asiriyar.net

cause for extinction of species. Exotic species inundation, less predictability of weather
have proved harmful to both aquatic and patterns, extreme weather conditions,
terrestrial ecosystems. outbreak of squalor diseases, migration of
Tilapia fish (Jilabi kendai) (Oreochromis animals and loss of trees in forest. Thus,
mosambicus) introduced from east coast of climate change is an imminent danger to the
South Africa in 1952 for its high productivity existing biodiversity (Fig 11.4).
into Kerala’s inland waters, became invasive,
due to which the native species such as Puntius Human
Anthropogenic Ecosystem
dubius and Labeo kontius face local extinction. GHG and Aerosol Services
Emissions
Amazon sailfin catfish is responsible for Land-use
Climate
Change
destroying the fish population in the wetlands Impacts

of Kolkata. The introduction of the Nile Perch, a Climate


Impacts
predatory fish into Lake Victoria in East Africa Climate
Climate
Biodiversity
Regulation
led to the extinction of an ecologically unique
assemblage of more than 200 nature species Ecosystem
Biogenic
of cichlid fish in the lake. GHG and Aerosol
Function
Emissions

African apple snail (Achatina fulica) is the Biogeochemical


Cycles
most invasive among all alien fauna in India.
Links between Biodiversity, Climate Change and Human Well-being
This mollusc was first reported in the Andaman Fig. 11.4 Links between biodiversity,
and Nicobar Islands. It is now found across the climate change and human well - being
country and threatens the habitat of several Shifting or Jhum cultivation (Slash-
native species. Moreover it is becoming a and-burn agriculture)
vicious pest in vegetable farms.
In shifting cultivation, plots of natural
Exotic earthworms compete for food with tree vegetation are burnt away and the cleared
native varieties and deplete their population in patches are farmed for 2-3 seasons, after
soil. Papaya Mealy Bug (Paracoccus marginatus) which their fertility reduces to a point where
is native of Mexico and Central America, is crop production is no longer profitable. The
believed to have destroyed huge crops of papaya farmer then abandons this patch and cuts
in Assam, West Bengal and TamilNadu. down a new patch of forest trees elsewhere
for crop production.This system is practiced
Global Climate changes in north-eastern regions of India. When vast
Industrialization is a major contributor areas are cleared and burnt, it results in loss of
to climate change and a major threat to forest cover, pollution and discharge of CO2
biodiversity. Energy drives our industries, which in turn attributes to loss of habitat and
which is provided by burning of fossil fuels. climate change which has an impact on the
This increases the emission of CO2, a GHG, faunal diversity of that regions.
leading to climate change. Due to large scale
deforestation, the emitted CO2 cannot be Coextinctions
absorbed fully, and its concentration in the Coextinction of a species is the loss of
air increases. Climate change increases land a species as a consequence of the extinction
and ocean temperature, changes precipitation of another. (Eg., orchid bees and forest trees
patterns and raises the sea level. This
by cross pollination). Extinction of one will
inturn results in melting of glaciers, water
automatically cause extinction of the other.

Biodiversity and its conservation 202

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 202 25-02-2019 19:23:02


www.asiriyar.net

Another example for co-extinction is the Forestry


connection between Calvaria tree and the There is a tendency to grow economically
extinct bird of Mauritius Island, the Dodo. The important and viable trees like Teak, Sandal,
Calvaria tree is dependent on the Dodo bird Oak, Sal in forests resulting in loss of other
for completion of its life cycle. The mutualistic forest trees.
association is that the tough horny endocarp of
the seeds of Calvaria tree are made permeable Natural threats
by the actions of the large stones in birds gizzard These include spontaneous jungle fires,
and digestive juices thereby facilitating easier tree fall, land slide, defoliation by insects or
locust attack.
germination. The extinction of the Dodo bird
led to the imminent danger of the Calvaria tree
11.5.1 Loss of biodiversity
coextinction.
Species have been evolving and dying
Pollution out (extinction) ever since the origin of life.
Pollutants and pollution are a major However, species are now becoming extinct at
cause for biodiversity loss. Excessive use of a faster rate. This is destabilizing the ecological
fertilisers, pesticides and heavy metals have stability and the distribution of biological
diversity on earth. Human activities greatly
polluted the land, ground and surface water
contribute to the loss of biodiversity. Natural
bodies. There is a tendency of pesticide
resources such as land, water and organisms
biomagnification which results in high
are indiscriminately exploited by human
concentrations at higher trophic levels
beings.
which has resulted in drastic decline in the
According to the Convention of
population of fish eating birds and falcons.
Biological Diversity, direct and indirect
Run off from fertilizer rich fields causes
human activities have a detrimental effect
nutrient enrichment of water bodies leading to on biodiversity. Direct human activities like
eutrophication. Mercury, arsenic, cadmium, change in local land use, species introduction
chromium poisoning has led to depletion of or removal, harvesting, pollution and climate
biotic resources in vulnerable ecosystems. change contribute a greater pressure on loss of
Death of vulture population is attributed to biodiversity. Indirect human drivers include
the veterinary medicine Diclofenac, which is demographic, economic, technological,
responsible for the thinning of the egg shells. cultural and religious factors.
Even though new species are being
Intensive agriculture:
discovered, there is little hope for adding
Spread of agriculture is sometimes at
new species through speciation into the
the cost of wetlands, grasslands and forests.
biodiversity treasure. Monsoon failure, global
Intensive agriculture is based on a few high
warming, depletion in ozone layer, landslides
yielding varieties. As a result, there is reduction
in hilly states, pollution are a few indirect
in the genetic diversity. It also increases
effects of human activities which results in
vulnerability of the crop plants to sudden attack
the loss biodiversity. IUCN Red List (2004)
by pathogens and pests. There are only few
documents the extinction of 784 species in
varieties of traditional paddy strains today due
the 500 years.
to use to hybrid varieties in Tamil Nadu.
It is estimated that the current rate of
biodiversity loss is 100 to 1000 times higher

203 Biodiversity and its conservation

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 203 25-02-2019 19:23:02


www.asiriyar.net

than the naturally occurring extinction rate IUCN's scheme after Critically Endangered
and is still expected to grow in the future. (CR).
This loss of biodiversity has a immense In 1998 there were1102 animal and 1197
impact on plant animal and human life. The plant species in the IUCN Red List. In 2012,
negative effects include dramatic influence on the list features 3079  animal  and 2655 plant
the food web. Even reduction in one species species as endangered (EN) worldwide. 
can adversely affect the entire food chain
which further leads to an overall reduction 11.5.4 Extinction:
in biodiversity. Reduced biodiversity leads Species is considered extinct when none
to immediate danger for food security by of its members are alive anywhere in the
reducing ecosystem services. world. If individuals of a species remain alive
only in captivity or other human controlled
11.5.2 Hotspots conditions, the species is said to be extinct in
Hotspots are areas characterized with high the wild. In both of these situations, the species
concentration of endemic species experiencing would be considered globally extinct. A species
unusual rapid rate of habitat modification loss. in considered to be locally extinct when it is no
Norman Myers defined hot spots as “regions longer found in an area it once inhabited but is
that harbour a great diversity of endemic species still found elsewhere in the wild.
and at the same time, have been significantly In the 450 million years of life on Earth,
impacted and altered by human activities.” there had been 5 mass extinctions, which had
A hotspot is a region that supports at least eliminated at least 50% of the species of flora
1500 endemic vascular plant species (0.5% of and fauna on the globe.
the global total) has lost more than 70% of its The extinction of species is mainly
original vegetation. There are 35 biodiversity due to drastic environmental changes and
hotspots in the world. India is home to four population characteristics.
biodiversity hotspots (as per ENVIS). They are
There are three types of Extinctions
a. Himalaya (the entire Indian Himalayan
i. Natural extinction is a slow process
region)
of replacement of existing species with
b. Western Ghats
better adapted species due to changes in
c. Indo-Burma: includes entire North-eastern environmental conditions, evolutionary
India, except Assam and Andaman group of changes, predators and diseases. A small
Islands (and Myanmar, Thailand, Vietnam, population can get extinct sooner than
Laos, Cambodia and Southern China) the large population due to inbreeding
d. Sundalands: includes Nicobar group depression (less adaptivity and variation).
of Islands (and Indonesia, Malaysia,
ii. Mass extinction: The earth has experienced
Singapore, Brunei, Philippines)
quite a few mass extinctions due to
11.5.3 Endangered organisms environmental catastrophes. A mass
A species  that has been categorized as extinction occurred about 225 million years
very likely to become extinct is an Endangered ago during the Permian, where 90% of shallow
species. Endangered (EN), as categorized by the water marine invertebrates disappeared.
International Union for Conservation of Nature iii. Anthropogenic extinctions These are
(IUCN) Red List, is the second most severe abetted by human activities like hunting,
conservation status for wild populations in the habitat destruction, over exploitation,

Biodiversity and its conservation 204

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 204 25-02-2019 19:23:02


www.asiriyar.net

urbanization and industrialization. Some world. It plays a vital role in the implementation
examples of extinctions are Dodo of of several international conventions on nature
Mauritius and Steller’s sea cow of Russia. conservation and biodiversity.
Amphibians seem to be at higher risk of
Red Data Book
extinction because of habitat destruction.
Red Data book or Red list is a catalogue
The most serious aspect of the loss of of taxa facing risk of extinction. IUCN –
biodiversity is the extinction of species. The International Union of Conservation of Nature
unique information contained in its genetic and Natural Resources, which is renamed as
material (DNA) and the niche it possesses are WCU – World Conservation Union (Morges
lost forever. Switzerland) maintains the Red Data book.
The concept of Red list was mooted in 1963.
One more species goes extinct...
The purpose of preparation of Red List are:
• To create awareness on the degree of threat
to biodiversity
• Identification and documentation of
species at high risk of extinction
• Provide global index on declining
biodiversity
George the tree snail (Achatinella • Preparing conservation priorities and help
apexfulva) died on January 1, 2019, at in conservation of action
the age of 14. He was the last snail of his
• Information on international agreements
species, and is emblematic of the loss of
on conservation of biological diversity
native Hawaiian molluscs.
Red list has eight categories of species
i) Extinct ii) Extinct in wild iii) Critically
11.6 IUCN Endangered iv) Endangered v) Vulnerable
The International Union for Conservation vi) Lower risk vii) Data deficiency viii) Not
of Nature (IUCN) is an organization working in evaluated.
the field of nature conservation and sustainable
use of natural resources. It was established in
11.7 Biodiversity and its
1948 and located at Gland VD, Switzerland. It is conservation
involved in data gathering and analysis research, The natural resources
field projects and education on conservation, of the Earth, including air,
sustainable development and biodiversity. water, land, flora and fauna
IUCN’s mission is to influence, encourage and of natural ecosystems must
assist societies throughout the world to conserve be safeguarded for the
nature and to ensure that any use of natural benefit of the present and future generations
resources is equitable and ecologically sustainable. through careful planning and management,
It influences governments and industries as appropriate – Principle of the Stockholm
through partnerships by providing information Declaration,1972.
and advice. The organization collects, compiles The large-scale loss of biodiversity and its
and publishes the IUCN red list of threatened global impact makes conservation the need of
species and their conservation status in the the hour.

205 Biodiversity and its conservation

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 205 25-02-2019 19:23:02


www.asiriyar.net

Conservation of biodiversity is protection Protected Area:


and scientific management of biodiversity These are biogeographical areas where
so as to maintain it at its optimum level and biological diversity along with natural and
derive sustainable benefits for the present as cultural resources is protected, maintained and
well as future generations. It aims to protect managed through legal measures. protected
species from extinction and their habitats and areas include national parks, wild life sanctuaries,
ecosystems from degradation. community reserves and biosphere reserves.
General strategies in conservation World Conservation monitoring centre has
• identify and protect all threatened species recognized 37,000 protected areas world-wide.
India has about 771 protected areas covering
• identify and conserve in protected areas
162099 km2 comprising of National Parks (104),
the wild relatives of all the economically
Wild Life Sanctuaries (544), biosphere reserves
important organisms
(18) and several sacred groves.
• identify and protect critical habitats for
feeding, breeding, nursing, resting of each Project Tiger: The Government of India
species launched the ‘Project Tiger’ in 1973 to protect
• resting, feeding and breeding places of our national animal. From 9 tiger reserves
the organisms should be identified and since its inception, the Project Tiger coverage
protected has increased to  50 at present. Project Tiger
• Air, water and soil should be conserved on is an ongoing Centrally Sponsored Scheme
priority basis of the Ministry of Environment and Forests,
• Wildlife Protection Act should be providing central assistance to the states for
implemented tiger conservation in designated tiger reserves.
There are two aspects of conservation strategies Project Tiger was launched in the Jim Corbett
(Fig.11.3). National Park, Uttarakhand in1973. The project
ensures a viable population of Bengal tigers in
i) In-situ conservation their natural habitats, protecting them from
ii) Ex-situ conservation extinction and preserving areas of biological
11.7.1 In-situ Conservation importance as a natural heritage.
(Conservation in the natural The National Tiger Conservation Authority
habitat): (NTCA) is a statutory body of the Ministry,
This is the conservation of genetic created under the Wildlife (Protection) Act,
resources through their protection within a 1972. India holds over half the world’s tiger
natural or manmade ecosystem in which they population. According to the latest tiger census
occur. It is conservation and protection of the report released on 20th January 2015 by NTCA,
whole ecosystem and its biodiversity at all levels the current tiger population is estimated at
in order to protect the threatened species. 2,212. There are 50 tiger reserves in the country.
Maximum protection of biodiversity
hotspots regions with very hight levels of species National Parks (NP):
richness. Although all the biodiversity hotspots It is a natural habitat that is notified by
together cover less than 2 percent of the earth the state government to be constituted as a
land area, the number of species they harbour is National Park due to its ecological, faunal,
extremely high and protection of these hotspots floral, geomorphological, or zoological
could reduce the ongoing mass. association of importance. No human activity

Biodiversity and its conservation 206

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 206 25-02-2019 19:23:02


www.asiriyar.net

is permitted inside the national park except There are 544 existing wildlife sanctuaries
the activities permitted by the Chief Wildlife in India covering an area of 118,918 km2, which
Warden of the state under the conditions given is 3.62 % of the geographical area of the country
in CHAPTER IV, of the Wildlife Protection (National Wildlife Database, 2017).
Act (WPA) 1972 (Table 11.1). Sanctuaries are tracts of land where wild
animals and fauna can take refuge without
Table 11.1 National Parks in Tamil Nadu
being hunted or poached. Other activities
National Parks Year of like collection of forest products, regulated
District(s)
in Tamil Nadu establishment harvesting of timber, private ownership of
Guindy NP 1976 Chennai land are permitted. Periyar wild life sanctuary
Gulf of Mannar Ramanathpuram in Kerala is famous for the Indian Tiger and
1980
Marine NP and Tuticorin Asiatic Elephant.
Indira Gandhi Table 11.2 Wild life sanctuaries in Tamil Nadu
1989 Coimbatore
(Annamalai) NP
Prominent WLS Year of
Mudumalai NP 1990 Nilgiris Districts
in Tamil Nadu establishment
Mukurthi NP 1990 Nilgiris
Vedanthangal
1936 Chengalpet
Lake Birds WLS
There are 104 existing national parks in India
covering an area of 40,501 km2, which is Mudumalai WLS 1942 Nilgiris
1.23% of the geographical area of the country
Point Calimere
(National Wildlife Database, Aug. 2018). 1967 Nagapattinam
WLS
National Park is an area which is strictly Indira Gandhi
reserved for the betterment of wildlife and (Annamalai) 1976 Coimbatore
biodiversity and where activities like WLS
development, forestry, poaching, hunting, Mundanthurai
1977 Tirunelveli
WLS
grazing and cultivation are not permitted.
They are large areas of scenic and national Biosphere Reserve (BR):
beauty maintained for scientific educational Biosphere Reserve (BR) is an international
and recreational use. They are not used for designation by UNESCO for representative parts
commercial extraction of resources. of natural and cultural landscapes extending
Kaziranga National park is a protected area over large area of terrestrial or coastal/ marine
for the one Horned Rhinoceros in Assam. ecosystems or a combination thereof. BRs are
Wild Life Sanctuaries (WLS): designated to deal with the conservation of
Any area other than the area comprised with biodiversity, economic and social development
any reserve forest or the territorial waters can be and maintenance of associated cultural
notified by the State Government to constitute as values. Biosphere Reserves are thus special
a sanctuary if such area is of adequate ecological, environments for both people and nature and
faunal, floral, geomorphological, natural or are living examples of how human beings and
zoological significance. This is for the purpose nature can co-exist while respecting each other’s
of protecting, endangered factual species. Some needs. The Biosphere Reserve Programme
restricted human activities are allowed inside is guided by UNESCO’s Man and Biosphere
the Sanctuary area details of which are given in (MAB) programme, as India is a signatory to
CHAPTER IV, of the Wildlife Protection Act the landscape approach supported by MAB
(WPA) 1972. Ecoturism is permitted, as long as programme. The scheme called Biosphere
animal life is undistrubed. Reserve was implemented by the Government of

207 Biodiversity and its conservation

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 207 25-02-2019 19:23:02


www.asiriyar.net

programmes. As a result, many animals which


The Madras Crocodile Bank Trust
have become extinct in the world continue to be
The Madras Crocodile Bank Trust and Centre
maintained in Zoological Parks. As the number
for Herpetology was the brain child of the
increases in captive breeding, the individuals
legendary Romulus Whitaker and a handful
are selectively released in the wild. In this way
of like-minded conservation visionaries, who
the Indian crocodile and gangetic dolphin have
began work on the facility in 1976. It aimed to
been saved from extinction.
save India’s dwindling crocodilian population.
The mission is to promote the conservation Gene Banks:
of reptiles and amphibians and their habitats Gene banks are a type of biorepository
through education, scientific research and which preserve genetic materials. Seeds of
capture breeding. The crocodile bank remains a different genetic strains of commercially
world leader in the field of frontline conservation important plants can be stored in long periods
and the preservation of natural landscapes. The in seed banks, gametes of threatened species
Crocodile Bank currently consists of a large can be preserved in viable and fertile condition
reptile park near Chennai and several field for long periods using cryopreservation
projects located throughout the subcontinent techniques.
reaching as far as the Nicobar Islands. About However, it is not economically feasible
half a million people visit the bank every year, to conserve all biological wealth and all the
making it one of the most popular tourist ecosystems. The number of species required
attractions along the East Coast Road. to be saved from extinction far exceeds the
conservation efforts.
India in 1986. There are 18 Biosphere Reserves
in the country. Agasthyamalai (Karnataka Summary:
- Tamil Nadu - Kerala), Nilgiri (Tamil Nadu -
Kerala), Gulf of Mannar (Tamil Nadu) are the Table 11.3 Difference between Insitu and Exsitu
Conservation
BRs notified in Tamil Nadu  Insitu Conservation Exsitu Conservation
It is the on-site This is a conservation
Sacred Groves conservation or the strategy which involves
A sacred grove or sacred woods are any conservation of genetic placing of threatened
grove of trees that are of special religious resources in natural
animals and plants in
importance to a particular culture. Sacred populations of plant or
animal species. special care locations
groves feature in various cultures throughout for their protection.
the world. It is the process of It helps in recovering
protecting an endangered populations or
11.7.2 Ex-Situ Conservation plant or animal species in preventing their
It is conservation of selected rare plants/ its natural habitat, either extinction under
animals in places outside their natural homes. It by protecting or restoring simulated conditions
includes offsite collections and gene banks. the habitat itself, or by that closely resemble
defending the species from their natural habitats.
Offsite Collections: predators.
They are live collections of wild and National Parks, Zoological parks and
domesticated species in Botanical gardens, Biosphere Reserve, Wild Botanical gardens
Zoological parks, Wildlife safari parks, Arborata Life Sanctuaries form are common exsitu
(gardens with trees and shrubs). The organisms insitu conservation conservation
strategies. programs.
are well maintained for captive breeding
Biodiversity and its conservation 208

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 208 25-02-2019 19:23:02


www.asiriyar.net

Arignar Anna Zoological Park, Vandalur management under the name of Zoo e-Eye. 24
Arignar Anna Zoological Park is spread x 7 Animal Live Streaming was introduced for
over an area of 602 hectares. of Reserve Forest at the benefit of the visitors for the first time in the
Vandalur, Chennai. It is one of the largest zoo in world. Vandalur Zoo Mobile Application was
South East Asia in terms of area. The Zoological introduced to provide services to the visitors like
Park exhibits different classes of animals – it has facility to book tickets, Zoo navigation, Animal
around 2500 wild animals of nearly 180 species information in text and audio format. Digital
which includes Mammals, Birds and Reptiles. 34 payments at ticket counters are also available.
years since its establishment, the Zoological Park The Zoo school has been involved in
has emerged as a successful ex-situ conservation education and outreach programmes. One such
centre and a captive breeding centre for many successful programme is ‘Zoo Ambassador’
endangered species like Royal Bengal Tiger, Lion which is been conducted for school children.
Tailed Macaque, Nilgiri Langur, Gray Wolf, etc., In the year 2018, more than 400 students were
The Zoo has many attractive features like trained and titled as Zoo Ambassadors. The Zoo
Butterfly Park, Childrens Park, Walk Through also has a Rescue Centre which accommodates
Aviary, Lion & Deer Safari, Forest Museum, rescued wild animals and treats them to come out
Interpretation centre, etc., which attracts more of stress.
than 21 lakh visitors every year. The Zoo has Source: Director, Arignar Anna Zoological Park,
strengthened its protection by means of installing Vandalur, Chennai
CCTV Cameras for both visitors and animal

Biodiversity is the variety of all life on Earth, population growth and increased consumption.
encompassing genetic, species and ecosystem This increased exploitation of biological resources
diversity. Today’s biodiversity is the fruit of billions has resulted in the loss of species at levels currently
of years of evolution, shaped by natural processes estimated to be 100 times faster than the natural
and, increasingly, by the influence of humans. To rate of loss prior to significant human intervention.
date, about two million species have been identified Though many species were lost and new ones
on Earth. formed, it is likely we will lose all this natural
Biodiversity supplies a large number of goods wealth in less than two centuries, if the present rate
and services that sustain human life, including of biodiversity losses persist.
the provision of food, fuel and building materials; The biodiversity and its conservation is the
purification of air and water; stabilization and important global issue of international concern.
moderation of the earth’s climate; moderation Recognition of this problem has made scientists and
of floods, droughts, temperature extremes and policy makers to work and develop mechanisms
wind forces; generation and renewal of soil health; to document, conserve and sustainably use
maintenance of genetic resources as inputs to crop biodiversity.
varieties and livestock breeds, medicines, and other
products; and cultural, recreational and aesthetic The younger generation should be made to
benefits. realize the critical state of biodiversity today and
volunteer to protect and conserve it, so as to enable
Over the past few hundred years, biodiversity the future generations get to enjoy the benefits of
has faced major challenges, including a growing Nature.
demand for biological resources caused by

209 Biodiversity and its conservation

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 209 25-02-2019 19:23:02


www.asiriyar.net

Evaluation b) Both Assertion and Reason are true but


1. Which of the following Reason is not the correct explanation of
regio n has maximum Assertion.
biodiversity c) Assertion is true , but Reason is false.
a) Taiga d) Both Assertion and Reason are false.
10. Define endemism.
b) Tropical forest
11. How many hotspots are there in India?
c) Temperate rain forest d)Mangroves
Name them.
2. Conservation of biodiversity within their
12. What are the three levels of biodiversity?
natural habitat is
13. Name the active chemical found in the
a) Insitu conservation
medicinal plant Rauwolfia vomitoria. What
b) Exsitu conservation
type of diversity it belongs to?
c) In vivo conservation
14. “Amazon forest is considered to be the lungs
d) In vitro conservation
of the planet”-Justify this statement.
3. Which one of the following is not coming 15. ‘Red data book’-What do you know about it?
under insitu conservation 16. Extinction of a keystone species led to loss
a) Sanctuaries b) Natural parks of biodiversity – Justify.
c) Zoological park d) Biosphere reserve 17. Compare and Contrast the insitu and exsitu
4. Which of the following is considered a conservation.
hotspots of biodiversity in India 18. What are called endangered species? Explain
a) Western ghats  b) Indo-gangetic plain with examples.
c) Eastern Himalayas  d) A and C 19. Why do we find a decrease in biodiversity
5. The organization which published the red distribution, if we move from the tropics
list of species is towards the poles?
20. What are the factors that drive habitat loss?
a) WWF  b) IUCN  c) ZSI  d) UNEP
21. Where are biodiversity hotspots normally
6. Who introduced the term biodiversity? located? Why?
a) Edward Wilson b) Walter Rosen 22. Why is biodiversity so important and
c) Norman Myers d) Alice Norman worthy of protection?
23. Why do animals have greater diversification
7. Which of the following forests is known as
than plant diversity?
the lungs of the planet earth?
24. Alien species invasion is a threat to endemic
a) Tundra forest
species – substantiate this statement.
b) Rain forest of north east India
25. Mention the major threats to biodiversity
c) Taiga forest
caused by human activities. Explain.
d) Amazon rain forest
26. What is mass extinction? Will you encounter
8. Which one of the following are at high risk
one such extinction in the near future.
extinction due to habitat destruction
Enumerate the steps to be taken to prevent it.
a) Mammals b) Birds 27. In north eastern states, the jhum culture is a
c) Amphibians d) Echinoderms major threat to biodiversity – substantiate.
9. Assertion: The Environmental conditions 28. List out the various causes for biodiversity
of the tropics are favourable for losses.
speciation and diversity of organisms. 29. How can we contribute to promote
Reason: The climate seasons, temperature, biodiversity conservation?
humidity and photoperiod are more or less 30. ‘Stability of a community depends upon its
stable and congenial. species diversity’ Justify the statement.
a) Both Assertion and Reason are true 31. Write a note on i) Protected areas, ii) Wild
and Reason explains Assertion correctly. life sanctuaries, iii) WWF.
Biodiversity and its conservation 210

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 210 25-02-2019 19:23:03


www.asiriyar.net

Concept Map
,PSRUWDQFH
RIELRGLYHUVLW\
7KUHDWVWR 3DWWHUQVRI
ELRGLYHUVLW\ ELRGLYHUVLW\

0DJQLWXGH
&DXVHVRI RI
ELRGLYHUVLW\ ELRGLYHUVLW\

%LRGLYHUVLW\ +RWVSRWV
/RVVRI
ELRGLYHUVLW\

/HYHORI
ELRGLYHUVLW\
(QGDQJHUHG
RUJDQLVP

&RQFHSWVRI
ELRGLYHUVLW\
([WLQFWLRQ

Red data
Hotspots book Offsite Gene
conservation banks

Protected
National areas IUCN CITES
parks INSITU EXSITU
conservation Govt WWF conservation

Organisations
Sanctuaries Biosphere in conservation
reserves

Biodiversity conservation

211 Biodiversity and its conservation

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 211 25-02-2019 19:23:03


www.asiriyar.net

ICT CORNER
BIO DIVERSITY AND ITS
CONSERVATION

Let us go out for an virtual exhibition,


to know about 30 endangered animals.

Procedure :
Step -1: Type the URL or scan the QR code to open the activity page. Click “Explore the
exhibition” to start the exhibition.
Step -2: Find the species name below the figure (Ex: Helmeted Hornbill). Find a grey dot right
next to the name. Click the same to know about its extinction.
Step -3: Click “<” on the left top of this page to play a video about the same species. Click “x” to
run to the homepage.
Step – 4 : On the left “ top first” option to load all the species. Middle square in a circle is for slide
show of all the species.
Step -5: On the right of the page, find ^ and down button to move on from one to the next.

Step 1 Step 2 Step 3

Step 4

BIO DIVERSITY AND ITS CONSERVATION URL:


http://www.species-in-pieces.com/

*Pictures are indicative only


*Allow flash player

Biodiversity and its conservation 212

TN_GOVT_XII_ Bio Zoology_chapter 11.indd 212 25-02-2019 19:23:05


www.asiriyar.net

12
UNIT - V

Environmental
Issues
CHAPTER

Chapter Outline
12.1 Pollution
12.2 Air Pollution
12.3 Water Pollution Environment is my prime teacher
12.4 Noise Pollution - Masanabu Fukuoka
12.5 Agrochemicals
12.6 Biomagnification
12.7 Eutrophication
12.8 Organic Farming and its
Implementation
12.9 Solid Waste Management
A clean environment is very necessary
to live a peaceful and healthy life. But
our environment is getting dirty day by day
12.10 Global Environment Change
12.11 Ozone Depletion because of our negligence. Earth is currently
12.12 Deforestation facing a lot of environmental concerns like air
12.13 Ecosan Toilets
12.14 Peoples Participation in Conservation pollution, water pollution, and noise pollution,
of Forests global warming, acid rain, biomagnification,
eutrophication, deforestation, waste disposal,
ozone layer depletion and climate change.
Over the last few decades, the exploitation of
Learning Objectives our planet and degradation of our environment
have gone up at an alarming rate. As our
•• Gain knowledge about our environment and its actions have not been in favour of protecting
importance.
•• Get to know about the effects and after effects of this planet, we have seen natural disasters
human activities on climate and ecosystem. striking us more often in the form of flash
•• Realize the need and importance of forests. floods, tsunami and cyclones.
•• Know about eco-friendly practices
for pollution mitigation. “Every individual should be environmentally
•• Acquire insights into solutions to aware, regardless of whether they work with
environmental problems. environmental issues or not.”
•• Understand the need for peoples’
participation in environmental
protection. 12.1 Pollution
•• Know about the global level Pollution is any undesirable change in the
conventions on climate change.
physical, chemical and biological characteristics
•• Understand the importance of clean environment.
of the environment due to natural causes and
human activities. The agents which cause
pollution are called pollutants. Pollution is

213

TN_GOVT_XII_ Bio Zoology_chapter12.indd 213 25-02-2019 19:24:47


www.asiriyar.net

classified according to the types of environment continue to accumulate (biomagnification).


that is affected. They are mainly air, water and Toxic elements like lead, mercury, cadmium,
soil pollution. chromium and nickel are such common
pollutants.
12.1.1 Classification of Pollutants
In terms of eco-system, pollutants can 12.2 Air Pollution
be classified into two basic groups – Non- Earth is surrounded by a gaseous envelope
degradable and degradable. Based on the time which is called atmosphere. The gaseous
taken to breakdown into their ingredients, blanket of the atmosphere acts as a thermal
degradable pollutants are classified as rapidly insulator and regulates the temperature of
degradable (non-persistent) and slowly the earth by selectively absorbing the UV
degradable (persistent). rays of solar radiation. The adverse effects
a) Rapidly degradable or non-persistent of pollution include depletion of Ozone
pollutants: These can be broken down by by Chlorofluorocarbons or CFCs, used as
natural processes. Domestic sewage and refrigerants and global warming by elevated
vegetable waste are examples of such pollutants. CO2 (industries, deforestation, and partial
b) Slowly degradable or persistent combustion).
pollutants: These are pollutants that remain The alterations or changes in the composition
in the environment for many years in an of the earth’s atmosphere by natural or human
unchanged condition and take decades or activities (anthropogenic factors) are referred as
longer to degrade, as in the case of DDT. Air Pollution. Pollutants include the abundant
c) Non-degradable pollutants: These presence of solid, liquid or gaseous substances
cannot be degraded by natural processes. produced by human or natural activity. The
Once they are released into the environment, nature and concentration of a pollutant
they are difficult to be eliminated and determines the severity of detrimental effects

Pollutant emissions

Lightning Fertilizer

Wildfires Volcanoes Oil & Gas Cities Industry, power plants, Airplanes, Cars, Trucks,
Sewage treatment Buses and Three & Two wheelers

Natural Area Stationary Mobile

Fig. 12.1 Sources of air pollution.


Environmental Issues 214

TN_GOVT_XII_ Bio Zoology_chapter12.indd 214 25-02-2019 19:24:47


www.asiriyar.net

on organisms and human health. Along with •• Area sources – agricultural - wood /
atmospheric factors (humidity, precipitation, stubble burning, fireplaces
wind, air currents, altitude) prevailing at a place •• Natural sources – wind-blown dust,
and time, its effects can be far reaching and wildfires, volcanoes (Fig. 12.1).
catastrophic.
12.2.2 Effects of Air Pollution
Air pollutants can be •• Affects all organisms as they depend on the
• discharge of dusts or particulate matter atmosphere for respiration.
(PM: 2.5 ,10) •• Causes irritation in the throat, nose, lungs
• discharge of gases (SO2, NO2, CO, CO2) and eyes. It causes breathing problems and
Carbon monoxide (CO) is produced mainly aggravates existing health conditions such
due to incomplete combustion of fossil fuels. as emphysema and asthma.
Automobiles are major causes of CO pollution •• Contaminated air reduces the body’s
in large cities and towns Automobile exhausts, defense mechanism and decreases the
fumes from factories, emission from power body’s capacity to fight other infections
plants, forest fires and burning of fire-wood in the respiratory system.
contribute to CO pollution.
•• Frequent exposure to polluted air increases
With rapid urbanization, major amount of the risk of cardiovascular diseases.
carbon dioxide and sulphur dioxide (SO2) is Breathing air that is filled with fine
released in the atmosphere. From automobiles, particulate matter can induce hardening of
aeroplanes, power plants and other human the arteries, triggering cardiac arrhythmia
activities that involving the burning of fossil or even a heart attack.
fuels (coal, oil etc.,) CO2 is the main pollutant
•• People who exercise outdoors can
that is leading to global warming.
sometimes be susceptible to adverse effects
Nitrogen oxides are also major air of air pollution because it involves deeper
pollutants. Fossil fuel combustion and and faster breathing. Hence it is advisable to
automobiles exhausts are the source of walk or jog in the mornings in places with
nitrogen oxides. Sulphur dioxide and nitrogen ample tree cover.
oxides are the major causes of acid rain.
•• Gas leaks can be lethal or affect the quality
Particulate matters are tiny particles of
of air in the affected area.
solid matter suspended in a gas or liquid.
•• CO in the atmosphere interferes with O2
Combustion of fossil fuels, fly ash produced
transport since haemoglopin has greater
in thermal power plants, forest fires, asbestos
affinity for carbon monoxide. At low
mining units, cement factories are the main
concentration it causes headache and
sources of particulate matter pollution.
blurred vision. In higher concentration, it
12.2.1 Sources can lead to coma and death.
The main sources of air pollution are:
•• Transport sources (Fig.12.1)– cars, buses,  ameer, an App provides
S
airplanes, trucks, trains hourly updates on the
•• Stationary sources – power plants, National Air Quality Index
incinerators, oil refineries, industrial (AQI) published by CPCB.
facilities, and factories

215 Environmental Issues

TN_GOVT_XII_ Bio Zoology_chapter12.indd 215 25-02-2019 19:24:47


www.asiriyar.net

12.2.3 Other notable effects of Air 12.2.4 Control of Air Pollution


Pollution Certain measures help to remove pollutants,
Smog is a type of air pollution caused by reduce their presence or prevent their entry into
tiny particles in the air. The word comes from the atmosphere.
a mixture of the words smoke and fog . •• Trees are the best remedy for urban
Today, smog generally refers to photochemical particulate and gaseous pollution
smog, which is created when sunlight reacts •• Forests act as carbon sinks and lungs of
with nitrogen oxides and volatile organic the planet
compounds found in fossil fuel emissions •• Catalytic converters in vehicles help to
from automobiles, factories, and power plants. reduce polluting gases drastically
These reactions create ground-level ozone and
•• Diesel exhaust filters in automobiles cuts
particulate matter, reducing visibility. Smog
particulates
can make breathing more difficult, especially
for people with asthma. •• Electrostatic precipitators reduce release
of industrial pollutants.
Smog also affects plants and animals.
It damages crops as well as causes health •• Cost effective air pollution treatment
problems in pets, farm animals and human systems like indoor plants and high
beings. Smog has also been known to cause performance biofilters can improve
corrosive damage to buildings and vehicles. indoor air quality.
Peroxyacetyl nitrate (PAN) is a secondary
pollutant present in photochemical smog. It The Taj Mahal, a UNESCO world
is thermally unstable and decomposes into heritage site, is facing deterioration and
peroxyethanol radicals and nitrogen dioxide damage by industrial gases due to several
gas causing eye irritation. industrial units around Agra. The white
Global warming: Increase in the marble has decolorized to yellow.
concentrations of greenhouse gases such as
CO2, methane, nitrous oxide, CFCs, and ozone
12.2.5  Legal Protection
causes greenhouse effect, warming of the •• The Air (Prevention and Control of
earth, resulting in sea level rise, submerging of Pollution) Act was enacted in 1981 and
islands and sea shores of various parts of the amended in 1987 for the prevention,
world. control and abatement of Air pollution in
India.
Ozone depletion: Thinning of the
stratospheric ozone layer is known as ozone •• Traffic Emissions Standards: The
depletion. Such depletion causes the ‘ozone Government has decided to enforce Bharat
hole’, resulting in poor screening of the Stage VI norms from 2020.
harmful UV rays and increase in incidences of •• The Green Bench and the National Green
skin cancer. Some of the common agents that Tribunal (NGT) give judicial safeguard to
deplete ozone are CFCs. environmental protection.
Acid rain: Acid rain is a form of precipitation Steps taken by the Central and the State
that contains acidic components, such as governments in India:
sulfuric acid or nitric acid. It damages trees, •• Road traffic rationing, encourage public
crops and harms marine animals (coral reefs) transport, carpooling.
and induces corrosion.

Environmental Issues 216

TN_GOVT_XII_ Bio Zoology_chapter12.indd 216 25-02-2019 19:24:47


www.asiriyar.net

•• Increase green cover alongside roads 12.3 Water Pollution


(planting avenue trees).
12.3.1 Quality of Water
•• Promoting Swachh Bharat Abhiyan
Water is essential for life and for the health of
•• Enactment and Enforcement of stricter
the environment. As a valuable natural resource,
environmental laws
it comprises marine, estuarine, freshwater (river
•• Maintenance of air standards by proper and lakes) and groundwater environments that
enforcement and monitoring stretch across coastal and inland areas. Water has
two dimensions that are closely linked: quantity
Average human and quality. Water quality is commonly defined
consumption of Oxygen by its physical, chemical, biological and aesthetic
per day = 550 L (appearance and smell) characteristics. A
Cost of 2.75 L Oxygen healthy environment is one in which the water
cylinder = ₹ 6500 quality supports a rich and varied community of
Cost of 550 L of oxygen from tree organisms and protects public health.
= ₹ 13,00,000
12.3.2 Water Pollution
-----------------------------------------
Water pollution occurs when there is a
Oxygen production by one healthy
change in the chemical, physical or biological
tree per year =1,00,375 L
quality of water that has harmful effect(s) on
Cost of 2.75 L oxygen cylinder living organisms that consume it or live in it.
= ₹ 6500 Water pollution adversely affects water
Cost of 1,00,375 L of oxygen from one bodies due to the large amounts of natural
tree /year = ₹ 23,72,50,000 or man-made materials let into it. When it
becomes unfit for its intended use, water is
•• Reducing carbon emissions considered polluted.
•• Encourage use of renewable energy
12.3.3 Sources of Water Pollution
•• Limiting the sale of firecrackers and
developing eco-friendly crackers Even though water bodies or sources can be
polluted by natural causes, water pollution is
•• Make Environmental Impact Assessment
usually caused by human activities. There are
mandatory
three main types of sources: point sources,
Air Quality Index (AQI) is a number used non-point sources, leaks and spills.
by government agencies to communicate to the
Point sources: Discharge of pollutants at
public how polluted the air is at a given time.
specific locations through pipelines or sewers
Air Quality Index into the water body. Factory effluents, sewage,
AQI Air Pollution Level Colour underground mines, oil wells, oil tankers
and agriculture are common point sources
0-50 Good
(Fig. 12.2 a).
51-100 Moderate
Non-point sources: Sources that cannot be
101-150 Unhealthy for Sensitive Groups
traced to a single site of discharge like acid
151-200 Unhealthy
rain, dumping of the plastics in water bodies,
201-300 Very Unhealthy agriculture chemical run off are common
301+ Hazardous examples (Fig. 12.2 b).

217 Environmental Issues

TN_GOVT_XII_ Bio Zoology_chapter12.indd 217 25-02-2019 19:24:47


www.asiriyar.net

(a) containing waste water, sometimes in


toxic concentrations. These discharges
can affect temperatures of the water
bodies as well as dissolved oxygen level.
3. Agricultural wastes include fertiliser and
pesticide runoff from agricultural fields,
food processing waste, tree and saw dust
(b) from logging operations and bacteria
from sewage or livestock operations.
Water pollutants reach water bodies like
rivers, streams and the marine system by
precipitation, run-off and the groundwater by
seepage or percolation.

12.3.4 Effect of Water pollution on


(c) Ecosystems
1. Destruction of ecosystems: Ecosystems,
especially aquatic systems, can be
severely affected or destroyed by water
pollution.Water pollutants affect existing
niches and habitats and the survival of
organisms. Soil fertility is affected and the
system becomes uninhabitable.
Fig.12.2 Sources of water pollution
2. Disruption of food-chains: Water
Leaks and Spills: This occurs mostly due to pollution disrupts the natural food chains
ship collision, off shore oil rigs, oil leakages as well as food webs. Pollutants such as
and discharges into sea (Fig. 12.2 c). lead and cadmium are taken up by primary
Sources of water pollution can also be classified consumers where they can be lethal or
in three ways. They are municipal wastes, get stored. Later, when these animals are
industrial wastes, and agricultural wastes. consumed by secondary consumers, the
food chain can get disrupted at any trophic
Sources of water pollution level or result in enhanced concentration
of these pollutants (biomagnification).
Hot water from industries when released
Municipal Industrial Agricultural into the water bodies affects aquatic
wastes wastes wastes density and diversity.

12.3.5. Effect of Water pollution on


1. Municipal waste water is from homes and Organisms
commercial establishments. 1. Water pollution can be lethal to aquatic
2. Industrial discharge (effluents) may organisms and others that depend on
contain varieties of compounds such these water bodies.
as heavy metals (cadmium, chromium, Accidental oil spills from tanker ships can
lead), and organic / inorganic chemicals cause substantial environmental damage. Oil

Environmental Issues 218

TN_GOVT_XII_ Bio Zoology_chapter12.indd 218 25-02-2019 19:24:47


www.asiriyar.net

spreads on the water surface, prevents the 2. Water (Prevention and Control of
entry of light and oxygen into the water. This Pollution) Act, 1974, sections 17 to 40
increases BOD and COD, resulting in mass prohibit the pollution of a stream or well
death of organisms and degradation of water by disposal of polluting matter.
quality. It also clogs fish gills and the feathers 3. The Central/State Pollution Control
of aquatic birds. Boards have the power to advise the
central/state government on various
On January 28, 2017, two cargo ships matters concerned with the prevention
collided off the Ennore coast in Chennai and control of pollution of water.
causing oil to spill into the sea. Due to wave
4. The Ministry of Environment, Forest and
action and the southern current, the spill
Climate Change (MoEFCC) is the nodal
spread over to 34 km down south affecting
agency of the Central Government for
the coast. Beach sand also got spoiled by
the planning, promotion, co-ordination
the oil sludge. It took more than a thousand
and for overseeing the implementation
volunteers to clean the oil sludge.
of India’s environmental and forestry
2. Humans and other organisms can get policies and programmes.
affected by diseases such as hepatitis and
Prevention
typhoid by consuming contaminated
•• Regulate or control of pollutant(s)
water and food. Excess of fluoride in
discharge at the point of generation.
drinking water causes fluorosis. In many
poor nations, outbreak of water borne •• Wastewater can be pretreated by scientific
diseases and epidemics are a result of methods before discharge to municipal
contaminated water and poor or absence treatment sources.
of water treatment processes. •• Setting up of Sewage Treatment Plants
3. Water pollution can cause eutrophication (STP) and Effluent Treatment Plants (ETP).
due to nutrient enrichment. This causes •• Regulate or restrict the use of synthetic
algal blooms which affect the quality fertilisers and pesticides.
of water bodies (Fig. 12.3). Red tides, if •• Public awareness and people's involvement
occur, can be lethal to aquatic organisms. is essential.

Assessment by CPCB
The number of polluted stretches in
India’s rivers has increased to 351 from
302 (in 2006), and the number of critically
polluted stretches – where water quality
indicators are the poorest – has gone up
to 45 from 35 (Source: The Hindu, 17
September, 2018).
Fig. 12.3 Algal bloom
Case study
12.3.6 Control Measures
Namami Gange (National Mission
1. Right to clean water is a fundamental right
for Clean Ganga) Programme is an
under the Indian Constitution.

219 Environmental Issues

TN_GOVT_XII_ Bio Zoology_chapter12.indd 219 25-02-2019 19:24:47


www.asiriyar.net

Integrated Conservation Mission approved •• Marine animals are affected by noise


as the ‘Flagship Programme’ of the Union pollution from offshore activities and port
Government in June 2014 with a budget activities.
outlay of 20,000 crores to accomplish the •• Fire crackers frighten animals. Birds are
twin objectives of effective abatement of often affected by increased air traffic.
pollution, conservation and rejuvenation of
12.4.3 Control
River Ganga.
•• Planting trees in and around noise sources
is an effective solution for noise pollution
12.4 Noise Pollution
as plants are known to absorb noise and
Sound that is unwanted and undesirable or bring down sound levels.
can disrupts one’s quality of life is called as Noise.
•• Regular servicing and tuning of
When there is lot of ‘noise’ in the environment,
automobile engines can effectively reduce
it is termed as Noise Pollution. The intensity of noise pollution by vehicles and machinery.
noise is meaured in decibels (dB).
•• Workers should be provided with ear plugs
12.4.1 Sources of Noise Pollution and earmuffs at work sites that generate
high noise levels.
Vehicle engines, air horns, audio video
•• Lubrication of machinery and regular
systems, trains, low flying aircrafts, factory
servicing minimizes noise levels.
machines, sirens, motors, drillers and
•• Regulations should be imposed to restrict
crushers, compressor machines, crackers,
the usage of loudspeakers in crowded
explosives, modern supersonic transports are
areas and public places.
the common sources of noise pollution.
The threshold of pain is about 120 db. 12.4.4 Legal Protection
World Health Organization has proposed that Article 48-A and Article 51-A of the
noise must be recognized as a major threat to Constitution of India, Noise Pollution
human well-being. This is applicable for all (Regulation and Control) Rules 2000, and
living organisms. Tamil Nadu State Environment Policy
2017 are some of the legal relief from noise
12.4.2 Effect of Noise Pollution pollution.
•• According to the USEPA (United States According to Noise Pollution (Regulation
Environmental Protection Agency) there and Control) Rules, 2000, the permissible
are direct links between noise and health. limit of noise in areas categorized as
Heart disease, high blood pressure, stress commercial is 65 decibels (dB) during day
related illness, sleep disruption, hearing and 55 dB during night.
loss (deafness), and productivity loss are
the problems related to noise pollution. 12.5 Agrochemicals
•• Increased stress and tension, nervousness, Chemicals which are used in agriculture for
irritability, anxiety, depression and panic growth of plants and pest control are called
attacks. agrochemicals or agrichemicals.
•• Peptic ulcer, severe head ache, Overuse of agrochemicals have been observed
memory loss. to generate residues that cause nutrient
imbalance, and

Environmental Issues 220

TN_GOVT_XII_ Bio Zoology_chapter12.indd 220 25-02-2019 19:24:47


www.asiriyar.net

•• May kill beneficial bacteria and soil 12.6 Biomagnification


organisms. Food chains are components of all
•• Can cause eutrophication in water bodies. ecosystems. Producers and consumers form
•• Affect aquatic animals and their trophic levels in a chain through which energy
productivity. flow is carried out by the process of eating and
•• Pesticide containing water, even in trace being eaten. Usage, storage and transformation
quantities is unfit for human consumption. of food and biomolecules by metabolism are a
normal process. Degradation or breakdown is
•• Particles (aerosols) and residues of these
an essential part of any food chain and hence all
chemicals cause air pollution.
naturally occurring substances are degradable.
•• Inhalation of contaminated air can cause
respiratory problems. Biomagnification of DDT
•• Consumption can lead to poisoning, side When non-degradable substances enter the food
effects and after effects. chain, they do not get metabolized or broken
•• Chemicals can cause skin rashes and down or expelled and instead get transferred up
irritation of eyes. the tropic levels of the food chain. During this
process, they show an increase in concentration
•• Many of these chemicals are reported to
which is referred to as biomagnification. This
be carcinogenic.
results in increased toxicity and may even be
•• They can trigger hormonal disorders and lethal. This phenomenon is well established for
neurotoxicity. mercury and DDT. Figure 13.4 schematically
•• Beneficial insects and animals can be shows biomagnification of DDT in an aquatic
affected. food chain where the concentration of DDT is
enhanced at successive trophic levels.

1. Mosquito Repellents Magnification of


DDT concentration
DEET  (n-n-diethylnetatoluamide)
and allethrin used in mosquito coils Fish-eating
may cause itching, burning, tingling birds 10,000,000

sensation or numbness.
Large
2. C
 olony collapse syndrome in Honey fish 1,000,000

bees due to pesticides/herbicides can


lead to destruction of hives and lower Small
100,000
fish
agricultural productivity. !!Remember
bees are Nature’s best pollinators!!
Zooplankton 10,000

Producer
1000
(Phytoplankton)

1
Water
1

Fig. 12.4 Biomagnification

221 Environmental Issues

TN_GOVT_XII_ Bio Zoology_chapter12.indd 221 25-02-2019 19:24:48


www.asiriyar.net

12.7 Eutrophication animal wastes. Realizing the importance of


When run-off from land clean potable water, the Government passed the
containing nutrients reaches Water (Prevention and Control of Pollution)
water bodies like lakes, it Act in 1974, which made it mandatory to treat
results in dense growth of wastewater in treatment plants. The treatment
plant life. This phenomenon can be carried out by three ways:
is called Eutrophication. 1. Physical methods
Natural aging of lakes also 2. Chemical methods
leads to nutrient enrichment of its water. In a 3. Biological methods
lake, the water is cold and clear (oligotrophic
1. 
Physical methods of wastewater
stage), supporting little life. With time, streams
draining into the lake introduce nutrients such treatment
as nitrates and phosphates, which encourage Wastewaters containing insoluble
the growth of aquatic organisms. Aquatic substances or colloids are treated through
plants and animal life grow rapidly, and organic processes such as flotation, sedimentation,
remains begin to be deposited on the lake filtration and centrifugal separation.
bottom (mesotrophic stage) (Fig. 12.5).
2. 
Chemical methods of Wastewater
Pollutants from anthropogenic activities treatment
like effluents from the industries and homes Chemical methods of wastewater treatment
can radically accelerate the aging process. include:
This phenomenon is known as Cultural or •• Generation of insoluble solids.
Accelerated Eutrophication.
•• Produce an insoluble gas.
Nutrients stimulate the growth of algae, water •• Produce biologically degradable substances
hyacinth and can cause clogging of canals, rivers from a non-biodegradable substance.
and lakes as well as, displacing native plants. It •• Oxidize or reduce to produce a non-
causes unsightly foam and unpleasant odours, objectionable substance.
and deprives the water of dissolved oxygen. 3. 
Biological methods of Wastewater
12.7.1 Integrated Wastewater treatment
Management (1) 
Bioremediation of wastewater includes
Wastewater Treatment the aerobic treatment (oxidation ponds,
aeration lagoons) and anaerobic treatment
Wastewater or sewage originates from (anaerobic bioreactors, anaerobic
domestic waste waters, industrial wastes and lagoons).

Fig. 12.5 Stages of Eutrophication


Environmental Issues 222

TN_GOVT_XII_ Bio Zoology_chapter12.indd 222 25-02-2019 19:24:48


www.asiriyar.net

(2) Phytoremediation of wastewater includes


constructed wetlands, Root Zone
Wastewater Treatment (RZWT), and
Decentralized Waste Water Treatment
System (DEWATS) (Fig. 12.6 a).

G. Nammalvar was a supporter and expert of


organic farming. He was an agricultural scientist,
environmental activist celebrated for his work
on spreading Ecological farming & Organic
farming. He was against the use of chemical
fertilisers and pesticides. He trained hundreds of
farmers in natural farming. Nammalvar was the
Fig. 12.6 (a) DEWATS system at Auroville
author of several Tamil and English books on
natural farming, pesticides & fertilisers and was
featured in magazines & television programs. He
founded the Nammalvar Ecological Foundation
for Farm Research and Global Food Security
Trust or simply Vaanagam at Karur, Tamilnadu.
He developed social forest at Ammankurai and
the Kolunji Ecological Farm in Pudukottai.
He and his friends made a 10-acre barren land
(b) RZWT system at Aravind Eye Hospital into fertile cultivable land in the dry Pudukottai
Case Study: Auroville, located in South India district. He planted 52 varieties of trees in
near Puducherry has been experimenting the same waste land extending in 20 acres.
with natural wastewater recycling systems His organization ‘Kudumbam’ preserves and
(Fig:12.6a). Such treatment plants have regenerates hundreds of native flora and fauna,
in order to ensure a sustainable livelihood.
now also been implemented in Aravind Eye
Hospital, Puducherry (Fig:12.6 b) and the 12.9 Solid Waste Management
Chennai Mathematical Institute, Siruseri IT
Every day, tonnes of solid wastes are disposed
Park, Chennai.
off at landfill sites. This waste comes from
12.8 Organic Farming and Its homes, offices, industries and various other
Implementation agricultural related activities. These landfill
It is a method of farming system which sites produce foul smell if waste is not stored
primarily aims at cultivating the land and raising and treated properly. When hazardous wastes
crops in such a way, so as to keep the soil alive and like pesticides, batteries containing lead,
in good health by use of organic wastes (crop, cadmium, mercury or zinc, cleaning solvents,
animal and farm wastes, aquatic wastes) and radioactive materials, e-waste and plastics are
other biological materials along with beneficial mixed up with paper and other scraps and
microbes (biofertilizers) to release nutrients to burnt, they produce gases such as dioxins.
crops for increased sustainable production in These gases are toxic and carcinogenic. These
an eco-friendly pollution free environment. pollute the surrounding air, ground water
and can seriously affect the health of humans,

223 Environmental Issues

TN_GOVT_XII_ Bio Zoology_chapter12.indd 223 25-02-2019 19:24:48


www.asiriyar.net

wildlife and our environment. The following Solid Waste management includes the
are major sources of solid waste (Table 12.1). activities and actions required to manage waste
from its inception to its final disposal. This
includes the collection, transport, treatment and
disposal of waste, together with monitoring and
regulation of the waste management process. It
is all about how solid waste can be changed and
used as a valuable resource.
Case Study: The Corporation of Chennai looks
Dr. Sultan Ahmed Ismail is an Indian soil
after clearance and management of solid waste
biologist and ecologist from Tamil Nadu.
His work has centered on techniques in Chennai. Every day around 5400 Metric
for recycling biodegradable waste into Tonnes (MT) of garbage is collected from the
fertiliser using varieties of earthworms, city. Door to door collection of garbage is done
and on soil bioremediation. in most zones apart from sweeping, collecting,
Dr. Ismail received a D.Sc. in Zoology and storing the waste in the specified bins.
from the University of Madras for his At present garbage generated in Chennai is
research on the role of earthworms in dumped at two sites. Proposals are there for
soil ecology and waste management. remediation of the existing landfill or scientific
He works on vermicomposting as a closure and to have integrated waste processing
sustainable ecological practice. He has facilities with waste to energy plants as one of
been instrumental in introducing as well the components at the existing Kodungaiyur
as spreading awareness on environmental and Perungudi sites.
issues, solid waste management,
vermicomposting, organic farming, 12.9.1 Waste management practices
vermitech and waste management to a)  Source segregation
several educational institutions, industries b) Composting
and organic farmers in India and abroad. 1. Aerobic 2. Anaerobic

Table 12.1  Major sources of solid waste


Waste category Source
Food wastes, plastics, paper, glass, leather, cardboard, metals, yard wastes,
Residential
ashes, tires, batteries, old mattresses
Industrial Packaging wastes, ashes, chemicals, cans, plastics, metal parts
Thin and thick plastics, food wastes, metals, paper, glass, wood,
Commercial
cardboard materials
Institutional Wood, paper, metals, cardboard materials, electronics
Construction Steel materials, concrete, wood, plastics, rubber, copper wires, dirt and glass.
and Demolition
Agriculture Agricultural wastes, spoiled food, pesticide containers
Syringes, bandages, used gloves, catheter, urine bags, drugs, paper,
Biomedical
plastics, food wastes, sanitary napkins and diapers, chemicals.
Electronic items like used TVs, transistors, tape recorders, computer cabinets,
E-waste
mother boards, CDs, cassettes, mouse, wires, cords, switches., chargers.

Environmental Issues 224

TN_GOVT_XII_ Bio Zoology_chapter12.indd 224 25-02-2019 19:24:48


www.asiriyar.net

c) Vermicomposting objective of treatment activities for longer-


d)  Biogas generation lived radioactivity. The waste is contained
e) Incineration in corrosion resistant containers and
transported to disposal sites. Leaching of
12.9.2 Radioactive waste heavy metals and radionuclides from these
Radioactive wastes are generated during sites is a problem of growing concern.
various operations of the nuclear power plant.
Radioactive waste can be in gas, liquid or solid Control and Management
form, and its level of radioactivity can vary. The Three ways are employed to manage nuclear
waste can remain radioactive for a few hours or wastes
several months or even hundreds of thousands •• Spent Fuel Pools - The spent fuel
of years. Depending on the level and nature of discharged from the reactors is temporarily
radioactivity, radioactive wastes can be classified stored in the reactor pool. The Spent fuel
as exempt waste, Low and Intermediate level rods are used in stored cooling ponds.
waste and High Level Waste. They protect the surroundings from
radiation and absorb the heat generated
Radioactive waste management during radioactive decay.
Radioactive waste management involves
•• Vitrification method – This prevents
the treatment, storage, and disposal of liquid,
reaction or degradation of nuclear waste
airborne, and solid effluents from the nuclear
for extended periods of time and encased
industry.
in dry cement caskets.
•• Geological Repositories - A deep
The Three Mile Island
geological repository is a nuclear waste
(Pennsylvania, United
repository excavated deep within a
States), Chernobyl
stable geologic environment. It is suited
(Pripyat, Ukraine) and
to provide a high level of long-term
Fukushima Daiichi
isolation and containment without future
(Ōkuma, Japan) are nuclear disasters
maintenance. In India at Tarapur and
the world has seen in the recent period.
Kalpakkam, a wet storage facility of Spent
Methods of disposal of radioactive Fuel is the main mode of storage.
wastes are
1. Limit generation - Limiting the generation 12.9.3  Medical waste
of waste is the first and most important Any kind of waste that contains infectious
consideration in managing radioactive wastes. material generated by hospitals, laboratories,
medical research centers, Pharmaceutical
2. Dilute and disperse - For wastes having low
companies and Veterinary clinics are called
radioactivity, dilution and dispersion are
medical wastes.
adopted.
Medical wastes contain body fluids like blood,
3. Delay and decay - Delay and decay is
urine, body parts and other contaminants,
frequently an important strategy because
culture dishes, glasswares, bandages, gloves,
much of the radioactivity in nuclear
discarded needles, scalpels, swabs and tissues.
reactors and accelerators is very short lived.
Management: The safe and sustainable
4. Concentrate and confine process -
management of biomedical waste is the social
Concentrating and containing is the

225 Environmental Issues

TN_GOVT_XII_ Bio Zoology_chapter12.indd 225 25-02-2019 19:24:48


www.asiriyar.net

and legal responsibilities of people working in can lead to adverse human health effects and
healthcare centers. environmental pollution.
Waste disposal: Involved by incineration, Recycling and disposal of e-waste may
chemical disinfection, autoclaving, encapsulation, involve significant risk to the health of workers
microwave irradiation are methods of waste and communities in developed countries
disposals. Final disposal includes landfill and and great care must be taken to avoid unsafe
burying as per norms inside premises. exposure in recycling operations and leaking
12.9.4 E-Waste of materials such as heavy metals from landfills
Electronic waste or e-waste describes and incinerator ashes.
discarded electrical electronic devices as well 12.9.5 Plastic Waste – Solutions and
as any refuse created by discarded electronic Remedies
devices and components and substances Plastics are low molecular weight organic
involved in their manufacture or use. Their polymers that are non-degradable in the natural
disposal is a growing problem because electronic environment. They are used in several items,
equipment frequently contains hazardous
including cars, bulletproof vests, toys, hospital
substances. In a personal computer, for example,
equipment, carry bags and food containers.
there may be lead (Pb) in the cathode ray tube
Packaging materials used in supermarkets, retail
(CRT) and soldering compound, mercury
outlets, manufacturing industries, households,
(Hg) in switches and housing, and cobalt (Co)
hotels, hospitals, restaurants and transport
in steel components, among other equally
companies are major contributors to plastic
toxic substances. E-wastes are basically PCB
waste generation. Plastic waste constitutes a
(Polychlorinated biphenyl) based, which are
non-degradable (Fig12.7). major part of municipal solid waste.

• Remedies: ‘4R’- Refuse, Reduce, Reuse


and Recycle mantra is the best available
remedy for plastic waste pollution.
• Tamil Nadu State government successfully
implemented the ban on single use
plastics from 1st January 2019.

12.10 Global Environment Change


Green House Effect and Global warming
Natural environment and climate are dynamic
and keep changing over course of time. But with
human population growth, industrialization
and associated anthropological activities the
changes are more pronounced and impactful
Fig.12.7 Types of E-wastes in a much shorter time span, thus resulting in
drastic Global environmental change.
Used electronics which are destined for Large-scale changes of global environment can
reuse, resale, salvage, recycling, or disposal lead to hazards, which may include climate
are also considered e-waste. Unauthorised change, stratospheric ozone depletion, changes
processing of e-waste in developing countries

Environmental Issues 226

TN_GOVT_XII_ Bio Zoology_chapter12.indd 226 25-02-2019 19:24:48


www.asiriyar.net

in ecosystems due to loss of biodiversity, changes expected (flooding and desertification).


in hydrological systems and the supplies of Coastal areas shall become more vulnerable
freshwater, land degradation, urbanization, and to storm surges as sea level rises. Plant and
stress on food-producing systems. animal species will migrate or disappear in
Greenhouse gases (GHG) water vapour, response to climate change.
carbon dioxide, methane, nitrous oxide, •• Global warming can directly affect the
ozone and some artificial chemicals such as flora and fauna. This could also result in
chlorofluorocarbons (CFCs) causes greenhouse shortage of food and even lead to food
effect. The absorbed energy warms the crisis; and affect the health of the people
atmosphere and the surface of the Earth. and organisms.

Major International Environmental Climate change threatens Nilgiri Tahr:


Conventions The endangered wild goat could lose
1972: 
UN conference on Human approximately 60 % of its habitat, starting
environment, Stockholm, Sweden from the 2030s. (The Hindu, 12.08.2018)
1972: UN environment programme
The UNO has several measures to control
(UNEP), Stockholm, Sweden
or reduce pollution. Through various
1987: Montreal Protocol, Vienna
conventions organized by UNO, the countries
1989: Intergovernmental panel on climate
assured to take steps to control or reduce
change, Geneva, Switzerland. emissions by factories and automobiles.
1992: Earth summit, Rio de Janeiro.
Agenda 21, otherwise called Rio 12.11  Ozone Depletion
conference, Brazil
1997: Kyoto Protocol, Japan At about 15 and 30 kilometers from the
2002: World Summit on Sustainable ground level, the earth’s atmosphere has a
Development, Johannesburg, South thin layer of ozone, which absorbs ultraviolet
Africa sunlight. Ozone is found in the layer of the
2003: World climate change conference, atmosphere called the Stratosphere. It acts as
Moscow, Russia a protective covering that absorbs ultraviolet
2012: UN Conference on Sustainable (UV) radiation from the sun. The ozone
Development, Rio de Janeiro molecule (O3) consists of three oxygen atoms.
2015: UN Sustainable Development It is formed when atmospheric oxygen (O2)
Summit, New York on exposure to solar radiation breaks into two
2016: Montreal Protocol amendment at oxygen atoms; each atom then joins up with
Kigali, Rwanda a single oxygen atom. The ozone molecule is
2017: The COP23 climate change summit unstable. It soon decays again to form molecular
in Bonn, Germany oxygen. This cycle is a continuous process in
2018: UN climate change conference, the upper reaches of the stratosphere.
Katowice, Poland
Causes and effects of ozone layer
•• The large-scale global warming will have
depletion
significant impact on people and nature. Causes: Ozone layer depletion mainly occurs
As global average temperatures rise, by anthropogenic actions.
precipitation patterns could be affected. The excessive release of chlorine and
Extreme wet and dry conditions can be bromine from man-made compounds such as

227 Environmental Issues

TN_GOVT_XII_ Bio Zoology_chapter12.indd 227 25-02-2019 19:24:48


www.asiriyar.net

chlorofluorocarbons (CFCs) causes ozone layer


depletion. CFCs, methyl chloroform, carbon World Ozone Day
tetrachloride, hydrochlorofluorocarbons, September 16 has been designated by the
hydrobromofluorocarbons and methylbromide United Nations as the International Day for
are found to have direct impact on the depletion the Preservation of the Ozone Layer.
of the ozone layer. These are categorized as The ozone layer was discovered in 1913
ozone-depleting substances (ODS). by the French physicists Charles Fabry and
Effects: UV rays may penetrate deep into the Henri Buisson.
skin and can lead to premature skin aging and
wrinkling of skin; suppression of the immune
system, skin cancer (melanoma) and chronic
12.12 Deforestation
effects leading to eye damage. DNA damage Deforestation is the destruction of forests
can result from free radicals and reactive in order to clear the land and make it
oxygen and photons can damage the DNA available for other uses. Forests cover about
itself. 30 percent of the world’s landmass. But due
to deforestation it is estimated that the earth
Control: Ozone layer depletion can be
loses 18.7 million acres of forests per year. In
controlled by
2016, global tree cover loss reached a record
(1) Phase down or ban the use of CFCs
of 29.7 million hectares.
(CFC free refrigerants).
Common methods of deforestation are
(2) Minimizing the use of chemicals such as
burning trees and clear cutting.
halons and halocarbons.
(3) 
Creating awareness about ozone 12.13 People’s Participation in
depleting agents. Conservation of Forests
People’s participation is vital in forest
Ozone hole (in purple colour), is the area
conservation, especially those living in them
above Antarctica, where the ozone layer is
or close to the forest. This is referred to as
the thinnest.
Community forestry, which varies widely in
Ozone thickness
legal, political and cultural settings and the
is given in
Dobson unit term covers a wide range of experiences and
(see carefully practices.
the scale shown The Bishnois, who are known conservators
in colour from of their forest, were inspiration to many
violet to red). people’s participatory movements for
The ozone hole Environmental protection in India. The
over Antarctica Chipko movement resisted the destruction
develops each of forests of India in the 1970s. Sunderlal
Ozone depletion
year between late Bahuguna was the leader of this movement.
around Polar
August and early People in the movement hugged the trees,
region
October. and prevented felling of trees by contractors.
Courtesy: NASA The ‘Forest man of India’, Jadav Payeng
who created 1,360 acres of dense and defiant
forest was born in Arunasapori (a river island

Environmental Issues 228

TN_GOVT_XII_ Bio Zoology_chapter12.indd 228 25-02-2019 19:24:49


www.asiriyar.net

on the Brahmaputra). He had just completed Man of India’. Later, the President APJ Abdul
his Class X exams in1979 when he started to Kalam felicitated him with a cash award in
sow the seeds and shoots on the eroded island Mumbai. The same year, he received the
covered with sand and silt. ‘Padma Shri’.

Amrita Devi was a brave lady from Khejarli The Indian Constitution also stresses on
Village of Jodhpur District, Rajasthan. the importance of the role of the People in
She sacrificed her life to maintain Bishnoi protecting their environment.
Dharma. In 1730, Maharaja Abhay Singh,
ruler of Marwar, Rajasthan state wanted to 12.14  Ecosan Toilets
log green Khejri (Prosopis cineraria) trees About 150 liters of wastewater at an average
to burn lime for the construction of his new is generated by an Indian individual daily, and
palace. Since there was a lot of greenery in a large amount of it is generated from toilets.
the Bishnoi villages even in the middle of Ecological sanitation (EcoSan) is a sustainable
Thar Desert, the king ordered his men to system for handling human excreta by using
get the wood from Khejri trees. When she dry composting toilets. EcoSan toilets not
came to know about the cutting of trees only reduce wastewater generation but also
by the King’s men, she and many others generate the natural fertiliser from recycled
had hugged the Khejri trees to save from human excreta, which forms an excellent
cutting. But king’s men killed Amrita Devi substitute for chemical fertilisers. This
along with more than 363 other Bishnois. method is based on the principle of recovery
It was a Tuesday, black Tuesday in Khejarli. and recycling of nutrients from excreta to
This incident took place to save trees and is create a valuable supply for agriculture.
recorded in India’s history. ‘EcoSan’ toilets are being used in several parts
of India and Sri Lanka.
Summary
Degrading natural environments, depleting
natural resources, pollution, vulnerability to
large scale environmental changes and hazards
are the core Environmental issues of today.
Air pollution by fossil fuel burning and other
anthropological activities like industrialization
To commemorate her bravery, the
is reaching alarming levels and affecting human
Government of Rajasthan and Madhya
health and testing the survival of sensitive species.
Pradesh have initiated the prestigious state
level award named as ‘Amrita Devi Bishnoi Domestic and industrial sewage, and
Smriti Award’ for excellent contribution to agricultural run-off are the most common reasons
the protection and conservation of wildlife. for pollution of water bodies, resulting in reduced
dissolved oxygen and increased Biochemical
Thirty-six years later he had converted the Oxygen demand of water bodies. Eutrophication
once unproductive land into a forest. Payeng’s and algal blooms are regular occurrences today.
Industrial wastewaters are often rich in toxic
forest is now home to five Royal Bengal tigers,
chemicals, heavy metals and organic compounds
over a hundred deer, wild boar, vultures, and
which harm living organisms and may even
several species of birds. For his remarkable result in death of aquatic life.
initiative, the Jawaharlal Nehru University
Noise pollution is a threat to human and
invited Payeng in 2012 on Earth Day and other animals. It can affect health and disturb
honoured him with the title of the ‘Forest

229 Environmental Issues

TN_GOVT_XII_ Bio Zoology_chapter12.indd 229 25-02-2019 19:24:49


www.asiriyar.net

peaceful habitats. Agrochemicals and its usages d) Technology transfer mechanism to


cause many ill effects in human beings, other developing countries for ‘clean-energy’
organisms and soil. Agrochemicals can also production.
cause biomagnification. The solution is to revert 3. Which among the following awards
to non-chemical farming (use of biofertilisers, instituted by the Government of India for
biopesticides, protect pollinators) practices. individuals or communities from rural areas
Generation of municipal wastes and their safe that have shown extraordinary courage and
disposal are major issues faced by communities dedication in protecting Wildlife?
today. Solid wastes create environmental a) Indira Gandhi Paryavaran Puraskar
problems and must be disposed-off in safe ways.
b) Medini Puruskar Yojana
Disposal of solid wastes, radioactive wastes and
e-wastes requires further efforts and research. c) Amrita Devi Bishnoi Award
Solid wastes like plastic can be combated by d) Pitambar Pant National Award
practicing the 4R - refuse, reduce, reuse and
4. The ‘thickness’ of Stratospheric Ozone layer
recycle. Ecosan toilets are some of the universally
is measured in/on:
accepted eco-friendly practices.
a) Sieverts units b) Dobson units
Green house effect and depletion of ozone
layer are aggravated by emissions of carbon c) Melson units d)Beaufort Scale
dioxide, methane, nitrous oxide and CFCs and 5. Which among the following is the most
deforestation. Melting of ice caps, rising sea abundant Green-House-Gas (GHG) in the
levels, change in rainfall patterns, increase in earth’s atmosphere?
average global temperature, are deleterious to a) Carbon dioxide b) Water Vapour
living organisms. Increased risks of skin cancer,
mutations and other disorders are potential c) Sulphur Dioxide d) Tropospheric Ozone
threats. 6. As per 2017 statistics, the highest per capita
Earth summits, Conventions on climate emitter of Carbon dioxide in the world is
change, developing of protocols and creation of a) USA b) China
emission standards and control are some of the c) Qatar d) Saudi Arabia
steps taken by governments towards protecting
7. The use of microorganism metabolism to
our environment and conserve for today and the
remove pollutants such as oil spills in the
future generations.
water bodies is known as
Evaluation a) Biomagnification b) Bioremediation
1. Right to Clean Water is a c) Biomethanation d) Bioreduction
fundamental right, under
the Indian Constitution 8. The Ozone Day is observed every year on
September 16 as on this day in 1987 the
a) Article 12 b) Article 21
___________was signed for launching
c) Article 31 d) Article 41 efforts to arrest the depletion of the fragile
2. With which of the following, the Agenda 21’ ozone layer in the stratosphere that prevents
of Rio Summit, 1992 is related to? the harmful ultra-violet rays of the sun from
a) Sustainable development reaching the earth. Fill the correct word in
b) Combating the consequences of blank.
population a) Montreal Protocol b) Geneva Protocol
c) Mitigation norms of Green House c) Kyoto Protocol d)Nagoya Protocol
Gases (GHGs) emission.

Environmental Issues 230

TN_GOVT_XII_ Bio Zoology_chapter12.indd 230 25-02-2019 19:24:49


www.asiriyar.net

9. Which among the following always 17. Discuss the causes and effects of global
decreases in a Food chain across tropic warming. What measures need to be taken
levels? to control global warming?
a) Number b)Accumulated chemicals 18. What would Earth be like without the
greenhouse effect?
c) Energy d) Force
19. Write notes on the following:
10. In the E-waste generated by the Mobile a. Eutrophication
Phones, which among the following metal b. Algal Bloom
is most abundant?
20. What effect can fertilizer runoff have on an
a) Copper b) Silver aquatic ecosystem?
c) Palladium d) Gold 21. How can we control eutrophication?
11. The Hydrochlorofluorocarbons (HCFCs) 22. Why does ozone hole form over Antarctica?
are the compounds which have the 23. Mention the causes of enhanced use of
following molecules: ultraviolet radiation.
24. Discuss the role of women in protection and
a) Hydrogen b) Carbon
conservation of forests.
c)Chlorine d)Fluorine 25. Discuss the role of an individual to reduce
12. SMOG is derived from : environmental pollution.
a) Smoke b) Fog 26. How does recycling help reduce pollution?
c) Both A and B d) Only A 27. What is the primary purpose of the Kyoto
Protocol?
13. Excess of fluoride in drinking water
28. In what way Peyang conserves the forest?
causes:
29. Discuss briefly the following :
a) Lung disease b) Intestinal infection
a. Catalytic converter
c) Fluorosis d) None of the above b. Greenhouse gases
14. Expand (i) CFC (ii) AQI (iii) PAN c. Ecosan
15. What is SMOG and how it is harmful for us? 30. What are some solutions to toxic dumping
in our oceans?
16. List all the wastes that you generate, at home,
school or during your trips to other places. 31. Describe how deforestation might
contribute to global warming.
Could you very easily reduce the generation
of these wastes? Which would be difficult or 32. How does forest conservation help to reduce
air pollution?
rather impossible to reduce?

231 Environmental Issues

TN_GOVT_XII_ Bio Zoology_chapter12.indd 231 25-02-2019 19:24:49


www.asiriyar.net

Glossary Carrier – An individual heterozygous for a


Abiogenesis –  The emergence recessive gene that is not expressed
of life forms emerging from Catastrophic– Something or substance that
non-living chemical systems. involves or causes a sudden terrible disaster.
In contrast with  spontaneous Changes in animals over time in response to
generation, abiogenesis is not changing environmental factors /conditions.
a process that biologists think continues in a Adaptations help develop physiological, behavioral
particular environment, such as a planet or moon, and structural / functional traits which increase
once a living system has emerged. the chances of survival of the organisms.
Acidogenesis – Conversion of simple organic Chemical oxygen demand - A measure of the
materials into acetate, H2 and CO2 by acidogenic oxygen required to oxidize soluble and particulate
bacteria. organic matter in water.
Algal bloom – Presence of large amounts of Cirrhosis - Scarring of the liver that impairs its
nutrients in waste water causing excessive growth functioning.
of planktonic algae. Co-dominance – In a heterozygote, the dominant
Allergy - A hypersensitivity reaction that can and recessive allele is capable of phenotypic
involve various deleterious effects. expression.
Anthropogenic causes– Problems created Coacervates – are the microscopic spontaneously
by human formed spherical aggregates of lipid molecules
Anthropology – The study of differences and that are held together by electrostatic forces and
similarities, both biological and cultural, in human that may have been precursor of cells.  They are
populations. Anthropology is concerned with the  cluster of molecular aggregates in colloidal
typical biological and cultural characteristics of form which are bounded by a membrane
human populations in all periods and in all parts and  grows  by absorbing molecules from the
of the world. environment. Oparin believed that life developed
Antisense DNA– It is the non coding strand from coacervates.
complementary to the coding strand in double Cytolysis -  Destruction of cells
stranded DNA. The antisense strand serves as a Cursorial – A cursorial organism is one that is
template for mRNA synthesis. adapted specifically to run. Cursorial organisms
Apoptosis– Is a form of programmed cell death are typically adapted to long-distance running
that occurs in multicellular organisms. at high speeds, rather than animals with high
Attenuated – reduced in virulence. acceleration over short distances; thus, a cheetah
Autoradiography – It is the use of X-ray or is considered cursorial, while a leopard is not.
photographic film to detect radioactive materials. Denaturing – Denaturing means separation or
Bacteriophages– Viruses which infect bacterial splitting of the double helix into single stands
cells. by breaking hydrogen bonds between the two
Biogeography - The scientific study of the strands.
geographic distribution of organisms. Dendritic cells -  Professional antigen presenting
Canopy – The canopy is the above ground cells that have long membrane processes
portion of a plant community or crop, formed Diapedesis -  The movement of blood cells
by the collection of individual plant crowns. (leucocytes) out of the circulatory system and
Carcinogens– Substance causing cancer towards the site of tissue damage or infection
accompanying inflammation.
Cardiac arrhythmia– Any variation from the
normal rhythm in the heartbeat.
Glossary 232

TN_GOVT_XII_Glossary.indd 232 25-02-2019 19:26:57


www.asiriyar.net

Dinosaurs - a term coined by Sir Richard Owen ]Galaxy – a specific arrangement of stars.
for giant extinct reptiles. Group of animals that Gene bank-A facility established for the ex-situ
have bird-like and lizard-like facial appearance Conservation of individuals, seeds, tissues or
(Mesozoic). reproductive cells .
Distribution – The occurrence of different Gene pool – the total gene content of a whole
organisms in a given area and the way they are species.
distributed in their space, specific time and Genetic drift – an alteration in the gene
utilization of their resources. frequency.
DO – Dissolved Oxygen is the amount of Geology – the study of origin and structure of
gaseous oxygen (O2) dissolved in the water. Earth.
Ecotourism - Travel undertaken to witness sites Glaciers– A large mass of ice that moves slowly.
or regions of unique natural ecological quality Group of individuals of the same species living
the provision of services to facilitate such travel. in a given area at a given time and reproduce
El Nino– Unusual warming of surface waters in among themselves.
the eastern tropical Pacific Ocean. Haemophilia – A medical condition in which
Emphysema– A serious medical condition that the ability of the blood to clot is severely
occurs when the lungs become larger and do not reduced, causing the patient to bleed severely
work properly, causing difficulty in breathing. from even a slight injury.
Endemism-The phenomenon in which the Haemozoin - Toxic malarial pigment that
organisms are exclusively restricted to a given causes malaria fever.
area. Hallucination - The sensation of seeing, hearing
Endometriosis – An abnormal condition in or sensing something that does not exist.
which endometrial tissue that normally lines Heterochromatin – Heterochromatin is a
the uterus grows outside . tightly packed form of DNA or condensed
Eohippus – ancestor of modern horse. DNA.
Euchromatin – Euchromatin is a tightly packed Homeostasis– It is the state of steady internal
form of chromatin that is enriched in genes, and conditions maintained by living things.
is often under active transcription. Immune reaction – The production of
Eutrophication - Excessive richness of nutrients antibodies in response to antigens
in a lake or other water bodies frequently due to Interferon -  An antiviral protein produced
run of fertilizers from the land causing dense from virally infected fibroblasts and leucocytes
growth of plant life. induces antiviral state in uninfected cells.
Fibroids – Fibroids are abnormal growths Intersex – An individual showing a combination
formed on the outside, inside or in the walls of
of male and female characteres.
the uterus.
Intra-Uterine Insemination (IUI)-Processed
Foetus – Developmental stage extending
sperm sample is infused into the uterus, by
from the ninth week of development
passing the vagina. Intracytoplasmic sperm
to birth.
injection (ICSI)-injection of a sperm directly
Fossorial – Fossorial (from Latin fossor,
into the ovum.
meaning "digger") is an animal adapted to
Intra uterine transfer (IUT)-Transfer of
digging which lives primarily, but not solely,
embryo with more than 8 celled blastomeres
underground. Some examples are badgers,
naked mole-rats, clams, and mole salamanders. into the uterus.

233 Glossary

TN_GOVT_XII_Glossary.indd 233 25-02-2019 19:26:57


www.asiriyar.net

In vitro fertilization (IVF)- Fertilization Mutation – sudden and inheritable changes.


outside the body in the laboratory. Narcotic -  A powerful drug that produced,
In vivo fertilization -fusion of gametes within relaxed, dreamy state, derived from Opium
the female plant.
Inflammation - e.g., Vaginitis- inflammation Nascent RNA – Nascent RNA is an immediately
in the vagina, urethritis- inflammation in the formed RNA. In this RNA no post transcriptional
urethra,endocervicitis- inflammation inside modification had occured.
the cervix, epididymitis - inflammation in the NBOD – Nitrogenous BOD
epididymis, prostatitis - inflammation in the Nk cells -  Natural Killer cells that kill infected
prostate gland and tumor cells.
Keystone species-A species whose loss from Nondisjunction – Nondisjunction is the
an ecosystem would cause a greater than failure of homologous chromosomes or sister
average change in other species population or chromatids to separate properly during cell
ecosystem process. division
Locus – The particular point on the chromosome NPK fertilizers– Fertilizers with Nitrogen (N),
at which the gene for a given trait occurs. Phosphorus (P) and Potassium (K).
Macrophage -  A large, leucocyte derived from a Nucleosome – A morphologically repeating
monocyte that functions in phagocytosis, unit of DNA containing 190 base pairs of DNA
Malt - Mucosal Associated Lymphoid Tissue folded together with eight histone molecules.
collective terms for secondary lymphoid organs Null cell -  A small population of peripheral
located along various mucous membrane blood lymphocytes that lack the membrane
surfaces including Peyer’s patches, tonsils, markers characteristic of B and T cells. Natural
appendix killer cells are included in this group.
Mast cell -  A bone marrow derived cell Number of individuals in a population within a
Menarche – Starting of the first menstrual defined unit of space and time.
period. Ontogeny – life history of an individual.
Merozoite -  A trophozoite of Plasmodium Oocyte – The encysted zygote of Plasmodium
found in RBC or liver cells. Operon – A cluster of genes whose expression
Methanogenesis – Conversion of acetate, H2 is controlled by a single operator.
and CO2 into methane by methane producing Panspermia – units of life in the forms of spores.
bacteria Permafrost – Any ground that remains
Molecular biology – The branch of biology completely frozen (32°F (0°C) or colder) for
which attempts to interpret biological events at least two years straight. These permanently
in terms of the physico chemical properties of frozen grounds are most common in regions
molecules in a cell. with high mountains and in Earth’s higher
Molecular pharming – Production of active latitudes near the North and South Poles.
pharmaceutical substances in genetically Phenotypic plasticity - the ability of one genotype
moldified organisms to produce more than one  phenotype  when
Mould – an impression of a complete organism exposed to different environments.
or a part of it in the rock that surrounds it. Phylogeny – recalling of ancestral history.
Multple sclerosis– is a demyelinating disease in Planetesimals - Planetesimals are the
which the insulating covers of nerve cells in the fundamental building blocks of the planets as
brain and spinal cord are damaged. well as the ancestors of asteroids and comets.

Glossary 234

TN_GOVT_XII_Glossary.indd 234 25-02-2019 19:26:57


www.asiriyar.net

Polypeptide chain– It consists of smaller Sewage - Domestic waste water containing various
subunits or amino acids that are linked together. solid and liquid waste materials including human
They are the building blocks of proteins. excreta.
Postpartum – Period of life following childbirth. Single cell protein (SCP) – A protein derived from
Precursor– A substance from which another is a culture of single celled organisms used especially
formed, especially by metabolic reaction as a food supplement.
Primer – A short oligonucleotide that hybridizes SOD– Sediment Oxygen Demand is the rate at
the template strand and gives a 3’ – OH end for the which dissolved oxygen is removed from the water
initiation of nucleic acid synthesis. column during the decomposition of organic
Probe – The probe is a single stranded DNA matter in streambed or lakebed sediments.
molecule that is ‘complementary’ to the gene of Solubilisation – Dissolving the feed stock in water
interest in a sample under study. to make a slurry for anaerobic digestion.
Pseudopodia – Blunt temporary protoplasmic Speciation – formation of new species from the
projections found in Amoeba or in some amoeba- pre-existing ones.
like cells. Structural gene – A gene coding for the structure
Psychoactive drug - A chemical substance that of a protein.
acts on brain and affects the mind and behaviour Taq DNA polymerase– is a thermostable
of user. DNA polymerase obtained from thermophilic
Puberty – Period of reproductive maturity bacterium Thermus aquaticus. It helps in the
Pyrolysis– Decomposition brought about by high synthesis of DNA.
temperatures. Transgene– The target gene responsible for the
Recombinant– A cell or organism whose genetic development of transgenic organism.
complement results from recombination Trophozoite stage –  In Plasmodium life cycle,
Redia – Larva in the life cycle ofmost trematodes. cryptomerozoites in the RBC become round and it
Rheoreceptors – They are receptors in fish modifies into a young trophozoite.
and some amphibians that respond to water Umbilical cord – Structure bearing arteries and
currents. veins connecting the placenta and the foetus.
Saltation – single step large mutation. Variations – dissimilarity between the members of
Satellite DNA – Short highly repeated the same species.
eukaryotic DNA sequences, usually clustered in Vitrification– Transformation of a substance into
heterochromatin and generally not transcribed a glass.
Saltatorial – Saltatorial is an animal adapted to Volatility– A liquid or substance is one that will
leaping. They have large, muscular hindlimbs and quickly change into a gas.
sometimes, reduced forelimbs. A few example Withdrawal symptoms - The reactions
for jumpers in the animal kingdom include fleas, experienced by an addict after he/she stops using
froghoppers, grasshoppers, and frogs. drugs.
Schizogony - The process of multiple fission, in Woolly mammoth – A hairy relative of modern
which one organism divides to produce many elephant that lived in cold climates.
daughter cells. Zoogeography – study of details with the
Schizont – The trophozoite of Plasmodium grows geographical distribution of animals.
in size to form the schizont. Zygote intra fallopian transfer-(ZIFT)transfer
Selection – choosing the better adapted alleles of zygote or embryo with 8 or less than 8 celled
from the mixed population. blastomeres into the fallopian tube.

235 Glossary

TN_GOVT_XII_Glossary.indd 235 25-02-2019 19:26:57


www.asiriyar.net

References • Doan, T., Melvold, R., Viselli, S. and


Waltenbaugh, C. (2008). Lippincott’s
• Ahluwalia KB., (1895), Genetics, wiley Illustrated Reviews: Immunology.
eastern Ltd Published by Wolters Kluwer (India) Pvt.
• Ananthanaryan, R and JayaramPaniker, Ltd., New Delhi.
C.K. (2009). Text book of Microbiology, • Dodson O. Dodson, 1661, Evolution
University Press (India) Pvt. Ltd. 8th process and product, Dodson University,
Edition. Australia.
• Barucha, E. (2004). Textbook for • Dubey. R.C and Maheswari., D.K (2010),
Environmental Studies, New Delhi: A text book of Microbiology, Revised
University Grants Commission edition, S. Chand & Company Ltd.
• Benjamin, E., Coico, R and Sunshine, • Edward J. Kormondy Concepts of Ecology
G. (2000). Immunology.A short course. – Fourth edition Publised by Ashoke K.
Fourth Edition.Wiley-Liss, Wiley and Ghosh, PHI Learning (P) Ltd.
Sons, Inc., Publication.
• Ekambaranatha Ayyar and Anantha
• Bose, A.K. (1999). Legal Control of Water Krishnan, (1987), Manual of Zoology, Vol
Pollution in India. Indian Institute of II Chordata , 5th Edition S.Viswanathan
Management, Kolkata. Publishers and Printers Pvt. Ltd.,
• Brooker/Widmaier, 2014, Evolution, • Farrugia. A and R. Blundell (2007). In
Second Edition, Prime books publishers, vitro Fertilisation and Other Artificial
USA. Reproductive Technology Methods-
• Chaudhary Sushil, 2000, Pioneer Review Paper. International Journal
Refresher Course in Biology, Dhanpat Rai of Molecular Medicine and Advance
& Co, Delhi. Sciences 3 (1): 16-23, 2007.

• Clary DP., (2010), Molecular biology, Ap • Fukuoka, M. (2009). The One-Straw


cell press. Revolution: An Introduction to Natural
Farming, New York Review of Books,
• Climate change and global warming. New York.
(2015). ENVIS centre for Himalayan
Ecology, Uttarakhand. • Futuyma Douglas J 2008, Evolution,
Second Edition, Prime books publishers,
• Dabady, K & Tulk, P. (2015). Agrochemicals USA.
and their Impact on Human Health,
McGill University, Canada. • Gangane. S.D(2012), Human genetics, 4th
edition Elsevier publications India Ltd
• Daniel L. Hartl., (2011), Essential
Genetics. A genomics perspective fifth • Gaya Pandey, 2010, Bio-cultural
edition, Jones and Bartlett Publishers. Evolution, Concept publishing company
Pvt, New Delhi.
• Dhami P.S and Mahindru R.C 1698, A text
book of Biology, Pradeep publications, • Getchell, Pippin and Varnes, Perspectives
Jalandhar. on Health, New edition, Mcdougal Littell.

References 236

TN_GOVT_XII_ Reference.indd 236 25-02-2019 19:28:11


www.asiriyar.net

• Goldsby, R.A., Kindt, T.J., Osborne, B.A. • Jordan E.L and Verma P.S.,(2010),
and Kuby, J. (2003). Immunology.Fifth Invertebrate Zoology, 14th Edition, S.
Edition.W.H.Freeman and Company. Chand & Company Ltd.,
New York.
• Joseph, B. (2009). Environmental Studies,
• Goodwin TM, Montoro MN, Muderspach McGraw Hill Education (India) Pvt. Ltd.,
L, Paulson R, Roy R.(2010). Management New Delhi.
of Common Problems in Obstetrics and
• Kardong Kenneth V 2005, Biological
Gynecology, 5th Edition, Dec 2010, Wiley-
Evolution, Washington State University,
Blackwell. ISBN: 978-1-444-39034-6
USA.
• Gopalakrishnan T.S ,Dr. Itta Sambaswaiah
• Klug W.S and Cummings M.R., Concept
1684, Dr Kamalakara Rao A.P (Three
of Genetics, Seventh Edition. Chepter 5
Author book) Principles of organic
evolution, 7th Edition Himalaya • Kotpal R.L., (2016), Modern Text Book
Publishing House, Chennai. Of Zoology- Invertebrates, 11th Edition,
Rastogi Publications.
• Guyton. AC. and I.E. Hall. (2000).
Endocrinology and Reproduction. In • Kotpal R.L., (2012), Modern Text Book Of
Schmitt, W., R. Gruliow and A Norwitz. Zoology- Vertebrates(Diversity - II), 3rd
(Eds.). Text book of Medical Physiology. Edition, Rastogi Publications.
W.B. Saunders Company. pp: 916-941.
• Leonard B. Radinsky, 2000, Evolution of
• Hall J. E. , 202, 13th Edition. In Guyton Vertebrates Second Edition, John Wiley
and Hall Textbook of Medical Physiology; and Sons, New York.
Reed Elsevier India Pvt. Ltd.,
• MacKenzie, S.H. (1996). The Ecosystem,
• Helen Kreuzer and Adrianne Massey Island Press, CA (USA).
(2005) Biology and Biotechnology-
• Marieb E. N. and Hoehn K, 2011, 8th
Science , Applications and Issues, ASM
Edition. In. Anatomy and Physiology;
Press, American Society for Microbiology.,
Pearson Education Inc.,
Washington DC
• Mudaliar A.L and Krishna Menon M.K,
• Herren, Ray V (2005), Introduction
202, 12th Edition. In. Clinical Obstetrics;
to Biotechnology: An Agricultural
Universities Press (India) Pvt. Ltd.
Revolution, Thomson-Delmar Learning
Inc., NY. • Muthayya NM, 2010, 4th Edition. In.
Human Physiology; Jaypee Brothers
• Ichhpujani R.L and Rajesh Bhatia (1994),
Medical Publishers (P) Ltd.
Microbiology for Nurses, First edition,
Jaypee brothers Medical Publishers (P) Ltd. • National Population Education project,
Adolescence Education in Schools,
• Jones M, Fosbery M, Gregory J and
NCERT, New Delhi.
Taylor D., (2014), Bridge international. AS
and A level biology course book, Fourth • R. C. Dubey (2003) A Textbook of
edition, Cambridge University Press. Biotechnology, S. Chand and Company
LTD., New Delhi.

237 References

TN_GOVT_XII_ Reference.indd 237 25-02-2019 19:28:11


www.asiriyar.net

• Randhawa SS (2006), a text book • Tamil Nadu State Environment Policy


of genetics, 3rd edition, pee vee – 2017, Department of Environment,
publications Ltd. Government of Tamil Nadu, Chennai -
600 015.
• Ridley Mark, 2004, Evolution,
Third edition Blackwell publishing, • Tortora.J and Funk.R., (2008),
Malden, USA. Microbiology an Introduction, 9th
edition, Pearson Education in South Asia.
• Roitt(2001). Immunology. Harcourt
Publishers limited. Sixth edition. • U. Satyanarayana Biotechnology, Books
and Allied (P) Ltd., Kolkata
• S.N.Chary Ecology – Environmental
Studies, First Edition 2008, Published by • Ugene P.Odum, Gray W. Barrett
Rajiv Beri for Macmillan India Ltd. Fundamental of Ecology – Fifth edition,
2005. Cengage Learning India (p) Ltd.
• Sekar, P. & Mathivanan, J. (2008).
Environmental Education, Neminatha • VamanRao C. (2017). Immunology.
Pathippagam, Polur. Narosa Publishing House Pvt. Ltd., Third
Edition.
• Sharma P.D. Ecology and Environment
12th edition – 12th Revised edition, • Verma P.S., Agarwal V.K. Environmental
Rastogi publication. Biology – S.Chand & Company Ltd.

• Silverthorn, D.U(2016). Human • Verma PS and Agarwal VK., (2008),


Physiology.An integrated approach. Genetics, Ninth Revised multicolor
Pearson Education Limited. Seventh edition, S.Chand & Company Ltd.
Edition.
• William J. Thieman and Michael A
• Stiling, P. (2012). Ecology: Global Palladino (2004), Introduction to
Insights & Investigations, McGraw-Hill Biotechnology, Pearson Education Inc.,
Companies Inc., New York. and Dorling Kingsley Publishing Inc.,
New Delhi, India
• Tamarin RH (2007), Principles of
genetics, 7th edition, tata Mcgraw hill
publication Ltd.

References 238

TN_GOVT_XII_ Reference.indd 238 25-02-2019 19:28:11


www.asiriyar.net

MCQs for Higher Studies


Chapter 1 - Reproduction in Organisms Chapter 2 - Human Reproduction
1. “Nothing lives forever, but life continues”. What 1. Select the incorrect statement. [NEET 2016, phase I]
does it mean? [AIPMT 1995] a) LH and FSH trigger ovulation in ovary
a)  Older dies but new ones are produced by b)  LH and FSH decrease gradually during the
reproduction follicular phase
b) Nothing can produce without death c) LH triggers secretion of androgens from the Leydig cells.
c) Death has nothing to do with the continuation of d)  FSH stimulates the sertoli cells which help in
life spermiogenesis
d) Parthenogenesis is must for sexual reproduction 2. Identify the correct statement on ‘inhibitin’
2. A
 few statements describing certain features of [NEET 2016, phase I]
reproduction are given below. Select the options that a) is produced by granulose cells in ovary and
are true for both sexual and asexual reproduction inhibits the secretion of FSH
from the options given: b) is produced by granulose cells in ovary and inhibits
i. Gametic fusion takes place the secretion of LH
ii. Transfer of genetic material takes place c) is produced by nurse cells in testes and inhibits the
iii. Reduction division takes place secretion of LH
iv. Progeny have some resemblance with parents d) inhibits the secretion of LH, FSH and prolactin.
a) i and ii b) ii and iii 3. 
Several hormones like hCG, hPL, oestrogen and
c) ii and iv d) i and ii progesterone are produced by [NEET 2016, phase I ]
3. A
 few statements with regard to sexual reproduction a) ovary b) placenta
are given below: c) fallopian tube d) pituitary
i. Sexual reproduction does not always require two 4. Match column I with column II and select the correct
individuals option using the codes given below
ii. Sexual reproduction generally involves gametic [NEET 2016, phase I]
fusion Column I Column II
iii. Meiosis never occurs during sexual reproduction A. Mons pubis 1.Embryo formation
iv. External fertilization is a rule during sexual
B. Antrum 2. Sperm
reproduction
Choose the correct statements from the options C. Trophectoderm 3. Female external genitalia
below: D. Nebenkem 4. Graafian follicle
a) i and iv b) i and ii
A B C D
c) ii and iii d) i and iv
a) 3 4 2 1
4. 
Given below are a few statements related to external
b) 3 4 1 2
fertilization. Choose the correct statements:
c) 3 1 4 2
i. The male and female gametes are formed and
d) 1 4 3 2
released simultaneously
5. Which one of the following is not the function of
ii. Only a few gametes are released into the medium
placenta? (NEET, 2013)
iii. Water is the medium in a majority of organisms
a) To facilitate supply of oxygen and nutrients to embryo
exhibiting external fertilization
b) To secrete oestrogen
iv. Offspring formed as a result of external
c) To facilitate the removal of carbondioxide and
fertilization have better chance of survival than
material from embryo
those formed inside the organism
d) T  o secrete oxytocin during parturition
a) iii and iv b) i and iii
6. 
The testes in human are situated outside the
c) ii and iv d) i and iv
abdominal cavity inside a pouch called scrotum. The
5. Which
 of the following statements, support the view purpose served is for [AIPMT 2011]
that elaborate sexual reproductive process develops a) escaping any possible compression by the visceral organs.
much later in the organic evolution? b) providing more space for the growth of epididymis.
i) Lower groups of organisms have simpler body design c) providing a secondary sexual feature for exhibiting
ii)Asexual reproduction is common in lower groups the male sex
iii) Asexual reproduction is common in higher d) maintaining the scrotal temperature lower than
groups of organisms internal body temperature
iv)The high incidence of sexual reproduction is in 7. 
Hormones secreted by placenta to maintain
angiosperms and vertebrates. pregnancy are [NEET,2018]
a) i, ii and iii b) i, iii and iv a) hCG, hPL, progesterone, estrogen
c) i, ii, and iv d) ii, iii and iv b) hCG, hPL, estrogen, relaxin, oxytocin

239 MCQs for Higher Studies

Competitive Questions for Higher studies NEW.indd 239 25-02-2019 19:50:58


www.asiriyar.net

c) hCG, hPL, progesterone, prolactin b) Out of one pair factors one is dominant and the
d) hCG,
 progesterone, estrogen, glucocorticoids other recessive
8. Match and select the correct option [NEET, 2018] c) Alleles do not show any blending and both the
Column I Column II characters recover as such in F2 generation
d) Factors occur in pairs
a. Proliferative phase 1. Breakdown of
3. ABO blood groups in humans are controlled by the
endometrium lining
gene I. It has three alleles – IA, IB and i. Since there
b. Secretory phase 2. Follicular phase are three different alleles, six different genotypes are
possible. How many phenotypes can occur?
c. Menstruation 3. Luteal phase
[AIPMT PRE 2010]
a b c
a) Three b) One c) Four d) Two
A) 3 2 1
4.  Which one of the following symbols and its
B) 2 3 1
representation, used in human pedigree analysis is
C) 1 3 2
correct? [AIPMT PRE 2010]
D) 3 1 2
a) □  =○=Mating between relatives
b) ○  =Unaffected male
Chapter 3 - Reproductive Health c) □  =Unaffected female
1. Which of the following is a hormone releasing d) ◊=Male affected
Intrauterine Device (IUD)? [AIPMT 2014] 5.  Which one of the following conditions correctly
a) Multiload 375 b) LNG-20 describes the manner of determining the sex in the
c) Cervical cap d) Vault given example? [AIPMT PRE 2011]
2. Assisted reproductive technology, IVF involves the a) XO type of sex chromosomes determine male
transfer of [AIPMT 2014] sex in grasshopper
a) Ovum into the fallopian tube b)  XO condition in humans as found in Turner
b) Zygote into the fallopian tube syndrome, determines female sex
c) Zygote into the uterus c)  Homozygous sex chromosomes(XX) produce
d) Embryo with 16 blastomeres into the fallopian tube male in Drosophila
3. In context of amniocentesis, which of the following d)  Homozygous sex chromosomes(ZZ) determine
statements is incorrect? [NEET-I, 2016] female sex in birds
a) It is usually done when a woman is between 14-16 6.  A normal-visioned man whose father was blind,
weeks pregnant marries a woman whose father was also colour
b) It is used for prenatal sex determination blind. They have their first child as a daughter. What
c) It can be used for detection of Down syndrome are the chances that this child would be colour blind?
d) It can be used for detection of Cleft palate [AIPMT PRE 2012]
4. Which of the following approach does not give the a) 100% b) 0% c) 25% d) 50%
defined action of contraceptive? [NEET-I, 2016] 7. Which of the following statements is not true of two
a) Barrier methods Prevent fertilization genes that show 50 per cent recombination frequency
[AIPMT 2013]
b) Intra uterine Increases phagocytosis of sperms,
a) The genes may be on different chromosomes
devices suppresses sperm motility and
b) The genes are tightly linked
fertilizing capacity of sperms
c) The genes show independent assortment
c) Hormonal Prevent retard entry of sperms, d) If the genes are present on the same chromosome
contraceptives prevent ovulation and fertilization 8. A pleiotropic gene: [RE-AIPMT 2015]
d) Vasectomy Prevents spermatogenesis a) Is a gene evolved during Pliocene
b) Controls a trait only in combination with another gene
Chapter 4 - Principle of Inheritance and Variation c) Controls multiple traits in an individual
1. The fruit fly Drosophila melanogaster was found d) Is expressed only in primitive plants
to be very suitable for experimental verification of 9. A gene showing codominance has: [RE-AIPMT 2015]
chromosomal theory of inheritance by Morgan and a) Alleles tightly linked on the same chromosome
his colleagues because [AIPMT MAINS 2010] b) Alleles that are recessive to each other
a) It reproduces parthenogenetically c)  Both alleles independently expressed in the
b) A single mating produces two young flies heterozygote
c) S maller female is easily recognizable from large male d) One allele dominant on the other
d) It completes the life cycle in about two weeks 10. Pick out the correct statements: [NEET-I, 2016]
2. Which one of the following cannot be explained on a) Haemophilia is a sex-linked recessive disease
the basis of Mendel’s Law of Dominance? b) Down’s syndrome is due to aneuploidy
[AIPMT PRE 2010] c) Phenylketonuria is an autosomal recessive gene disorder
a) The discrete unit controlling a particular character d) Sickle cell anaemia is an X-linked recessive gene
is called a factor disorder

MCQs for Higher Studies 240

Competitive Questions for Higher studies NEW.indd 240 25-02-2019 19:50:58


www.asiriyar.net

a) A and D are correct b) B


 and D are correct c) Prove semi- conservative nature of DNA replication
c) A,C and D are correct d) A
 ,B and C are correct d) Polymerises in the 5’ to 3’direction and explain 3’
to 5’ DNA replication
Chapter 5 - Molecular Genetics 8. During translation initiation in prokaryotes, a GTP
1. The association of histone H1 with a nucleosome molecules is needed in  [AIPMT 2003]
indicates (NEET 2017) a) association of 30s, mRNA with formyl met tRNA
a) Transcription is occurring b)  association of 50s subunit of ribosome with
b) DNA replication is occurring initiation complex
c) The DNA is condensed into chromatin fibre c) formation of formyl met tRNA
d) The DNA double helix is exposed d) binding of 30s subunit of ribosome with mRNA.
2. Which of the following is not required for any of 9. Reverse transcriptase is
the techniques of DNA fingerprinting available at a) RNA dependent RNA polymerase
present?  [NEET 2016] b) DNA dependent RNA polymerase
a) Zinc finger analysis c) DNA dependent DNA polymerase
b) R  estriction enzymes d) RNA dependent DNA polymerase
c) D  NA-DNA hybridization 10. Escherichia coli fully labeled with N14 medium. The
d) polymerase chain reaction two strands of DNA molecules of the first generation
3. Satellite DNA is important because it [AIPMT 2015] bacteria have
a) codes for proteins needs in cell cycle a) Different density and do not resemble parent DNA
b) shows high degree of polymorphism in population b) Different density but resemble parent DNA
and also the same degree of polymorphism in c) Same density and resemble parent DNA
an individual, which is heritable from parents to d) Same density but do not resemble parents DNA
children Chapter 6 - Evolution
c)  Does not code for protein and is same in all
1. The wings of a bird and of an insect are
members of the population.
a) homologous structure and represent convergent
d) Codes for enzymes needed for DNA replication.
evolution
4. The diagram shows an important concept in the
b) homologous structure and represent divergent evolution
genetic implication of DNA. Fill in the blanks A to C.
c) analogous structure and represent convergent
(NEET 2013)
evolution
A B C
d) analogous structure and represent divergent evolution
DNA ----→mRNA ---------→protein -proposed by---
2. Which one of the following statement is correct?
a) A- trancscription, B- replication C-James Watson
a) stem cells are specialized cells
b) A- trancscription, B- trancscription, C-Erwin
a) there is no evidence of the existence of gills during
c) A- trancscription, B- tranlation, C-Francis Crick
embryogenesis of mammals
d)  A- trancscription, B- extension, C-Rosalind
b) all plant and animal cells are totipotent
Frankin
c) Ontogeny repeats phylogeny
5. Select the two statements out of the four (I –IV) given
3. In Hardy-Weinberg equation, the frequency of
below about lac operon. [AIPMT 2010]
heterozygous individual is represented by
i. Glucose or galactose may bind with the repressor
a) P2 b) 2pq c) pq d) q2
and inactive it.
4. The correct order in Era is
ii. In the absence of lactose, the repressor binds
a) Palaeozoic---- Archaeozoic --- Coenozoic
with the operator region
b) Archaeozoic ---Palaeozoic------ Proterozoic
iii. Th  e z-gene codes for permease.
c) Palaeozoic--- Mesozoic ----- Coenozoic
iv.  This was elucidated by Francois Jacob and
d) Mesozoic ---- Archaeozoic---- Proterozoic
Jacques monod.
5. The most apparent change during the evolutionary
The correct statements are
history of Homo sapiens is raced in (AIPMT 2010)
a) i and ii b) i and iii c) ii and iv d) i and ii
a) loss of body hair
6. Which one of the following pairs of codons is
b) walking upright
correctly matched with their function or the single
c) shortening of jaws
for the particular amino acid? [AIPMT 2008]
d) remarkable increase in the brain size.
a) GUU, GCU – Alanine
6. The process by which organisms with different
b) UAG, UGA – Stop codon
evolutionary history evolve similar phenotypic
c) AUG, ACG - start/methionine
adaptations in response to a common environmental
d) UUA, UCA – Leucine
challenge is called (AIPMT 2013)
7. The Okazaki fragments in DNA chain growth
a) Natural selection
(AIPMT 2007)
b) Convergent evolution
a) Result in transcription
c) Non-random evolution
b) Polymerise in the 3’ to 5’ direction and forms
d) Adaptive radiation Human health and diseases
replication fork

241 MCQs for Higher Studies

Competitive Questions for Higher studies NEW.indd 241 25-02-2019 19:50:58


www.asiriyar.net

Chapter 7 & 8 - Human Health and Diseases and Immunology a) Ancylostoma duodenale
1. Select the correct statement from the given below. b) Enterobius vermicularis
[AIPMT 2010] c) Trichimella spiralis
a) Barbiturates when given to criminals make them d) Ascaris lumbricoides
tell the truth 8. The active form of Entamoeba histolytica feeds upon:
b) Morphine is often given to persons who have [AIPMT 2015]
under gone surgery as a pain killer a) Erythrocytes, mucosa and submucosa of colon
c) Chewing tobacco lowers blood pressure and heart rate b) Mucosa and submucosa colon only
d) Cocaine is given to patients after surgery as it c) Food in intestine
stimulates recovery d) Blood only
2. Match the following [AIPMT 2008] 9. Which one of the following statements is correct with
Column I Column II respect to AIDS? [AIPMT PRE 2010]
a) The HIV can be transmitted through eating food
A) Amoebiasis i) Treptonema pallidum
together with an infected person.
B) Diphtheria ii) Use only sterilized food
b) Drug addicts are least susceptible to HIV infection.
and water
c) AIDS patients are being fully cured 100 percent
C) Cholera iii) DPT vaccine
with proper care and nutrition.
D) Syphilis iv) Use oral rehydration d)  The causative HIV retrovirus enters helper
therapy
T-lymphocytes thus reducing their numbers.
A B C D
10. Select the correct statement with respect to diseases
a) i ii iii iv
and immunization [AIPMT MAINS 2011]
b) ii iv i iii
a) If due to some reason B and T lymphocytes are
c) ii I iii iv
damaged, the body will not produce antibodies
d) ii iii iv i
against a pathogen
3. If a person shows production of interferons in his
b) Injection of dead/inactivated pathogens caused
body, the chances are that he has got an infection of
passive immunity
a) Typhoid b) Measles
c)  Certain protozoans have been used in mass
c) Tetanus d) Malaria
production of hepatitis B vaccine.
4. A person suffering from a disease caused by
d) Injection of snake antivenom against snake bite is
Plasmodium, experiences recurring chill and fever at
an example of active immunization.
the time when? [AIPMT MAINS 2010]
11. Which one of the following statements is correct with
a) The sporozoites released from RBC’s are being
respect to immunity? [AIPMT MAINS 2012]
rapidly killed and broken down inside spleen
a) The antibodies against small pox pathogen are
b) The trophozoites reach maximum growth and give
produced by T – lymphocytes
out certain toxins.
b) Antibodies are protein molecules each of which
c) The parasite after its rapid multiplication inside
has four light chains.
RBC’s reptures them, releasing the stage to enter
c) Rejection of a kidney graft is the function of B –
fresh RBC’s
lymphocytes.
d) The microgametocytes and megagametocytes are
d) Preformed antibodies need to be injected to
being destroyed by the WBC’s
treat the bite by a viper snake.
5. Where will you look for the sporozoites of the
12. Which one of the following is not a property of
material parasite? [AIPMT PRE 2011]
cancerous cells whereas the remaining three are?
a) Red blood corpuscles of humans suffering from malaria.
[AIPMT PRE 2012]
b) Spleen of infected humans
a) They compete with normal cells for vital nutrients
c) Salivary glands of freshy moulted female anopheles
b) They do not remain confined in the area of formation
mosquito.
c) They divide in an uncontrolled manner
d) Saliva of infected female anopheles mosquito.
d) They show contact inhibition
6. Which one of the following organisms is scientifically
13. At which stager HIV infection does one usually show
and correctly named, correctly printed according
symptoms of AIDS? [AIPMT 2014]
to the International Rules of Nomenclature and
a) Within 15 days of sexual contact with an infected
correctly described? [AIPMT MAINS 2012]
person
a) Plasmodium falciparum – a protozoan causing
b) When the infected retro virus enters host cells
the most serious type of malaria.
c) When HIV damages large number of helper T-
b) Felis tigris – The Indian tiger is well protected in
Lymphocytes
Gir forests.
d)  When the viral DNA is produced by reverse
c)  E. Coli – The full name is Entamoeba coli, a
transcriptase
commonly occurring bacterium in human intestine.
14. Match each disease with its correct type of vaccine
7. Which of the following endoparasites of humans
[AIPMT 2015]
does show vivipaity? [AIPMT 2015]

MCQs for Higher Studies 242

Competitive Questions for Higher studies NEW.indd 242 25-02-2019 19:50:58


www.asiriyar.net

a)Tuberculosis i) harmless virus 5. During sewage treatment, biogas are produced which
includes [AIPMT 2015]
b)Whooping cough ii) inactivated toxin a) Methane, hydrogen sulphide, carbon dioxide
c)Diphtheria iii) killed bacteria b) Methane, oxygen, hydrogen sulphide
d)Polio iv) harmless bacteria c) Hydrogen sulphide, methane, sulphur dioxide
a) b) c) d) d) Hydrogen sulphide, nitrogen, methane
a) (ii) (i) (iii) (iv) 6. What gases are produced in anaerobic sludge
b) (iii) (ii) (iv) (i) digesters? [AIPMT 2014]
c) (iv) (iii) (ii) (i) a) Methane and CO2 only
d) (i) (ii) (iv) (iii) b) Methane, hydrogen sulphide and CO2
15. Which of the following is correct regarding AIDS c) Methane, hydrogen sulphide and O2
causative agent HIV? [NEET-II, 2016] d) Hydrogen sulphide and CO2
a)  HIV is enveloped virus that contains two e) Consumption of organic matter in the water is
identical molecules of single-stranded RNA and higher by the microbes
two molecules of reverse transcriptase 7. Match the following list of microbes and their
b) HIV is unenveloped retrovirus importance: [RE-AIPMT 2015]
c)  HIV does not escape but attacks the acquired a)Saccharomyces (i)Production of
immune response cerevisiae immunosuppressive agents
d HIV is enveloped virus containing one molecule of b)Monasus purpureus (ii)Ripening of Swiss cheese
single – stranded RNA and one molecule of reverse
c)Trichoderma (iii)Commercial
transcriptase
polysporum production of ethanol
Chapter 9 - Microbes in Human Welfare d)Propionibacterium (iv)Production of blood-
shermanii cholesterol lowering agents.
1. When domestic sewage mixes with river water
e) (iv) (iii) (ii) (i)
[AIPMT MAINS 2010]
f) (iv) (ii) (i) (iii)
a) Small animals like rat will die after drinking river water
g) (iii) (i) (iv) (ii)
b)  The increased microbial activity releases
h) (iii) (iv) (i) (ii)
micronutrients such as iron.
8. Which of the following is wrongly matched in the
c)  The increased microbial activity uses up
given table? [NEET – I, 2016]
dissolved oxygen.
d) The river water is still suitable for drinking as Microbe Product Application
impurities are only about 0.1 per cent (a)Trichoderma Cyclosporin A Immunosuppressive
2. Select the correct statement from the following. polysporum drug
[AIPMT PRE 2010] (b)Monascus Statins Lowering of blood
a)  Biogas is produced by the activity of aerobic purpureus cholesterol
bacteria on animal waste. (c) Streptococcus Sterptockinase Removal of clot
b) Methanobacterium is an aerobic bacterium found from blood vessel
in rumen of cattle. (d)Clostridium Lipase Removal of oil
c) Biogas, commonly called gober gas, is pure methane. butylicum stains
d) Activated sludge-sediment in settlement tank 9. Match Column – I with Column – II and select the
of sewage treatment plant is a right source of correct options using the codes given below:
aerobic bacteria. [NEET – II, 2016]
3. Read the following four statements (A to D): Column I Column II
[AIPMT MAINS 2012] A.Citric acid 1. Trichoderma
a) Colostrums is recommended for the new born B.Cyclosporin A 2. Clostridium
because it is rich in antigen. C.Statins 3. Aspergillus
b)  Chikungunya is caused by a gram negative
D.Butyric acid 4. Monoscus
bacterium.
a) A:3, B:1, C:4, D:2
c)  Tissue culture has proved useful in obtaining
virus-free plants. b) A:1, B:4, C:2, D:3
d) Beer is manufactured by distillation of fermented c) A:3, B:4, C:1, D:2
grape juice d) A:3, B:1, C:2, D:4
How many of the above statements are wrong?
a) Three b) Four c) One d) Two Chapter 10 - Biotechnology and Its Application
4. Which of the following are likely to be present in 1. Genetic engineering has been successfully used for
deep sea water? [AIPMT 2013] producing [AIPMT RE 2010]
a) Archaebacteria b) Eubacteria a) Transgenic mice for testing safety of polio
c) Blue – green algae d) Saprophytic fungi vaccine before used in humans.

243 MCQs for Higher Studies

Competitive Questions for Higher studies NEW.indd 243 25-02-2019 19:50:58


www.asiriyar.net

b) Transgenic models for studying new treatments A) A bacterium B) Plasmid


for certain cardiac diseases. C) Plasmodium D) Bacteriophage
c) Transgenic cow Rosie which produces high fat a) (A), (B) and (D) only b) (A) only
milk for making ghee. c) (A) and (C) only d) (B) and (D) only
d) Animals like bulls for farm work as they have 8. Which one of the following palindromic base
super power. sequences in DNA can be easily cut at about the
2. Some of the characteristics of Bt cotton are middle by some particular restriction enzyme?
[AIPMT RE 2010] [AIPMT PRE 2010]
a) Long fibre and resistance to aphids a) 5’ – CGTTCG – 3’ 3’ –ATGGTA -5’
b) Medium yield, long fibre and resistance to beetle pests. b) 5’-GATATG -3’ 3’ CTACTA -5’
c) High yields and production of toxic protein c) 5’ –GAATTC – 3’ 3’ – CTTAAG-5’
crystals which kill dipteran pests. d) 5’ –CACGTA -3’ 3’ –CTCAGT -5’
d) High yield and resistance to bollworms 9. Restriction endonucleases are enzymes which
3. Bacillus thuringiensis forms protein crystals which [AIPMT PRE 2010]
contain insecticidal protein. This protein a) Make cuts at specific positions within the DNA
[AIPMT MAINS 2010] molecule.
a) Binds with epithelia cells of midgut of the insect b)  Recognize a specific nucleotide sequence for
pest ultimately killing it. binding of DNA ligase.
b) Is coded by several genes including the gene cry. c) Restrict the action of the enzyme DNA polymerase.
c) Is activated by acid pH of the foregut of the insect d) Remove nucleotides from the ends of the DNA
pest. molecule.
d) Does not kill the carrier bacterium which is itself 10. Stirred – tank bioreactors have been designed for
resistant to this toxin. [AIPMT PRE 2010]
4. Read the following four statements (A to D) about a) Addition of preservatives of the product
certain mistakes in two of them. [AIPMT MAINS 2011] b) Purification of the product
a) The first transgenic buffalo, Rosie produced milk c) Ensuring anaerobic conditions in the culture vessel
which was human alpha – lactalbumin enriched. d) Availability of oxygen throughout the process
b) Restriction enzymes are used in isolation of DNA 11. There is a retriction endonuclease called EcoRI. What
from other macromolecules. does ‘co’ part in it stand for? [AIPMT PRE 2011]
c) Downstream processing is one of the steps of a) Coelom b) Coenzyme
rDNA technology c) Coli d) Colon
d) Disarmed pathogen vectors are also used in 12. Which one is true state regarding DNA polymerase
transfer of rDNA into the host. used in PCR? [AIPMT PRE 2012]
Which of the two statements have mistakes? a) It is used to ligate introduced DNA in recipient cells.
a) B and C b) C and D b) It serves as selectable marker
c) A and C d) A and B c) It is isolated from a virus.
5. The colonies of recombinant bacteria appear white d) It remains active at high temperature.
in contrast to blue colonies of non-recombinant 13. For transformation, micro-particles coated with
bacteria because of [AIPMT 2013] DNA to be bombarded with gene gun are made up of
a) Non-recombinant bacteria containing β-galactosidase. [AIPMT PRE 2012]
b) Insertional inactivation of α-galactosidase in non- a) Silver or Platinum b) Platinum or Zinc
recombinant bacteria. c) Silicon or Platinum d) Gold or Tungsten
c) Insertional inactivation of α-galactosidase in
recombinant bacteria. Chapter 11 - Organisms and Population
d) Inactivation of glycosidase enzyme in recombinant
bacteria 1. Which one of the following is most appropriately
6. Which body of the Government of India regulates defined? [AIPMT MAINS 2010]
GM research and safety of introducing GM organism a)  Host is an organism which provides food to
for public services? [AIPMT 2015] another organism.
a) Bio-safety committee b) Amensalism is a relationship in which one species
b) Indian council of agricultural research is benefited whereas the other is unaffected.
c) Genetic engineering approval committee c) Predator is an organism that catches and kills
d) Research committee on Genetic manipulation other organism for food.
7. In genetic engineering, a DNS segment (gene) of d) Parasite is an organism which always lives inside
interest is transferred to the host cell through a the body of other organism and may kill it.
vector. Consider the following four agents (A to D) 2. Study the four statements (1 to 4) given below and select
in this regard and select correct option about which the two correct ones out of them. [AIPMT PRE 2010]
one or more of these can be used as vector/vectors. a) A lion eating a deer and a sparrow feeding on grain
[AIPMT MAIN 2010] are ecologically similar in being consumers.

MCQs for Higher Studies 244

Competitive Questions for Higher studies NEW.indd 244 25-02-2019 19:50:58


www.asiriyar.net

b) Predator star fish Pisaster helps in maintaining 9. When does the growth rate of a population following
species diversity of some invertebrates. the logistic model equal zero? The logistic model is
c) Predators ultimately lead to the extinction of prey given as dN/dt=rN(1-N/K): [NEET – I, 2016]
species. a) When N/K is exactly one
d) Production of chemicals such as nicotine, b) When N nears the carrying capacity of the habitat
strychnine by the plants is metabolic disorders. c) When N/K equals zero
The two correct statements are d) When dearth rate is greater than birth rate
a) (B) and (C) b) (C) and (D)
c) (A) and (D) d) (A) and (B) Chapter 12 - biodiversity and conservation
3. Which two of the following changes ( 1 to 4) usually 1. Select the correct statement about biodiversity
tend to occur in the plain dwellers when they move to [AIPMT MAINS 2012]
high altitudes(3500 m or more)? [AIPMT PRE 2010] a) Large scale planting of Bt cotton has no adverse
A) Increase in red blood cell size effect on biodiversity.
B) Increase in red blood cell production b) Western Ghats have a very high degree of species
C) Increased breathing rate richness and endemism
D) Increase in thrombocyte count c) Conservation of biodiversity is just a fad pursued
a) (B) and (C) b) (C) and (D) by the developed countries.
c) (A) and (D) d) (A) and (B) d) The desert areas of Rajasthan and Gujarat have a
4. Consider the following four conditions (A-D) and very high level of desert animal species as well as
select the correct pair of them as adaptation to numerous rare animals.
environment in desert lizards. [AIPMT PRE 2011] 2. Sacred groves are specially useful in[AIPMT MAINS 2012]
The conditions: a) Preventing soil erosion
A) Burrowing in soil to escape high temperature. b) Year-round flow of water in rivers
B) Losing heat rapidly from the body during high c) Conserving rare and threatened species
temperature d) Generating environmental awareness
C) Bask in sun when temperature is low
D) Insulating body due to thick fatty dermis.
3. The highest number of species in the world is
a) (A) and (C) b) (B) and (D) represented by [AIPMT PRE 2012]
c) (A) and (B) d) (C) and (D) a) Fungi b) Mosses c) Algae d) Lichens
5. People who have migrated from the planes to an area 4. Which of the following is not used for ex situ plant
adjoining Rohtang Pass about six months back conservation? [AIPMT PRE 2012]
[AIPMT PRE 2012] a) Field gene banks b) Seed banks
a)Have more RBC’s and their haemoglobin has a c) Shifting cultivation d) Botanical gardens
lower binding affinity to O2. 5. In which of the following both pairs have correct
b) Are not physically fit to play games like football
combination? [AIPMT 2015]
c) Suffer from altitude sickness with symptoms like
a) In situ conservation: National Park
nausea, fatigue, etc.
Ex situ conservation: Botanical Garden
d) Have the usual RBC count but then haemoglobin
b) In situ conservation: Cryopreservation
has very high binding affinity to O2.
6. A biologist studies the population of eats in a barn.
Ex situ conservation: Wildlife Sanctuary
He found that the average natality was 250, average c) In situ conservation: Seed Bank
mortality is 240, immigration is 20 and emigration to be Ex situ conservation: National park
30. The net increase in population is  [AIPMT 2013] d) In situ conservation: Tissue culture
a) 10 b) 15 c) 05 d) Zero Ex situ conservation: Sacred groves
7. An association of individuals of different species 6. Cryopreservation of gametes of threatened species
living in the same habitat and having functional in viable and fertile condition can be referred to
interaction is: [RE-AIMPT 2015] as [AIPMT 2015]
a) Biotic community b) Ecosystem a) In situ conservation of biodiversity
c) Population d) Ecological niche b) Advanced ex situ conservation of biodiversity
8. Gause’s principle of competitive exclusion states c) In situ conservation by sacred groves
that: [NEET – I, 2016] d) In situ cryo-conservation of biodiversity
a) More abundant species will exclude the less
abundant species through competition 7. The species confined to a particular region and not
b) Competition for the same resources excludes found elsewhere is termed as [RE-AIPMT 2015]
species having different food preferences a) Alien b) Endemic c) Rare d) Keystone
c) No two species can occupy the same niche 8. Which of the following National Parks is home to
indefinitely for the same limiting resources the famous musk deer or hangal? [NEET-II, 2016]
d) Larger organisms exclude smaller ones through a) Bandhavgarh National Park, Madhya Pradesh
competition b) Eaglenest Wildlife Sanctuary, Arunachal Pradesh

245 MCQs for Higher Studies

Competitive Questions for Higher studies NEW.indd 245 25-02-2019 19:50:58


www.asiriyar.net

c) Dachigam National Park, Jammu & Kashmir 7. A scrubber in the exhaust of a chemical industrial
d) Keibul Lamjao National Park, Manipur plant removes
a) Gases like sulphur dioxide.
Chapter 13 - Environmental Issues b) Particulate matter of the size 5 micrometer or
1. DB is a standard abbreviation used for the above.
quantitative expression of [AIPMT PRE -2010] c) Gases like ozone and methane
d) Particulate matter of the size 2.5 micrometer or less
a)The density of bacteria in a medium
b) A particular pollutant 8. Rachel Carson’s famous book ‘Silent Spring’ is related
c) The dominant bacillus in a culture to [AIPMT-2015]
d) A certain pesticide a) Pesticide pollution
b) Noise Pollution
2. Which one of the following expanded forms of the
c) Population explosion
following acronyms is correct? [AIPMT PRE-2011] d) Ecosystem management
a)UNEP United Nations Environmental Policy 9. Which of the following is not one of the primary health
b)EPA Environmental Pollution Agency risks associated with greater UV radiation through
c)IUCN International Union for Conservation the atmosphere due to depletion of stratospheric
of Nature and Natural Resources ozone? [AIPMT-2015]
a) Increased skin cancer
d)IPCC International Penal for climate Change b) Reduced immune system
3. In an area where DDT had been used extensively c) Damage to eyes
the population of birds declined significantly d) Increased liver cancer
because 10. Increase in the concentration of the toxicant at
[AIPMT PRE-2012] successive trophic levels is known as [RE AIPMT-2015]
a) Birds stopped laying eggs a) Biodeterioration
b) Earthworms in the area got eradicated. b) Biotransformation
c) Cobras were feeding exclusively on birds. c) Biogeochemical cycling
d) Many of the birds eggs, laid, did not hatch. d) Biomagnifications
4. Which one of the following is a wrong statement? 11. A river with an inflow of domestic sewage rich in
AIPMT PRE-2012] organic waste may result in: [NEET-I, 2016]
a) Most of the forests have been lost in tropical areas. a) Drying of the river very soon due to algal bloom
b) Ozone in upper part of atmosphere is harmful b) Increased population of aquatic food web organisms
to animals. c)  An increased production of fish due to
c) Greenhouse effect is natural phenomenon biodegradable nutrients
d) 
Eutrophication is a natural phenomenon in d) Death of fish due to lack of oxygen
freshwater bodies. 12. A lake which is rich in organic waste may result in
5. Measuring Biochemical Oxygen Demand (BOD) is a [NEET-II, 2016]
method used for [AIPMT PRE-2012] a) Drying of the lake due to algal bloom
a) Estimating the amount of organic matter in b) Increased population of fish due to lots of nutrients
sewage water. c) Mortality of fish due to lack of oxygen
b) Working out the efficiency of oil driven automobile d) Increases population of aquatic organisms due to
engines. minerals
c) Measuring the activity of saccharomyces cerevisiae 13. The highest DDT concentration in aquatic food
in producing curd on a commercial scales chain shall occur in [NEET-II, 2016]
d) Working out the efficiency of RBCs about their a) Seagull b) Crab
capacity to carry oxygen c) Cell d) Phytoplankton
6. Kyoto Protocol was endorsed at [AIPMT -2013]
a) CoP-3 b) CoP-5
c) CoP-6 d) CoP-4

MCQs for Higher Studies 246

Competitive Questions for Higher studies NEW.indd 246 25-02-2019 19:50:59


www.asiriyar.net

Biology-Zoology – Class XII


List of Authors and Reviewers
Advisory Committee Members Subject Expert and Coordinator Domain Experts
and Chair person Dr. S. Shameem Dr. P. Sarala
Associate Professor, Department of Zoology,
Dr. Sultan Ahmed Ismail Deputy Director
State Council of Educational Research and Training, Quaid-e-Millath College for Women, Chennai.
Scientist Chennai.
Ecoscience Research Foundation, Chennai. Dr. Sumit Rose
Dr. P.K. Kaleena Coordinators Associate Professor, Department of Zoology,
Presidency College, Chennai.
Associate Professor, Dr. V.T. Shanthi
Department of Zoology, Senior Lecturer, Dr. B. Meena
District Institute of Education and Tranning, Tirur. Associate Professor, Department of Zoology,
Presidency College, Chennai. Presidency College, Chennai.
Mrs. B. Selvi
Assistant Professor, Dr. E. Malathi
Content Writers SCERT, Chennai. Associate Professor, Department of Zoology,
Queen Mary’s College, Chennai.
Mr. M. Mayilsamy Prospects of Zoology
Senior Lecturer, Reviewers
District Institute of Education and Tranning,
Krishnagiri.
Dr. T. Sankara Saravanan Dr. Dinesh Kumar
Deputy Director
Reader, NCERT, New Delhi.
Dr. P. Sekar Tamil Nadu Textbook and Educational
Assistant Professor Services Corporation, Chennai. Dr.Vareishang Tangu
Govt. Institute of Advanced Assistant Professor in Zoology
Study in Education (Autonomous), Translators RIE NCERT, Mysore.
Saidapet, Chennai.
Dr. S. Muthazhagu Dr. Chitralekha Ramachandran
Dr. S. Ganesapandian Associate Professor (Rtd.) Professor (Rtd.),
Head Master A.A Govt. Arts College, Cheyyar. Stella Mary's College, Chennai.
Government Higher Secondary School,
Kadukkai Valasai, Ramanathapuram Dist. Mr. M. Sivaguru Ms. Hemamalini Akundy
Head Master Assistant HOD., Salwan Public School,
Dr. J. Savarimuthu Michael Sri Ramakrishna Vidyasala Higher Secondary School, Gurgaon.
P.G. Assistant in Zoology Chidambaram, Cuddalore.
Carmel Higher Secondary School, Content Readers
Nagercoil, Kanyakumari Dist. Mr. S. Maheswaran
Head Master Dr. Mazher Sulthana
Mr. Alen Godfrey R. Jose Govt. Boys Higher Secondary School, Associate Professor in Zoology (Rtd.),
P.G. Assistant in Zoology Sayal Gudi, Ramanathapuram Dist. Presidency College, Chennai.
M.C.C Mat.Higher Secondary School,
Chetpet, Chennai. Mr. V. Rajendran Dr. R. Saravanan
Assistant Professor in Zoology
P.G. Assistant in Zoology
Mr. L. Sivan pillai Government Higher Secondary School,
Dr. Ambedkar Govt. Arts College,
P.G. Assistant in Zoology Vyasarpadi, Chennai.
Aragalur, Salem Dist.
Bharath Senior Secondary School,
Mr. S. Natarajan Dr. N. Sarojini
Adyar, Chennai. Assistant Professor in Zoology
P.G. Assistant in Zoology,
Mrs. P. Sophia Selvakumari Model School, Kolli Hills, Namakkal Dist. Bharathi Women’s College, Chennai.
P.G. Assistant in Zoology Mr. K. Senthil Vel Mr. S. Munusamy
Bentinck Higher Secondary School for Girls, P.G.Assistant in Zoology Head Master. (Rtd.),
Vepery, Chennai. A.S. Govt. Higher Secondary School, GHSS., Velachery, Chennai.
Mr. K.P. Muthuswamy Sholavandan, Madurai Dist.

P.G. Assistant in Zoology


C.S.M.A. Higher Secondary School,
Mr. S.P. Sabarinathan
P.G.Assistant in Zoology
Art and Design Team
M.M. Kovilur, Dindigul Dist. Govt. Higher Secondary School, Illustrators
Sengurichi, Dindugul Dist. Gopu Rasuvel
Mr. V. Elangovan
P.G. Assistant in Zoology Mr. G. Kirubananthan N. Prabhakar
Sir M. Ct. M. Higher Secondary School, P.G. Assistant in Zoology Murugesan Veeraiyan
Pursawalkam, Chennai. Govt. Higher Secondary School,
Anakaputhur, Kanchipuram District. Santhanakrishnan
Mr. M. William Vijayraj Vimal Shanmugam
P.G. Assistant in Zoology
Dr. P. S. S. Mpl. Higher Secondary School, ICT Coordinators Layout In-House
Kanchipuram.
R.Kamesh Rajesh Thangappan
Mr. N. Senthil Kumar SGT., Govt. Primary School, C. Prasanth
PG Assistant in Zoology
Govt Boys Higher Secondary School,
Pinjanur, Cuddalore Dist. Petchimuthu
Thalaivasal, Salem District. Santhiyagu Stephen
Mrs. Reena Alfred QR Management Team P. Prasanth
Principal J.F. Paul Edwin Roy, B.T, R. Mathan Raj
Alpha Higher Secondary School, PUMS -Rakkipatty, Salem. Pakkirisamy Annadurai
CIT, Saidapet, Chennai.
M. Murugesan, B.T, Wrapper Design
Mr. R. Perumal Pums. Pethavelankottagam, Kathir Arumugam
Principal Muttupettai, Thiruvarur.
Velammal Vidhyashram,
V. Padmavathi, B.T, In-House QC
Surapet, Chennai.
GHS, Vetriyur, Manohar Radhakrishnan
Ariyalur. Arun Kamaraj P.
Co-ordination
Ramesh Munisamy
This book has been printed on 80 G.S.M. Elegant Maplitho paper.
Printed by offset at:

247

Authors pages.indd 247 25-02-2019 19:57:49


www.asiriyar.net

NOTE

248

Authors pages.indd 248 25-02-2019 19:57:49

S-ar putea să vă placă și